Datasets:

JYumeko

/

processed_pubmed_scientific_papers

like 0

tuberculosis tb caused mycobacterium tuberculosis member m. tuberculosis complex mtbc according world health organization ) 2010 estimated 12.0 million prevalent cases tb equivalent 178 cases per 100000 individuals approximately 1.4 million people died tb year most cases 2009 55% occurred asia 1 according administration tuberculosis leprosy control ministry health medical education iran 2010 a total 10485 old new cases tb reported iran cases 326 patients around 2.2% hiv positive 2 the diseases caused mycobacterium complex become important recent years particularly association worldwide pandemic situation caused human immunodeficiency virus hiv 2010 in addition estimated 0.35 million deaths among tb cases hiv positive according incidence pulmonary tuberculosis hiv positive patients iran 0.38 0.28 0.51 per 100000 individuals 2012 3 opportunistic microorganisms nocardia spp are gram positive weakly acid fast filamentous branching appearance part normal human bacterial flora date at least sixteen species capable producing disease humans identified 4 pulmonary disease predominant clinical presentation microorganism fatal untreated untreated pulmonary nocardiosis similar tuberculosis n. asteroids frequent cause pulmonary infection humans 85% 5 since clinical radiological manifestations non specific pulmonary nocardiosis could mistaken infections bacterial pneumonia in addition nocardiosis may reported among aids defining criteria 6 diagnosis pulmonary nocardiosis dependent isolation demonstration organism respiratory secretions sputum tissue specimens nocardia m. tuberculosis slow growing organism requires prolonged incubation least 4 6 weeks 7 diagnosis nocardiosis currently based direct examination conventional culture serology usually useful treatment nocardiosis different tuberculosis regarding therapeutic agents route administration duration therapy 8) sulfonamides agents choice treatment nocardiosis however combination therapy two agents recommended although nocardiosis uncommon illness co infection disease tuberculosis reported 9 the aim study assess presence nocardia spp m. tuberculosis sputum specimens patients pulmonary tuberculosis meantime 32 hiv infected patients suspected pulmonary tuberculosis included study order evaluate concomitant infection patients a total 189 sputum samples obtained reference mycobacteriology laboratory ahvaz jundishapur university medical sciences march 2011 april 2012 all specimens processed immediately according standard routine diagnosis procedures naoh n acetyl l cysteine nalc method next concentrated specimens used smear preparation culture pcr assay 10 11 furthermore 250 l concentrated sputum specimen inoculated onto lowenstein jensen l j media merck germany are acid fast survive decontamination clinical specimens sodium hydroxide nalc methods thereby grow l j medium cultures examined weekly 8 weeks incubation cultures showed growth reported negative discarded microscopic examination using disposable pasteur pipette one drop sediment sputum specimen spread clean microscope slide air drying fixation heat smears stained ziehl neelsen gram staining 10 after decontamination chromosomal dna extracted using proteinase k phenol chloroform precipitated ethanol isopropanol according standard procedures 12 purified dna amplified specific pairs primers is1 5ctcgtccagcgccgcttcgg 3 is2 5cctgcgagcgtaggcggtgg 3 m. tuberculosis complex strains ann microbiol the pcr protocols optimized 35 cycles consisting 45 seconds 94c denaturation 30 seconds 68c annealing 30 seconds 72c extension followed final 5 minute extension 72c primers ng1 5ctcgtccagcgccgcttcgg3 ng2 5cctgcgagcgtaggcggtgg3 used amplify nocardia genus specific 590-bp fragment 16s rrna the pcr protocols optimized 40 cycles consisting 45 seconds 94c denaturation 30 seconds 57c annealing 30 seconds 72c extension followed final 5 minute extension 72c amplification primers observed electrophoresis 2% w v agarose gel stained ethidium bromide figure 1 the n. asteroides atcc 19247 m. tuberculosis h37rv used positive reference strains two pcrs sample performed separate tubes two pairs primers one set dedicated m. tuberculosis complex whereas set nocardia spp round pcr the investigators blinded clinical data experiment detection microbial agents co infection all specimens unnamed labeled secure code reference mycobacteriology laboratory clinical sample m. tuberculosis a total 189 sputum samples obtained reference mycobacteriology laboratory ahvaz jundishapur university medical sciences march 2011 april 2012 all specimens processed immediately according standard routine diagnosis procedures naoh n acetyl l cysteine nalc method next concentrated specimens used smear preparation culture pcr assay 10 11 furthermore 250 l concentrated sputum specimen inoculated onto lowenstein jensen l j media merck germany are acid fast survive decontamination clinical specimens sodium hydroxide nalc methods thereby grow l j medium cultures examined weekly 8 weeks incubation cultures showed growth reported negative discarded microscopic examination using disposable pasteur pipette one drop sediment sputum specimen spread clean microscope slide air drying fixation heat smears stained ziehl neelsen gram staining 10 after decontamination chromosomal dna extracted using proteinase k phenol chloroform precipitated ethanol isopropanol according standard procedures 12 the purified dna amplified specific pairs primers is1 5ctcgtccagcgccgcttcgg 3 is2 5cctgcgagcgtaggcggtgg 3 m. tuberculosis complex strains ann microbiol the pcr protocols optimized 35 cycles consisting 45 seconds 94c denaturation 30 seconds 68c annealing 30 seconds 72c extension followed final 5 minute extension 72c primers ng1 5ctcgtccagcgccgcttcgg3 ng2 5cctgcgagcgtaggcggtgg3 used amplify nocardia genus specific 590-bp fragment 16s rrna the pcr protocols optimized 40 cycles consisting 45 seconds 94c denaturation 30 seconds 57c annealing 30 seconds 72c extension followed final 5 minute extension 72c amplification primers observed electrophoresis 2% w v agarose gel stained ethidium bromide figure 1 the n. asteroides atcc 19247 m. tuberculosis h37rv used positive reference strains two pcrs sample performed separate tubes two pairs primers one set dedicated m. tuberculosis complex whereas set nocardia spp round pcr the investigators blinded clinical data experiment detection microbial agents co infection all specimens unnamed labeled secure code reference mycobacteriology laboratory clinical sample m. tuberculosis among 157 outpatients 7.6% 12/157 specimens positive results acid fast bacilli acid fast staining none samples positive nocardia spp after cultures evolution 10.1% 16/157 specimens positive results mtbc specimens grew nocardia spp microscopic examination gram staining method could nt find particle morphologically similar nocardia 157 samples 7% 11/157 ) were positive pcr mtbc none samples positive nocardia pcr among 32 samples hiv infected patients four 12.5% culture positive m. tuberculosis none positive nocardia furthermore four samples positive acid fast staining pcr assay four samples two positive nocardia spp pcr method based data prevalence nocardiosis also concomitant infection tuberculosis study 6.25% 2/32 hiv infected patients 1.05% 2/189 cases among 157 outpatients 7.6% 12/157 specimens positive results acid fast bacilli acid fast staining none samples positive nocardia spp after cultures evolution 10.1% 16/157 specimens positive results mtbc specimens grew nocardia spp microscopic examination gram staining method could nt find particle morphologically similar nocardia 157 samples 7% 11/157 ) were positive pcr mtbc none samples positive nocardia pcr among 32 samples hiv infected patients four 12.5% culture positive m. tuberculosis none positive nocardia furthermore four samples positive acid fast staining pcr assay four samples two positive nocardia spp pcr method based data prevalence nocardiosis also concomitant infection tuberculosis study 6.25% 2/32 hiv infected patients 1.05% 2/189 cases as clinical manifestation pulmonary tuberculosis nocardiosis similar laboratory tests required order distinguish nocardiosis tuberculosis nocardia slow growing bacteria contamination risk culture bacteria fungi high therefore suggested approach problem molecular techniques since sensitive conventional diagnostic methods 15 two samples positive nocardia spp and mtbc using pcr method suggested concurrent pulmonary tuberculosis nocardiosis may developed coincidently nocardiosis reported prevalent hiv infected patients patients infection opportunistic agents nocardia attributed suppression cell mediated immunity 16 it suggested common condition predisposing patients nocardiosis underlying chronic lung disease study it found coincidence pulmonary tuberculosis nocardiosis 1% entire study population 6.25% among hiv infected patients the incidence pulmonary nocardiosis hiv infected patients previously reported investigators pulmonary nocardiosis hiv infected patients suspected pulmonary tuberculosis reported 3% alnaum et al reported average 3 4% infection 17 some reports indicate greater two thirds patients diagnosed pulmonary nocardiosis initially diagnosed tuberculosis 5% patients proven pulmonary tuberculosis shown co infection nocardia 18 140 sputum samples african hiv positive individuals clinically suspected tuberculosis tb frequency nocardiosis reported 3.6% 19 areas hiv associated tb common only case reports concomitant infection nocardia tb published literature 20 a prevalence 1.4% pulmonary nocardiosis reported tuberculosis chest diseases hospital amritsar singh et al although pintado et al indicated overall incidence nocardiosis among hiv infected patients 0.1 0.4% associated high morbidity mortality rates 18 concurrent pulmonary aspergillosis nocardiosis reported immunocompromised patient following long term steroid therapy 22 study nocardia was distinguished sputum specimens using conventional methods however positive samples determined using pcr assay our study showed pcr technique sensitive conventional methods detection nocardia accordance molecular techniques conventional methods reported 70 90% several studies 22 23 iran several studies investigated pulmonary nocardiosis tuberculosis patients various clinical symptoms recently aminzade et al reported concomitant pulmonary nocardiosis tuberculosis patient rheumatoid arthritis 24 study eshraghi amin nocardia asteroides isolated one patient suffering cushing syndrome bronchogenic carcinoma amongst 142 patients advanced symptomatic pulmonary disease tehran iran 25 another study iran shojaei et al ) clinical isolation n. cyricigeorgica patients various clinical manifestations performed 26 best knowledge this first study reporting co infection nocardiosis tuberculosis hiv positive patients iran concurrent pulmonary tuberculosis nocardiosis much frequent hiv infected patients fatal although nocardiosis resembles tuberculosis first line anti tuberculous drugs efficient treatment therefore important establish potent diagnosis method high sensitivity specificity molecular methods improve speed diagnosis nocardiosis

background : tuberculosis ( tb ) remains as one of the most serious infectious diseases in the world . pulmonary tuberculosis can occur with other pulmonary diseases caused by opportunistic organisms such as nocardia spp . particularly in immunocompromised patients . therefore , diagnosis of co - infection at the early stage of the disease could be lifesaving.objectives:the goal of this study was to detect mycobacterium tuberculosis and nocardia spp . in sputum specimens in order to assess the concomitant nocardiosis and tuberculosis in patients with suspected pulmonary tuberculosis.patients and methods : from march 2011 to april 2012 , 189 sputum specimens were obtained from patients who were suspected of having pulmonary tuberculosis . out of 189 samples , 32 of the samples belonged to hospitalized hiv - infected patients . samples were examined by gram and ziehl - nelsen staining , culture and pcr methods.results:from 157 sputum specimens , positive samples by acid fast staining , culture and pcr for m. tuberculosis were reported for 7.6% ( 12/157 ) , 10.1% ( 16/157 ) and 7% ( 11/157 ) of samples , respectively . no results were obtained by the described methods for nocardia spp . among 32 samples of hiv - infected patients , four ( 12.5% ) had positive results for acid fast staining , culture and pcr detecting m. tuberculosis while only two samples had positive results for nocardia spp . by pcr and no results were reported by culture , gram and acid fast staining for this organism.conclusions:concurrent pulmonary nocardiosis and tuberculosis is frequent in hiv - infected patients . rapid and sensitive methods such as pcr are recommended for detection of such co - infections .

proton magnetic resonance spectroscopy h mrs noninvasive technique allows us provide vivo assessment brain tissue composition gives us insight metabolic processes neurologic disorders 1 2 this technique ability obtain good spatial localization serial measurements high resolution makes vivo h mrs ideal investigative tool brain function respect biochemical interactions 3 the application technique creates possibility observing major brain metabolites contributes major resonances seen h mr spectra brain n acetylaspartate naa creatine phosphocreatine cr choline containing compounds cho myo inositiols ins 1 3 using current localization techniques h mrs spectra obtained regions 1 10 l within timescale clinical examination allows definition spectral changes specific motor cortex 3 early studies h mrs stroke mostly investigated ischemic stroke shown increased lactate decreased naa within stroke lesion 4 6 however attempts determine whether magnitude neuronal damage measured naa loss correlates disability impairment ischemic stroke patients brought forth inconsistent results 7 10 there previous h mrs study investigated metabolic changes higher motor cortex following intracerebral hematoma hemiparetic humans the aim study evaluate local metabolic changes primary motor cortex m-1 supplementary motor area sma affected hemisphere ah unaffected hemisphere uh according axonal injuries level internal capsule the m-1/sma ah uh studied using h mrs 9 patients 4 men 5 women mean age 54 yr range 30 70 yr right handed documentable hemiparesis varying severity the hemiparesis caused deep intracerebral hematoma putamen thalamus locations directly adjacent internal capsule intracerebral hematoma areas mostly brings hemiparesis neurologic sequele the h mrs study performed alert patients definite hemiparesis extremities contralateral ah control possible h mrs spectral change excluded patients undergone surgical intervention major systemic illness uremia the results compared h mrs studies performed 10 normal control volunteers five men five women mean age 41 yr range 28 59 yr right handed screened exclude people prior systemic disease head injury the institutional review board approved mr study proctocol investigation conducted full compliance accepted standards research involving humans the mean duration study approximately 1 yr range 7 days 1 yr development intracerebral hematoma in vivo h mrs studies performed 1.5 mri mrs system ge signa advantage version 4.8 ge medical systems milwaukee wi u.s.a using stimulated echo acquisition mode steam sequence water suppression chemical shift selective chess rf pulse dephasing gradients 11 12 standard head coil used routine neurological research imaging sequences image guided single voxel spectroscopic acquisition a 6.4 ml volume cortex selected using t2-weighted mr images 90 msec te 2,500 msec tr examining m-1 cortex single voxel technique a cubic volumes interest voi 181820 mm placed medial precentral gyrus broadman area 4 anterior central sulcus hemispheres ah uh sma sized voi placed medial side superior frontal gyrus broadman area 6 anterior m-1 cortex voi shown fig the voxel location carefully chosen two investigators ensure exact anatomical location m-1/sma patient the spectral parameters used 20 msec te 2,000 msec tr 128 averages 2,500 hz spectral width 2,048 data points the shim procedure used optimizing magnetic field homogeneity entire volume interest detected receiver coil focused water signal after autoprescan typical line width full length half maximum fwhm usually 2 4 hz raw data processed using sage data analysis package ge medical systems the post processing done using zerofilling 4k apodization filtering used improve either snr resolution and/or reduce truncation artifacts fourier transformation zero order phase correction phase absorption spectra performed directly along baseline corrections resolution enhancement the peak areas obtained spectra using marquardt algorithm fit lorentzian gaussian peak type 13 proton peak assignments major vivo h mrs observable metabolites naa 2.00 ppm cr 3.00 pm cho 3.20 ppm sum glx glu gaba 2.35 2.25 ppm ins 3.50 pm 14 after the data processed selected personal blinded patient histories conditions results expressed meanssd naa cr ratio cho cr ratios metabolite ratios ah uh controls values compared significant differences using paired test assuming equal variance independent sample test probability values less 0.05 considered significant values less 0.01 considered highly significant the m-1/sma ah uh studied using h mrs 9 patients 4 men 5 women mean age 54 yr range 30 70 yr right handed documentable hemiparesis varying severity the hemiparesis caused deep intracerebral hematoma putamen thalamus locations directly adjacent internal capsule intracerebral hematoma areas mostly brings hemiparesis neurologic sequele the h mrs study performed alert patients definite hemiparesis extremities contralateral ah control possible h mrs spectral change excluded patients undergone surgical intervention major systemic illness uremia the results compared h mrs studies performed 10 normal control volunteers five men five women mean age 41 yr range 28 59 yr right handed screened exclude people prior systemic disease head injury the institutional review board approved mr study proctocol investigation conducted full compliance accepted standards research involving humans the mean duration study approximately 1 yr range 7 days 1 yr development intracerebral hematoma in vivo h mrs studies performed 1.5 mri mrs system ge signa advantage version 4.8 ge medical systems milwaukee wi u.s.a using stimulated echo acquisition mode steam sequence water suppression chemical shift selective chess rf pulse dephasing gradients 11 12 a standard head coil used routine neurological research imaging sequences image guided single voxel spectroscopic acquisition a 6.4 ml volume cortex selected using t2-weighted mr images 90 msec te 2,500 msec tr examining m-1 cortex single voxel technique a cubic volumes interest voi 181820 mm placed medial precentral gyrus broadman area 4 anterior central sulcus hemispheres ah uh sma sized voi placed medial side superior frontal gyrus broadman area 6 anterior m-1 cortex voi shown fig the voxel location carefully chosen two investigators ensure exact anatomical location m-1/sma patient the spectral parameters used 20 msec te 2,000 msec tr 128 averages 2,500 hz spectral width 2,048 data points the shim procedure used optimizing magnetic field homogeneity entire volume interest detected receiver coil focused water signal autoprescan the typical line width full length half maximum fwhm usually 2 4 hz raw data processed using sage data analysis package ge medical systems the post processing done using zerofilling 4k apodization filtering used improve either snr resolution and/or reduce truncation artifacts fourier transformation zero order phase correction phase absorption spectra performed directly along baseline corrections resolution enhancement the peak areas obtained spectra using marquardt algorithm fit lorentzian gaussian peak type 13 proton peak assignments major vivo h mrs observable metabolites naa 2.00 ppm cr 3.00 pm cho 3.20 ppm sum glx glu gaba 2.35 2.25 ppm ins 3.50 pm 14 after data processed selected personal blinded patient histories conditions results expressed meanssd naa cr ratio cho cr ratios the metabolite ratios ah uh controls values compared significant differences using paired test assuming equal variance independent sample test probability values less 0.05 considered significant values less 0.01 considered highly significant the results summarized table 2 naa cr ratios m-1 ah uh 1.080.12 1.500.17 respectively there significant differences ah uh naa cr ratios m-1 p<0.05 the naa cr ratios m-1 measured ah controls 1.080.12 1.370.12 respectively there also significant differences ah controls naa cr ratios m-1 p=0.01 however naa cr ratios m-1 measured uh showed differences compared ratios normal volunteers p=0.115 these results showed naa cr ratios ah significantly decreased compared uh normal volunteers therefore metabolic changes occurred high cortical region ipsilateral injured hemispheres however naa cr ratios m1 ah showed significant correlation severity arm weakness leg weakness duration hemiparesis naa cr ratios sma measured ah uh 1.180.15 1.180.27 respectively there difference ah uh naa cr ratios sma p=0.980 however compared sma controls naa cr ratios sma ah uh showed significant differences p<0.05 terms cho cr ratios significant differences found following m1 cortices ah uh p=0.316 smas ah uh p=0.561 m-1 cortex sma ah p=0.745 m-1 cortex sma uh p=0.289 no significant differences found comparing cho cr ratios cortex normal volunteers lactate resonance expected see 1.3 ppm observed cases the naa cr cho cr ratios m1 sma control group show difference right left hemispheres hemiparesis commonly experienced deficit stroke acutely affects 80% subjects chronically affects greater 40% subjects 15 patients show wide range degree recovery restorative processes occur brain stroke remain incompletely understood this work focused neurochemical profile motor cortex supplementary motor area relation pyramidal tract injury caused deep intracerebral hematoma h mrs provides chemical information local cellular metabolism using metabolic ratios neurochemicals detected spectra 11 12 one important contributions h mrs clinical neuroscience ability quantify neuronal loss demonstrate reversible neuronal damage 1 2 h mrs useful research tool elucidating pathophysiology underlying certain diseases including brain tumors head trauma cerebrovascular neurodegenerative metabolic brain diseases 1 h mrs used attempting better qualification brain damage caused stroke h mrs allows vivo measurement n acetyl containing compounds creatine choline lactate the majority n acetyl signal comes naa present high concentrations brain 16 the function naa unclear although suggestions included initiation protein synthesis neurotransmission deactivation glutamate naa particular interest studies brain located almost exclusively neurons adults 17 initially suggested decrease naa represented neuronal loss 18 however reversible decrease naa recently shown occur acute lesions multiple sclerosis stroke like episodes melas 19 further naa synthesis vitro shown occur energy dependent manner reduced mitochondrial inhibitors 20 therefore decrease naa resonance peak vivo must interpreted index neuronal axonal injury rather marker neuronal axonal loss 21 decrease naa shown correlate disability multiple sclerosis 22 suggesting axonal injury responsible chronic functional impairment disease early studies h mrs stroke shown increased lactate decreased naa within stroke lesion 4 6 subsequent attempts made determine whether magnitude neuronal damage measured naa loss infarcted region correlated disability impairment stroke patients ( 8) found patients made complete recoveries naa levels relatively well preserved in contrast gideon et al 9 found clear relationship level naa patient clinical outcome ( 10 found naa reduction correlated barthel index score discharge ( 7 found naa loss measured first week stroke patients speech motor deficit correlated scandinavian stroke scale barthel index 6 months however authors criticized findings remained unclear whether naa loss better prognostic indicator measures infarct volume measured imaging 21 ( 21 pointed mentioned studies regarding h mrs outcome stroke measured naa loss center infarcted region thus naa losses representative total neuronal injury moreover the naa loss measured specific brain region directly relevant chosen outcome measures examine relationship naa loss stroke motor outcome researchers studied naa levels posterior limb internal capsule contains descending motor pathways patients motor deficits secondary cortical subcortical capsular stroke study found mean internal capsule naa significantly lower patient group axonal injury descending motor pathways level internal capsule correlated motor deficit patients stroke they suggested possible anterograde axonal injury might important role naa loss strokes involving internal capsule motor subcortex areas contains motor pathway 21 although many h mrs studies dealing motor deficit ischemic stroke h mrs studies investigating motor system hemorrhagic stroke especially intracerebral hematoma rare furthermore researchers used h mrs detection biochemical changes motor motor association areas following subordinate motor pathway damage 3 23 biochemical information obtained present study shows m-1 naa cr ratios significantly decreased ah intracerebral hematoma induces axonal injury internal capsule the exact pathophysiologic mechanism naa loss normal appearing motor cortex unclear however reduced levels naa normal appearing white matter already shown occur patients multiple sclerosis cerebral ischemia caused motor stroke 21 24 we suggest naa loss m-1 present study may caused retrograde degeneration according axonal injury level internal capsule due adjacent intracerebral hematoma ( 21 studied eighteen ischemic strokes caused motor deficit use h mrs shown cortical subcortical stroke induced naa loss normal appearing internal capsule the metabolic information obtained study shows naa cr ratios m-1 significantly decreased ah following intracerebral hematoma although examination time time associated disease quite different respect neural injury i.e. motor pathway believed likely significant commonality two reduced metabolism motor cortex already documented pet study dealing ischemic stroke 25 pet study 10 patients following recovery striatocapsular infarction comparison regional cerebral blood flow rcbf maps patients rest normal subjects revealed significantly lower regional cerebral blood flow basal ganglia thalamus sensorimotor insular dorsolateral prefrontal cortices brainstem ipsilateral cerebellum patients contralateral side recovered hand 25 these researchers suggest cause decreased rcbf areas functional deactivation although structural changes microscopic level due transsynaptic retrograde degeneration excluded the reduction naa cr ratios m-1 cortex study seems concordant already documented reduction rcbf sensorimotor cortex pet study recovered ischemic capsular infarction 25 ( 3 evaluated motor cortex using vivo h mrs patients incomplete spinal cord injury showed good motor function recovery report the mean level naa cr ratio significantly elevated motor cortex patients compared ipsilateral occipital cortex cortical area controls they explained increased naa cr value neural adaptation accompanies recovery spinal cord injury first glance increased naa cr value motor cortex recovered incomplete spinal cord injury study seems contrary observations decreased naa cr values ah motor cortex hemiparesis however several differences patients characteristics methods used mrs location voxels etc study puri et al ( 3 subjects already shown good recovery motor function neural injury enrolled subjects recovered hemiparesis terms technical aspects h mrs puri co workers located voxel centrum semiovale used technique chemical shift imaging we found significant correlation severity weakness naa cr values m-1 believe functional location voxel study closer trunk leg homunculus arm homunculus nevertheless correlation found naa cr values affected m-1 severity leg weakness however think difficult draw definite conclusion results number patients enrolled study small timing h mrs examination development intracerebral hematoma variable time clear whether naa cr ratio ah would increase according recovery hemiparesis intracerebral hematoma there evidence significant recovery naa occur acute brain damage 19 for example reversible decreases naa found two patients mitochondrial encephalopathy four patients demyelinating lesions 24 further study needed longer follow larger numbers subjects investigate correlation severity weakness the sma ii occupies medial surface superior frontal gyrus rostral area 4 corresponds medial part area 6 area 6 26 sma considered involved programming learned skilled motor sequences may play role initiating voluntary movement 27 the recruitment sma described normal accompaniment either anticipation sequencing motor task 28 clinical studies suggest sma may contribute return motor function stroke 29 30 therefore investigate whether biochemical alteration due capsular injury intracerebral hematoma included bilateral sma addition m-1 study present study found significant reduction naa cr ratios ah uh compared normal controls it difficult explain exact meaning reduction naa cr ratio bilateral smas however sma striking bilateral influences upon proximal distal musculatures primates cortical projections sma ipsilateral areas 4 6 7 contralateral sma 26 28 considering sma bilateral influence motor function speculate unilateral injury motor pathway might induce metabolic changes bilateral sma possible retrograde degeneration summary sought determine whether h mrs able detect metabolic changes m-1 sma follow pyramidal tract injury intracerebral hemorrhage we found m-1 ah lower naa cr values m-1 uh normal volunteers in addition sma also showed bilateral lower naa cr values ah uh normal volunteers though precisely document exact meaning lower naa cr ratios presumed retrograde degeneration functional deactivation may play role naa losses m-1 sma due motor tract injury further experiments include longitudinal studies patients motor deficit intracerebral hematomas whether reversible component naa loss

this study was conducted to investigate the metabolic changes in the motor and motor association cortices following axonal injury in the internal capsule that was caused by deep intracerebral hematoma . using proton magnetic resonance spectroscopy ( 1h mrs ) , the authors studied the primary motor cortices ( m-1 ) and sup - plementary motor areas ( sma ) of 9 hemiparetic patients with documentable hemi - paresis of varying severity , and we studied 10 normal volunteers as controls . to measure the m-1 and sma biochemical changes , 4 separate single volumes of inter - est(vois ) were located bilaterally in the affected and unaffected hemisphere ( ah and uh ) . 1h mrs provided a neuronal and axonal viability index by measuring levels of n - acetylaspartate ( naa ) and creatine / phosphocreatine ( cr ) . the m-1/sma naa / cr ratios of the ah and uh in patients , and the ah and normal volunteers were com - pared . the naa / cr ratios of the m-1 and sma in ah , and the sma in uh were sig - nificantly lower than those of normal volunteers . these 1h mrs findings indicate that axonal injury in the descending motor pathway at the level of internal capsule could induce metabolic changes in the higher centers of the motor pathway .

conversion disorder one symptoms affect voluntary motor sensory function suggesting neurological medical condition inconsistent known neurological musculoskeletal pathologies instead symptoms due unconscious expression psychological conflict need the symptoms often reinforced social support family friends avoiding underlying emotional stress the symptoms patients conversion disorder debilitating include paralysis one limbs ataxia tremors tics dystonia many names used describe disorder functional gait disorder hysterical paralysis psychosomatic disorder conversion reaction chronic neurosis the disorder common adolescence childhood despite conversion disorders long documented history it often confused psychological disorders conversion disorder remain diagnostic challenges clinicians a 17-year old female coming mses premorbidly maintaining well came complaints asymmetrical repetitive flickering like movement right hand started day 12 grade board exams she observed reduced sleep since 1 week exams relatively less communication family members day exams time got question paper whole right arm started repetitive flickering movement vigorously support right arm left write exam come exam hall without completing exam within days abnormal movements progressed right leg informant said use crying spells appear sad time given exams she treated promethazine trihexyphenidyl neuroimaging done found normal she showed improvement 20 days completely resolved day day admission developed shivering whole body admitted intensive care unit it associated loss consciousness urine fecal incontinence frothing mouth tongue biting rolling eyeball electroencephalogram computed tomography magnetic resonance imaging brain done found normal found average student class family much expectation she also said younger sister always given attention mother her episodes provoked asked write hold pen right hand also asked walk without assistance she also observed flex right toe walking stay hospital observed sudden onset asymmetrical repetitive jerky movements bilateral legs routine hemogram renal function test liver function test blood sugar lipid profile thyroid function found normal the patient prescribed diazepam 4 mg per days 2 days increased 6 mg per day showed gradual improvement on initial days sessions symptoms got aggravated sessions session stopped after attempts patient ventilated us mother gives less importance compared younger sister 6 years younger the patient also said toddler stage till 10 standard living paternal grandmother father moved different house along parents her parents also included sessions issues mother discussed the patient gradually started walking without difficulty frequency abnormal movements reduced diazepam tapered stopped within week stable time discharge patient came follow 2 weeks maintaining well the clinical picture indicative dissociative motor disorder f44.4 according icd 10 taking detailed history clear parents giving pressure attain high marks board exam interview whenever patient asked hold pen write symptoms increased patient started therapy sessions well low dose diazepam sessions possible causes symptoms discussed encouraged hold pen write her parents also psychoeducated psychosomatic nature symptoms advised encourage symptom free lifestyle they also given instruction pay attention complaints physical nature patient explained problem nerves recorded study along dose diazepam also increased 6 4 mg study patient showed dramatic improvement symptoms failure treatment dissociative disorders occurs mostly identify primary stressor gain taking proper history early identification stressor there case reports dissociative disorders managed alone therapy sessions patient taught deal stressful situations nerve conduction study diagnostic test evaluate function i.e. electrical conduction motor sensory nerve human body also done along needle electromyography measure nerve muscle function study performed electrical stimulation peripheral nerve recording muscle supplied nerve time taken electrical impulses travel stimulation recording site measured patient procedure well explained patient showed marked improvement conversion disorder somatoform disorder malingering always remain diagnostic challenges clinicians the prompt history taking identification stressors use appropriate validated physical examination manoeuvres coordination care information exchange family members medical team may facilitate expeditious care patients cost effective manner the existing literature supports multidisciplinary treatment approach specific interventions cognitive behavior therapy cognitive restructuring psychodynamic therapy addressing symptom connections trauma dissociation

conversion disorders are more prevalent in childhood and adolescence , especially in females . they are usually associated with stressors and symptoms usually reflect a means to avoid the stressor , or also with a primary and secondary gain . this case report involves a similar situation where a young girl was treated successfully with diazepam , therapeutic nerve conduction study , and behavioral psychotherapy .

study protocol approved institutional review board kim eye hospital seoul korea all participants provided informed consent prior enrollment procedures conformed guidelines declaration helsinki june 2006 july 2011 134 eyes 132 patients underwent agv implantation surgery kim eye hospital analyzed retrospectively each subject underwent full ophthalmic examination including visual acuity assessment iop assessment goldmann applanation tonometer anterior segment examination slit lamp biomicroscopy fundus examination 90 diopter lens 24 2 swedish interactive threshold algorithm standard automated visual fieldest humphrey visual field analyzer carl zeiss meditec dublin ca usa surgery well 1 day 1 month 2 3 months 4 6 months 11 16 months 17 24 months surgery the study included patient underwent agv implantation surgery kim eye hospital performed using technique 1 2 glaucoma specialists yhs hkk minimum 6 months follow the exclusion criteria patients age less 18 years 80 years agv implanted inferior quadrants previous seton surgery trabeculectomy operated eye inflammatory ocular surface disease severe conjunctival scarring history retinal detachment surgery scleral buckle vitrectomy operated eye history endophthalmitis operated eye among 134 eyes 132 patients 44 eyes 42 patients before surgery included 50 eyes neovascular glaucoma 36 eyes secondary open angle glaucoma 4 eyes primary open angle glaucoma the agv implantation selection made surgeon based conjunctival mobility presence previous surgical conjunctival scaring limited subconjunctival space owing previous ocular surgeries scarred upper fornix shallow fornix presence small eyes eyes implanted fp7 fp8 agvs assigned fp7 group fp8 group respectively the procedures performed similar manner subjects regardless implant size the conjunctival incision made 4 mm posterior limbus following dissection conjunctiva tenon capsule toward fornix limbus bipolar cautery performed mitomycin c 0.02% applied large piece soaked cellulose sponge conjunctival flap episclera 3 minutes followed thorough irrigation area balanced salt solution the plate implant secured sclera 8 10 mm posterior surgical limbus using 2 interrupted 7 0 silk sutures the tube trimmed appropriate length bevel facing anteriorly injection methyl cellulose anterior chamber via clear cornea stab incision tube inserted anterior chamber corneoscleral track created using 23-gauge needle the tube fixed episclera 10 0 nylon mattress suture a quadrangular donor scleral patch graft 4 7 mm fashioned secured exposed part tube using 10 0 nylon sutures the conjunctiva tenon capsule repaired using 8 0 vicryl suture material running fashion dexamethasone 4 mg gentamycin 100 mg injected subconjunctivally upon procedure conclusion the postoperative regimen included topical levofloxacin 0.5% eye drops 4 times per day 1 week topical fluorometholone 0.1% eye drops 4 times per day usually tapered 6 8 weeks postoperative follow visits scheduled 1 day 1 2 weeks 1 3 6 12 months procedure every 6 months thereafter surgical success defined iop maintained 21 mmhg regardless number iop medications used final follow observation the following observations made follow regarded surgical failures iop greater 22 mmhg 2 consecutive follow visits iop less 5 mmhg 2 consecutive follow visits additional glaucoma surgery required loss light perception independent tests chi squared tests performed compare ocular demographic variables 2 groups compare success rate surgery 2 groups log rank mantel cox test performed the study protocol approved institutional review board kim eye hospital seoul korea all participants provided informed consent prior enrollment procedures conformed guidelines declaration helsinki june 2006 july 2011 134 eyes 132 patients underwent agv implantation surgery kim eye hospital analyzed retrospectively each subject underwent full ophthalmic examination including visual acuity assessment iop assessment goldmann applanation tonometer anterior segment examination slit lamp biomicroscopy fundus examination 90 diopter lens 24 2 swedish interactive threshold algorithm standard automated visual fieldest humphrey visual field analyzer carl zeiss meditec dublin ca usa surgery well 1 day 1 month 2 3 months 4 6 months 11 16 months 17 24 months surgery the study included patient underwent agv implantation surgery kim eye hospital performed using technique 1 2 glaucoma specialists yhs hkk minimum 6 months follow the exclusion criteria patients age less 18 years 80 years agv implanted inferior quadrants previous seton surgery trabeculectomy operated eye inflammatory ocular surface disease severe conjunctival scarring history retinal detachment surgery scleral buckle vitrectomy operated eye history endophthalmitis operated eye among 134 eyes 132 patients 44 eyes 42 patients before surgery included 50 eyes neovascular glaucoma 36 eyes secondary open angle glaucoma 4 eyes primary open angle glaucoma the agv implantation selection made surgeon based conjunctival mobility presence previous surgical conjunctival scaring limited subconjunctival space owing previous ocular surgeries scarred upper fornix shallow fornix presence small eyes eyes implanted fp7 fp8 agvs assigned fp7 group fp8 group respectively the procedures performed similar manner subjects regardless implant size conjunctival incision made 4 mm posterior limbus following dissection conjunctiva tenon capsule toward fornix limbus bipolar cautery performed mitomycin c 0.02% applied large piece soaked cellulose sponge conjunctival flap episclera 3 minutes followed thorough irrigation area balanced salt solution the plate implant secured sclera 8 10 mm posterior surgical limbus using 2 interrupted 7 0 silk sutures the tube trimmed appropriate length bevel facing anteriorly injection methyl cellulose anterior chamber via clear cornea stab incision tube inserted anterior chamber corneoscleral track created using 23-gauge needle the tube fixed episclera 10 0 nylon mattress suture a quadrangular donor scleral patch graft 4 7 mm fashioned secured exposed part tube using 10 0 nylon sutures the conjunctiva tenon capsule repaired using 8 0 vicryl suture material running fashion dexamethasone 4 mg gentamycin 100 mg injected subconjunctivally upon procedure conclusion the postoperative regimen included topical levofloxacin 0.5% eye drops 4 times per day 1 week topical fluorometholone 0.1% eye drops 4 times per day usually tapered 6 8 weeks postoperative follow visits scheduled 1 day 1 2 weeks 1 3 6 12 months procedure every 6 months thereafter surgical success defined iop maintained 21 mmhg regardless number iop medications used final follow observation the following observations made follow regarded surgical failures iop greater 22 mmhg 2 consecutive follow visits iop less 5 mmhg 2 consecutive follow visits additional glaucoma surgery required loss light perception independent tests chi squared tests performed compare ocular demographic variables 2 groups compare success rate surgery 2 groups log rank mantel cox test performed among 66 eyes underwent fp7 implant surgery 24 eyes underwent fp8 implant surgery table 1 summarizes demographic clinical characteristics study populations mean age 57.6 11.4 years fp7 group 61.0 9.9 years fp8 group p 0.199 preoperative iop 41.9 9.2 mmhg fp7 group 39.0 6.6 mmhg fp8 group p 0.105 there significant difference 2 groups following variables sex systemic disease distribution glaucoma subtype baseline visual acuity number preoperative antiglaucoma medications previous ocular surgeries laterality implantation site p 0.05 table 1 the mean follow period 17.2 9.1 months fp7 group 20.3 4.4 months fp8 group p 0.273 the postoperative visual acuity fp8 group better fp7 group early postoperative periods 1 week 2 3 months 7 10 months surgery p 0.05 however 10 postoperative months significant differences visual acuity 2 groups 3-year follow p 0.05 table 2 postoperative iop significantly different 2 groups p 0.05 except iop postoperative day 1 11.4 8.4 mmhg fp7 group 7.4 3.9 mmhg fp8 group p 0.031 table 3 statistically significant differences groups terms number glaucoma medications surgery table 4 study surgical success considered iop maintained less 21 mmhg regardless medication used additional glaucoma surgery required non occurrence light sense loss consecutive follow visits low iop therefore cumulative success rate according log rank test kaplan meier survival analysis 79.2% fp8 group 72.7% fp7 group 3-year follow p 0.535 fig 1 main reasons failure significantly different 2 groups table 5 it hypothesized glaucoma drainage implants large plates produces increased surface area encapsulation higher degree iop reduction prospective randomized clinical trial comparing single plate double plate molteno implants heuer et al found higher success rate greater iop reduction double plate implants single plate implants presumably large surface area double plate implants contrary seah et al reported significant difference success rates final iop number medications rates complications 250 350 mm baerveldt glaucoma implants bgis another prospective study comparing 350 500 mm bgis lloyd et al reported difference success rates visual outcomes different implant sizes britt et al also reported 500 mm bgi superior 350 mm bgi iop control these results agreement present study results differences found vision preservation iop reduction decrease number glaucoma medications fp7 fp8 agv implants adult eyes glaucoma thus far study comparing surgical outcomes fp7 fp8 agv implants adult eyes similar surgical outcomes fp7 fp8 groups imply plate area may major factor determining surgical success likely maximal surface area beyond minimal improvement iop control kang kee argued upper limit increase surface area implants cease beneficial effect iop inferred effect iop decrease depend area filter cloth beyond certain size this phenomenon may least partly responsible lack superior iop reduction fp7 agv implants compared fp8 agv implants another possible explanation surgeon perceived priori likelihood failure complications choice implant extent influenced severity glaucoma it difficult compare surgical success rates different studies differences study design populations studied types implants used lengths follow periods variable success rates agv implantation reported range 64.5% 95.0% follow periods 6 24 months with fp7 follow 6 months 78% reported coleman et al fp7 follow 12 months in addition success rate 96% obtained fp7 implant follow 12 months these results similar results ishida et al reported 94.2% success rate fp7 implant 12 months 40 eyes 40 patients different types refractory glaucoma 92.5% success rate was reported fp7 fp8 follow period 6 months unfortunately study report separate success rates fp7 fp8 groups although materials vary 53.8% success rate reported 96 mm agv model s3 new world medical inc 92.3% success rate reported 184 mm agv model s3 new world medical inc follow period 10 months present study the success rates 79.2% fp8 group 72.7% fp7 group 3-year follow comparable success rates studies adult eyes however conditions conjunctival scarring limited subconjunctival space fp7 agv implantation challenging in addition oversized implant result various complications including implant exposure extrusion discomfort motility defects given fp7 fp8 agv implants show differences surgical outcomes suggest fp8 implantation may useful surgical option iop control adult eyes insufficient conjunctival subconjunctival areas option may especially useful special circumstances asian eyes since small globes common population compare surgical outcomes fp7 fp8 agv implants randomization subjects underwent however present study type agv chosen per surgeon clinical judgment without randomization other limitations include relatively small sample size limited follow period long term prospective randomized patient- investigator masked studies needed confirm results study conclusion fp7 fp8 agv implants showed difference terms preservation vision iop reduction decrease number required glaucoma medications the fp8 agv implant appears viable option management refractory glaucoma adult eyes conjunctival scarring limited subconjunctival space owing previous ocular surgeries inflammatory ocular disorders small eyes

purposeto compare the success rates , complications , and visual outcomes between silicone ahmed glaucoma valve ( agv ) implantation with 96 mm2 ( fp8 ) or 184 mm2 ( fp7 ) surface areas.methodsthis study is a retrospective review of the records from 132 adult patients ( 134 eyes ) that underwent silicone agv implant surgery . among them , the outcomes of 24 eyes from 24 patients with refractory glaucoma who underwent fp8 agv implantation were compared with 76 eyes from 76 patients who underwent fp7 agv implantation . preoperative and postoperative data , including intraocular pressure ( iop ) , visual acuity , number of medications , and complications were compared between the 2 groups.resultsthere were no significant differences in baseline characteristics between the 2 groups ( p > 0.05 ) . the postoperative visual acuity of the patients in the fp8 group was better than that of the patients in the fp7 group in some early postoperative periods ( p < 0.05 ) ; however , after 10 postoperative months , visual acuity was not significantly different through the 3-year follow - up period ( p > 0.05 ) . postoperative iop was not significantly different between the 2 groups ( p > 0.05 ) except for iop on postoperative day 1 ( 11.42 mmhg for the fp7 group and 7.42 mmhg for the fp8 group ; p = 0.031 ) . there was no statistical difference in success rates , final iop , number of medications , or complication rates between the 2 groups ( p > 0.05).conclusionsthe fp7 and fp8 agv implants showed no difference in terms of vision preservation , iop reduction , and number of glaucoma medications required .

use dental implants support retain dental prostheses demonstrated clinically efficacious a precise fit implant abutment superstructure determining absence bone tension without occlusal load important factor long term success implant supported restorations considering fact implants completely surrounded bone interface elastic minimum movement observed due bone deformation loading accordingly must anticipated stress introduced implant system result prosthesis misfit may present many years placement ankylotic nature osseointegration the present findings support concern precision frameworks regard various aspects fatigue long term perspective2,13 widely used solution implant anchored prosthesis this abutment designed directly engage implant thus allows prosthodontist extending porcelain subgingivally areas extremely limited gingival tissue height the subgingival placement restoration improves esthetics also helps situations interocclusal distance limitations20 the use abutments allows correction angulations implants inserted angles ideal single tooth restorations the provision antirotational device necessary fixed partial restorations non hexed castable ucla abutments present better alternative concern whether use custom made abutments would result fit abutment implant could comparable achieved use premachined titanium abutments an intermediate solution developed whereby premachined ucla abutments made noble metal alloys could cast onto directly allow integration restoration abutment these hand operated devices developed correct casting defects fitting surface reduce abutment implant misfit despite various prosthetic technical improvements laboratory procedures used fabrication implant supported prostheses especially casting porcelain baking this study evaluated effect cast rectifiers misfit cast ucla abutments compared premachined ucla abutments the influence casting porcelain baking marginal misfit components also investigated two groups components analyzed test group n=10 castable plastic non hexed ucla abutments 055021;conexo sistemas de prtese paulo sp brazil control group n=10 non hexed premachined ucla abutments 055022 conexo sistemas de prtese paulo sp brazil figure 1a the components groups individually positioned implant analogue 013020 conexo sistema de prteses paulo sp brazil sectioned diamond bur 34570 microdont paulo sp brazil low speed water cooling 8 mm height keeping cylindrical shape abutments secured sprues fixated sprue former a silicone casting ring adapted sprue former investment poured bellavest bego bremen germany four silicone rings used one containing 5 ucla abutments adding 20 components 10 per group the patterns induction cast abutments test group nickel chromium alloy wiron 99 bego bremen germany abutments control group palladium silver alloy williams w1 ivoclar vivadent amherst ny usa ) castings allowed bench cool divested cleaned air abrasion process implant analogues joined abutments reduce risk damage abutment implant interface figure 1b fitting surfaces castings made plastic patterns test group milled cast rectifiers conexo sistema de prteses paulo sp brazil turning tool abutment fitting surface twenty times clockwise direction a single operator performed procedure figures 2 3 20 specimens porcelain omega 900 vita bad sckingen germany applied abutments carved baked according manufacturer recommendations porcelain addition standardized teflon cylindrical device perfectly fitted implant analogue adequate space application bulk material nearly 1.5 mm specimens misfit measurements performed light microscope sprint 100 ram optical instrumentation irvine ca usa a standard threaded 3.75x13-mm implant 517713 screw conexo sistemas de prtese paulo sp brazil stabilized center brass support machined achieve final hexagonal configuration allowing lateral seating light microscope figures 4a b 5 laser marks created abutments implant allow positioning components place microscopic measurements the abutments attached implants predetermined position screw tightened torque 5 ncm torque driver figure 6 three microscopic measurements x460 magnification made aspect hexagonal base reading points predetermined laser marks lateral aspect implant platform adding 18 reading points specimen marginal misfit measurements test group performed m1 m2 use rectifiers ceramic application m3 control group measurements performed m1 m2 casting ceramic application m3 figure 7 means standard deviations marginal misfit groups 3 test moments m1 m2 m3 presented table 1 means followed letters statistically similar 5% significance level tukey test the cast ucla abutments test group m1 showed greatest discrepancies marginal misfit mean 25.68 significant reduction marginal misfit cast ucla abutments 25.68 14.83 after ceramic application m3 cast abutments presented marginal misfit mean 16.18 statistically similar observed premachined abutments interval 14.3 casting premachined ucla abutments control group m2 altered significantly marginal misfit components 9.63 14.6 there significant changes due porcelain baking groups investigated several studies demonstrated success implantology9,18 however despite evolution specialty clinical complications still frequent numerous studies conducted understand reduce occasional complications11,16 spite advances technology materials techniques employed fabrication prosthetic structures dimensionally accurate require investigation development distortions structures inevitable impossible achieve perfect fit absolute passivity prosthetic interfaces8,17 prosthesis misfit favors bacterial colonization leading inflammation periimplant soft tissues harming osseointegration3,11 this lack precision also contributes unfavorable distribution stresses may lead mechanical complications loosening fracture screws prosthetic components addition biological complications periimplant bone loss impairment osseointegration severe cases6,11,17 prosthetic protocols employing machined components reduce risks due higher accuracy fit19 however allow versatility overcoming angulation esthetic problems castable plastic patterns ucla abutments permit esthetic restorations finished close implant head solving many esthetic dilemmas use prosthetic option increased even though fit abutment implant interface satisfactory fit provided premachined abutments3,19 due increased search components companies developed alternatives reduce misfit premachined ucla abutments other option use castable plastic patterns followed laboratory finishing fitting surface cast rectifier this device manual instrument designed minimize marginal misfit cast ucla abutments leading better mechanical stability assembly reducing probability bacterial aggregation this hand operated device developed non hexed cast ucla abutments i.e. without antirotational device therefore used hexed ucla abutments single tooth restorations the present study revealed high values marginal misfit castings made plastic patterns test group m1 25.68 compared premachined abutments 9.63 the factors contribute distortion castings directly impairing marginal fit components include fabrication acrylic cylinders limitations investment processes casting techniques the use cast rectifiers led significant reduction marginal misfit cast ucla abutments reduction marginal misfit means 25.68 14.83 the reduction vertical misfit reduces mechanical instability prosthetic components thereby eliminating gaps bacterial colonization concerning premachined abutments used reference mean marginal misfit ceramic application m3 14.3 the cast abutments used present study use rectifiers porcelain baking m3 exhibited mean marginal misfit of16.18 statistically equivalent mean observed premachined components interval 14.3 disagreement findings vigolo et al.20 2000 present investigation demonstrated group premachined abutments even carefully conducted laboratory steps significant changes occurred implant abutment interface casting process increase mean marginal gap 9.63 14.6 ceramic application change marginal misfit groups these results agreement findings previous studies1,3,4,7 find significant dimensional alteration metal secondary ceramic application the seating force used place samples master cast important effect vertical misfit the use torque driver even lowest torque available 10 n cm may considerably narrow vertical misfit gaps abutment framework interface9,12,21 marginal misfit investigations screws hand fastened always investigator first resistance met suggested zervas et al.21 1999 allows real fit evaluation attempt made narrow vertical misfit gaps however seems risky protocol due wide variation ability clinicians perceive torque making difficult standardization screw tightening procedure prior microscope measurements present study a special torque driver fabricated reducing torque 5 n cm way screw tightening standardized seating force considerably influence vertical misfit gaps it important stand seating force 5 n cm used specifically vitro investigation must used clinically present investigation microscopic evaluation marginal misfit employed the measurements taken positioning specimens microscope marginal area connection abutment implant could observed directly perpendicular perspective this allows measurement marginal discrepancy non destructive manner multiple readings specimens even though several three dimensional methods evaluating prosthetic misfit sophisticated equipment required analyses promptly available10,12 utilization common techniques still provides information relative fit misfit prostheses even though acknowledged techniques precise three dimensional methods10 according currently available scientific based evidences despite efficacy contemporary dental technology employed fabrication prosthetic frameworks that concepts passivity provide necessary theoretical ideals yet achievement impossible the accomplishment accurate clinical laboratory procedures combined use rectifiers may optimize final outcomes allow completion rehabilitation prostheses impair longevity osseointegration use rectifiers cast ucla abutments reduced significantly marginal misfit implant abutment interface 2 even carefully performed laboratory steps changes implant interface premachined ucla abutments occurred 3

objectives : this study assessed the effect of cast rectifiers on the marginal misfit of cast ucla abutments compared to premachined ucla abutments . the influence of casting and porcelain baking on the marginal misfit of these components was also investigated.methods:two groups were analyzed : test group 10 cast ucla abutments , finished with cast rectifier and submitted to ceramic application ; control group 10 premachined ucla abutments , cast with noble metal alloy and submitted to ceramic application . vertical misfit measurements were performed under light microscopy . in the test group , measurements were performed before and after the use of cast rectifiers , and after ceramic application . in the control group , measurements were performed before and after casting , and after ceramic application . data were submitted to statistical analysis by anova and tukey 's test ( = 5%).results : the use of cast rectifiers significantly reduced the marginal misfit of cast ucla abutments ( from 25.68m to 14.83m ; p<0.05 ) . after ceramic application , the rectified cylinders presented misfit values ( 16.18m ) similar to those of premachined components ( 14.3 m ) . casting of the premachined ucla abutments altered the marginal misfit of these components ( from 9.63 m to 14.6 m ; p<0.05 ) . there were no significant changes after porcelain baking , in both groups.conclusion:the use of cast rectifiers reduced the vertical misfit of cast ucla abutments . even with carefully performed laboratory steps , changes at the implant interface of premachined ucla abutments occurred . ceramic application did not alter the marginal misfit values of ucla abutments .

diabetic neuropathy leading complication diabetes mellitus resulting significant morbidity mortality although exact pathogenesis fully understood hyperglycemia appear sole factor development neuropathy diabetic patients enigmatically recent reports described long term tight glycemic control may major risk factor development diabetic neuropathy 1 2 neuropathy secondary rapid normalization chronic hyperglycemia setting poorly controlled diabetes also emerging new disease entity classified iatrogenic complication symptoms patients typically consistent distal sensory polyneuropathy appearing shortly initiation intensive glycemic control referred insulin neuritis treatment induced neuropathy characterized acute severe pain however parallel worsening neuropathy retinopathy rapid tightening glycemic control 4 5 suggests common underlying pathophysiology hypoglycemia potentially devastating neuronal insult usually result attempting tight control blood glucose levels insulin hypoglycemic agents 1 6 currently available method preventing hypoglycemia induced neuronal injury clinical setting delivery glucose treatment paradoxically may exacerbate insult the objective present research study molecular mechanisms acute neuropathic pain induced insulin hypoglycemia animal model the expression c fos protooncogene marker nociceptive induced neuronal activity spinal cord 7 8 also determined additionally preventive effects pretreatment coenzyme q10 coq10 hypoglycemia induced neuropathic pain stress sensitive factor expression explored all experiments carried following guidelines protocols animal care use committee university miami protocol approved iacuc committee c57bl/6j mice served controls cba caj mice develop diabetes spontaneously functioned treatment group obtained jackson laboratory bar harbor maine usa all mice approximately 12 14 weeks old comparable young adult humans while cba caj mice spontaneously develop mild hyperglycemia mice yet developed peripheral neuropathy commencement study assessed mechanical testing mice housed groups five plastic cages soft bedding free access food water 12 h/12 h light dark cycle dark cycle 7:00 pm7:00 blood animals glucose measurement obtained via tail tip snip collection initial blood expressed discarded subsequent sample analyzed onetouch glucometer examine effects acute insulin induced hypoglycemia mechanical sensitivity 1 unit kg insulin novolin novo nordisk 2880 bagsvrd denmark injected intraperitoneally treatment group control animals received equal volumes normal saline blood glucose levels mechanical sensitivity tested injection periodically throughout study blood glucose levels recovered normal determine whether insulin insulin induced hypoglycemia cause mechanical hypersensitivity blood glucose levels clamped normal range combined administration insulin 1 unit kg glucose 3.2 g kg intraperitoneal injection the primary reason utilizing intravenous infusion fact mechanical sensitivity measurement unrestricted behavior test presence intravenous access felt interfere measurements louis mo usa dissolved olive oil sigma aldrich concentration 30 mg ml dosed 100 mg kg this dose represents human equivalent doses 8 mg kg based body surface area twice volume 100 l/30 g body weight 20 hr 4 hr induction hypoglycemia the mechanical allodynia test conducted touch test sensory evaluator von frey filaments north coast medical inc the mouse placed wire mesh platform covered transparent glass container period 30 minutes allowed habituation the observation positive response paw lifting shaking licking within five seconds application filament followed application thinner filament thicker one response negative the paw withdrawal threshold measured five times expressed tolerance level grams normal saline injected control mice mice hypoglycemia induced insulin hypoglycemic mice pretreated coq10 sacrificed via overdose nembutal decapitated part samples fixed 4% paraformaldehyde phosphate buffered saline ph 7.4 overnight cryoprotected 0.1 phosphate buffered saline containing 20% sucrose sectioned cryostat 15 thick sections sections incubated overnight 4c primary antibody anti c fos sigma aldrich usa followed biotinylated secondary antibody vector lab usa one hr 22c ensure specificity primary antibody the primary antibody replaced diluent antibody one section set stains exclude nonspecific background staining positive c fos cells counted laminar ii area 280 dorsal horn lumbar spinal cord transverse section laminar ii area shown dotted line figure 4 the half collected samples fresh frozen dry ice stored 80c the levels mrna c fos evaluated rt pcr drg spinal cord tissues extraction total rna carried trizol invitrogen grand island ny usa according manufacturer instructions 1 g rna reverse transcribed 200 u sample superscript ii invitrogen 250 ng reaction random primers promega san luis obispo ca usa the genes c fos amplified 0.1 g aliquots cdna standard pcr buffer 50 mm kcl 1.5 mm mgcl2 10 mm tris hcl ph 8.3 containing 10 pmol forward reverse primers along 0.5 u sample amplitaq dna polymerase applied biosystems grand island ny usa the sequences primer pairs following -actin forward ctagacttcgagcaggagatg reverse caagaaggaaggctggaaaag product 150 bp c fos forward ccagtcaagagcatcagcaa reverse aagtagtgcagcccggagta product 247 bp data presented mean sem analyzed using prism 4 software graphpad software inc san diego ca the behavior test data analyzed two way analysis variance two repeated factors followed tukey multiple comparison test comparison two groups assessed unpaired two tailed student test compared control animals appeared decreased blood glucose levels correlated increased pain insulin treatment group both strains demonstrated significant differences mechanical sensitivity 40 90 150 min insulin injection p 0.05 p 0.001 figure 1 shows decreased withdrawal thresholds mechanical hypersensitivity associated insulin induced acute hypoglycemia strains mice a group normal saline injected mice served control demonstrated changes blood glucose levels mechanical sensitivity indicating handling injection stress affect confound results determine whether insulin alone induces hypersensitivity blood glucose levels clamped normal levels joint insulin glucose injection table 1 demonstrated blood glucose levels two strains mice different situation saline insulin insulin combined glucose linked administration insulin glucose blood glucose levels remained average 123.33 8.55 165.93 10.60 mg dl c57b/6j cba caj mice respectively mice subsequently demonstrated significant change hindpaw withdrawal thresholds figure 2 indicates mechanical hypersensitivity develop blood glucose levels remained normal range insulin injected suggesting insulin involved hypoglycemia induced mechanical hypersensitivity coq10 critical role producing energy antioxidant protection body scenario insulin induced hypoglycemia evaluated whether coq10 could play protective role peripheral nerves figure 3 indicates coq10 affect blood glucose level decrease following insulin injection however pretreatment coq10 prevent development mechanical hypersensitivity insulin induced hypoglycemic mice levels c fos mrna c fos immunoreactivity within spinal cord evaluated insulin induced hypoglycemic mice figure 4 shows c fos positive cells dorsal horn lumbar spinal cord insulin injection increased significantly cell counted analysis positive cells insulin injected group numerous saline injected group p 0.01 rt pcr analysis mrna level c fos insulin injected group almost two times saline injected group p 0.001 student test however pretreatment coq10 partially decreased c fos expression spinal cord rt pcr analysis c fos mrna levels group pretreated coq10 significantly lower insulin injected group p 0.05 studies suggested hypoglycemia induced neuropathy may simply result glucose deprivation rather result multifactorial process involving oxidative stress stress sensitive factors the results present study demonstrate insulin induced hypoglycemia may result acute neuropathic pain increased mechanical sensitivity noted result decreased glycemic levels rather insulin the immunohistological rt pcr results suggest insulin induced hypoglycemia results increased expression stress sensitive pain related factor c fos nerve tissues this turn may mechanism acute pain induced body furthermore results demonstrated pretreatment coq10 prevent hypoglycemia induced mechanical hypersensitivity decrease expression c fos results suggest protective effects coq10 pain sensitivity may related decrease activation spinal pathways mediated inhibition oxidative stress intracellular signaling preventing neuronal injury patients diabetes may face difficult situation tight blood glucose control reduce risk diabetic complications however degree control may also increase risk dangerous hypoglycemic episodes studies estimate 30% diabetics experience serious hypoglycemic episodes annually hypoglycemia potentially devastating effects nervous tissues clinicians described acute severe painful neuropathy occurring intensive treatment patients type 1 type 2 diabetes treated oral hypoglycemic agents insulin 1 11 1933 caravati described neuropathic pain resulting insulin use insulin neuritis however mechanism remains unclear trophic factors cytokines including vascular endothelial growth factor vegf insulin growth factor igf mitogenic cytokine il-8 il-6 tnf- implicated pathogenesis diabetic retinopathy diabetic nephropathy diabetic neuropathy it hypothesized upregulation trophic factors cytokines associated intensive glycemic control responsible early worsening retinopathy acute pain our data suggests c fos immediate early transcription factor involved insulin induced hypersensitivity elevated cytokine levels including interleukin-1 interleukin-6 tumor necrosis factor- associated impaired autonomic function experimental hypoglycemia thus acute treatment diabetes induced neuropathy retinopathy notably intensive glycemic control may common pathophysiological mechanism involves upregulation proinflammatory cytokines this concept also suggests additional hypoglycemia related pathophysiological mechanism provides potential targets therapeutic intervention our data demonstrated combined glucose insulin injections without subsequent hypoglycemic episodes result acute painful neuropathy suggesting insulin induce hypoglycemia induced mechanical hypersensitivity thus acute painful neuropathy concern diabetics also normal subjects experiencing sudden hypoglycemic episodes tight glucose control associated numerous clinical benefits diabetic patients including reduction diabetic neuropathy however type treatment significantly increases risk severe hypoglycemic episodes as demonstrated hypoglycemia may exacerbate neuropathy currently available method preventing hypoglycemia induced neuronal injury clinical setting delivery glucose treatment paradoxically may exacerbate insult this study obvious limitations notably conducted solely mice it difficult extrapolate data lower mammals humans pain many complex elements difficult assess autophagy occurs hypoglycemic peripheral nerves association axonal degeneration regeneration rats models hypoglycemia causes wallerian type axonal degeneration large myelinated nerve fibers peripheral nerve insulin treated diabetic animal models 19 20 neuronal death resulting hypoglycemia involves excitotoxicity dna damage using cortical neuron cultures researchers found application poly(adp ribose polymerase parp-1 endogenous caspase-3 substrate inhibitor increases neuronal survival glucose deprivation additionally rat models insulin induced hypoglycemia shown therapeutic potential papd-1 inhibitors other researches demonstrated coq10 inhibits high glucose induced cleavage papd-1 suggest coq10 prevents oxidative stress induced apoptosis inhibition mitochondria dependent caspase-3 pathway taken together present results indicate pretreatment coq10 prevent hypoglycemia induced mechanical hypersensitivity decrease expression c fos chronic treatment coq10 may scavenge free radicals instantly prevent mitochondrial dysfunction transient hypoglycemia induced tight glucose control diabetics

diabetic neuropathic pain is reduced with tight glycemic control . however , strict control increases the risk of hypoglycemic episodes , which are themselves linked to painful neuropathy . this study explored the effects of hypoglycemia - related painful neuropathy . pretreatment with coenzyme q10 ( coq10 ) was performed to explore the preventive effect of coq10 on hypoglycemia - related acute neuropathic pain . two strains of mice were used and 1 unit / kg of insulin was given to induce hypoglycemia . mechanical sensitivity of hindpaw withdrawal thresholds was measured using von frey filaments . blood glucose levels were clamped at normal levels by joint insulin and glucose injection to test whether insulin itself induced hypersensitivity . results suggest that the increased mechanical sensitivity after insulin injection is related to decreased blood glucose levels . when blood glucose levels remained at a normal level by the linked administration of insulin and glucose , mice demonstrated no significant change in mechanical sensitivity . pretreatment with coq10 prevented neuropathic pain and the expression of the stress factor c - fos . these results support the concept that pain in the diabetic scenario can be the result of hypoglycemia and not insulin itself . additionally , pretreatment with coq10 may be a potent preventive method for the development of neuropathic pain .

estimated 1.0 1.5 million individuals infected human immunodeficiency virus hiv united states majority likely develop acquired immunodeficiency syndrome aids next decade by mid-1988 57,000 cases aids reported centers disease control cdc more one half individuals diagnosed died thousands afflicted aids related complex arc 1991 270,000 individuals diagnosed aids 179,000 died disease projected 1991 alone 145,000 persons aids require medical attention 54,000 die time centers disease control 1988 nationally 64 percent aids cases reported among homosexual bisexual males iv intravenous drug users 18 percent among heterosexual iv drug users 7 percent among homosexual males also iv drug users 4 percent among heterosexual partners high risk groups 2 percent among recipients blood blood products 1 percent among persons hemophilia 3 percent undetermined cause centers disease control 1988 the number cases aids children growing steadily early march 1988 totaled 865 although homosexual bisexual males continue account largest number cases nationwide the disease spreading rapidly among iv drug users blacks hispanics women children aids cases reported 50 states plus puerto rico territories the burden greatest eight states new york california florida texas new jersey illinois pennsylvania massachusetts reporting 1,000 cases most major metropolitan areas experienced impact epidemic notably new york san francisco los angeles although new york many total cases city affected disease san francisco terms burden aids relative total population table 1 the response city county san francisco local aids epidemic described detail elsewhere arno 1986 arno hughes 1987 silverman 1987 early 1981 san francisco department public health dph began coordinate efforts plan develop services respond health care needs growing numbers persons aids pwa city homosexual bisexual males early 1982 dph provided local tax funds board supervisors support aids prevention activities community psychosocial support services late 1982 multidisciplinary aids outpatient clinic established san francisco general hospital sfgh provide screening diagnosis treatment followup education counseling services the first inpatient aids ward united states opened sfgh 1983 last 6 years the city provided substantial level funding wide range medical social services pwa city county san francisco 1988 following list available health supportive services aids screening outpatient services including dedicated clinics practical support daily living emotional support counseling professional counseling hospital advocacy mental health support practical support services addition private physicians fee service practice community hospitals kaiser hospital permanente medical group become increasingly involved care pwa came known san francisco model developed strong public sector leadership exemplary medical care highly mobilized gay community providing volunteer services psychosocial support advocacy early commitment outpatient home community based services rather inpatient hospital care arno hughes 1987 the response aids epidemic public private sectors san francisco generated range medical social psychological housing services meet needs pwa considerable state local resources directed toward development continuum services appropriate complex character disease significant multiple acute chronic dimensions somewhat paradoxically success san francisco developing range services address complex aids care needs produced new set problems planners program managers namely manage care pwa across providers appropriate responsive cost effective ways morrison 1988 this need better manage delivery health social services exacerbated two characteristics aids 1 likelihood precipitous changes physical emotional status throughout course illness resulting frequent changes care needs 2 increased incidence neurological psychosocial problems broadening range complexity care needs like many communities confront aids epidemic san francisco devoted increased attention development case management services pwa order plan monitor care throughout course illness benjamin 1988 case management refers set support activities designed complement various direct services provided persons need especially chronically ill although exists considerable variation definitions models goals associated case management spitz 1987 support activities generally intended reduce inappropriate use inpatient hospital care improve continuity care enhance client quality life community franklin et al 1987 despite widespread equation case management san francisco model aids care emergence formal case management public policy priority san francisco relatively recent development brief examination role case management within local service network suggests least three phases formalization centralization support services the definitions formalization centralization context become clearer phases discussed as suggested earlier striking feature period 1982 1985 development continuum medical social services pwa form public services e.g. inpatient outpatient care private sector care provided public contracting e.g. home health hospice care volunteer services subsidized public funds e.g. housing practical support homemaker food information referral period case management set activities relatively informal decentralized case assessment planning monitoring done dedicated professionals community volunteers pwa moved agency agency early years epidemic hospital discharge planning sfgh one half aids population received acute care was central formal part informal case management network more generally pwa moved one organization another care case management responsibilities assumed professionals organization extent responsibilities centralized this occurred physician large aids caseload and/or volunteer time expertise share role no single case manager assigned follow patient throughout illness plan facilitate access needed services several years this relatively informal decentralized system generally proved successful san francisco variety reasons first sheer number variety medical social support services available pwa reduced likelihood many persons would fall cracks however informal case management might second cadre medical social service professionals dedicated aids care emerged rapidly city group shared philosophy regarding importance home- community based services need help pwa negotiate network services third large number volunteers many drawn local gay community filled roles case advocates increasingly overworked professionals could fourth relatively enlightened political public health leadership took advantage city sound fiscal situation allocated funds public nonpublic aids providers first three conditions reinforced fifth dph administers full range public health medical long term care services able important ways coordinate care within public sector private sector sixth dph governed broadly representative health commission enhances public participation policies programs department seventh city small compact despite growing aids caseload small number core providers among sfgh shanti visiting nurse association hospice san francisco san francisco aids foundation aids health project offered services pwa well known one another thus facilitating informal planning management across agencies time finally number aids cases although large relative communities overwhelm service system early years informal decentralized strategies could succeed this system case management worked well number pwa began increase rapidly 1985 86 point formal still relatively decentralized variants began develop in 1986 various observers began questioning whether pool volunteers san francisco model depended could sustained arno 1986 lee 1987 jenna 1987 whether dedicated professionals could continue coordinate manage care adjunct direct service responsibilities community hospitals including kaiser hospital physicians home care agencies providers became involved aids care informal approaches case coordination became much difficult growth number intravenous drug users homeless among persons aids although still small proportionally along expanded number cases central nervous system involvement increased complexity mainly white homosexual bisexual male caseload city demanded experienced less episodic attention service needs pwa available volunteers the result increased need formalize coordinate case management efforts individual provider agencies plan centralized system communitywide aids case management future the case sfgh currently provides excellent care one third inpatient outpatient pwa city illustrates strengths limits current case management efforts the highly esteemed designated inpatient unit outpatient clinic sfgh developed significant capacity hospital discharge planning followup pwa multidisciplinary discharge planning sfgh begins point inpatient admission earlier i.e. outpatient clinic the public health department helped established formal agreements public hospital community care providers facilitate coordinated care outside hospital weekly case conferences sfgh involving many community providers volunteers enhanced case planning coordination hospital currently utilizes 40 acute care beds aids patients provides 2,000 outpatient visits per month however sustained case management activities must limited primarily acute episode immediate aftermath rather entire period illness although hospital post hospital period may well difficult many pwa represents 10 percent less duration illness because even excellent hospital discharge planning circumscribed scope impact therefore activities need articulated broader system case management kaiser permanente largest health maintenance organization region currently enrolls nearly one third pwa san francisco time that kaiser become major provider aids care sought avoid designation carrier choice pwa adverse selection might follow favorable publicity kaiser provide expanded service package aids although flag catastrophic cases provide contract services reduce hospital use case management services offered pwa persons severe arc kaiser service package limited e.g. home care services covered case managers focus upon locating resources including local programs medi cal medicaid pay and/or provide needed services plan members as sfgh case management attention given primarily hospital discharge activities especially arranging referrals nonplan providers one goals case management sfgh kaiser community hospitals reduce utilization inpatient care planning coordination care provided outside hospital in addition enrolled kaiser health plan one third san francisco aids population covered private insurance least part illness blue cross prudential aetna third party insurers share interest limiting hospital use managing medical care reduce costs most insurers established mechanisms flagging catastrophic cases offering case management potentially costly enrollees aids tends included general process like kaiser insurers pursue home community based alternatives acceptable client considered cost saving potential however care reimbursement provided tends limited skilled medical services few insurers california planning develop aids specific case management efforts outside broader mechanisms addressing catastrophic illness as suggested earlier striking feature period 1982 1985 development continuum medical social services pwa form public services e.g. inpatient outpatient care private sector care provided public contracting e.g. home health hospice care volunteer services subsidized public funds e.g. housing practical support homemaker food information referral period case management set activities relatively informal decentralized case assessment planning monitoring done dedicated professionals community volunteers pwa moved agency agency early years epidemic hospital discharge planning sfgh one half aids population received acute care was central formal part informal case management network more generally pwa moved one organization another care case management responsibilities assumed professionals organization to extent responsibilities centralized occurred physician large aids caseload and/or volunteer time expertise share role no single case manager assigned follow patient throughout illness plan facilitate access needed services several years this relatively informal decentralized system generally proved successful san francisco variety reasons first sheer number variety medical social support services available pwa reduced likelihood many persons would fall cracks however informal case management might second cadre medical social service professionals dedicated aids care emerged rapidly city group shared philosophy regarding importance home- community based services need help pwa negotiate network services third large number volunteers many drawn local gay community filled roles case advocates increasingly overworked professionals could fourth relatively enlightened political public health leadership took advantage city sound fiscal situation allocated funds public nonpublic aids providers first three conditions reinforced fifth dph administers full range public health medical long term care services able important ways coordinate care within public sector private sector sixth dph governed broadly representative health commission enhances public participation policies programs department seventh city small compact despite growing aids caseload small number core providers among sfgh shanti visiting nurse association hospice san francisco san francisco aids foundation aids health project offered services pwa well known one another thus facilitating informal planning management across agencies time finally number aids cases although large relative communities overwhelm service system early years informal decentralized strategies could succeed this system case management worked well number pwa began increase rapidly 1985 86 point formal still relatively decentralized variants began develop 1986 various observers began questioning whether pool volunteers san francisco model depended could sustained arno 1986 lee 1987 jenna 1987 whether dedicated professionals could continue coordinate manage care adjunct direct service responsibilities community hospitals including kaiser hospital physicians home care agencies providers became involved aids care informal approaches case coordination became much difficult growth number intravenous drug users homeless among persons aids although still small proportionally along expanded number cases central nervous system involvement increased complexity mainly white homosexual bisexual male caseload city demanded experienced less episodic attention service needs pwa available volunteers the result increased need formalize coordinate case management efforts individual provider agencies plan centralized system communitywide aids case management future the case sfgh currently provides excellent care one third inpatient outpatient pwa city illustrates strengths limits current case management efforts the highly esteemed designated inpatient unit outpatient clinic sfgh developed significant capacity hospital discharge planning followup pwa multidisciplinary discharge planning sfgh begins point inpatient admission earlier i.e. outpatient clinic the public health department helped established formal agreements public hospital community care providers facilitate coordinated care outside hospital weekly case conferences sfgh involving many community providers volunteers enhanced case planning coordination hospital currently utilizes 40 acute care beds aids patients provides 2,000 outpatient visits per month however sustained case management activities must limited primarily acute episode immediate aftermath rather entire period illness although hospital post hospital period may well difficult many pwa represents 10 percent less duration illness because even excellent hospital discharge planning circumscribed scope impact therefore activities need articulated broader system case management kaiser permanente largest health maintenance organization region currently enrolls nearly one third pwa san francisco time kaiser become major provider aids care sought avoid designation carrier choice pwa adverse selection might follow favorable publicity kaiser provide expanded service package aids although flag catastrophic cases provide contract services reduce hospital use case management services offered pwa persons severe arc kaiser service package limited e.g. home care services covered case managers focus upon locating resources including local programs medi cal medicaid pay and/or provide needed services plan members as sfgh case management attention given primarily hospital discharge activities especially arranging referrals nonplan providers one goals case management sfgh kaiser community hospitals reduce utilization inpatient care planning coordination care provided outside hospital in addition enrolled kaiser health plan one third san francisco aids population covered private insurance least part illness blue cross prudential aetna third party insurers share interest limiting hospital use managing medical care reduce costs most insurers established mechanisms flagging catastrophic cases offering case management potentially costly enrollees aids tends included general process like kaiser insurers pursue home community based alternatives acceptable client considered cost saving potential however care reimbursement provided tends limited skilled medical services few insurers california planning develop aids specific case management efforts outside broader mechanisms addressing catastrophic illness by indications next stage evolution case management san francisco development centralized case management attempts bridge services provided single agencies organizations individuals the availability last 2 years state federal funding support case management initiatives reinforced local efforts formalization encouraged trends toward centralization the department public health san francisco received demonstration grant 1986 office aids california department health services provide home care case management services small number pwa the success modest initiative placed emphasis service subsidies data collection case management led city apply substantial funding state support development centralized case management system proposal still pending state level california department health services seeking home community based waiver medi cal eligible pwa strong provisions local centralized case management included pending application both initiatives stimulated planning new approaches case assessment coordination monitoring the case management program additional funding sought state office aids designed establish case management capacity city dph expected serve pwa referred sfgh district health centers community hospitals including kaiser physicians private practice community government agencies family members friends self referrals the proposed program initially support two case management teams follow 40 aids arc patients time initial inpatient admission referral course illness directed public health nurse assistance medical social worker team responsible conducting initial ongoing needs assessment ensuring access appropriate services the experience san francisco organizing managing delivery aids care leaves various questions unanswered regarding case management system design financing the aids provider community san francisco remains split merits centralized case management relatively small city relatively abundant services strong provider networks the centralization case management dph moreover may require adjustment established interagency linkages administrative cost participants on hand centralized case management may essential communities similar resource collaborative conditions exist although san francisco embraced come known brokering model case management case management involves gaining access coordinating existing services communities fewer available aids services adopted direct service model wright sklebar heiman 1987 case managers plan care directly provide services otherwise available pwa latter model caseloads must necessarily smaller brokering model case management costs likely higher pressures ration care greater need centralized administration obvious although everyone endorses team approach principle participants differ terms commitment medical versus social case management models usually form nurse versus social worker terms extent professional training needed i.e. bachelor masters level arguments sides usually involve types services emphasized cost staffing case management system an additional issue concerns scope case management specifically whether case managers reasonably expected foster interagency coordination areas rare e.g. psychosocial mental health medical care circumstances professionals trained manage care individual pwa confront need alter institutional relationships order successful such change may result efforts institutional leadership case managers case management san francisco many communities designed primarily address needs largest subpopulation pwa locales i.e. homosexual bisexual men it likely case management approaches adapted different aids populations system designed gay white males unlikely appropriate minority male female intravenous drug users ivdu children also infected least know latter population accompanied network volunteers specialized services established gay organizations various communities various behavioral problems associated drug use make planning monitoring care difficult demonstration waiver programs new jersey new york cities large numbers ivdu aids cases may cast light elements case management appropriate aids population special state funded initiatives prospective medicaid waivers currently represent primary sources funding case management services payment case management continues provided exceptional circumstances established routine sources funding may needed case management play significant role aids care case management succeeded san francisco many services needed pwa available case managers coordinate without additional funding services significantly long term care services as number aids cases grows fiscal burden aids care governments especially local ones increases important also recognize funding indirect services like case management likely reduced harder direct services absence clear understanding case management and which goals serves spitz 1987 price policy choices difficult assess the literature case management chronically ill elderly mentally ill others needing wide range medical social support services raises serious questions regarding capacity case management reduce inpatient hospital utilization reduce costs capitman haskins bernstein 1986 kemper et al in many cities aids lengths stay twice san francisco planners remain hopeful nonetheless introduction case management reduce dependence inpatient care coordinated use outpatient home community services although many factors besides case management explain shorter length stay san francisco scitovsky cline lee 1986 arno hughes 1987 remains reason believe communities aids may prove exception prior findings limited impact case management demonstrating services shorten hospital stays thus reduce overall costs caring persons aids

the acquired immunodeficiency syndrome ( aids ) epidemic represents a growing challenge for the health care system and for case management models applied to persons with aids . the experience of san francisco highlights some of the issues involved in developing a case management system appropriate to the needs of persons with aids , as well as providers , and payers . dramatic growth in the size and complexity of the aids caseload and the involvement of public , health maintenance organization , and community providers has required the increasing formalization and centralization of case management roles . persistent questions about the definition and goals of case management complicate development of these services .

obesity considered major health problem prevalence increased dramatically last decades corresponding 36.9% men 38.0% women worldwide obesity usually accompanied diseases common type 2 diabetes mellitus t2d insulin resistance ir cardiovascular complications moreover other metabolic consequences related nonalcoholic fatty liver disease nafld even many cancers although obesity unique problem metabolic syndrome becoming common due rise obesity rates among adults last years number people diabetes mellitus increased massively raising prevalence worldwide focus western societies economically advanced countries increase 50% 2030 become one important public health challenges globally although great advances made understanding mechanisms involved pathogenesis t2d still fully elucidated currently effective therapy weight loss including lately accepted bariatric surgery last knowledge effectiveness physical activity able decrease specific visceral fat increasing fat free mass adipose tissue key regulator energy balance playing active role lipid storage buffering synthesizing secreting wide range endocrine products circulating blood influence systemic metabolism a classical paradigm fact adipose tissue higher prevalence metabolic diseases relationship interested researchers however certain inconsistencies found example extremely obese people diabetic overweight people develop severe ir diabetes this suggests absolute amount fat stored may important factor determining relationship obesity diabetes obesity related adverse health consequences therefore appear related fat distribution rather total amount fat there many theories linked obesity simplest excess energy lipids intake recent gut microbiota 15 16 interesting theory focused limit functional capacity adipose tissue capacity exceeded metabolic disorders occur this suggests factor linking obesity diabetes associated comorbidities may absolute amount fat accumulated mismatch energy surplus storage capacity this new vision places adipose tissue level vital organs one speak heart liver kidney failure the aim review better understand adipose tissue organ reviewing influence variables govern ability expand influence development ir diabetes associated obesity mainly based studies undertaken research team last years fat accumulation determined balance fat synthesis lipogenesis fat breakdown lipolysis fatty acid oxidation lipogenesis encompasses processes fatty acid synthesis triglyceride synthesis takes place liver adipose tissue it long accepted primary function adipocytes store fuel distribution nonadipose tissues times need adipose tissue also important site endogenous fatty acid synthesis although lipogenesis tissue considered low less liver excessive hepatic lipogenesis hallmark feature many models obesity diabetes although causal relationship tissue lipid accumulation insulin resistance unclear some feasible reasons relationship nafld endoplasmic reticulum er stress role free fatty acids ffa ceramides lipogenesis thought relatively minor contributor whole body lipid stores present day human consuming typical high fat diet nevertheless special situations high carbohydrate diet total body fat synthesis significantly exceeds de novo lipogenesis it well recognized adipose tissue storage capacity fatty acids prevents lipotoxicity tissues however adipose tissue buffering impaired obesity defects ability adipose tissue respond rapidly thus lipogenic pathway suggested downregulated obesity least gene expression level although early obesity increase lipogenic gene expression store fat rapidly long term obese subjects expression decreases perhaps due late adaptive process aimed limiting development fat mass a possible explanation reversal storage capacity adipocytes reached cells reduce ability synthesize additional fatty acids following natural inhibitory feed back process thus changes lipid storing capacity lipid mobilization processes adipocytes represent important elements adipose tissue dysfunction many factors involved action although focus research team working figure 1 last years widely known others shown novel approach gene expression patterns play key role determining pathogenesis candidate genes t2 dm obesity 30 31 first step transcription function cascade peroxisome proliferator activated receptor- ppar regulator adipogenesis lipogenesis considered important regulator processes the behavior ppar long recognized clinical pathological observational case studies the activation ppar leads adipocyte differentiation fatty acid storage whilst represses genes induce lipolysis release free fatty acids ffa adipocytes failure metabolism molecule leads dysregulation optimal lipid storage mobilization main problem obesity normal conditions ppar mrna expression highest postprandially activation leads upregulation genes mediate fatty acid uptake trapping ensuring storage relocalization excess triacylglycerol moreover ppar direct role transcriptional control specific functional nodes lipolytic axis protein kinase pka complex on the hand subjects ir obesity reduced ppar expression fasting postpandrially 35 36 morbidly obese patients patients diabetes lower expression ppar2 mrna comparison morbidly obese insulin sensitive patients vat muscle this closely associated storage capacity adipose muscle tissues mismatch energy surplus storage capacity adipose tissue muscle tissues possibly important factor linking obesity ir this lower expression also found ppar ppar2 mrna peripheral blood mononuclear cells high fat meal morbidly obese humans patent insulin resistant indicating altered response individuals on hand another important molecule process fatty acid synthase fasn central enzyme de novo synthesis long chain saturated fatty acids key enzyme lipogenesis so point concerning carbohydrate metabolism disorders obesity demonstrated adipose fasn gene expression closely related hyperglycemic state higher normoglycemic individuals compared hyperglycemia in addition also demonstrated significant decrease fasn expression hypertensive individuals pronounced obese patients another protein recently studied zinc-2 glycoprotein zag protein expressed mature adipocytes vat sat involved body weight control lipid mobilizing activity via interaction 3-adrenoreceptors suggesting role lipid catabolism previous vivo studies showed zag induces loss body weight overweight obese animals specific depletion carcass fat studying extreme form obesity found inverse relationship zag expression body mass index we suggested zag may involved regulation lipid metabolism due different expression vat sat different relation genetic expression lipolytic enzymes another way address issue of the loss lipogenic capacity individuals ir compensation loss tissues organs adipose tissue for instance fatty acid binding protein 4 fabp4 protein linked insulin sensitivity lipid metabolism inflammation described important mediator crosstalk adipocytes macrophages adipose tissue we suggested adipose tissue liver may act balanced manner depending ir status decrease fabp4 expression observed adipose tissue metabolically obese patients versus metabolically healthy humans opposite takes place liver increase fabp4 expression metabolically obese patients ir status important determinant tissue expression another orphan nuclear receptor associated ir studied laboratory retinoic acid receptor related orphan nuclear receptor 1 ror1 also expressed human adipose tissue ror1 important role adipogenesis glucose homeostasis modulating glucose uptake promoting adipogenesis subjects obesity high degree ir clear rise gene protein expression ror1 receptor adipose tissue especially visceral depot this suggests ror1 may added list nuclear receptors adipose tissue could used modulate ir associated obesity stearoyl coa desaturase-1 scd1 endoplasmic reticulum bound enzyme converts different saturated fatty acids mono unsaturated fatty acids studying regulation scd1 particular interest since alterations composition phospholipids implicated variety diseases including cancers diabetes cardiovascular disorders mice targeted disruption scd1 gene resistant diet induced weight gain accord results we reported scd1 morbidly obese patients related obesity ir raised scd1 protein level vat sat morbidly obese patients a recent collaboration found adaptive response compensate antilipogenic effect associated ir maintaining lipid desaturation preferential scd1 regulation facilitating fat storage adipose tissue another example regulated molecules obesity rab18 gtpase found regulate intracellular membrane bidirectional trafficking lipids lipid droplets involved mechanism release lipids lipid droplets adipocytes rab18 overexpression increased basal lipogenesis rab18 silencing impaired lipogenic response insulin suggesting protein promotes fat accumulation adipocytes performing activity endoplasmic reticulum hand evidence participation rab18 regulation lipolysis via -adrenergic pathway moreover obesity associated increase rab18 expression suggests upregulation gtpase may appropriate response managing energy excess adaptive response overcome alterations lipid metabolism occurring obesity this participation regulation lipid processing adipose tissue takes place normal pathological conditions and finally finished breast cancer 1 brca1 good example protein important role lipogenic lipolysis pathways involved relationship obesity associated metabolic pathologies brca1 protein involved multiple cellular functions including dna repair cell cycle checkpoint control transcription associated dna damage reported breast ovarian cancers ubiquitination activity developed thanks heterodimer bard1 among others it suggested brca1 helps maintain fatty acid biosynthesis lipogenesis control this supported findings laboratory showing increased brca1 expression adipose tissue adipogenesis mirror effects lipogenic enzymes acetyl coa carboxylase acc fasn on hand brca1 found regulated adipose tissue obese subjects independently whether t2d suggest crosstalk brca1 lipogenesis adipogenesis obesity obesity associated ir thus taking together increased expression brca1 gene reduced expression many lipogenic factors could interpreted process cells reduce ability synthesize additional fatty acids limit storage capacity adipocytes attained adipose tissue suggested considered another vital organ mainly due endocrine properties adipocytes main units adipose tissue tissue considered control whole body metabolism dysregulation huge consequences health adipose tissue dysfunction thought major factor leading whole body ir beyond expandability adipose tissue adipose tissue dynamic much 10% fat cells die renewed every year lipid excess results increased adipocyte size hypertrophy increased numbers adipocytes hyperplasia seen enlarged sat vat figure 2 as noticed metabolic functional differences adipose tissue depots sat recognized safest tag depot first receive excess lipids whereas visceral deposition occurs sat capacity exceeded thus vat greater capacity generate free fatty acids uptake glucose sat avid absorption circulating free fatty acids triacylglycerols hand different impact subcutaneous visceral fat cell sizes lipid glucose insulin profiles observed so mean fat cell size associated metabolic complications systemic adipose inflammation morbid obesity region specific influence large visceral fat cells strongly linked dyslipidaemia whereas large subcutaneous fat cells correlate impaired glucose metabolism hyperinsulinaemia insulin resistance thus veilleux et al suggested vat sat adipocyte hypertrophy associated altered lipid profile independent body composition fat distribution women these differences may determinant development obesity related disorders ir important factor linking vat cardiovascular risk whereas states low ir expression enzymes lipogenic lipolytic pathways greater sat facilitating triglyceride fatty acid cycling however large interindividual variability observed adipocyte size given adiposity level suggests tendency fat cell hypertrophy fat compartment may differ among individuals although may seem incongruent strategies increase capacity adipose tissue store lipid therefore make individuals obese may fact confer metabolic benefits allowing adipose tissue store lipids may prevent secondary metabolic complications caused lipids deposited nonadipose organs thus ability adipose tissue expand match storage needs energy surplus may key determinant protection metabolic syndrome associated obesity it therefore important understand signaling factors control adipose tissue expansion the wnt family known control adipocyte differentiation several members wnt family shown inhibit early steps adipogenesis conversely endogenous inhibitors wnt signaling found promote generation adipocytes one group extracellular wnt antagonists secreted frizzled related proteins sfrps also known secreted apoptosis related proteins sarps least five structurally similar sfrps identified obesity it observed mrna levels sfrp1 4 sfrp5 altered finding sfrp1 sfrp2 sfrp4 adipokines expressions correlated insulin sensitivity however demonstrated setting obesity sfrp5 secretion adipocytes exerts salutary effects metabolic dysfunction controlling inflammatory cells within adipose tissue hand there limited evidence support role endogenous sfrp1 physiological and/or pathological development human obesity metabolic syndrome accordingly collaboration team lagathu et al suggested model adipose tissue expansion characterized upregulation sfrp1 early stages obesity this elevation sfrp1 could inhibit wnt signaling therefore facilitate adipose tissue expansion allowing nutrient storage demands met further weight gain results sfrp1 levels falling back values lean subjects limiting adipogenesis increased wnt/-catenin signaling compromising adipose tissue expansion figure 3 nevertheless new factors discovered induce adipogenesis thyroid hormone responsive spot 14 thrsp s14 another specific factor whose gene expression protein levels lipogenic tissues strongly linked glucose thyroid hormone insulin glucose directly associated adipogenesis human adipocytes inversely related obesity omental fat accumulation the great revolution study adipose tissue though isolation characterization adipose tissue derived multipotent stem cell population ho msc this opened new possibilities especially concerning study multipotent stem cell population resident adipose tissue affected contributes tissue dysfunction isakson et al observed preadipocytes obese individuals present reduced adipogenic potential correlating increasing bmi cleveland donovan et al observed alterations proliferative ability impaired cell cycle activation accordance observations demonstrated association obesity loss stemness ho msc population featured impaired multilineage differentiation potential stem cell regulatory network ho mscs obese subjects greater senescence senescence increased degree obesity rises thus obese subjects lower differentiation capacity ho msc adipose bone tissue several molecular pathways may explain refractory response ho mscs morbidly obese patients differentiation in summary despite potential genetic disposition force adipogenic cell fate upregulation ppar combination dysregulated genes mainly members notch shh foxa2 foxc2 inhibitors adipogenic differentiation mirnas mirna23b mir27b ppar cebp repressors wnt activators mir103 mirna542 5p mirna320 involved wnt dependent inhibition adipogenesis among others may cause block inducing failure enter and/or progress adipogenic fate thus ho mscs morbidly obese subjects impaired capacity expand differentiate features this reflected called adipose tissue expandability hypothesis pathological expansion abdominal adipose tissue morbid obesity reaches threshold characterized inability adipose tissue expand capacity recruit new adipocytes exhausted this associated metabolic complications ir due ectopic deposition excess lipid nonadipose tissue apoptosis fundamental mechanism homeostasis mammalian tissues linked variety disorders apoptosis form programmed cell death occurs certain physiological pathological conditions common mechanism cell replacement tissue remodeling elimination damaged cells the dysregulation process suggested contribute obesity differences regional fat distribution lipodystrophy recently relationship adipose tissue inflammation apoptosis proposed 85 86 although apoptosis adipose tissue still relatively poorly studied phenomenon many proapoptotic antiapoptotic molecules mediated apoptosis achieving homeostasis mammalian tissues modulation apoptosis emerging promising antiobesity strategy removal adipocytes process result reducing body fat two main families involved apoptosis caspases b cell lymphoma 2 bcl2 proteins recently found increase proapoptotic casp3/7 gene expression decrease antiapoptotic bcl2 gene expression adipose tissue vat sat increase body fat mass moreover vitro studies demonstrated culture proinflammatory factors adipocytes increases apoptotic pathway these phenomena could consequence obesity induced inflammation thus linked results state ir changes paralleled increase gene expression inflammatory cytokines tnf- il-6 macrophage infiltration markers many markers associated apoptosis mainly inflammation proapoptotic others antiapoptotic properties a multifunctional proapoptotic cytokine belonging tnf superfamily named tnf like weak inducer apoptosis tweak controls many cellular activities emerged new player inflammatory process tweak receptor fn14 upregulated severe obesity modulation microenvironment infiltrated macrophages hypoxia recent collaboration found decrease soluble form tweak severely obese patients may favor proinflammatory activity tnf the latest studies shown trail tnf- tumor necrosis factor- related apoptosis inducing ligand ameliorates natural history diabetes mellitus associating changes induced significant reduction proinflammatory cytokines modulation adipose tissue gene expression apoptosis thus circulating trail levels may indicate severity t2d low circulating levels may precede onset t2d whereas higher levels soluble trail may indicate chronic t2d moreover binding trail r2 trail activates cleavage caspase-8 caspase-3 turn cleaves inactivates ppar. causes changes gene expression lipogenic genes glut4 fasn acc finally leads inhibition insulin stimulated glucose uptake lipogenesis this reduction ppar also reduces adipocyte differentiation consistent study bernardi et al attributed improvement metabolic abnormalities t2d following trail treatment effect adiposity might influenced proinflammatory cytokines levels glucose metabolism adipose tissue highly vascularized adipocyte nourished extensive capillary network thus adipose tissue expansion linked development vasculature however hypertrophy increase vascularization happen parallel molecular mechanisms switching angiogenic phenotypes healthy pathological tissues involve imbalanced production overlapping angiogenic factors inhibitors it documented abnormalities angiogenesis may contribute pathogenesis diabetes complications the vascular endothelial growth factor vegf receptors play crucial role angiogenesis vasculogenesis vegf also recognized potent stimulator endothelial proliferation migration moreover noticed signaling needed adequate adipose tissue function white adipose tissue produces secretes many different types proangiogenic factors vegf vegf b two key angiogenic factors produced adipocytes other adipose tissue derived factors proangiogenic properties include vegf c vegf found important proper formation maintenance lymphatic network overexpression vegf resulted increased blood vessels number size white brown adipose tissues laboratory much interest generated finding morbidly obese subjects low insulin resistance higher adipose tissue vegf levels obese subjects high insulin resistance hypothesizing upregulation vegf adipose tissue could relationship ir believing upregulation compensatory mechanism replaces reduction vegf b vegf c vegf other complications derived diabetes include dyslipidemia atherosclerosis vegf also related disorders vegf c rather vegf closely related the data presented paper however little portion problem old trends tended focus one part know everything much complex obesity single cause due obesity part major problem metabolic syndrome moreover comorbidities diabetes cardiovascular diseases reason must try understand problem complicated network pathways related work we focused pathologies associated adipose tissue failure molecular approach tiny part story thus summing many genes related obesity comorbidities t2d pparg continues central actor scene dysfunction many others recognized part cause development diseases belong lipogenesis pathway fasn fabp4 scd1 others used associated roles zag rora1 rab18 brca1 roles dysfunction emerging but lipogenesis process involved crucial processes normal function adipose tissue adipogenesis apoptosis angiogenesis necessary processes help adipose tissue expansion order avoid future metabolic disturbances caused excess fatty acids sfrp1 spot14 two genes influenced weight gain involved adipogenesis whose overexpression protects metabolic disturbances however noticed morbidly obese patients process endangered way occurs caspases bcl2 proteins tweak trail concerning apoptosis vegf family case angiogenesis also deregulated morbidly obese patients increase fat therefore although obesity mainly related perturbations balance food intake energy expenditure factors must nevertheless considered figure 4 present many hypotheses developed trying explain causes adipose tissue hypertrophy hyperplasia a hot topic example relationship gut microbiota nowadays growing interest elucidating microorganisms help aggravate problem various mechanisms proposed explain influence microbiota metabolic disorders metabolic endotoxemia modifications secretion incretins butyrate production metabolic endotoxemia generated lipopolysaccharides lps endotoxins commonly found outer membrane gram negative bacteria these lps absorbed enterocytes conveyed plasma coupled chylomicrons aggravating inflammation way dietary fats associated increase absorption lps related changes gut microbiota another recent theory hypoxia could new potential risk factor chronic inflammation obesity the hypoxia able induce inflammation adipose tissue induction gene expression adipocytes macrophages it believed local inflammation produced hypoxia may serve physiological signal angiogenesis remodeling extracellular matrix adipose tissue although inflammation control promote insulin resistance locally systemically obesity the enlargement vascular network sufficient supply enough oxygen adipocytes local hypoxia occurs hypoxia could key trigger adipose tissue dysfunction obesity hypoxia appears clusters adipocytes become distant vasculature adipose tissue expands it established mice deletion vegf ad adipose vascular density reduced adipose hypoxia transgenic mice vegf adtg increased adipose vasculature reduced hypoxia indicating important role played vegf phenomenon obesity increases risk t2d induction insulin resistance link established many factors inflammation mitochondrial dysfunction hyperinsulinemia lipotoxicity consensus mechanism insulin resistance inflammation could seen best candidate however inflammation good target treatment insulin resistance corroborated clinical trials but noticed none exposed theories explain complications metabolic disorders reason none led development effective drugs therapies information must taken account together trying understand process interferes final status better understanding role parts orchestra give us capacity understand relationships therefore way level act obtain best response

obesity is considered a major health problem . however , mechanisms involved and its comorbidities are not elucidated . recent theories concerning the causes of obesity have focused on a limit to the functional capacity of adipose tissue , comparing it with other vital organs . this assumption has been the central point of interest in our laboratory . we proposed that the failure of adipose tissue is initiated by the difficulty of this tissue to increase its cellularity due to excess in fat contribution , owing to genetic or environmental factors . nevertheless , why the adipose tissue reduces its capacity to make new adipocytes via mesenchymal cells of the stroma has not yet been elucidated . thus , we suggest that this tissue ceases fulfilling its main function , the storage of excess fat , thereby affecting some of the key factors involved in lipogenesis , some of which are reviewed in this paper ( ppar , ror1 , fasn , scd1 , rab18 , brca1 , zag , and fabp4 ) . on the other hand , mechanisms involved in adipose tissue expandability are also impaired , predominating hypertrophy via an increase in apoptosis and a decrease in adipogenesis and angiogenesis . however , adipose tissue failure is only part of this great orchestra , only a chapter of this nightmare .

intestinal pseudo obstruction ipso defined ineffective intestinal propulsion occurs absence mechanical obstructive factors 1 cases ipso primary clinical feature typically associated connective tissue diseases however ipso presenting first manifestation systemic lupus erythematosus sle rare 30 cases ipso patients sle reported 14 clinical features generally include severe abdominal symptoms distension pain nausea vomiting radiographic signs show gaseous small bowel distension air fluid levels acute lupus pneumonitis alp uncommon pulmonary manifestation sle lung involvement reported 3% sle patients 5,6 alp unusual life threatening complication sle usually presents acute onset fever cough tachypnea hypoxia the radiological sign alp consolidations one areas often associated pleural effusion pulmonary arterial hypertension the majority alp responds steroids requires treatment cyclophosphamide however rate mortality remains high 5,7 ipso alp occurring single patient described co manifestation sle reported previously herein report case ipso initial presentation sle secondary onset alp occurred emergency surgery a 26-year old female complaining abdominal pain nausea vomiting constipation 1 day admitted emergency room second affiliated hospital zhejiang university hangzhou china june 2013 physical examinations showed distress countenance soft abdomen absence bowel sounds abdominal tenderness rebound tenderness 1a white blood cell wbc count hemoglobin hgb erythrocyte sedimentation rate esr c reactive protein crp urinalysis normal computed tomography ct scanning showed jejunal wall thickened streaky fig the patient thought strangulated intestinal obstruction emergency laparotomy performed operation ~80 cm jejunum showed hyperemia edema multiple petechiae serosal surface lymph node enlargement mesentery in addition ~800 ml turbid peritoneal fluid detected bowel perforation peritoneal lavage segmental resection diseased jejunum placement jejunostomy fistula performed pathological examination jejunum using hematoxylin shanghai bioscience technology co. ltd shanghai china eosin shanghai sss reagent co. ltd shanghai china h&e staining showed chronic inflammation intestinal mucosa submucosal anapetia congestion hemorrhage interstitial edema post operatively intestinal peristalsis recover gastrointestinal decompression tube placed duodenum apart bowel problem sporadic rashes mild fever without clear origin appeared following anti infective treatment ceftazidimine 2.5 g intravenous injection q.8.h hainan haling chemipharma corporation ltd haikou china careful nursing electrocardiograph monitoring mp 30 philips medical systems b.v 10 days patient demonstrated clinical improvement abdominal pain relieved patient experienced chills nausea vomiting vital signs stable discharged after 5 days patient readmitted due high fever 39.2c upper abdominal pain nausea vomiting particularly fatty meal abdominal x ray ct scanning somatom sensation 16 siemens ag munich germany revealed sporadic air fluid levels intestinal wall thickness fig 2 anti infective treatment cefoperazone sulbactam 1.5 g intravenous infection q.12.h pfizer inc new york ny usa administered ineffective multiple rashes lower extremities appeared fourth day laboratory examinations showed rheumatoid factor 20.4 iu ml increased antinuclear antibody 1:320 increased esr 26.00 mm h increased anti ribonucleoprotein antibody strong anti smith antibody strong anti sjogren syndrome antibody strong anti sjogren syndrome b antibody weak antibodies double stranded dna detected complement c3 0.39 g l decreased crp 7.0 mg l normal wbc 2.510/l decreased hgb 89 g l decreased furthermore patient experienced hair loss multiple red rashes response strong sunlight previous year sle lupus related ipso diagnosed according american college rheumatology criteria 1997 8) systemic lupus erythematosus disease activity index sledai score 10 8) the patient treated 2 mg kg day methylprednisolone pfizer inc general condition improved 2 days however patient sudden onset fever 40.4c dyspnea oxygen saturation sao2 87% arterial blood gas analysis revealed ph 7.409 pco2 33.6 mmhg po2 83.9 mmhg further laboratory examination showed glutamic pyruvic transaminase 436 u l increased glutamic oxaloacetic transaminase 740 u l increased k 3.36 mmol l decreased wbc hgb crp urinalysis normal chest ct lungs showed ground glass appearance uneven density interlobular septal thickening bilateral hydrothorax fig anti infective treatment imipenem cilastatin 0.5 g intravenous injection q.8.h administered 3 days however fever dyspnea alleviated a comprehensive infectious work blood sputum urine cultures negative bronchoalveolar lavage bal olympus bx43 olympus corporation tokyo japan examination affected areas also negative gram positive negative bacteria viral infections fungal infections acid fast bacilli hemosiderin laden macrophage the erythematous rash accentuated pathological biopsy results using h&e staining showed subcutaneous fibrous tissue hyperplasia inflammatory cell infiltration fig 3c alp finally diagnosed high dose 1 g day methylprednisolone gamma globulin therapy administered 3 days treatment this therapy followed 2 mg kg day methylprednisolone maintenance treatment glycyrrhizin minophagen pharmaceutical co. ltd repeat chest ct scan showed significant improvement long term tapering period stopping corticosteroids methylprednisolone pfizer inc patient recovered well relapse detected the present study presents rare case ipso initial presentation sle secondary onset alp emergency surgery best knowledge previous reports ipso alp occurring single patient ipso defined presence clinical features suggesting intestinal obstruction without organic obstruction 9 present case the clinical manifestations ipso include abdominal pain nausea vomiting absence bowel sounds may include constipation fever 4 an x ray ct scan frequently show air fluid levels thickening small and/or large intestinal wall ipso may first manifestation sle patients however usually represents complication case series described literature 1,2,10 ipso easily confused mechanical intestinal obstruction represents diagnostic challenge surgeon ureterohydronephrosis highly associated ipso sle 1,4,10 repeated urinalysis examination results negative ureterohydronephrosis occur patient the pathophysiology ipso secondary sle remains unclear 9 although hypotheses suggested dysmotility due primary myopathy secondary immune complex mediated vasculitis 11 the pathological characteristics gastrointestinal tract chronic intestinal pseudo obstruction cipo patients include widespread myocyte necrosis severe atrophy fibrosis muscularis layer active serositis serosal thickening fibrosis little evidence vasculitis injury 11,12 present aipo case the pathological results jejunum showed muscle layer atrophy submucosal anapetia congestion hemorrhage therefore present case supports hypothesis clinical features aipo sle patients appear result primary intestinal smooth muscle myopathy similar cipo alp uncommon 112% manifestation may life threatening complication sle 12 the clinical features alp characterized acute onset fever cough pleurisy dyspnea the key radiographic manifestation majority cases pulmonary infiltration appears ct scan ground glass honeycomb appearance 5,13 the diagnosis alp essential exclude causes lung infiltration particularly infective pneumonia 7 present case infective pneumonia excluded comprehensive infectious work negative anti infective treatment ineffective diffuse alveolar hemorrhage excluded negative results hemosiderin laden macrophage bal fluid alp finally diagnosed syndrome acute reversible hypoxemia abnormal results ct scan exclusion causes lung infiltration the pathophysiology alp based acute injury alveolar capillary units pulmonary vasculature 7 alp typically occurs active stage sle may partially explain mortality alp ~50% even treated large doses steroids 14 emergency surgery shown independent risk factor increasing complication rate morbidity sle patients 15,16 present case although sledai score 10 alp occurred may explained emergency surgery performed ipso the trauma abdominal operation enhances inflammatory function may promoted activity autoimmunity sle patients eventually caused occurrence alp the patient clinical symptoms ameliorated radiographic results showed improvement following high dose methylprednisolone gamma globulin supplement therapy 3 days followed 2 mg kg methylprednisolone maintenance treatment conclusion report first case alp ipso co existing patient sle it remains challenge surgeon establish correct diagnosis prevent inappropriate surgical intervention ipso plays role initial presentation sle alp typically occurs active stage sle thus emergency surgery may increase rate complication

intestinal pseudo - obstruction ( ipso ) and acute lupus pneumonitis ( alp ) are uncommon severe complications of systemic lupus erythematosus ( sle ) . the present study reports the case of a 26-year - old female who presented with abdominal pain , nausea and vomiting as initial symptoms . computed tomography ( ct ) scanning revealed the jejunal wall was thickened and streaky , mimicking the presentation of intestinal obstruction . following emergency surgery , the patient 's general condition was aggravated , with evident limb erythematous rashes . a series of laboratory examinations revealed sle , and combined with patient 's medical history ipso was diagnosed , with a disease activity index score of 10 . during the therapeutic period , high fever , dyspnea and oxygen saturation ( sao2 ) reductions were detected , and ct scans indicated lung infiltration , excluding other causes through a comprehensive infectious work - up and a bronchoalveolar lavage examination . alp was confirmed and treated with high - dose methylprednisolone and gamma globulin supplement . the patient responded well and was discharged in 2 weeks . in the one - year tapering period and after stopping corticosteroids , the patient recovered well with no relapse detected . in conclusion , the manifestation of ipso in sle is rare and represents a challenge for the surgeon to establish the correct diagnosis and avoid inappropriate surgical intervention . alp may be the consequence of emergency surgery , and immediate high - dose glucocorticoid therapy is recommended .

military personnel face multiple stressors lives.1,2 studies reported stress occurs risky assignments missions,35 demand physical fitness problems interactions peers higher rank,6 sleep deprivation shift work,7,8 deployment separation family,9 additional noncombat work assignments disaster relief peacekeeping humanitarian actions.10 home front problems spouses children also impact lives military personnel.9,11,12 global defense budget cuts downsizing military manpower increase workload stress remaining military personnel.1315 world health organization definition health includes physical mental social aspects.16 quality life qol context individual cultural subcultural systems associated personal goals expectations standards values.17 advocated goals promotion quality life preservation function well well prolongation peoples lives.18 quality life instrument whoqol brief version whoqol bref commonly used scales use among general populations well among disease specific populations.19 mental physical health military personnel may vary result different administrative characteristic political factors.20 identification stressors military life well factors influence health would enable us provide proper care military personnel therefore relationship quality life qol perceived health crucial maintenance welfare military personnel troop strength the aim study evaluate military personnel select branches ground forces taiwan perceived health status qol data collected basic military units taiwan ground forces units within 1 consecutive year army air force gendarmeries there differences ethnicity study participants han chinese taiwan inclusion criteria 1 membership one military service branches taiwan including mandatory voluntary entry 2 ability read write 3 agreement participants personal information test results could used research personal characteristics participants included age sex rank level education income marital status military service mandatory voluntary enrollment the packet also included whoqol bref taiwan version general health questionnaire-12 chinese version chq)-12.16,24 smoking alcohol consumption personal medical conditions medical history also recorded our research team sent 1,200 questionnaires 900 returned 720 could used led effective response rate 60% the chq-12 based goldberg general health questionnaire ghq translated cheng.16,21 chq-12 reduced number questions 60 12 used screening instrument anxiety depression insomnia fatigue social functioning family relationships each question four possible responses ranging 0 3 points felt much frequently usual previous research revealed chq-12 fair validity reliability.16,2123 intrinsic validity cronbach alpha coefficient 0.9 community sample 0.92 hospital patients sensitivities 76% 77% respectively the whoqol bref taiwan version translated yao et al,24 determined reliable valid.24,25 taiwan version added two questions local culture addition basic 26 questions this instrument used assess subject psychological physical social environmental conditions previous 4 weeks.25 internal consistency ranged 0.700.77 four domains physical psychological social environmental test retest reliability reached 0.760.80 domain level the discriminant validity effectively distinguished healthy unhealthy people accounted 60% total qol.24 packet contained part self reported vas mental health the vas method widely used assess status patient pain illness.26,27 cost effective way evaluate patient health.28,29 scores range 0 worst 100 best indicate subjective health previous 2 weeks participants entered military service spss windows version 21.0 ibm corporation armonk ny usa used statistical analysis descriptive results continuous variables expressed mean standard deviation categorical variables expressed frequency group differences determined pearson chi square one way analysis variance one way analysis variance also used analyze differences chq qol different ranks levels education groups mandatory voluntary military services logistic regression used estimate odds ratios ors 95% confidence intervals association demographic factors four whoqol bref domain scores psychological morbidity multiple regression analysis used identify significant variables associated chq qol vas subjective health condition past 2 weeks all statistical tests two tailed values p<0.05 considered statistically significant permission study obtained institutional review boards tri service general hospital national defense medical center data collected basic military units taiwan ground forces units within 1 consecutive year army air force gendarmeries there differences ethnicity study participants han chinese taiwan inclusion criteria 1 membership one military service branches taiwan including mandatory voluntary entry 2 ability read write 3 agreement participants personal information test results could used research personal characteristics participants included age sex rank level education income marital status military service mandatory voluntary enrollment the packet also included whoqol bref taiwan version general health questionnaire-12 chinese version chq)-12.16,24 smoking alcohol consumption personal medical conditions medical history also recorded our research team sent 1,200 questionnaires 900 returned 720 could used led effective response rate 60% the chq-12 based goldberg general health questionnaire ghq translated cheng.16,21 chq-12 reduced number questions 60 12 used screening instrument anxiety depression insomnia fatigue social functioning family relationships each question four possible responses ranging 0 3 points felt much frequently usual previous research revealed chq-12 fair validity reliability.16,2123 intrinsic validity cronbach alpha coefficient 0.9 community sample 0.92 hospital patients sensitivities 76% 77% respectively the whoqol bref taiwan version translated yao et al,24 determined reliable valid.24,25 taiwan version added two questions local culture addition basic 26 questions this instrument used assess subject psychological physical social environmental conditions previous 4 weeks.25 internal consistency ranged 0.700.77 four domains physical psychological social environmental test retest reliability reached 0.760.80 domain level the discriminant validity effectively distinguished healthy unhealthy people accounted 60% total qol.24 packet contained part self reported vas mental health the vas method widely used assess status patient pain illness.26,27 cost effective way evaluate patient health.28,29 scores range 0 worst 100 best indicate subjective health previous 2 weeks participants entered military service the chq-12 based goldberg general health questionnaire ghq translated cheng.16,21 chq-12 reduced number questions 60 12 used screening instrument anxiety depression insomnia fatigue social functioning family relationships each question four possible responses ranging 0 3 points felt much frequently usual previous research revealed chq-12 fair validity reliability.16,2123 intrinsic validity cronbach alpha coefficient 0.9 community sample 0.92 hospital patients sensitivities 76% 77% respectively the whoqol bref taiwan version translated yao et al,24 determined reliable valid.24,25 taiwan version added two questions local culture addition basic 26 questions this instrument used assess subject psychological physical social environmental conditions previous 4 weeks.25 internal consistency ranged 0.700.77 four domains physical psychological social environmental test retest reliability reached 0.760.80 domain level the discriminant validity effectively distinguished healthy unhealthy people accounted 60% total qol.24 the vas method widely used assess status patient pain illness.26,27 cost effective way evaluate patient health.28,29 scores range 0 worst 100 best indicate subjective health previous 2 weeks participants entered military service spss windows version 21.0 ibm corporation armonk ny usa used statistical analysis descriptive results continuous variables expressed mean standard deviation categorical variables expressed frequency group differences determined pearson chi square one way analysis variance one way analysis variance also used analyze differences chq qol different ranks levels education groups mandatory voluntary military services logistic regression used estimate odds ratios ors 95% confidence intervals association demographic factors four whoqol bref domain scores psychological morbidity multiple regression analysis used identify significant variables associated chq qol vas subjective health condition past 2 weeks all statistical tests two tailed values p<0.05 considered statistically significant permission study obtained institutional review boards tri service general hospital national defense medical center we collected 720 useable questionnaires service members army n=297 41.3% air force n=59 8.2% gendarme n=197 27.4% participants n=167 23.1% we divided collected data three groups according subjects military rank officers n=162 31.3% noncommissioned officers ncos n=104 20.1% enlisted men n=251 48.5% none enlisted subjects female officer 146/14 91.3% nco 97/7 93.3% groups predominantly male the average age officers 30 years older participants nco 25.3 years enlisted groups 23.7 years the officer group higher level education 15.2 years versus 14.3 years ncos 14.1 years enlisted men most officers volunteers 138/145 95.4% half ncos 50/104 49% enlisted men volunteers 13/215 5.7% though fulfilling obligatory military duty officers longest time service 11.1 years compared ncos 4.8 years enlisted men 1.5 years the average monthly income officers ncos enlisted men new taiwan dollars ntd 28,700 us 956.70 ntd 25,600 us 853.30 ntd 16,100 us 536.70 respectively there significant differences smoking drinking alcohol three groups 34.8% officers history smoking 8.2% drank alcohol per week the percentages history smoking drinking alcohol ncos enlisted men 37.9%/13% 35%/10.5% respectively there 104 participants reported ongoing medical problems including allergies n=24 skin rash itching n=26 common cold symptoms n=18 musculoskeletal discomfort strain sprain n=55 self reported herniated intervertebral disc n=6 muscle pain n=12 hepatitis b virus carrier n=3 peptic ulcer n=1 hypertension n=2 type 2 diabetes mellitus n=1 the officers higher score vas self reported health 72.5 ncos 67.7 enlisted men 66.3 p<0.001 previous 2 weeks the vas score self reported health entered military service showed significant differences three groups officers 74.6 ncos 71.0 enlisted men 72.0 the ncos enlisted men felt health significantly worsened recent times compared time passed became enlisted average number years enlisted officers ncos enlisted men 11.17.3 years 4.85.7 years 1.52.4 years respectively shown table 1 officers lower chq scores 9.62 ncos 11.07 enlisted men 11.51 when used score 9 cut point set three quarter cut point),22 considered subjects reporting 10 points unhealthy chq cases cases psychological morbidity officers higher percentage good health 57.4% ncos 38.5% enlisted men 42.2% officers also higher total qol scores 83.98 ncos 80.64 enlisted men 79.67 comparing four domains qol officers still significantly higher scores domain enlisted men ncos significantly lower scores officers physical environmental domains table 1 figure 1 the qol showed borderline differences different income statuses income significant influence adjusting regression items 1 3 4 5 9 chq showed significant differences among three groups item 1 headache item 5 poor sleep quality ncos scores 2.06 2.52 respectively higher officers scores 1.72 2.04 respectively on item 4 limb tremor numbness item 5 poor sleep quality enlisted men scores 1.62 2.48 respectively higher officers scores 1.43 2.04 respectively officers felt better health -value 0.162 0.542 compared enlisted men other significant data showed older personnel better health -value 0.0033 0.967 smokers accounted psychological morbidity higher chq scores -value 0.377 1.458 table 3 vas scores self reported health also revealed significant differences chq cases non chq cases the participants experiencing one physical symptoms accounted chq cases -value 1.196 27.609 the social environmental domains qol significantly associated lower chq case rates -values 0.133 0.287 ors 6.944 25.905 table 3 relationships qol domains vas scores self reported health chq scores adjusted risk factors as shown table 4 military rank ongoing physical illness showed significant relationship in cross sectional study qol chq scores interactions analyzed different military branches ranks service types voluntary obligatory enlisted personnel a total 55.3% subjects reported unhealthy chq higher general population rates 18%33% reported different samples.3034 among subjects ncos enlisted men rated poor health 61.5% 57.8% respectively this result similar previous report uk.35 previous studies military personnel either training combat peacekeeping missions ghq case rates 19.5%48% higher found studies general populations.3640 one previous study performed military hospital,41 ghq case rates 22%32% physicians nurses staff this difference may reflect different tools used different nature stress people work hospital troops present study 55.3% military subjects chq cases rate higher rates found militaries countries higher general population found professions.33,41 among different ranks chq case rate 61% ncos rate higher two groups the chq case rate obligatory service members 58.9% higher volunteers 48.9% table 5 reviewed several previously selected studies conducted among different military nonmilitary populations mobilized military personnel the nature military stress rather age demographic data example combat related deployments peacekeeping disaster relief actions outbreaks infectious diseases),35,4147 likely related psychological morbidity poor quality life peace time contrarily41 among general population,48,49 age may play role contributing psychological morbidity poor qol one study conducted military hospital two studies conducted general population.41 previous studies conducted among students,5052 similar age distribution present study ghq rates varied 29%52% higher female sex among subjects experiencing stressful events basic level training academic problems family social economic status however studies including present one varied greatly number participants demographic data countries stress nature target population furthermore present study cross sectional study associations demographic factors psychological morbidity qol hard compare studies some research shown ghq better screening minor psychiatric morbidity depression.53,54 military psychological factors well social environmental problems could risk factors suicidal ideations.55 higher case rates require attention previous study,56 age may independent risk factor poor psychological health however present study age slightly negatively related chq scores adjustment multiple regression analysis rank influence age chq disappeared the reason may higher ranks military often older ncos enlisted men however among enlisted men age still played role subjects rating healthy older rating 0.160 p=0.013 this may reflect fact even mandatory personnel spent time service better adapt military environment life hand younger soldiers especially subject obligatory military enlistment faced challenges adaptation veterans it important help individuals adapt faster previous studies,22,57 people education may greater ability express emotions received higher scores health questionnaires data however chq inversely related higher rank represents older age greater levels education the vas self reported health subjective overall scale health status lower ncos enlisted men higher officers this suggested officers higher rank time spent military average 13 years better subjective health although specific individual domains overall finding similar results found chq the vas showed significant difference chq cases non chq cases disparity 10 points multiple regression analysis used adjust risk factors vas rank illness independent risk factors previous studies revealed vas useful tool quantifying qol,58 vas correlated ghq across specific diseases.59 present study may suggest vas could used quick screening tool mental health suitable certain emergent stressful missions disaster rescue although studies needed analysis subitems chq ncos headaches sleep problems officers enlisted men limb numbness sleep problems officers this may reflect frequent shift work due security duty heavy demands military services loaded ncos enlisted persons further study sleep military personnel relation mood health status considered domain qol officers better scores enlisted men terms general qol physical symptoms concentration daily energy levels physical pain sleep sex life appearance leisure activities capacity work money respect chq question food chq question the whoqol scores may negative association presence severity psychopathology.60,61 research also found military personnel lower social environmental domain scores whoqol higher chq case rates this may indicate area future investigation way improve status military personnel first female subjects sex related differences could studied well military environment given many participants provide marital status data became difficult analyze potential confounder although questionnaire return rate 60% many units unwilling receive we plan conduct qualitative research area sleep depression instruments pittsburgh sleep quality index62 beck depression inventory63 render data complete finally cross sectional study relationship demographic factors qol hard determine needs longitudinal studies some analyses could compared previous studies exactly demographic data in addition combat readiness forces disaster relief important task our military personnel statistically higher chq case rates members general population average case rates countries military personnel lower noted study whether higher risk post traumatic stress disorder mental illnesses executing rescue disaster missions serious concern addition worth noting rank independent factor affects mental health military personnel qol we pay attention military personnel mental health well physical health the vas self reported health might useful tool screening military mental health it could used war situation emergency mobilization takes less time administering comprehensive survey

objectivethe mental health of military personnel varies as a result of different cultural , political , and administrative factors . the purpose of this study was to evaluate the psychological morbidity and quality of life of military personnel in taiwan.materials and methodsthis cross - sectional study utilized the world health organization quality of life instrument , brief version , taiwan version , the general health questionnaire-12 , chinese version , and the visual analog scale ( vas ) in several military units.resultsmore than half of the subjects ( 55.3% ) identified themselves as mentally unhealthy on the general health questionnaire-12 , chinese version ; however , a higher percentage of officers perceived themselves as healthy ( 57.4% ) than did noncommissioned officers ( 38.5% ) or enlisted men ( 42.2% ) . officers also had higher total quality of life ( qol ) scores ( 83.98 ) than did enlisted men ( 79.67 ) . scores on the vas also varied : officers : 72.5 ; noncommissioned officers : 67.7 ; and enlisted men : 66.3 . the vas and qol were positively correlated with perceived mental health among these military personnel.conclusionour subjects had higher rates of perceiving themselves as mentally unhealthy compared to the general population . those of higher rank perceived themselves as having better mental health and qol . improving mental health could result in a better qol in the military . the vas may be a useful tool for the rapid screening of self - reported mental health , which may be suitable in cases of stressful missions , such as in disaster rescue ; however , more studies are needed to determine the optimal cut - off point of this measurement tool .

amateur wrestling community maybe entire sports community across world shocked deaths 3 college wresters usa six weeks 1997 the deaths athletes attributed autopsy weight loss performed short time victims undergone dehydration 15%1 following deaths 1997 national collegiate athletic association ncaa initiated developed new safety precautions order prevent unsafe weight practices2 after studies subject ncaa decided competition weighing conducted nearer competitions new weight classes determined adding nearly 3 kg weight class3 besides ncaa recommended weekly weight loss exceed 1.5% body weight part wrestling weight certification wwc program4 however important reason athletes lose weight want compete lowest weight class possible think time weighing competition ~16 hours sufficient rehydration dehydration5 nevertheless studies report time period ~16 hours enough regain body weight lost6 dehydration decreases athletes performances too7 it reported athletes particularly combat sports judo karate boxing wrestling perform excessively severe dehydration short time 17 days undergo hematologic changes8 9 would changes posm levels also na bun glucose levels due posm10 11 it reported athletes perform weight loss competitions undergo change hydration status also experience health problems sleep disorders learning memory difficulties anxiety depression irregular body temperature vasoconstriction low sexual performance dysfunctions skeletal muscles12 skeletal muscle damage hematologically detected analyzing serum levels ck indicators ldh ast alt enzymes cells many tissues13 the important indicator skeletal muscle damage serum ck level ck skeletal muscle tissues enzyme exists higher amounts sarcolemma mitochondrial cells healthy muscle cells primarily responsible regulating anaerobic metabolism14 observing serum ck ldh levels may provide useful information status muscles adaptation physical load serum ck ldh levels demonstrate degree metabolic adaptation skeletal muscles physical exercise these values increase considerably intense exercise15 physical tissue damage inflammatory conditions c rp main acute phase protein sensitive objective indicator16 17 indeed abramson vaccarino reported c rp level increased one exercise dependent duration intensity exercise18 hand booth et al reported c rp one indicators studied 12-day military exercise 5.005.9 it also reported serum c rp level athletes increased one exercise protocol20 prospective studies serum c rp level athletes decreased21 studies literature dehydration skeletal muscle damage inflammation among elite wrestlers22,23,24 however study conducted determine whether skeletal muscle damage inflammation occur dehydration accordingly present study aimed identify weight loss hydration levels competitions among elite wrestlers explore skeletal muscle damage inflammation levels dehydration trainers athletes benefit information skeletal muscle damage inflammation levels caused dehydration the study subjects 72 volunteer elite wrestlers competed turkish inter university wrestling championship division least 5 years sport experience least one exercise daily basis the participant athletes asked use kinds medicine ergogenic aids within 48 hours competition weighing order ensure standardization subjects used medicines ergogenic aids excluded study study period no disease could affect blood values athletes detected three athletes excluded study ck levels 1,000 u l hyper responder values considered lost data the study completed 69 elite wrestlers 22.512.49 years 174.546.59 cm 78.9815.87 kg bmi 25.733.77 the details dehydration protocols long time periods methods elite wrestlers achieved weight loss datails dehydration protocols wrestlers reported lost weight 17 days competitions food fluid restrictions sauna exhausting exercises literature euhydration accepted reference range 280290 mosm l thus wrestlers posm 290 assigned dehydrated group posm 290 dehydrated group25 dehydration calculated using formula posm 2 na)+(bun/2.8)+(glucose/18)26 determined 1% dehydration satisfactory dehydration 13% dehydration mild dehydration 35% dehydration high dehydration 5% dehydration severe dehydration27 the percentage body weight loss pbwl calculation performed using formula body weight change=[(pre body weight post body weight)/pre body weight 100 help specialists 5 cc blood was drawn forearm veins participant wrestlers 8.5 ml tubes vacuatiner blood collection system competition place weighing time one day competition 06:00 06:30 pm transported laboratory centrifugation the blood samples centrifuged nve nf-400 5 minutes 4,000 rpm athlete serums extracted blood preserved two different eppendorf tubes 20 c time analysis day analysis biochemical analyses hydration indicators na bun glucose analyses skeletal muscle damage indicators ast alt ldh ck performed using beckman coulter au2700 plus biochemical auto analyzer beckman coulter kits hormone analyses roche hitachi cobas e601 auto analyzer roche kits c rp analyses performed using beckman coulter immage 800 nephelometer autoanalyzer roche kits the independent samples test used compare pairwise group variables followed normal distribution anova used two groups following variance analyses lsd multiple comparison test employed order detect measurement results caused differences the responses questionnaire show 55.07% elite wrestlers underwent fast weight loss competition 17 days 4.55%1.87 the wrestlers underwent fast weight loss higher levels posm 296.053.14 upper limit reference value 290 suffered dehydration when intergroup hydration indicators assessed found na bun pbwl levels wrestlers dehydrated higher wrestlers dehydrated p<0.05 differences existed groups terms glucose levels p>0.05 table 1table 1.comparison hydration indicators wrestlers terms hydration statusnhydration statusreference range na mmol l)31dehydrated136146142.51.6**38not dehydrated137.52.7bun mg dl)31dehydrated82016.43.4 38not dehydrated14.33.6glucose mg dl)31dehydrated7410697.015.838not dehydrated97.112.5posm mosm l)31dehydrated280290296.13.1**38not dehydrated285.35.2pbwl 31dehydrated-4.61.9**38not dehydrated1.01.3*p<0.05 p<0.01 mean standard deviation na sodium bun blood urea nitrogen posm plasma osmolarity pbwl percentage body weight loss * p<0.05 p<0.01 mean standard deviation na sodium bun blood urea nitrogen posm plasma osmolarity pbwl percentage body weight loss skeletal muscle damage inflammation differences elite wrestlers examined relation hydration status differences ast ldh ck levels p<0.05 found whereas differences existed groups terms alt c rp levels p>0.05 although differences groups terms ast upper limit 50 u l ldh upper limit 248 u l values values within reference ranges however ck levels upper limit 171 u l groups higher reference range table 2table 2.comparison skeletal muscle damage inflammation indicators wrestlers terms posm levelsnposm mosm l)reference range ast u l)31dehydrated05024.96.3 38not dehydrated21.54.5alt u l)31dehydrated05014.29.038not dehydrated14.07.3ldh u l)31dehydrated0248207.237.2 38not dehydrated185.827.6ck u l)31dehydrated0171421.0174.0**38not dehydrated175.880.7c rp mg dl)31dehydrated00.60.30.338not dehydrated0.30.3*p<0.05 p<0.01 ast aspartate aminotransferase alt alanine aminotransferase ldh lactate dehydrogenase ck creatine kinase c rp c reactive protein posm plasma osmolarity * p<0.05 p<0.01 ast aspartate aminotransferase alt alanine aminotransferase ldh lactate dehydrogenase ck creatine kinase c rp c reactive protein posm plasma osmolarity according classification made casa et al investigating skeletal muscle damage inflammation indicators athletes there differences groups terms ast ldh ck levels p<0.05 differences groups terms alt c rp levels p>0.05 table 3table 3.comparison skeletal muscle damage inflammation indicators wrestlers terms pbwl classificationnpbwl classification ast u l)22% 0122.04.318% 1319.95.019% 3525.65.510% 526.35.6alt u l)22% 0113.65.918% 1314.17.619% 3515.311.910% 513.13.2ldh u l)22% 01182.624.118% 13188.038.619% 35203.225.810% 5222.241.1ck u l)22% 01191.689.618% 13214.4125.119% 35364.5170.810% 5472.9226.3c rp ast aspartate aminotransferase alt alanine aminotransferase ldh lactate dehydrogenase ck creatine kinase c rp c reactive protein pbwl percentage body weight loss represents differences among groups ast aspartate aminotransferase alt alanine aminotransferase ldh lactate dehydrogenase ck creatine kinase c rp c reactive protein pbwl percentage body weight loss generally many athletes perform fast weight loss competitions within 17 days adapt different weight classes compete rivals less strong weaker order gain advantage weight loss results dehydration among athletes affecting hydration levels negatively studies dehydration report dehydration detected urine specific gravity usg well serum posm2 28 when posm value 290 hydration considered normal euhydration 290 hydration lower normal level dehydration)25 present study 55.07% elite wrestlers underwent fast weight loss competition 17 days table 1 the level posm wrestlers underwent fast weight loss reference range upper limit 290 296.053.14 suffered dehydration 4.55% these results posm level wrestlers similar results usg29 30 serum na bun levels higher among dehydrated wrestlers due increase posm differences seen glucose values table 1 literature mmol l na concentration blood sample 135 mmol l defined hyponatremia 145 defined hypernatremia31 it reported na+ concentration generally remains high due long term physical activities excessive sweating deficiency body fluids na gradually increases time32 33 it recommended exercises athletes keep serum na concentration within reference range controlled diet34 otherwise nervousness reaction lethargy muscle contraction spasticity convulsions coma even mortality may occur it opinion differences bun values resulted fact wrestlers long term exhausting exercises and/or adhered food fluid restriction programs dehydration since bun closely associated metabolic functions liver filtrating excreting functions kidneys dehydration may increase35 indeed the study mashiko et al reported according measurements 20 day camp rugby players lost weight result bun levels decreased owing weight loss36 the fact differences glucose values dehydrated wrestlers made us think adrenaline increased exercises converts glycogens stored liver glucose glucose flows blood help glucagons result regulates blood glucose levels differences na bun values affect posm values athletes change hydration status it stated dehydration 23% causes cognitive disorders irregular body temperature cardiovascular dysfunctions well reduced endurance weakens muscle strength37,38,39 there significant differences terms damage skeletal muscles dehydrated wrestlers dehydrated wrestlers the differences hydration levels skeletal muscle damage determined according classification casa et al study noted significant differences ast ldh ck differences found alt values tables 2 3 two groups study nathwaniet et al reported serum levels ck ldh ast alt increased following muscle damage13 normal conditions these elevated levels may tolerated athletes nutritional relaxation programs among dehydrated athletes metabolism consumes low levels carbohydrate due food fluid restrictions uses energy combination fat proteins thus glucose inhibition occurring high plasma free fat acids suggest damage muscles wrestlers would continue40 41 clinical practice ck ldh ast alt commonly used diagnosis skeletal muscle diseases skeletal muscle tissue damage42 the ldh level accepted specific indicator fatigue44 45 ast cytoplasmic mitochondrial enzyme may increase many clinical disorders alt reported specific indicator liver damage13 study serum ck ldh levels important damage indicators higher dehydrated group dehydrated group among dehydrated wrestlers high level serum ck would affected performance negatively well restricted movements muscle pains it also possible high level serum ldh may cause wrestlers reluctant and/or unwilling next exercise when aminotransferases investigated levels ast alt increased however significant difference ast levels significant difference seen alt level demonstrates ast exists higher amounts skeletal muscles alt serum levels damage indicators reduced exercises correlated relaxation feeding exercises46 all participant wrestlers reported daily exercises training therefore opinion high level skeletal muscle damage among dehydrated wrestlers caused food fluid restriction following exercises c rp major acute phase reactant increases acutely quickly response tissue damage infection47 systematic study c rp found acute phase response c rp temporally increased single exercise protocol among trained athletes however prospective studies demonstrated c rp pretest posttest levels exercise groups reduced in words although physical activity increased c rp levels chronic physical exercises reduced c rp levels48 c rp levels participant athletes groups low difference existed groups considering fact athletes sportive experience least five years expected would increased tissue oxygenation regularly exercised years uww united world wrestling shortened resting time competitions wrestling championships aiming muscle endurance among wrestlers wrestling tournament the qualifications semi finals even finals time bouts short resting time sufficient full recovery lowering performance wrestlers lose weight fast and/or higher levels weight loss competition produced differences wrestlers hydration indicator levels damage skeletal muscles dehydrated wrestlers greater hydrated difference found inflammation levels groups necessary lose weight competition athletes way achieve gradual extended weight loss period time depending weight loss targeted in addition athletes losing weight keep levels hydration skeletal muscle damage indicators within reference ranges ergogenic aids thus ergogenic aids play mediator role wrestlers wishing demonstrate maximum performance lead healthy life

[ purpose ] the present study aimed to identify weight - loss and hydration levels before competitions among elite wrestlers and determine the skeletal muscle damage and inflammation levels after dehydration . [ subjects ] seventy - two elite wrestlers who participated in the turkish wrestling championship . [ methods ] with the help of specialists , 5 cc of blood were drawn from the forearm veins of the wrestlers . laboratory analyses of na+ , bun , glucose , ck , ldh , ast , alt , c - rp levels were performed . using a mathematical formula for hydration the posm levels of the athletes were calculated . [ results ] the wrestlers were divided into two groups based on hydration status . there were significant correlations between hydration indicators of na+ , bun and pbwl values . there were significant differences between ast , ldh , ck values and skeletal muscle damage indicators of the two groups , but there were no significant differences between the inflammation levels and c - rp values of the groups . [ conclusion ] no differences existed in inflammation levels among the wrestlers , although dehydrated wrestlers suffered from higher level of skeletal muscle damage than wrestlers who were not dehydrated .

primary spinal cord tumors represent 4.5% cns neoplasms common tumor type meningioma 24.4% 1 spinal meningiomas common elderly patients mean age varying 56 66 years different studies 3 6 sandalcioglu et al.s study age range 17 88 years review 131 patients 3 spinal meningiomas slow growing tumors therefore lead symptoms reach considerable size compress spinal cord causing local pain however significant number patients diagnosis confirmed neurologic deficits gait disturbances become evident 3 intraspinal meningiomas commonly located thoracic region followed cervical lumbar areas 7 9 there reports literature describing postoperative outcome spinal meningiomas 10 14 in addition little known different prognostic factors influencing recovery especially influence histopathologic subtype 11 this study carried evaluate effect factors specially effect histopathologic subtype postoperative outcome all patients spinal meningioma referred shohada hospital tehran iran surgical resection spinal meningioma october 1998 january 2012 included study the patients records including age sex address history radiologic data operative notes tumor location pathology reports registered retrospectively the results 8 120 months post operative follow classified according frankel classification table 1 all patients plain x rays ct scan spine 14 36% mri localization tumor three pathologists studied histologic slides independently diagnoses made according 2007 criteria statistical analyses performed using spss software version 11.0 using test fisher exact test compared results a total number 39 patients spinal meningioma referred shohada hospital underwent neurosurgical resection twenty five women 64% 14 men 36% histological classification according criteria follows 34 cases 87% grade 15 cases 38% psammomatous 7 cases 18% meningothelial 9 cases 23% transitional 3 cases 8% fibroblastic five patients 13% grade ii 3 7.5% clear cell appearance remaining 2 5.5% chordoid appearance figures 1 2 meningothelial b fibroblastic c chordoid psammomatous there significant difference preoperative neurologic signs according frankel classification different histological subtypes table 2 shows summary pre- post operative neurologic deficits 39 patients spinal meningiomas seventy nine percent patients grade e 19% grade c 2% grade b. postoperatively 82% improved changed 18% worsened one patient psammomatous cervical meningioma frankel grade c severe grade b signs surgery following surgery pain relieved patients bladder dysfunction one case cured paresthesia remained one ten patients 8 patients unable walk group b c ) five cases remained status group b c postoperatively two cases psammomatous three cases grade ii meningioma comparing surgical outcome different histologic subtypes observed 6 15 patients psammomatous meningioma 40% worsened results persistent functional deficit grade c worse all five cases grade ii meningioma worsened surgery remained unchanged grade c. significantly different remaining 19 cases grade meningioma non psammomatous 100% showed improved results changed post operatively remaining grade e p 0.003 p 001 tables 3 4 good outcome means frankel grades e poor outcome means group b c. mean age patients good postoperative outcome 51.8 mean age patients poor outcome 51.5 age affect outcome p 0.34 seven 11 patients poor outcome 63.6% 18 28 patients good outcome 64% women sex significant influence outcome p 0.99 cervical location tumor seen 5 11 patients poor outcome 45.5% 3 28 patients good outcome 10.7% cervical location significant influence outcome p 0.027 the mean tumor size 2.7 cm greatest dimension patients poor outcome 2.6 cm cases good outcome p 0.40 five poor outcome cases reported adhesion surgery incomplete removal 45% two others condition 7% p 0.012 meningiomas primary tumors spines arisen arachnoid cap cells meninges constitute 1.2% cns meningiomas 3 study spinal meningiomas constitute 7.7% cns meningiomas could due fact shohada hospital referral center difficult cases spinal tumor surgery psammomatous subtype grade ii cases poor postoperative outcome subtypes grade good outcome study schaller study ( 11 psammomatous subtype less favorable outcome compared subtypes roux et al study 6 histological subtype seem influence postoperative outcome ( 6 klekamp samii 5 haegelen et al 4 sandalcioglu et al ( 3 revealed significantly higher incidence meningioma women study revealed female male ratio 1.8 1 study roux et al ( 6 study sex influence prognosis average age patients varies 56 66 studies roux et al 6 haegelen et al ( 4 respectively study average age 51.6 prognosis influenced increasing age schaller study age less 60 years correlated good outcome 11 sandalcioglu study 3 elderly patients proved harbor increased risk surgical morbidity study cervical location tumor related poor outcome study schaller study 11 tumor location c4 seemed correlated good outcome studies 3 6 10 12 correlation found incomplete removal tumor seen half cases poor outcome 7% group since 80% incompletely removed tumors first group are psammomatous subtype seems incomplete removal tumor may reason poor outcome psammomatous subtype comparison subtypes grade although studies larger sample size needed confirm result spinal meningioma grade psammomatous subtype associated less favorable postoperative neurologic outcome subtypes results closer cases grade ii incomplete resection spinal meningioma occurs frequently psammomatous subtype cases grade ii trying complete resection may cause additional neurological damage cervical location another factor seems negative correlation good outcome psammomatous subtype grade ii cases poor postoperative outcome subtypes grade good outcome study schaller study 11 psammomatous subtype less favorable outcome compared subtypes roux et al study 6 histological subtype seem influence postoperative outcome ( 6 klekamp samii 5 haegelen et al 4 sandalcioglu et al ( 3 revealed significantly higher incidence meningioma women study revealed female male ratio 1.8 1 study roux et al ( 6 study sex influence prognosis the average age patients varies 56 66 studies roux et al ( 6 haegelen et al 4 respectively study average age 51.6 prognosis influenced increasing age schaller study age less 60 years correlated good outcome 11 sandalcioglu study 3 elderly patients proved harbor increased risk surgical morbidity study patients age influence post operative outcome cervical location tumor related poor outcome study schaller study 11 tumor location c4 seemed correlated good outcome studies 3 6 10 12 correlation found incomplete removal tumor seen half cases poor outcome 7% group since 80% incompletely removed tumors first group are psammomatous subtype seems incomplete removal tumor may reason poor outcome psammomatous subtype comparison subtypes grade although studies larger sample size needed confirm result spinal meningioma grade psammomatous subtype associated less favorable postoperative neurologic outcome subtypes results closer cases grade ii incomplete resection spinal meningioma occurs frequently psammomatous subtype cases grade ii trying complete resection may cause additional neurological damage cervical location another factor seems negative correlation good outcome

backgroundpostoperative outcome of spinal meningiomas is an important issue in surgery decision - making . there are limited and conflicting data in the literature about the prognostic factors influencing recovery , especially about the histopathologic subtypes.objectivesthis study was carried out to evaluate the effect of some of these factors on postoperative outcome.patients and methodsthis study was performed on 39 patients operated for spinal meningioma between october 1998 and january 2012 ; their histopathologic subtype was determined according to who criteria . the follow up period ranged between 8 - 120 months . the influence of histopathologic subtype , grade , age , sex , surgical approach , local adhesion and anatomical location was assessed according to frankel classification of neurologic deficit.resultsfrom a total number of 39 spinal meningiomas , 34 cases were who grade i , from which 15 cases were psammomatous , 7 cases were meningothelial , 9 cases were transitional and 3 cases were fibroblastic . five cases were grade ii , 3 of which had clear cell appearance and the remaining 2 had chordoid appearance . the mean age was 51.6 ( 22 to 76 ) years ; 25 cases were female and 14 cases were male . this study revealed that grade ii meningioma cases had poor prognosis in all 5 cases and psammomatous subtype had poor postoperative outcome in 40% of cases while the other subtypes had good outcome in all cases ( p = 0.026 ) . cervical location of the tumor was also related with poor outcome in 37.5% of the cases , while 22.5% had poor outcome in other locations ( p = 0.029 ) . age below and above 45 years and sex had no significant influence on the outcome.conclusionsspinal meningiomas of psammomatous type and grade ii spinal meningiomas are associated with less favorable postoperative neurologic outcome . cervical location has also a negative correlation with a good outcome .

cystic fibrosis cf fatal disorder characterized chronic progressive lung disease determines morbidity mortality patients airways cf patients show chronic nonresolving neutrophilic inflammation increases upon infection disease progression neutrophil products elastase chitinase like proteins chemokines identified important risk factors lung damage lung function decline suggested biomarkers based cross sectional longitudinal studies patients cf 27 mice cf like lung disease previous studies also provided evidence free extracellular dna highly increased cf airway specimen initially referred dna derived necrotic cells however several studies established cf airway secretions contain meshwork structures reminiscent nets 1014 traditionally neutrophils known combat pathogens intracellularly phagocytosis paradigm extended challenged finding neutrophils immobilize kill pathogens extracellularly net formation netosis 15 16 these released nets consist nuclear dna backbone equipped characteristic granule cytoplasmic proteins while netosis initially described novel form cell death recent studies demonstrated also living neutrophils eosinophils basophils form extracellular traps ets expelling mitochondrial dna 1823 viable nonlytic rapid net formation found response staphylococcus aureus infection phagocytosis chemotaxis net formation worked collaborative manner 24 25 study investigated cf airway inflammation focus abundance free dna structures characteristic nets different airway specimen sputum bal obtained patients cf enac transgenic enac tg mice cf like lung disease 2628 correlated dna levels proinflammatory cxc chemokines characteristic cf pathogens measurements lung function our results demonstrate free airway dna levels correlate obstructive lung disease proinflammatory chemokines cf patients cf mice could serve therapeutic target potential biomarker cf lung disease nets visualized characterized staining extracellular dna citrullinated histones myeloperoxidase elastase the quantification free dna performed using quant picogreen assay molecular probes inc eugene usa based green fluorescent dye binds dna clsm samples collected poly lysine precoated cover slides placed freshly harvested human sputum left place 510 min order adhere the cover slides washed pbs ph 7.4 transferred fixative 4% paraformaldehyde 2 hours the fixed samples washed pbs permeabilized 0.5% triton x-100 pbs blocked 10% normal goat serum 10 mm glycine diluent containing 0.5% bovine serum albumin 0.5% normal goat serum 0.5% triton x-100 pbs for visualisation citrullinated histones samples incubated rabbit anti human citrullinated histone h3 antibody ab77164 abcam cambridge uk this antibody detected clsm means secondary anti rabbit fitc antibody ab6717 abcam cambridge uk for visualisation neutrophil elastase myeloperoxidase samples incubated rabbit antineutrophil elastase ab21595 abcam cambridge uk mouse antimyeloperoxidase ab25989 abcam cambridge uk antibodies negative controls initially incubated 500 u ml dnase dnase recombinant grade roche diagnostics gmbh vienna austria 20 min room temperature rt stopped 50 mm edta excess thereafter treated mentioned the specimens analysed clsm zeiss lsm 510 meta uv carl zeiss gmbh vienna austria relative fluorescence quantified using zeiss lsm software application scanning electron microscopy sem studies sputum samples collected described the fixed samples washed 0.1 sodium cacodylate ph7.6 blocked 1% bsa 20 min rt then samples dehydrated ascending series ethyl alcohol critical point dried subsequently sputtered gold the specimens examined scanning electron microscope esem xl30 fei company philips eindhoven netherlands operating 20 kv the negative controls digested dnase thereafter processed way transmission electron microscopy tem studies sputum samples collected formvar coated grids placed freshly harvested sputum left place 60 sec order adhere the grids immediately transferred fixative 4% paraformaldehyde pbs ph 7.4 two hours the fixed samples washed pbs permeabilized blocked 10% normal goat serum 10 mm glycine 0.2% tween 20 diluent containing 0.5% bovine serum albumin 0.5% triton x-100 pbs for visualisation citrullinated histone h3 grids incubated rabbit anti human citrullinated histone h3 citrulline 2 8 17 antibody cith3 ab77164 abcam cambridge uk gold conjugated secondary antibody ab27237 abcam cambridge uk gold sphere diameter 20 nm ab27235 abcam cambridge uk 5 nm gold sphere diameter finally grids stained 1% uranyl acetate sigma aldrich vienna austria a second type negative controls obtained omitting primary antibody ultrathin sputum sections sputum samples stained ruthenium red osmium tetroxide technique enable visualization nets bacterial glycocalyx briefly samples fixed 1.2% glutaraldehyde buffered ph 6.5 0.1 sodium cacodylate addition 0.05% ruthenium red 2 hours rt postfixation performed 1% osmium tetroxide buffered ph 6.5 0.1 sodium cacodylate 0.05% ruthenium red 2 h rt ultrathin sections examined transmission electron microscope leo em 910 leo elektronenmikroskopie ltd oberkochen germany levels human murine cxcr2 ligands quantified commercial sandwich elisa kits according manufacturer instructions previously described cf patients healthy control subjects included study table 1 the diagnosis cf based typical clinical symptoms positive sweat tests disease causing mutations cftr gene inclusion criteria cf patients stable concomitant therapy least two weeks prior study forced expiratory volume 1 second fev1 25% predicted value chronic bacterial fungal colonization diagnosed using leeds criteria organism present 50% patient samples year prior analysis the study approved institutional review board ethics committees medical faculty ludwig maximilians university munich university tbingen germany written informed consent obtained patients control subjects prior study induced sputum obtained inhalation 5.85% hypertonic sodium chloride 15 min low speed 4c 500 g 10 min supernatants obtained induced sputum centrifuged 4c 4000 g 20 min bronchoscopy bal 4 1 ml 0.9% nacl per kg body weight performed described previously 31 32 because high percentage neutrophils first fraction bal used subsequent analyses the generation enac tg mice line 6608 previously described the colony maintained mixed genetic background c3h hen c57bl/6n enac tg mice identified pcr mice housed pathogen free animal facility free access chow water bronchoalveolar lavage bal mice deeply anesthetized via intraperitoneal injection combination ketamine xylazine 120 mg kg 16 mg kg resp trachea cannulated lungs carefully lavaged twice 800 l pbs kc mip2 concentrations measured bal supernatant using elisa according manufacturer instructions total cell counts determined differential cell counts performed cytospin preparations studies performed investigators blinded respect genotype treatment mice we used invasive pulmonary function devices forced maneuver system buxco research systems wilmington nc mmf medetomidine midazolam fentanyl intubated placed forced pulmonary maneuver system heated plethysmograph chamber mice ventilated average rate 140 breaths per minute flow mouth esophageal pressure heart rate monitored measure forced expiratory volume 100 ms fev100 comparisons among groups performed anova comparisons two patient groups performed two sided test statistical analysis performed prism 4.0 graphpad software stata version 8.2 windows stata corporation increased extracellular dna fibres morphological net characteristics found airway specimen cf patients figures 1(a 1(b positive costaining neutrophil elastase figure 1(a citrullinated histones figures 1(a 1(b 1(d characteristic net markers negative staining f actin figure 1(d supported notion cf airway dna fibres represented nets rather necrosis derived dna treatment cf airway fluids dnase dissolved dna net like structures confirming nature dna strands data shown ultrastructural imaging methods supported findings revealed complex meshwork dna strands bacteria entangled figure 1(b free dna present different cf airway compartments particular sputum figure 1(a bronchoalveolar lavage fluid bal figure 1(c lower panel lung tissue figure 1(c upper panel remarkably abundant free dna found cf sputa whereas bal lung tissue lower amounts free dna strands detected consistent observation neutrophilic inflammation prominent proximal bronchial airway compartments cf lung disease bal fluid observed lower amounts dna net like structures observed elastase associated free dna structures also appeared colocalize neutrophil cellular membrane figure 1(c lower panel cf airway fluids found dna net like structures associated bacteria figure 1(e however associations free dna structures live dead bacteria noted figure 1(e stratifying cf patients disease severity found cf patients poor pulmonary function higher levels free dna airway fluids patients mild lung disease figure 2(a we found airway free dna levels associated fungal colonization aspergillus fumigatus surprisingly bacterial infection figure 2(a representative net dna dapi staining cf patient groups stratified lung disease severity shown figure 2(b highly increased levels cxc chemokines cxcl1 gro alpha cxcl2 gro beta cxcl8 il-8 detected cf airway fluids figure 2(c since cxcr1 proteolytically cleaved cf airway neutrophils 4 32 cxcr2 remains main binding site chemokines cf airway microenvironment cf airway nets correlated positively levels proinflammatory chemokine cxcl2 figure 2(d these findings provide evidence cf lung disease features free airway dna levels characteristic netosis suggest increased free dna levels associated poor lung function cf patients investigate role free dna net formation vivo used transgenic mice airway specific overexpression amiloride sensitive epithelial na channel enac tg model cf like lung disease 26 27 these mice phenocopy airway surface liquid depletion mucociliary dysfunction chronic airway disease neutrophilic airway inflammation mucus obstruction structural lung damage 26 27 34 similar human cf airway fluids levels cxcr2 ligands cxcl1 cxcl2 figure 3(a free dna figure 3(b highly increased bal airway fluids enac tg mice compared wild type controls also consistent data obtained human cf lung disease samples extent free dna murine cf airway fluids correlated positively levels cxcr2 ligand cxcl2 figure 3(c pulmonary obstruction parameters fev100 figure 3(d whereas correlation found free dna levels cxcl1 parameters pulmonary restriction parameters data shown netosis regarded double edged sword human disease one hand nets capture immobilize kill pathogens hand uncontrolled infection independent net formation potential harm host tissue histones proteases mechanisms 21 36 37 related latter mechanism net formation recently implicated pathogenesis autoinflammatory autoimmune disease conditions lupus preeclampsia septic shock autoimmune vasculitis 3640 beyond conditions nets found concert platelets monocytes play role thrombus formation deep vein thrombosis 41 42 however antihost defense autoinflammatory conditions dichotomous nature temporarily overlap upon resolution infection progression chronic infection especially immunocompromised conditions viewing findings combination balance targeted antimicrobial host defense nontargeted tissue damage net delicate essential understanding therapeutic potential net formation human disease conditions several studies provided evidence netosis netosis like structures cf lung disease broadened potential role net formation complex pathogenesis infective cf lung disease we others demonstrated previously free dna net like structures abundantly detectable cf airway secretions 1014 recently study found cf sputum showed netosis characteristics implicated macrophage migration inhibitory factor mif formation nets context cf lung disease confirm extend previous observations showing cf airway free dna levels correlate pulmonary obstruction cf patients mice these observations reasonable given continuous nonresolving neutrophil recruitment activation within cf airways supported beneficial effect recombinant inhaled dnase dornase alpha cf patients strongest evidence moderate severe disease severity 4446 based increasing extent neutrophilic inflammation pulmonary obstruction evidence free net like dna structures cf airways tempts us speculate earlier milder stages cf lung disease net formation may act beneficial providing extracellular antibacterial antifungal host defense time dnase may used caution since encaptured pathogens might freed could cause additional host damage hand later moderate severe stages cf lung disease amount mucus dna accumulation causes airway obstruction rendering dnase efficient cleaving dna traps effect probably overweighs antimicrobial actions net formation hypothesis awaits tested vivo studies clinical trials our correlations free dna levels pulmonary obstruction parameters human patients cf mouse model cf lung disease suggest least cf cohort advanced lung disease severity nets may cause harm good host obvious limitations study whole approach free dna analysis cf airway fluids remain free extracellular dna could result different forms cell death addition netosis including necrosis pyroptosis others addition studies image net formation using fixation biological samples thereby limited fact dna structures reminiscent netosis clearly attributed active net formation since would require live cell imaging approaches nevertheless several previous publications provided indirect evidence indicating presence net structures cf airway fluids 1014 supported methodologically studies using confocal laser scanning scanning electron microscopy transmission electron microscopy atomic force microscopy decreasing probability fixation staining artefacts cf lung disease is typically associated chronic colonizations infections pseudomonas aeruginosa effect pathogen net formation investigated using different methodologies modelling systems 11 13 4749 the latter studies found pseudomonas aeruginosa efficiently induced net formation particularly solution vitro demonstrated nets kill pathogen extracellular dna mediated mechanism single cell level authors also showed neutrophils cf patients cell intrinsic alteration net formation supporting notion net accumulation found cf airway fluids specific cftr mutation based disease conditions rather represent prototypical picture severe chronic neutrophilic inflammation body compartment as cf airway fluids show low antioxidant activity substantially different biochemical properties speculate particular microenvironment favors net formation while find statistically significant association pseudomonas aeruginosa infection status free dna levels positive correlation found fungal colonization aspergillus fumigatus line recent study showing nets mainly formed response large pathogens fungi a recent study analyzing neutrophils patient papillon lefevre syndrome pls lacking serine proteases showed neutrophils patient failed produce nets corroborating concept serine proteases particularly elastase regulate net formation 50 5254 papayannopoulos coworkers demonstrated neutrophil elastase highly increased cf airway fluids represents promising therapeutic target 1 4 enhances sputum solubilization cleaving histones enhance access exogenous nucleases dna the researchers also showed neutrophil elastase bound dna downregulates proteolytic activity could restrict host tissue damage this study extended recent report demonstrating nets represent reservoir active proteases dnase treatment increases free proteolytic activities suggesting cf patients dnase treatment could benefit addition protease inhibitors previous studies found correlation airway dna levels neutrophilic inflammation lung function parameters cf patients 9 57 58 our study confirms extends findings showing correlation free dna levels lung function chemokine levels fungal colonization cf patients the correlation neutrophil chemokine cxcl2 free dna levels cf airway fluids could one hand reflect increased cxcl2-mediated neutrophil chemotaxis could also hand involve cxcl2 potential trigger dna release neutrophils as lack convincing data supporting latter hypothesis underlying mechanistic basis correlation remains dissected future besides net associated products proteases cause harm host recent study identified surfactant protein key protein binding nets thereby promoting net mediated trapping p. aeruginosa this ample implications cf lung disease since surfactant protein found degraded cleaved serine matrix metalloproteases cf airway fluids 6064 result could impair antibacterial netosis related effects surfactant protein cf airways vivo regarding surfactant protein beyond proteins may interfere net formation and/or net activities could attractive therapeutic targets advanced cf lung disease our view net formation extended description rapid net formation vitro vivo 24 25 unraveling far unappreciated mode collaboration net formation chemotaxis phagocytosis convincing data skin infection models mice evidence human neutrophils still limited the potential role rapid net formation cf lung disease remains dissected summary study line previous investigations demonstrates free dna net like characteristics represents extracellular component cf airway fluids advanced stages cf lung disease nets seem harm good experimental data causative relationship lacking approaches interfere net formation net associated products dnases antiproteases supplementing surfactant protein targeting histones combination thereof could represent promising therapeutic strategies cf lung disease chronic lung diseases associated sustained neutrophilic inflammation 38 40 43

chronic obstructive lung disease determines morbidity and mortality of patients with cystic fibrosis ( cf ) . cf airways are characterized by a nonresolving neutrophilic inflammation . after pathogen contact or prolonged activation , neutrophils release dna fibres decorated with antimicrobial proteins , forming neutrophil extracellular traps ( nets ) . nets have been described to act in a beneficial way for innate host defense by bactericidal , fungicidal , and virucidal actions . on the other hand , excessive net formation has been linked to the pathogenesis of autoinflammatory and autoimmune disease conditions . we quantified free dna structures characteristic of nets in airway fluids of cf patients and a mouse model with cf - like lung disease . free dna levels correlated with airflow obstruction , fungal colonization , and cxc chemokine levels in cf patients and cf - like mice . when viewed in combination , our results demonstrate that neutrophilic inflammation in cf airways is associated with abundant free dna characteristic for netosis , and suggest that free dna may be implicated in lung function decline in patients with cf .

parenting stress escalates much faster rate among mothers disabled children comparison mothers non disabled children the addition disabled child family requires parents adopt new roles responsibilities turn creates change function family system indeed disabled children often demand effort daily activities social integration non disabled children for example terms social integration disabled children rely others extended period time due lack independence tend cause long term parenting stress mothers the personal growth psychological development children appear influenced parental attitudes specifically parents mental stability psychological traits found significantly impact disabled children1 further behavior disposition disabled children largely affected social surroundings thus parents stress3 parents experience repeated parenting stress typically react negatively children due parents adverse reaction children respond behavior evokes poor parenting behavior not surprisingly higher levels mother reported parenting stress associated higher levels denial coercive parenting behavior therefore parenting stress considered salient predictor inappropriate parenting behavior among mothers1 3 parenting stress among mothers elicited psychological child related factors well environmental factors family income supporting factors including fathers parenting participation4,5,6,7 previous studies focused role fathers reducing experience parenting stress among mothers traditionally mothers closest companions8 9 assuming role androgynous father fathers reduce negative effects gender roles interacting deeper level children therefore need socially introduce new concept regarding role family members research fathers parenting participation magnified8 however fathers parenting participation factor parenting stress mothers disabled children adequately studied thus objective study examine novel concept regarding role fathers investigating relationship fathers parenting participation parenting stress experienced mothers primary caregivers disabled children broadly research examine traditional parenting approaches places responsibility mother egalitarian parenting the sample consisted mothers disabled kindergarteners attended day care center rehabilitation center disabled gwangju one hundred questionnaires distributed randomly selected participants 83 completed returned one questionnaire returned missing data 82 the study carried accordance international ethical guidelines declaration helsinki approved local institutional review board the survey comprised series questions general characteristics table 1table 1.general characteristics household n=82)classificationfrequency number)percentage employ status mothersemployed2834.1unemployed5465.9co residing family memberscouple7591.5children82100.0father law44.9mother law67.3father22.4mother44.9others22.4reason couple separationno7591.5occupational issues33.7couple issues00.0divorce33.7death11.2child gendermale5061.0female3239.0diagnosis childbrain lesions4554.9down syndrome33.7intellectual disability1214.6developmental disorder67.3autism33.7others1315.8age childno response89.836 years old4251.2712 years old2935.4older 13 years old33.7 parenting participation fathers parenting stress mothers the former included age mother employment status education level type family couple co residence status family income latter included gender age diagnosis cause disease gestation period birth weight birth order the study used modified version questionnaire designed lamb validity reliability verified previous study fathers parenting participation support spouse parenting role satisfaction10 the questionnaire fathers parenting participation consisted 30 questions 10 relating interaction family 10 guidance 5 housekeeping activities 5 recognition leisure activities for question 5-point likert scale responses 1 strongly agree 5 used score ranged 30 points 150 points thus high score overall implied high levels aforementioned areas participation this study measured parenting stress mothers using parenting stress index short form psi sf based 101 questions parenting stress index developed abidin11 psi sf is divided 3 broad subscales based source mothers stress parental distress parent child dysfunctional interaction difficult child total 35 questions question 5-point likert scale ranging 1 strongly agree 5 used total scores could range 35 points 175 points whereby higher scores associated higher levels parenting stress a total score higher 90 points may indicate participant requires professional help spss version 20.0 windows spss inc chicago il usa used analyze data a frequency analysis conducted examine demographic characteristics participants examine reliability questionnaire fibally pearson product moment correlation coefficient used examine correlation parenting participation fathers parenting stress mothers the fathers parenting participation mean score 105.9 points indicates average fathers showed greater moderate participation parenting mean score fathers interaction family guidance recognition play leisure activities accordingly scores subscales converted 100 points effective score mostly found 70 points table 2table 2.descriptive statistics sub scales parenting participation fathers n=82)classificationmeanstandard deviationinteraction family35.87.8guidance35.97.3housekeeping activities17.76.2recognition play leisure activities16.54.4total score105.922.4 out highest possible score 175 points average mothers parenting stress 92.7 points when converted 100 points score found 52 points indicating parenting stress mothers disabled children moderate table 3table 3.descriptive statistics sub scales parenting participation mothers n=82)classificationmeanstandard deviationdistress mothers34.07.6dysfunctional interaction children29.16.8difficult child29.66.2total score92.717.2 higher level parenting participation fathers associated lower level parenting stress mothers reference subscales parenting participation fathers parenting stress experienced mothers fathers scores interaction family guidance housekeeping activities recognition play leisure activities showed significant negative correlation mothers distress score however reference subscales mothers parenting stress score dysfunctional interaction children revealed significant negative correlation fathers participation guidance well total score parenting participation fathers subscale score significant negative correlation guidance housekeeping activities fathers parenting participation total score finally subscales parenting stress mothers negatively correlated total score parenting participation fathers table 4table 4.correlations subscales parenting participation fathers parenting stress mothers n=82)distress mothersdysfunctional interactionwith childrendifficult childtotal score parentingstress mothersinteraction family0.3550.1950.1410.284guidance0.3690.2710.2180.348housekeeping activities0.3290.1990.2990.331recognition play leisure activities0.3670.1910.1090.276total score parenting participation fathers0.4070.2490.2250.358*p<0.05 p<0.01 the present study aimed examine relationship parenting participation fathers parenting stress experienced mothers disabled children also aimed provide baseline data facilitating positive parenting participation fathers order decrease parenting stress experienced mothers results show higher levels mother perceived father participation parenting associated lower levels distress among mothers however although dysfunctional interaction children difficult child significant positive correlations fathers parenting participation mothers parenting stress correlation moderate level the fathers interaction family recognition play leisure activities child significantly correlated recently several studies examined relationship fathers parenting participation mothers parenting stress focusing parents disabled children8 9 son examined structural relationship among parenting participation fathers parenting stress mothers parenting efficacy verified mediating effect mothers parenting stress relationship fathers parenting participation disabled children fathers parenting efficacy furthermore son found mediating role mothers parenting stress relationship fathers parenting participation disabled children mother parenting efficacy8 support present study also found negative relationship fathers parenting participation perceived mothers mothers self rated parenting stress notably son study found fathers interaction family strongest correlation mothers parenting stress according mothers reports fathers interactions families reflected fathers respected mothers opinions felt responsible parenting tried respond disabled children questions enthusiasm this implied high interaction fathers committed investing developing relationship trust children encouraging respecting curiosity this particularly true family context fathers moved away patriarchal role such family context instance would include fathers mothers resolving family issues together discussing important topics similarly prioritizing family system therefore fathers may longer conceptualized patriarchal authoritative mothers rather key players invest equally family furthermore fathers participate parenting mothers experience feeling solidarity satisfaction trust therefore mothers disabled children feel emotionally mentally stable parenting turn believed decrease parenting stress the present study explored relationship fathers parenting participation perceived mothers mothers parenting stress future research investigating factors influence fathers parenting participation may useful yet studied additionally because study sample size relatively small 82 participants survey limited gwangju area results may generalizable

[ purpose ] the purpose of this research was two - fold : ( 1 ) to evaluate the effects of father s parenting participation on parenting stress among mothers with disabled children and ( 2 ) more specifically , to investigate the importance of fathers parenting participation in decreasing mothers parenting stress . [ subjects and methods ] to examine these relationships , this study recruited 82 mothers with disabled children from rehabilitation centers in the gwangju city . the common characteristics of parents and children , father s parenting participation , and mother s parenting stress were assessed using standard questionnaires . [ results ] based on mother reports , findings suggest that as fathers parenting participation increases mothers parenting stress decreases . [ conclusion ] the present study reveals a need for improvement in parenting education and in providing fathers of disabled children with a temporary leave of absence from work . specifically , this research highlights the importance of shared parenting responsibilities among family members . finally , our findings suggest that developing a standardized national program for assisting parents with disabled children may help decrease parenting stress in mothers .

progressive nodular histiocytosis pnh rare normolipemic macrophage disorder first described taunton et al 1978 it belongs subgroup non langerhans cell histiocytosis lchs juvenile xanthogranuloma jxg family includes xanthoma disseminatum xd benign cephalic histiocytosis bch multiple adult xanthogranuloma maxg generalized eruptive histiocytosis geh according weitzman jaffee they present positive reaction factor xiiia cd68 cd14 negative reactions cd1a s-100 proteins these disorders difficult categorize primarily diverse pathological findings due overlapping clinical microscopic features a 30-year old gentleman presented us complaints asymptomatic nodular skin lesions body 10 years duration age 20 years started developing small skin colored lesions bilateral peri orbital areas these lesions continued increase size time lesions became pedunculated especially calves along appearance cutaneous lesions also noticed gradually progressive bilateral painless loss vision he complain itching watering photophobia discharge eyes he diagnosed eale disease underwent laser photocoagulation he developed premature cataracts eyes treated phacoemulsification posterior capsular intraocular lens implantation eyes prior presentation us underwent intra lesional steroid therapy using triamcinolone acetonide peri orbital lesions good response seen smaller lesions effect larger lesions the lesions sites removed using various modalities like cryotherapy radiosurgery surgical excision larger troublesome lesions cutaneous examination revealed multiple approximately 30 40 yellowish skin colored firm non tender papules nodules ranging diameter 5 40 mm face figure 1 trunk extremities elbows hands palms soles figure 2 decreasing order frequency these lesions located almost symmetrically peri orbital area mostly outer canthi also lower eyelids leading ectropion the smaller lesions face mounted skin larger lesions calf area pedunculated papular nodular lesions face eyelid large nodules seen elbows hand sole visual acuity time presentation 6/18(r 6/60(l the clinical differential diagnoses considered time presentation us multiple eruptive dermatofibromas xanthoma disseminatum pnh blood examination revealed hemoglobin 10.5 gm dl microcytic hypochromic blood picture total leukocyte count 7200/mm normal differential leukocyte count fasting lipid profile renal total serum proteins albumin normal reversal g ratio a cellular tumor seen centered dermis composed sheets oval spindle shaped cells arranged haphazardly short fascicles storiform pattern places figures 3a c the spindle cells oval elongated benign looking nuclei vesicular chromatin small nucleoli on immunohistochemistry cells positive cd68 figure 4 negative s-100 cd34 cd21 cd35 hmb45 supporting diagnosis spindle cell histiocytic tumor dab chromogen 100 based history clinical examination histopathological correlation dermatological disorder diagnosed pnh he started tab imatinib 400 mg od lesions developed encrustation stopped 5 months continued develop new lesions drug second line treatment pazopanib 800 mg od started stopping tab imatinib lines soft tissue sarcoma based age onset lesions areas body involved progression disease lab abnormality serum lipids possible differentiate pnh forms jxg family benign cephalic histiocytosis jxg usually occur early childhood jxg also reported adults lesions tendency resolve spontaneously period time multiple adult xanthogranuloma another important differential diagnosis pnh similar features jxg occurs adults xanthoma disseminatum ruled based absence mucosal systemic involvement normal lipid profile usually presents hyperchylomicronemia hypertriglyceridemia diabetes insipidus since accurate diagnosis specific disorder within jxg subgroup quite difficult made diagnosis pnh based history presence typical skin lesions progressive course histopathological demonstration spindle cells positive immunohistochemistry histiocyte marker cd68 negative s-100 non langerhan cell histiocytosis disorders difficult diagnose case presents another clinical expression variable confusing disorder knowledge this first case report progressive nodular histiocytosis associated eale disease

progressive nodular histiocytosis ( pnh ) is a rare normolipemic macrophage disorder and belongs to a subgroup of non - langerhans cell histiocytosis ( lchs ) which is characterized by a progressive course with no sign of spontaneous resolution but without systemic involvement . we report a 30-year - old gentleman who presented with skin lesions all over the body associated with gradual bilateral painless loss of vision . on examination , approximately 30 to 40 , skin - colored , firm , non - tender papules and nodules were noted over the body especially on the face and trunk . a skin biopsy revealed a cellular tumor in the dermis composed of oval to spindle - shaped cells , positive for cd68 but negative for s-100 , cd34 , cd21 , cd35 and hmb45 , supporting a diagnosis of spindle cell histiocytic tumor . ophthalmic examination revealed a generalized arteriolar attenuation in both eyes . he received tab imatinib 400 mg od for 5 months followed by tab pazopanib 800 mg od for 4 months and both the drugs were stopped due to lack of any response in the skin lesions . we report this case due to its rarity , characteristic clinical presentation , and its association with eale 's disease . primary treatment remains surgical excision of bothersome lesions and optimal systemic treatment is still unknown .

desmoplastic fibroma df benign locally aggressive lesion bone recognized intra osseous counterpart soft tissue fibromatosis usually seen affecting long bones pelvis occasionally presents jaw lesion mandible commonly affected compared maxilla cranium head neck region systematic literature search pubmed database national library medicine using df mandible keywords revealed total 57 published cases occurring mandible alone year 19692014 the cause df unknown stipulated varied pathogenesis ranging genetic endocrine traumatic factors exuberant reactive proliferation when differentiating neoplasms behave aggressively history expansion perforation cortical plates along histopathological confirmation would pointer right direction a 35-year old female patient visited department oral medicine radiology chief complaint slowly growing painless swelling left lower back tooth region since 3 years figure 1 clinical extra oral examination revealed expansion left inferior border mandible intra oral examination revealed solitary bony hard swelling measuring 4.0 cm 5.0 cm size obliteration left buccal vestibule relation 37 38 figure 2 clinical image showing swelling left side lower jaw intra oral photograph showing obliteration left buccal vestibule relation 37 38 left lateral oblique view radiograph showed multilocular radiolucencies fine trabeculations leading soap bubble appearance extending left angle mandible mesial root mandibular left first molar no displacement teeth resorption root seen figure 3 left lateral oblique view radiograph showing multilocular radiolucencies computerized tomography ct scan demonstrated buccal lingual cortical plate expansion soap bubble appearance figure 4 computed tomography scan showing buccal lingual cortical plate expansion surgical excision lesion the hematoxylin eosin stained tissue section showed hypo hyper cellular areas proliferation plump fibroblasts arranged interlacing fascicles dense collagen focal areas section also revealed dense collagenous stroma foci hyalinization figure 8 photomicrograph showing hypo cellular hyper cellular areas spindle cells arranged interlacing fascicles h&e stain 10 photomicrograph showing hyper cellular area proliferating plump fibroblasts h&e stain 20 photomicrograph showing proliferating plump spindle shaped fibroblasts collagenous stroma h&e stain 40 photomicrograph showing focus dense collagenous stroma focal areas hyalinization h&e stain 10 final diagnosis df arrived histopathological examination df rare locally aggressive myofibroblastic benign tumor connective tissue origin intra osseous lesion df first described jaffe 1958 named df 1965 the first report df jaw presented griffith und irby the histologic criteria df defined world health organization rare benign bone tumor composed spindle shaped cells minimal cytological atypia abundant collagen production desmoid tumor also called aggressive fibromatosis described df about 69% desmoid tumors abdominal extra abdominal variety occurring bone df although df affect age group patients affected first three decades life case the average age patients time final diagnosis 15.1 years metaphysis long bones especially tibia scapula femur frequent sites involvement mandible fourth common site involvement sex predilection remains unclear mandible lesions tend occur posteriorly ramus angle region this similar case report lesional tissue relation second third molars the symptoms nonspecific including diffuse moderate pain region tumor rest movement bone bears weight maxillofacial region dfs usually painless slow growing firm masses similar history painless radiographic appearance may vary uni locular multi locular without expansion perforation cortical plates according frick et al radiographs showed osteolytic lesions coarsened ridge like trabeculae 63% cases osteolytic lesions 24% cases mixed lytic mildly sclerotic lesions 13% cases ct revealed radiolucent 65% mixed radiolucent mildly sclerotic 35% matrix patterns the ct case clearly showed cortical expansion without resorption displacement adjacent teeth t1-weighted sequences mri showed signal intensities within lesions isointense hypointense adjacent normal muscle the hypocellular areas tumors abundant collagen responsible areas t2-shortening hyper cellular parts filled fibroblasts necrotic areas responsible higher intensity parts within lesions gross examination desmoid tumor appears firm rubbery white nonencapsulated fibrous growth histologically df contains mature fibrous connective tissue low variable cellularity spindle shaped fibroblasts myofibroblasts uniform long nuclei abundant stroma collagenous matrix lacking cellular pleomorphism nuclear hyperchromatism mitoses the differential diagnosis considered histologically would spindle cell tumors low grade fibrosarcoma important tumors fibrous histiocytoma fibrous dysplasia low grade intra osseous osteosarcoma tumor like lesions aneurysmal bone cyst juvenile bone cyst also present similar clinical picture though fibrosarcoma exhibits highly cellular stroma along high grades polymorphism mitosis low grade variant shows collagen rich tissue low cell count mitotic activity this similar histopathological picture df definitive diagnosis possible postoperative clinical development found df immunoreactivity cd117 estrogen progesterone receptors 50% cases showed positivity muscle specific markers -catenin pathway seem essential role tumorigenesis df desmoid type fibromatosis found majority tumor cells express mesenchymal marker vimentin immunoreactivity antidesmin anti s-100 protein df maxilla mandible extra osseous extensions treated complete excision including margin uninvolved soft tissue the recurrence rate 40 47% seen lesions treated curettage intra lesional resection making follow necessity

desmoplastic fibroma ( df ) is a benign intra - osseous neoplasm , that is , recognized as the intra - osseous counterpart of soft tissue fibromatosis in both gnathic and extra - gnathic sites . it has a propensity for locally aggressive behavior and local recurrence . an occurrence of intra - osseous lesion other than that of odontogenic origin is rare in the jaws . in this case report , we define the clinico - pathological and radiographic features of df of the mandible in a 35-year - old female , who presented to the outpatient department with a 3-year history of a slowly expanding painless mass in the left mandibular posterior region . thus , we present a classic case of df exhibiting characteristic features along with a review of the literature .

japan elderly individuals defined people aged 65 years known account 25% population people age concomitant decrease muscle strength1 this age related change affects ability walk2 ability walk elderly decreases associated decrease balance ability3 4 independent daily living activities5 show increased risk fall6 therefore necessary maintain ability walk elderly ground reaction force external force involved walking affects acceleration body center mass7 the vertical ground reaction force often measured gait analysis regarded representative measure walking8 the two peaks vertical ground reaction force early stance late stance phases reflect support body center mass the minimum value mid stance indicates vertical force applied ground decreases thus reaction force ground body also decreases9 the profile vertical ground reaction force correlates many parameters gait functional performance walking speed10 timed go test time functional reach distance11 elderly it also known vertical ground reaction force walking affected aging elderly people exhibit lower first peak second peak forces higher minimum value mid stance young people12 the vertical ground reaction force provides correlative information ability walk elderly people several studies reported elderly individuals exhibit age related alteration kinetic profiles walking hip knee joint moments elderly significantly lower young people13 moreover devita hortobagyi14 reported elderly people showed different distributions joint moments powers compared young individuals support stance phase achieved net extensor pattern moments ankle knee hip joint15 age related alterations lower extremity joint moment suggest difference support strategy elderly young date unclear causes difference profile ground reaction force elderly young the results previous study16 suggest men women make use different joint moments generation antero posterior ground reaction forces age showing age related alteration motor pattern used generate antero posterior ground reaction force moreover elderly people exhibit age related alteration support moment lower extremity changes joint moment may affect magnitude vertical ground reaction force analyzing relationships vertical ground reaction force lower extremity joint moments would possible clarify difference support strategies elderly young people therefore purpose study examine relationships vertical ground reaction force hip knee ankle joint moments walking elderly young individuals we hypothesized relation joint moments vertical ground reaction force differs elderly young similar previous study16 age related change support strategy use walking forty community dwelling elderly people 65 years old older mean age 70.1 years age range 6580 years 40 young people aged 20 29 years mean age 23.2 years participated study 20 males 20 females group the exclusion criteria included neurologic disorders osteoarthritis rheumatic arthritis joint pain affecting walking history surgery lower extremities spine all procedures approved hiroshima international university human research ethics committee participants gave written informed consent prior enrollment walking trials participants walked barefoot end 7 walkway self selected preferred walking speed a 3d motion analysis system 8 infrared cameras vicon mx vicon motion systems oxford uk 8 force plates amti watertown usa used record kinematic kinetic data sampling frequencies 100 1,000 hz respectively the force plate layout designed measure ground reaction force limb using four force plates arranged longitudinal direction participants instructed walk placing foot left right force plate avoiding stepping two force plates simultaneously a total 30 reflective markers placed bilaterally following landmarks participant acromion process olecranon styloid process radius anterior superior iliac spine posterior superior iliac spine greater trochanter medial lateral femoral condyles mid point greater trochanter lateral femoral condyles medial lateral malleoli mid point lateral knee joint line lateral malleolus head first fifth metatarsal calcaneal tuberosity these anatomical markers used construct anatomical coordinate systems pelvis thigh shank foot segments the coordinates joint center calculated following description previous study17 a 7-link segmental model developed calculate kinematic kinetic variables hip knee ankle joints using inverse dynamics technique davis et al.18 vaughan et al19 anthropometric parameters mass position center mass moment inertia segments obtained report okada et al20 we calculated hip knee ankle joint moments using local coordinate system origin joint center study joint moment normalized subject body mass nm kg walking speed calculated using center gravity cog whole body averaged 3-s data collection period stride length measured antero posterior distance left calcaneal tuberosity marker one heel contact next heel contact initial contact assumed occur vertical reaction force exceeded 10 n toe assumed occur first frame following initial contact vertical reaction force fell 10 n. account different builds ground reaction force normalized subject body mass n kg first second peaks vertical ground reaction force minimum value two peaks extracted ground reaction force profile fig 1.graph representation vertical ground reaction forces joint moment hip knee ankle gait cycle peak values joint moment stance phase extracted joint moment profile fig graph representation vertical ground reaction forces joint moment hip knee ankle gait cycle two way analysis variance performed examine differences elderly young interactions age gender age body height body weight body mass index bmi spatio temporal parameters two way analysis covariance also performed examine difference elderly young interactions age gender vertical ground reaction force peak values joint moment using walking speed covariate step wise linear regression performed determine joint moments predicted amplitude vertical ground reaction force elderly men elderly women young men young women relationships among peak values hip knee ankle joint moments early stance phase first peak force minimum value vertical ground reaction force investigated relationships among peak values hip knee ankle joint moments late stance phase second peak force vertical ground reaction force also investigated the stepping method criteria f value 0.05 inclusion segmental model 0.10 removal model the baseline demographic characteristics study subjects presented table 1table 1.characteristics subjectvariableelderlyyoungmales n 20)females n 20)males n 20)females n 20)age years)69.45 4.80)*70.70 4.62)*22.80 2.80)23.50 2.70)height m)1.64 0.07)*1.49 0.04)*1.71 0.07)1.57 0.05)weight kg)62.28 9.78)52.09 6.20)64.04 8.34)52.91 9.92)bmi kg m)23.06 2.96)*23.25 2.69)*21.74 2.63)21.21 3.30)value mean standard deviation sd significant difference young p 0.05 bmi body mass index the elderly participants significantly shorter body height higher bmi younger study participants significant difference body masses value mean standard deviation sd significant difference young p 0.05 bmi body mass index spatio temporal parameters peak values joint moment presented table 2table 2.spatio-temporal parameters peak values joint momentvariableelderlyyoungmales n 20)females n 20)males n 20)females n 20)walking speed s)1.20 0.16)*1.15 0.12)*1.26 0.12)1.29 0.10)stride length body height)73.63 6.79)*73.59 5.48)*77.47 5.64)81.68 5.69)first peak force n kg 10.57 0.94)10.71 1.06)10.96 0.75)10.90 0.79)minimum force n kg)7.29 0.58)7.52 0.58)7.20 0.58)7.00 0.60)second peak force n kg 10.43 0.50)9.97 0.61)*10.64 0.52)10.74 0.51)hipextension moment nm kg 0.76 0.31)0.58 0.29)0.72 0.19)0.64 0.29)flexion moment nm kg 0.67 0.17)0.61 0.17)0.71 0.14)0.60 0.13)kneeflexion moment early stance nm kg)0.23 0.15)0.21 0.11)0.08 0.17)0.15 0.11)extension moment early stance nm kg)0.58 0.29)0.74 0.26)0.71 0.20)0.76 0.27)flexion moment terminal stance nm kg)0.21 0.09)0.10 0.14)0.18 0.12)0.19 0.12)extension moment terminal stance nm kg)0.20 0.07)*0.26 0.12)*0.17 0.08)0.17 0.10)ankledorsiflexsion moment nm kg)0.21 0.10)0.24 0.11)0.25 0.08)0.21 0.11)plantarflexion moment nm kg)1.16 0.22)*1.02 0.16)*1.30 0.11)1.22 0.19)value mean standard deviation sd significant difference age groups p 0.05 significant difference gender groups p 0.05 the elderly males females significantly slower walking speeds shorter stride lengths young participants significant different cadence two age groups the second peak vertical ground reaction force exhibited significant interaction age gender elderly females significantly lower second peak vertical ground reaction force younger females there approximately 7.5 percent difference elderly females young females groups on hand extension moment terminal stance phase knee higher elderly participants there approximately 14.5 30.0 percent differences elderly young groups males females respectively although flexion moment terminal stance phase knee exhibited significant interaction age gender significant difference age groups neither malese females value mean standard deviation sd significant difference age groups p 0.05 vertical ground reaction force results step wise linear regression analyses vertical ground reaction force presented table 3table 3.models vertical ground reaction force forward step wise regression analysis.subjectindependent variableunstandardizedcoefficientstandardizedcoefficientadjusted rfirst peak forceelderly femalehip extension moment2.140.610.34young female knee extension moment early stance1.350.470.22minimum value mid stanceyoung maleknee extension moment early stance1.950.690.48elderly femaleknee extension moment early stance1.310.510.26young femaleknee extension moment early stance1.040.540.29second peak forceyoung maleknee extension moment late stance2.670.450.21elderly female ankle plantarflexion moment2.220.570.33 p 0.05 vertical ground reaction force joint moments related vertical ground reaction force shown fig 2fig 2.the joint moments predict amplitude vertical ground reaction force group elderly males exhibited statistically significant factors related vertical ground reaction force p 0.05 vertical ground reaction force joint moments predict amplitude vertical ground reaction force group young males females elderly women groups knee extension moment early stance phase related minimum value vertical ground reaction force mid stance young males the knee extension moment late stance phase related second peak vertical ground reaction force on hand young females knee extension moment early stance phase related first peak vertical ground reaction force in contrast group elderly females hip extension moment related first peak vertical ground reaction force ankle plantarflexor moment related second peak vertical ground reaction force this study examined relationships vertical ground reaction force hip knee ankle joint moments walking young elderly individuals the analyses study performed consideration gender well age this done previous report21 indicated significant gender differences walking speed stride length kinematics kinetics study parameters exhibited significant gender difference interaction age gender thus order maximize ability determine effects age walking study subjects divided gender the first peak minimum value mid stance vertical ground reaction force significantly different elderly young hand the second peak vertical ground reaction force elderly women significantly lower young women yamada maie11 reported elderly people lower first peak second peak forces higher minimum value mid stance younger people hand larish et al.22 reported significant difference first peak force significant difference second peak vertical ground reaction force because amplitude peak vertical ground reaction force affected cadence rather stride length23 may difference elderly young people first peak vertical ground reaction force both first second peaks vertical ground reaction force correspond upward acceleration body center mass8 the elderly females study low upward acceleration body center mass push this may increase load front limb producing upward acceleration double support phase elderly females the plantar flexion moment ankle elderly smaller approximately 14.5 percent young people therefore plantarflexor muscles elderly exhibited age related functional decline knee extension moment early stance negative relationship minimum value mid stance knee extension moment late stance positive relation second peak vertical ground reaction force young males the knee extension moment early stance positive relation first peak force negative relation minimum value mid stance ground reaction force young females these results suggest vertical ground reaction force may controlled knee extension young people previous study16 the knee extension moment late stance associated anterior component ground reaction force young males knee joint moment associated antero posterior component ground reaction force young females the knee extension moment young people important decreasing reaction force ground body mid stance increasing ground reaction force weight acceptance push phase it necessary muscle strength order increase joint moment walking brown et al.25 reported relationship quadriceps strength walking ability especially young people rather elderly therefore knee joint function important support walking young people elderly females study extension moment hip positive relationship first peak ground reaction force previous study16 the extension moment hip associated posterior component ground reaction force elderly females present result consistent result previous study the elderly females large hip extension moment ground reaction force early stance phase relatively high although knee joint moment associated first peak vertical ground reaction force young females hip joint moment associated first peak vertical ground reaction force elderly females the elderly young females study made use different joints control vertical ground reaction force these results mostly consistent hypothesis age related change support strategy walking support body provided combination knee extensors hip extensors early stance phase26 while walking moreover elderly people forward trunk lean large hip flexion angle early stance14 function muscles surrounding knee joint reduces aging addition age related alternation attitude walking weight acceptance early stance phase elderly accomplished hip joint weight acceptance initial stance therefore necessary elderly females develop hip extensor the extension moment early stance phase knee negative relationship minimum value ground reaction force mid stance elderly females this result similar one found young females study order reduce mechanical load exerted body mid stance may important elderly females strengthen quadriceps muscles generate knee extension moment early stance moreover plantarflexion moment ankle positive relationship second peak ground reaction force elderly females winter15 reported ankle plantarflexion moment major contributor support push the rate decline maximal voluntary isometric force aging greatest plantar flexors28 it probables elderly females lower plantarflexion moment ankle young females second peak vertical ground reaction force smaller elderly females study a previous study reported importance plantarflexor muscles ankle walking elderly29 therefore important strengthen plantarflexor muscles ankle elderly females order enhance support late stance in contrast factors related first peak second peak forces minimum value vertical ground reaction force elderly males found it reported contribution joint moment antero posterior ground reaction force small elderly males16 individual variation greater among elderly males factors related vertical ground reaction force found significant similar antero posterior ground reaction force the changes physical function aging equal males females30 physical characteristics lifestyle social background different males females therefore gender differences age related changes walking characteristics elderly males make use various joint moment patterns control vertical ground reaction force the relationship vertical ground reaction force lower extremity joint moments walking elderly young subjects investigated however step wise linear regression analysis find factor related vertical ground reaction force several models analyzed data divided age gender using mechanical analysis using equations motion kepple et al.26 showed support body provided ankle plantarflexor moment single limb support combination ankle plantarflexors knee extensors hip extensors double limb support younger people therefore order clarify age related changes walking mechanism elderly people necessary perform detailed analyses dynamic equations motion furthermore unable identify causative factor age related changes support strategy walking further studies required determine causes changes strategy aging

[ purpose ] this study examined the relationships between joint moment and the control of the vertical ground reaction force during walking in the elderly and young male and female individuals . [ subjects and methods ] forty elderly people , 65 years old or older ( 20 males and 20 females ) , and 40 young people , 20 to 29 years old ( 20 males and 20 females ) , participated in this study . joint moment and vertical ground reaction force during walking were obtained using a 3d motion analysis system and force plates . stepwise linear regression analysis determined the joint moments that predict the amplitude of the vertical ground reaction force . [ results ] knee extension moment was related to the vertical ground reaction force in the young males and females . on the other hand , in the elderly females , hip , ankle , and knee joint moments were related to the first peak and second peak forces , and the minimum value of vertical ground reaction force , respectively . [ conclusion ] our results suggest that the young males and females make use of the knee joint moment to control of the vertical ground reaction force . there were differences between the elderly and the young females with regard to the joints used for the control of the vertical ground reaction force .

economic impact influenza immense due large number lost working hours hospitalizations medical complications treatment costs although vaccines influenza exist rapid mutation influenza virus calls constant surveillance annual vaccine reformulation a huge body sequence data annotations knowledge available literature online resources biological databases genbank uniprot protein data bank epiflu database openflu database influenza research database ird immune epitope database iedb however underlying mechanisms host pathogen interaction still completely understood the lack universal broadly neutralizing influenza vaccine attributed among factors combinatorial complexity host immune system highly variable nature viral antigens leading immune escape emerging influenza variants 9 10 one approach attempt overcome challenges immune escape raise cell response class class ii epitopes conserved among viral strains 11 12 public databases represent valuable resource study development broadly protective cell vaccines ability analyze data falls behind pace data accumulation they include keyword text search tools sequence comparison tools blast algorithm multiple sequence alignment tools mafft muscle clustal 3d structure visualization tools 17 18 hla binding prediction algorithms 1921 conservation analysis tools 22 23 among others the application tools discrete steps yield valuable information however extraction higher level knowledge requires integrating data multiple databases employing various analytical tools answer specific questions for example new infectious influenza strain emerges h9n7 avian flu new seasonal flu desirable rapidly investigate similarities dissimilarities known sequences epidemic pandemic potential humans different past vaccine strains t- b cell epitopes previously circulating strains estimate immune escape potential additionally new pandemic strains 2009 swine flu desirable establish origin identify strains useful vaccine candidates well defined workflows enable rapid extraction knowledge automated generation reports contain information knowledge based systems previously utilized 26 27 the integration multistep analysis multidimensional data vaccine analysis discovery requires automation analytical workflows flukb knowledge based system integrates multiple types influenza data analytical tools workflows support vaccine target discovery the datasets flukb consist curated enriched standardized protein sequence data immunological data multiple data sources set modular analysis tools the analysis tools infrastructure comprises library individual tools along standard applicable multiple pathogens specific influenza vaccine target discovery workflows furthermore developed standardized nomenclature enable speed data mining using automated workflows flukb user friendly web based interface access data tools predefined workflows workflow reports kb builder consists seven major functional modules enable automated data extraction multiple sources data cleaning import central repository integration basic analysis tools integration advanced analysis tools workflow definition update maintenance the kb builder framework enabled setting web accessible knowledge base analysis workflows a workflow takes user request performs complex analyses combines specific data analytical tools feeds results subsequent analyses produce comprehensive report these interfaces access search routines analytical tools workflows use combination php perl common gateway interface cgi c background software development kb build flukb carried centos 5.11 linux environment the web server used apache http server 2.2.3 access web server per default parallelized user the linux server 16-core server 32 gb ram able handle traffic website the data repository within flukb contains four types data protein sequence data hla related data cell epitopes hla ligands 3d crystal structures neutralizing antibody related data protein sequences available influenza b c viruses collected ird genbank hla related data collected iedb the complex structures neutralizing antibodies influenza virus hemagglutinin ha collected protein databank pdb the binding neutralization assays neutralizing antibody collected primary literature described the following sequence data annotations extracted ird protein sequence genbank identifiers gi accession numbers uniprot nomenclature type host location year subtype available the metadata included vocabulary comprises instances following terms protein names host names geographic locations years subtypes the vocabulary comprised correct terms well variants terms erroneous terms updates if terms within entry matched correct terms entry automatically annotated converted flukb format if erroneous term identified curator alerted correct term proposed entry the curator approves change manually corrects entry updates vocabulary needed new term identified update dataset the vocabulary iteratively increases size update less 20 new terms usually identified update this approach enables data curation extremely high quality performed fast figure 2 upper path we converted existing nomenclatures whenever possible standardized formats verify protein annotations newly added entries protein assignment strain proteomes was done aligning entry proteome sequence representative influenza reference sequences using blast algorithm we selected 10 proteins uniprot detailed annotations reference sequences protein two influenza types b the reference sequences shown supplemental table s1 see supplementary material available online http://dx.doi.org/10.1155/2015/380975 the immunological data extracted iedb include cell epitope sequence epitope type hla binding naturally processed cell epitope pubmed references experimental methods results hla allele restriction figure 2 lower path flukb includes entries iedb bind hla class ii allele least one positive result reported cell epitopes neutralizing antibody the following descriptive information provided flukb isolation information human samples antibody phage display libraries primary literature corresponding crystal structure antibody ha complex pdb database b cell epitope sequence variants detected experimentally validated strains computationally defined b cell epitopes ha protein displayed sequence 3d structure jmol each influenza strain sample annotated using nomenclature originally proposed providing shorthand description influenza virus strains for example nomenclature influenza isolate type subtype h2n3 isolated duck heinersdorf 1986 written using original nomenclature peking duck heinersdorf/648 4/1986(h2n3 peking duck heinersdorf/648 4/1986(h2n3 lack standardization nomenclature led inconsistent nomenclature incomplete metadata thus increasing difficulty extraction specific data subsets analysis first organism name term erroneous peking duck traditional chinese dish second unclear heinersdorf located ensure complete access control sequence data within flukb entry the key represented flukb standardized fasta header provides condensed detailed summary sample information the flukb data mining key heinersdorf sample ha protein flu0175850|type a|host:/mallard;anas platyrhynchos;8839|location heinersdorf;berlin germany;de be|isolate:648 4|year:1986|subtype h2n3|protein ha|seqtype complete|variant:1|vaccine:_|genbank cy117179|geneinfo 386644010|uniprot:_|original peking duck heinersdorf/648 4/1986|key yes flu0175850|type a|host:/mallard;anas platyrhynchos;8839|location heinersdorf;berlin germany;de be|isolate:648 4|year:1986|subtype h2n3|protein ha|seqtype complete|variant:1|vaccine:_|genbank cy117179|geneinfo 386644010|uniprot:_|original peking duck heinersdorf/648 4/1986|key yes search key compresses detailed sequence annotations fasta format enabling easy combination results sequence comparison analysis annotations standardized formats host geographic location enable proper grouping mapping results host species the ncbi taxonomy ids bird life international taxonomy http://www.birdlife.org/datazone/info/taxonomy names used standard terms including ncbi taxonomy number geographical locations two letter iso codes countries provinces used iso-3166 2012 this allows host species geographic term described nonambiguous terms the fasta format easily understandable descriptive nature fields fasta header finally use term key yes entries could fully annotated allowing utilized within analysis framework flukb could fully annotated assigned key found search these tools include selection keyword searching tools mafft multiple sequence alignment msa blast sequence similarity search specialized tools analysis variability include sequence conservation metrics visualization using block entropy analysis the cell epitope prediction tools hla class class ii integrated within flukb vaccine related analyses flukb enables conservation analysis single positions within protein sequences linear blocks amino acids extracted multiple sequence alignments msa proteins using block entropy in addition virtual peptides constructed discontinuous epitopes within msa analyzed using block entropy enabling variability analysis b cell epitopes it displays amino acids corresponding one letter code graph amino acids present one position stacked top frequency position based individual height graph blocklogo enables variability analysis peptides either linear peptides discontinuous strings amino acids rather single residues the combinatorial number possible blocks created weblogo quickly become large variation individual positions blocklogo shows exact peptides frequent investigated positions class the alleles available predictions hla a02:01 -a03:01 -a11:01 -a2402 -b07:02 -b08:01 -b15:01 since prediction accuracies alleles relatively high additionally predict binders hla a01:01 since allele high frequency human population although predictions slightly lower accuracy seven benchmarked alleles collectively alleles cover approximately 82% human population class ii mhc predictions used netmhciipan 3.0 users predict binders hla drb101:01 03:01 04:01 07:01 11:01 13:01 15:01 benchmarked validated high accuracy the standardized data mining key flukb enables sequence similarity searching display sequence origin world map purpose the query sequence entered search window optionally maximal number amino acid mismatches selected it combined sequence similarity analysis allow user select query sequence find closest matches flukb visualize world map this feature provides visualization epidemiological information useful evaluating spread given virus closely related variants the flukb sequence repository december 2014 contains 402,306 sequence entries 75,426 unique strains influenza there 67,907 type 7,028 type b 194 type c 297 unknown type sequence entries 330,435 full length sequences 71,501 fragments 370 protein sequences failed align well template alignments annotation process each sequence entry contains information location host time isolation well standardized nomenclature identification strains each entry contains protein sequence standardized curated enriched annotations table 2 the epitope repository contains total 357 unique cell epitopes 194 class 163 class ii 685 unique hla binders 572 class 113 class ii each record describes type epitope cell epitope naturally processed hla binder epitope sequence type exact epitopes included repository experimental method used validation hla restriction literature references twenty eight neutralizing antibodies influenza virus crystal structures ha antibody complexes available pdb twenty antibodies target globular head ha protein binding sites remaining eight antibodies located ha stem region all antibodies classified broadly neutralizing cross neutralization within subtype across subtypes strain specific antibodies we plan yearly updates flukb moving forward new data tools become available the sequence data collected ird subject extensive cleaning quality control qc enrichment annotations we found 142,232 38.25% 402.306 entries contained least one type error ambiguity missing data most errors geographic location fields 72,340 17.9% error 6,821 12.1% missing information entry see table 3 initial screen data found 2,977 entries conform nomenclature standard including 305 entries lacked information host species 867 entries lacked separation fields within nomenclature 1,805 deficiencies furthermore abbreviations alternative misspelled names constituted largest proportion errors present 10,000 entries all name related errors corrected dictionary consolidation using dictionary standardized metadata terms an example redundancy shown table 1 host mallard found 16,457 flukb entries described 14 different terms total 96.41% errors various types described corrected 469 standardized forms missing data location host species added manually searching original literature our effort data cleaning enrichment stage focused minimizing errors maximizing data completeness enhance knowledge extraction discovery potential vaccine targets influenza well genetic epidemiological modeling viral strains because system reference sequences templates reference msa implemented flukb expect majority future entries automatically corrected contain errors redundancies already encountered system any new errors subject manual curating updating dictionaries enable automated data mining workflows created data mining keys original nomenclature influenza viruses standardized terms the data mining keys utilized ncbis taxid database host species iso codes geographical location iso-3166 2012 a total 398,078 sequences 98.95% assigned new developed nomenclature 4,228 1.05% could assigned original standard nomenclature included data mining key reference additional literature searches text mining article databases data mining vaccine targets often requires analysis subsets data example patient data specific hla profile age group phenotypes factors similarly epidemiological modelling may need analysis sequences certain hosts example specific migrating birds limited geographical locations the host time location collection key information help determine spread specific influenza strains central better understanding influenza outbreaks the data mining keys enable analyses standardized nomenclature pattern recognition algorithms utilize labels entries without data mining key made unavailable analysis flukb inclusion entries lack data could affect reliability outcome results the data mining keys furthermore nomenclature crucial automation computational analyses standardization nomenclature fields allows computer interpret data automatically previously limited for instance taxonomy hosts enables host specific analyses potentially reveal features important interspecies transmission influenza proper organization data allows grouping data ancestral species variability followed time furthermore iso codes geographical location country provinces enhance analyses instance epidemiological studies increased resolution terms actual spread analysed this information used analysis changes cell b cell epitopes in flukb two search strategies deployed sequence search annotation based epitope based the first keyword search enables user extract data flukb specific subsets second sequence similarity search blast these search types vital following data analysis enable user select needed datasets based specific scientific questions the user query sequence entries information type protein subtype year range country province host original nomenclature sequence type fragment full protein keyword search an example entry page retrieved flu0306481 strain name guangdong/1/2013 protein ha shown figure 3 flukb indexed database generated sequence entries searched sequence similarity using blast algorithm the standard parameters used e value 10 word size 2 substitution matrix blosom62 gap cost 11 extension 1 size result list 500 pairwise list 250 besides sequence search flukb entries searched cell epitopes b cell epitopes tab entering either list sequence ids query window selection subsets proteins name influenza type subtype range years identification country province host complete sequences fragments the protein subsets selection window supplemental figure s1 used sequence variability analysis block entropy calculation appropriate tabs epitope block entropy cell epitopes uses protein subsets selection window enables input epitope sequence the analysis variability viral sequences important understanding emergence new strains immune escape changes pathogenicity extent spread viral strains vaccine design the variability analysis performed interactively variability analysis tools also integrated cell b cell mapping tools relevant workflows the main tools analysis variability blast search accessed individual entries figure 3 find similar sequences sequence alignment tools tab the msa performed results blast search selection sequences clicking the positions variability within msa results color coded better visual inspection sequence hyperlinked record supplemental figure s2 sequence variability analysis tool plots entropy red curve percentage sequences blue curve containing consensus amino acid positions along consensus sequence supplemental figure s3 block entropy calculation visualizes conservation peptides lengths appropriate immune recognition rather individual residues for example three cell epitope entries displayed record entry page figure 3 in addition prediction cell epitopes performed selecting allele peptide length predicted hla binders the visual display experimentally verified cell epitopes shown figure 4(b t cell epitope search also initiated search tab epitope searched sequence the results appear list epitopes along binding cell restriction specificities the list hyperlinked epitope record example shown figure 4(a finally cell epitope search performed using workflow titled vaccine targets workflows tab after selection input parameters example allele hla a0201 protein ha influenza type subtype year(s 2013 2014 affinity threshold 500 nm conservation threshold 95% remaining values default 98 sequences selected report generated b cell epitope analysis performed search tab selecting antibodies list end may 2014 28 antibodies detailed neutralizing structural information deposited flukb these antibodies listed webpage respective b cell epitopes displayed three interactive structures x-31 strain specific antibodies ha structure 1ken broadly neutralizing antibodies ha structure 1eo8 influenza b virus antibodies ha structure 4fqk this feature enables visual comparison antibody specific b cell epitopes neutralizing antibody isolation information structure information computational identified b cell epitope information accessed also neutralized motifs escape motifs extracted experimentally validated strains primary literature presented well in addition two workflows implemented analysis neutralization coverage estimation b cell epitope mapping supplemental figure s4 the neutralized escape coverage specific existing neutralizing antibody calculated complete population influenza strains the strain population coverage neutralizing antibody assessed within selected subset influenza strains year range specific subtype geographic coverage cross neutralization coverage known neutralizing antibody estimated based sequence comparison known neutralizing epitopes this tentative discontinuous peptide compared b cell epitopes experimentally validated strains flukb offers capability address complex questions relating sequence variability specific subsets identification potential cell epitopes selection combination epitopes polyvalent vaccine constructs the tools data reorganized tools created answer additional questions example relating epidemiological modeling analysis cross protective potential neutralizing antibodies publically available influenza data valuable resource computational analyses applications vaccine design similarly existing bioinformatics tools provide means extraction information new knowledge however utilize full potential resources data preprocessing must performed analytical tools must carefully combined well defined workflows these workflows allow users ask specific questions scientific technical clinical provide means systematic data analysis the infrastructure data tools backbone flukb similar knowledge based systems 26 27 despite many years research available vaccines influenza remains major public health burden threat major new pandemic multiple data sources provide information protein nucleotide sequences immune epitopes influenza 2 58 39 40 they represent well maintained catalogues influenza sequences annotations along selection basic search tools the flukb developed focusing different purpose facilitation data mining influenza vaccinology immunology influenza infection the flukb clean standardized data integrating information antigen sequences immunological epitopes the set integrated analysis tools workflows designed aid rational vaccine design this includes discovery vaccine targets assessment variability depth analysis immune epitope flukb unique data mining system largely automated knowledge discovery ever increasing body influenza data applications cell b cell immunology vaccinology systematic discovery influenza vaccine targets requires highly accurate date standardized data influenza antigens immune epitopes sequence epitope data available publications various reports databases vary quality granularity data formats the extraction knowledge discovery vaccine targets diverse scattered data sources challenging time consuming task flukb integrates content analytical tools unified system enables automation complex queries discovery flukb contribution long standing quest universal influenza vaccines 41 42 allowing large scale analysis large collection annotated influenza sequences

flukb is a knowledge - based system focusing on data and analytical tools for influenza vaccine discovery . the main goal of flukb is to provide access to curated influenza sequence and epitope data and enhance the analysis of influenza sequence diversity and the analysis of targets of immune responses . flukb consists of more than 400,000 influenza protein sequences , known epitope data ( 357 verified t - cell epitopes , 685 hla binders , and 16 naturally processed mhc ligands ) , and a collection of 28 influenza antibodies and their structurally defined b - cell epitopes . flukb was built using a modular framework allowing the implementation of analytical workflows and includes standard search tools , such as keyword search and sequence similarity queries , as well as advanced tools for the analysis of sequence variability . the advanced analytical tools for vaccine discovery include visual mapping of t- and b - cell vaccine targets and assessment of neutralizing antibody coverage . flukb supports the discovery of vaccine targets and the analysis of viral diversity and its implications for vaccine discovery as well as potential t - cell breadth and antibody cross neutralization involving multiple strains . flukb is representation of a new generation of databases that integrates data , analytical tools , and analytical workflows that enable comprehensive analysis and automatic generation of analysis reports .

nasopharyngeal carcinoma npc endemic disease within specific regions world the highest incidence found among southern chinese people especially cantonese origin whereas among caucasians north american western countries sporadic radiation therapy rt alone combined chemotherapy paramount approach initial treatment option npc distant metastasis however remains one major problems radical treatment patients locally advanced disease we report case 68-year old patient advanced npc developed intrathoracic endotracheal metastasis rt we believe first reported case intrathoracic endotracheal metastasis npc patient a 68-year old man presented patient department september 21 2004 3-month history headache hearing loss computed tomography ct revealed nasopharyngeal mass extending left parapharyngeal space left carotid sheath skull base an enlarged cervical lymph node 2 2 cm found left level ii pathology showed nasopharyngeal undifferentiated nonkeratinizing carcinoma according 2002 american joint committee cancer staging system the patient received initial dose 66 gy conventional rt boost dose 10 gy three dimensional conformal radiation therapy 3d crt primary site prophylactic radiation given bilateral neck doses 63.3 gy upper neck 50 gy lower neck however 2 months later metastatic nodule 1.5 1.1 cm found left lower lobe lung he received 4 cycles chemotherapy vinorelbine cisplatin 2 cycles chemotherapy docetaxel cisplatin 3d crt dose 66 gy nodule 33 fractions 6.5 weeks thirty four months initial rt patient presented cough hemoptysis ct showed presence enlarged lymph node measuring approximately 1.5 1.5 cm para aortic arch 2 immunohistochemical analysis found ck ck7 ck20 ttf-1 eber confirming tumor nasopharyngeal origin he treated conventional rt anterior posterior posterior anterior fields 40 gy mediastinum the patient tolerated treatment well significant acute side effects treatment interruption he died nonmalignant disease signs tumor recurrence august 2008 2 years treatment completion metastatic tracheal tumors extremely rare usually arise direct invasion neighboring primary lesions carcinomas bronchus larynx thyroid mid esophagus similarly tracheal metastasis distant site also poorly documented upper trachea frequently involved site best knowledge report intrathoracic endotracheal metastasis nasopharyngeal origin distant metastasis treatment main problem npc patients advanced disease large cohort study lee et al 2,687 consecutive patients irradiated 6-mv photons median total dose 66 gy after median follow 3.4 years 732 patients 27% found progressive disease 16% distant failure predominant pattern treatment failure however specific sites distant failure study given yi et al found bone common site distant metastasis followed liver lung the patient presented developed solitary metastasis lung para aortic arch prior presence intrathoracic endotracheal lesion it certain whether secondary tracheal tumor consequence lung metastasis anatomically lung malignancies may spread mediastinum result mediastinal lymph node involvement intrapulmonary hilar lymphatic drainage the enlarged tracheal nodule patient likely caused direct invasion mediastinal lymph nodes since separated anatomically the presence endophytic tumor growth intact outer layer trachea found ct images suggest likely separate metastatic deposit hemoptysis coughing common symptom patients endotracheal endobronchial metastasis incidence 41 62% although ct provides valuable information tumor location effect distal lung parenchyma lymph node status metastatic lesions helps us plan management bronchoscopy remains gold standard quickly establishing diagnosis management 8 9 the appropriate management patients endotracheal metastases depends tumor stage tumor location histopathology patient performance coexisting disease(s since patients usually present advanced disease surgery routinely performed unless patient emergency situation needs prompt symptom relief bronchoscopic treatment considered alternative surgery avoid excessive morbidity mortality associated procedure however if treatment emergent modalities brachytherapy external beam radiotherapy chemotherapy considered case long term complete tumor control achieved conventional rt plus 3d crt suggesting external beam rt may appropriate management approach achieve long term tumor control disease

intrathoracic endotracheal metastasis from a very distant site is extremely rare . we report the first case of such a disease in a 68-year - old man with nasopharyngeal carcinoma who presented with a cough and hemoptysis 34 months after finishing radiotherapy . prior to tracheal metastasis , he developed a solitary metastasis in the lung and underwent chemotherapy followed by radiotherapy . computed tomography showed the presence of an enlarged lymph node in the para - aortic arch . fiberoptic bronchoscopy revealed an endotracheal tumor 1 cm above the carina . histological and immunohistochemical analyses confirmed its nasopharyngeal origin . he was treated with conventional radiotherapy and three - dimensional conformal radiotherapy ; complete tumor remission was achieved . he died of nonmalignant disease with no signs of tumor recurrence 2 years after treatment completion . radiotherapy may be an appropriate management approach to achieve long - term tumor control for this disease .

though exact incidence unknown ranges 3 10% nulliparous population significant public health threat globally contributing greatly maternal perinatal mortality morbidity extensive changes occur kidneys part end organ damage preeclampsia proteinuria occurs consequence reduction integrity glomerular barrier reduced tubular reabsorption it remains important objective criterion diagnosis preeclampsia used classify severity well predict adverse fetomaternal outcomes preeclampsia among various methods available quantify proteinuria alternative methods like spot urine sample protein creatinine p c ratio avoid influence variations urinary solute concentrations reduce delay diagnosis management preeclamptic patients though serum uric acid level limited use initial diagnosis preeclampsia many investigators shown correlates well disease severity study tried correlate spot urine p c ratio 24-h urine protein estimation test diagnostic accuracy detecting significant proteinuria we also correlated spot urine p c ratio serum uric acid levels tried analyze association proteinuria hyperuricemia adverse fetomaternal outcomes preeclamptic women this observational correlation clinical study conducted obtaining clearance hospital ethics committee this prospective study conducted november 2010 may 2012 among pregnant women admitted hospital suspicion preeclampsia primigravida singleton pregnancy cephalic presentation diagnosis preeclampsia included study preeclampsia diagnosed blood pressure 140/90 mm hg two occasions least 4 h apart single diastolic reading 110 mm hg 20 week pregnancy presence proteinuria 1 detected dipstick urine analysis women previous renal disease chronic hypertension urinary tract infection pathological vaginal discharge required delivery completion 24-h urine sample excluded study a total 75 pregnant women satisfied inclusion exclusion criteria recruited informed written consent participation participants asked collect random midstream urine sample estimating spot urine p c ratio they instructed collect 24-h urine starting second urine sample morning i.e. discarding first morning specimen till first urine sample next day morning the urine p c ratio obtained dividing urinary protein concentration urinary creatinine concentration urine protein measured urinary cerebrospinal fluid protein method adaptation pyrogallol red molybdate method urine creatinine measured crea method modification jaffe reaction serum uric acid assessed using automated photospectrometric assay approved international federation clinical chemistry patients all patients followed till delivery various parameters maternal fetal outcomes noted fetal outcomes noted apgar scores 1 5 min neonatal intensive care unit nicu admission birth weight neonatal complications like neonatal sepsis stillbirth seizures adverse maternal outcomes defined maternal complications like abruption eclampsia postpartum hemorrhage disseminated intravascular coagulation dic hemolysis elevated liver enzymes low platelets hellp syndrome r used correlate spot urine p c ratio 24-h urine protein serum uric acid levels p used study levels spot urine p c ratio 24-h urine protein serum uric acid level predicting fetomaternal outcomes receiver operating characteristic roc curve analysis done evaluate diagnostic accuracy spot urine p c ratio detect significant proteinuria 300 mg day the statistical software sas 9.2 used analysis data microsoft word excel used generate graphs tables a total 75 pregnant women preeclampsia recruited study meeting criteria of 73.3% mild preeclampsia proteinuria 1 using urine dipstick analysis 26.7% severe preeclampsia proteinuria 2 urine dipstick table 1 shows distribution patients according 24-h urine protein spot urine p c ratio serum uric acid levels the pearson correlation test showed positive correlation 24-h urine protein spot urine p c ratio r 0.373 p 0.001 strongly significant table 2 scatter diagram demonstrated linear correlation spot urine p c ratio 24-h urine protein figure 2 roc curve analysis showed optimal cut value spot urine p c ratio detect significant proteinuria 300 mg day 0.6 sensitivity 73.53% specificity 65.85% area curve auc 0.799 good test figure 3 though spot urine p c ratio high sensitivity 96.9% specificity 19% cut value spot urine p c 0.3 significant proteinuria a statistically significant direct correlation also found serum uric acid spot urine p c ratio r 0.355 p 0.002 table 2 demographic data age years b period gestation c region wise distribution distribution patients according 24-h urine protein spot protein creatinine ratio serum uric acid levels pearson correlation 24-h urine protein spot urine protein creatinine ratio serum uric acid scatter diagram showing correlation spot urine protein creatinine ratio 24-hour urine protein well serum uric acid 24-hour urine protein receiver operating characteristic curves spot urine protein/ creatinine ratio bold curve reference 24-hour urine protein upper dashed curve serum uric acid lower dashed curve the cut value spot p c ratio 0.6 sensitivity 73.53% specificity 65.85% roc area curve 0.799 good test though statistically significant association proteinuria hyperuricemia various fetal maternal outcome parameters studied shown tables 3 4 5 three maternal complications namely abruptio placentae intrapartum eclampsia hellp syndrome occurred patients significant proteinuria elevated uric acid levels there 11 intrauterine growth restrictions iugrs study time 89% associated significant proteinuria a stillbirth occurred patient severe preeclampsia induced 30 weeks significant proteinuria 534 g day spot p c ratio 0.9 normal serum uric acid levels fetomaternal outcomes 24-h urine protein fetomaternal outcomes spot urine protein creatinine ratio fetomaternal outcomes serum uric acid preeclampsia multisystemic disorder endothelial dysfunction affects 3 5% pregnancies contributes greatly fetomaternal morbidity mortality renal dysfunction leading proteinuria diagnostic hallmark preeclampsia along hyperuricemia used predict adverse pregnancy outcomes 24-h urine protein estimation considered gold standard testing proteinuria disadvantage consuming time delaying diagnosis thus delaying initiation appropriate management alternative testing methods like p c ratio single random urine sample correlated well gold standard this study conducted november 2010-may 2012 estimate diagnostic accuracy spot p c ratio evaluate efficacy 24-h urinary protein spot urine p c ratio serum uric acid predicting outcomes preeclampsia correlate spot urine p c ratio serum uric acid levels study mean age 25.35 years mean gestational period 36.9 weeks among 75 preeclamptic women we found moderate correlation 24-h urine protein spot urine p c ratio statistically significant r 0.373 p 0.001 the roc curve analysis revealed sensitivity 73.53% specificity 65.85% auc 0.799 good test cut value spot p c 0.6 detect significant proteinuria similar study done aggarwal et al 120 preeclamptic women mean age 26 years mean gestational age 32 weeks they reported significant association two tests correlation coefficient r 0.596 p < 0.01 sensitivity specificity spot p c cut value 1.14 72% 75% respectively but observed values spot urine p c correlated well higher levels proteinuria thus concluded test could rule mild preeclampsia hence used replace 24-h urine protein estimation wheeler et al conducted study among 126 patients admitted evaluation preeclampsia reported strong correlation random spot urine p c ratio 24-h urine protein levels pearson r 0.88 the optimal p c cutoff 0.21 300 mg per 24 h 3.0 5000 mg per 24 h auc 0.86 cut values 0.21 1.0 cut values 3.0 they concluded though strong association spot urine p c ratio 24-h urine protein excretion former lacks ability measure proteinuria quantitatively other reports given conflicting results report 24-h urine collection remain standard evaluation preeclampsia durnwald mercer comparative study 24-h urine protein spot urine p c ratio among 220 preeclamptic women mean age 26.1 years gestational age 36.5 weeks they reported poor correlation coefficient 0.41 24-h urine spot urine p c ratio the roc analysis revealed clear shoulder although auc 0.8 sensitivity 55.8% specificity 81% cut value 0.3 spot urine p c ratio morris et al systematic review meta analysis concluded average across studies optimal threshold spot p c ratio detect significant proteinuria 0.30 0.35 relating sensitivity specificity values 75% proteinuria preeclampsia occurs due altered glomerular permeability and/or changes tubular reabsorption filtered proteins the severity proteinuria regarded predictor adverse maternal fetal outcomes 24-h urine protein greater 300 mg considered significant proteinuria study incidence low birth weight 1500 g increased 9.8% 17.6% 24-h urine protein exceeded 300 mg nicu admission increased 19.3% 38.2% fetal complications like iugr neonatal sepsis 9.8 26.5% 24-h urine protein values 300 mg there one stillborn value 24-h urine 300 mg three maternal complications namely one abruptio placentae one intrapartum eclampsia one hellp syndrome occurring 24-h urine protein 300 mg but overall differences maternal fetal outcomes related 24-h urine protein levels greater less 300 mg attain statistical significance similar findings reflected prediction adverse fetomaternal outcomes using spot p c ratio there nicu admission low birth weights fetal complications women spot p c 0.3 whereas 15.2% low birth weight 37.95% nicu admission 19.7% fetal complications spot urine p c 0.3 all three maternal complications present spot urine p c 0.3 none fetal maternal parameters significant association spot p c literature search revealed one study compared spot urine p c random urine samples adverse outcomes hypertensive pregnant women this study done martins costa et al retrieved medical charts 370 hypertensive pregnant women divided three groups based spot urine p c values group 1 0.3 group 2 0.3 1.99 group 3 2.0 compared groups composite maternal perinatal outcomes like dic hellp eclampsia thrombocytopenia neonatal sepsis perinatal death small gestational age they reported random spot urine p c values 0.3 high probability unfavourable maternal fetal clinical outcomes additional increments associated worsening outcomes indicating usefulness test diagnostic monitor clinical worsening newman et al concluded study women preeclampsia massive proteinuria increased maternal morbidity compared women severe mild proteinuria a systematic review 16 studies estimation proteinuria predictor complications preeclampsia concluded measure proteinuria poor predictor either maternal fetal complications questioned commonly practised management decisions based severity proteinuria preeclamptic women highlighted need large well designed prospective studies address important issue the utility serum uric acid marker severity preeclampsia substantiated several studies yassaee found strong correlation apgar scores less 7 serum uric acid levels 6 mg dl study there five iugrs 45% women uric acid levels 5.5 mg dl number uric acid levels 3.5 5.5 mg dl we observed differences occurrence fetal complications nicu admissions levels uric acid 3.5 5.5 5.5 mg dl yassaee reported intra uterine death iud rate 22% uric acid levels 6 mg dl present study still births found levels 5.5mg dl one stillbirth uric acid level 3.5 5.5 mg dl 2.3% overall found statistical significance serum uric acid levels various parameters fetal outcome study the three maternal complications study namely abruptio placentae hellp intrapartum eclampsia occurred uric acid levels 5.5 mg dl thought suggestive significance p 0.063 yaasaee noted 22% eclampsia serum uric acid 6mg dl study they showed strong significant p 0.01 relationship hyperuricemia maternal outcomes study retrospective analysis parrish et al showed adverse maternal outcomes 15.3% 258 persons cohort study present study adverse maternal outcomes occurred 4% 75 patients studied systematic review accuracy serum uric acid predicting complications preeclampsia thangaratinam et al he concluded serum uric acid poor predictor maternal fetal complications women preeclampsia study as well could confirm association serum uric acid fetomaternal outcomes the magnitude proteinuria hyperuricemia correlated severity renal histological finding glomerular endotheliosis if association levels proteinuria serum uric acid ? we tried correlate proteinuria using spot p c 24-h urine protein serum uric acid levels correlation coefficients showed moderate correlation urine spot p c ratio uric acid r 0.355 p 0.002 poor correlation 24-h urine protein uric acid level r 0.118 p 314 however studies reported till date regarding sample size small generalize results there blinding results spot p c ratio might influenced decisions regarding management patients avoid complications as preeclamptic women drugs excluded influence drugs parameters studied might obscured there patients proteinuria 1 g could assess impact high levels proteinuria pregnancy outcomes in present study found moderate correlation 24-h urine protein spot urine p c ratio statistically significant r 0.373 p 0.001 the optimal cut value spot urine p c ratio significant proteinuria 0.6 sensitivity 73.53% specificity 65.85% the roc curve analysis spot urine p c ratio auc 0.799 good test there moderate correlation spot urine p c ratio serum uric acid r 0.355 p 0.002 there statistically significant association proteinuria serum uric acid fetomaternal outcomes preeclampsia

background : it is well - known that estimation of 24-h urine protein and spot urine protein / creatinine ( p / c ) ratio are commonly performed investigations to assess proteinuria in preeclamptic women . serum uric acid has been shown to correlate well with disease severity in preeclampsia.materials and methods : a total of 24-h urine protein estimation , spot urine p / c ratio , and serum uric acid measurements were carried out in 75 pregnant preeclamptic women and the correlation between these investigations , as also the association between proteinuria and hyperuricemia with adverse fetomaternal outcomes were studied.results:pearson's correlation test showed a positive correlation between 24-h urine protein and spot urine p / c ratio . a statistically significant and direct correlation was also found between serum uric acid and spot urine p / c ratio , while there was no statistically significant difference between proteinuria and hyperuricemia with respect to the various fetal and maternal outcome parameters studied.conclusion:in the present study , we found a moderate correlation between 24-h urine protein and spot urine p / c ratio . there was a moderate correlation between spot urine p / c ratio and uric acid , while there was no statistical significance of the association between proteinuria and uric acid with fetomaternal outcomes in preeclampsia .

acute liver failure alf caused ingestion mushrooms containing exceptionally powerful hepatotoxins among mushroom intoxications the amatoxin syndrome primary importance accounts 90% fatalities it characterized asymptomatic incubation period followed gastrointestinal hepatotoxic phases leading eventually multiorgan failure death although exact incidence mushroom poisoning precisely estimated due presumably relatively high number underreporting cases amatoxin poisoning worldwide problem approximately 50100 fatal cases reported every year western europe less common united states however cases amatoxin poisoning africa asia australia central south america also described 1 2 amatoxin poisoning caused mushroom species belonging three genera amanita galerina lepiota majority fatalities attributable amanita phalloides commonly known death cap figure 1 being common deadly cause mushroom poisoning present paper analyzes pathogenesis clinical features prognostic indicators therapeutic strategies alf secondary amanita phalloides intoxication the toxicity amanita phalloides related two distinct groups toxins phallotoxins amatoxins the phallotoxins consist least seven compounds seven similar peptide rings their toxicity reside thiamide bond sulphur atom located indole ring these toxins cause damage cellular membrane enterocytes therefore responsible initial gastrointestinal symptoms nausea vomiting diarrhea exhibited almost patients even phallotoxins highly toxic liver cells add little amanita phalloides toxicity adsorbed intestine reach liver the amatoxins bycyclic octapeptides formed least nine different compounds amatoxins -amanitin main component along -amanitin likely responsible toxic effect 6 7 they destroyed cooking still present mushroom long periods cold storage the lethal dose low little 0.1 mg kg body weight may lethal adults amount adsorbed even ingesting single mushroom the liver principal organ affected first organ encountered absorption gastrointestinal tract once liver amanitins transported nonspecific transport system hepatocytes producing extensive centrolobular necrosis 4 10 60% absorbed -amanitin is excreted bile returned liver via enterohepatic circulation 4 1115 however organs especially kidney susceptible toxicity amatoxins significantly protein bound cleared plasma within 48 h ingestion 16 17 they filtered glomerulus reabsorbed renal tubules resulting acute tubular necrosis finally animal human post mortem studies cellular damage also found pancreas adrenal glands testes 19 20 amanitins directly interact enzyme rna polymerase ii eucaryotic cells inhibit transcription causing progressive decrease mrna deficient protein synthesis cell death reason metabolically active tissues dependent high rates protein synthesis cells gastrointestinal tract hepatocytes proximal convoluted tubules kidney disproportionately affected among potential toxic mechanisms proposed alpha amanitin acts synergy endogenous cytokines e.g. tumor necrosis factor might cause cell damage induction apoptosis the clinical picture due amanita phalloides poisoning range mild subclinical presentation lethal fulminant course result patients amanita phalloides poisoning develop alf fatal outcome the overall severity intoxication depends amount toxin ingested time elapsed ingestion initiation treatment clinical picture amanita phalloides intoxication as toxins irritating initial phase characterized absence signs symptoms the incubation time goes 6 40 hours average 10 hours it important early diagnosis suspect amatoxin intoxication case relatively prolonged latency period mushroom ingestion onset symptoms since toxic mushrooms cause liver involvement usually induce gastrointestinal symptoms much earlier 1 2 h ingestion 1 2 4 10 21 2 gastrointestinal phase this phase characterized nausea vomiting crampy abdominal pain severe secretory diarrhea this gastroenteritic phase may severe enough result acid base disturbances electrolyte abnormalities hypoglycemia dehydration hypotension this second stage lasts 12 24 h. hours patient seems clinically improving correction dehydration achieved liver kidney function tests usually normal point illness association toxic mushrooms made patients may erroneously diagnosed gastroenteritis discharged home hospitalized 1 2 4 10 21 3648 h ingestion signs liver involvement may appear third stage despite apparent improvement gastrointestinal symptoms effects toxins damaging liver kidneys resulting progressive deterioration liver enzyme tests increase serum transaminases lactic dehydrogenase in last phase transaminases rise dramatically liver renal function deteriorate resulting hyperbilirubinemia coagulopathy hypoglycemia acidosis hepatic encephalopathy hepatorenal syndrome multiorgan failure disseminated intravascular coagulation mesenteric thrombosis convulsions death may result within 13 weeks ingestion in contrast patients favourable outcome rapid improvement liver function tests occurs followed full recovery restoration normal quality life diagnosis based careful assessment history clinical manifestations confirmed laboratory tests the first task link clinical presentation mushroom ingestion association may obscured delay symptom onset mushroom meal interviewing patients patient relatives suspected suffering mushroom poisoning physicians must obtain detailed history concerning ingestion key questions include description eaten mushroom environment harvested number different types mushrooms ingested storage consumption preparation ingestion onset similar symptoms people eaten mushroom time frame mushroom ingestion onset symptoms amanitins resistant heat still active long periods storage thus in contrast toxins bacterial contamination cooking prolonged cold storage may exclude causes mushroom intoxication poisoning due amanita phalloides 10 24 analysis amatoxin levels serum available routine use clinical setting the role analysis confirm exclude diagnosis grade severity we use different methods analysis ria elisa hplc highly sensitive without false negatives performed first 48 h ingestion 23 25 these procedures alpha amanitin urine quite diffuse available specialized centers furthermore relationship urinary concentration -amanitin severity liver damage weak finally identification mycologist remaining mushrooms crucial diagnosis the clinical efficacy modality treatment amatoxin poisoning difficult demonstrate since randomized controlled clinical trials reported management amatoxin poisoning consists preliminary medical care supportive measures specific therapies liver transplantation a complete analysis world experience treatment amatoxin poisoning published 2002 enjalbert et al because long asymptomatic latency clinical utility measures seems quite limited data support exclude use emesis induced ipecac syrup administration insufficient well use whole bowel irrigation the first goal directed treat dehydration electrolyte abnormalities metabolic acidosis caused gastrointestinal phase intoxication detoxification procedures consist two different approaches reduction intestinal absorption enhancement excretion repeated activated charcoal administration avoid reabsorption toxins due enterohepatic circulation although evidence use improves clinical outcome gastroduodenal aspiration nasogastric tube recommended sole technique combined activated charcoal remove bile fluids interrupt enterohepatic circulation actual benefit procedures documented if diarrhea ceased use cathartics recommended 2 21 intense forced neutral diuresis longer recommended urinary output 100200 ml h 4 5 days sufficient increase renal elimination amatoxins although real efficacy method liver support systems analyzed appropriate trials use may represent potential additional option treat patients severe amanitina poisoning mars modified dialytic method mimics biological features hepatocyte membrane transferring protein bound water soluble toxic metabolites blood stream dialysate compartment via special membrane the method shown efficient improving liver function continuously removing protein bound substances however generally accepted extracorporeal decontamination treatment useful started early soon gastrointestinal symptoms occur according retrospective data most authors indicate silibinin n acetylcysteine nac may effective management patients amanita phalloides poisoning 1 2 4 21 many drugs used past amatoxin poisoning antibiotics antioxidants thioctic acids hormones steroids abandoned silibinin water soluble silymarin derivate competes amatoxins transmembrane transport inhibits penetration amanitin hepatocytes thus direct hepatoprotective effect moreover silibinin appears affect also secondary uptake liver mediated enterohepatic recirculation administration silibinin recommended patient seen within 48 hours ingestion the doses 2050 mg kg day intravenously treatment continued 4896 hours silymarin capsules may also given dose 1.4 4.2 g orally 30 31 penicillin g seems similar mechanism action displacing amanitin binding plasma protein thus promoting excretion preventing hepatic uptake penicillin g used continuous intravenous administration high doses na k penicillin g 1,000,000 iu kg first day 500,000 iu kg next two days although combined treatment silibinin penicillin suggested clinical data support approach superior monotherapy silibinin data suggesting hepatoprotection antioxidants support use free radical scavengers n acetylcisteine nac management amatoxin intoxication nac used many centers patients alf induced paracetamol administration proposed also cases amatoxin poisoning although data quite limited acetylcysteine usually administered intravenously 5% dextrose 0.9% saline may also used the suggested dosage 150 mg kg 15 min intravenously followed 50 mg kg 4 hours intravenously followed 100 mg kg 16 hours intravenously infusion initial dose 30 60 minutes rather 15 minutes may reduce incidence anaphylactoid reactions 33 34 amatoxin poisoning may progress alf eventually death liver transplantation lt performed on basis available data mortality rate amanita phalloides poisoning ranges 10 20% 2 29 30 patients severe liver injury admitted intensive care unit connected liver transplant centre two surgical options orthotopic liver transplantation olt auxiliary partial liver transplantation apolt developed olt well established procedure requiring long immunosuppression prevent graft rejection patients partial hepatectomy temporary support may complete morphological functional recovery liver portion native liver removed remainder left situ transplant provides temporary assistance native liver recovers immunosuppression withdrawn the major dilemma patients alf find right timing transplantation if surgical procedure performed early patient could survived without impaired quality life if search liver graft starts late patient may die suitable donor organ becomes available several sets criteria decide timing liver transplantation patients alf proposed although universally accepted table 2 since number patients amatoxin poisoning evaluated lt quite small the widely used criteria urgent lt patients alf king college hospital described o'grady et al include different parameters paracetamol nonparacetamol induced alf these criteria based prothrombin time pt age etiology time elapsing appearance jaundice onset encephalopathy bilirubin concentration in contrast clichy criteria urgent lt based factor v age encephalopathy however criteria easily transferred patients amatoxin poisoning retrospectively analyzed outcome large series amatoxin intoxication cases found predictors death prothrombin index combination serum creatinine level 310 days ingestion however although presence hepatic encephalopathy absolute requirement diagnosis alf king clichy criteria clinical manifestation adequately investigated paper ganzert et al imprecise data patient records thus authors proposed patient amatoxin poisoning listed urgent lt regardless presence hepatic encephalopathy prothrombin index less 25% serum creatinine greater 106 mol l third day ingestion also escudi et al retrospective study including 27 patients admitted amanita phalloides poisoning suggested encephalopathy absolute prerequisite deciding liver transplantation nonetheless independently variables decrease prothrombin index 10% normal inr 6 4 days ingestion lead consider urgent lt interestingly authors proposed interval ingestion toxic mushrooms onset diarrhea shorter 8 h prompt especially careful monitoring high risk fatal outcome finally taken account studies efficacy prognostic criteria urgent lt patients alf carried countries graft usually available within short time however waiting time emergency transplant list exists may prolonged parts world liver transplant may never performed others situations the use new therapies i.e. mars could useful well availability surgical techniques apolt

mushroom poisoning is a relatively rare cause of acute liver failure ( alf ) . the present paper analyzes the pathogenesis , clinical features , prognostic indicators , and therapeutic strategies of alf secondary to ingestion of amanita phalloides , which represents the most common and deadly cause of mushroom poisoning . liver damage from amanita phalloides is related to the amanitins , powerful toxins that inhibit rna polymerase ii resulting in a deficient protein synthesis and cell necrosis . after an asymptomatic lag phase , the clinical picture is characterized by gastrointestinal symptoms , followed by the liver and kidney involvement . amatoxin poisoning may progress into alf and eventually death if liver transplantation is not performed . the mortality rate after amanita phalloides poisoning ranges from 10 to 20% . the management of amatoxin poisoning consists of preliminary medical care , supportive measures , detoxification therapies , and orthotopic liver transplantation . the clinical efficacy of any modality of treatment is difficult to demonstrate since randomized , controlled clinical trials have not been reported . the use of extracorporeal liver assist devices as well as auxiliary liver transplantation may represent additional therapeutic options .

exogenous endophthalmitis generally arises direct breech external ocular barrier complication ocular trauma intraocular surgery endogenous endophthalmitis rare form endophthalmitis accounts 28% endophthalmitis cases 1 2 endogenous endophthalmitis caused breeching blood ocular barrier pathogens spread blood borne route originating infective foci example endocarditis liver abscess urinary tract infection uti meningitis although infective foci often identified isolated occurrence iatrogenic source dental surgery contaminated intravenous fluids also possible 3 4 number systemic conditions might predispose patients developing endogenous endophthalmitis including diabetes mellitus cardiac diseases underlying malignancy immunosuppression intravenous drug abuse the causative organisms endogenous endophthalmitis found vary largely different geographical locations 57 published series contained fungal bacterial endogenous endophthalmitis fungal infections common causes 810 bacterial endogenous endophthalmitis gram positive organisms prevalent north america europe gram negative organisms commonly found asia prompt diagnosis treatment endogenous endophthalmitis important final visual outcome endogenous endophthalmitis potentially devastating studies suggested endogenous endophthalmitis due fungal infection particular candida species likely result better visual outcome 810 the aim study evaluate clinical features causative organisms infective sources outcomes endogenous endophthalmitis three tertiary eye centers hong kong 8-year period we also aimed assess whether type infection would influence visual outcome comparing eyes bacterial endogenous endophthalmitis versus fungal endogenous endophthalmitis this retrospective study consecutive cases infective endogenous endophthalmitis three hospitals including hong kong eye hospital queen elizabeth hospital prince wales hospital hong kong inclusion criteria included diagnosis infective endogenous endophthalmitis proven blood culture 2000 2007 exclusion criteria included patients ocular surgery within one year presentation history ocular trauma delayed onset exogenous endophthalmitis the clinical information studied included age gender preexisting ocular medical conditions presenting ocular features infective foci microbiological results treatment final visual outcome survival the study performed accordance declaration helsinki approved institutional review board all data entered spreadsheet program microsoft excel mac 2011 microsoft inc redmond wa usa analyzed using statistical software statplus mac 2009 analystsoft inc the main outcome measure study visual outcome latest follow visit particular proportion eyes vision finger counting fc better eyes enucleated eviscerated assigned vision light perception nlp categorical variables compared using chi square test odds ratios calculated based study connell et al hypothesized eyes fungal endogenous endophthalmitis better visual prognosis 90% eyes vision fc better compared 50% eyes bacterial endogenous endophthalmitis alpha 5% sample size 16 eyes bacterial endogenous endophthalmitis 6 eyes fungal infection 54% power detect significant difference two groups a total 22 eyes 21 patients one patient bilateral involvement identified endogenous endophthalmitis study period table 1 the mean standard deviation sd age patients presentation 61.8 13.9 years range 22 89 years the mean follow duration patients 2.7 2.2 years range 1 month 6.3 years twenty 95.2% 21 patients presented within 30 days onset ocular symptoms blurring vision eye redness eye pain one patient presenting 90 days onset ocular symptoms the median mean duration onset ocular symptoms presentation 2 12 days respectively range 1 90 days preexisting medical conditions predisposed development endogenous endophthalmitis included diabetes mellitus 11 eyes 50% urinary tract infection 8 eyes 36.4% septicemia 7 eyes 31.8% recent general surgery 5 eyes 22.7% liver abscess 4 eyes 18.2% malignancy 4 eyes 18.2% two subjects 9% undergone renal transplant systemic immunosuppressive therapy other medical conditions included indwelling catheter intravenous drug use pneumonia soft tissue abscess one case all eyes presentation found inflammation involving anterior chamber cells 1 other common ocular clinical findings included vitritis 19 eyes 86.4% hypopyon 13 eyes 54.5% conjunctival chemosis 10 eyes 45.5% posterior synechiae 6 eyes 27.7% keratic precipitates 6 eyes 27.7% presentation eight 36.4% eyes vision fc better remaining visual acuity hand motion hm worse eyes endogenous endophthalmitis due fungal infection likely vision fc better compared eyes endogenous endophthalmitis due bacterial infection 83.3% versus 25% resp odds ratio 15.0 chi square test p 0.013 following onset endogenous endophthalmitis patients diagnostic tapping ocular specimen microbiological investigations including vitreous tap 15 68.2% eyes aqueous tap 10 45.5% eyes all diagnostic taps performed time initial presentation ocular symptoms prior commencement intravitreal antimicrobial therapy four samples vitreous tap two samples aqueous tap found culture positive blood cultures also performed patients positive 100% cases gram negative organisms found causative microorganism 11 eyes 50% gram positive organisms 5 eyes 22.7% fungus 6 eyes 27.3% table 2 the common microorganisms klebsiella pneumoniae 8 cases followed candida sp the common primary focus urinary tract 7 eyes 31.8% followed liver 4 eyes 18.2% table 1 topical antibiotics 17 eyes intravitreal antibiotics 16 eyes systemic antibiotics 17 eyes used treatment bacterial endogenous endophthalmitis antifungal drugs given intravitreal injection 5 eyes and/or systemically 6 eyes used cases fungal endogenous endophthalmitis topical corticosteroid treatments also used 9 selected cases reduce extent ocular inflammation systemic corticosteroid also used one patient control severe intraocular inflammation associated neovascularization iris pars plana vitrectomy ppv performed 4 18.2% eyes following development endogenous endophthalmitis 6 27.3% eyes enucleated eviscerated due uncontrollable infection nlp vision there suggestive trend enucleation evisceration eyes bacterial endogenous endophthalmitis 6 eyes 37.5% compared fungal endogenous endophthalmitis 0 eye 0% difference failed reach level statistical significance chi square test p 0.07 ten 45.5% eyes va nlp five eyes final va 20/400 20/200 there significant difference proportion eyes vision fc better latest follow bacterial fungal cases 25% versus 16.7% p 0.68 eyes acute presentation within 48 hours onset symptoms less likely final vision fc better compared presented later 7.7% versus 44.4% odds ratio 0.10 p 0.041 the final visual acuity one patient available patient died 1 month presentation endogenous endophthalmitis there 3 14.3% deaths follow period two related systemic sepsis third death due disseminated nasopharyngeal carcinoma multiple metastases endogenous endophthalmitis rare form endophthalmitis occurs pathogen crosses blood ocular barrier causes intraocular infection diagnosis endogenous endophthalmitis mainly based clinical findings empirical treatment usually administered waiting microbiological investigations results blood intraocular specimens endogenous endophthalmitis commonly associated systemic conditions cause relative immunocompromised state major review 267 cases bacterial endogenous endophthalmitis jackson et al 56% patients underlying condition increased risk infections current study 90.9% patients one identifiable preexisting predisposing condition commonest systemic condition found diabetes mellitus 50% other coexisting potential risk factors included uti 36.4% septicemia 31.8% liver abscess 18.2% malignancy 18.2% renal transplant 9.1% use immunosuppressive therapy similar results also found literature studies demonstrated 42% endogenous endophthalmitis patients underlying diabetes mellitus 6 11 connell et al also reported 14.2% bacterial infection coexisting malignancy series the common source urinary tract 36.4% followed liver abscess 18.2% soft tissue abscess pneumonia 4.5% chung et al reported series korean patients 22.2% pneumonia 16.7% liver abscess wong et al reported singapore cohort 48% bacteremia arose hepatobiliary tract intravenous drug use ivdu reported another risk factor commonly west connell et al reported figure 48.1% fungal infection cases ivdu leibovitch et al showed 23.1% ivdu suffered fungal infection series only 1 case 4.5% ivdu identified patient staph this relatively low positive rate revealed difficulty making microbiological diagnosis endogenous endophthalmitis order improve sensitivity speed diagnosis use polymerase chain reaction pcr technique diagnosing endogenous endophthalmitis advocated however technique without disadvantages false positive rate 5% due sample contamination antibiotics sensitivity determined pcr most published series included fungal bacterial endogenous endophthalmitis showed fungal endogenous endophthalmitis common compared bacterial cause 811 current series the commonest species found klebsiella pneumoniae present 8 eyes 36.3% these results different compared reported north america europe majority organisms found fungal gram positive bacteria there rising trend gram negative organisms causing endogenous endophthalmitis recently especially south east asia 7 10 12 1416 the exact cause higher proportion cases gram negative endogenous endophthalmitis unknown might due higher prevalence hepatobiliary infections asian countries 12 17 18 endogenous endophthalmitis associated klebsiella sp well documented associated poorer prognosis 19 20 series 50% eyes requiring enucleation evisceration infected klebsiella sp 62.5% klebsiella infection coexisted diabetes mellitus 50% liver abscess 20-year review ang et al concluded endogenous klebsiella endophthalmitis presence hypopyon unilateral involvement associated poorer prognosis similar association worse prognosis eyes hypopyon also observed patients klebsiella endogenous endophthalmitis six 75% eight eyes klebsiella endogenous endophthalmitis hypopyon presentation ended nlp vision 50% requiring evisceration for two 75% eyes without hypopyon va presentation hm fc respectively final va two cases improved 20/100 prompt treatment treatment modality bacterial endogenous endophthalmitis employed series included intravitreal systemic antibiotics antifungal well surgical treatments like ppv intravitreal antibiotics generally essential treating bacterial endogenous endophthalmitis topical systemic antibiotics reach sufficient therapeutic level vitreous the use intravitreal antibiotics reported reduce chance evisceration enucleation significantly improve visual prognosis ppv another important treatment option previous study demonstrated ppv result 85% anatomical success rate 80% retained vision fc better surgery in addition chance requiring enucleation evisceration also reduced ppv despite treatment although previous studies suggested fungal endogenous endophthalmitis associated better vision compared bacterial endogenous endophthalmitis 810 findings showed significant difference proportion eyes fc better vision latest follow this highlights need better therapeutic agents intraocular fungal infections conclusion in contrast previous studies series showed bacterial causes particular gram negative bacteria common fungal causes endogenous endophthalmitis despite recent advances medical surgical treatment postoperative exogenous endophthalmitis appeared little improvement clinical outcome endogenous endophthalmitis recent years a higher index suspicion early diagnosis new molecular techniques aggressive treatment might hopefully improve prognosis future

purpose . to evaluate the clinical features , microbiological spectrum , and treatment outcomes of endogenous endophthalmitis . methods . retrospective review of consecutive cases with infective endogenous endophthalmitis presenting from 2000 to 2007 . the main outcome measure was the visual outcome at the latest follow - up visit . other outcome measures included microbiological investigations , anatomical and clinical outcomes . results . 22 eyes of 21 patients were included , and the mean follow - up duration was 2.7 years . eyes with fungal endogenous endophthalmitis were more likely to have visual acuity of finger counting or better at presentation compared with those with bacterial endogenous endophthalmitis ( odds ratio = 15.0 , p = 0.013 ) . gram - negative microorganisms accounted for 50% of infections , while fungal and gram - positive organisms accounted for 27.3% and 22.7% , respectively . despite treatment , the visual outcome was poor in general as 10 ( 45.5% ) eyes had no light perception at the latest follow - up visit and 6 ( 27.3% ) eyes required enucleation or evisceration . contrary to previous studies , fungal endogenous endophthalmitis did not appear to have better visual outcome compared with bacterial endogenous endophthalmitis . conclusion . gram - negative microorganisms were the main causative pathogens of endogenous endophthalmitis in hong kong . the visual prognosis of endogenous endophthalmitis is generally poor as almost 50% of eyes were blind despite treatment .

disc herniation protrudes mediolaterally spinal canal migration lumbar intervertebral disc fragment posterior epidural space rare event rapid advances neurosurgical knowledge technology putting increased pressure neurosurgeons process huge quantities information requirements continuous learning updating scientific knowledge skills time consuming essential significant advances occurred investigative methods magnetic resonance imaging computerized tomography ct heralded revolution noninvasive imaging spinal disorder revolution leaded increase preoperative diagnosis posterior epidural migrated lumbar disc 61 cases reported date we report case 46-year old woman presented perforation ligamentum flavum lf sequestrated posterior epidural lumbar intervertebral disc best knowledge there previously reported cases perforation lf posterior epidural migrated sequester disc a 46-year old woman presented left side radiculopathy started 2 weeks admission clinical examination revealed steppage gait strength score three fifth dorsiflexion feet patellar reflex depressed sphincter dysfunction saddle anesthesia magnetic resonance imaging showed sequestrated disc fragment posterior epidural space left l4l5 level compressed dural sac figures 1 2 axial magnetic resonance imaging sequestrated posterior epidural lumbar disc sagittal images case patient underwent surgery using posterior approach performing left l4 hemipartial laminectomy perforation lf posterior epidural migrated lumbar disc noted figure 3 when sequestered fragment followed downward clearly seen disc fragment posteriorly laterally compressing l5 root axilla the extruded disk fragment gently removed without incising lf l4l5 interspace explored operative picture shows perforated ligamentum flavum sequestrated posterior lumbar disc fragment postoperative computed tomography images patient the patient underwent surgery using posterior approach performing left l4 hemipartial laminectomy perforation lf posterior epidural migrated lumbar disc noted figure 3 when sequestered fragment followed downward clearly seen disc fragment posteriorly laterally compressing l5 root axilla the extruded disk fragment gently removed without incising lf l4l5 interspace explored operative picture shows perforated ligamentum flavum sequestrated posterior lumbar disc fragment postoperative computed tomography images patient one causes lumbar disc may migrate superiorly inferiorly laterally posterior migration sequestered disc fragment uncommon first time report perforation lf disc fragment our case surprised intervertebral disc larger two types weight bearing joints make repeating vertebral motion segments spine one structures lf axis sacrum extending downward lamina respective anatomic segment the lf thick short symmetrical left right sides side the upper attachment medial portion lower half ventral surface lamina attachment lateral portion inferior aspect pedicle the medial portion passes back next lower lamina attaches upper quarter dorsal surface lamina the lateral portion passes front zygapophysial joint formed two vertebrae ligament connects the lateral fibers extend along root superior articular process far next lower pedicle attached this part lateral portion lf continuous fibrous connections synovium this two layer anatomy ligamentum flavum may perforation entering epidural space surgeon remove superficial layer lf dissect deep layer attachment anterosuperior portion caudal lamina best accomplished use small angled curette alone kerrison rongeur level however present case indicates lateral part flavum may strong medial part best knowledge this first case characterizing perforation lf lumbar disc fragment this degenerative process multifactorial irreversible may associated mechanical dysfunction our case 46 years old degenerative spinal stenosis age related changes spine case lf perforated sequestrated disc left side literature this point epidural disc migration interesting agree point investigated human body appears symmetrical along midline grossly fact asymmetrical morphologically physiologically low back pain long connected postural structural asymmetries externally difference bilateral dimensions various body parts musculature internally due asymmetrical positioning viscera well variations bilateral skeletal dimensions more stress strain dominant side may cause differences sides often referred directional asymmetry wolff law says bone formation occurs along lines stress bones muscles respond growing vigorously increasing density exposure repeated high levels mechanical loading left sided epidural disc herniations reported human studies may explained way asymmetric features epidural disc migration investigated treatment spine pathologies consider anatomic rule posterior epidural migrated lumbar disc fragments extremely rare disorder best knowledge there previously reported cases perforation lf posterior epidural migrated sequester disc our case important indeed one first report something something value

disc fragments are well known to migrate to superior , inferior , or lateral sites in the anterior epidural space , posterior epidural migrated lumbar disc fragments is an extremely rare disorder , 61 cases have been reported to date . however , there were no cases with perforated ligamentum flavum ( lf ) . we report a different case with perforation of ligamentum ligamentum by disc fragment . to the best of our knowledge , this is the first report of perforation lf by a posterior epidural migrated sequester disc .

mosseri et al.1 reported conduction disturbances frequent patients compromised blood flow septal branches coronary artery bypass grafting cabg operation they analyzed association conduction disturbance location cad 43 patients permanent pacemaker implantation coronary angiography cag classifying coronary pathology 4 categories table 1 reported compromised blood flow septal branch right coronary artery rca type iv anatomy significantly associated severe conduction disturbances.2 henceforward several studies reported predominance type ii type iv anatomy patients severe conduction disturbance.3)4 although several studies supporting causal relationship conduction disturbances underlying coronary anatomy association clear particularly view avb reversibility study omeroglu et al.5 8 patients cad complete avb treated cabg operation none patients recovered complete avb revascularization yesil et al.6 investigated 53 patients third degree avb significant cad result showed small percentage patients recovered third degree avb 19% medical 27% interventional treatment without statistically significant difference these studies may indicate revascularization helpful recovery conduction disturbances this regards evaluated association avb cad elucidate whether avb reversible patients cad this study approved institutional review board seoul national university hospital irb h-1109 011 376 january 2005 june 2011 280 consecutive patients clinically significant new onset avb admitted seoul national university hospital via outpatient clinic emergency department enrolled clinically significant avb requiring pacemaker defined follows complete avb advanced avb including 2 1 avb ninety two patients underwent pacemaker revision implantable loop recorder insertion excluded total 188 patients analyzed study fig baseline demographic variables gender age height weight body mass index kg smoking status amount smoking pack year history diabetes mellitus hypertension hypercholesterolemia renal insufficiency cerebrovascular accident atrial fibrillation cad prior revascularization therapy including percutaneous coronary intervention cabg prior open heart surgeries cardiomyopathies congenital heart disease valvular heart disease family history sudden cardiac death family history premature cad first degree relatives 55 years males 65 years females identified based electronic medical records coronary artery disease determined result cag coronary ct angiography myocardial single photon emission computerized tomography spect significant cad defined 50% stenosis epicardial coronary artery cag coronary ct angiography perfusion decrease myocardial spect coronary pathologies classified 4 types according classification mosseri et al.2 type lesions related septal branches atrioventricular av node type ii lesions compromising blood supply septal branches emerging left anterior descending artery lad type iii lesions compromising blood supply av node type iv lesions compromising blood supply septal branches emerging lad av node table 1 when determining coronary pathologies results myocardial spect counted could designate specific location the test fisher exact test used categorical variables evaluate association cad conduction disturbance require implantation permanent pacemaker univariate multivariate all statistical analyses performed software statistical package social sciences spss 18.0 spss inc chicago il usa p<0.05 considered statistically significant this study approved institutional review board seoul national university hospital irb h-1109 011 376 january 2005 june 2011 280 consecutive patients clinically significant new onset avb admitted seoul national university hospital via outpatient clinic emergency department enrolled clinically significant avb requiring pacemaker defined follows complete avb advanced avb including 2 1 avb ninety two patients underwent pacemaker revision implantable loop recorder insertion excluded total 188 patients analyzed study fig baseline demographic variables gender age height weight body mass index kg smoking status amount smoking pack year history diabetes mellitus hypertension hypercholesterolemia renal insufficiency cerebrovascular accident atrial fibrillation cad prior revascularization therapy including percutaneous coronary intervention cabg prior open heart surgeries cardiomyopathies congenital heart disease valvular heart disease family history sudden cardiac death family history premature cad first degree relatives 55 years males 65 years females identified based electronic medical records coronary artery disease determined result cag coronary ct angiography myocardial single photon emission computerized tomography spect significant cad defined 50% stenosis epicardial coronary artery cag coronary ct angiography perfusion decrease myocardial spect coronary pathologies classified 4 types according classification mosseri et al.2 type lesions related septal branches atrioventricular av node type ii lesions compromising blood supply septal branches emerging left anterior descending artery lad type iii lesions compromising blood supply av node type iv lesions compromising blood supply septal branches emerging lad av node table 1 when determining coronary pathologies results myocardial spect counted could designate specific location the test fisher exact test used categorical variables evaluate association cad conduction disturbance require implantation permanent pacemaker univariate multivariate logistic regression analysis all statistical analyses performed software statistical package social sciences spss 18.0 spss inc chicago il usa p<0.05 considered statistically significant irreversible avb observed 173 patients ib group undergone implantation permanent pacemaker there significant differences gender smoking status serum level high density lipoprotein cholesterol hdl c c reactive protein crp 2 groups ib group 75 43.4% male 11 6.4% current smokers rb group 11 73.3% males 4 26.7% current smokers p=0.031 gender p=0.021 smoking status serum level hdl c higher ib group 46.5610.95 mg dl vs. 40.0010.07 mg dl p=0.030 whereas crp higher rb group 0.531.24 mg dl vs. 1.991.80 mg dl p=0.014 there difference characteristics two groups ib group 129 74.6% ) had cad admission 40 23.1% stable angina 2 1.2% presented unstable angina 2 1.2% presented acute myocardial infarction ami in contrast rb group 13 86.7% ami one 6.7% stable angina one 6.7% without cad admission p<0.001 aspect cad type reversibility avb 13/15 86.7% patients ami 0/2 0% unstable angina 1/41 2.4% stable angina reversible avb fig the proportion reversible avb patients ami significantly higher groups patients without cad stable angina unstable angina the reversibility avb analyzed according distribution coronary pathology table 3 43 24.9% 173 patients non ami group 15 100.0% 15 patients ami group cad avb rarely reversible non ami group one 43 patients 2.3% showed reversible avb in contrast 13 15 patients ami 86.7% reversible avb significant difference non ami group ami group p<0.001 among 15 patients ami 11 patients inferior wall st segment elevation myocardial infarction stemi 1 patient anterior wall stemi there 2 patients ami ib group showing inferior anterior wall stemi rca lesions found 25 15.0% non ami group 14 93.3% ami group p<0.001 cag the proportion reversible avb among patients rca lesion also significantly higher ami group p<0.001 according mosseri et al's2 classification the number patients cad non ami group 4 9.3% type anatomy 9 20.9% type ii anatomy 7 16.3% type iii anatomy 23 53.5% type iv anatomy one patient whose avb reversible type iii anatomy ami group according classification system patients type anatomy 1 6.7% patient type ii 5 33.3% patients type iii 9 60.0% patients type iv the proportions reversible avb type iii type iv higher ami group p=0.072 type iii p<0.001 type iv the composite type ii iv septal blood flow lad compromised common found 32 74.4% patients non ami group avb irreversible patients composite found 10 66.6% patients ami group 9 90.0% patients reversible avb p<0.001 among demographic variables status cad admission identified factors showed significant association reversibility avb univariate multivariate logistic regression analysis table 4 univariate analysis revealed several significant factors male gender odds ratio 3.593 95% confidence interval ci 1.101 11.732 p=0.034 current smoker 5.355 95% ci 1.464 19.594 p=0.011 cad 41.045 95% ci 5.245 321.208 p<0.001 ami admission 555.750 95% ci 72.302 4271.773 p<0.001 multivariate analysis used clarify uncertainties showed obvious result ami admission associated factor 350.409 95% ci 21.406 5736.146 p<0.001 irreversible avb observed 173 patients ib group undergone implantation permanent pacemaker there significant differences gender smoking status serum level high density lipoprotein cholesterol hdl c c reactive protein crp 2 groups ib group 75 43.4% male 11 6.4% current smokers rb group 11 73.3% males 4 26.7% current smokers p=0.031 gender p=0.021 smoking status serum level hdl c higher ib group 46.5610.95 mg dl vs. 40.0010.07 mg dl p=0.030 whereas crp higher rb group 0.531.24 mg dl vs. 1.991.80 mg dl p=0.014 in ib group 129 74.6% cad admission 40 23.1% stable angina 2 1.2% presented unstable angina 2 1.2% presented acute myocardial infarction ami in contrast rb group 13 86.7% ami one 6.7% stable angina one 6.7% without cad admission p<0.001 aspect cad type reversibility avb 13/15 86.7% patients ami 0/2 0% unstable angina 1/41 2.4% stable angina reversible avb fig the proportion reversible avb patients ami significantly higher groups patients without cad stable angina unstable angina the reversibility avb analyzed according distribution coronary pathology table 3 43 24.9% 173 patients non ami group 15 100.0% 15 patients ami group cad avb rarely reversible non ami group one 43 patients 2.3% showed reversible avb in contrast 13 15 patients ami 86.7% reversible avb significant difference non ami group ami group p<0.001 among 15 patients ami 11 patients inferior wall st segment elevation myocardial infarction stemi 1 patient anterior wall stemi there 2 patients ami ib group showing inferior anterior wall stemi rca lesions found 25 15.0% non ami group 14 93.3% ami group p<0.001 cag the proportion reversible avb among patients rca lesion also significantly higher ami group p<0.001 according mosseri et al's2 classification the number patients cad non ami group 4 9.3% type anatomy 9 20.9% type ii anatomy 7 16.3% type iii anatomy 23 53.5% type iv anatomy one patient whose avb reversible type iii anatomy ami group according classification system patients type anatomy 1 6.7% patient type ii 5 33.3% patients type iii 9 60.0% patients type iv the proportions reversible avb type iii type iv higher ami group p=0.072 type iii p<0.001 type iv the composite type ii iv septal blood flow lad compromised common found 32 74.4% patients non ami group avb irreversible patients composite found 10 66.6% patients ami group 9 90.0% patients reversible avb p<0.001 among demographic variables status cad admission identified factors showed significant association reversibility avb univariate multivariate logistic regression analysis table 4 univariate analysis revealed several significant factors male gender odds ratio 3.593 95% confidence interval ci 1.101 11.732 p=0.034 current smoker 5.355 95% ci 1.464 19.594 p=0.011 cad 41.045 95% ci 5.245 321.208 p<0.001 ami admission 555.750 95% ci 72.302 4271.773 p<0.001 multivariate analysis used clarify uncertainties showed obvious result ami admission associated factor 350.409 95% ci 21.406 5736.146 p<0.001 the main finding study avb patients ami usually reversible avb patients cad ami usually irreversible this result indicates permanent pacemaker implantation delayed cases ami knowledge present study first describe reversibility avb type cad although could provide optimal timing confirm reversibility avb type cad results study deserve special consideration causal relationship avb inferior wall ami avb complicates inferior wall ami 10% 15% cases,7 9 patients recovered avb revascularization.10 12 however association cad ami reversibility avb still unclear rarely studied context tried evaluate association avb cad order elucidate whether avb reversible patients cad the blood supply av node posterior interventricular artery branch rca right dominant individuals remainder individuals the av node still supplied posterior interventricular artery artery branch left circumflex artery coronary circulation individuals considered left dominant intraventricular conduction system supplied septal branches lad especially first septal perforator branch proximal lad.13 physiologic background supported several studies mosseri et al.2 reported compromised blood flow septal branch rca associated conduction disturbances tandoan et al.,3 yesil et al.,14 wei et al.4 reported similar results stenoses septal branch lad rca associated avb however revascularization stenosed coronary artery could reverse conduction disturbances.5)6 present study status cad admission showed significant difference ib group rb group the majority ib group evidence cad rb group mainly consisted ami patients patients ami recovered avb revascularization therapy cases concordant previous reports.10 12 contrast almost patients without ami eventually underwent implantation pacemaker recover sinus rhythm result postulate patients avb ami higher chance return sinus rhythm coronary revascularization applied patients without ami patients new onset avb might present ami unstable angina stable angina when planning implantation pacemaker patients noted dual antiplatelet therapy usually required pci era drug eluting stent.15 hand dual antiplatelet therapy time pacemaker implantation might increase risk bleeding complication extend procedure time.16 18 considering clinical aspect study results recommend application different therapeutic strategies entity fig if patient new onset avb presents ami revascularization therapy definitely required treatment ami but treatment avb resultant feature ami pacemaker implantation delayed type avb high probability return sinus rhythm appropriate revascularization patient avb presents unstable angina recommend patient undergo pacemaker implantation first revascularization therapy present study considering necessity dual antiplatelet therapy coronary interventions,15 would rational undergo pacemaker implantation prior revascularization if patients new onset avb evidence ami unstable angina pacemaker implantation would important treatment reversibility avb patients hardly expected the result multivariate analysis table 4 confirmed strong causal relationship ami new onset avb male gender smoking status existence cad significantly associated factors univariate analyses multivariate analysis as male gender smoking status distinct risk factors cad seems gender smoking status major components reversibility avb the important aspect result strong association ami reversibility avb cad this result also poses question whether cag routine procedure prior implantation permanent pacemaker mandatory the location pathologic coronary artery among patients irreversible avb showed similar distribution compare results previous several studies table 5).2 6)14 present study type iv common type coronary pathology type ii second common type ib group type anatomy observed 9.1% patients cad type ii 22.7% type iii 15.9% type iv 52.3% study yesil et al.14 ) the distribution coronary pathology 9.6% type 38.7% type ii 16.0% type iii 35.0% type iv tandoan et al.3 studied 78 patients pacemaker implantation angiographically proven cad distribution 19% type 24% type ii 11% type iii 45% type iv study mosseri et al.2 type iv frequently observed types 44.4% type among 36 matched patients permanent pacemaker generously type ii type iv much frequently observed patients irreversible avb required implantation permanent pacemaker thus study result supports association avb underlying cad compromise blood flow septal branch rca the similarity shared result previous studies supports validity study also increases potential generalization screening patients new onset avb visited hospital majority patients evidence cad 2 patients presented unstable angina second observational retrospective study based electronic medical records no standardized protocol used indicate tests advance although attending physicians referred guidelines managing avb third prospective study required investigate effect revascularization reversibility avb our results show avb patients ami usually reversible revascularization treatment patients avb without ami usually required implantation permanent pacemaker irrespective presence cad avb patients cad ami usually irreversible therefore implantation pacemaker considered preferential basis majority patients evidence cad 2 patients presented unstable angina second observational retrospective study based electronic medical records no standardized protocol used indicate tests advance although attending physicians referred guidelines managing avb third prospective study required investigate effect revascularization reversibility avb our results show avb patients ami usually reversible revascularization treatment patients avb without ami usually required implantation permanent pacemaker irrespective presence cad avb patients cad ami usually irreversible therefore implantation pacemaker considered preferential basis

background and objectivesthe causal relationship of clinically - significant atrioventricular block ( avb ) and coronary artery disease ( cad ) is uncertain . we investigated whether cad is related to irreversible avb that requires treatment with a permanent pacemaker.subjects and methodswe included 188 consecutive patients with new - onset avb considering pacemaker , who had undergone invasive or noninvasive coronary evaluation . patients were divided into one of 2 groups : irreversible avb who underwent implantation of permanent pacemaker { irreversible block ( ib ) group , n=173 } or reversible avb { reversible block ( rb ) group , n=15}.resultsin ib group , significant cad was observed in 44 patients ( 25.4% ) and there were 2 ( 1.2% ) patients with acute myocardial infarction ( ami ) . in rb group , 14 patients ( 93.3% ) had cad ( p<0.001 ) and 13 patients ( 86.7% ) presented with ami ( p<0.001 ) . on the aspect of cad type and reversibility of avb , 13/15 ( 86.7% ) patients of ami , 0/2 ( 0% ) of unstable angina , and 1/41 ( 2.4% ) of stable angina had reversible avb.conclusionavb in patients with ami is usually reversible . therefore , permanent pacemaker implantation should be delayed in cases of ami . avb in patients with cad other than ami is usually irreversible .

end stage renal disease esrd major healthcare problem worldwide especially developing countries according centers disease control prevention cdc 10% 20 million people aged 20 years older usa chronic kidney diseases ckd india due absence national registry a recent indian study shown burden incident esrd india continues substantial going major health problem moreover due economic constraints less 10% patients receive definite renal replacement therapy malnutrition multifactorial origin one major hurdles 18 75% contributing mortality dialysis patients restricted diet metabolic acidosis gastroparesis appetite suppression side effect drugs chronic volume overload presence acute chronic systemic diseases cause inflammatory responses dialysis contribute malnutrition patients serum leptin increased ckd may responsible anorexia malnutrition syndrome however studies show malnutrition renal failure may due chronic inflammatory process reflected increase crp the short half life leptin 25 min requires rapidly cleared blood either via degradation peripheral tissues via filtration across glomerular basement membrane studies available literature show controversial results role serum leptin malnutrition studies available indian population explore relationship crp member class acute phase reactants levels rise dramatically inflammatory processes occurring body this increment due rise plasma concentration il-6 produced predominantly macrophage well adipocytes inflammation increase crp also one contributory factors malnutrition due paucity studies demonstrate effect serum leptin crp body mass index bmi patients esrd hemodialysis india this study planned aim reviewing association bmi serum leptin crp levels esrd patients comparing effectiveness using serum leptin biomarker vis vis crp predict nutritional status study results compared age- gender- bmi matched control indian population the study group comprised 40 patients esrd maintenance hemodialysis 3 months lok nayak hospital patients suffering acute infection acute renal failure endocrine disorder except diabetes mellitus taking glucocorticoids 8 weeks prior study excluded study the control group consisted 40 healthy hospital staff members genders routine hematologic investigations hemogram kidney function tests lipid profile carried control group found within normal limits complete medical history obtained relevant clinical examination including following anthropometric tests performed a)standing height bare feet measured accurately nearest 0.5 cm.(b)body weight recorded avery weighing scale accurately within 50 g.(c)body surface area bsa square meter calculated height weight using dubois formula.bsa wt kg ht cm 0.007184(d)lean body mass lbm)/body fat estimation difference total body mass weight kg weight body fat it derived following formula lean body weight men 1.10 weight kg 128 weight/(100 height m)))lean body weight women 1.07 weight kg 148 weight/(100 height m)))(e)bmi kg calculated total body mass i.e. weight kilograms height h meters using formula bmi kg m/(h h bmi reliable indicator estimation body fat wherein high bmi value usually indicates high levels body fat vice versa body weight recorded avery weighing scale accurately within 50 g. body surface area bsa square meter calculated height weight using dubois formula bsa wt kg ht cm 0.007184 lean body mass lbm)/body fat estimation difference total body mass weight kg weight body fat it derived following formula lean body weight men 1.10 weight kg 128 weight/(100 height lean body weight women 1.07 weight kg 148 weight/(100 height bmi kg calculated total body mass i.e. weight kilograms height h meters using formula bmi kg m/(h h bmi reliable indicator estimation body fat wherein high bmi value usually indicates high levels body fat vice versa routine hematologic investigation hemogram blood sugar urea lipid profile special investigations serum leptin crp carried drg leptin elisa kit solid phase enzyme linked immunosorbent assay based sandwich principle used quantitative determination leptin levels serum it based principle measurement antigen antibody reaction end point method using turbidimetric immunoassay student test used analysis p 0.05 considered significant complete medical history obtained relevant clinical examination including following anthropometric tests performed a)standing height bare feet measured accurately nearest 0.5 cm.(b)body weight recorded avery weighing scale accurately within 50 g.(c)body surface area bsa square meter calculated height weight using dubois formula.bsa wt kg ht cm 0.007184(d)lean body mass lbm)/body fat estimation difference total body mass weight kg weight body fat it derived following formula lean body weight men 1.10 weight kg 128 weight/(100 height m)))lean body weight women 1.07 weight kg 148 weight/(100 height m)))(e)bmi kg calculated total body mass i.e. weight kilograms height h meters using formula bmi kg m/(h h bmi reliable indicator estimation body fat wherein high bmi value usually indicates high levels body fat vice versa body weight recorded avery weighing scale accurately within 50 g. body surface area bsa square meter calculated height weight using dubois formula bsa wt kg ht cm 0.007184 lean body mass lbm)/body fat estimation difference total body mass weight kg weight body fat it derived following formula lean body weight men 1.10 weight kg 128 weight/(100 height lean body weight women 1.07 weight kg 148 weight/(100 height bmi kg / m calculated total body mass i.e. weight kilograms height h meters using formula bmi kg m/(h h bmi reliable indicator estimation body fat wherein high bmi value usually indicates high levels body fat vice versa routine hematologic investigation hemogram blood sugar urea lipid profile special investigations serum leptin crp carried drg leptin elisa kit solid phase enzyme linked immunosorbent assay based sandwich principle used quantitative determination leptin levels serum it based principle measurement antigen antibody reaction end point method using turbidimetric immunoassay student test used analysis p 0.05 considered significant the study control groups similar terms anthropometric parameters age height weight bmi table 1 comparison anthropometric data study control groups comparing biochemical parameters across study control groups table 2 observed following comparison biochemical parameters study control groups serum electrolytes sodium potassium lipid profile cholesterol triglycerides high density lipoprotein hdl low density lipoprotein ldl similar across two groups.hemoglobin levels significantly lower study group.blood sugar kidney function test urea levels observed significantly higher study group serum electrolytes sodium potassium lipid profile cholesterol triglycerides high density lipoprotein hdl low density lipoprotein ldl similar across two groups blood sugar kidney function test urea levels observed significantly higher study group special investigations conducted measure serum leptin crp levels study control groups table 3 comparison serum leptin ng ml c reactive protein mg dl study control groups serum leptin levels significantly higher study group 1.44 0.72 ng ml compared control group 0.68 0.55 ng ml similar observation holds true analyze serum leptin levels male female patients separately 0.001 i.e. highly significant.crp levels also higher study group 3.93 1.20 mg ml compared control group 0.28 0.24 mg ml similar observation holds true analyze crp levels male female patients separately the difference study control groups significant p 0.001 i.e. highly significant serum leptin levels significantly higher study group 1.44 0.72 ng ml compared control group 0.68 0.55 ng ml similar observation holds true analyze serum leptin levels male female patients separately the difference study control groups significant p 0.001 i.e. highly significant crp levels also higher study group 3.93 1.20 mg ml compared control group 0.28 0.24 mg ml similar observation holds true analyze crp levels male female patients separately the difference study control groups significant p 0.001 i.e. highly significant analyzing correlation serum leptin crp bmi study group figure 1 observed following correlation serum leptin c reactive protein body mass index serum leptin bmi statistically significant positive correlation r 0.314 p value 0.048.crp bmi show significant correlation r 0.126 p value 0.438 serum leptin bmi statistically significant positive correlation r 0.314 p value 0.048 crp bmi show significant correlation r 0.126 p value 0.438 the results indicate serum leptin might better biomarker crp predicting nutritional status esrd patients maintenance hemodialysis this study effort find association body weight serum leptin levels crp patients chronic renal failure hemodialysis this study comprised 80 subjects i.e. reasonably good subjects either gender spread wide age range 20 70 years thus justifying better exploration correlation serum leptin bmi esrd patients hemodialysis indian population complex chronic renal failure syndrome the markers malnutrition strongly associated poor quality life although many causes malnutrition mentioned literature one talked causes increase serum leptin levels reported hormone leptin increases ckd may responsible anorexia malnutrition syndrome serum leptin levels study significantly higher patients ckd maintenance hemodialysis controls p 0.001 this may kidney responsible 80% leptin clearance healthy individuals it cleared circulation process glomerular filtration followed metabolic degradation renal tubules patients normal renal function net renal intake 12% circulating leptin whereas patients ckd renal uptake leptin these findings close agreement reported many indian well western work bmi simple accurate reproducible calculation based height weight many studies available literature correlate relationship serum leptin levels bmi patients esrd hemodialysis controversial results few studies reported iglesias et al nizhizawa et al lonnqvist et al shown strong direct correlation serum leptin levels bmi had shown correlation plasma leptin levels history weight change dialysis the present study reinforces direct correlation serum leptin bmi ckd patients hemodialysis accordance theory reverse epidemiology however control group show significant correlation document recent study reported pecoits et al hemodialysis patients suggested paradoxically inverse association higher serum leptin levels markers nutritional status finding consistent theory reverse epidemiology given kalantar et al year inflammation generally agreed one reasons anorexia hypoalbuminemia hemodialysis patient subsequently nordfors et al proposed among patients esrd leptin gene expression higher elevated crp hence interest examine crp marker inflammation correlate bmi hemodialyzed patients the mean levels crp study significantly markedly higher patients ckd compared controls this study failed establish correlation crp levels bmi patients esrd maintenance hemodialysis this finding close agreement reported stenvinkel et al viikari study demonstrates superiority serum leptin vis vis crp biomarker assess nutritional status patients esrd hemodialysis

nutrition is one of the key parameters in predicting morbidity and mortality in patients with end - stage renal disease ( esrd ) on hemodialysis . body weight , body mass index , and visceral protein levels ( serum protein , albumin , prealbumin , and transferrin ) have traditionally been used as markers for nutritional status . serum leptin and c - reactive protein ( crp ) , have been recently added to the list of markers for nutritional status . this study was a comparative assessment of serum leptin and crp for nutritional status in patients with esrd on maintenance hemodialysis . a total of 40 patients with esrd on maintenance hemodialysis and a similar number of age- , gender- , and bmi - matched healthy individuals were studies . complete medical history was obtained and relevant clinical examination including anthropometry was carried out . all the individuals were subjected to routine investigations and special investigations ( serum leptin and crp ) . data were analyzed using student 's t - test and correlation was found using pearson 's correlation coefficient . mean value of serum leptin for the study group ( 1.44 0.72 ng / ml ) was found to be significantly higher than that of the control group ( 0.68 0.55 ng / ml ) . in addition , we also observed a positive correlation between serum leptin and bmi ( r = 0.350 , p<0.05 ) . for crp , we observed that the study group ( 3.93 1.20 mg / ml ) had a significantly higher value vis - - vis the control group ( 0.28 0.24 mg / ml ) . however , crp and bmi did not show a significant correlation . based on the above observations , we conclude that serum leptin is a better biomarker than crp for assessing nutritional status in patients with esrd on maintenance hemodialysis .

questions class versus ii versus iii classification lever first place 1416 loading assumptions but lever model coupled bending beam analogy mandible form foundation generally accepted longitudinal stress distribution pattern depicted figure 1(a 1821 variant figure 1(b 18 20 22 23 the lever oversimplified structural representation jaw biomechanical concepts derived suspect present context lever intrinsic vertical occlusal force primary drawback thus principal purposes paper demonstrate basic analytical engineering mechanics barebones mathematics shortcomings lever beam model based concepts relate surgery mandible specifically central issues involve 1 relationship occlusal force direction associated stress distributions within intact mandible 2 extrapolation stress fields plated fractured mandible figure 2(a partial dimensions irrelevant discussion omitted free body diagram fbd frame- versus lever- figure 1 idealized mandible an fbd used equilibrium analysis shows external loads forces moments act isolated object i.e. mandible portion interest purposes project crucial difference lever figure 1 frame model latter direction force vector necessarily vertical figures 2 3 the fbd figure 2(b imaginary real i.e. fractured segment mandible anterior arbitrarily defined distance occlusal contact circle approximated centroidal axis dashed line mandible represent internal shear normal perpendicular forces respectively represents internal moment symbolize net internal loads interface real imaginary necessary maintain static equilibrium anterior segment occlusal force acts applying static equilibrium conditions fbd figure 2(b yields 1)forcesvertical=0:ty=0 =ty,forceshorizontal=0:+tx=0 =tx,moments abouto=0:tytx=0or =tytx the right hand sides equations known specified calculated purposes project important recognize determined ty tx respectively function ty tx well anatomy horizontal distance section occlusal contact the analysis based range occlusal force directions represented figure 3(a occlusal contact occur maxillary cusp distal incline mandibular cusp mesial incline t0 t1 t2 maxillary cusp mesial incline mandibular cusp distal incline t4 flat plane occlusion t3 also figure 1 ( according classic friction principles assuming frictionless contact direction contact force surfaces must perpendicular common tangent t 04 characterized positions lines action loa relative circle t1 passes equivalently behind thus requiring clockwise cw moment equilibrium equilibrium dictates must counterclockwise ccw t2 t3 t4 pass front second relevant characteristic direction horizontal component t0 t1 t2 directed posteriorly therefore equilibrium must right t3 lever analogue vertical 0 thus 5 ts generically represent permutations loa orientations relative horizontal force component directions it emphasized 1 figures 24 essentially apply identically imaginary anterior segment intact mandible actual fractured section similarity ends the physical manifestations two scenarios fundamentally distinct the system equivalent produced stresses within bone plated mandible produced loads plates contact fractured bone surfaces elementary engineering beam theory used determine stress systems figure 5 equivalent specific set figure 4 ( identical engineering principles implicitly behind generally accepted obvious figure 1 stresses uniform compression equivalent anteriorly directed c figures 5(a 5(b 5(c similarly uniform tensile stress equivalent posteriorly directed figure 5(e ( uniform tension compression associated t3 figure 5(d t3 vertical requires 0 equilibrium the equivalents cw figure 5(b ccw figures 5(c 5(d 5(e stress gradients compression top tension bottom c top bottom opposite respectively ( uniform stress without gradient sufficient t0 equilibrium figure 5(a completeness shear stress equivalent included figure 5 generally done literature henceforth ignored noted figures 24 1 also apply exactly plated fractured mandible figure 6(a however system equivalent specific set figure 4 provided loads hu vu mu hl vl ml identified fbd plated fractured segment figure 6(b distributed bone stresses imaginary section figures 1 5 h v unknown forces moments acting within upper lower plates directly overlying bone fracture figure 6(b representative normal perpendicular shear contact forces respectively fractured bone surface two segments touch ( according basic friction theory maximum max coefficient friction bones this likely influence results experimental studies mandible analogue plastic different bone ) similar derivation 1 three independent simultaneous equations static equilibrium based fbd figure 6(b obtained summing forces vertical 2 horizontal 3 directions summing moments 4 tooth contact point 2)ty++vu+vl=0 3)tx+huhl=0 4)duhuvu+mudlhlvl+ml=0 fewer independent equations unknown forces moments ( only tx ty known statically indeterminate problem solved using principles static equilibrium fortunately solving problem goal equations 2)(4 serve explicit evidence complexity plating biomechanics as consequence loa position figure 3 t1 produces counterclockwise ccw moment rotation circle t0 cause rotation t2 t3 t4 produce clockwise cw rotations equilibrium intact fractured mandible these moments horizontal vertical components must opposed internal loads respectively figures 2(b 4 1 intact mandible expressed equivalent stress distributions figure 5 the sums according superposition principle individual stress distributions excluding -associated shear stress yield net longitudinal tension compression stress gradients shown figure 7 ( the result figure 7(d identical depicted figure 1(a plated mandible load system equivalent supplied loads plates contacts bone fragments but even simplified plated assembly figure 6 far intricate solve methods basic static equilibrium equations 1)(4 clearly indicate complex relationships known given unknown three dimensional 3d numerical 26 27 experimental models often lead questions prevailing lever based tot cob stress distribution dogma however previous criticisms involve location occlusal forces focus paper direction forces specifically lever based two dimensional 2d model figure 1 consists one force component direction vertical one moment component direction perpendicular page right hand rule model figure 2 basis presented analysis adds horizontal force component this general 2d model possible used demonstrate serious deficiencies lever method without resort complexities 3d approach convenience and/or perhaps lever model legacy studies generally limited occlusal forces one usually vertical t3 direction ( experimental setups occlusal plane slightly canted vertical force effect similar t4 but reason believe bolus food would necessarily elicit vertical particular occlusal force direction if instead crown crown contact assumed vertical force assumption restricts analyses solely frictionless flat plane edge edge occlusions this study framed context crown crown contacts specified contact angle i.e. cusp incline angulation incisal guidance generally defines nonvertical orientation occlusal force readers may prefer attribute nonvertical occlusal forces interactions muscle activity presence bolus food either case compelling justification vertical occlusal force simplification demonstrated occlusal force direction critical determinant mechanical environment within mandible the fbd figure 3(b serve purpose fbd figure 2(b however former presented emphasize without entirely superfluous mandible outline actually mundane static equilibrium problem force applied point located specified position relative another point reactions interest therefore aspect analysis things matter direction loa position relative i.e. distance specific quantitative values magnitude would also needed but qualitative analysis relative magnitudes sufficient linear model relative magnitudes change changes magnitude another purpose presenting figure 3(b alternative illustrate human mandible drawing figure 2(b could easily replaced nonhuman mandible machine part forth without effects 5 occlusal forces t04 but instead continuum directions practical consider categories force directions defined positions loa relative combined directions horizontal components for example whenever loa force passes generically represented t0 results presented herein t0 apply naturally angulation t0 defined would different incisal versus molar contact nonetheless qualitatively stress distributions would identical this concept already taken granted t3 stress distribution figure 1 specified particular contact location t2 loa bounded t3 t0 shaded region figure 5(c associated stress distribution seen morph left right figure 7(c tot cob t3 figure 7(d complete compression t0 figure 7(a similar trends less defined endpoints occur t1 t4 loa bound one side t0 t3 respectively stress distribution within body mandible decreasing tension gradient gingival height near mid level reversal increasing gradient compression toward inferior border this tension top compression bottom tot cob stress distribution consistent inherent vertical occlusal force lever but reality general must also nonzero horizontal bite force component figure 3 whenever inclined planes cusps contact and as demonstrated presence potential profoundly alter stress distribution within mandible generally accepted tot cob figures 1 5(d 7(d example exactly opposite figure 7(b left the depictions relative magnitudes stress distributions figures 5 7 drawn scale mathematical complexities governing equations necessary quantitative results circumvented detail would unnecessarily obfuscating serendipitously simplifications perfectly suited mathematics minimized approach paper critical nuances figure 7 examined without resorting rigorous mathematics if acts circle t0 longitudinal stress body mandible entirely uniform compression figures 5(a 7(a ( illustrated figure 4(a t0 requires 0 equilibrium hence uniform stress that course contrary tot cob lever based stress distribution figures 1 7(d the sums 1 associated uniform compression c cw 1 associated c gradients t1 figures 4(b 5(b combine produce 3 different net stress distribution patterns figure 7(b 1 1 associated compression top part mandible c c respectively doubt top part compression bottom part mandible 1 associated compression c 1 associated tension thus depending relative magnitudes c net longitudinal stress bottom part mandible tensile zero compressive left middle right respectively figure 7(b determine three stress patterns reflects actual stress governing beam equations would solved but present purposes suffices simply note 3 potential t1 results variance lever tot cob stress distribution t 2 figures 4(c 5(c like t1 produces uniform compression consistent 2 2 ccw associated gradient c. 2 longitudinal stress distributions superimposed figure 7(c certain bottom part mandible compression depending position t2 loa within shaded region figure 5(c top part tension stress free compression specifically t2 approaches vertical longitudinal stress distribution figure 7(c left looks like vertical t3-associated stress figure 7(d as t2 direction approaches t0 stress distribution figure 7(c right starts resemble t0 produced stress figure 7(a t 3 lever replica figures 4(d 5(d vertical 3 equivalent stress its tot cob stress distribution figures 1 7(d entirely equivalent ccw 3 and finally t4 figures 4(e 5(e different others 4 equivalent stress uniform tension combined ccw 4 c gradient top portion mandible tension bottom portion tension stress free compression figure 7(e thus 11 possibilities depicted figure 7 3 left figure 7(c figure 7(d right figure 7(e concert lever tot cob longitudinal stress distribution ( oral surgeons intimately familiar biomechanical principles work extraction the tooth considered vertical analogy mandible loaded figures 5(b 5(c when tooth luxated back forth generated reduce associated tensile longitudinal stress root compressive intrusive force applied concurrently thereby reducing eliminating tension analogous right sides figures 7(b 7(c turned 90 degrees lever model extraction would account critical intrusive force component prevents tension induced root fracture plated mandible figure 6(b insufficient number equations solve unknowns this statically indeterminate problem numerically modeled typically fea 2936 whatever solution may must satisfy 2)(4 thus evidenced equations everything intertwined complex manner furthermore fracture angle plates horizontal parallel 2)(4 would complicated trigonometric functions different values upper lower plates this clearly problem amenable commonsensical analysis especially intuition based nonapplicable lever paradigm intact mandible consider plates ab cd secured single screws ends figure 8(a abdc figure 8(b forms 4-bar linkage b constrained move along arcs circles centered c respectively therefore reason b moves b must move bone dimension bd (= bd remains unchanged thus virtually occlusal force plate constraints dictate downward displacement ccw rotation anterior segment bd bd hence inferior border distraction when concepts terminology intact mandible applied outcome ascribed compression top tension bottom 26 37 but fact top plate ab tension cd bottom plate compression except compression bone bone contact top tension would impossible anyway fracture compression bone anywhere along fracture thus contrary popular notion enlarged gap inferior border caused tension contrary caused compression cd. course many 4-bar linkage configurations would produce different interfragmentary displacements plate ab example secured single screws ends transmit pure compression tension 2-force member ( figure 6 top plate affixed single screws ends hu 0 vu mu 0 accounting friction bone plate screw plate even one additional screw would immensely complicate problem necessitating inclusion shear forces i.e. vu 0 figure 6(b bending moments i.e. mu 0 figure 6(b plates relative bone movements would depend mostly plate deformations caused forces moments clinically however would advantageous conceptualize plate imposed constraints terms linkages rather intact mandible paradigm ( neither realistic context intact idealization entirely irrelevant misleading ) although focus plates similar discussions would pertain modes fixation for example sagittal split osteotomy transverse shear stresses within bicortical screws bone bone friction produce equivalent system plating a mandible function intact plated complicated 3d statically indeterminate structure subjected complex interactions variable anatomy highly changeable muscle occlusal forces and many reasons obvious subtle plated fractured mandible entirely different complex load bearing structure intact mandible if reason impossibility tensile stresses acting across break tot cob stress distributions illustrated figures 1 5 7 possible near fracture according saint venant principle stress distributions present distance away plated areas nevertheless figure 1 tot cob representations often invoked explicitly 18 20 22 23 31 implicitly matters fracture repairs although demonstrated analytical method inadequate solution problems best instructional approach conceptually far realistic ubiquitous lever model this analysis appropriate conceptualizing mandibular biomechanics casting doubt status quo conclusion ( 1 lever based tension top compression bottom tot cob stress gradient assumed intact mandible it one several possible stress distributions depend direction occlusal force relative location section question ( 2 internal forces moment necessary equilibrium mandibles intact fixed beyond sharing valid comparisons intact plated screwed forth mandibles ( 3 stress distribution within intact mandible extrapolated plated otherwise stabilized mandible

objectives . the purpose of this analytical study was to examine and critique the engineering foundations of commonly accepted biomechanical principles of mandible fracture repair . materials and methods . basic principles of static equilibrium were applied to intact and plated mandibles , but instead of the traditional lever forces , the mandibles were subjected to more realistic occlusal forces . results . these loading conditions produced stress distributions within the intact mandible that were very different and more complex than the customary lever - based gradient . the analyses also demonstrated the entirely different mechanical environments within intact and plated mandibles . conclusions . because the loading and geometry of the lever - idealized mandible is incomplete , the associated widely accepted bone stress distribution ( tension on top and compression on the bottom ) should not be assumed . furthermore , the stress gradients within the bone of an intact mandible should not be extrapolated to the mechanical environment within the plated regions of a fractured mandible .

saccades described fast eye movements target tracked registering image target fovea the saccade neural network requires involvement series neurons designed imitate behavior actual neuronal populations horizontal saccade controller generic neuron model therefore desired quantify neural stimulations meticulously thus reflecting physiology linked dendrite cell body axon presynaptic terminal neuron the continuing research effort demonstrating model driven need provide means develop network neurons tailored complexity involved inherent physiological evidence encompass all desired neural behaviors neurons several modifications generic neuron model seem necessary directly impact firing rate trajectory 13 the widespread use spiking neural networks snns lies leveraging efficient learning algorithms spike response models a spike pattern association neuron identified five classes spike patterns associated networks 200 400 600 synapses success rates 96% 94% 90% respectively hybrid analog digital circuitry laid implement snn outputs postsynaptic potential integrating filtered action potentials brainstem saccadic circuitry corroborated several contributions local field potentials lfps dynamics neuronal synaptic activity three neural populations generating horizontal vertical saccades two rhesus monkeys introduced van horn et al extracellular recordings including spike trains lfps taken saccadic burst neurons sbns paramedian pontine reticular formation pprf premotor level omnipause neurons nucleus raphe interpositus motoneurons motor level it concluded lfps neuron encode eye velocity ipsilateral contralateral directions in addition lfp response amplitude sbns described function saccade direction 400 saccades fitting gaussian curves data see figure 8(b indicating sbn lfps fine tuned directed saccades neural system comprised persistent firing sensory neuron habituating synapse motoneuron developed illustrate spike timing dependency working memory the persistent firing neuron stems izhikevich neuron model habituating synapse conductance based model motor neuron captures essence hodgkin huxley hh model these studies provide abundant evidence snn well suited evoke properties firing patterns premotor neurons pulse slide phases saccade however none studies presented demonstration neural circuits reproducing electrophysiological responses network neurons premotor motor levels encompass desired neural behaviors neural circuitry used match firing rate trajectory premotor neurons we model saccade induced spiking activities premotor level hh model bursting neurons modified fitzhugh nagumo fhn model tonic spiking neurons time optimal control theory horizontal saccades establishes fact minimum time required eyes reach destination involving thousands neurons conjugate goal directed horizontal saccades well characterized first order time optimal neural controller the analytical solutions neural innervation signals active state tensions found well matched experimental data it important new complex time optimal controller ascertains firing rate motoneurons change function saccade magnitude pulse innervation oculomotor plant the muscle fiber model mfm improves oculomotor plant model using several configurations muscle fibers series parallel drive eyes destination words elevates whole muscle model level muscle fiber model calculating viscosity elasticity latter model terms parameter values former model demonstrated increasing number muscle fibers results closer saccadic agreement two muscle models it indicated muscle fiber model substantiates fact number motoneurons firing highest influence accuracy saccade controller contradicting control strategy adjusting firing rates among whole neurons investigation muscle fiber model imperative allows recognizing effects firing individual neurons well number active neurons firing maximally controlling saccades this investigation well provides optimum fit agonist antagonist neural controllers match experimental data small saccades paper focus neural control horizontal monkey saccades neural network model saccade related neural sites midbrain first presented we next characterize underlying dynamics neural site network needs treated case spiking neurons consequence match dynamics neurons synapses saccadic circuitry including omnipause neuron opn premotor excitatory burst neuron ebn inhibitory burst neuron ibn long lead burst neuron llbn tonic neuron tn interneuron motoneurons abducens nucleus oculomotor nucleus finally motoneuronal control signals drive time optimal controller stimulates mfm model oculomotor plant we abbreviate conjugate goal directed horizontal monkey saccade term saccade throughout paper the terms motoneurons agonist antagonist neurons also substitutable paper neurophysiological evidence developmental studies indicate important neural populations consisting cerebellum superior colliculus sc thalamus cortex nuclei brainstem involved initiation control saccades 13 1315 the studies also provided evidence saccades generated parallel distributed neural network shown figure 1 neural coordinated activities sc fastigial nucleus fn cerebellum identified saccade initiator terminator respectively the two sides symmetric network figure 1 known ipsilateral side contralateral side the ipsilateral side exhibits coordinated activities initiation control saccade right eye contralateral side simultaneously synapses ipsilateral side generate saccade left eye each neuron parallel distributed network fires response neurons stimulate final motoneurons sides network determined manner execute saccade the neural populations side midline excite inhibit one another sequentially ensure coactivation leads coordination movement eyes context neuroanatomical connectivity structure figure 1 the saccade neural network includes neuron populations imitate behavior actual neuronal populations initiation control termination saccadic burst generator a description synaptic properties major neural sites involved execution saccade provides basis developing quantitative computational models neural network here outline characteristics premotor neurons pprf the pprf encompasses neurons show dominantly increasing burst frequencies 1,000 hz saccade remain inactive periods fixation the llbn medium lead burst neuron mlbn two types burst neurons pprf the llbn forms excitatory synapse ibn inhibitory synapse opn there two types neurons mlbn ebn ibn the primary inputs neuron excitatory input sc inhibitory input contralateral ibn opn the ibn though controls firing ebn well tn opposite side network corresponding ibn this neuron receives excitatory inputs fn cerebellum opposite side llbn side inhibitory input opn the cerebellum aggregates ins whose functionality depends anatomical aspects properties membranes the receives excitatory inhibitory inputs corresponding tn ibn respectively it consecutively provides step component agonist antagonist neural controllers tn utility modified fhn model tonic bursting mode exhibits particular neural spiking activity the following section characterizes underlying dynamics neural site neural network the saccade generator investigated work built upon extant research 13 13 14 16 17 monkey saccades categorized two different modes operation namely small ranging 3 8 large 8 the differentiation two modes governed fact saccade size increases active neurons firing synchronously form agonist neural input small saccades large saccades however number active neurons firing maximally remains unchanged consistent time optimal controller described enderle wolfe the model first order time optimal depend firing rate neurons determine saccade magnitude we next demonstrate features structure proposed saccade neural network highlight important neurological control implications the structure saccade neural network leverages neural coding burst duration transformed saccade amplitude time optimal condition such coding manifests activities including onset burst firing saccade peak firing rate end firing respect saccade termination neuron basis physiological evidence these characteristics provided neural sites framework simulations table 1 summarizes activities initiating controlling terminating burst firing neural network generating saccade right eye note agonist antagonist tonic firing governed ipsilateral activity tonic firing operation mode the firing rate trajectories medium lead burst neuron monkey data saccades 4 8 12 16 20 provided it explained trajectories agreement data published literature 19 20 this illustration trajectories figure 2 aids comprehending foundations first order time optimal neural controller the entire active agonist neurons fire maximally pulse interval saccade small saccades the controller constrained required minimum duration agonist pulse knowing this saccade magnitude depends number active neurons firing maximally accord physiological evidence 3 12 note number active neurons parameter varies mfm among different saccades adaptive control strategy oculomotor plant it demonstrated 3 12 adjusting parameter provides significant analytical convenience controlling small saccades opposed changing firing rate active neurons function saccade magnitude for large saccades duration agonist pulse dominant factor determines saccade magnitude according main sequence diagrams the fn cerebellum records duration agonist pulse number active neurons arranging end saccade motoneurons receive excitatory input ipsilateral ebn burst discharge saccade adequately similar ebn bursting such burst discharge motoneurons responsible movement rectus muscles saccade the firing rate trajectory ebn prime importance control saccade the presented ebn model showed constant plateau bursting second portion burst decay occurs we model ebn firing rate applying firing rate trajectory slow linear reduction firing rate assumed 3 21 we also consider trajectory sc current stimulation llbn accord different simulations examining effects several depolarizing stimulus currents ebn axon specifically see figure 2.10 it emphasized point sc contributes optimal control saccades driving llbn the movement fields within sc indicators number neurons firing different small large saccades see locus points detailed view sc retinotopic mapping figure 2.14 it implied number cells firing llbn determined number cells firing sc long feedback error maintained cerebellar vermis the number opn cells firing inhibition llbn determines turn many ebn cells released inhibition finally number ebn cells firing determines number motoneurons driving eyes destination the saccade completion involves evolution events orderly sequence neural sites the output block indicates firing pattern neural site manifested saccade saccade starts time zero represents saccade termination the negative time neural site refers onset burst saccade see table 1 the neural activity within block represented pulses and/or steps consistent described burst discharge mechanism reflect neural operation timing gates ultimately motoneurons innervate rectus muscles eyes end interaction level block diagram the following description outlines eight steps required implement saccade control strategy context figure 3 it represents sequence events accounted enderle zhou modifications made steps iv)(vii indicate function local neural integrators tn providing step component motoneurons.the deep layers sc initiate saccade based distance current position eye desired target.the ipsilateral llbn ebn stimulated contralateral sc burst cells the contralateral fn also stimulates ipsilateral llbn ebn.when opn ceases firing mlbn ebn ibn released inhibition.the ipsilateral ibn stimulated ipsilateral llbn contralateral fn cerebellum when released inhibition ipsilateral ebn responds postinhibitory rebound burst brief period time the ebn stimulated contralateral fn perhaps sc enables special membrane property causes high frequency burst decays slowly inhibited contralateral ibn the follows closely integration mechanism tn.the burst firing ipsilateral ibn inhibits contralateral ebn well ipsilateral on.the burst firing ipsilateral ebn causes burst ipsilateral stimulates ipsilateral lateral rectus muscle contralateral stimulation lateral rectus muscle ipsilateral an inhibition ipsilateral medial rectus muscle via saccade occurs right eye simultaneously contralateral medial rectus muscle stimulated contralateral inhibition contralateral lateral rectus muscle via saccade occurs left eye hence eyes move conjugately control single drive center fixation periods the ins provide steady state tensions required keep eyes desired destination.at termination time cerebellar vermis operating purkinje cells inhibits contralateral fn stimulates ipsilateral fn some stimulation ipsilateral llbn ibn lost inhibition contralateral fn the contralateral ibn inhibits ipsilateral ebn tn contralateral this inhibition removes stimulus agonist muscle.the ipsilateral fn stimulation contralateral ebn allows modest bursting contralateral ebn once sc ceases firing stimulus llbn stops allowing resumption opn firing inhibits ipsilateral contralateral mlbn hence terminating saccade the deep layers sc initiate saccade based distance current position eye desired target ipsilateral llbn ebn when opn ceases firing mlbn ebn ibn released inhibition the ipsilateral ibn stimulated ipsilateral llbn contralateral fn cerebellum when released inhibition ipsilateral ebn responds postinhibitory rebound burst brief period time the ebn stimulated contralateral fn perhaps sc enables special membrane property causes high frequency burst decays slowly inhibited contralateral ibn the burst firing ipsilateral ibn inhibits contralateral ebn well ipsilateral the burst firing ipsilateral ebn causes burst ipsilateral stimulates ipsilateral lateral rectus muscle contralateral stimulation lateral rectus muscle ipsilateral an inhibition ipsilateral medial rectus muscle via saccade occurs right eye simultaneously contralateral medial rectus muscle stimulated contralateral inhibition contralateral lateral rectus muscle via saccade occurs left eye hence eyes move conjugately control single drive center fixation periods the ins provide steady state tensions required keep eyes desired destination termination time cerebellar vermis operating purkinje cells inhibits contralateral fn stimulates ipsilateral fn stimulation ipsilateral llbn ibn lost inhibition contralateral fn the contralateral ibn inhibits ipsilateral ebn tn contralateral the ipsilateral fn stimulation contralateral ebn allows modest bursting contralateral ebn once sc ceases firing stimulus llbn stops allowing resumption opn firing inhibits ipsilateral contralateral mlbn hence terminating saccade the advances computational neural modeling supplied us abundant information different structural scales biophysical 4 5 circuit 3 6 7 systems levels the following includes modeling premotor motor neurons circuit level we introduce neural circuit model parameterized match described firing characteristics type neuron a typical neuron embodies four major components cell body dendrites axon presynaptic terminals shown figure 4 dendrites act synaptic inputs preceding excitatory inhibitory neurons upon stimulation neuron dendrites permeability cell plasma membrane sodium intensifies action potential moves dendrite axon the transmission action potential along axon facilitated means nodes ranvier myelin sheath end axon presynaptic terminals neurotransmitters diffuse across synaptic cleft a complete understanding properties membrane means standard biophysics biochemistry electronic models neuron lead better analysis membrane potential response this response dependent much neurotransmitter received presynaptic terminal adjacent neurons thereby neuron becomes hyperbolized depolarized a generic neuron circuit model introduced section together description modifications required populate neural network control saccades the saccade neural network includes eight neuron populations premotor motor levels seen figure 1:long lead burst neuron llbn),omnipause neuron opn),excitatory burst neuron ebn),inhibitory burst neuron ibn),tonic neuron tn),interneuron in),abducens nucleus an),oculomotor nucleus long lead burst neuron llbn omnipause neuron opn excitatory burst neuron ebn inhibitory burst neuron ibn abducens nucleus oculomotor nucleus the saccade circuitry underlies dynamics eight distinct neurons contributes control mechanism saccade except opn proposed parallel distributed neural network proposed parallel distributed neural network accommodates two neurons network the dendrite model delineated adjustable stimulation mechanism eight neurons the axon model spiking neurons except ebn opn adheres hodgkin huxley hh model the tn integrates input modeled fitzhugh nagumo fhn model tonic bursting mode the presynaptic terminal elicits pulse train stimulus whose amplitude depends membrane characteristics postsynaptic neuron the dendrite partitioned number membrane compartments predetermined length diameter each compartment dendrite three passive electrical characteristics electromotive force emf resistance capacitance shown figure 5 the presynaptic input dendrite modeled pulse train current source the node equation first dendrite compartment 1 cmdvm1dt+vm1vthreq+vm1vm2ra vm1 membrane potential first compartment vm2 membrane potential second compartment the membrane resistance req capacitance cm emf vth characterize compartment there two inputs input previous compartment membrane potential input next compartment membrane potential the node equation second compartment 2)cmdvm2dt+vm2vthreq+vm2vm1ra+vm2vm3ra=0 vm3 membrane potential third compartment last dendrite compartment receives one input preceding compartment the corresponding node equation 3 cmdvmndt+vmnvthreq+vmnvm(n1)ra=0 membrane potential vmn related preceding compartment membrane potential vm(n1 axial resistance ra the neurons dendrite model realized experimental tuning parametric capacitance resistance properties basic dendrite model this parametric adaptation allows accommodation synaptic transmission neural network required stimulate postsynaptic neuron each neuron dendrite rise time constant determines delay emulate postsynaptic potential propagation along dendrite consistent initiation firing respect saccade onset provided table 1 table 2 includes membrane resistance capacitance dendrite compartments neuron computational efficiency accrues minimum number compartments dendrite model required we chose include 14 compartments dendrite achieve desired membrane properties type neuron for example ebn dendritic membrane potential across first second third last compartments illustrated figure 6 the farther compartment along dendrite smoother potential response pulse train current source the hodgkin huxley hh model axon serves basis neurons modeled ebn opn based modified hh model this nonlinear model describes membrane potential axon hillock caused conductance changes the circuit diagram unmyelinated portion squid giant axon illustrated figure 7 the node equation expresses membrane potential vm function stimulus current dendrite voltage dependent conductance sodium potassium channels 4)gkn4(vmek)+gnam3h(vmena vmel)rl+cmdvmdt im 5)dndt=n(1n)nn dmdt=m(1m)mm dhdt=h(1h)hh gk=36103 gna=120103 s. coefficients first order system differential equations related exponentially membrane potential vm 6)n=0.01v+10e((v+10)/10)1 ms1,n=0.125e(v/80 ms1,m=0.1v+25e((v+25)/10)1 ms1,m=4e(v/18 ms1 h=0.07e(v/20 ms1,h=1e((v+30)/10)+1 ms1,v vrpvm mv resting potential vrp 60 mv neural firing rate entire burst neurons adjusted meet peak firing rate requirement table 1 this adjustment intended neuron contribute generation saccade mimicking required physiological properties end right hand side n h differential expressions 4 multiplied appropriate coefficients achieve desired peak firing rates for instance required coefficient ebn 35,000 thereby presents peak firing rate 1,000 hz note description basic hh model axon used burst neurons except ebn opn latter neurons modified hh model used change threshold voltage 45 mv 60 mv illustrative examples shown variation causes ebn fire autonomously without existence excitatory stimulus description dominant effect sodium channel current changes threshold voltage beginning action potential threshold voltage ebn axon model the opn axonal threshold voltage firing adjusted following modification 7 this alteration threshold voltage ebn opn enables fire spontaneously without significant depolarization peripheral current stimuli table 2 lists firing threshold voltage coefficient required adjust peak firing rate neuron the axon transfers action potential spike generator locus output end synaptic mechanism the transmission along axon thus amounts introducing time delay action potential appears synapse this modeled excitatory inhibitory pulse train stimuli stimulate dendrite postsynaptic neuron realistically chain synaptic transmission the amplitude width single pulse chosen experimentally provide desired postsynaptic behavior neurons based timing constraints table 1 the width constrained two points action potential crosses constant level axonal potential the synapse sense thought voltage frequency converter releases pulse train output figure 8 shows number action potentials synaptic current pulses ebn toward end burst firing interval note time delay action potential corresponding current pulse evident in addition transmission time delay along axon chemical synapses introduce small delay excitatory inhibitory pulse train this delay accounts time required release neurotransmitters time takes distribute synaptic cleft this small synaptic delay taken effect increasing rise time constant following postsynaptic dendritic compartments indicated the amplitude width synaptic current pulses neuron uniquely chosen order postsynaptic neurons exhibit desired behavior this table summarizes differences dendritic axonal synaptic among eight distinct neurons whose realization important time optimal control saccade we next describe linear homeomorphic muscle model captures nonlinear properties muscle namely force velocity length tension relationships the time optimal controller model investigated obtain saccadic eye movement model solution drives eyeball destination different saccades 3 17 here explain saccadic eye movement model solution characterized realization agonist antagonist controller models thereby providing active state tensions inputs linear homeomorphic model oculomotor plant the first order time optimal controller model defined two complementary controllers agonist controller model antagonist controller model these models describe neural innervation signals motoneurons converted active state tensions drive agonist antagonist muscle saccade assuming oculomotor plant given order in what follows active state tensions defined low pass filtered neural innervation signals the agonist controller first order pulse slide step neuronal controller describes agonist active state tension low pass filtered neural stimulation signal the neural stimulation signal firing rate ipsilateral contralateral the slide meant model transition pulse step exponentially the expression low pass filtering neural innervation input agonist controller model 8)fag nagfagag 9)ag=gac(u(tt1)u(tt2))+gdeu(tt2 nag represents agonist neural innervation input agonist active state tension fag generated agonist time constant ag is expressed two step functions dependent agonist activation time constant gac deactivation time constant gde t1 indicates saccade latent period t2 start transition slide interval agonist controller it noteworthy activation deactivation time constant model accounts different dynamic characteristics muscle upon increasing decreasing stimulation the antagonist muscle unstimulated pause saccade remains fixed step input keep eyeball destination serve purpose the neural stimulation signal controller firing rate ipsilateral contralateral the antagonist active state tension expressed low pass filtered pause step waveform 10)fant nantfantant 11)ant=tde(u(tt1)u(tt3))+tacu(tt3 nant denotes antagonist neural innervation input fant antagonist active state tension generated antagonist time constant describable two step functions introducing antagonist deactivation time constant tde activation time constant tac t1 takes account latent period t3 onset change step component necessary keep eyeball steady destination the time optimal controller found reasonably consistent characteristics main sequence diagrams follows a linear homeomorphic muscle fiber model mfm oculomotor plant presented a linear homeomorphic mfm captures nonlinear properties muscle namely force velocity length tension relationships investigated the muscle fiber known basic structural unit muscle exhibits mechanical functionality whole muscle model the significance introducing muscle fiber model accommodates multiple neurons drive eyes destination accordingly effect number active neurons controlling saccade magnitude investigated adaptive control paradigm oculomotor plant in contrast whole muscle model information muscle fibers aggregated parameters mfm the entire 100 muscle fibers similar terms parameters stimulation active state tension generator model the rigorous analysis mfm including length tension force velocity characteristics indicates model agrees previous results whole muscle model 3 12 the experiments mfm illustrated different combinations columns series muscle fibers load mass active state tension the focus attention herein description oculomotor plant mfms agonist antagonist rectus eye muscles incorporated the mfm parameterized using scaled estimates parameters whole muscle oculomotor plant figure 9 shows studied oculomotor plant two parallel networks muscle fibers attached eyeball angle displacement eyeball primary position x denotes respective change length arc the changes length agonist muscle left antagonist muscle right shown xag xant respectively there 2n columns muscle fibers muscle fibers series each column muscle fibers also includes two tendon elements whose viscous elastic elements b2 kse top bottom structural unit muscle fiber is modeled viscous element b1 elastic element klt active state generator fj 1 2n 2 j 1 change primary position node j muscle fiber column denoted xj note nj exhibits input agonist antagonist controller models stated formerly motoneurons provide saccadic neural innervation signals muscle fiber time optimal controller the advantage state variables approach facilitated mathematical descriptions oculomotor plant implementation matlab simulink definition y1 = xag x2 net torque developed agonist mfm 12)tag=i=1n(ksey1i+b2y1i two tendon elements column j 1 2 state equation 13)yji=(ti+kseyji)b2 state equation represents dynamics muscle fibers column 2 j 1 14)yji=tikltyji+fjib1 ti tension generated muscle fiber column similar approach antagonist mfm ( 1 2n definition y1 xant x2 net torque developed antagonist mfm 15)tant=i n+12n(ksey1i+b2y1i state equation two tendon elements column j 1 2 16)yji tikseyjib2 dynamics muscle fibers column 2 j 1 represented 17)yji tikltyjifjib1 ti denotes tension developed muscle fiber column consequently third order linear differential equation solve optimal solution saccade 18)tagtant jpr+bpr+kpr jp denotes moment inertia eyeball bp denotes viscous element eyeball passive elasticity eyeball represented kp it assumed muscles primarily stretched 3.705 mm 1 3 note expressions show inputs mfm agonist antagonist active state tensions these tensions obtained low pass filtering motoneurons innervation signals previously described pulse slide step pause step controllers the analytical solutions fj yielded previous work found different characteristics saccades well matched experimental data estimation routine involved estimation 25 parameters oculomotor plant neural inputs active state tensions the parameters physiological accuracy corroborated previously published experimental findings human monkey note empirical parameters involved herein parameters whole muscle model oculomotor plant monkey see page 47 two small saccades 4 8 three large saccades 12 16 20 focal point simulations horizontal monkey saccades first order time optimal control strategy all neural populations consisted 14 dendrite compartments membrane properties included table 2 the determination rise time constant neuron dendrite plays vital role integration current pulses synapse analyses dendritic membrane potentials performed ni multisim circuit design suite neural network simulated matlab simulink environment saccade induced spiking activities premotor level are modeled hh model bursting neurons tonic spiking behavior tn implemented modified fhn model well transmission along axon introduced delay presence action potential axon hillock action potential appears synapse synaptic connections functionally modeled neuron populations modeled following current based synapse scheme see table 2 differences membrane parameters among neurons onset delay saccade peak firing rate burst termination time different neuron populations we arranged 100 identical muscle fibers n 1 100 since coordination provided sufficient resolution matching experimental data as described number active neurons impacts control saccades instead variations firing rate neurons time optimal control strategy in addition number active neurons differs saccade saccade evident dynamics observed main sequence diagrams 3 12 as demonstrated system parameter determined reducing maximum 100 active neurons eye position estimate mfm whole muscle model match the active state tension agonist neurons activated modeled exponentially decay pulse rise slide using time constants agonist controller model the number active agonist neurons 4 8 saccades reported 48 76 respectively the neural innervations number neurons small saccade muscle fiber oculomotor plant tend excellent agreement whole muscle oculomotor plant each active neuron exhibits pause slide step firing trajectory later shown figure 11 substantiating physiological accuracy agonist controller model the adjustment number active neurons large saccades empirically carried maximize correlation whole muscle oculomotor plant muscle fiber oculomotor plant the number active neurons estimated 75 neurons 12 saccade 100 neurons 16 saccade 92 neurons 20 saccade table 3 lists number active neurons duration burst agonist pulse five different saccades work the termination time saccades solely depends duration burst time optimal control strategy the selection duration burst accord saccade duration saccade magnitude characteristic main sequence diagrams sample illustrations plots dendritic membrane potential first column axonal membrane potential second column synaptic current pulse train third column ipsilateral burst neurons generation 16 saccade recall train action potentials converted train current pulses presynaptic terminal neuron provide excitatory inhibitory input succeeding neurons based neural connections figure 1 this current pulse flows postsynaptic dendritic compartments latter neurons thus providing smooth postsynaptic potentials prime axonal compartment it appears upon increasing stimulus current pulse magnitude depolarization postsynaptic membrane intensifies it obvious synapse propagation raises different excitatory inhibitory postsynaptic potentials dendritic compartments postsynaptic neuron shown first column figure 10 one realize view trajectory changes membrane potential among compartments postsynaptic neuron turn either become closer firing action potential chain inhibited firing it clear presynaptic input pulses closely spaced time succeeding postsynaptic potential smaller basic single pulse response postsynaptic response input pulse demonstrable it worth noting llbn membrane response different rest since stimulated contralateral sc current input formerly introduced furthermore burst onset offset premotor neuron figure 10 agreed place within saccadic circuitry hierarchical processing order generating final motoneuronal signals when ipsilateral ebn weakly stimulated contralateral fn renders special membrane property tends high frequency burst mechanism inhibition contralateral ibn opn recall responsible keeping agonist antagonist muscles steady periods fixation pulse phase however ipsilateral tn inhibited contralateral ibn ipsilateral inhibited ipsilateral ibn the forms excitatory synapse provide step component innervation obviously burst tonic firing activity figure 10(q reflects burst firing ebn tonic firing presented figure 11 ipsilateral agonist first third rows antagonist second last rows burst tonic firing rates respective active state tensions saccades it interest note firing rate scenarios vary function saccade magnitude thus proving proposed time optimal controller well capable mimicking physiological properties saccade the agonist antagonist active state tensions periods fixation found functions eye position steady state see page 47 the corresponding tonic firing rates readily determined based linear transformation scales tonic firing rate active state tension figure 11 follows agonist antagonist firing patterns fairly well match estimated waveforms based system identification approach see figure 1.19 the ipsilateral control simulation results eye position two small saccades time optimal control strategy demonstrated figure 12 parameterized saccadic oculomotor plant for the trend changes muscle tensions involved saccade neuron data derived active state tensions drive muscle fiber oculomotor plant shown figure 13 ipsilateral control simulation results eye position three large saccades time optimal control strategy it interest note envisioned 1 18 investigated oculomotor plant considerably influence main sequence diagrams the entire neural stimulation signals eye movements contralateral side close coordination corresponding ipsilateral signals simulated conjugate saccades the simulation results show remarkable agreement provided analytical descriptions agonist antagonist neural inputs corresponding active state tensions see figure 1.19 the trajectory variation agonist pulse magnitude among saccades consistent agonist pulse magnitude saccade magnitude characteristic large saccades refer figure 1.25(a the burst duration found show similar correlation mlbn duration burst firing extracellular single unit recordings evident different firing rate trajectories ebn this however duration second portion burst discharge gradual drop varied among based entire duration burst firing table 3 indicated table 1 ebn firing lags behind saccade 68 ms whereas starts burst firing 5 ms saccade see figure 10 finding dendrite parameters neurons meeting required onset time delay experimentally challenging implementing opn dendrite synapse models order neuron stops inhibiting ebn 10 ms saccade resumes inhibition almost saccade ends subject numerous experimental tunings see table 1 without coordination timing burst firing ebn this rebound burst turn causes saccade deviate normal characteristics it also vital end ibn inhibition antagonist motoneurons coincides resumption tonic firing deviation normal saccade present midbrain coordination mechanism generating saccades is qualitatively studied 13 15 complete neural circuitry includes premotor motor neurons quantifying final motoneuronal command eye muscles yet attended the utility snns biophysical modeling interconnected neurons 4 5 elucidates broad insights modeling higher structural scales circuit 3 6 7 systems levels the computer simulations neural circuitry herein allow synaptic stimuli propagate saccade pathways motoneurons ultimately drive oculomotor plant a time optimal neuronal control strategy human saccadic eye movements first proposed based experimental data analysis we used first order time optimal controller includes activation deactivation time constants agonist antagonist controller inputs muscle fiber oculomotor plant this controller proven agree experimental findings 25 26 realization suitable time constants agonist antagonist controllers expressed 9 11 key providing required steady state active state tensions muscle fiber oculomotor plant the estimated activation deactivation time constants system identification approach 1 3 best satisfy specification without appropriate parameters the set agonist antagonist control inputs muscle fiber oculomotor plant supports time optimal controller motoneurons firing rate determine saccade magnitude the application mfm oculomotor plant proves important accommodating constraint number active neurons firing maximally controlling saccade magnitude the number active neurons key parameter whose adjustment mfm vital providing desired saccade control simulation results it follows observations duration agonist burst firing number active agonist neurons integral determining saccade size see table 3 it noteworthy duration agonist burst discharge prime significance determining saccade magnitude seen figure 11 it concluded neural network constrained minimum duration agonist pulse dominant factor determination amplitude number active neurons small saccades large saccades however duration agonist burst firing directly related saccade magnitude the number active neurons 16 20 saccades remains relatively although 12 saccade aggregates fewer active neurons seen table 3 the discussion enderle sierra enlightening increasing movement field activity within sc saccades 12 monkey data furthermore velocity profiles simulated saccades found monkey saccade larger peak velocity human the final eye position results establish evidence acceptable performance proposed neural circuitry exploited time optimal controller modeling horizontal monkey saccades the dependence different saccades agonist pulse duration found well presented time optimal controller the simulation results substantiate time optimal controller close agreement obtained analytical solutions saccade characteristics 3 12 this agreement gives rise accuracy experimentally found membrane parameters modeling neuron listed table 2 we simulated five different conjugate goal directed horizontal monkey saccades 4 8 12 16 20 first order time optimal control strategy a parallel distributed neural network model midbrain first presented develop quantitative computational models establish basis functional neural network model a neural circuit model demonstrated parameterized match firing characteristics eight neuron populations premotor motor stages context elevated neural modeling single neuron network neurons our control strategy define two controllers namely agonist antagonist controller models characterized pulse slide step pause step waveforms respectively the horizontal monkey saccades well characterized integrating neural controllers third order linear muscle fiber oculomotor plant 100 identical muscle fibers connected series agonist antagonist muscles oculomotor plant time optimal strategy number neurons actively fire duration agonist pulse determined saccade magnitude the choice number active neurons proved accurate adapting muscle fiber model provide desired control simulation results the proposed saccadic circuitry thus complete model saccade generation since includes neural circuits premotor motor stages saccade generator also uses time optimal controller yield desired saccade magnitude small large saccades the saccade characteristics found well correlated found analytical descriptions experimental data

a neural network model of biophysical neurons in the midbrain is presented to drive a muscle fiber oculomotor plant during horizontal monkey saccades . neural circuitry , including omnipause neuron , premotor excitatory and inhibitory burst neurons , long lead burst neuron , tonic neuron , interneuron , abducens nucleus , and oculomotor nucleus , is developed to examine saccade dynamics . the time - optimal control strategy by realization of agonist and antagonist controller models is investigated . in consequence , each agonist muscle fiber is stimulated by an agonist neuron , while an antagonist muscle fiber is unstimulated by a pause and step from the antagonist neuron . it is concluded that the neural network is constrained by a minimum duration of the agonist pulse and that the most dominant factor in determining the saccade magnitude is the number of active neurons for the small saccades . for the large saccades , however , the duration of agonist burst firing significantly affects the control of saccades . the proposed saccadic circuitry establishes a complete model of saccade generation since it not only includes the neural circuits at both the premotor and motor stages of the saccade generator , but also uses a time - optimal controller to yield the desired saccade magnitude .

electronic cigarettes battery operated devices deliver nicotine lungs evaporation liquid chronic idiopathic neutrophilia condition characterized elevated white blood cell neutrophil counts without underlying disease smoking implicated potential cause a male caucasian patient born 1977 presented september 2005 asymptomatic elevation white blood cell neutrophil count mildly elevated c reactive protein levels he smoker since 1996 treated 20 mg day simvastatin since 2003 due hyperlipidemia clinical examination laboratory imaging investigations ruled infectious haematological rheumatological endocrine conditions he 2 unsuccessful attempts quit smoking one unassisted second performed use varenicline nicotine replacement therapy patches subsequent 6.5 years leukocyte c reactive protein levels repeatedly elevated condition consistent chronic idiopathic neutrophilia february 2012 started using electronic cigarettes managed quit smoking within 10 days after 6 months laboratory examination showed normalized leukocyte count c reactive protein levels confirmed immediately second laboratory repeated tests 1 2 months smoking cessation use electronic cigarette led reversal chronic idiopathic neutrophilia the daily use electronic cigarette may help preserve beneficial effects smoking cessation cigarette smoking major cause disease affecting several systems human body.1,2 although reducing cigarette consumption improve prognosis,3 smoking cessation important beneficial socioeconomic health related implications.4,5 however quitting smoking difficult task smokers try quit without medical aid treatment extremely low success rate.6 although several pharmaceutical products available smoking cessation long term quit rates relatively low.7 therefore tobacco harm reduction strategies products developed main goal reduce amount harmful substances administered human body.8 electronic cigarettes introduced market recent years alternative smoking they hand held electronic nicotine delivery devices consisting battery cartridge containing liquid electrical resistance heated battery power evaporates liquid they deal chemical addiction delivering nicotine lungs consequently circulation although millions people use world lack clinical evidence efficacy reversing smoking related disease conditions chronic idiopathic neutrophilia cin condition characterized asymptomatic elevation white blood cells wbcs neutrophil count persists years without underlying disease.9 smoking implicated cause condition,9,10 leukocyte count predictor future cardiovascular events.11,12 best knowledge report first time case study subject cin reversed smoking cessation daily use electronic cigarettes written informed consent obtained patient presenting case report a male caucasian born 1977 presented september 2005 elevated wbc count found routine check time smoker since 1996 9 pack years time presentation he positive family history premature coronary heart disease hyperlipidemia treated simvastatin 20 mg day since 2003 complete blood count tests performed 9 18 months earlier normal wbc 89009700/l neutrophils 41834462/l lymphocytes 40054268/l eosinophils 89194/l basophils 623776/l presentation his wbc count 14,600/l 8614/l neutrophils 5256/l lymphocytes 292/l eosinophils 438/l basophils he completely asymptomatic history recent infections trauma reported fever he changes body weight appetite past months body mass index bmi 27.7 kg presentation c reactive protein elevated 14 mg l normal range 5 mg l rheumatologic infectious disease work including ana anti dsdna le test ra test asto cmv ebv antibodies wright test widal reaction negative disease he invited repeat complete blood count 2 months wbc reaching 21,000/l neutrophils 14,280/l lymphocytes 5250/l eosinophils 630/l basophils 840/l once asymptomatic signs infection inflammatory condition he instructed stop intake simvastatin repeat examination another 2 months january 2006 leukocytosis still present wbc 17,900/l neutrophils 11635/l lymphocytes 5012/l eosinophils 537/l basophils 716/l the diagnosis cin suspected offered bone marrow aspiration biopsy rule conditions all results consistent cin mild elevations c reactive protein also noted fig 2 receive medications period besides antipyretics 2 episodes common cold laboratory examinations performed least 10 weeks far common cold episodes he two unsuccessful attempts quit smoking one without medical treatment 2006 one varenicline plus nicotine patches 2010 a change statin prescription atorvastatin 20 mg day rosuvastatin 20 mg day done may 2010 difference observed wbc count subsequent measurements february 2012 it mentioned use electronic cigarettes personal choice patient advice recommendation use provided physicians since approved smoking cessation method one month earlier complete blood count consistent cin august 2012 routine follow showed leukocytosis wbc 8800/l neutrophils 4400/l lymphocytes 3344/l eosinophils 352/l basophils 704/l further tests 1 2 3 months later revealed leukocytosis period using electronic cigarette daily consuming liquid nicotine concentration 9 mg ml smoking abstinence confirmed last three visits measuring carbon monoxide exhaled breath within normal limits 4 ppm to best knowledge first study reports smoking cessation use electronic cigarette leads reversal chronic idiopathic neutrophilia the important message despite daily use electronic cigarette patient beneficial effects smoking cessation maintained electronic cigarettes invented 2003 awareness use increasing significantly past 3 years.13 introduced market tobacco harm reduction products may unique role field they work evaporating nicotine containing liquid subsequently inhaled user in addition nicotine constituents liquids used evaporation limited propylene glycol glycerol flavorings since deliver nicotine time resemble act smoking production visible vapor deal chemical nicotine delivery behavioral components cigarette addiction.14 non randomized study polosa et al15 internet survey siegel et al16 suggested may effective smoking cessation tool the absence tobacco lack combustion important features health related profile products until recently research composition toxicology clinical effects electronic cigarettes scarce thus fda publicly expressed serious concerns electronic cigarette use 2009 recommending use avoided cahn siegel14 summarized several chemical analyses performed 2011 showing electronic cigarette liquid contents far less harmful compared tobacco.14 nitrosamines mentioned present amount 500-fold 1400-fold reduced electronic compared tobacco cigarettes.14 substances produced combustion tobacco cigarettes like polycyclic aromatic hydrocarbons present liquids tested although still inadequate research electronic cigarettes progressed past year 14th annual meeting society research nicotine tobacco europe romagna et al17 presented cytotoxic study comparing electronic cigarette vapor tobacco cigarette smoke found vapor extract 10 different commercially available liquids cytotoxic cultured mammalian cells compared significant cytotoxicity observed tobacco smoke extract.17 three clinical studies effects electronic cigarettes human health performed vardavas et al18 found 5 minute use electronic cigarette produced mild significant elevation pulmonary resistance.18 however comparison effects tobacco cigarettes performed flouris et al19 found elevation wbc count found electronic cigarette use comparison wbc neutrophil counts significantly elevated immediately tobacco cigarette smoking.19 farsalinos et al20 studied smokers electronic cigarette users echocardiography smoking electronic cigarette use respectively.20 acute diastolic dysfunction observed smokers immediately smoking 1 cigarette diastolic function preserved using electronic cigarette 7 minutes interestingly although electronic cigarette users previously heavy smokers took average 2 days quit smoking use device despite data fact study found electronic cigarettes harmful compared tobacco cigarettes must emphasized research still infancy more studies needed especially clinical studies long term effects it take several years however studies published awareness use electronic cigarettes increased recently delay also occur knowledge smoking related disease beneficial effects smoking cessation take several years becoming clinically evident time research focus pathophysiological mechanisms smoking causes disease proceed laboratory clinical level the crucial scientific question addressed whether electronic cigarettes less harmful compared tobacco cigarettes since marketed solely tobacco harm reduction product new habit general population case regulation specific quality standards implemented use non pharmaceutical grade nicotine constituents may lead presence toxic tobacco impurities liquids subsequently inhaled user.14 although exclude constituents electronic cigarette vapor may beneficial effects reducing wbc count patient probable explanation reversal cin caused smoking cessation smoking causes diseases variety mechanisms including inflammation.21 causes 20%25% increase peripheral blood leukocyte count22 addition elevated levels inflammatory markers like c reactive protein.23 cin uncommon condition associated greater elevation wbcs neutrophils observed majority smokers the patient persistently elevated wbc count mildly elevated c reactive protein levels without underlying disease this may represent state low grade inflammation risk factor future cardiovascular disease.24 although smoker several years cin developed could find specific underlying cause development condition particular time presentation we know however inflammatory markers temporal relationship smoking,25 might explain delay cin presentation cigarette smoking suggested potential cause condition patient extensive diagnostic analysis excluded possible conditions intake medications corticosteroids lithium associated neutrophilia.9 despite use medically approved methods patient failed quit smoking finally aid electronic cigarettes able quit smoking timely manner five months later cin reversed although using electronic cigarette daily basis in conclusion presented case young smoker cin low grade inflammation reversed smoking cessation electronic cigarette use successful smoking cessation tool two failures quit smoking one use currently approved pharmaceutical methods the daily use electronic cigarettes hinder beneficial effects smoking cessation patient undoubtedly case report way conclusive effects electronic cigarettes health however indicates research potential efficacy health consequences electronic cigarettes tobacco harm reduction product intensified time recommend use physicians face two important ethical dilemmas daily practice advise patients managed quit smoking using electronic cigarettes like patient stop using risk smoking relapse patients repeatedly failed quit smoking currently approved methods patient study denied possibility however small may quit smoking using electronic cigarettes

introduction : smoking is a major risk factor for a variety of diseases . electronic cigarettes are battery - operated devices that deliver nicotine to the lungs by evaporation of a liquid . chronic idiopathic neutrophilia is a condition characterized by elevated white blood cell and neutrophil counts without any underlying disease ; smoking has been implicated as a potential cause.case presentation : a male caucasian patient , born in 1977 , presented in september 2005 with asymptomatic elevation of white blood cell and neutrophil count , and mildly - elevated c - reactive protein levels . he was a smoker since 1996 and was treated with 20 mg / day of simvastatin since 2003 due to hyperlipidemia . clinical examination , and laboratory and imaging investigations ruled out any infectious , haematological , rheumatological , or endocrine conditions . he was followed - up regularly and was advised to stop smoking . he had 2 unsuccessful attempts to quit smoking ; one was unassisted and the second was performed with the use of both varenicline and nicotine replacement therapy ( patches ) . during the subsequent 6.5 years , his leukocyte and c - reactive protein levels were repeatedly elevated ; the condition was consistent with chronic idiopathic neutrophilia . in february 2012 , he started using electronic cigarettes and he managed to quit smoking within 10 days . after 6 months , laboratory examination showed normalized leukocyte count and c - reactive protein levels , confirmed immediately by a second laboratory and by repeated tests after 1 and 2 months.conclusion:smoking cessation with the use of electronic cigarette led to reversal of chronic idiopathic neutrophilia . the daily use of electronic cigarette may help preserve the beneficial effects of smoking cessation .

based results 5 randomized clinical trials rcts mechanical thrombectomy using stent retriever approved standard treatment acute anterior circulation stroke due occlusions internal carotid artery ica m1 segment middle cerebral artery mca recent studies regarding meta analysis 5 rcts showed stent retriever thrombectomy associated considerable improvement functional independence compared standard medical care after acceptance effective treatment option next steps establish patient selection criteria generalize stent retriever thrombectomy broader class stroke patients acute large vessel occlusions broaden treatment indications stent retriever thrombectomy although exist studies investigated prognostic factors predict outcomes stent retriever thrombectomy patients acute anterior circulation stroke studies limited small sample size inclusion patients posterior circulation stroke 4 8 thus study aimed investigate clinical imaging procedural factors predictive good outcome mortality stent retriever thrombectomy large cohort patients acute anterior circulation stroke from december 2010 november 2015 total 356 consecutive patients presenting acute ischemic stroke due ica mca occlusions treated stent retriever thrombectomy comprehensive regional stroke center mri examinations performed using 1.5-t unit signa hdxt ge medical systems milwaukee usa mri sequences included dwi gradient echo imaging flair sequence 3-dimensional tof mra perfusion imaging dwi sequences obtained axial plane using single shot spin echo echo planar technique following parameters tr 9,000 ms te 80 ms slice thickness 4 mm interslice gap 0 mm fov 260260 mm b values 0 1,000 sec mm 356 patients prestroke modified rankin scale mrs score 3 n=11 concomitant posterior circulation infarctions n=8 lost follow n=2 ) we prospectively collected following clinical imaging procedural data 335 patients demographic features cerebrovascular risk factors nihss scores admission use iv thrombolysis time endovascular treatment procedure time time reperfusion revascularization status underlying intracranial atherosclerotic stenosis tandem occlusion proximal cervical portion ica intracranial hemorrhage post therapeutic ct scans gradient echo mri alberta stroke prognosis early ct score aspects applied dwi dwi aspects clinical outcomes 3 months the institutional ethics committee approved retrospective analysis waived informed consent based study design upon admission the inclusion criteria stent retriever embolectomy follows 1 procedure started within 6 hours symptom onset 2 baseline nihss score 4 3 occlusion ica mca 4 intracranial hemorrhage detected cranial ct mri 5 infarct volume less one third mca territory dwi determined dwi aspects 3 non enhanced ct determined alteplase thrombolysis acute noninterventional therapy ischemic stroke atlantis criteria for patient written informed consent endovascular therapy obtained family member endovascular therapy performed conscious sedation cases agitation intravenous bolus midazolam stent based thrombectomy solitaire stent covidien irvine usa trevo stent stryker kalamazoo usa performed first line endovascular treatment when stent based thrombectomy unsuccessful additional mechanical approaches performed including manual aspiration thrombectomy penumbra reperfusion catheter penumbra alameda usa navien catheter covidien irvine usa intracranial angioplasty without stenting performed severe 70% underlying intracranial atherosclerotic stenosis observed when patient tandem occlusion proximal cervical portion ica carotid angioplasty stenting performed prior stent retriever thrombectomy revascularization status assessed final angiogram classified according modified tici scale successful revascularization defined modified tici grade 2b 3 all patients underwent non enhanced ct scans immediately 24 hours endovascular treatment gradient echo mri 24 36 hours treatment intracerebral hemorrhages assessed posttreatment ct gradient echo mr images classified hemorrhagic infarction hi parenchymal hemorrhage ph based european cooperative acute stroke study ecass criteria symptomatic intracranial hemorrhage defined intracranial hemorrhage caused neurological deterioration increase 4 points nihss score deterioration 1 point level consciousness nihss clinical outcome assessed stroke neurologist using modified rankin scale mrs outpatient visit 3 months treatment if patients unable attend outpatient clinic outcomes obtained via telephone interview first relationship clinical procedural characteristic 3-month outcome determined 2 test fisher exact test used comparing categorical variables mann whitney u test used comparing continuous variables second independent associations good outcome mrs 0 2 clinical procedural factors determined multivariate logistic regression analysis the variables tested multivariate logistic regression models p<0.05 univariate analysis third multivariate logistic regression analysis performed identify independent predictors mortality 3 months variables p value 0.05 univariate analysis mortality included multivariate logistic regression analysis all statistical analyses performed spss software version 21.0 ibm spss chicago il usa p value from december 2010 november 2015 total 356 consecutive patients presenting acute ischemic stroke due ica mca occlusions treated stent retriever thrombectomy comprehensive regional stroke center mri examinations performed using 1.5-t unit signa hdxt ge medical systems milwaukee usa mri sequences included dwi gradient echo imaging flair sequence 3-dimensional tof mra perfusion imaging dwi sequences obtained axial plane using single shot spin echo echo planar technique following parameters tr 9,000 ms te 80 ms slice thickness 4 mm interslice gap 0 mm fov 260260 mm b values 0 1,000 sec mm 356 patients prestroke modified rankin scale mrs score 3 n=11 concomitant posterior circulation infarctions n=8 lost follow n=2 ) we prospectively collected following clinical imaging procedural data 335 patients demographic features cerebrovascular risk factors nihss scores admission use iv thrombolysis time endovascular treatment procedure time time reperfusion revascularization status underlying intracranial atherosclerotic stenosis tandem occlusion proximal cervical portion ica intracranial hemorrhage post therapeutic ct scans gradient echo mri alberta stroke prognosis early ct score aspects applied dwi dwi aspects clinical outcomes 3 months the institutional ethics committee approved retrospective analysis waived informed consent based study design the inclusion criteria stent retriever embolectomy follows 1 procedure started within 6 hours symptom onset 2 baseline nihss score 4 3 occlusion ica mca 4 intracranial hemorrhage detected cranial ct mri 5 infarct volume less one third mca territory dwi determined dwi aspects 3 non enhanced ct determined alteplase thrombolysis acute noninterventional therapy ischemic stroke atlantis criteria for patient written informed consent endovascular therapy obtained family member endovascular therapy performed conscious sedation cases agitation intravenous bolus midazolam stent based thrombectomy solitaire stent covidien irvine usa trevo stent stryker kalamazoo usa performed first line endovascular treatment stent based thrombectomy unsuccessful additional mechanical approaches were performed including manual aspiration thrombectomy penumbra reperfusion catheter penumbra alameda usa navien catheter covidien irvine usa intracranial angioplasty without stenting performed severe 70% underlying intracranial atherosclerotic stenosis observed when patient tandem occlusion proximal cervical portion ica carotid angioplasty stenting performed prior stent retriever thrombectomy revascularization status assessed final angiogram classified according modified tici scale successful revascularization defined modified tici grade 2b 3 all patients underwent non enhanced ct scans immediately 24 hours endovascular treatment gradient echo mri 24 36 hours treatment intracerebral hemorrhages assessed posttreatment ct gradient echo mr images classified hemorrhagic infarction hi parenchymal hemorrhage ph based european cooperative acute stroke study ecass criteria symptomatic intracranial hemorrhage defined intracranial hemorrhage caused neurological deterioration increase 4 points nihss score deterioration 1 point level consciousness nihss clinical outcome assessed stroke neurologist using modified rankin scale mrs outpatient visit 3 months treatment if patients unable attend outpatient clinic outcomes obtained via telephone interview first relationship clinical procedural characteristic 3-month outcome determined 2 test fisher exact test used comparing categorical variables mann whitney u test used comparing continuous variables second independent associations good outcome mrs 0 2 clinical procedural factors determined multivariate logistic regression analysis the variables tested multivariate logistic regression models p<0.05 univariate analysis third multivariate logistic regression analysis performed identify independent predictors mortality 3 months variables p value 0.05 univariate analysis mortality included multivariate logistic regression analysis all statistical analyses performed spss software version 21.0 ibm spss chicago il usa of 335 patients acute anterior circulation stroke 233 patients occlusions mca 102 ica successful revascularization modified tici 2b 3 achieved 81.8% n=274/335 good outcome 45.1% patients n=151/335 parenchymal hemorrhage occurred 8.9% n 30/335 symptomatic hemorrhage 3.9% n=13/335 seventy one patients 21.2% received manual aspiration thrombectomy rescue therapy failed stent retriever thrombectomy forty patients 11.9% underlying intracranial atherosclerotic stenosis 36 10.7% tandem occlusion proximal cervical portion ica in entire cohort n=335 median dwi aspects 7 iqr 6 8 patients good outcome higher dwi aspects score compared poor outcome 8 vs. 7 1.278 p<0.001 in univariate analysis following variables identified predictors good outcome 3 months younger age absence hypertension dwi aspects mca occlusions vs. ica occlusions low baseline nihss need rescue therapy successful revascularization absence parenchymal hemorrhage symptomatic hemorrhage shorter procedure time shorter time revascularization dichotomized patients aged 80 years frequent poor outcome mrs 3 6 aged 80 years 69.6% vs. 51.1% 2.2 p=0.007 univariate analysis multivariate analysis younger age 0.965 ; 95% ci 0.944 0.986 p=0.001 successful revascularization 4.658 95% ci 2.240 9.689 p<0.001 low baseline nihss 0.908 95% ci 0.855 0.965 p=0.002 absence parenchymal hemorrhage 0.150 95% ci 0.049 0.460 p=0.001 independent predictors good outcome 3 months table 2 in univariate analysis age history previous stroke transient ischemic attack tia revascularization status symptomatic hemorrhage baseline nihss score associated mortality 3 months patients aged 80 years higher mortality rate aged 80 years 18.8% vs. 8.6% 2.2 p=0.015 univariate analysis multivariate analysis age 1.043 95% ci 1.002 1.086 p=0.041 history previous stroke tia 3.124 95% ci 1.340 7.281 p=0.008 revascularization 0.171 95% ci 0.079 0.370 p<0.001 parenchymal hemorrhage 2.961 95% ci 1.059 8.276 p=0.038 independent predictors mortality 3 months table 3 the main findings study summarized follows 1 age revascularization status parenchymal hemorrhage significant independent predictors good clinical outcome also mortality 3 months 2 addition nihss score admission independently associated good outcome whereas history previous stroke tia independently associated mortality several studies evaluated independent predictors clinical outcome stent retriever thrombectomy patients acute ischemic stroke due intracranial large vessel occlusion 4 8 these previous studies identified younger age lower admission nihss score successful recanalization shorter procedure time smaller early ischemic changes pretreatment ct lower serum glucose level independent predictors good outcome 4 8 symptomatic ich baseline dwi aspect score baseline nihss 20 onset recanalization 5 hours identified independent predictors mortality stent retriever thrombectomy however studies limited small sample sizes inclusion posterior circulation stroke the strengths study include large sample size inclusion anterior circulation stroke consistency patient selection endovascular procedures study age a good outcome significantly less frequent among patients 80 years among 80 years 30.4% vs. 48.9% mortality significantly frequent among patients 80 years 18.8% vs. 8.6% present study patient age 80 years associated 2.2-fold increase poor outcome mortality compared younger cohort the results study agreement north american solitaire stent retriever acute stroke nasa registry included 354 patients nasa registry patients 80 years showed less favorable outcome 27.3% vs. 45.4% p=0.02 increased mortality 43.9% vs. 27.3% p=0.01 compared patients 80 years age however meta analysis 4 recent randomized trials showed trend toward better outcome mrs 0 2 90 days 38% vs. 19% significant reduction mortality 20% vs. 41% adjusted 3.7 p=0.01 patients 80 years received solitaire stent thrombectomy compared received medical treatment alone thus old age used exclusion criteria stent retriever thrombectomy patients acute large vessel occlusions our study suggests successful recanalization still strong predictor clinical outcome endovascular treatment acute ischemic stroke recent era mechanical thrombectomy present study successful recanalization defined modified tici 2b ) occurred 82% patients powerful independent predictor good clinical outcome mortality our results consistent 2 previous reports demonstrated successful recanalization one independent predictors good outcome regard association recanalization mortality the nasa registry showed successfully recanalized patients lower mortality 25.2% vs. 46.9% p<0.001 univariate analysis solitaire stent thrombectomy nasa registry proximal occlusion ica basilar artery occlusion high admission nihss score 18 need rescue therapy predictors mortality successfully recanalized patients the results study together previous studies strongly suggest neurointerventionalists make every effort achieve successful recanalization order increase good outcome decrease mortality parenchymal hemorrhage considered catastrophic complication reperfusion therapy acute ischemic stroke known one predictors clinical outcome study parenchymal hemorrhage occurred 8.9% patients patients parenchymal hemorrhage good outcome less frequently 13.3% vs. 48.2% mortality frequently 23.3% vs. 9.5% compared without our findings consistent recent multicenter retrospective study included 1,122 patients anterior circulation large vessel occlusion strokes received multimodal endovascular therapy study parenchymal hemorrhage occurred 8.6% patients 96 1122 associated higher rate poor outcome or=6.24 p<0.001 higher mortality or=3.52 p<0.001 study atrial fibrillation or=1.61 p=0.045 independent predictor parenchymal hemorrhage in addition mishra et al suggested presence severely hypoperfused lesion pretreatment imaging defined low cerebral blood volume perfusion mri strong predictor parenchymal hemorrhage or=33 p<0.001 patients undergoing endovascular therapy acute stroke however significant clinical procedural predictor parenchymal hemorrhage univariate multivariate analysis study although occurrence parenchymal hemorrhage endovascular therapy multifactorial careful patient selection based pretreatment imaging studies judicious management blood pressure reduced use contrast agents thrombolytic drugs endovascular procedure needed decrease occurrence parenchymal hemorrhage interestingly history previous stroke tia independently associated mortality study previously reported stent retriever thrombectomy studies mortality occurred frequently patients previous stroke tia 23.1% vs. 8.5% without although novel finding studies regarding mechanical thrombectomy using stent retrievers history previous stroke tia found predictor short term long term mortality patients acute ischemic stroke compared healthy control subjects observational studies the results study previous studies indicate improved management vascular risks needed prevent secondary stroke subsequent cardiovascular mortality patients first ever stroke study nihss score admission independently associated good outcome mortality reported baseline nihss score or=1.228 p=0.002 independent predictor poor outcome 3 months jiang et al showed patients lower baseline nihss score score 20 good outcome less frequently 21.1% vs. 56.9% or=5.25 compared nihss score 20 in addition shi et al reported baseline nihss score independent predictor functional dependence mrs 3 6 despite successful revascularization or=1.13 p=0.0074 109 patients treated trevo stent retriever however like advanced age severe stroke used exclusion criteria patients severe stroke even worse medical therapy alone baseline aspects measured ct mri found independent predictor clinical outcome stent retriever thrombectomy two previous studies present study dwi aspects significantly higher patients good outcome poor outcome univariate analysis or=1.278 per 1-point increase p<0.001 however dwi aspects independent predictor good outcome mortality multivariate analyses similarly recent study showed differences outcomes patients high dwi aspect scores 7 10 intermediate scores 4 6 underwent stent retriever thrombectomy acute anterior circulation stroke this finding may high rate successful revascularization stent retrievers study disparity aspect score infarct lesion volume in addition potential confounding factors blood glucose level analyzed study admission blood glucose level known associated poor outcome increased hemorrhage mortality following iv thrombolysis stent retriever thrombectomy we analyze blood glucose level study missing patients finally fact 21.2% patients received manual aspiration thrombectomy rescue therapy failed stent retriever thrombectomy may limit accuracy data regard interpretation related value stent retriever thrombectomy in conclusion age revascularization status parenchymal hemorrhage independently associated good outcome mortality stent retriever thrombectomy patients acute anterior circulation stroke in addition nihss score admission independently associated good outcome whereas history previous stroke independently associated mortality our results suggest achieving successful revascularization trying reduce parenchymal hemorrhage priorities performing stent retriever thrombectomy patients acute anterior circulation stroke the data also suggest novel finding history previous stroke tia considered predictor mortality patients receiving stent retriever thrombectomy

background and purpose predictive factors associated with stent - retriever thrombectomy for patients with acute anterior circulation stroke remain to be elucidated . this study aimed to investigate clinical and procedural factors predictive of good outcome and mortality after stent - retriever thrombectomy in a large cohort of patients with acute anterior circulation stroke.methods we analyzed clinical and procedural data in 335 patients with acute anterior circulation stroke treated with stent - retriever thrombectomy . a good outcome was defined as a modified rankin scale score of 0 to 2 at 3 months . the associations between clinical , imaging , and procedural factors and good outcome and mortality , respectively , were evaluated using logistic regression analysis.results using multivariate analysis , age ( odds ratio [ or ] , 0.965 ; 95% confidence interval [ ci ] , 0.944 - 0.986 ; p=0.001 ) , successful revascularization ( or , 4.658 ; 95% ci , 2.240 - 9.689 ; p<0.001 ) , parenchymal hemorrhage ( or , 0.150 ; 95% ci , 0.049 - 0.460 ; p=0.001 ) , and baseline nihss score ( or , 0.908 ; 95% ci , 0.855 - 0.965 ; p=0.002 ) were independent predictors of good outcome . independent predictors of mortality were age ( or , 1.043 ; 95% ci , 1.002 - 1.086 ; p=0.041 ) , successful revascularization ( or , 0.171 ; 95% ci , 0.079 - 0.370 ; p<0.001 ) , parenchymal hemorrhage ( or , 2.961 ; 95% ci , 1.059 - 8.276 ; p=0.038 ) , and a history of previous stroke / tia ( or , 3.124 ; 95% ci , 1.340 - 7.281 ; p=0.008).conclusions age , revascularization status , and parenchymal hemorrhage are independent predictors of both good outcome and mortality after stent retriever thrombectomy for acute anterior circulation stroke . in addition , nihss score on admission is independently associated with good outcome , whereas a history of previous stroke is independently associated with mortality .

65-year old man intermittent colicky periumbilical pain first occurred two months earlier admitted hospital he eight year history congestive heart failure caused mitral valvular regurgitation atrial fibrillation he nonalcoholic history diarrhea hematochezia melena vital signs admission stable laboratory findings including white blood cell count liver function test electrolytic balance within normal ranges electrocardiography revealed atrial fibrillation chest radiography demonstrated cardiomegaly shown exclude acute appendicitis initial ultrasonography us ) was performed demonstrated diffuse segmental concentric wall thickening terminal ileum proximal ileocecal valve nonspecific ileitis crohn disease intestinal tuberculosis ischemic enteritis suggested possible causes bowel wall thickening order evaluate terminal ileum colonoscopic examination performed the ascending colon found completely obstructed circumferential mass lesion colonoscopic fiber could advanced subsequent ct scanning showed markedly dilated small bowel ascending colon concentric hyperattenuating focal wall thickening hepatic flexure ascending colon fig in addition terminal ileum dilated showed diffuse concentric wall thickening long segments heterogeneous contrast enhancement thickened wall there appeared several possible diagnoses including ischemic enterocolitis caused thromboembolism mesenteric vessels arising atrial fibrillation inflammatory bowel disease involving ascending colon terminal ileum ischemic infectious enteritis associated colon cancer stool culture yielded lactose fermenting gram negative bacillus urine culture yielded citrobacter freundii gram staining urine revealed presence gram negative rods organisms isolated blood cultures in addition conservative management congestive heart failure patient underwent antibiotic therapy amoxacillin tobramycin aztreonam two weeks ciprofloxacin several days symptoms abdominal pain ameliorated level bowel sound decreased laboratory findings continued within normal ranges vital signs stable except intermittent fever 38.2 30 days admission time hepatic flexure ascending colon found completely obstructed hard concentric mass 15 cm terminal ileum proximal ileocecal valve markedly dilated diffusely thickened a cut section thickened terminal ileum revealed marked submucosal edema depth approximately 10 mm though evidence mucosal lesion microscopic examination also showed mucosal folds thickened ileal loop blunted submucosal edema extensive inflammatory reaction infiltrations neutrophils areas thickened bowel wall neutrophil infiltration extended subjacent muscular layer even serosa fig 1d inflammatory reactions provided evidence granuloma formation histologic findings consistent phlegmonous enteritis phlegmonous enterocolitis rare inflammatory bowel disease high mortality rate least 60% the association disease entity variety liver diseases well documented 1 3 though cases associated lobar pneumonia pharyngitis infected peritoneojugular venous shunt septicemia reported also occurred healthy individuals 1 4 6 several kinds pathognomic bacteria demonstrated culture histologically 1 6 gram staining intestinal lesions revealed variety entities streptococci gram positive cocci gram negative -positive rods the mortality rate associated disease continues high due delayed diagnosis 1 5 thus cases reported literature discovered autopsy examination surgical specimens following surgery 1 6 some reports suggested earlier diagnosis surgical resection diseased bowel together use broad- spectrum antibiotics led good outcome 1 6 pathogenesis disease entity clear ito et al first direct toxic effect alcohol may affect gastrointestinal tract prolonged alcohol ingestion leading changes intestinal mucosa increased intestinal permeability subsequent penetration lamina propria antigens organisms intestinal lumen results local antibody response second chronic alcoholism systemic mucosal immune mechanisms impaired may exacerbate bacterial infection known organisms involved phlegmonous enteritis confined submucosa bowel wall edema associated portal hypertension described liver cirrhosis loose connective tissue submucosa excellent soil rapid diffuse spread organisms involved episode bacteremia 5 first patient alcoholic evidence liver disease septicemia second clinical course silent long period discovered surgery previously reported cases hand manifested acute serious clinical course one led even sudden death case the early use broad spectrum antibiotics might helped condition persist the literature english includes one case report dealing radiologic findings pertaining disease mooney et al 6 reported ct findings one case nonspecific small bowel wall thickening small amount ascites noted case the terminal ileum showed marked wall thickening thumbprinting blunted mucosal folds revealed ultrasonography the hypoattenuating focal areas thickened wall shown microscopic examination submucosal abscesses case thought provide clue diagnosis phelgmonous enteritis

phlegmonous enteritis is a rare infective inflammatory disease of the intestine , predominantly involving the submucosal layer . it is difficult to diagnose and often fatal . its association with alcoholism and various liver diseases , although rarely reported , is well documented . we report a case of phlegmonous enteritis in a male patient with congestive heart failure and colon cancer , and describe the ultrasonographic and ct findings .

neuroblastoma common extracranial solid tumor childhood accounts 7% malignancies patients younger 15 years it originates sympathetic nervous system particular developing incompletely committed precursor cell derived neural crest tissues neuroblastoma occurs sporadically 98% cases genetic defect involved rare familial neuroblastoma subset cases neuroblastoma presenting context congenital abnormalities neural crest association germline loss function mutation homeobox gene phox2b demonstrated hand familial neuroblastoma associated congenital disorders neural crest arises activating mutations anaplastic lymphoma kinase alk oncogene whose somatic mutations however observed sporadic cases disease due widespread presence sympathetic nervous tissue various body organs apparatus the presenting features neuroblastoma may variable depending location primary tumor also frequent metastases furthermore young children neuroblastoma exceptionally manifests paraneoplastic opsoclonus myoclonus ataxia poma due antineuronal nuclear anti hu antibodies also associated gastrointestinal disturbances constipation gut dismotility paralytic ileus contrary watery diarrhea due aberrant vasoactive intestinal peptide secretion proteinuria part presenting features childhood cancer patients neuroblastoma we report case proteinuria initial reason medical evaluation child neuroblastoma a 10-month old girl admitted hospital investigations nephrotic range proteinuria she born unrelated italian healthy parents spontaneous delivery 38th week uncomplicated pregnancy birth weight 3,110 g. growth development normal age nine months began vomiting feeding poorly sweating copiously losing weight admission her weight 7,220 g 3th percentile reduced previously reached 8,450 g length 68 cm body temperature 37.5c heart rate 150 beats min respiratory rate 46 breaths min blood pressure normal repeated measurements 82/43 mm hg complete blood cell count showed leukocytes 12,800/mm red cell count 7,160,000/mm hemoglobin 15.7 g dl platelets 501,000/mm blood urea nitrogen 28 mg dl 10.23 mmol l creatinine 1.5 mg dl 132.60 mol l glucose 92 mg dl 5.1 mmol l ast 25 iu l alt 42 iu l total plasma protein level 7.9 g dl albumin 56.9% 4.2 g dl a1 7.3% a2 21.3% 1 6.3% 2 3.4% 4.8% uric acid 8.5 mg dl sodium 138 mmol l potassium 3.2 mmol l chloride 88 mmol l venous ph 7.55 partial pressure carbon dioxide 29.2 mm hg probably due crying hyperventilation bicarbonate 27.8 mmol l 4 the iii activity 100% prothrombin activity 100% aptt 29 serum lactate dehydrogenase 376 iu l ferritin 5.9 mol l normal value age 7140 mol l she polyuria hypostenuria diuresis 125 ml kg/24 h urinalysis revealed nephrotic range proteinuria 6,100 mg/24 h albuminuria 4,540 mg/24 h urinary loss igg 107 mg/24 h a1 microglobulin 29.4 mg/24 h mild glucosuria 39 mg dl aminoaciduria also found without hematuria casts urinary ph 7.5 urinary density 1,005 electrocardiogram revealed sinus tachycardia 180 beats min echocardiogram showed mild concentric left ventricular hypertrophy however without pathological features an endocrinologic evaluation revealed increased plasma renin 8 g l h reference range 1.0 4.5 g l h aldosterone 4.83 nmol l reference range 0.1 0.8 nmol l levels cortisol thyroid hormones within normal range plasma erythropoietin 42.6 mu ml reference range 3.7 37.5 mu ml urinary excretion vanillylmandelic acid increased 11 mg/24 h 1.57 mg kg/24 h reference range 0.1 0.18 mg kg/24 h catecholamines normal range except normetanephrine noradrenaline also elevated normetanephrine 1,537 g/24 h reference range 88 440 g/24 h noradrenaline 120 g/24 h reference range 010 g/24 h ultrasound abdomen examination revealed solid suprarenal mass left side sized 2 2 cm right kidney showed slightly increased echogenicity upper side high resolution ct showed abdominal mass sized 5 5.8 10.7 cm localized vertebral bodies d9 l3 aorta enveloping celiac tripod superior mesenteric artery bilaterally renal vessels the upper half right kidney showed area reduced perfusion left kidney showed abnormal tissue density adrenal glands identifiable context tumor mass calcifications recognizable histopathology showed tumor low grade neuroblastic differentiation mitosis karyorrhexis index 2% elevated mitotic activity in patient presenting signs symptoms neuroblastoma included severe dehydration polyglobulia tubulointerstitial damage acute kidney injury renal insufficiency electrolyte acid base unbalancing heavy glomerular proteinuria although diarrhea dehydration may observed presentation neuroblastoma tubular alterations definitely unusual we able identify one case previously 4-year old boy affected neuroblastoma presenting nephrotic syndrome described 1979 renal histology demonstrated membranous glomerulonephritis due immune complex hand poma syndrome gastrointestinal disturbances associated anti hu antibodies furthermore development immune complex demonstrated mice c1300 neuroblastoma tumors confirming tendency neuroblastoma produce immunologic paraneoplastic diseases nevertheless recent study performed broad series adults solid tumors prevalence rheumatic syndromes 2.65% none manifested nephropathy shows exceptionality manifestations also adult patients opinion the physiopathology complex clinical picture case describe herein ascribable autoimmune pathogenesis rather hemodynamic mechanism subsequently complicated series physiopathologic phenomena the initial event development tumor mass adrenal glands extension upwards envelope great abdominal blood vessels bilaterally renal vessels the meaningful feature disruption renal blood supply hemodynamic consequences different various areas renal tissue revealed sonography ct findings so local increased intraglomerular pressure could prime development hyponatremic hypertensive syndrome characterized glomerular hyperfiltration proteinuria polyuria acid base electrolyte unbalancing rarely described children renovascular systemic hypertension 9 10 11 although circumstances expected consequence proteinuria development nephrotic syndrome cases plasma albumin inexplicably remains normal level even case lasting massive albuminuria patient 11 12 13 14 we could speculate severe dehydration following copious sweating vomiting polyuria caused hypovolemia hemoconcentration plasma albumin concentration persisted beyond threshold edema also polyglobulia could explained mechanism even another factor could increased production erythropoietin probably stimulated local renal parenchyma hypoxia hypovolemia also responsible mild activation renin angiotensin aldosterone system perhaps metabolic alkalosis hypochloremia hypokalemia loss chloride sweating likely important cause phenomenon hypovolemia disruption local renal blood circulation caused acute kidney injury signs symptoms proximal tubular damage glucosuria aminoaciduria on hand profound hypochloremia cause metabolic alkalosis instead metabolic acidosis typically associated proximal tubular damage increased vasoactive amine secretion neuroblastoma infrequent may cause elevated although usually severe hypertension conclusion 10-month old child alteration renal function glomerular tubular levels presenting features neuroblastoma resulting multiple pathogenic mechanisms our report furthermore emphasizes high variability various facets clinical manifestations neuroblastoma

neuroblastoma is the most common extracranial solid tumor in childhood . its presenting signs and symptoms may be highly variable , depending on the location of the primary tumor and its local or metastatic diffusion and , rarely , with paraneoplastic syndrome such as opsoclonus - myoclonus - ataxia syndrome and gastrointestinal disturbances , due to autoantibodies or to aberrant secretion of vasoactive intestinal peptide . herein we describe a 10-month - old child with neuroblastoma presenting with a complex clinical picture characterized by acute kidney injury manifested by renal insufficiency and signs and symptoms of tubulointerstitial damage , with polyuria , polydipsia , glucosuria , aminoaciduria and hypochloremic metabolic alkalosis , and of glomerular damage with heavy proteinuria . imaging study documented a suprarenal mass enveloping the aorta and its abdominal and renal ramifications and bilaterally renal veins . this clinical picture shows some analogies with the hyponatremic - hypertensive syndrome concerning the renovascular disease ; however , in absence of systemic arterial hypertension , the heavy proteinuria and the polyuria could be explained by sectional increased intraglomerular pressure , due to local renal blood vessels constriction . hypochloremic metabolic alkalosis probably developed because of local production of renin , responsible of renin - angiotensin - aldosterone system activation , but above all because of chloride loss through sweating . the long lasting dehydration , due to vomiting , sweating and polyuria , caused prolonged prerenal failure evolving in proximal tubular damage manifestations .

mature mirnas short single stranded rna molecules approximately 1923 nucleotides length the mirna sequence encoded stem loop structure primary transcript cleaved nucleus ribonuclease iii enzyme drosha form precursor mirna pre mirna the pre mirna subsequently exported cytoplasm exportin cleaved another ribonuclease iii enzyme dicer form mature mirna 13 mature mirnas regulate expression large number genes posttranscriptional level mirna partially complementary sequence mirna recognition elements mre 3 untranslated regions utrs target mrnas the seed sequence seven nucleotides mirna determines specificity mrna targeting whereas remaining mirna sequence supposed stabilize mirna target complex mirna inhibit translation target mrnas blocking protein translation machinery sequestering mrna transcript away ribosomal interaction mirna also induce target mrna degradation similar way like rna interference 1 5 mirnas identified wide range species computational analysis shows nearly 30% protein coding genes modulated mirnas general mirnas negatively regulate expression targets however also reported mir-369 3p upregulate expression target tumor necrosis factor- tnf- mirnas demonstrated play important roles many biological processes cell cycle control proliferation apoptosis differentiation metabolism hemopoiesis development a rapidly growing body evidence shows mirnas also comprehensive functions tumor progression some mirnas may function oncogenes also called oncomirs mirnas supposed tumor suppressors the importance mirnas cancer highlighted fact half mirna genes located cancer associated regions fragile sites frequently altered deleted cancer many tumor types show unique mirna signatures thus mirnas may use cancer diagnosis prognosis 11 12 pituitary adenomas usually benign intracranial neoplasms accounting 1015% diagnosed brain tumors pituitary adenomas derived single mutant cell five differentiated cell types within pituitary gland somatotropes lactotropes corticotropes thyrotropes gonadotropes respectively secrete growth hormone gh prolactin prl adrenocorticotrophic hormone acth thyroid stimulating hormone tsh gonadotropins follicle stimulating hormone fsh luteinizing hormone lh according hormonal activity pituitary adenomas defined functioning causing endocrine dysfunction cushing disease acth secreting pituitary adenomas acromegaly gh secreting pituitary adenomas galactorrhea amenorrhea prl secreting pituitary adenomas hyperthyroidism tsh secreting pituitary adenomas hand nonfunctioning pituitary adenomas nfa give rise hormone hypersecretion pituitary adenomas might small lesions slow growth however pituitary adenomas grow rapidly cause tumor mass effect local compressive effect large pituitary tumors brain structures cranial nerves also invade downwards paranasal sinuses laterally cavernous sinuses upwards parenchyma brain occasionally malignant pituitary carcinomas metastasize distant locations central nervous system lymph nodes liver sites throughout body recent years nevertheless correlation function mirnas target genes pathogenesis pituitary adenomas remain largely unknown only small number mirnas target genes pituitary adenomas validated far review summarize recent advances study mirnas validated potential targets pituitary adenomas discuss future perspectives aberrant expressions mirnas demonstrated far table 1 mir-15a mir-16 1 first two mirnas shown differential expression pituitary adenomas mir-15a mir-16 1 genes located chromosome 13q14 region frequently deleted pituitary tumors previous studies suggested genes locus may responsible progression pituitary adenoma aggressive form 2005 mir-15a mir-16 1 reported lower expression gh secreting prl secreting pituitary adenomas normal tissues downregulation correlated greater tumor volume impaired secretion p43 potent anticancer cytokine suggesting mir-15a mir-16 1 may function tumor suppressors inactivation may contribute tumor growth pituitary adenomas another study acth secreting pituitary tumors mir-15a mir-16 were also expressed lower level association mirnas expression tumor size observed study this accordance result subsequent report showed correlation downregulation mir-15a gh secreting pituitary tumor size mutations mir-16 1 gene reported partially responsible altered expression chronic lymphocytic leukemia cll patients thus worth exploring whether similar mutations pituitary adenoma patients family members located chromosomal regions often altered deleted human tumors downregulation let-7 reported breast lung colon others cancers 3033 let-7 considered tumor suppressor targeting ras oncogene recently studies revealed high mobility group a2 hmga2 negatively regulated let-7 mirnas vitro 35 36 hmga2 plays diverse roles many biological processes embryogenesis differentiation neoplastic transformation overexpression hmga2 hallmark various tumors including pituitary adenomas associated highly malignancy 38 39 the transgenic mice overexpressed hmga2 developed pituitary adenomas indicating hmga2 may involved pituitary tumorigenesis 2009 hmga2 frequently upregulated pituitary adenomas including prl acth fsh lh null cell adenomas relatively rare gh mixed gh prl adenomas hmga2 overexpression decrease let-7 significantly correlated tumor proliferation growth invasion tumor grade lead hypothesis let-7 may also function tumor suppressor pituitary adenomas targeting hmga2 decreased expression let-7a pituitary adenomas also reported studies 27 41 suggesting general downregulation let-7 pituitary adenomas hand mirnas mir-98 also regulate hmga2 expression indicating hmga2 may multiple mirnas regulators pituitary development let-7b c was proposed operate rna binding protein ksrp negative feedback loop ksrp induces maturation let-7b c let-7b c posttranscriptionally downregulates expression ksrp pituitary adenomas derived differentiated cell types within pituitary gland different subtypes pituitary adenomas could display distinct mirna profiles specific profiles might useful distinguish pituitary adenoma subtypes 2007 the representative ones mir-212 mir-026a mir-150 mir-152 mir-191 mir-192 upregulated pituitary adenomas mir-024 1 mir-098 downregulated tumor samples twenty nine mirnas identified able predict pituitary adenoma histotype acth- gh- prl secreting adenomas nfa limit sample numbers the authors analyzed association deregulated mirnas tumor diameter nfa group five mirnas upregulated mir-140 mir-099a mir-099b mir-030b mir-030c one mir-138 2 downregulated macroadenomas compared microadenomas 2009 amaral et al investigated differential expression mirnas acth secreting pituitary tumors in addition decrease let-7a mir-15a mir-16 also found underexpression mir-21 mir-141 mir-143 mir-145 mir-150 acth secreting pituitary adenomas compared normal pituitary tissues among mirnas mir-143 expression decreased human lung colorectal cancers 46 47 reported inhibit kras translation colorectal cancer cell mir-145 downregulated human breast lung colorectal cancers 30 46 47 49 mir-145 could regulate expression various targets different tumors fscn1 esophageal squamous cell carcinoma oct4 egfr nudt1 lung adenocarcinoma 51 52 fli1 colon cancer mir-150 overexpressed hematopoietic progenitor stem cells demonstrated target notch3 human cell development recent study studies conducted aim investigating aberrant expression mirnas gh secreting pituitary adenomas 2010 mao et al identified totally fifty two mirnas differentially expressed gh secreting pituitary adenomas mir-184 mir-524 5p mir-629 mir-766 upregulated mir-124 mir-222 mir-32 mir-744 mir-765 downregulated 2012 another set mirnas identified differentially expressed gh secreting pituitary adenomas eighteen mirnas including mir-34b mir-326 mir-432 mir-548c-3p mir-570 mir-603 drastically constantly downregulated gh adenomas whereas mir-320 significantly upregulated mir-34b and mir-548c-3p demonstrated regulate hmga1 hmga2 expression whereas mir-326 mir-432 mir-570 target hmga2 mir-326 mir-603 could decrease expression e2 transcription factor 1 e2f1 besides mir-107 found overexpressed gh secreting nonfunctioning pituitary adenomas inhibited expression pituitary tumor suppressor gene aryl hydrocarbon receptor interacting protein aip recently palumbo et al identified 17 mirnas differentially expressed gh secreting pituitary tumors specifically five mirnas mir-26b mir-26a mir-212 mir-107 mir-103 upregulated twelve mirnas mir-125b mir-141 mir-144 mir-164 mir-145 mir-143 mir-15b mir-16 mir-186 let-7b let-7a3 mir-128 downregulated mir-26b mir-128 controlled pituitary cell properties regulation direct targets pten bmi1 respectively mirnas also dysregulated nonfunctioning pituitary adenomas nfa 2011 butz et al expressions smad3 smad6 smad9 meg dlk1 significantly decreased nfa pathway analysis silico target prediction specific subset mirnas identified may potentially downregulate tgf- signaling pathway nfa five mirnas predicted target smad3 mir-135a mir-140 5p mir-582 3p mir-582 5p mir-938 overexpressed mir-140 5p already validated target smad3 directly in addition inverse correlation tumor size expression eighteen mirnas observed six mirnas mir-450b-5p mir-424 mir-503 mir-542 3p mir-629 mir-214 significantly underexpressed one mirna mir-592 significantly overexpressed nfa compared normal pituitary tissues another study mir-124a upregulated mirna mir-31 downregulated mirna nonfunctioning pituitary adenomas gonadotropin secreting pituitary adenomas study demonstrated mir-10b upregulated mir-503 downregulated furthermore integration coordination hormones pituitary cells important regulatory function pituitary tissues gonadotropin releasing hormone gnrh acts pituitary gonadotropes stimulate lh fsh synthesis secretion gnrh induces expressions mir-132 mir-212 lt2 pituitary gonadotrope cells regulate cellular morphology migration the p250rhogap protein downstream target mir132/212 downregulation involved morphological change migration altered gnrh it well known dysfunction cell cycle control critical step initiation progression human cancers some oncoproteins tumor suppressors play important roles cell cycle control interacting critical cell cycle regulators cyclin cyclin dependent kinase cdk cell cycle inhibitors tumor progression genes involved cell cycle control often aberrant expression resulting unlimited tumor cell growth some reports suggested deregulated mirnas might also regulate cell cycle pituitary adenomas post transcriptional level figure 1 mir-128a mir-155 mir-516a-3p target 3-utr wee1 exogenous overexpression mirnas inhibited wee1 expression mir-128a brain enriched mirna reported decreased pituitary adenomas its ectopic overexpression reduced neuroblastoma cell motility invasiveness suggesting tumor suppressive role mir-516a-3p involved glioblastoma development associated progression breast cancer these mirnas may take part regulation cell cycle pituitary adenomas together related mirnas hmga2 associated e1a regulated transcriptional repressor p120 e4f interfering p120 e4f binding cyclin promoter ectopic expression hmga2 resulted activation cyclin promoter induction endogenous cyclin expression moreover chromatin immunoprecipitation experiments showed hmga2 associated cyclin promoter gene transcriptionally activated these data indicate cyclin cellular target hmga2 first time lead mechanism hmga2-dependent cell cycle regulation thus let-7 regulator hmga2 may exert effects cell cycle control pituitary adenomas targeting hmga2 mir-23b mir-130b reduced gh gonadotroph nfpa adenomas overexpression mir-23b mir-130b arrested cells g1 g2 phase cell cycle recently study revealed mir-15a mir-16 1 cluster could modulate prostate cancer targeting multiple genes including cyclin d1 regarding deregulation pituitary adenomas mir-15a mir-16 1 may exert roles tumor suppressors regulating cell cycle previous study shown mir-126 could modulate phosphatidylinositol 3-kinase pi3k signaling limiting pi3k regulatory subunit beta p85b loss mir-126 would eliminate check point increase pi3k signaling facilitate tumor growth colon carcinogenesis mir-145 downregulated gh secreting pituitary adenomas line results 11 samples cortitropinomas the potential targets mir-145 include myc kras fos yes fli cyclin d2 mapk transduction proteins indicating mir-145 might function cell cycle control targeting multiple genes mir-503 validated directly target cyclin d1 thought tumor suppressor furthermore important potential target mir-503 cell cycle regulator cdc25 mir-26b mir-128 were found directly regulate pten bmi1 respectively moreover mir-128 regulated pten expression akt activity pituitary tumor cells interfering binding bmi1 pten promoter since pten akt pathway plays important roles cell cycle control mir-26b mir-128 might regulate cell cycle pten akt pathway moreover mir-26a also overexpressed acth secreting pituitary adenomas plays important role cell cycle control modulating protein kinase c delta apoptosis process programmed cell death important barrier tumor cells malignant transformation tumor progression tumor cells escape regulated cell death obtain advantage growth expansion early stage apoptosis cells receive death signals apoptotic trigger controlled pro- antiapoptotic members b cell lymphoma 2 bcl-2 family regulatory proteins accumulating evidence shown mirnas regulate cancer cell apoptosis targeting bcl-2 family apoptosis regulators figure 1 mir-15a mir-16 1 demonstrated induce apoptosis targeting bcl-2 cll bcl-2 founding member bcl-2 family family antiapoptotic proteins governing mitochondrial death signaling bcl-2 frequently overexpressed many types human cancers including carcinomas lymphomas leukemias cll apoptosis related genes identified targets mir-15a mir-16 1 cluster mcl1 could enhance cell survival inhibiting apoptosis therefore possible pituitary adenomas mir-15a mir-16 1 influence apoptosis targeting multiple antiapoptotic genes besides mir-214 mir-629 two mirnas overexpressed nfa negatively correlated tumor size also potentially target bcl2 mir-21 differentially expressed acth secreting pituitary adenomas compared normal pituitary tissues mir-21 identified upregulated human breast lung colorectal cancers 30 46 49 75 suppression mir-21 antisense oligonucleotides mir-21 knockdown associated increased apoptotic activity inhibition tumor cell growth probably downregulating target tumor suppressor genes mir-21 may exert function apoptosis targeting tumor suppressor pdcd4 pten overexpression pdcd4 able result apoptotic death pten induce apoptosis phosphoinositol-3-kinase akt dependent independent pathways putative targets mir-212 include death effector domain containing protein dedd protein involved apoptotic signaling well proteins participating apoptosis mir184 markedly upregulated gh secreting pituitary adenomas correlated tumor diameter contrary another study reported ectopic overexpression mir-184 resulted increased apoptosis study cheng et al suggested upregulated mir-150 mir-152 mir-191 mir-192 may also involved apoptosis mir-26b found upregulated gh secreting pituitary tumors directly regulate pten mir-200c characterized tumor suppressor oncogene different cancers also inhibited apoptosis pituitary adenoma cells targeting pten akt signaling pathway intriguingly novel marine drug sz-685c isolated secondary metabolites mangrove endophytic fungus reported induce apoptosis mmq pituitary tumor cells downregulating mir-200c tgf- shown inhibit proliferation induce apoptosis hp75 cells cell line derived clinically nfa thereby mirnas targeting tgf- signaling mir-135a mir-140 5p mir-582 3p mir-582 5p mir-938 may effects apoptosis however tgf- also promote cancer cell invasion inducing epithelial mesenchymal transition emt rational conclude mirnas targeting tgf- pathway may suppress invasion metastasis blocking emt mir-300 human epithelial cancer therefore mirnas regulate tgf- pathway play controversial roles tumor initiation progression deregulation bmi1 revealed affect apoptosis thus mir-128 downregulated gh secreting pituitary tumors could also affect apoptosis directly regulating bmi1 these data together lead hypothesis many mirnas may function network regulate apoptosis pituitary adenomas although invasion metastasis rare pituitary tumors studies provide clues mirnas function pituitary tumor invasion metastasis figure 1 significant correlation hmga2 overexpression tumor cell invasion detected breast cancer gastric cancer 89 90 oral squamous cell carcinomas strong staining hmga2 loss e cadherin expression observed invasive front tumor previous studies also demonstrated tumor specific downregulation e cadherin h cadherin related invasiveness pituitary adenoma hmga2 may involved tumor cell invasion due association epithelial mesenchymal transition facilitates tumor cell invasion since let-7 regulates hmga2 expression pituitary adenomas let-7 may also take role pituitary adenoma invasion in amaral et al study although association mirnas expression tumor size observed patients acth secreting pituitary tumors expressing reduced mir-141 chance remission transsphenoidal surgery suggesting mir-141 may regulate pituitary genes involved tumor growth local invasion pttg protein 1 target mir-126 mir-381 downregulated gh secreting pituitary adenomas aggressive pituitary adenomas carcinomas frequently deletion regions near rb gene 94 95 2010 stilling et al more mirnas deregulated pituitary adenomas normal pituitaries compared carcinomas normal pituitaries pituitary carcinomas compared acth adenomas mir-122 mir-493 upregulated three metastatic sites acth carcinomas mir-122 expression markedly increased recently palumbo et al identified mir-26b upregulated mir-128 downregulated gh secreting pituitary tumors inhibition mir-26b overexpression mir-128 suppressed colony formation invasiveness pituitary tumor cells interestingly inhibition mir-26b overexpression mir-128 synergistic effect suppressing tumorigenicity invasiveness pituitary tumors since deregulation pten bmi1 correlates invasive metastatic phenotype several human cancer types 97 98 possible mir-26b mir-128 regulate invasiveness pituitary tumor cells directly targeting pten bmi1 respectively although metastatic pituitary carcinomas rare data suggest altered expression mirnas may provide diagnostic information distinguish pituitary adenomas carcinomas metastasize the symptoms mass effect hormonal hypersecretion caused pituitary adenomas could reversed surgical resection debulking adenoma radiotherapy medical treatment medical treatment primary choice prolactinomas secondary option acromegaly cushing disease gonadotropin secreting tumours tsh secreting adenomas some studies provide evidence mirnas differentially expressed pharmacological treatment altered mirna profile could provide useful information responsiveness pituitary adenomas patients pharmacological treatment figure 1 2007 a microarray carried analyze mirna profiles pituitary adenomas normal pituitary samples elucidate whether mirnas profile altered pharmacological treatment differentially expressed mirnas identified nfa patients pharmacological treatment patients without treatment six mirnas found differentially expressed mir-29b mir-29c mir-200a upregulated mir-134 mir-148 mir-155 downregulated treatment thus mirna expression could differentiate treated patient samples nontreated patient samples 2010 another study aimed identify altered expression mirnas gh secreting pituitary adenomas fifteen pituitary adenomas patients treated lanreotide four months surgery six patients receive presurgical medical treatments patients 50% reduction gh secretion lanreotide treatment considered somatostatin analogs ssa responders patients 50% gh secretion considered ssa nonresponders thirteen mirnas differentially expressed gh secreting pituitary adenomas patients lanreotide treatment without treatment eight mirnas mir-183 mir-193a-5p mir-222 mir-516b mir-524 5p mir-601 mir-629 99b upregulated five mirnas mir-124 mir-32 mir-574 5p mir-744 mir-96 downregulated putative targets mirnas mainly igfbp family members igfals scp1 matrix metalloproteinase-9 accumulating evidence demonstrates large number mirnas altered expression pituitary adenomas mirnas may play important roles tumor progression targeting multiple genes the molecular mechanism regulation mirnas pituitary adenomas still mystery some proofs indicate genetic epigenetic alterations may contribute deregulated expression mirnas for example mutations mir-16 1 gene reported partially responsible aberrant expression cll patients expressions mir-124 mir-203 decreased cpg methylation some mirnas demonstrated target multiple genes indicating may different roles pituitary tumors hand a gene involved pituitary adenomas progression modulated one mirna therefore mirnas targets could regulate pituitary adenomas progression complex network advances technology investigate mirnas make easier faster explore exactly roles mirnas pituitary adenomas mirnas signatures used distinguish pituitary adenomas normal pituitaries even subtypes pituitary tumors also possible develop mirna based diagnosis therapies pituitary adenomas the knowledge pituitary pathogenesis still limited continuing study mirnas targets shed light mechanisms pituitary adenomas

micrornas ( mirnas ) are a class of recently identified noncoding rnas that regulate gene expression at posttranscriptional level . due to the large number of genes regulated by mirnas , mirnas play important roles in many cellular processes . emerging evidence indicates that mirnas are dysregulated in pituitary adenomas , a class of intracranial neoplasms which account for 1015% of diagnosed brain tumors . deregulated mirnas and their targets contribute to pituitary adenomas progression and are associated with cell cycle control , apoptosis , invasion , and pharmacological treatment of pituitary adenomas . to provide an overview of mirnas dysregulation and functions of these mirnas in pituitary adenoma progression , we summarize the deregulated mirnas and their targets to shed more light on their potential as therapeutic targets and novel biomarkers .

altmetrics creates new approach evaluating impact publications considering number downloads shares discussions social networks.1 approach replace traditional bibliometric indicators impact factor h index rather focuses new aspects publication impact.2 although still infancy altmetrics potential become valid assessment strategy evaluation publication impact.3 altmetric tools capture information use metrics html views downloads articles blog posts tweets bookmarks etc all sources alternative indicators impact go beyond traditional citation focusing content uses social web,4 information provided real time altmetrics elucidate impact scientific research researchers also impact research public social media.2,5 fact altmetrics impact research measured individual article level using combination data number times particular paper downloaded discussed shared cited.6 approach allows researchers also institutions analyze postpublication activity around paper near real time using various online resources.5 use new tool focused italian researchers simpar group founded pavia 2007 this group rapidly become eminent translational group pain field annual meeting considered major international pain conference www.simpar.eu in addition authors study nine members simpar group drs marco baciarello dario bugada christian compagnone andrea fanelli stefano govoni maurizio marchesini cristina e minella carolina muscoli william raffaeli simpar multidisciplinary collaboration included several professionals different disciplines produced number publications personalization pain therapy multidisciplinary approach including traditional medical genetic epigenetic table s1 lists 18 papers published least two simpar members collaboration 2010 2015 as described herein able obtain statistically significant results regarding force group whole research public communities for 12 researchers team comprised created orcid open researcher contributor account www.orcid.org addition impact story https://impactstory.org account imported data synchronized unique orcid identifiers collected items assigned specific categories cited highly cited saved highly saved discussed so impact story provided us data regarding number times article saved scholars cited researchers publicly discussed facebook etc cited general public blog posts wikipedia these metrics classified along two dimensions audience scholars public type engagement online research products viewed discussed saved cited).7 impact story able retrieve altmetrics data 12 researcher accounts paper citations discussions views research community public personal profiles altmetrics member simpar group able count number citations times paper saved discussions public community paper published then compared simpar group percentages articles cited highly cited saved highly saved discussed relative published single authors either written alone collaboration coauthors members simpar group means fisher exact test quantitative variables described median interquartile range iqr ie 25th 75th percentiles compared collective simpar data individual publication articles means nonparametric mann the association citations scopus altmetric score components eg facebook posts tweets mendeley readers expressed nonparametric spearman -correlation coefficient all analyses performed utilizing stata 14 statacorp lp college station tx usa through personal profiles altmetrics member simpar group able count number citations times paper saved discussions public community paper published then compared simpar group percentages articles cited highly cited saved highly saved discussed relative published single authors either written alone collaboration coauthors members simpar group means fisher exact test quantitative variables described median interquartile range iqr ie 25th 75th percentiles compared collective simpar data individual publication articles means nonparametric mann the association citations scopus altmetric score components eg facebook posts tweets mendeley readers expressed nonparametric spearman -correlation coefficient all analyses performed utilizing stata 14 statacorp lp college station tx usa the median number articles authors 17 iqr 1027 median year publication 2013 iqr 20112014 altmetrics demonstrated simpar group publications likely saved 78% vs 53% p=0.05 publicly discussed 61% vs 4% p<0.0001 individual publications however significant difference emerged simpar group publications individual publications terms cited cited 44% vs 36% highly cited 22 vs 11% p=0.20 publicly viewed 11% vs 3% p=0.25 notably eleven 18 articles published collectively simpar group received tweet median 1 iqr 13 36 151 individual publications received tweet moreover 15 articles simpar group collectively accessed mendeley readers median times accessed 4 iqr 111 versus 85 individual publications median times accessed 2 iqr 08 p=0.01 we describe correlation scopus citations single components analyzed alternative metrics table 1 we found alternative metrics generally low exception mendeley readers =0.47 p<0.0001 figure 1 we found significant correlations simpar group collective publications impact indicator linked research activity mendeley readers although public discussion facebook tweets however impact collective simpar group articles high also general public items even though reach statistical significance this meaningful funders universities publishers increasingly demand indicators impact science society.8 moreover confident new metrics medical groups could impact pain patient community well online platforms twitter facebook like minded people form communities discuss shared experiences problems results also illustrate collaborative multidisciplinary teams projects improve overall impact researchers work researchers collaborative efforts widely disseminated individual publications study suggests efforts potentially provide additional exposure group members may result greater career enhancement individual publications avenues researchers leverage social media opportunities professional academic advantage.9 enhanced exposure allows sharing ideas research among respective networks spotlighting pain studies nationally internationally finally simpar group take research ethics seriously opine collaborative approach ethical one well effective one ways increase yield biomedical research identified imperative.10 collaborative efforts demonstrated enhance access meaningful clinically relevant research results approach results bang buck readily disseminating useful information practicing clinicians well researchers interested building upon fund data obtained investigations the 18 papers published italian simpar group least two members analyzed paper follows perotti l cusato ingelmo p et al comparison differences systemic pharmacokinetics levobupivacaine ropivacaine continuous epidural infusion prospective randomized multicenter double blind controlled trial postoperative analgesia laparoscopic ovarian cyst resection double blind multicenter randomized control trial comparing intraperitoneal nebulization peritoneal instillation ropivacaine 2015;22(5):759766.casale r di matteo minella ce fanelli g allegri m. reduction painful area new possible therapeutic target post herpetic neuropathic pain treated 5% lidocaine medicated plaster case series 2014;7:353357.bugada allegri lavandhomme p de kock fanelli g. inflammation based scores new method patient targeted strategies improved perioperative outcome cancer patients biomed res int 2014;2014:142425.gigliuto c de gregori malafoglia v et al pain assessment animal models need studies ? clinical pharmacokinetics morphine metabolites morphine dose titration chronic cancer pain 2014;36(3):335344.compagnone c tagliaferri f allegri fanelli g. ethical issues pain omics research points start debate croat med j. 2014;55(1):12.bugada guardia nicola f carboni v allegri m. transversus abdominis plane catheter infusions major abdominal surgery morbidly obese patients reply comments 2014;80(6):747.fanelli ghisi allegri m. spinal anaesthesia suitable technique ultra short outpatient procedures ? 2013;84(1):7680.bugada guardia nicola f carboni v allegri m. tap block opioid free postoperative analgesia obese surgery genetic variability comt oprm1 ugt2b7 loci modulates morphine analgesic response acute postoperative pain consequences 118a g polymorphism oprm1 gene translation bench bedside ? 2013;6:331353.allegri clark mr de andrs j fanelli g. pain treatment new approach link bench bedside gregori de gregori ranzani gn allegri minella c regazzi m. morphine metabolism transport brain disposition 2010;11(3):276282.allegri de gregori niebel et al pharmacogenetics postoperative pain new approach improve acute pain management spontaneous cervical c1-c2 cerebrospinal fluid leakage repaired computed tomography guided cervical epidural blood patch perotti l cusato ingelmo p et al comparison differences systemic pharmacokinetics levobupivacaine ropivacaine continuous epidural infusion prospective randomized multicenter double blind controlled trial postoperative analgesia laparoscopic ovarian cyst resection double blind multicenter randomized control trial comparing intraperitoneal nebulization peritoneal instillation ropivacaine casale r di matteo minella ce fanelli g allegri m. reduction painful area new possible therapeutic target post herpetic neuropathic pain treated 5% lidocaine medicated plaster case series j pain res 2014;7:353357 bugada allegri lavandhomme p de kock fanelli g. inflammation based scores new method patient targeted strategies improved perioperative outcome cancer patients gigliuto c de gregori malafoglia v et al pain assessment animal models need studies ? 2014;10(5):673684 de gregori minella ce de gregori et al clinical pharmacokinetics morphine metabolites morphine dose titration chronic cancer pain compagnone c tagliaferri f allegri fanelli g. ethical issues pain omics research bugada guardia nicola f carboni v allegri m. transversus abdominis plane catheter infusions major abdominal surgery morbidly obese patients reply comments fanelli ghisi allegri m. spinal anaesthesia suitable technique ultra short outpatient procedures ? bugada guardia nicola f carboni v allegri m. tap block opioid free postoperative analgesia obese surgery genetic variability comt oprm1 ugt2b7 loci modulates morphine analgesic response acute postoperative pain consequences 118a g polymorphism oprm1 gene translation bench bedside ? allegri clark mr de andrs j fanelli g. pain treatment new approach link bench bedside simpar meeting 2011 de gregori de gregori ranzani gn allegri minella c regazzi m. morphine metabolism transport brain disposition spontaneous cervical c1-c2 cerebrospinal fluid leakage repaired computed tomography guided cervical epidural blood patch

in this study , we investigated the impact of scientific publications of the italian simpar ( study in multidisciplinary pain research ) group by using altmetrics , defined as nontraditional metrics constituting an alternative to more traditional citation - impact metrics , such as impact factor and h - index . by correlating traditional and alternative metrics , we attempted to verify whether publications by the simpar group collectively had more impact than those performed by its individual members , either in solo publications or in publications coauthored by non - simpar group investigators ( which for the purpose of this study we will refer to as individual publications ) . for all the 12 members of the group analyzed ( pain therapists , biologists , and pharmacologists ) , we created open researcher and contributor i d and impact story accounts , and synchronized these data . manually , we calculated the level metrics for each article by dividing the data obtained from the research community by those obtained from the public community . we analyzed 759 articles , 18 of which were published by the simpar group . altmetrics demonstrated that simpar group publications were more likely to be saved ( 77.8% vs 45.9% ) , discussed ( 61.1% vs 1.1% , p<0.0001 ) , and publicly viewed ( 11.1% vs 1.3% , p=0.05 ) than individual publications . these results support the importance of multidisciplinary research groups in the impact of scientific literature ; the interaction and synergy among the research participants allowed the obtainment of high impact - literature in the field of personalized pain medicine . finally , our findings demonstrate the potential of altmetrics in estimating the value of the research products of a group .

clinical presentation variable may include skin manifestations like recurrent oral genital ulcers well cns articular ocular signs described international study group behet disease key diagnostic features1 diverse vasculopathies thrombophilia size vessel encompass vascular accidents arterial venous vasculitis thrombosis behcet disease describe case behet disease complicated cardiac tamponade hemorrhagic pericarditis ttp dvt coronary artery stenosis coronary artery pseudo aneurysm latter occurred disease evolution a 37-year old woman transferred emergency room history syncope three days previously experienced chest discomfort dyspnea palpitations low grade fever relevant past medical history co morbidity presentation her blood pressure 80/50 mmhg pulse rate 76/min respiratory rate 36/min body temperature 37.5. physical examination remarkable dyspnea orthopnea absence normal heart sounds jugular vein dilatation additional tests revealed low voltage ecg sinus tachycardia large cardiac shadow x ray laboratory findings showed ph 7.37 paco2 18.8 mmhg pao2 88.5 mmhg hco3 10.8 mmol l abga hemoglobin 9.2 g dl white blood cell 12900/l platelet 476000/l cbc the patient suspected cardiac tamponade therefore transthoracic echocardiography tte performed immediately revealed moderate pericardial effusion hypokinetic lv anterior anterolateral apex portions heart figure 1 the drained fluid white blood cell 225 pml 100% red blood cell 90,000/l ldh 1064u l glucose 190 mg dl organism gram stain culture a class cytology indicating acute chronic inflammation revealed postoperative day 3 fever dyspnea oliguria mental status changes developed patient deteriorated rapidly a follow evaluation showed serum hemoglobin 6.9 g dl white blood cell 14900/l platelets 18000/l ast alt cpk 272 151 247 blood urea nitrogen 40.6 mg dl creatinine 4.9 mg dl ldh 2279 u l pt 11.6 seconds aptt 32 seconds a peripheral blood smear remarkable schistocytosis anisocytosis normoblasts thrombocytopenia suggestive microangiopathic hemolytic anemia figure 2 all findings compatible diagnosis thrombotic thrombocytopenic purpura ttp treatment methylprednisolone pulse therapy started 1 g day 3 days investigation etiology ttp revealed patient suffered severe recurrent oral genital ulcers the ulcers reported frequent 3 4 per month exacerbated menstruation age 20 the patient also reported taking medications intermittently painful skin indurations eruptions well arthralgia considering clinical symptoms total diagnosis behcet disease complicated ttp hemorrhagic pericarditis made treatment methylprednisolone pulse therapy resulted dramatic response improvements cbc lft azotemia improved mental status the patient went fully recover returned normal activities daily living within days follow evaluation tte complete recovery showed normal right left ventricular heart function minimal pericardial effusion after discharge patient continued taking medication including colchicine 1.2 mg day prednisolone 5 mg day she presented sudden onset left leg swelling pain diagnosed left proximal femoral vein thrombosis duplex scan the patient treated catheter directed thrombolysis using urokinase thrombectomy venoplasty started combination anticoagulation therapy figure 3 six months maintenance therapy coumadin colchicines sulfasalazine started homogenous soft tissue mass found incidentally routine laboratory radiologic follow the soft tissue density attached left perihilar area pulmonary conus figure 4 the laboratory tests showed hemoglobin 11.1 g dl platelet 324000/l wbc 6000/l esr 39 mm h crp 1.59 mg dl albumin 4.5 g dl ldh 503 u l bun 11.8 mg dl creatinine 1.0 mg dl pt 29.7 second inr 2.95 chest ct angiography cardiac mri revealed 5x5 cm sized round aneurysmal sac left atrium left ventricle adjacent proximal pulmonary artery definite stalk origin could found figure 5 a doppler echocardiography demonstrated holosystolic ejection flow surface left ventricle figure 6 despite fact origin aneurysmal stalk could identified the pressure gradient calculated color doppler flow aneurysmal stalk lumen 9 mmhg the dilated vascular sac appeared pseudo aneurysm coronary artery origin the scan revealed reversible perfusion defect antero septal wall figure 7 subsequent coronary angiography allowed us confirm diagnosis pseudo aneurysm mid left anterior descending artery lad interrupted distal flow creating indentations diffuse stenotic lesions along whole length right coronary artery rca in addition well developed collateral circulation observed lad left circumflex artery lcx an emergency operation planned aneurysmal resection coronary artery bypass grafting cabg however size thus risk rupture opted instead balloon angioplasty u pass graft stent implantation proceeded using graftmaster 3.019 mm mid lad origin pseudo aneurysm figure 8) because compromised distal flow rca lad would advantage outcome cabg packed completely expected aneurysmal sac would grow would regress resorption fibrosis administration high dose glucocorticoid therapy prednisolone 1 mg kg day azathioprine 150 mg day addition mechanical intervention highly effective management demonstrated follow tte coronary angiography showed diversion flow lad regression aneurysmal size 3.93.8 cm 55 cm initially preserved heart function lvef 60% figure 9 six months discharge patient asymptomatic vestige aneurysm evident routine chest x ray figure 10 behet disease heterogenous presentation variable symptoms including mucocutaneous ophthalmic neurological cardiovascular pulmonary gastrointestinal urogenital musculoskeletal involvement the prevalence vascular involvement behet disease reported range 7.7 60.6% kabbaj et al reported 85% venous involvement 10% arterial 5% combined arterial venous involvement2 4 deep vein thrombosis found occur earlier course disease arterial disease develops median 7 years deep vein thrombosis occurs primarily lower extremities involvement possible site5 although pathogenesis thrombotic events behet disease elucidated microscopic examinations veins arteries involved demonstrated vasculitis it postulated genetic predisposition certain agents might result damage and/or functional impairment vascular wall endothelium vessels this observed damage may due impaired prostacyclin production significantly higher levels plasma endothelin-1,2 von willebrad factor anti endothelial cell antibodies the role thrombophilia behet disease protein c antithrombin deficiency presence antiphospholipid antibodies factor v leiden investigated results conflicting6 7 cardiac involvement behet disease rare pericarditis myocardial infarction coronary arteritis valvular regurgitation especially aortic valve regurgitation impaired conduction abnormalities reported8 case hemorrhagic pericarditis identified presenting abnormality identifiable sign symptom reported possibility link behet disease ttp came conclusion ttp developed due cause e.g. drugs administered infection others reported hemolytic uremic syndrome hus patients behet disease treated cyclosporin9 11 case the patient history prior surgery general anesthesia along exposure several medications mainly antibiotics onset ttp nevertheless recovered completely dramatically high doses glucocorticoid conservative maintenance antibiotics the prevalence arterial occlusion behet disease reported range 0.5 1.5% involve coronary subclavian carotid renal pulmonary peripheral artery cause myocardial infarction pulseless disease stroke hypertension respiratory failure intermittent claudication6 common sites aorta pulmonary femoral popliteal subclavian common carotid arteries artery affected6 12 it significant aneurysmal rupture leading cause death behcet disease patients6 thus deliberate counter thrombophilia anticoagulant therapy despite presence thrombotic event degeneration anastomotic site thrombosis rare complications postoperative period12 ozeren et al reported pseudo aneurysm originating proximal left anterior descending artery true aneurysm right coronary artery fistulization right atrium they surgically corrected pseudo aneurysm cardiopulmonary bypass support closing neck false aneurysm using endo aneurysmal approach gore tex patch13 case several studies undertaken examine graft stent implantation behet disease however prior report involvement coronary artery the main advantages endovascular treatment lower mortality rates e.g. 0.6% 3.5% even high risk groups higher success rates 97% other advantages shorter hospital stay shorter convalescence period returning normal life in addition avoidance general anesthesia surgical dissection especially important behet disease propensity healing impairment12 14 15 report behcet disease patient rare complications related cardiovascular system disease evolution problems included hemorrhagic pericarditis ttp dvt coronary artery stenosis coronary artery pseudo aneurysm the coronary pseudo aneurysm treated combined approach immunosuppression endovascular non surgical intervention cardiovascular complications bechet disease must treated aggressive immunosuppression using combination corticosteroid cytotoxic agents anticoagulants antiplatelet agents judiciously required address risk hemorrhage vasculitic process aneurysmal rupture cases thrombotic complications6 16 patients graft stent implantation as evidenced present case anticoagulants like coumadin may cause aneurysm formation growth behet disease therefore patients behet disease early detection cardiovascular complications cardinal importance leading cause mortality we recommend physicians pay close attention even minor complaints physical changes scrutinized regular screening protocols established early detection cardiovascular complications behet disease

behet 's disease with concomitant thrombotic thrombocytopenic purpura ( ttp ) , coronary artery stenosis and coronary artery pseudo aneurysm is rare . here we report a case of behet 's disease with several cardiovascular complications , namely : pericarditis , deep vein thrombosis ( dvt ) , ttp , coronary artery stenosis , and a coronary artery pseudo aneurysm.a 37-year - old female presented with sudden dyspnea and syncope at our emergency room and underwent pericardiectomy and pericardial window formation for the diagnosis of cardiac tamponade with acute hemorrhagic pericarditis . thereafter , ttp and dvt complicated her illness . after confirmation of behet 's disease on the basis of a history of recurrent oral and genital ulcers and erythema nodosum , remission was achieved after treatment with methylprednisolone pulse therapy , colchicine , catheter directed thrombolysis and thrombectomy . however , whilst maintaining anticoagulation therapy , a newly developed pericardial aneurysmal dilatation was noted on follow - up radiologic evaluation . further evaluation revealed right coronary artery stenosis and a left coronary artery pseudo aneurysm ; these additional problems were treated with the nonsurgical insertion of an endovascular graft stent . at the time of writing three months later after stent insertion , the aneurysm has continued to regress and no additional complications have intervened with combined immunosuppressive therapy .

like cells organisms bacteria archaea need handle threat viral infection kill organism reduce fitness it matters little successful organisms aspects life deal viruses fact contributes multitude anti virus defense mechanisms see nature the defenses divided innate systems recognize certain pre set features limit infection adaptive systems able learn recognize threats previously recognized microorganisms contain variety innate defense mechanisms preventing dna injection cleaving certain sequences using restriction modification systems preventing phage proliferation bacteriophage exclusion even committing altruistic suicide abortive infection systems prevent viruses spread population however long time humans along vertebrates known adaptive immune system the presence adaptive immune system microorganisms unanticipated known crispr cas systems suggested 2005 subsequently demonstrated 2007 the system based storing fragments genetic material viruses locus called clustered regularly interspaced short palindromic repeats crispr cells genome transcribed crispr rna crrna ) is used guide crispr associated cas proteins destroy virus genetic material many hundreds articles since published detailed molecular understanding crispr cas systems generated system learns recognize new viruses components systems produced virus recognized destroyed countermeasures viruses use non immunity processes crispr cas components participate the diversity system explored today 6 basic types described along numerous subtypes key question surprisingly peripheral years actual function importance system nature sequenced genomes convincing crisprs found slightly less half 45% bacteria almost 85% archaea the numbers may interpreted crispr cas systems important though essential however crispr cas systems evolved mobile genetic elements appear retained capability horizontally transferring cells though yet demonstrated experimentally this mobility reason crispr cas phylogeny related family tree organisms inhabit the mobility also means prevalence good indicator importance crispr cas systems regarded selfish genetic elements further recent investigation uncultured microorganisms headed jillian banfield indicate major bacterial lineages 10% contain crispr cas systems the authors suggest restriction enzymes serve important virus defense studied lineages the finding underlines investigation natural communities important understanding importance crispr cas systems the dynamics crispr cas immunity first demonstrated another study jillian banfields team virus host interaction acid mine drainage biofilms california investigated the extreme environment chosen site found harbor species microorganisms allowed depth study normally prevented complexity microbial ecosystems using large scale sequencing dna directly environmental samples least terms possible time ) viruses quickly acquired mutations circumvented defenses called escape virus escape phage introducing changes regions targeted spacer case acid mine drainage viral community early experiment role crispr cas virus host interaction laboratory settings published 2013 using bacterial dairy workhorse streptococcus thermophilus d2972 phage s. thermophilus convenient studies phage resistance generated crispr cas system following bacteria phage co evolution population clear crispr spacer diversification phage evolution quick and it also discovered certain regions phage genome preferred targets crispr cas system another study species demonstrated addition expected competition crispr cas immunity phage escape mutants unanticipated results phages could establish culture containing one 2 spacers targeting bacteria without crispr cas immunity persist cultures despite presence large amount phage bacteria 2 spacers targeting phage could still establish population phage sensitive bacteria the authors conclude full understanding interaction phage host bacteria model beyond simple iterative process crispr cas immunity phages escaping needed a key question understanding dynamics virus defense relative importance different anti virus mechanisms which system important conditions comparing constitutively active like constitutively costly receptor mutations inducible systems like temporarily costly crispr cas systems useful ? this question addressed edze westra angus buckling coworkers using combination theoretical modeling experimental evolution model system used pseudomonas aeruginosa bacteria dms3vir phage unlike s. thermophilus p. aeruginosa frequently become resistant phage using crispr cas system also mutating receptor phage uses infection nutrient rich conditions the authors demonstrated flood infections nutrient rich conditions makes constitutive defense favorable crispr cas system favored nutrient poor conditions cells rarely encounter phage having addressed issue balancing constitutive inducible virus defense westra buckling teams turned attention role immune system diversity basic question described article van houte et al came observation phage readily generates escape mutants dms3vir phages still became extinct time p. aeruginosa cultures studies disease parasites plants animals demonstrate genetic diversity improves resistance population could phage onslaught result diversity crispr cas immunity sufficient power escape phage development ? the teams set study examine relationship crispr diversity systems effectiveness mixing infecting cultures consisting different number clonal strains strain different spacer matching phage otherwise identical phages readily evolved escape mutants established single strain cultures found life increasingly difficult diversity culture mixtures 2448 strains phages quickly became extinct the diverse cultures could even outcompete receptor mutant constitutively phage resistant the reason demonstrated phages unable generate mutants resistant clones mixture diverse cultures escape phages detected diverse cultures escape phage may able infect strains eventually phage encounter resistant cell destroy phage sensitive clones probably prevented wiped mixture strains effect known herd immunity disease unable spread sensitive individuals majority resistant individuals confirm interplay diversity immunity limited type f crispr cas system p. aeruginosa role diversity type ii system infection s. thermophilus virus 2972 tested the result essentially p. aeruginosa though phage infection persistent probably due lower rate spacer acquisition s. thermophilus the ability population high diversity crispr cas immunity successful protect viral escape mutants may selection pressure driving evolution anti crispr strategies though anticipated discovery crispr cas immune system took several years first cases phage encoded anti crispr proteins described indeed dms3vir phage encoding anti crispr protein affected high diversity crispr populations manner crispr monocultures demonstrating usefulness crispr cas immunity basically nullified what impact anti crispr proteins evolution crispr cas system clear likely contribute evolution diversity crispr cas systems explain many microorganisms several different systems the findings described demonstrate microbial model systems used describe functional role virus defense systems the small increasing number studies field provided increase understanding interaction viruses hosts key process evolution ecology population biology we hopefully see investigation virus host interaction wake work e.g. determining role predator prey models kill winner hypothesis co evolution models red queen hypothesis the use laboratory experiments phage host interaction valuable hypothesis driven research important addition direct analysis natural populations higher degree complexity species composition virus interaction

abstractvirus - host interaction is a key process in understanding the ecology and evolution of life . the study of the crispr - cas rna - guided adaptive immune systems of bacteria and archaea has added to our understanding of the virus defense mechanisms of microorganisms . the molecular details of the crispr - cas systems are well explored and have allowed development a new generation of gene editing tools . however , the actual role and importance of crispr - cas virus defense in nature is complex to study and have attracted less attention . metagenomic analysis of microbial populations and the study of viruses - host systems in the laboratory have begun to unravel this question . key findings in the field are described , with focus on recent developments .

two classes agents targeting m2 ion channel targeting neuramindase available treat prevent influenza infection emergence resistance m2 ion channel inhibiting drugs amantadine rimantadine has limited clinical utility resistance neuraminidase inhibitors including oseltamivir also observed several seasonal influenza strains drug resistance mutations emerge almost influenza subtypes strains including pandemic 2009 h1n1 virus limiting clinical efficacy currently approved drugs the three largest genomic rna segments encode viral rna dependent rna polymerase rdrp consisting polymerase acidic protein pa polymerase basic proteins 1 pb1 2 pb2 pa subunit endonuclease activity ii involved viral rna vrna)/complementary rna crna promoter binding iii interacts pb1 subunit pa two domains pan 25 kda n terminal domain residues 1197 pac 55 kda c terminal domain residues 239716 crystal structures pac determined complexes n terminal fragments pb1 the structure pan solved several crystal forms unliganded various ligands influenza rdrp responsible replication transcription segmented viral rna genes viral mrna transcription involves cap snatching mechanism polymerase binds host cellular mrna via 5-cap cleaves mrna 1213 nucleotides downstream this cleaved rna fragment contains 5 cap acts primer viral mrna synthesis cap snatching important event life cycle members orthomyxoviridae family viruses including influenza b c viruses because host cell analogous activity inhibitors cap snatching may selective influenza subtypes strains including oseltamivir resistant influenza viruses without interfering host cell these include 2,4-dioxobutanoic acid derivatives 5-hydroxy-1,6-dihydropyrimidine-4-carboxylic acid derivatives flutimide derivatives 2-hydroxyphenyl amide derivatives well tetramic acid derivatives recently silico screening vitro ex vivo follow studies identified hexanetetrones trihydroxyphenyls endonuclease inhibitors anti influenza activity as correctly hypothesized endonuclease activity influenza polymerase belongs two metal ion group phosphate processing enzymes x ray crystallographic screening campaign fragment library targeting influenza endonuclease enzyme identified 5-chloro-3-hydroxypyridin-2(1h)-one bimetal chelating ligand active site enzyme using information we reported structure activity relationships two new series compounds 3-hydroxypyridin-2(1h)-ones 3-hydroxyquinolin-2(1h)-ones endonuclease inhibitors figure 1 structures 5-(p fluorophenyl-3-hydroxypyridin-2(1h)-one 5-fphp 6-(p fluorophenyl)-3-hydroxypyridin-2(1h)-one 6-fphp 6-(p fluorophenyl)-3-hydroxyquinolin-2(1h)-one 6-fphq 7-(p fluorophenyl)-3-hydroxyquinolin-2(1h)-one 7-fphq phenyl substituted derivatives 3-hydroxypyridin-2(1h)-ones among potent inhibitors influenza endonuclease 4-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one exhibit significant activity 5-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one ic50 values < 1.0 present study undertaken determine relative effects aza substitution various positions phenyl substituted 3-hydroxypyridin-2(1h)-ones potential inhibit influenza endonuclease this dione tautomerize either 5- 6-(4-fluorophenyl)-3-hydroxypyrazin-2(1h)-one 1b 1c the 2,3-dichloropyrazine treated excess sodium methoxide form 2,3-dimethoxypyrazine previously described bromination 2,3-dimethoxypyrazine n bromosuccimide dmf provided 5-bromo derivative suzuki coupling conditions 4-fluorophenylboronic acid gave 5-(4-fluorophenyl)-2,3-dimethoxypyrazine treatment dimethoxypyrazine 1:1 mixture dioxane 2 n hcl provided 1 suzuki coupling intermediate 4-fluorophenylboronic acid provided 6-(p fluorophenyl)-4,5-dimethoxypyrimidine 1:1 mixture dioxane 2 n hcl produced 5-methoxy-6-(4-fluorophenyl)pyrimidin-4(3h)-one the synthetic approach employed preparation various substituted 2-phenyl 5-hydroxypyrimidin-4(3h)-ones outlined scheme 3 2-chloro-4,5-dimethoxypyrimidine prepared 2,4-dichloro-5-methoxypyrimidine common intermediate 2-phenyl 5-hydroxypyrimidin-4(3h)-ones suzuki coupling appropriate phenylboronic acid provided desired 2-phenyl 4,5-dimethoxypyrimidine derivative initially hydrolyzed 1:1 dioxane 2 n hcl provide requisite 2-phenyl 5-methoxypyrimidin-4(3h)-one further treatment 5-methoxypyrimidin-4(3h)-ones bbr3 ch2cl2 provided 2-(fluorophenyl derivatives 35 well various 2-biphenyl derivatives 68 similar manner 2-(4-cyanophenyl and 2-(3-cyanophenyl 5-methoxypyrimidin-4(3h)-ones prepared treated bbr3 ch2cl2 form 5-hydroxypyrimidin-4(3h)-ones 9 10 treatment 9 10 sodium azide dmf presence catalytic amount acetic acid gave 5-tetrazoyl derivatives 11 12 respectively formation 2-methoxymethyl derivative 4,5-dichloropyridazin-3(2h)-one followed selective replacement 4-chloro substituent methoxyl group provided 2-methoxymethyl-5-chloro-4-methoxypyridazin-3(2h)-one this mom protected chloropyridazin-3(2h)-one reacted 4-fluorophenylboronic acid suzuki coupling conditions provide 2-methoxymethyl-5-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one the synthesis various 6-phenyl substituted pyridazin-3(2h)-ones accomplished outlined scheme 5 commercially available 3,4,6-trichloropyridazine was converted 6-chloro-3,4-dimethoxypyridazine subsequently used either 4-fluorophenylboronic acid 4-cyanophenylboronic acid suzuki coupling conditions form 6-phenyl-3,4-dimethoxypyridazine intermediates treatment dimethoxypyridazines 1:1 mixture dioxane 2 n hcl provided 4-methoxypyridazine-3(2h)-ones subsequently treated bbr3 ch2cl2 provide 14 15 treatment 15 sodium azide dmf presence catalytic amount acetic acid provided 6-(4-(tetrazol-5-yl)phenyl derivative 16 table 1 the tautomeric forms 5-(4-fluorophenyl)-1,4-dihydropyrazine-2,3-dione 1b 1c 5- 6-(4-fluorophenyl)-3-hydroxypyrazin-2(1h)-one represent 4-aza derivatives 5- 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one respectively upon basis nmr spectra however dominant tautomeric form 1 1,4-dihydropyrazine-2,3-dione 1a minor amounts tautomers 1b 1c alternatively 1b 1c form appreciable extent enzyme assay conditions presence 4-aza substituent adjacent 3-hydroxyl group either tautomer 1b 1c may associated reduced intrinsic activity inhibitor the lack activity observed 2 consistent previous structure activity relationships observed various 4-substituted 3-hydroxypyridin-2-ones presence phenyl group relatively large substituents 4-position various 3-hydroxypyridin-2-ones associated dramatic loss potency inhibitor it noteworthy 4-fluorophenyl substituent 2-postion 5-hydroxypyrimidin-4(3h)-ones comparable 6-position 3-hydroxypyridin-2-ones significant activity terms endonuclease inhibition observed ic50 0.58 this 4-fluorophenyl derivative twice potent either 3- 2-fluorophenyl isomers 4 5 steric factors may responsible decreased activity observed 4- 2-biphenyl derivatives 6 8 relative 7 the structure activity studies performed 3-hydroxypyridin-2-ones indicated 6-[(4-tetrazoyl)phenyl]-3-hydroxypyridin-2-one pronounced activity endonuclease inhibitor ic50 0.085 basis observation 2-[(tetrazoyl)phenyl derivatives 5-hydroxypyrimidin-4(3h)-one 2-(cyanophenyl precursors targeted synthesis evaluation endonuclease inhibitors the 3-cyanophenyl derivative 10 approximately twice potent compared 4-cyanophenyl isomer 9 however 4-(tetrazoly)phenyl derivative 11 potent 5-hydroxypyrimidin-4(3h)-ones evaluated ic50 0.15 3-fold greater potency 3-(tetrazoly)phenyl derivative 12 previously formed crystals apo pandemic 2009 influenza endonuclease soaked solution containing 11 described previously supporting information table 1s the crystal structure revealed 11 chelates two active site metal ions mode similar 3-hydroxypyridin-2(1h)-one containing compounds figure 2 the n1 atom pyrimidine ring forms hydrogen bond interactions network water molecules present near active site n3 interacts tyr130 two bridging waters similar 5-[4-(tetrazoly)phenyl containing pyridinone compounds 2-[4-(tetrazoly)phenyl makes bidentate hydrogen bond interactions arg124 the 2-phenyl ring rotated 90 relative 5-phenyl seen previously coplanar pyrimidine ring due lack steric restraint additional ring substitutions seen previously stereoview image crystal structure 11 yellow bound pan(cyan superposed previously published structure pdb 4m5u 5-(4-(1h tetrazol-5-yl)phenyl)-6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one green metal coordinating bonds depicted black dashed lines whereas hydrogen electrostatic bonds depicted blue electron density calculated omit map contoured 4.0 blue mesh consistent structure activity relationships observed 4-phenyl substituted 3-hydroxy pyridin-2(1h)-ones 13 exhibit significant activity endonuclease inhibitor these 6-phenylpyridazin-3(2h)-ones 1416 active 4-fluorophenylpyrazine derivative 1 least order magnitude less active analogous 2-phenyl-5-hydroxypyrimidin-4(3h)-ones active derivative 6-(4-tetrazoyl)phenyl-4-hydroxypyridazin-3(2h)-one 16 ic50 3.0 interestingly 5-substituted 3-hydroxypyridin-2(1h)-ones 6-substituted 4-hydroxypyridazin-3(2h)ones well variously substituted 3-hydroxyquinolin-2(1h)ones previously established amino acid oxidase daao inhibitors however none similarly structured aza analogues 3-hydroxypyridin-2(1h)-ones synthesized present study evaluated relative activity daao inhibitors data relative activity aza 3-hydroxypyridin-2(1h)-one derivatives indicate 2-phenyl-5-hydroxypyrimidin-4(3h)-ones 5-aza analogues 6-phenyl-3-hydroxypyridin-2(1h)-ones exhibit comparable activity inhibitors endonuclease however 6-phenyl-4-hydroxypyridazin-3(2h)-ones 6-aza analogues 5-phenyl-3-hydroxypyridin-2(1h)-ones 2.38.2-fold less active although tautomers 5-(4-fluorophenyl)-1,4-dihydropyrazine-2,3-dione viewed 4-aza analogues either 5- 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one 80 times less potent either 3-hydroxypyridin-2(1h)-ones the relative ranking comparable phenyl substituted pyridin-2(1h)-ones aza derivatives terms endonuclease inhibition 3-hydroxypyridin-2(1h)-one 5-hydroxypyrimidin-4(3h)-ones 4-hydroxypyridazin-3(2h)-ones 1,4-dihydropyrazine-2,3-dione reaction monitoring follow done using aluminum backed silica g tlc plates uv254 sorbent technologies visualizing ultraviolet light flash column chromatography done combi flash rf teledyne isco using hexane ethyl acetate dichloromethane methanol the h 400 mhz c 100 mhz nmr spectra done cdcl3 methanol d4 dmso d6 recorded bruker avance iii 400 mhz multinuclear nmr spectrometer data expressed parts per million relative residual nondeuterated solvent signals spin multiplicities given singlet doublet dd doublet doublets triplet dt doublet triplets q quartet multiplet bs broad singlet coupling constants j reported hertz analytical hplc performed shimadzu lc-20at prominence liquid chromatograph using 150 mm 4.6 mm princeton spher-100 rp c18 1000a 5 column using 0% water 2 min 0100% water methanol gradient 5 min period 5 min 100% methanol 2.0 ml min flow rate monitoring uv absorbance 254 296 nm using method analysis purity compounds used bioassays determined 95% hrms experiments conducted washington university resource biomedical bioorganic mass spectrometry department chemistry 5-(4-fluorophenyl)-2,3-dimethoxypyrazine 100 mg 0.43 mmol dissolved mixture dioxane 5 ml 2 n hcl 5 ml the reaction mixture refluxed 21 h. reaction completed cooled room temperature solvent removed reduced pressure the white suspension filtered solid collected dried give 5-(4-fluorophenyl)pyrazine-2,3(1h,4h)-dione white solid 75 mg 85% mp 285287 c h nmr 400 mhz dmso d6 11.55 1h 11.46 1h 7.57 dd j 9 hz j 5 hz 2h 7.237.19 2h 6.59 j 3 hz 1h c nmr 100 mhz dmso d6 161.8 jc fjc f 243 hz 156.9 155.7 128.1 127.6 jc f 9 hz 121.0 115.5 jc f 21 hz 107.1 f nmr 376 mhz dmso d6 114.0 hrms esi calculated c10h7fn2o2na na 229.0384 found 229.0382 5-bromo-2,3-dimethoxypyrazine 150 mg 0.69 mmol 4-fluorophenyl)boronic acid 144 mg 1.03 mmol pd(pph3)4 80 mg 0.069 mmol na2co3 218 mg 2.06 mmol dissolved mixture dioxane 6 ml water 2 ml then reaction mixture refluxed 5 h. reaction completed additional 4-fluorophenyl)boronic acid 48 mg 0.34 mmol added it refluxed 16 h. cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 010% etoac hexane this afforded 5-(4-fluorophenyl)-2,3-dimethoxypyrazine white solid 123 mg 77% mp 108110 c h nmr 400 mhz cdcl3 8.03 1h 7.90 dd j 9 hz j 5 hz 2h 7.157.10 2h c nmr 100 mhz cdcl3 163.06 jc f 247 hz 149.43 149.41 140.29 132.66 jc f 3 hz 127.77 127.73 127.69 jc f 8 hz 115 f nmr 376 mhz cdcl3 113.7 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0880 2,3-dimethoxypyrazine 565 mg 4.03 mmol nbs 754 mg 4.23 mmol dissolved dmf 5 ml then resulting residue diluted dcm organic layer washed satd nahco3 followed brine the organic layer dried na2so4 concentrated reduced pressure provide 5-bromo-2,3-dimethoxypyrazine white solid 384 mg 43% mp 5456 c h nmr 400 mhz cdcl3 7.86 1h 4.03 3h 3.88 3h c nmr 100 mhz cdcl3 161.2 150.0 141.7 138.1 56.6 55.1 2,3-dichloropyrazine 1.04 ml 10 mmol added meoh 10 ml it treated naome 5.4 g 100 mmol allowed warm room temperature the resulting white suspension filtered filtrate concentrated reduced pressure the residue diluted dcm washed water followed brine the organic layer dried na2so4 concentrated reduced pressure reveal colorless liquid 2,3-dimethoxypyrazine crystallized white solid 1.13 g 81% mp 2123 c h nmr 400 mhz cdcl3 7.47 2h 3.88 6h c nmr 100 mhz cdcl3 150.3 131.7 53.4 6-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one 107 mg 0.49 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 5 ml 5 mmol added it allowed warm room temperature stirred 24 h. solvent removed reduced pressure the resulting residue diluted etoac washed satd nahco3 followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm provide 6-(4-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one white solid 50 mg 50% mp 285287 c h nmr 400 mhz dmso d6 12.67 bs 1h 9.83 bs 1h 8.20 dd j 9 hz j 6 hz 2h 7.87 1h 7.297.25 2h c nmr 100 mhz dmso d6 161.9 jc f 245 hz 158.7 141.1 138.5 136.0 132.3 130.7 jc f 8 hz 114.8 jc f 21 hz hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0568 4-(4-fluorophenyl)-5,6-dimethoxypyrimidine 134 mg 0.57 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 12 h. cooled room temperature the reaction mixture put vacuum remove solvent gave white residue the solid collected gave 6-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one white solid 109 mg 87% mp 204206 c h nmr 400 mhz dmso d6 12.76 1h 8.07 1h 8.04 dd j 9 hz j 6 hz 2h 7.337.28 2h 3.34 3h c nmr 100 mhz dmso d6 162.5 jc f 246 hz 158.8 147.4 143.7 142.9 131.7 131.2 jc f 8 hz 115.0 jc f 21 hz 58.8 hrms esi calculated c11h10fn2o2 h 221.0721 found 221.0721 4-chloro-4,5-dimethoxypyrimidine 165 mg 0.95 mmol 4-fluorophenyl)boronic acid 99 mg 1.42 mmol pd(pph3)4 110 mg 0.095 mmol na2co3 300 mg 2.84 mmol dissolved mixture dioxane 9 ml water 3 ml then reaction mixture refluxed 19 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 010% etoac hexane this afforded 4-(4-fluorophenyl)-5,6-dimethoxypyrimidine white solid 181 mg 82% mp 6264 c h nmr 400 mhz cdcl3 8.53 1h 8.07 dd j 9 hz j 6 hz 2h 7.177.11 2h 4.07 3h 3.73 3h c nmr 100 mhz cdcl3 163.7 jc f 249 hz 164.0 154.3 152.0,139.4 131.4 jc f 8 hz 131.3 115.3 jc f 21 hz 60.2 54.2 f nmr 376 mhz cdcl3 111.0 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0882 4,6-dichloro-5-methoxypyrimidine 300 mg 1.68 mmol added meoh 10 ml it treated naome 99 mg 1.85 mmol allowed warm room temperature after reaction completed put vacuum remove meoh the resulting residue diluted etoac washed satd nh4cl followed brine the residue purified flash chromatography silica gel eluting 010% etoac hexane provide 4-chloro-5,6-dimethoxypyrimidine white solid 168 mg 57% mp 5355 c h nmr 400 mhz cdcl3 8.27 1h 4.03 3h 3.88 3h c nmr 100 mhz cdcl3 163.6 151.6 151.3 138.2 60.7 54.8 2-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one 58 mg 0.26 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 3 ml 3 mmol added it allowed warm room temperature stirred 24 h. solvent removed reduced pressure it filtered solid collected dried vacuum provide 2-(4-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one white solid 23 mg 42% mp 252254 c h nmr 400 mhz dmso d6 12.88 bs 1h 9.64 bs 1h 8.05 dd j 9 hz j 5 hz 2h 7.54 1h 7.337.29 2h c nmr 100 mhz dmso d6 163.4 jc f 246 hz 159.0 146.9 143.4 131.7 129.4 jc f 9 hz 129.1 115.5 jc f 22 hz hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0566 2-(4-fluorophenyl)-4,5-dimethoxypyrimidine 187 mg 0.799 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 12 h. cooled room temperature the reaction mixture diluted etoac washed satd nahco3 followed brine the resulting residue purified flash chromatography silica gel eluting 50100% etoac hexane give 2-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one white solid 41 mg 23% mp 229231 c h nmr 400 mhz dmso d6 12.79 1h 7.68 1h 8.08 dd j 9 hz j 5 hz 2h 7.357.30 2h 3.79 3h c nmr 100 mhz dmso d6 163.6 jc f 247 hz 158.1 148.4 145.4 130.4 129.6 jc f 9 hz 129.1 115.5 jc f 22 hz 56.0 f nmr 376 mhz dmso d6 110.2 hrms esi calculated c11h9fn2o2na na 243.0540 found 243.0546 2-chloro-4,5-dimethoxypyrimidine 500 mg 2.86 mmol 4-fluorophenyl)boronic acid 601 mg 4.30 mmol pd(pph3)4 330 mg 0.29 mmol na2co3 910 mg 8.59 mmol dissolved mixture dioxane 12 ml water 4 ml air evacuated replaced n2 reaction mixture refluxed 5 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 010% etoac hexane this afforded 2-(4-fluorophenyl)-4,5-dimethoxypyrimidine white solid 123 mg 77% mp 114116 c h nmr 400 mhz cdcl3 8.37 dd j 9 hz j 6 hz 2h 8.12 1h 7.167.12 2h 4.17 3h 3.98 3h c nmr 100 mhz cdcl3 163.1 jc f 248 hz 159.7 155.3 141.0 137.2 133.6 jc f 3 hz 129.6 jc f 8 hz 115.3 jc f 22 hz 56.4 54.0 f nmr 376 mhz cdcl3 111.9 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0878 2,4-dichloro-5-methoxypyrimidine 2.37 g 13.2 mmol k2co3 1.8 g 13.2 mmol dissolved meoh 50 ml stirred 19 h room temperature the resulting residue dissolved etoac washed distilled water followed brine the resulting residue purified flash chromatography silica gel eluting 020% etoac hexane give 2-chloro-4,5-dimethoxypyrimidine white solid 1.70 g 73% mp 6567 c h nmr 400 mhz cdcl3 7.84 1h 4.03 3h 3.88 3h c nmr 100 mhz cdcl3 161.2 150.0 141.7 138.2 56.6 55.0 2-(3-fluorophenyl)-5-methoxypyrimidin-4(3h)-one 100 mg 0.45 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 4.54 ml 4.54 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure the resulting residue diluted etoac washed 2 n hcl followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(3-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one white solid 87 mg 93% mp 210212 c h nmr 400 mhz dmso d6 7.89 j 8 hz 1h 7.84 dd j 10 hz j 2 hz 1h 7.61 1h 7.577.52 1h 7.36 td j 8 hz j 2 hz 1h c nmr 100 mhz dmso d6 162.1 jc f 243 hz 158.9 146.5 143.8 134.7 131.5 130.6 jc f 8 hz 123.0 117.2 jc f 20 hz 113.6 jc f 24 hz hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0565 2-(3-fluorophenyl)-4,5-dimethoxypyrimidine 390 mg 1.67 mmol dissolved mixture 2 n hcl 10 ml dioxane 10 ml the reaction mixture refluxed 18 h. cooled room temperature the reaction mixture diluted etoac washed water followed brine the resulting residue purified flash chromatography silica gel eluting 0100% etoac hexane give 2-(3-fluorophenyl)-5-methoxypyrimidin-4(3h)-one white solid 237 mg 63% mp 122124 c h nmr 400 mhz dmso d6 12.86 bs 1h 7.91 j 8 hz 1h 7.877.83 1h 7.71 1h 7.587.53 1h 7.37 td j 8 hz j 2 hz 1h 3.81 3h c nmr 100 mhz dmso d6 162.1 jc f 242 hz 157.9 147.8 145.5 134.7 130.7 jc f 9 hz 130.1 123.2 jc f 9 hz 117.5 jc f 22 hz 113.8 jc f 24 hz 56.1 f nmr 376 mhz dmso d6 112.5 hrms esi calculated c11h10fn2o2 h 221.0721 found 227.0722 2-chloro-4,5-dimethoxypyrimidine 300 mg 1.72 mmol 3-fluorophenyl)boronic acid 343 mg 2.58 mmol pd(pph3)4 199 mg 0.17 mmol na2co3 546 mg 5.15 mmol dissolved mixture dioxane 12 ml water 4 ml then reaction mixture refluxed 8 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 010% etoac hexane this afforded 2-(3-fluorophenyl)-4,5-dimethoxypyrimidine white solid 393 mg 98% mp 8385 c h nmr 400 mhz cdcl3 8.09 dt j 8 hz j 1 hz 1h 8.03 1h 8.017.98 1h 7.387.33 1h 7.07 tdd j 8 hz j 3 hz j 1 hz 1h 4.09 3h 3.90 3h c nmr 100 mhz cdcl3 163.1 jc f 242 hz 159.5 154.6 jc f =3 hz 141.3 139.8 jc f 8 hz 136.9 129.7 jc f 8 hz 123.1 jc f 3 hz 116.4 jc f 22 hz 114.3 jc f 23 hz 56.2 53.9 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0879 2-(2-fluorophenyl)-5-methoxypyrimidin-4(3h)-one 100 mg 0.45 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 4.54 ml 4.54 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure the resulting residue diluted etoac washed 2 n hcl followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(2-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one white solid 89 mg 96% mp 187189 c h nmr 400 mhz dmso d6 12.80 bs 1h 9.73 bs 1h 7.65 j 7 hz 1h 7.59 1h 7.55 j 7 hz 1h 7.367.30 2h c nmr 100 mhz dmso d6 159.3 jc f 248 hz 158.2 144.6 143.9 132.2 jc f 8 hz 132.1 130.8 124.5 jc f 3 hz 121.8 jc f 12 hz 116.1 jc f 21 hz f nmr 376 mhz dmso d6 115.2 hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0565 2-(2-fluorophenyl)-4,5-dimethoxypyrimidine 400 mg 1.71 mmol dissolved mixture 2 n hcl 10 ml dioxane 10 ml the reaction mixture refluxed 18 h. cooled room temperature the reaction mixture diluted etoac washed water followed brine the resulting residue purified flash chromatography silica gel eluting 0100% etoac hexane followed 010% meoh dcm give 2-(2-fluorophenyl)-5-methoxypyrimidin-4(3h)-one white solid 300 mg 80% mp 159161 c h nmr 400 mhz dmso d6 12.81 bs 1h 7.70 1h 7.66 j 8 hz 1h 7.607.55 1h 7.377.31 1h 3.80 3h c nmr 100 mhz dmso d6 159.3 jc f 248 hz 157.3 145.9 132.4 jc f 9 hz 130.8 jc f 8 hz 130.2 124.5 jc f 3 hz 121.8 121.6 116.1 jc f 22 hz 56.0 f nmr 376 mhz dmso d6 115.2 hrms esi calculated c11h10fn2o2 h 221.0721 found 221.0721 2-chloro-4,5-dimethoxypyrimidine 300 mg 1.72 mmol 2-fluorophenyl)boronic acid 343 mg 2.58 mmol pd(pph3)4 199 mg 0.17 mmol na2co3 546 mg 5.15 mmol dissolved mixture dioxane 12 ml water 4 ml air evacuated replaced n2 then reaction mixture refluxed 18 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 030% etoac hexane this afforded 2-(2-fluorophenyl)-4,5-dimethoxypyrimidine white solid 402 mg 100% mp 7274 c h nmr 400 mhz cdcl3 8.11 1h 7.97 td j 8 hz j 2 hz 1h 7.347.29 1h 7.15 td j 8 hz j 1 hz 1h 7.117.06 1h 4.06 3h 3.90 3h c nmr 100 mhz cdcl3 161.0 jc f 253 hz 159.5 154.2 jc f 4 hz 140.9 137.0 131.4 jc f 2 hz 130.9 jc f 8 hz 126 0 jc f 9 hz 123.8 jc f 4 hz 116.7 jc f 22 hz 56.2 54.1 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0877 2-(4-biphenyl)-5-methoxypyrimidin-4(3h)-one 50 mg 0.18 mmol dissolved anhydrous dcm 5 ml reaction mixture was cooled 0 c 1 dcm bbr3 1.80 ml 1.80 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure the resulting residue diluted etoac washed 2 n hcl followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(4-biphenyl)-5-hydroxypyrimidin-4(3h)-one white solid 46 mg 96% dec 259261 c h nmr 400 mhz dmso d6 12.85 bs 1h 9.68 bs 1h 8.13 j 8 hz 2h 7.80 j 8 hz 2h 7.75 j 7 hz 2h 7.62 1h 7.50 j 8 hz 2h 7.41 j 7 hz 1h c nmr 100 mhz dmso d6 159.1 147.5 143.5 141.9 139.0 131.7 131.3 129.0 128.0 128.5 126.7 126.7 hrms esi calculated c16h13n2o2 h 265.0972 found 265.0973 2-(4-biphenyl)-4,5-dimethoxypyrimidine 343 mg 1.73 mmol dissolved mixture 2 n hcl 15 ml dioxane 15 ml the reaction mixture refluxed 18 h became white suspension the suspension filtered solid collected give 2-(4-biphenyl)-5-methoxypyrimidin-4(3h)-one white solid 256 mg 78% mp 292294 c h nmr 400 mhz dmso d6 12.83 bs 1h 8.14 j 8 hz 2h 7.81 j 8 hz 2h 7.777.72 3h 7.50 j 8 hz 2h 7.42 j 7 hz 1h 3.81 3h c nmr 100 mhz dmso d6 158.0 148.8 145.6 142.1 139.0 131.2 130.4 129.0 128.0 127.7 126.74 126.70 56.1 hrms esi calculated c17h15n2o2 h 279.1128 found 279.1128 2-chloro-4,5-dimethoxypyrimidine 400 mg 2.29 mmol 4-biphenylboronic acid 681 mg 3.44 mmol pd(pph3)4 264 mg 0.23 mmol na2co3 728 mg 6.87 mmol dissolved mixture dioxane 12 ml water 4 ml air evacuated replaced n2 then reaction mixture refluxed 8 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 030% etoac hexane this afforded 2-(4-biphenyl)-4,5-dimethoxypyrimidine white solid 670 mg 100% mp 115117 c h nmr 400 mhz cdcl3 8.43 j 8 hz 2h 8.15 1h 7.70 j 8 hz 2h 7.67 j 7 hz 2h 7.47 j 8 hz 2h 7.37 j 7 hz 1h 4.19 3h 3.98 3h 142.5 141.1 140.7 137.3 136.4 128.8 128.1 127.5 126.1 56.4 54.0 hrms esi calculated c18h17n2o2 h 293.1285 found 293.1286 2-(3-biphenyl)-5-methoxypyrimidin-4(3h)-one 100 mg 0.36 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 3.60 ml 3.60 mmol added it allowed warm room temperature stirred 6 h. solvent removed reduced pressure the resulting residue diluted etoac washed 2 n hcl followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(3-biphenyl)-5-hydroxypyrimidin-4(3h)-one white solid 34 mg 36% mp 221223 c h nmr 400 mhz dmso d6 8.30 1h 7.99 j 7 hz 1h 7.88 j 8 hz 1h 7.81 j 8 hz 2h 7.66 1h 7.63 j 8 hz 1h 7.52 j 8 hz 2h 7.43 j 7 hz 1h c nmr 100 mhz dmso d6 158.9 147.5 143.7 140.4 139.5 133.1 132.3 129.2 128.9 128.5 127.7 126.8 126.0 125.0 hrms esi calculated c16h13n2o2 h 265.0972 found 265.0973 2-(3-biphenyl)-4,5-dimethoxypyrimidine 670 mg 2.29 mmol dissolved mixture 2 n hcl 15 ml dioxane 15 ml the reaction mixture refluxed 18 h. cooled room temperature the reaction mixture diluted etoac washed water followed brine the solid collected give 2-(3-biphenyl)-5-methoxypyrimidin-4(3h)-one white solid 493 mg 77% mp 209211 c h nmr 400 mhz dmso d6 12.97 br 1h 8.34 1h 8.04 j 8 hz 1h 7.837.80 3h 7.73 1h 7.59 j 8 hz 1h 7.51 j 8 hz 2h 7.41 j 7 hz 1h 3.82 3h c nmr 100 mhz dmso d6 157.9 148.9 145.8 140.4 139.4 132.9 130.5 129.3 128.9 128.8 127.8 126.9 126.2 125.2 56.1 hrms esi calculated c17h15n2o2 h 279.1128 found 279.1129 2-chloro-4,5-dimethoxypyrimidine 400 mg 2.29 mmol 3-biphenylboronic acid 681 mg 3.44 mmol pd(pph3)4 264 mg 0.23 mmol na2co3 728 mg 6.87 mmol dissolved mixture dioxane 12 ml water 4 ml air evacuated replaced n2 then reaction mixture refluxed 8 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 030% etoac hexane this afforded 2-(3-biphenyl)-4,5-dimethoxypyrimidine white solid 670 mg 100% mp 7274 c h nmr 400 mhz cdcl3 8.62 1h 8.36 j 8 hz 1h 8.15 1h 7.71 j 7 hz 2h 7.67 j 8 hz 1h 7.54 j 8 hz 2h 7.497.45 3h 7.37 j 7 hz 1h 4.18 3h 3.97 3h c nmr 100 mhz cdcl3 159.7 156.1 141.4 141.17 141.15 137.9 137.2 128.9 128.8 128.6 127.4 127.3 126.6 126.4 56.4 54.0 hrms esi calculated c18h17n2o2 h 293.1285 found 293.1286 2-(2-biphenyl)-5-methoxypyrimidin-4(3h)-one 50 mg 0.18 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 1.80 ml 1.80 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure the resulting residue diluted etoac washed 2 n hcl followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(2-biphenyl)-5-hydroxypyrimidin-4(3h)-one white solid 31 mg 64% mp 271273 c h nmr 400 mhz dmso d6 7.707.65 2h 7.56 j 8 hz 2h 7.48 1h 7.39 j 7 hz 2h 7.33 j 7 hz 1h 7.23 j 7 hz 2h c nmr 100 mhz dmso d6 158.6 156.9 148.3 140.8 140.5 139.4 131.9 130.4 130.1 129.9 128.6 128.2 127.2 hrms esi calculated c16h13n2o2 h 265.0972 found 265.0974 2-(2-biphenyl)-4,5-dimethoxypyrimidine 309 mg 1.06 mmol dissolved mixture 2 n hcl 15 ml dioxane 15 ml the reaction mixture refluxed 18 h. cooled room temperature the reaction mixture diluted etoac washed water followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 2-(2-biphenyl)-5-methoxypyrimidin-4(3h)-one colorless oil 158 mg 54% h nmr 400 mhz dmso d6 12.51 bs 1h 7.59 j 8 hz 1h 7.557.47 4h 7.36 j 7 hz 2h 7.30 j 7 hz 1h 7.23 j 7 hz 2h 3.72 3h c nmr 100 mhz dmso d6 157.1 151.0 145.4 140.3 139.8 133.0 131.5 131.4 130.03 130.01 129.8 128.6 128.2 127.2 55.8 hrms esi calculated c17h15n2o2 h 279.1128 found 279.1129 2-chloro-4,5-dimethoxypyrimidine 500 mg 2.86 mmol 2-biphenylboronic acid 851 mg 4.30 mmol pd(pph3)4 266 mg 0.29 mmol na2co3 909 mg 8.58 mmol dissolved mixture dioxane 21 ml water 7 ml air evacuated replaced n2 reaction mixture refluxed 8 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 030% etoac hexane h nmr 400 mhz dmso d6 8.26 1h 7.84 dd j 7 hz j 1 hz 1h 7.547.45 2h 7.40 dd j 7 hz j 1 hz 1h 7.307.24 3h 7.08 j 7 hz 2h 3.85 3h 3.30 3h c nmr 100 mhz dmso d6 158.1 157.2 142.2 141.1 140.0 137.7 137.3 130.4 130.2 128.9 128.6 127.8 127.2 126.2 56.0 52.9 hrms esi calculated c18h17n2o2 h 293.1285 found 293.1290 4-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile 50 mg 0.22 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 2.2 ml 2.2 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure it filtered solid collected dried vacuum provide 4-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile white solid 15 mg 32% mp 324326 c h nmr 400 mhz dmso d6 13.05 bs 1h 9.91 bs 1h 8.18 j 8 hz 2h 7.95 j 8 hz 2h 7.64 1h c nmr 100 mhz dmso d6 158.8 132.5 129.4 127.6 127.2 127.1 126.7 118.4 112.5 hrms esi calculated c11h8n3o2 h 214.0611 found 214.0618 4-(4,5-dimethoxypyrimidin-2-yl)benzonitrile 53 mg 0.22 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 5 h. cooled room temperature the reaction mixture diluted etoac washed satd nahco3 followed brine the resulting residue purified flash chromatography silica gel eluting 05% meoh dcm give 4-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile white solid 50 mg 100% mp 297299 c h nmr 400 mhz dmso d6 12.99 bs 1h 8.19 j 8 hz 2h 7.96 j 8 hz 2h 7.75 1h 3.81 3h c nmr 100 mhz dmso d6 157.8 147.4 146.2 136.5 132.5 130.0 127.8 118.4 112.8 56.1 hrms esi calculated c12h10n3o2 h 228.0768 found 228.0770 2-chloro-4,5-dimethoxypyrimidine 100 mg 0.57 mmol 4-cyanophenyl)boronic acid 126 mg 0.86 mmol pd(pph3)4 66 mg 0.06 mmol na2co3(182 mg 1.72 mmol dissolved mixture dioxane 9 ml water 3 ml then reaction mixture refluxed 4 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated vacuo resulting residue purified flash chromatography silica gel eluting 020% etoac hexane this afforded 4-(4,5-dimethoxypyrimidin-2-yl)benzonitrile white solid 69 mg 74% mp 170172 c h nmr 400 mhz cdcl3 8.49 j 9 hz 2h 8.18 1h 7.76 j 9 hz 2h 4.20 3h 4.02 3h c nmr 100 mhz cdcl3 159.8 154.0 141.8 141.5 137.0 132.3 128.0 119.0 113.0 56.4 54.2 hrms esi calculated c13h12n3o2 h 242.0924 found 242.0929 3-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile 50 mg 0.22 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 2.2 ml 2.2 mmol added it allowed warm room temperature stirred 18 h. solvent removed reduced pressure it filtered solid collected dried vacuum provide 3-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile white solid 27 mg 58% mp 294296 c h nmr 400 mhz dmso d6 8.44 1h 8.35 j 8 hz 1h 7.93 j 8 hz 1h 7.68 j 8 hz 1h 7.61 1h c nmr 100 mhz dmso d6 159.3 146.4 143.9 134.3 133.4 131.9 131.5 130.4 129.8 118.4 111.7 hrms esi calculated c11h8n3o2 h 214.0611 found 214.0613 3-(4,5-dimethoxypyrimidin-2-yl)benzonitrile 138 mg 0.57 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 6 h. cooled room temperature the reaction mixture diluted etoac washed satd nahco3 followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 3-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile white solid 56 mg 43% mp 255257 c h nmr 400 mhz dmso d6 12.93 bs 1h 8.44 1h 8.34 j 8 hz 1h 7.99 j 8 hz 1h 7.747.70 2h 3.82 3h c nmr 100 mhz dmso d6 157.9 147.5 145.9 133.9 133.7 131.7 130.7 130.4 129.9 118.3 111.7 56.1 hrms esi calculated c12h10n3o2 h 228.0768 found 228.0767 2-chloro-4,5-dimethoxypyrimidine 100 mg 0.57 mmol 3-cyanophenyl)boronic acid 126 mg 0.86 mmol pd(pph3)4 66 mg 0.06 mmol na2co3(182 mg 1.72 mmol dissolved mixture dioxane 9 ml water 3 ml then reaction mixture refluxed 5 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated vacuo resulting residue purified flash chromatography silica gel eluting 020% etoac hexane this afforded 3-(4,5-dimethoxypyrimidin-2-yl)benzonitrile white solid 138 mg 100% mp 134136 c h nmr 400 mhz cdcl3 8.61 1h 8.54 j 8 hz 1h 8.09 1h 7.65 j 8 hz 1h 7.51 j 8 hz 1h 4.13 3h 3.95 3h c nmr 100 mhz cdcl3 159.8 153.6 141.7 138.5 137.0 132.8 131.6 131.3 129.2 118.9 112.6 56.4 54.2 hrms esi calculated c13h12n3o2 h 242.0924 found 242.0928 4-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile 68 mg 0.32 mmol nan3 79 mg 1.21 mmol dissolved anhydrous dmf 1 ml it sealed heated 130 c 17 h. reaction cooled room temperature gave brownish suspension the resulting residue suspended water filtered give 2-(4-(1h tetrazol-5-yl)phenyl)-5-hydroxypyrimidin-4(3h)-one dark brown solid 42 mg 51% dec 290292 c h nmr 400 mhz dmso d6 8.08 j 9 hz 2h 8.03 j 8 hz 2h 7.55 1h c nmr 100 mhz dmso d6 161.0 160.2 148.9 143.3 133.8 132.4 131.6 126.9 125.5 hrms esi calculated c11h9n6o2 h 257.0781 found 257.0791 3-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile 108 mg 0.50 mmol nan3 131 mg 2.02 mmol dissolved anhydrous dmf 1 ml it sealed heated 130 c 18 h. reaction cooled room temperature gave brownish suspension the greenish solid suspended 2 n hcl followed second filtration provide 2-(3-(1h tetrazol-5-yl)phenyl)-5-hydroxypyrimidin-4(3h)-one beige solid 32 mg 25% dec 295297 c h nmr 400 mhz dmso d6 8.67 1h 8.11 j 8 hz 1h 7.97 j 8 hz 1h 7.63 1h 7.56 j 8 hz 1h c nmr 100 mhz dmso d6 162.3 159.1 158.7 148.0 143.4 133.1 130.4 128.9 127.9 126.5 125.1 hrms esi calculated c11h9n6o2 h 257.0781 found 257.0785 5-(4-fluorophenyl)-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one 55 mg 0.21 mmol dissolved anhydrous dcm 10 ml the reaction mixture cooled 0 c 1 dcm bbr3 2.1 ml 2.1 mmol added it allowed warm room temperature stirred 24 h. solvent removed reduced pressure this gave 5-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one recharged 1 dcm bbr3 2.1 ml 2.1 mmol the filtered solid purified flash chromatography silica gel eluting 010% meoh dcm this gave 5-(4-fluorophenyl)-4-hydroxypyridazin-3(2h)-one white solid 6.2 mg 14% mp 274276 c h nmr 400 mhz dmso d6 12.70 1h 7.76 1h 7.58 j 8 hz j 5 hz 2h 7.217.17 2h c nmr 100 mhz dmso d6 161.2 jc f 243 hz 161.9 154.6 132.7 132.4 jc f 8 hz 127.2 jc f 4 hz 115.8 114.2 jc f 21 hz f nmr 376 mhz dmso d6 114.1 hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0575 5-chloro-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one 58 mg 0.28 mmol 4-fluorophenyl)boronic acid 140 mg 0.43 mmol pd(pph3)4 32 mg 0.028 mmol na2co3 90 mg 0.85 mmol dissolved mixture dioxane 9 ml water 3 ml air evacuated replaced n2 then reaction mixture refluxed 14 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated vacuo resulting residue purified flash chromatography silica gel eluting 030% etoac hexane this afforded 5-(4-fluorophenyl)-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one white solid 56 mg 74% mp 123125 c h nmr 400 mhz cdcl3 7.95 1h 7.53 dd j 9 hz j 6 hz 2h 7.117 07 2h 5.48 2h 3.93 3h 3.49 3h c nmr 100 mhz cdcl3 162.6 jc f 247 hz 161.6 154.8 132.3 jc f 8 hz 128.5 125.7 120.7 112.9 jc f 22 hz 81.6 57.9 57.3 f nmr 376 mhz cdcl3 112.6 hrms esi calculated c13h14fn2o3 h 265.0983 found 265.0992 4,5-dichloro-2-(methoxymethyl)pyridazin-3(2h)-one 84 mg 0.40 mmol added meoh 10 ml reaction mixture cooled 0 c it treated naome 24 mg 0.44 mmol allowed warm room temperature the reaction mixture stirred 18 h room temperature reaction the resulting residue diluted etoac washed satd nh4cl followed brine the residue purified flash chromatography silica gel eluting 030% etoac hexane provide 5-chloro-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one white solid 59 mg 72% mp 101103 c h nmr 400 mhz cdcl3 7.85 1h 5.45 2h 4.08 3h 3.44 3h c nmr 100 mhz cdcl3 159.1 155.1 127.1 116.9 81.9 57.9 57.8 hrms esi calculated c7h10cln2o3 h 205.0374 found 205.0384 4,5-dichloropyridazin-3(2h)-one 200 mg 1.21 mmol 4-dimethylaminopyridine 15 mg 0.12 mmol dissolved anhydrous dcm 20 ml then reaction mixture cooled 0 c treated net3 0.29 ml 1.70 mmol followed momcl 0.110 ml 1.454 mmol the reaction mixture allowed warm room temperature stirred 17 h. poured dcm washed satd nh4cl followed brine the resulting residue purified flash chromatography silica gel eluting 030% etoac hexane provide 4,5-dichloro-2-(methoxymethyl)pyridazin-3(2h)-one white solid 84 mg 33% mp 6567 c h nmr 400 mhz cdcl3 7.78 1h 5.41 2h 3.43 3h c nmr 100 mhz cdcl3 156.9 137.0 136.0 134.9 82.4 58.1 6-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one 16 mg 0.074 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 0.74 ml 0.74 mmol added it allowed warm room temperature stirred 36 h. solvent removed reduced pressure it filtered solid collected dried vacuum provide 6-(4-fluorophenyl)-4-hydroxypyridazin-3(2h)-one white solid 5 mg 35% mp 281283 c h nmr 400 mhz dmso d6 13.10 bs 1h 11.02 bs 1h 7.87 dd j 9 hz j 5 hz 2h 7.307.26 m,2h 7.19 1h c nmr 100 mhz dmso d6 162.6 jc f 245 hz 157.6 155.4 145.2 132.0 jc f 3 hz 128.0 jc f 9 hz 115.6 jc f 22 hz 106.0 f nmr 376 mhz dmso d6 113.0 hrms esi calculated c10h8fn2o2 h 207.0564 found 207.0567 6-(4-fluorophenyl)-3,4-dimethoxypyridazine 122 mg 0.52 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 11 h. cooled room temperature the reaction mixture diluted etoac washed satd nahco3 followed brine the resulting residue purified flash chromatography silica gel eluting 010% meoh dcm give 6-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one white solid 41 mg 36% mp 211213 c h nmr 400 mhz dmso d6 13.05 br 1h 7.96 dd j 9 hz j 6 hz 2h 7.347.29 2h 7.28 1h 3.92 3h c nmr 100 mhz dmso d6 162.7 jc f 245 hz 156.2 155.7 144.3 132.0 jc f 3 hz 128.2 jc f 8 hz 115.6 jc f 22 hz 104.4 56.2 f nmr 376 mhz dmso d6 112.9 hrms esi calculated c11h10fn2o2 h 221.0721 found 221.0727 6-chloro-3,4-dimethoxypyridazine 101 mg 0.58 mmol 4-fluorophenyl)boronic acid 122 mg 0.87 mmol pd(pph3)4 67 mg 0.06 mmol na2co3(184 mg 1.74 mmol dissolved mixture dioxane 15 ml water 5 ml then reaction mixture refluxed 3 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 020% etoac hexane this afforded 6-(4-fluorophenyl)-3,4-dimethoxypyridazine white solid 109 mg 80% mp 103105 c h nmr 400 mhz cdcl3 7.88 dd j 9 hz j 5 hz 2h 7.107 06 2h 7.00 1h 4.14 3h 3.93 3h c nmr 100 mhz cdcl3 163.7 jc f 247 hz 156.5 155.7 148.9 132.9 jc f 3 hz 128.5 jc f 9 hz 115.8 jc f 21 hz 104.7 55.7 55.2 f nmr 376 mhz cdcl3 112.2 hrms esi calculated c12h12fn2o2 h 235.0877 found 235.0885 3,4,6-trichloropyridazine 200 mg 1.09 mmol added meoh 15 ml it treated naome 117 mg 2.17 mmol allowed warm room temperature after reaction completed put vacuum remove meoh the resulting residue diluted etoac washed satd nh4cl followed brine the residue purified flash chromatography silica gel eluting 030% etoac hexane provide 4-chloro-5,6-dimethoxypyrimidine white solid 101 mg 53% mp 117119 c h nmr 400 mhz cdcl3 6.71 1h 4.08 3h 3.88 3h c nmr 100 mhz cdcl3 156.9 151.1 149.8 108.4 56.2 55.3 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile 109 mg 0.48 mmol dissolved anhydrous dcm 5 ml the reaction mixture cooled 0 c 1 dcm bbr3 4.8 ml 4.8 mmol added it allowed warm room temperature stirred 20 h. solvent removed reduced pressure the solid dry loaded silica gel purified flash chromatography silica gel eluting 010% meoh dcm this afforded 4-(5-hydroxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile white solid 75 mg 73% mp 305307 c h nmr 400 mhz dmso d6 13.29 1h 11.15 bs 1h 8.03 j 9 hz 2h 7.92 j 9 hz 2h 7.29 1h c nmr 100 mhz dmso d6 157.7 154.6 144.4 139.8 132.7 126.5 118.6 111.4 106.0 hrms esi calculated c11h8n3o2 h 214.0611 found 214.0615 4-(5,6-dimethoxypyridazin-3-yl)benzonitrile 125 mg 0.52 mmol dissolved mixture 2 n hcl 5 ml dioxane 5 ml the reaction mixture refluxed 4 h. cooled room temperature put reduced pressure the product 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile collected white solid 82 mg 70% mp 271273 c h nmr 400 mhz dmso d6 13.97 bs 1h 8.02 j 8 hz 2h 7.94 j 8 hz 2h 6.62 1h 3.96 3h c nmr 100 mhz dmso d6 156.3 155.9 143.5 139.7 132.7 126.7 118.6 111.4 104.3 56.3 hrms esi calculated c12h10n3o2 h 228.0768 found 228.0774 6-chloro-3,4-dimethoxypyridazine 298 mg 1.71 mmol 4-cyanophenyl)boronic acid 376 mg 2.56 mmol pd(pph3)4 198 mg 0.17 mmol na2co3(543 mg 5.12 mmol dissolved mixture dioxane 15 ml water 5 ml air evacuated replaced n2 then reaction mixture refluxed 15 h. reaction completed cooled room temperature diluted etoac washed satd nh4cl followed brine the organic layer dried na2so4 concentrated reduced pressure resulting residue purified flash chromatography silica gel eluting 030% etoac hexane this afforded 4-(5,6-dimethoxypyridazin-3-yl)benzonitrile white solid 130 mg 31% mp 187189 c h nmr 400 mhz cdcl3 8.10 j 8 hz 2h 7.77 j 8 hz 2h 7.14 1h 4.23 3h 4.03 3h c nmr 100 mhz cdcl3 157.1 154.7 149.1 140.9 132.6 127.3 118.5 113.0 104.9 55.9 55.3 hrms esi calculated c13h12n3o2 h 242.0924 found 242.0931 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile 56 mg 0.26 mmol nan3 69 mg 1.06 mmol dissolved anhydrous dmf 1 ml it sealed heated 130 c 21 h. reaction cooled room temperature gave brownish suspension the suspension filtered gave white solid treated 2 n hcl filtered this afforded 6-(4-(1h tetrazol-5-yl)phenyl)-4-hydroxypyridazin-3(2h)-one white solid 33 mg 48% dec 273275 c h nmr 400 mhz dmso d6 11.13 1h 8.09 j 8 hz 2h 7.95 j 7 hz 2h 7.25 1h c nmr 100 mhz dmso d6 158.0 157.7 154.9 145.7 135.8 128.9 126.6 126.2 105.9 hrms esi calculated c11h9n6o2 h 257.0781 found 257.0791 pandemic h1n1 endonuclease residues 1204 expressed purified described previously the bl21 ril cells stratagene grown od600 0.8 induced 0.15 mm iptg 17 c 17 h. cells harvested centrifugation purified ni nta qiagen according manufacturers recommendations except final elution completed 500 mm imidazole containing buffer the endonuclease purified size exclusion chromatography using hiload 26/60 superdex 75 ge healthcare the buffer used size exclusion final buffer storage protein 100 mm nacl 20 mm tris ph 8.0 the protein concentrated 5 mg ml using ultrafree 10k millipore aliquoted stored 80 c crystals formed mixing 1:1 ratio endonuclease 5 mg ml crystallization buffer containing 200 mm mes ph 6.7 27% peg8000 200 mm ammonium sulfate 1 mm manganese chloride 10 mm magnesium acetate 10 mm taurine 50 mm sodium fluoride crystals form within hours grow maximum size 12 weeks 20 c crystal structures compounds 11 determined complex endonuclease previously described.11 soaked preformed crystals stepwise gradient shifting surrounding crystallization solution 1 mm manganese sulfate 200 mm hepes ph 7.7 25% w v peg 8000 50 mm ammonium sulfate 5 mm magnesium acetate 80 mm l arginine 10% dmso containing 100 mm 11 10% v v ethylene glycol crystals soaked ligand 2 h 20 c placed liquid nitrogen storage x ray diffraction data collection performed cornell high energy synchrotron source chess f1 beamline the diffraction data indexed processed scaled merged using hkl2000 structure solved refined using software phenix the endonuclease assay used single stranded dna probe sequence 6-fam)tggcaatatcagctccaca(mgbnfq applied biosystems reaction buffer contained 50 mm tris ph 7.5 50 mm sodium chloride 1 mm dtt 5 mm magnesium chloride 0.5 mm manganese sulfate 1 mm chaps dna probe 50 nm endonuclease 25 nm compound mixed ice placed varioskan fluorimeter thermo scientific preincubated 37 c detect fluorescence excitation 488 nm emission 518 nm fluorescence measured various time points activity inhibition calculated graphpad prism 6.0b

seasonal and pandemic influenza outbreaks remain a major human health problem . inhibition of the endonuclease activity of influenza rna - dependent rna polymerase is attractive for the development of new agents for the treatment of influenza infection . our earlier studies identified a series of 5- and 6-phenyl substituted 3-hydroxypyridin-2(1h)-ones that were effective inhibitors of influenza endonuclease . these agents identified as bimetal chelating ligands binding to the active site of the enzyme . in the present study , several aza analogues of these phenyl substituted 3-hydroxypyridin-2(1h)-one compounds were synthesized and evaluated for their ability to inhibit the endonuclease activity . in contrast to the 4-aza analogue of 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one , the 5-aza analogue ( 5-hydroxy-2-(4-fluorophenyl)pyrimidin-4(3h)-one ) did exhibit significant activity as an endonuclease inhibitor . the 6-aza analogue of 5-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one ( 6-(4-fluorophenyl)-4-hydroxypyridazin-3(2h)-one ) also retained modest activity as an inhibitor . several varied 6-phenyl-4-hydroxypyridazin-3(2h)-ones and 2-phenyl-5-hydroxypyrimidin-4(3h)-ones were synthesized and evaluated as endonuclease inhibitors . the sar observed for these aza analogues are consistent with those previously observed with various phenyl substituted 3-hydroxypyridin-2(1h)-ones .

57-year old woman admitted hospital evaluation mass located upper abdomen mass incidentally detected abdominal ultrasound exam medical checkup the patient presented recurrent abdominal distension without complaints medical history unremarkable except cholecystolithiasis fatty liver diagnosed two years previously admission the laboratory tests showed extremely high level -fetoprotein afp 35,350 ng ml reference 20 ng ml carbohydrate antigen ca 19 9 ca125 blood amylase aspartate transferase ast alanine transferase alt bilirubin levels within normal ranges pre contrast contrast enhanced spiral ct abdomen performed including arterial phase portal venous phase equilibrium phase following bolus injection intravenous contrast material the pre contrast ct scan revealed 4.5 cm diameter smooth marginated solitary heterogeneous mass occupying pancreatic neck body fig two hypodense lesions discovered liver measured 4.7 4.3 cm 7.0 6.8 cm respectively displaying minimal diffuse heterogeneous enhancement fig the high density within large mass left hepatic lobe indicated central hemorrhage since pancreatic cancer sometimes associated elevated afp level although high patient often hepatic metastases initial diagnosis conventional pancreatic adenocarcinoma made the patient underwent neoadjuvant chemotherapy consisted fluorouracil tetrahydrofolate cisplatin yet little effect serum afp level decrease an encapsulated mass measuring 4 cm diameter discovered pancreatic neck body in addition two metastatic lesions 5.0 4.0 cm 4.0 3.0 cm size found iii iv vii hepatic segments tumor resection included primary pancreatic neoplasm right hepatic metastatic mass carried for left hepatic mass hepatic segmentectomy segments ii iii part segment iv performed the immunohistochemical examination demonstrated tumor cells diffusely positive afp placental alkaline phosphatase plap carcino embryonic antigen cea negative ca19 9 the afp level notably decreased surgery 2,097 1,200 500 ng ml postoperative 3rd 9th 25th day respectively exclude existence primary gonadal germ cell tumor clinical ultrasound examinations conducted genital system patient abnormality found month operation the patient received systematic chemotherapy bep regimen bleomycin etoposide cisplatin a total three cycles therapy performed interval three weeks cycles chemotherapy ct examination repeated revealed tumor recurrence pancreas of genital tumors yolk sac tumors relatively uncommon mostly discovered infants adolescents median age 19 years 3 although typically arise gonads ysts already reported many extragonadal sites generally mediastinum sacrococcygeal region brain retroperitoneal space female reproductive tract relatively common locations exceedingly rare sites liver kidney omentum stomach spinal cord etc also previously reported 4 6 best knowledge report primary yst arising pancreas especially occurring 57-year old woman because rarity systematic study ct features extragonadal ysts large number cases previous case report tumor usually described large multi lobulated solid heterogeneous hypodense mass showed moderate heterogeneous enhancement 7 central necrotic and/or cystic changes observed ct images wong et al choi et al 9 evaluated ct findings ysts ovary ten patients characterized tumors large smooth marginated well enhancing solid masses cystic hemorrhagic necrotic portion present case non contrast ct scan showed oval shaped heterogeneous soft tissue mass central hypodense area mass displayed moderate inhomogeneous enhancement the imaging findings verified morphological observations encapsulated tumor focal necrosis central hemorrhage detected hepatic metastatic lesion might attributed notable proliferative vascularization activities tumor cells studies ysts shown infiltrative growth adjacent soft tissues higher magnification revealed microcystic growth pattern tumor cells formed reticular glandular structures contributed cystic necrotic changes seen ct images since ysts usually show high malignancy duration onset symptoms admission always short metastasis may already exist time patient admission like case presented an extremely high afp level may clue making diagnosis ysts because extreme rarity primary yst pancreas metastatic germ cell tumor gonads primary metastatic pancreatic neoplasms excluded present first case primary yst arising pancreas hepatic metastasis adult woman this unique case value reminding radiologists oncologists aware diagnosis yst patient presents extremely high level afp oval shaped multilobulated heterogeneous soft tissue mass discovered pancreas displaying moderate inhomogeneous enhancement ct images making careful differential diagnosis

extragonadal yolk sac tumor ( yst ) is a relatively rare entity . we describe here the case of an extragonadal yst that occurred in the pancreas with hepatic metastasis in an adult woman . the contrast enhanced ct images of the abdomen revealed a heterogeneous , solitary mass occupying the pancreatic neck and body with slightly inhomogeneous contrast enhancement . two low - density lesions in the liver were also displayed on the ct images . the patient underwent surgery and the diagnosis of yst was pathologically verified .

rheumatoid arthritis ra common rheumatoid condition affects approximately 2% adult population the onset disease usually takes place 45 55 year age diagnosed early rapidly leads permanent deformities motor organs the frequently affected anatomic area course ra hand anatomically hand made wrist metacarpus fingers the term rheumatoid hand denotes hand deformed course ra results injury ligamentous complex midcarpal carpometacarpal metacarpophalangeal interphalangeal joints deformity bone bases compose joints well post inflammatory lesions tendon sheaths tendons fig rheumatoid hand patient long term ra present due advancement knowledge concerning pathogenesis ra development diagnostic methods including imaging techniques ultrasound us magnetic resonance imaging mri controlling ailments symptoms disease main aims rheumatoid arthritis management ra diagnosed early allows rapid implementation treatment preventing advancement disease irreversible form results hand deformities thus contemporary treatment merely symptomatic also partially causal since thanks knowledge pathogenesis possible inhibit certain pathogenetic mechanisms hinders ra advancement radiological examinations bones many years constituted imaging modality ra diagnostics reveal advanced irreversible lesions erosions inflammatory cysts geodes joint deformities although non specific initially discrete detection allows commencement treatment early stage disease result observe classical image rheumatoid hand deformed disease rarely us examination commonly performed rheumatoid patients primarily purposes evaluating soft tissues joints rheumatoid arthritis affects sites synovial membrane may found articular cavities bursae sheaths therefore sites subject thorough evaluation moreover one remember limited volume osteofibrous carpal tunnel pathologies inflammatory synovitis radiocarpal midcarpal joints well tenosynovitis flexor tendons non inflammatory ones e.g. muscle anomalies osseous lesions predispose median nerve compression neuropathy necessarily require retinacular incision rheumatologist everyday practice us examination conducted stage diagnosis well monitor treatment confirm remission clinical picture ambiguous stage diagnosis us examination aims visualizing excluding inflammatory lesions case presence determining localization intensity degree activity finally although radiography main method area us examination enables detect erosions attest advancement disease completely change prognosis us examination following assessed articular cavities search signs synovitis effusions bone outlines terms geodes erosions tendons sheaths searching signs synovitis effusion tendon damage bursae hand second compartment extensors search synovitis effusion the synovial membrane lines inner surface articular capsule tendon sheaths bursae normal conditions healthy persons visible us scans course ra however subsequent stages evolution correspond lesions presented previous articles observed the hyperplasia intimal layer inflammatory edema subintimal layer visible form synovial thickening figs 2 3 coexistent joint effusion frequently observed contrary thickened synovium the effusion articular cavities sheaths bursae results malfunction synovial membrane affected inflammation the aim us examination measure thickness determine means probe induced compression whether low medium high pressure moreover enhanced vascularization synovium observed power doppler ultrasound examination pdus attests process neoangiogenesis figs 4 5 us examination one specify localization pathologically altered synovium determine whether process generalized e.g. metacarpophalangeal joints mcp sheaths extensor compartments involved whether limited single several joints sheaths pathogenetic point view capsular synovitis flexor extensor tenosynovitis tendovaginitis bursitis manifested synovial membrane thickening depending moment us examination performed hyperemia synovium may yet visible single vessels may observed finally typically ra intensive vascularization synovium may present the assessment degree hyperemia subjective semiquantitative based pdus for instance 03 score classification 0 marks lack flow 1 visible one two vessels area synovium 2 numerous vessels occupying approximately 50% thickened synovium 3 numerous vessels occupy 50% synovium another exemplary scale score 0 means correct vascularization synovium single vessels 1 low degree hyperemia 2 moderate hyperemia 3 intense vascularization synovium an example quantitative assessment however measurement cf indicator color fraction ratio color pixels pixels marked area interest the analysis vascularization synovial membrane pdus clinical significance proven correlations synovitis assessed pdus count th17 proinflammatory destructive lymphocytes synovial fluid patients ra thickening synovium druj radiocarpal midcarpal joints synovitis thickening synovium extensor carpi ulnaris tendon sheat tenosynovitis a. thickening vascularization synovium mcp joint synovitis b. joint pannus inflammatory granulation tissue composed numerous tiny vessels chronic inflammatory infiltrates h&e staining 100 thickening vascularization synovium flexor carpi radialis tendon tenosynovitis active pannus i.e. synovial membrane active inflammation leads damage articular structures case articular cavities initially peripheral i.e. occur region osseous junction articular capsule subsequently subchondral due damage articular cartilage geodes however attest presence another diseased area subchondral osseous tissue geodes visible us image defects subchondral layer covered cortical layer erosions hand analogically radiographic examination visible interruption outline cortical layer synovium frequently detected within erosion may undergo fibrosis vascularized the latter observation attests presence active process articular structure deterioration called active erosion fig the us access bone surfaces compose joints hand limited therefore sonography constitutes supplementation radiographic examination however enable visualize erosions either due overlapping dorsal ventral osseous masses active erosions mcp joint active pannus inflammatory process sheath hand may also involve tendon defined inflammation tendon tendon sheath fig the acute active condition manifests hyperemia synovial sheath hyperemia tendon chronic inflammatory condition frequently accompanying mechanical factors connected tendon movement uneven bone surfaces deteriorated inflammation often leads partial complete tendon rupture fig hypoechoic tears visible region thickened tendon case complete rupture prior planned surgery essential determine distance stumps morphological condition a. tendovaginitis tendinitis extensor carpi ulnaris 100 complete tear extensor pollicis longus tendon a. empty sheath level dorsal tubercle radius b. distal stump torn tendon thickened degenerated intrasubstance tears hand model cascade inflammatory destructive changes brought active pannus distal radioulnar joint druj fig 9 articular capsule ligaments stabilize joint become damaged erosions articular epiphyses occur articular surfaces undergo damage this results instability joint dorsal dislocations subluxations ulna in situation deterioration dorsal capsule ligamentous complex druj bands extensor finger 5 rub directly saw like erosion site surface dorsal epiphysis distal ulna moreover pannus tendon sheath extensor carpi ulnaris may infiltrate tendon subsequent damage favored subluxation ulna bone friction tendon deteriorated head ulna active tendovaginitis tendinitis extensor carpi ulnaris us examination one may observe anomalous joint position may caused damage articular surfaces late stages rheumatoid disease also early phase dynamic us examination may reveal contracture capsule ligamentous structures interphalangeal joints constraint natural hyperextension proximal interphalangeal joint they frequently caused failure begin rehabilitation onset arthritis therefore based us examination possible distinguish individual rheumatoid entities would desirable instance case undifferentiated unclassified arthritis ua respect the role sonography difficult x ray scan differentiation based localization lesions characteristic radiological features there probably one instance us differential diagnosis might attempted i.e. patient manifests inflammatory changes distal interphalangeal joint coexist entesopathy capsular tendoligamentous attachments including erosive destructive changes simultaneous proliferative lesions region epiphyses pathognomonic psoriatic arthritis fig what ultrasound symptoms characteristic rheumatoid diseases mainly synovitis tenosynovitis bursitis may occur course overuse post traumatic degenerative changes finally ultrasound image rheumatoid patients currently diagnosed early stage called therapeutic window frequently different one familiar course books mainly radiological images we familiar radiological images x ray us mri early phases rheumatoid diseases without proper clinical data differentiate yet pathogenetic knowledge rheumatoid practice indicate instance pain edema joint explained within 6 weeks thanks case diagnosis inflammation might recommend treatment period called therapeutic window i.e. within 3 months onset symptoms erosive proliferative inflammatory lesions dip3 joint hand sum sonography non invasive available examination constitutes one supplementary examinations diagnosis rheumatoid patients it allows diagnosis early inflammatory lesions soft tissues joints due fact patients report early stage disease whose advancement high probability may hindered implemented therapy significance us examinations increase prevents differentiation rheumatoid diseases degenerative overuse post traumatic changes overlap syndrome ra osteoarthritis post traumatic arthritis finally allow differentiation cause persistent synovial membrane thickening mean effusion chronically ill patients chronic inflammation synovial membrane fibrosis affects subsequent therapeutic decisions authors report financial personal links persons organizations might affect negatively content publication and/or claim authorship rights publication

ultrasound examination is becoming more and more common in patients with rheumatoid diseases . above all , it enables the assessment of articular soft tissues and constitutes a non - invasive examination . in a rheumatologist 's everyday practice , it is conducted at the stage of initial diagnosis as well as to monitor the treatment and to confirm the remission if the clinical picture is ambiguous . the first sign of arthritis ( including rheumatoid arthritis ) that is visible on ultrasound examination is the thickening of the synovial membrane of the joint cavities , tendon sheaths or bursae . it is frequently accompanied by the exudate in the joint , sheath or bursa . in a subsequent stage , in doppler examination , enhanced vascularization of the synovial membrane is observed . sometimes , the inflammatory process of the tendon sheaths also affects the tendons , which might lead to their damage . moreover , ultrasound examination also reveals erosions and inflammatory cysts ( geodes ) which attest to the advancement of the disease . a dynamic ultrasound examination enables to diagnose the capsule - ligamentous contracture of the interphalangeal joints , which occurs due to the lack of rehabilitation that should begin at the moment of the commencement of the inflammation . the ultrasound image does not allow for the differentiation between various rheumatoid entities , including those encompassing the joints in the hand , wrist . the observed changes , i.e. thickening of the synovial membrane , hyperemia , effusions , erosions or tendon damage , may accompany various rheumatoid entities . the purpose of the ultrasound examination is to recognize these irregularities , determine their localization and advancement and , finally , to monitor the course of treatment . furthermore , ultrasound scan enables to assess the joints and tendons in a dynamic examination in relation to local ailments of the patient as well as to monitor the biopsy , aspiration and medicine administration . sonography is used for a us - guided administration of radioisotope substances for synoviorthesis .

osteoarthritis oa common form arthritis leading cause disability especially among older adults the disease process leads limitation joint movement joint deformity tenderness inflammation severe pain oa characterized progressive loss cartilage articulating surfaces diarthrodial joints although pathophysiologic mechanisms osteoarthritis remain unresolved chondrocytes oa cartilage demonstrated morphologic changes characteristic features apoptosis suggests apoptosis plays important role development oa 36 conventional approaches treatment oa range conservative measures surgical intervention eventually joint replacement 79 currently curative treatment disease even though total joint replacement surgery relatively successful treatment oa lifespan artificial joints limited still significant problems implant loosening failure expensive cost non steroidal anti inflammatory drugs nsaids among widely prescribed drugs treatment osteoarthritis oa alleviate pain thereby maintain ability perform normal daily physical activities even treatment knee replacement surgery the clinical efficacy nsaids primarily related inhibition cyclooxygenase 2 cox-2 cyclooxygenase 1 celecoxib one first selective cox-2 inhibitors shown effective anti inflammatory analgesic drug patients rheumatoid arthritis oa comparable traditional nsaids naproxen diclofenac ibuprofen 912 a significant reduction gastrointestinal adverse events selective cox-2 inhibitors compared non selective nsaids frequently demonstrated currently several vitro studies shown celecoxib positive effect human osteoarthritic cartilage remains controversial effects agents progression oa herein based surgically induced osteoarthritis model performed study determine whether celecoxib could inhibit apoptosis chondrocytes ameliorate type ii collagen synthesis relieve symptoms oa one hundred thirty wistar rats 3~4 months old purchased laboratory animal center chongqing medical university oa model wistar rats induced using surgical resection left achilles tendon resulting decrease joint stress performed previously described the left knee used experimental side right knee control side the experiments done reference long term toxicity test methods methodology pharmacological experiments animals randomly divided 4 groups celecoxib group ce ibprofen group ibp indomethacin group normal saline group ns the daily drug dosages ce 24 mg kg american silver pharmaceutical company ibp 72 mg kg chongqing southwest pharmaceutical co.ltd 9 mg kg chongqing kerui pharmacy co.ltd ns sichuan kelun pharmaceutical co. ltd if 50 g weight difference rats drug would administered individually end 3 6 9 months treatment surgically induced model the knees dissected animal fixed 4% paraformaldehyde 70% ethanol decalcified 10% edta after staining chondrocytes cartilage surface cartilage matrix tide line observed microscope type ii collagen antibody sabc kit dab purchased boston corp the ihc stainings cartilage matrix chondrocyte observed photographed using olympus microscope beijing aviation medical image analysis system adopted calculate average density positive staining every field the apoptosis detection kit purchased mannheim company germany procedure tunel detection performed according manual the positive cells presented yellow particles distributed throughout nuclear material negative cells showed blue staining hematoxylin apoptosis proportion calculated formula number positive cells total number cells five hundred chondrocytes counted every slide per 1000 chondrocytes different periods group the rats killed vertebrae dislocation left knees exposed weight loading area femoral condyle 22 mm obtained the specimens fixed 1% osmium tetroxide decalcified 10% edta dehydrated graded series ethanol acetone finally embedded epoxy resin semithin section ultrathin sections cut using ultramicrotome double stained examined photographed transmission electron microscope the quantitative semi quantitative data analyses including analysis variance q test performed sas 6.12 software significance level set =0.05 one hundred thirty wistar rats 3~4 months old purchased laboratory animal center chongqing medical university oa model wistar rats induced using surgical resection left achilles tendon resulting decrease joint stress performed previously described the left knee used experimental side right knee control side the experiments done reference long term toxicity test methods methodology pharmacological experiments animals randomly divided 4 groups celecoxib group ce ibprofen group ibp indomethacin group normal saline group ns the daily drug dosages ce 24 mg kg american silver pharmaceutical company ibp 72 mg kg chongqing southwest pharmaceutical co.ltd 9 mg kg chongqing kerui pharmacy co.ltd ns sichuan kelun pharmaceutical co. ltd if 50 g weight difference rats drug would administered individually at end 3 6 9 months treatment surgically induced model rats killed the knees dissected animal fixed 4% paraformaldehyde 70% ethanol decalcified 10% edta after staining chondrocytes cartilage surface cartilage matrix tide line observed microscope type ii collagen antibody sabc kit dab purchased boston corp the ihc stainings cartilage matrix chondrocyte observed photographed using olympus microscope beijing aviation medical image analysis system adopted calculate average density positive staining every field the apoptosis detection kit purchased mannheim company germany procedure tunel detection performed according manual stainings observed photographed using olympus microscope test included positive negative control the positive cells presented yellow particles distributed throughout nuclear material negative cells showed blue staining hematoxylin apoptosis proportion calculated formula number positive cells total number cells five hundred chondrocytes counted every slide per 1000 chondrocytes different periods group the rats killed vertebrae dislocation left knees exposed weight loading area femoral condyle 22 mm obtained specimens fixed 1% osmium tetroxide decalcified 10% edta dehydrated graded series ethanol acetone finally embedded epoxy resin semithin section ultrathin sections cut using ultramicrotome double stained examined photographed transmission electron microscope the quantitative semi quantitative data analyses including analysis variance q test performed sas 6.12 software significance level set =0.05 the surface articular cartilage became slightly rough focus stress the toluidine blue staining mildly uneven death rats group experiment 9th month could completed 3 6 9 months treatment surgically induced animal model oa ns group ce group showed similar different periods progressive development oa 3 month surface stress concentration area rough double columnar nested chondrocyte hyperplasia observed 6 month superficial layer articular cartilage shed large amount chondrocyte hyperplasia 9 month superficial layer articular cartilage became rougher the chondrocytes ns group decreased chondrocytes ce group slightly decreased group 3 month layer cartilage became thinner appeared villous chondrocytes arranged irregular clusters 6 month changes mentioned progressed chondrocyte necrosis occurred ibp group 9 month thickness articular cartilage became thin deteriorated as shown table 1 3 6 9 months ibp promoted expression type ii collagen inhibited expression as shown table 2 3 month treatment ce suppressed chondrocyte apoptosis ibp promoted chondrocyte apoptosis especially ibp significantly increased chondrocyte apoptosis chondrocyte apoptosis maximized 3 month treatment began reduce 9 month treatment ce still inhibited chondrocyte apoptosis taken together ce inhibited chondrocyte apoptosis retained degeneration cartilage ibp promoted chondrocyte apoptosis aggravated degeneration cartilage ns ce groups chondrocytes articular cartilage appeared similar the shape cells normal integrated nuclear membrane slight aggregated chromatin abundant cytoplasm in ce group large number rough endoplasmic reticulum rer mitochondria glycogen chondrocytes ibp group the perinuclear halo gradually disappeared cell shape irregular chromatin structure obscure number golgi complex rough endoplasmic reticulum reduced shrank structure mitochondria unclear there many microfilament lysosome related organelles cytoplasm group electron density chondrocytes significantly increased many lytic necrosis the structure collagen fiber matrix also became unclear figure 3 the surface articular cartilage became slightly rough focus stress the toluidine blue staining mildly uneven death rats group at 3 6 9 months treatment surgically induced animal model oa ns group ce group showed similar different periods progressive development oa 3 month surface stress concentration area rough double columnar nested chondrocyte hyperplasia observed 6 month superficial layer articular cartilage shed large amount chondrocyte hyperplasia 9 month superficial layer articular cartilage became rougher the chondrocytes ns group decreased chondrocytes ce group slightly decreased group 3 month layer cartilage became thinner appeared villous chondrocytes arranged irregular clusters 6 month changes mentioned progressed chondrocyte necrosis occurred ibp group 9 month thickness articular cartilage became thin deteriorated the expression type ii collagen detected using immunohistochemistry figure 1 shown table 1 3 6 9 months ibp promoted expression type ii collagen inhibited expression chondrocyte apoptosis detected tunel staining figure 2 shown table 2 3 month treatment ce suppressed chondrocyte apoptosis ibp promoted chondrocyte apoptosis especially 6 month treatment ce still inhibited chondrocyte apoptosis ibp significantly increased chondrocyte apoptosis chondrocyte apoptosis maximized 3 month treatment began reduce 9 month treatment ce still inhibited chondrocyte apoptosis taken together ce inhibited chondrocyte apoptosis retained degeneration cartilage ibp promoted chondrocyte apoptosis aggravated degeneration cartilage the shape cells normal integrated nuclear membrane slight aggregated chromatin abundant cytoplasm ce group large number rough endoplasmic reticulum rer mitochondria glycogen chondrocytes ibp group the perinuclear halo gradually disappeared cell shape irregular chromatin structure obscure number golgi complex rough endoplasmic reticulum reduced shrank structure mitochondria unclear there many microfilament lysosome related organelles cytoplasm group electron density chondrocytes significantly increased many lytic necrosis the structure collagen fiber matrix also became unclear figure 3 the pathological changes chemical indicators cartilage rat oa models noted human oa widely used oa research we adopted resection tendon rats decreased cartilage stress side induced instability joint irregularity load conduction resulting degeneration articular cartilage inducing oa the pathological changes 3 6 9 months similar slow pathological development human oa surgically induced oa largely mimics pathological process oa represents ideal platform study early pathological changes associated disease well use study cartilage metabolism response drugs recent vitro vivo data celecoxib shown positive effects cartilage oa 1821 these studies showed celecoxib favorable effects turnover collagen metabolism oa cartilage late oa balance synthesis degradation type ii collagen destroyed amount type ii collagen cartilage matrix markedly decreases study 3 6 9 months treatment ce effect expression type ii collagen oa chondrocytes indicates ce possibly interfere metabolism type ii collagen articular cartilage plays role anti inflammatory analgesics in contrast ibp promotes expression type ii collagen chondrocytes increase synthesis type ii collagen compensates loss type ii collagen oa moreover inhibits expression type ii collagen chondrocytes decreases synthesis type ii collagen restrains metabolism type ii collagen degenerative cartilage accumulating evidences indicates chondrocyte apoptosis may represent important component pathogenesis oa 36 study high frequency chondrocyte apoptosis existed articular cartilage oa chondrocyte apoptosis positively associated degree cartilage matrix damage consistent previous reports 2527 moreover ce suppressed chondrocyte apoptosis retained degeneration articular cartilage ibp promoted chondrocyte apoptosis aggravated degeneration articular cartilage recently showed beneficial effect celecoxib normal cartilage influence il-1 tnf- effects normal healthy cartilage human articular chondrocytes stimulated cytokines il-1 tnf produce high levels chondrocytes cellular components cartilage metabolic activity associated synthesis degradation cartilage matrix the morphology chondrocytes related metabolic activity synthesis proteoglycan study ce promoted number golgi complex rough endoplasmic reticulum enlarged size in long term use nsaids treatment oa ce displays better therapy toleration retained degeneration oa cartilage may ideal choice treatment chronic destructive joint disease

summarybackgroundcelecoxib has a positive effect on human osteoarthritic cartilage , but the mechanisms remain unclear . the aim of this study was to test whether celecoxib could inhibit the apoptosis of chondrocyte and ameliorate type ii collagen synthesis to relieve symptoms of oa ( osteoarthritis).material / methods130 wistar rats were randomly divided into 4 groups as celecoxib ( ce ) , ibuprofen ( ibp ) , indomethacin ( in ) and normal saline group ( ns ) . the osteoarthritis was induced by the excision of the left achilles tendon . at the 3th , 6th , 9th month of treatment , the histological structure of articular cartilage was observed using he staining . type ii collagen was examined using immunohistochemistry . chondrocyte apoptosis was detected by tunel staining , and the change of ultra - microstructure of chondrocyte was examined through a transmission electron microscope.resultsce reduced the oa - like histological changes and suppressed chondrocyte apoptosis . however , in or ibp had deleterious effects on articular cartilage and enhanced the chondrocyte apoptosis . ibp promoted the expression of type ii collagen , and in inhibited its expression , but had no effect in the ce group.conclusionsce had favorable action on oa progression , and may be the ideal choice in the treatment of chronic destructive joint disease where anti - inflammatory drugs need to be used for a prolonged period .

although introduction dopamine agonists management acromegaly opened new doors non invasive approach clinical problem therapy proved wholly satisfactory long term treatment compounds resulted normalization levels plasma growth hormone 30 percent patients the short half life natural somatostatin well rebound hypersecretion growth hormone occurs infusion rendered native peptide impractical therapeutic use the long acting somatostatin analogue sms 201 995 sandoz basel switzerland recently became available clinical use this peptide exerts strong prolonged inhibitory effect growth hormone release without producing rebound hypersecretion natural form application acromegalics a large population patients effects growth hormone release subcutaneous dose 50 g suppressed growth hormone release acromegalics 8 hours kinetic studies sms 201 995 shown plasma half lives intravenous subcutaneous injection agent 43 113 minutes respectively plewe et al reported fall plasma growth hormone concentrations normal nearly normal levels lasted nine hours group subjects acromegaly received single subcutaneous injection 50 g treatment acromegaly dopamine agonists reduce size somatotrophic cell adenomas considered occur rarely comparison frequent shrinkage pituitary prolactinomas treated agents human gh hgh recognized heterogeneous family proteins consisting several molecular forms isohormones the predominant form hgh present plasma 22k accounted approximately 85% immunoreactive hgh approximately 7% minor forms showed 20k this abnormal form hgh might member group pathogenetic controls the treatment logic various medical treatments especially dopamine da agosts somatostatin concerned hypothalamic control hormones growth hormone releasing hormone ghrh somatostatin sms also this implied factors concerning pathogenesis acromegaly single factor compound multiple factors vivo paper report growth hormone response sms 201 995 treatment acromegalics investigate pathogenesis acromegaly via hypothalamic regulatory hormone mediation eight patients acromegaly six women two men aged 27 52 years studied the diagnostic criteria classical clinical findings enlargement extremities characteristic facial appearance excessive perspiration they also radiologic evidence pituitary tumor computed tomography scan elevated fasting growth hormone gh concentration 20 ng ml suppressed less 5 ng ml level oral glucose loading 100 g the clinical chief complaints headache 3 patients weight gain 2 patients arthralgia 2 patients malaise 1 patient blood samples taken hourly 8 a.m. eight hours order check diurnal variation serum gh levels on second day study preparations made patients injected 50 g sms 201 995 8 a.m. baseline blood sampling gh performed hourly 8 hours the patients classified two groups responders non responders depending upon gh responses 50 g sms 201 995 third day study the patients prepared method stimulated 400 g thyrotropin releasing hormone trh blood sampling gh conducted every 30 min two hours determine paradoxical response trh administration fourth day study the patients prepared previous method stimulated 100 g synthetic ghrh blood samples taken every 30 min 2 hours assess stimulatory response ghrh injection positive response single administration sms 201 995 defined 50% suppression gh basal level gh 4 hours time injection 50g sms 201 995 the positive response groups trh ghrh identified twofold increase baseline levels within 60 min stimulation the positive response group diurnal variation designated gh level increased decreased twofold previous gh levels period study the initial response single injection 50 g sms 201 995 showed two patterns i.e. responder non responder patients 1 2 6 8 belonged responder group others belonged non responder group patients 3 4 5 7 the responder group showed gh suppression single injection sms 201 995 lasted six eight hours returned basal gh levels the pattern suppression dramatic ten fold suppression noted every responder the non responder group revealed two patients patients 3 7 similar pattern responder group suppression last 4 hours the two patients patients 4 5 irregular curves gh response suppressed ( fig 1 paradoxical response gh trh stimulation showed 3 4 responders patients 1 2 8) paradoxically responded curve pattern stimulation peaked 30 60 min stimulation one responder patient 6 flat response curve pattern also 3 4 non responders showed responded curve pattern trh stimulation curves monotonous pattern transiently decreased previous value time point 30 60 min patient 5 response sms trh stimulation high levels gh stimulation trh 200 ng ml the gh response ghrh stimulation responder group showed tendency gradually increase time dependent fashion response group conform positive response criteria three patients group noted increasing tendency gh response curve remaining patient showed flat pattern gh curve high level 180 ng ml non responder group two patients group patients 3 4 showed peak levels time 30 min values exceed twice basal levels the two patients group revealed one patient 5 high flat curve 200 ng ml patient 7 low flat curve less 25 ng ml fig 3 responder group one responder patient 2 showed positive pattern gh diurnal curve three satisfy positive criteria but non responder group three patients positive gh patterns 8 hour period study patients 3 4 5 thus responder group sms administration one positive patient non responder group three patients satisfied criteria responsiveness trh ghrh was related responsiveness sms analog diurnal pattern gh morning afternoon closely related sms analog the initial response single injection 50 g sms 201 995 showed two patterns i.e. responder non responder patients 1 2 6 8 belonged responder group others belonged non responder group patients 3 4 5 7 the responder group showed gh suppression single injection sms 201 995 lasted six eight hours returned basal gh levels the pattern suppression dramatic ten fold suppression noted every responder the non responder group revealed two patients patients 3 7 similar pattern responder group suppression last 4 hours the two patients patients 4 5 irregular curves gh response suppressed the paradoxical response gh trh stimulation showed 3 4 responders patients 1 2 8) paradoxically responded curve pattern stimulation peaked 30 60 min stimulation one responder patient 6 flat response curve pattern also 3 4 non responders showed responded curve pattern trh stimulation curves monotonous pattern transiently decreased previous value time point 30 60 min patient 5 response sms trh stimulation high levels gh stimulation trh 200 ng ml the gh response ghrh stimulation responder group showed tendency gradually increase time dependent fashion response group conform positive response criteria three patients group noted increasing tendency gh response curve remaining patient showed flat pattern gh curve high level 180 ng ml non responder group also response ghrh stimulation two patients group patients 3 4 showed peak levels time 30 min values exceed twice basal levels the two patients group revealed one patient 5 high flat curve 200 ng ml patient 7 low flat curve less 25 ng ml fig in responder group one responder patient 2 showed positive pattern gh diurnal curve three satisfy positive criteria but non responder group three patients positive gh patterns 8 hour period study patients 3 4 5 thus responder group sms administration one positive patient non responder group three patients satisfied criteria responsiveness trh ghrh was related responsiveness sms analog diurnal pattern gh morning afternoon closely related sms analog anomalous gh responses trh glucose occur patients acromegaly 25 30% variety diseases healthy adults synthetic purified ovine crh corticotropin releasing hormone specific acth releasing activity gh levels influenced observed paradoxical response gh trh might originate presence dedifferentiated gh receptors gh producing cells acromegalic patients the study circadian regulation gh secretion acromegalics treated surgery showed gh secretion returned normal physiological regulation surgery 3 8 cases bromocriptine therapy induce resumption physiological gh secretion patterns despite fact gh levels significantly reduced although transphenoidal hypophysectomy pituitary microadenomas less 1 cm diameter high probability success diagnosis patients developed macroadenomas cure rate 50% less pituitary radiation rarely leads cure reduction circulating gh levels usually delayed sometimes years many drugs tried almost failed provide continued benefit possible exception da agonist bromocriptine administration drug results therapeutic responses half patients acromegaly although investigators agree therapeutic modalities acromegalics treatment da agonists somatostatin analogs pituitary surgery irradiation etc comparative studies effects somatostatin da agonists release gh acromegaly given conflicting results i.e. effect sms da agonists observed failed show correlation gh lowering effects sms bromocriptine these different study results due different pathogenetic mechanisms gh release acromegalics vitro study injection da third ventricle rats increased release somatostatin portal vessels these results might guess axonal relationship present dopaminergic nerve endings median eminence therefore gh lowering effect observed da infusion might mediated release endogenous somatostatin median eminence moreover vitro studies shown bromocriptine da inhibit release gh pituitary adenomas acromegalic patients other evidence dopaminergic inhibitory action shown infusion da inhibited insulin induced hypoglycemia l dopa stimulated gh release pituitary and/or median eminence level therapeutic aspect newly developed somatostatin analog sms 201 995 this drug suppressed gh levels several hours without rebound hypersecretion gh lambert et al investigated gh lowering effect sms 201 995 acromegalics found clinical biochemical improvement acromegaly sms 201 995 dose 200300 g bid tid this phenomena concerned us tried investigate effect sms 201 995 50 g bid 4 acromegalics unresponsive bromocriptine therapy the results showed continued suppression gh levels improved clinical symptoms 6 months 2 acromegalics but suppressability sms 201 995 variable responsiveness drug differed among patients the paradoxical gh response trh unresponsiveness ghrh reported many acromegalics circadian variation gh also noted acromegalics therefore investigated gh secretory patterns various stimuli circadian rhythm group 4 responders sms 201 995 group 4 non responders the observed results showed correlation gh paradoxical response trh stimulation ghrh stimulation sms 201 995 responsiveness but close correlation observed circadian rhythm gh sms responsiveness sms responder group circadikan rhythm gh our suggested pathogenetic mechanism acromegaly based study revealed figure 5 the mechanism acromegaly traditionally believed originate pituitary secondary effect excessive ghrh defective somatostatin activity hypothalamus if acromegaly originated pituitary would observed circadian rhythm observed circadian rhythm gh 4 patients according possible mechanism acromegaly patients 1 6 8 without circadian rhythm responded sms might mean defect endogenous somatostatinergic activity the relatively increased ghrh activity due defective somatostatin activity might secondary role tumor growth pituitary gland in contrast situation patients presence circadian rhythm gh patients 4 5 7 respond sms these patients might considered normal increased somatostatin levels excessive secretion ghrh might primary event then gh stimulated ghrh affected positive feedback somatostatin activity these serial phenomena may elicit response sms 201 995 also excitable ghrh secretory capacity might occur diurnal variation gh study moreover status continues long time duration predictive tumor begins autonomous character circadian rhythm responsiveness sms might disappear patient 3 it difficult make definitive conclusion pathogenetic mechanism acromegaly due small number participants study logical role concept criticized prospective study models

recently , sms 201 - 995 , a long acting somatostatin analogue , has been used in successful therapy for inhibition of growth hormone ( gh ) levels in acromegaly . but , it was reported that inhibitory and clinical effects in the individual patient were different in many cases . therefore , to find the predictive factor for patients with effective inhibition of gh , we investigated the paradoxical response to thyrotropin releasing hormone ( trh ) , growth hormone releasing hormone ( ghrh ) and diurnal variation of gh secretion between responders and non - responders to sms 201-995.the results were as follows;1 ) responders , patients with suppressive response to sms 201 - 995 , totalled 4 of 8 patients.2 ) the paradoxical response of gh to trh was observed in 3 of 4 responders and 3 of 4 non - responders.3 ) the response of gh to ghrh was not noted in either of the groups.4 ) the diurnal variation of gh secretion showed in one of the responders and in 3 of the non - responders . these results suggested that the absence of diurnal variation of gh secretion was a characteristic feature of responders to sms 201 - 995 and thus diurnal variation of gh secretion could be used as a predictive factor for sms 201 - 995 therapy , and the pathogenetic mechanism of acromegaly might be dependent on the controlled regulation of ghrh and endogenous somatostatin .

potential relevance endothelial activation biomarkers sepsis raised journal others 1 3 biomarkers sepsis associated endothelial glycocalyx remain relatively unknown however commentary attempts reverse omission the term glycocalyx sweet husk introduced 50 years ago describe extracellular polysaccharide coating cells whilst electron microscopy revealed luminal surface endothelium expressed structure thought little consequence functional significance what become increasingly evident however glycocalyx estimated extend 1 endothelial cell membrane represents substantial intravascular compartment contributing significantly vascular wall homeostasis specifically roles glycocalyx include maintenance vascular permeability barrier mediation shear stress dependent nitric oxide production housing vascular protective enzymes example superoxide dismutase wide array coagulation inhibition factors antithrombin protein c system tissue factor pathway inhibitor the glycocalyx also modulates inflammatory response preventing leukocyte adhesion binding numerous ligands including chemokines cytokines growth factors 4 6 negatively charged mesh like structure endothelial glycocalyx comprised glycoproteins proteoglycans glycosaminoglycans gags associated plasma proteins including albumin proteoglycans consisting core membrane bound protein syndecan glypican families attached heparan chondroitin sulphate gag side chains prominent feature hyaluronan nonsulphated uncharged gag water retaining properties attached adsorbed onto cell surface anchored proteins example cd44 helps stabilise glycocalyx structure alteration composition glycocalyx following exposure inflammatory insult one earliest features endothelial activation it accepted tnf oxidised lipoproteins lipopolysaccharide thrombin ischaemia reperfusion hyperglycaemia growth factors cause glycocalyx disruption via action proteases leading either partial degradation release gag side chains severe damage characterised shedding core proteins several studies evaluated circulating levels syndecan-1 gags patients sepsis 10 13 plasma gag levels higher patients septic shock matched controls significantly higher nonsurvivors in study syndecan-1 levels also increased correlated sequential organ failure assessment score additional study 150 patients either severe sepsis septic shock post abdominal surgery without systemic inflammatory response syndrome healthy volunteers significant increases plasma syndecan-1 heparan sulphate observed sepsis surgery groups the highest syndecan-1 levels detected patients sepsis correlated il-6 a study showed greater syndecan-1 levels patients septic shock compared healthy controls together positive correlation vascular adhesion protein-1 day 1 sequential organ failure assessment scores finally hyaluronan levels addition syndecan-1 heparan sulphate shown increase severity sepsis whilst care patients sepsis improved last decade the failure two promising drugs eritoran tetrasodium drotrecogin alfa confer significant reduction mortality suggests novel approaches sepsis research required given fundamental perhaps relatively overlooked role endothelial glycocalyx regulating vascular integrity functions central pathophysiology sepsis identifying interventions aimed protecting repairing might prove promising therapeutic target some clinically established therapies used treatment sepsis glucose control steroid administration also approaches used experimental studies tnf inhibition antithrombin iii infusion albumin avoidance natriuretic peptide release known reduce glycocalyx disruption however drugs might specifically increase synthesis glycocalyx components refurbish glycocalyx selectively prevent protease degradation currently available future endeavours field sepsis research urgently required include components endothelial glycocalyx list biomarkers also consider potential therapeutic targets development new therapies

sepsis is the third largest cause of death in industrialised countries , but treatment remains largely supportive and effective therapeutic interventions are urgently needed . disruption and dysfunction of the microvascular endothelium leading directly or indirectly to multiple organ failure are now recognised to underpin the pathophysiology of sepsis . biomarkers of endothelial activation may therefore assume an important role in guiding future research efforts . we suggest that integral to this approach is the investigation and evaluation of endothelial glycocalyx biomarkers , not only as indicators of the pathogenic process but also to inform the development of pharmacological and other therapies .

aldose reductase ar key enzyme polyol pathway known play important roles cataract formation pathogenesis diabetic complications neuropathy nephropathy retinopathy several naturally occurring synthetic ar inhibitors diverse structures studied experimental animals clinical trials determine effectiveness preventing cataract formation diabetic complications natural products excellent source chemical structures wide variety biological activities the development progression diabetic complications prevented controlling blood glucose difficult maintain normal blood glucose levels diabetic patient ar inhibition recognized important strategy prevention attenuation long term diabetic complications ar inhibitors studied potential therapeutic agents use treating diabetic complications 3 4 apart diabetic microvascular disease advanced glycation end products ages also implicated wide seemingly disparate range pathologies connective tissue diseases particularly rheumatoid arthritis neurological conditions alzheimer disease end stage renal disease vitro work has mostly shown age part complex interactions within oxidative stress vascular damage particularly atherosclerosis accelerated vascular damage occurs diabetes the complex fluorescent age molecules formed maillard reaction lead protein cross linking contribute development progression several diabetic complications cataracts atherosclerosis nephropathy neuropathy increased oxidative stress widely accepted contributor development progression diabetes complications diabetes usually accompanied increased production free radicals impaired antioxidant defenses 7 8 therefore inhibitors ar age formation provide alternative mode diabetes treatment dependent control blood glucose level these inhibitors useful prevention reduction certain diabetic complications prunella vulgaris almost 15 known individual species widely distributed europe asia northwest africa north america generally known self heal herb p. vulgaris used cure high blood pressure headaches lymphatic system disorders goiter tuberculosis tumors 1113 more recently hot water infusion plant used treat sores mouth throat phytochemical studies indicate p. vulgaris contains oleanolic betulinic ursolic 2 3-dihydroxyurs-12-en-28-oic 2 3-ursolic acids triterpenoids flavonoids tannins anionic polysaccharide called prunellin 11 14 the current study aimed evaluate ar age inhibitory p. vulgaris extract these studies important understanding inhibitory effects p. vulgaris diabetic complications dl glyceraldehyde reduced form nicotinamide adenine dinucleotide phosphate nadph bovine serum albumin bsa sodium phosphate quercetin used study purchased sigma st louis mo usa human recombinant aldose reductase purchased wako pure chemical industries osaka japan ric-1021 deposited regional innovation center hallym university republic korea ( 1 kg extracted water 5 l 2 times 2 h 100c the extract suspended distilled water partitioned sequentially n hexane methylene chloride ch2cl2 ethyl acetate etoac n butanol buoh respectively ch2cl2 fraction purified using medium pressure liquid chromatography lichroprep rp-18 glass column 36 460 mm 2540 particle size mobile phase meoh h2o 40 50% flow rate 10 5 ml min resulted isolation compounds 5 10.9 mg 6 13.5 mg since etoac fraction showed ar inhibitory activity fraction 2.2 g purified using medium pressure liquid chromatography lichroprep rp-18 glass column 36 460 mm 2540 particle size ) ; mobile phase meoh h2o 40 50% flow rate 10 5 ml min resulted isolation compounds 1 102.8 mg 2 53.3 mg 3 10.6 mg 4 27.9 mg crude rat lens aldose reductase rar prepared follows lenses removed sprague dawley rats weighing 250280 g frozen 70c use rat lens homogenate prepared according method hayman kinoshita modifications 1517 noncataractous transparent lenses pooled homogenate prepared 0.1 phosphate buffer saline ph 6.2 after centrifugation 10,000 rpm 20 min refrigerated centrifuge supernatant containing rar collected ar activity assayed spectrophotometrically measuring decrease absorption nadph 340 nm 4 min period according method hayman konoshita modifications using dl glyceraldehyde substrate each 1.0 ml cuvette contained equal units enzyme 0.10 sodium phosphate buffer ph 6.2 0.3 mm nadph without 10 mm substrate inhibitor 18 19 concentration inhibitors giving 50% inhibition enzyme activity ic50 calculated least squares regression line logarithmic concentrations plotted residual activity reaction mixtures consisted 0.1 potassium phosphate 0.16 mm nadph 2 mm recombinant human aldose reductase rhar varied concentrations substrate dl glyceraldehyde ar inhibitor total volume 200 l concentrations ranged 0.1 1 mm dl glyceraldehyde 0.1 1 mm active compound recombinant human aldose reductase activity assayed spectrophotometrically measuring decrease absorption nadph 340 nm substrate addition using bio tek power wave xs spectrophotometer bio tek instruments vt usa lenses isolated 10-week old male rats cultured 6 tc-199 medium contained 15% fetal bovine serum 100 units ml penicillin 0.1 mg ml streptomycin sterile conditions atmosphere 5% co2 95% air 37c the lenses divided 5 groups cultured medium containing 5 mm glucose 30 mm galactose rosmarinic acid caffeic acid ethylene ester galactitol determined hplc derivatization reaction benzoic acid fluorescent compound blood sample collected heparin containing polypropylene tube 10-week old male rats sugar sugar alcohol analysis erythrocytes heparinized blood were separated plasma buffy coat centrifuging 2000g 10 min the cells washed thrice normal saline 0.9% nacl 4c final washing cells centrifuged 2000 g 10 min obtain consistently packed cell preparation the packed cells 1 ml incubated krebs ringer bicarbonate buffer ph 7.4 containing 30 mm galactose presence absence samples 37c 5% co2 3 h. erythrocytes washed cold saline centrifuging 2000 g 10 min precipitated adding 6% cold perchloric acid 3 ml centrifuged 2000 g 10 min the supernatant neutralized 2.5 k2co3 4c used galactitol determination hplc analysis sugar sugar alcohol blood performed supernatant red blood cell homogenate benzoylated the modified procedure lee et al followed bovine serum albumin 10 mg ml incubated 5 mm methylglyoxal sodium phosphate buffer 100 mm ph 7.4 all reagent samples sterilized filtration 0.2 membrane filters mixture incubated 37c 7 days the fluorescence intensity measured excitation wavelength 330 nm emission wavelength 410 nm ls50b fluorescence spectrometer perkin elmer ltd the abts diammonium salt 2 mm potassium persulfate 3.5 mm mixed diluted distilled water kept dark room temperature 24 h use after addition abts solution 10 l antioxidant compounds recorded 10 min reaction percentage inhibition absorbance 750 nm calculated potted function concentration antioxidants the constituents dried p. vulgaris extracted water order identify active fractions p. vulgaris the ch2cl2 soluble etoac soluble fractions isolated using medium pressure liquid chromatography their chemical structures elucidated chemical spectral analysis caffeic acid 1 protocatechuic acid 2 p hydroxycinnamic acid 3 rosmarinic acid 4 caffeic acid ethylene ester 5 protocatechualdehyde 6 compounds 2 3 5 isolated first time plant the present study conducted identify new potential rar inhibitors p. vulgaris might potential uses treatment diabetic complications we showed water extract p. vulgaris inhibited activity rar order identify active compounds p. vulgaris extract divided several fractions tested rar inhibitory activity the etoac fraction high inhibitory activity rar ic50 value 2.99 0.10 g ml results shown table 1 previous studies used quercetin positive control comparing inhibitory activity active compounds isolated natural products lens human recombinant aldose reductase 9 30 31 we compared inhibition rar rhar compounds 16 quercetin natural aldose reductase inhibitor compounds 35 ic50 values 8.35 0.51 2.77 0.48 3.2 0.55 respectively ar compounds 4 5 ic50 values 18.62 0.40 12.58 0.32 respectively rhar of compounds tested rosmarinic acid potent rar inhibitory activity caffeic acid ethylene ester showed almost activity concentration compounds isolated p. vulgaris potent inhibitory effects rhar especially caffeic acid ethylene ester determine type inhibition activity produced compounds 4 5 a kinetic study conducted using dl glyceraldehyde substrate concentration 0.11 mm 3 different concentrations compound the lineweaver burk plots 1/velocity 1/concentration compounds 4 5 shown figure 2 changes concentration substrate dl glyceraldehyde resulted different slopes different x axis intersects obtained uninhibited enzyme 3 different concentrations compound the results indicated inhibition type rhar rosmarinic acid 4 caffeic acid ethylene ester 5 noncompetitive showing inhibitor unable bind either substrate binding region nadph binding region rhar we also studied effects compounds 4 5 galactitol accumulation rat erythrocytes lenses table 3 rat lens incubation 6 30 mm galactose resulted increased intracellular accumulation galactitol compounds 4 5 inhibited galactitol accumulation rat erythrocyte almost 35.5 31.7% 5 g ml respectively quercetin positive control inhibited galactitol accumulation rat erythrocyte 30.5% rat lenses almost 36.9 22.5% 5 g ml respectively the etoac fraction high inhibitory activity age ic50 value 141.34 1.27 g ml showing almost activity positive control table 4 inhibitory activity age formation isolated compounds tested using aminoguanidine positive control caffeic acid ethylene ester 5 exhibited potent inhibitory activity age formation ic50 value 33.16 0.54 compared positive control ic50 value 1944.86 8.39 table 5 oxidative stress might key role pathogenesis vascular complications diabetes microvascular macrovascular provides early marker damage development endothelial dysfunction 33 34 abts inhibitory activity isolated compounds tested using trolox positive control p hydroxycinnamic acid 3 strongest inhibitory activity ic50 value 5.94 1.01 caffeic acid ethylene ester 5 also potent inhibitory activity ic50 value 10.52 0.28 compared positive control ic50 value 15.34 0.40 see tables 6 7 the present study isolated six compounds p. vulgaris using medium pressure liquid chromatography among compounds caffeic acid ethylene ester 5 potent ar age inhibitory activity antioxidant specifically compound exhibited potent inhibition age ic50 33.16 0.54 the inhibitory effect compound 58.0-fold stronger positive control aminoguanidine ic50 1944.86 8.39 these results suggest compound p. vulgaris could potentially provide new natural treatment diabetic complications however studies mechanism age action caffeic acid ethylene ester 5 vivo evidence diabetic animals required

to evaluate the aldose reductase ( ar ) enzyme inhibitory ability of prunella vulgaris l. extract , six compounds were isolated and tested for their effects . the components were subjected to in vitro bioassays to investigate their inhibitory assays using rat lens aldose reductase ( rar ) and human recombinant ar ( rhar ) . among them , caffeic acid ethylene ester showed the potent inhibition , with the ic50 values of rar and rhar at 3.2 0.55 m and 12.58 0.32 m , respectively . in the kinetic analyses using lineweaver - burk plots of 1/velocity and 1/concentration of substrate , this compound showed noncompetitive inhibition against rhar . furthermore , it inhibited galactitol formation in a rat lens incubated with a high concentration of galactose . also it has antioxidative as well as advanced glycation end products ( ages ) inhibitory effects . as a result , this compound could be offered as a leading compound for further study as a new natural products drug for diabetic complications .

study design included one group internal comparison intersection acted control comparison number pedestrian motor vehicle collisions per intersection month pcs installation ethics approval study provided ethics review board hospital sick children intersections controlled traffic signals pcs introduced study period january 2000 december 2009 eligible inclusion intersections excluded analysis less 6 months installation traditional traffic signal controlled traffic signal walk phase flashing n't walk phase solid n't walk phase installation pcs this exclusion reduced likelihood measuring novel effects associated installation traffic signal exposure time calculated using number months intersection contributed study period installation pcs the outcome interest frequency reported pedestrian motor vehicle collisions january 2000 december 2009 data extracted motor vehicle collision reports filed toronto police service obtained city toronto transportation services division motor vehicle collision records excluded analysis 1 location code eg intersection mid block missing 2 collision occurred private property parking lot 3 collision occurred traditional signal installed respective intersection 4 collision occurred outside 30-m radius intersection pcs installed 5 collision occurred day pcs installed 6 collision occurred intersection less 6 months installation traditional traffic signal installation pcs age included potential effect modifier determine pcs equally effective pedestrians the following age classes used conduct stratified analysis 015 1659 60 years.22 records missing data age excluded age stratified analysis toronto police services categorise injuries sustained collision five types injury minimal medical attention required minor emergency department treatment major hospital admission required fatal previous research reported police misclassification injury likely associated minor injury.2325 study minimal minor injury categories combined census geography 1996 used geocode collisions occurring either urban inner suburban parts city toronto the inner suburbs recently constructed part city region auto mode share work activities typically higher elsewhere toronto.26 collisions intersections pcs mapped onto city toronto centerline shapefile using latitude longitude coordinates using arcgis arcmap version 10 arcgis used create pcs intersection dataset attach collision data set intersections pcs installation occurred crude incidence rates per 1000 intersection months calculated collisions strata pre post pcs installation poisson regression analysis repeated measures generalised estimating equations used estimate rr 95% ci collisions adjusted clustering predicted pcs status pre pcs post pcs look effect modification separate models fit total age group 015 1659 60 years injury severity classification injury minor minimal major fatal location pre amalgamated toronto inner suburbs models pcs predictor collision counts considered statistically significant p0.05 intersections less 6 months installation traditional traffic signal installation pcs n=113 excluded analysis a total 1965 intersections included analysis 1 january 2000 31 december 2009 23 428 pedestrian motor vehicle collisions toronto collision records missing data location n=2984 collisions occurred parking lot private property n=289 outside 30-m radius intersection pcs eventually installed n=10 486 installation traditional traffic signal n=385 day pcs installation n=3 intersections less 6 months installation traditional traffic signal installation pcs n=19 excluded producing final sample 9262 collisions there 226 records missing data age excluded age stratified analysis the number collisions per year plotted significant secular trend could identified either collisions occurring intersections pcs total pedestrian motor vehicle collisions figure 1 pcs analysis pedestrian motor vehicle collisions toronto canada 20009 reference group pre pedestrian countdown signal pcs intersections base n=1965 intersections location pre amalgamated toronto n=622 intersections inner suburbs n=1343 intersections overall crude incidence rates per 1000 intersection months remained fairly stable pre post pcs installation 40.73 41.30 respectively table 1 when modelled rr 1.014 95% ci 0.958 1.073 indicated significant relationship pcs collisions adjusting clustering the stratified analysis age revealed majority collisions n=6482 72% occurred among adults 1659 years age pre post crude incidence rates per 1000 intersection months similar age group 28.30 29.79 respectively when modelled rr rr 1.038 95% ci 0.972 1.108 revealed effect pcs collisions among age group among vulnerable road users children 015 years age older people 60 years age ) slight decrease crude incidence rates however rr children 015 rr 0.941 95% ci 0.792 1.119 older people 60 years rr 0.967 95% ci 0.844 1.108 indicated significant effect pcs collisions the majority collisions resulted minor minimal injury n=7949 86% crude incidence rates remained similar among pre post pcs periods types injury severity when modelled significant effect pcs seen collisions differing severity injury rr 0.838 95% ci 0.626 1.121 minor minimal rr 1.026 95% ci 0.965 1.090 major rr 0.984 95% ci 0.826 1.173 fatal rr 0.968 95% ci 0.594 1.578 the crude incidence rates location revealed higher rates collisions per intersection pre amalgamated toronto compared inner suburbs time periods however modelled effect pcs either location toronto rr 0.943 95% ci 0.866 1.027 inner suburbs rr 1.042 95% ci 0.967 1.122 intersections less 6 months installation traditional traffic signal installation pcs n=113 excluded analysis from 1 january 2000 31 december 2009 23 428 pedestrian motor vehicle collisions toronto collision records missing data location n=2984 collisions occurred parking lot private property n=289 outside 30-m radius intersection pcs eventually installed n=10 486 installation traditional traffic signal n=385 day pcs installation n=3 intersections less 6 months installation traditional traffic signal installation pcs n=19 excluded producing final sample 9262 collisions there 226 records missing data age excluded age stratified analysis the number collisions per year plotted significant secular trend could identified either collisions occurring intersections pcs total pedestrian motor vehicle collisions figure 1 pcs analysis pedestrian motor vehicle collisions toronto canada 20009 reference group pre pedestrian countdown signal pcs intersections base n=1965 intersections location pre amalgamated toronto n=622 intersections inner suburbs n=1343 intersections overall crude incidence rates per 1000 intersection months remained fairly stable pre post pcs installation 40.73 41.30 respectively table 1 modelled rr 1.014 95% ci 0.958 1.073 indicated significant relationship pcs collisions adjusting clustering the stratified analysis age revealed majority collisions n=6482 72% occurred among adults 1659 years age pre post crude incidence rates per 1000 intersection months similar age group 28.30 29.79 respectively when modelled rr rr 1.038 95% ci 0.972 1.108 revealed effect pcs collisions among age group among vulnerable road users children 015 years age older people 60 years age slight decrease crude incidence rates however rr children 015 rr 0.941 95% ci 0.792 1.119 older people 60 years rr 0.967 95% ci 0.844 1.108 indicated significant effect pcs collisions the majority collisions resulted minor minimal injury n=7949 86% crude incidence rates remained similar among pre post pcs periods types injury severity when modelled significant effect pcs seen collisions differing severity injury rr 0.838 95% ci 0.626 1.121 minor minimal rr 1.026 95% ci 0.965 1.090 major rr 0.984 95% ci 0.826 1.173 fatal rr 0.968 95% ci 0.594 1.578 the crude incidence rates location revealed higher rates collisions per intersection pre amalgamated toronto compared inner suburbs time periods however modelled effect pcs either location toronto rr 0.943 95% ci 0.866 1.027 inner suburbs rr 1.042 95% ci 0.967 1.122 this study found difference pedestrian motor vehicle collision rates installation pcs rates also similar pre post pcs installation collisions stratified age injury severity location similar pulugurtha et al,19 study was restricted collisions occurred signalised intersections pcs eventually installed therefore reasonable explanation findings controlled traffic signals general regardless signal head highly effective reducing number pedestrian motor vehicle collisions,27 addition pcs change overall impact this study also found negative impact pcs collision counts similar findings botha et al.10 work botha et al10 limited small sample size low statistical power short post pcs installation period sample size study addressed concerns the results reported contrast findings work markowitz et al.11 markowitz et al11 reported 52% reduction collisions post pcs installation however finding based analysis nine high collision intersections effect size may partly due regression mean collision history factor present study fact intersections included experience collisions study period pulugurtha et al19 found pcs effective high crash high volume intersections this may explain differences effect size pcs studies pcs appears impact overall city toronto possible effect pcs different places others elements built environment important consider analysing effectiveness pcs location included analysis understand impact pcs urban design many aspects urban design affect pedestrian safety notably vehicle speed determined driver behaviour higher vehicle speeds associated increased risk pedestrian motor vehicle collisions severity pedestrian injury.2831 80% risk pedestrian death estimated vehicle travelling 50 km h.28 possible include reliable data vehicle speed analysis comment road density type within location posted road speed vehicle volumes increase road type hierarchy local roads expressways.32 divided toronto two locations pre amalgamated toronto inner suburbs pre amalgamated toronto includes commercial downtown well higher density residential neighbourhoods pre second world war traditional neighbourhoods whereas inner suburbs include mainly lower residential commercial densities neighbourhoods inner suburbs closer design post war car oriented suburban aesthetic however high density residential neighbourhoods differences locations noteworthy two road types collector roads designed provide access property move traffic 2500 8000 vehicles per day posted speed limits 4050 km h 40 km h common inner suburbs)33 pavements sides road.32 notable difference road density type collector roads 34.55 km/100 000 population inner suburbs compared 19.82 km/100 000 population pre amalgamated toronto major arterial roads primarily designed traffic movement 20 000 vehicles per day posted speed limits 5060 km h pavements sides road sidewalks).32 slightly major arterial roads inner suburbs compared pre amalgamated toronto 29.56 km/100 000 population versus 24.28 km/100 000 population respectively pedestrians pre amalgamated downtown region exposed different built environment compared pedestrians suburbs without detailed area wide measures walking comment exposure per se differences road design control potentially driver behaviour indicate pcs interventions could work differently compared inner suburbs although pcs effective intervention either location likely combined intervention including pcs different different traffic environments it exploratory research study relationship pcs collisions toronto a parsimonious approach taken develop model understand rr pcs collisions these models adjust potential confounders changes pedestrian exposure the use collision rates per intersection month account population differences urban inner suburban areas city toronto this study able account exposure measures related pedestrian vehicle volumes a strength study conducted pulugurtha et al19 inclusion vehicle volume data these data would useful understand secular trends associated walking driving behaviours practices available sufficient detail analysis data quality concerns documented police reported collision data.23 24 34 35 motor vehicle collision reports completed injury therefore likely collisions pedestrians motor vehicles involving injury underrepresented data.35 addition data source limited collisions reported police previous studies conducted usa estimated police reported motor vehicle collision data underestimate number injured pedestrians involved motor vehicle collisions approximately 21%.23 number remains similar among paediatric populations usa 15 years age estimated pedestrian motor vehicle collisions underreported 20%.25 behavioural aspects including changes pedestrian driver actions conditions could captured collision data observational studies examining behavioural changes response pcs important provide insight pcs used road traffic environment make changes improve pcs intervention the city toronto transportation services currently conducting observational study pedestrian behaviour pre post pcs installation the results based controlled intersections pcs installed study period examine collisions occurred adjacent uncontrolled unchanged intersections road segments toronto to understand fully public health impact pcs modification built environment collisions toronto would need analysed outcome measure data 10-year period provided adequate statistical power permitted stratified analyses the use secondary data collected independently intervention prevented bias may influenced previous observational studies observer effects lack blinding the intersections included analysis comprised 95% total eligible intersections representative toronto the repeated measures design one group comparison provided control extraneous variables associated geographical location intersection including factors posted road speed land use mix road type unknown confounders the installation pcs 1965 signalised intersections toronto reduce frequency pedestrian motor vehicle collisions intersections reducing pedestrian motor vehicle collisions intersections requires simply installing pcs other changes lights use might safety benefits example increasing walking times prohibiting drivers turning red lights allowing pedestrian scrum crossings directions cars intersection fundamental changes cities intentionally build pedestrian safety advantages environment pcs may important component future strategies make pedestrians safer cities toronto experience suggest widespread installation pcs alone important benefits pedestrian safety this first population based study describe effectiveness pcs reducing pedestrian motor vehicle collisions 10-year period this study provides evidence installation pcs toronto canada associated reduction pedestrian motor vehicle collisions public health interventions designed create pedestrian friendly cities include additional components pcs alone likely important safety benefits other changes lights use might safety benefits example increasing walking times prohibiting drivers turning red lights allowing more fundamental changes cities intentionally build pedestrian safety advantages environment might increase popularity safety walking pcs may important component future strategies make pedestrians safer cities toronto experience suggest widespread installation pcs alone important benefits pedestrian safety this first population based study describe effectiveness pcs reducing pedestrian motor vehicle collisions 10-year period this study provides evidence installation pcs toronto canada associated reduction pedestrian motor vehicle collisions public health interventions designed create pedestrian friendly cities include additional components pcs alone likely important safety benefits

objectiveto determine whether pedestrian countdown signals ( pcs ) reduce pedestrian motor vehicle collisions in the city of toronto , canada.methodsa quasi - experimental study design was used to evaluate the effect of pcs on the number of pedestrian motor vehicle collisions in the city of toronto , from january 2000 to december 2009 . each intersection acted as its own control . we compared the number of pedestrian motor vehicle collisions per intersection - month before and after the intervention . stratified models were used to evaluate effect modification by pedestrian age , injury severity and location ( urban vs inner suburbs ) . poisson regression analysis with repeated measures ( generalised estimating equations ) was used to estimate the rr and 95% ci.resultsthe analysis included 9262 pedestrian motor vehicle collisions at 1965 intersections . the rr of collisions after pcs installation was 1.014 ( 95% ci 0.958 to 1.073 ) , indicating no statistically significant effect of pcs on collisions . there was no evidence to suggest effect modification between pcs and collisions by age , injury severity or location.conclusionthe installation of pcs at 1965 signalised intersections in toronto did not reduce the number of pedestrian motor vehicle collisions at these intersections .

briefly reveal registry multicenter observational prospective registry involving 55 university affiliated community hospital based pulmonary hypertension centers united states each participating sites received institutional review board approval e table 1 patients pah group 1 pulmonary hypertension venice 2003 definition confirmed right sided heart catheterization enrolled consecutively march 2006 december 2009 providing informed consent analysis evaluated patients with newly diagnosed disease qualifying right sided heart catheterization within 90 days enrollment hemodynamics measured rest patients pulmonary capillary wedge pressure 15 mm hg included first time postenrollment hospitalizations independently reviewed three investigators c. d. b. p. k. l. r. e. s. categorized pah related primarily related pah hereafter referred pah unrelated based information case report forms dates hospital admission discharge primary discharge diagnosis reason hospitalization disease characteristics treatments prior admission secondary diagnoses available determination pah related vs pah unrelated made based primary diagnosis categories pah related hospitalization determined review one categories would constituted pah related hospitalization categories pah unrelated hospitalizations also determined review modifications made afterward cover categories one admission any single discharge diagnosis fit category classified more one category could present given admission situations primary discharge diagnosis determinate hospitalization causality group differences patient demographics disease characteristics determined enrollment tested pearson mantel haenszel tests binary ordinal continuous variables respectively variables highly skewed distributions kaplan meier estimates freedom hospitalization survival computed distinct risk periods 1 full cohort ie hospitalized nonhospitalized patients risk period began enrollment 2 patients first time hospitalization risk period freedom event following hospitalization began hospital discharge 3 patients event free first year follow risk period future follow began 365 days enrollment of 862 patients analysis cohort 490 56.8% least one hospitalization follow study 372 43.2% none fig 1 of 490 first time hospitalizations 257 52.4% causes clearly related pah 214 43.7% pah unrelated causes considered related comorbidity 19 3.9% could characterized pah related unrelated insufficient data fig 1 the median time right sided heart catheterization diagnosis study enrollment 26 days pah pulmonary arterial hypertension pcwp pulmonary capillary wedge pressure reveal registry evaluate early long term pah disease management among 257 patients hospitalized pah related causes congestive heart failure n 81 31.5% placement removal central venous catheter n 63 24.5% two common causes cited admission table 1 other common causes first time hospitalization initial iv line insertion n 30 11.7% represents initiation iv therapy escalation therapy pah n 23 8.9% total 21 pah related hospitalizations 8.2% associated catheter infection 11 occurring first year three second year seven third year later reasons first time hospitalization related unrelated pah reasons mutually exclusive patient could hospitalized one reason includes angina myocardial infarction among 214 patients hospitalized pah unrelated causes non line related infections cited commonly pah unrelated infections n 38 21.1% pneumonia n 34 15.9% table 1 other common diagnoses time first hospitalization surgery procedures n 24 11.2% hemorrhage n 19 8.9% patients hospitalized reason likely patients hospitalized comorbidities diabetes depression severe pah enrollment measured functional class presence pericardial effusion higher mean atrial pressure lower cardiac index higher reveal registry risk score patients hospitalizations also significantly longer follow enrollment patients without hospitalizations table 2 patient demographics disease characteristics enrollment patients 1 hospitalization c includes patients pah related pah unrelated b hospitalizations 6mwd 6-min walk distance bnp brain natriuretic peptide chd congenital heart disease ctd connective tissue disease iqr interquartile range mpap mean pulmonary arterial pressure mrap mean right atrial pressure nyha new york heart association poph portopulmonary hypertension pvod pulmonary veno occlusive disease pvr pulmonary vascular resistance the total number patients cohort data enrollment parameter assumed 257 214 b 471 c 372 unless otherwise noted comparison pah related pah unrelated groups revealed differences enrollment in particular patients pah related hospitalizations less likely patients pah unrelated hospitalizations 18 years age likely severe pah measured functional class lower cardiac index length follow enrollment also shorter pah related group table 2 hospitalization related characteristics similar overall pah related pah unrelated groups notable exception patients pah related hospitalizations likely parenteral therapy functional class iii iv prior hospitalization higher reveal registry risk score prior hospitalization table 3 further description type timing pah related hospitalizations including distribution specific causes hospitalization time provided online supplement e figs 1 2 e table 2 characterization hospitalizations type hospitalization patients 1 hospitalization c includes patients pah related pah unrelated b hospitalizations see table 1 legend expansion abbreviation total number patients cohort data enrollment parameter assumed 257 214 b 471 c unless otherwise noted p value computed using fisher exact test entire analysis cohort 3 years enrollment 45.4% 1.8% patients remained free hospitalization fig 2a among patients hospitalized discharged alive following first hospitalization 25.4% 3.2% patients pah related 31.0% 4.0% patients pah unrelated first hospitalization remained free second hospitalization 3 years postdischarge p .11 fig 2b patients remained hospitalization free 1 year postenrollment 53.7% 2.5% remained free admission additional 3 years follow fig 2c a c kaplan meier estimates freedom hospitalization patients time enrollment b patients first time hospitalization time discharge type hospitalization c patients hospitalization first year follow including patients hospitalizations patients first time hospitalizations occurring first year follow 1 enrollment mortality significantly higher pah related hospitalizations compared pah unrelated hospitalizations 5.4% vs 1.4% p .024 table 3 among discharged alive following first time hospitalization the survival estimate 3 years postdischarge lower patients pah related hospitalization patients pah unrelated hospitalization 56.8% 3.5% vs 67.8% 3.6% p .037 fig 3a among patients remained hospitalization free 1 year postenrollment survival 3 additional years follow 77.8% 1.9% fig 3b a b kaplan meier estimates survival patients first time hospitalization time discharge type hospitalization b patients hospitalization first year follow including patients hospitalizations patients first time hospitalizations occurring first year follow 1 enrollment of 862 patients analysis cohort 490 56.8% least one hospitalization follow study 372 43.2% none fig 1 of 490 first time hospitalizations 257 52.4% causes clearly related pah 214 43.7% pah unrelated causes considered related comorbidity 19 3.9% could characterized pah related unrelated insufficient data fig 1 the median time right sided heart catheterization diagnosis study enrollment 26 days pah pulmonary arterial hypertension pcwp pulmonary capillary wedge pressure reveal registry evaluate early long term pah disease management among 257 patients hospitalized pah related causes congestive heart failure n 81 31.5% placement removal central venous catheter n 63 24.5% two common causes cited admission table 1 other common causes first time hospitalization initial iv line insertion n 30 11.7% represents initiation iv therapy escalation therapy pah n 23 8.9% total 21 pah related hospitalizations 8.2% associated catheter infection 11 occurring first year three second year seven third year later reasons first time hospitalization related unrelated pah reasons mutually exclusive patient could hospitalized one reason includes angina myocardial infarction among 214 patients hospitalized pah unrelated causes non line related infections cited commonly pah unrelated infections n 38 21.1% pneumonia n 34 15.9% table 1 other common diagnoses time first hospitalization surgery procedures n 24 11.2% hemorrhage n 19 8.9% patients hospitalized reason likely patients hospitalized comorbidities diabetes depression severe pah enrollment measured functional class presence pericardial effusion higher mean atrial pressure lower cardiac index higher reveal registry risk score patients hospitalizations also significantly longer follow enrollment patients without hospitalizations table 2 patient demographics disease characteristics enrollment patients 1 hospitalization c includes patients pah related pah unrelated b hospitalizations 6mwd 6-min walk distance bnp brain natriuretic peptide chd congenital heart disease ctd connective tissue disease iqr interquartile range mpap mean pulmonary arterial pressure mrap mean right atrial pressure nyha new york heart association poph portopulmonary hypertension pvod pulmonary veno occlusive disease pvr pulmonary vascular resistance the total number patients cohort data enrollment parameter assumed 257 214 b 471 c 372 unless otherwise noted comparison pah related pah unrelated groups revealed differences enrollment in particular patients pah related hospitalizations less likely patients pah unrelated hospitalizations 18 years age likely severe pah measured functional class lower cardiac index length follow enrollment also shorter pah related group table 2 hospitalization related characteristics similar overall pah related pah unrelated groups notable exception patients pah related hospitalizations likely parenteral therapy functional class iii iv prior hospitalization higher reveal registry risk score prior hospitalization table 3 further description type timing pah related hospitalizations including distribution specific causes hospitalization time provided online supplement e figs 1 2 e table 2 characterization hospitalizations type hospitalization patients 1 hospitalization c includes patients pah related pah unrelated b hospitalizations the total number patients cohort data enrollment parameter assumed 257 214 b 471 c unless otherwise noted for entire analysis cohort 3 years enrollment 45.4% 1.8% patients remained free hospitalization fig 2a among patients hospitalized discharged alive following first hospitalization 25.4% 3.2% patients pah related 31.0% 4.0% patients pah unrelated first hospitalization remained free second hospitalization 3 years postdischarge p .11 fig 2b patients remained hospitalization free 1 year postenrollment 53.7% 2.5% remained free admission additional 3 years follow fig 2c a c kaplan meier estimates freedom hospitalization patients time enrollment b patients first time hospitalization time discharge type hospitalization c patients hospitalization first year follow including patients hospitalizations patients first time hospitalizations occurring first year follow 1 enrollment see figure 1 legend expansion abbreviation in hospital mortality significantly higher pah related hospitalizations compared pah unrelated hospitalizations 5.4% vs 1.4% p .024 table 3 among discharged alive following first time hospitalization survival estimate 3 years postdischarge lower patients pah related hospitalization patients pah unrelated hospitalization 56.8% 3.5% vs 67.8% 3.6% p .037 fig 3a among patients remained hospitalization free 1 year postenrollment survival 3 additional years follow 77.8% 1.9% fig 3b a b kaplan meier estimates survival patients first time hospitalization time discharge type hospitalization b patients hospitalization first year follow including patients hospitalizations patients first time hospitalizations occurring first year follow 1 enrollment the reveal registry represents largest database far patients newly diagnosed pah group 1 analyzed characteristics first time hospitalization the burden disease patients pah substantial evidenced high incidence hospitalization 57% cohort patients newly diagnosed disease prospective reveal registry our findings clearly demonstrate cause hospitalization common among patients newly diagnosed disease particular the rate pah unrelated hospitalizations reveal registry cohort relatively high suggesting term pah unrelated misnomer category hospitalization actually reflects degree risk conferred pah comorbidity for example primary discharge diagnosis pneumonia case report form would result categorization patient hospitalization pah unrelated however pah predisposes patient non line related infections pneumonia infection pneumonia precipitate congestive heart failure one could argue hospitalization truly pah related although 53% patients first time hospitalizations clearly related pah unclear proportion called pah unrelated hospitalizations truly incidental precipitated pah comorbidity extent patients analysis hospitalized reason higher prevalence comorbidities severe pah enrollment measured functional class pericardial effusion mean right atrial pressure reveal registry risk score compared patients without hospitalizations fewer differences enrollment distinguished patients pah related pah unrelated hospitalizations although patients pah related hospitalizations presented severe pah time first admission the lack differences pah related pah unrelated groups enrollment important point given finding hospital postdischarge survival significantly worse patients hospitalized pah related reasons despite similar frequencies pah related pah unrelated hospitalizations occur the worse outcomes seen pah related group despite 46% use parenteral prostanoids time first hospitalization compared 22% pah unrelated group hospital readmission common patients pah especially whose first hospitalization pah related only 25.4% patients discharged pah related hospitalization remained free readmission 3 years later furthermore hospitalization cause increases overall risk death association documented previously even patients hospitalizations first year enrollment almost one half experience least one hospitalization subsequent 3 years despite treatment pah indicating surviving first year hospitalization free strongly relate likelihood future hospitalization mean total hospital days year first admission inclusive first admission patients least one hospitalization 15.3 days median 7.0 days represents significant burden health care system whole individual patients for analysis evaluate burden cost pah related hospitalization one retrospective study estimated total per patient per month costs including inpatient outpatient costs 4,021 patients pah extrapolating figure calculate total costs pah 188 million 2012 assuming prevalence 12.4 cases per million 313.9 million people united states 2012 based attention currently paid left sided heart failure regulatory reimbursement third parties total costs estimated 30 billion united states 2013 one might expect similar emphasis directed pah related hospitalizations particularly heart failure first analysis presented retrospectively determined may limited biases inherent analysis fully prespecified prospectively data collected we chose focus patients newly diagnosed disease minimize survivor bias must noted typically delay 1 month diagnosis enrollment perhaps importantly time first hospitalization patients longer newly diagnosed disease rather results generalized patients discharged first postdiagnosis hospitalization second categorization hospitalization pah related unrelated made based specific retrospective data available case report form 42 cases 16.3% hospitalization causality related pah could determined access full patient charts available time investigator review data for example placement removal central venous catheter may overlap overlap mitigated ensuring category pah unrelated infection excluded ( pah unrelated hospitalization three categories infection considered separately fourth significantly longer period follow patients hospitalizations compared patients without hospitalizations may source bias since likelihood hospitalization event increases time pah associated considerable burden disease measured cause hospitalization patients severely ill ie severe pah multiple comorbidities higher risk cause hospitalization the degree freedom hospitalization poor first hospitalization regardless cause prognosis relatively better patients hospitalizations first year first hospitalization occurring 1 year nevertheless remains poor

background : hospitalization is an important outcome in pulmonary arterial hypertension ( pah ) , shown previously to correlate with survival . using the registry to evaluate early and long - term pah disease management ( reveal registry ) , we sought to characterize first - time hospitalizations and their effect on subsequent hospitalization and survival in patients with newly diagnosed disease.methods:patients with newly diagnosed pah ( n = 862 , world health organization group 1 ) were evaluated for first - time hospitalization . the hospitalizations were categorized as pah related or pah unrelated based on the case report form . categories for pah - related and pah - unrelated hospitalization were defined before independent review . patient demographics and disease characteristics are described as well as freedom from hospitalization and survival.results:of 862 patients , 490 ( 56.8% ) had one or more hospitalizations postenrollment : 257 ( 52.4% ) pah related , 214 ( 43.7% ) pah unrelated , and 19 ( 3.9% ) of undetermined causes . the most common causes of pah - related hospitalization were congestive heart failure and placement / removal of a central venous catheter . patients with pah - related hospitalizations were more likely to receive parenteral therapy , be in functional class iii / iv , and have higher risk scores before hospitalization at enrollment . following discharge , 25.4% 3.2% and 31.0% 4.0% of patients with pah - related and pah - unrelated first hospitalization , respectively , remained hospitalization - free for 3 years ( p = .11 ) . survival estimates at 3 years postdischarge were 56.8% 3.5% and 67.8% 3.6% ( p = .037 ) for patients with pah - related and pah - unrelated hospitalization , respectively.conclusions:in the reveal registry , pah - related hospitalization was associated with relatively more rehospitalizations and worse survival at 3 years.trial registry : clinicaltrials.gov ; no . : nct00370214 ; url : www.clinicaltrials.gov

idiopathic intracranial hypertension iih previously termed pseudotumor cerebri benign intracranial hypertension syndrome increased intracranial pressure icp unknown etiology without clinical laboratory radiological evidence intracranial pathology while exact pathogenesis remains unclear chronic increased icp condition may lead morphological intracranial changes though traditionally performed exclude lesions produce intracranial hypertension imaging recent years has shown detect changes involving orbit sella sinovenous system providing important clues diagnosis we describe case lady chronic headache magnetic resonance imaging mri showed features suggestive iih addition highlight dramatic reversal findings following csf drainage allowing diagnosis made certainty a 45-year old housewife presented neurology outpatient department chronic headache 10 years recent aggravation 1 month though ignored symptoms long hampered daily household activities ophthalmological examination showed 6/6 vision eyes normal fundus visual field defect perimetry saggital oblique images optic nerve revealed distended perioptic subarachnoid space well buckling orbital portion optic nerve figure 1a a partial empty sella postero inferiorly compressed pituitary concave superior border posteriorly displaced infundibulum also noted figure 2a tof venography showed paucity cortical veins non visualization right transverse sinus ts figure 3a lumbar puncture lp done following mr study showed raised opening pressure csf 28 cm water twenty milliliters csf fluid removed sent biochemical microbiological examination normal following csf withdrawal significant improvement symptoms noted repeat mri done 3 days later showed straightening intraorbital optic nerve reduction perioptic subarachnoid space figure 1b in addition restoration infundibular position normal appearing pituitary flat superior margin seen figure 2b mr tof showed improved visualization cortical veins right ts figure 3b the patient discharged acetazolamide follow 2 6 months asymptomatic t2 fat saturated oblique saggital image optic nerve b shows optic nerve buckling prominent perioptic subarachnoid space post lp optic nerve straightens reduction perioptic fluid b saggital images sella show partial empty sella following csf drainage normalized b paucity cortical veins non visualized right transverse sinus reversed following csf drainage distension sinuses better visualization cortical veins b tof venogram possible explanations suggest lesion hematoencephalic barrier increased interstitial fluid increased movement interstitial fluid ventricles equivalent resorption csf subsequent rapid venous efflux maintains flow intracranial fluids allowing raised icp changes observed orbit iih consequence direct transmission raised csf pressure these may appreciated mr imaging prominent perioptic subarachnoid space vertical orbital optic nerve tortuousity additional orbital findings include intraocular protrusion prelaminar optic nerve posterior scleral flattening severe chronic pressure permanent degeneration varying degrees similarly owing progressive rise pressures patients iih sellar changes may seen results arachnocele herniation defect diaphragma sella subsequent pituitary compression posterior infundibular stalk displacement acetazolamide diuretics including furesemide used medical management iih lumboperitoneal shunting may required cases unresponsive medication patients deteriorating vision may need optic nerve sheath fenestration both orbital pituitary changes shown reversibility following csf drainage dramatic flip flop with straightening optic nerve normalization pituitary appearance restoration pituitary stalk position similarly observed patient following lp.cc mr imaging iih may additionally show bilateral ts narrowing may cause venous outflow obstruction whether ts narrowing cause effect still uncertain theories implicated congenital stenosis occasional primary cause iih effect iih stenosis may present either long smooth tapered narrowing attributed cerebral baedema fd raised csf pressures venography patient showed paucity cortical veins pre lp mr improved visualization post lp rohr et al proposed mrv pre- post csf diversion suspected iih patients distinguish reversible fixed transverse sinuses stenosis conclusion mr imaging important role evaluation follow patients iih avoiding repeated lumbar punctures monitor pressures signs iih involving optic nerve posterior sclera pituitary sinovenous system direct consequence longstanding raised icps disease the reversibility signs mr tof venogram following csf drainage confirms diagnosis iih also suggests decrease csf pressure indicating positive response therapy in addition also aids differentiating venous sinus thrombosis reversible stenosis iih

idiopathic intracranial hypertension ( iih ) is a headache syndrome with raised csf pressure in the absence of an intracranial mass lesion . though earlier confined to excluding intracranial lesions , magnetic resonance imaging ( mri ) in recent years has been shown to identify intracranial changes from prolonged raised csf pressure , suggestive of iih . we present the mri and tof ( time - of - flight ) venography findings involving the orbit , sella tursica and cerebral venous structures in a 45-year - old lady with iih and illustrate their reversibility ( flip - flop ) following csf drainage . our case highlights the role of imaging in evaluation and follow - up of patients with iih , without the need for repeated lumbar punctures to monitor pressures .

schizophrenia affecting around 1% population severe disorder involving chronic recurrent psychosis long term deterioration functional capacity 1 the characteristic onset schizophrenia early adulthood lifelong course debilitating symptoms plus high burden caregivers society make one disabling economically catastrophic disorders 1 despite improvement antipsychotic medications main stay treatment patients schizophrenia the symptom response always optimal side effects frequent treatment adherence often poor 2 4 therefore still large number studies ongoing identifying new drugs different classes may effective treatment schizophrenia 2 zinc zn ) is second abundant trace element body iron 5 it essential 300 processes enzymatic catalysis gene transcription gene expression dna replication protein synthesis tissue repair hormonal storage 6 7 it required development brain also function zn deficiency cause neuronal damage 9 11 while zn deficiency reported patients alzheimer disease ad cognitive improvement also demonstrated patients supplementation zn preliminary studies 11 some studies however number also shown efficacy zn improvement attention deficit hyperactivity disorder adhd children adolescents 12 14 antidepressant effects zn also reported number experimental clinical studies 15 16 moreover effects adjuvant zn therapy treatment obsessive compulsive disorder ocd reported well 6 there growing body evidence implicating activation n methyl aspartate nmda receptors pathophysiology schizophrenia 17 18 moreover zn modulate fast excitatory transmission number mechanisms 19 suppress increase extracellular glutamate 19 inhibit nmda receptors 16 it also facilitate release gamma amino butyric acid gaba 6 19 20 evidences gabaergic involvement pathophysiology schizophrenia also discussed several studies 21 23 there also many findings implying cholinergic dysfunction schizophrenia 25 26 one study the concentration zn scalp hair patients schizophrenia significantly lower healthy volunteers 27 reduced serum zn levels also reported patients schizophrenia 28 zinc supplements commonly used alleviate number conditions including zn deficient states diarrhea age related macular degeneration wound healing 5 to best knowledge thus far efficacy zn treatment schizophrenia investigated clinical trials the purpose present study assess efficacy zn sulfate adjuvant therapy treatment schizophrenia 6-week double blind placebo controlled trial this randomized double blind placebo controlled trial undertaken zare psychiatric hospital affiliated mazandaran university medical sciences sari city iran this trial registered iranian clinical trials registry irct registration number 138801241457n3 the trial performed accordance ethical standards laid 1995 declaration helsinki revised edinburgh 2000 all patients legally authorized representatives informed could withdraw experiment time all signed informed consent form prior inclusion study the protocol approved appropriate ethics committee human experimentation mazandaran university medical sciences all participants inpatients active phase disorder met diagnostic statistical manual mental disorders fourth edition text revision dsm iv tr criteria schizophrenia a minimum score 80 positive negative syndrome scale panss required entering study complete blood count liver enzymes creatinine tests plus electrocardiography undertaken baseline in addition urine test performed detect morphine and/or cannabis urine samples patients baseline the exclusion criteria included severe medical conditions e.g. cardiovascular renal hepatic pulmonary metabolic endocrine diseases immune system disorders active peptic ulcer clinically significant neurological disorder current previous history psychiatric disorders schizophrenia current substance use history substance dependency history allergy zn multidrug reaction taking medication study except risperidone trihexyphenidyl lorazepam pregnant lactating women reproductive age without using least one medically accepted mean birth control also excluded three eager enter trial nine patients excluded due different conditions including four history drug dependency two due abnormal liver enzyme levels one due cardiac arrhythmias one blood urine sample another patient skin sensitivity thirty screened patients male female 28/2 age range 18 65 year old met inclusion criteria meet exclusion criteria trial entered study the patients receive antipsychotics week prior entering trial depot antipsychotics least 2 months study risperidone produced sobhan pharmaceutical company administered patients standard antipsychotic treatment it started 1 mg twice daily titrated 6 mg day patients week participants randomly allocated two equal groups n 15 one group received risperidone 6 mg day plus capsules zn sulfate 220 mg containing 50 mg elemental zn three times day another group received risperidone 6 mg day plus identical placebo capsules three times day 6 weeks placebo capsules prepared pharmaceutical sciences laboratory pharmacy school mazandaran university medical sciences patients also received trihexyphenidyl faced extrapyramidal symptoms received lorazepam case agitation insomnia the panss applied assess psychotic symptoms baseline week 2 4 6 study trained third year resident psychiatry the panss common scale assessment schizophrenia including 30 items measures positive negative symptoms well general psychopathology means semistructured patient interview intensity item identified scoring 1 7 manner severe symptoms get higher scores 29 the panss supplemental aggression risk subscale also used evaluate aggression risk patients times panss applied 30 mean decrease panss score baseline there significant difference psychotic symptoms two groups patients according panss scores baseline p 0.05 we aware zn sulfate possible side effects looking patients so far side effect zn sulfate reported occur significantly placebo metallic taste 14 31 gastrointestinal discomfort nausea vomiting abdominal pain diarrhea also reported rate placebo 14 31 skin dermatitis caused zn element dental fillings reported 32 present study side effects reported either patients nurses psychiatric ward recorded only one patient zn sulfate group withdrew trial due generalized maculopapular reaction eligible participants stratified based age 25 25 45 45 years old gender male female subtype schizophrenia paranoid nonparanoid then 1:1 ratio using computer generated code patients assigned receive either zn sulfate placebo person administrated medications panss rater patients blind assignments for descriptive analysis data statistical indicators like mean standard deviation sd used repeated measure analysis variance anova time treatment interaction used assess effects treatment two groups considered subjects factor four measurements treatment considered within subjects factor time this done positive negative general psychopathology subscale total panss supplemental aggression risk scores california usa used analyze graph present scientific data differences p this randomized double blind placebo controlled trial undertaken zare psychiatric hospital affiliated mazandaran university medical sciences sari city iran this trial registered iranian clinical trials registry irct registration number 138801241457n3 the trial performed accordance ethical standards laid 1995 declaration helsinki revised edinburgh 2000 all patients legally authorized representatives informed could withdraw experiment time all signed informed consent form prior inclusion study the protocol approved appropriate ethics committee human experimentation mazandaran university medical sciences all participants inpatients active phase disorder met diagnostic statistical manual mental disorders fourth edition text revision dsm iv tr criteria schizophrenia a minimum score 80 positive negative syndrome scale panss required entering study complete blood count liver enzymes creatinine tests plus electrocardiography undertaken baseline in addition urine test performed detect morphine and/or cannabis urine samples patients baseline the exclusion criteria included severe medical conditions e.g. cardiovascular renal hepatic pulmonary metabolic endocrine diseases immune system disorders active peptic ulcer clinically significant neurological disorder current previous history psychiatric disorders schizophrenia current substance use history substance dependency history allergy zn multidrug reaction taking medication study except risperidone trihexyphenidyl lorazepam pregnant lactating women reproductive age without using least one medically accepted mean birth control also excluded three eager enter trial nine patients excluded due different conditions including four history drug dependency two due abnormal liver enzyme levels one due cardiac arrhythmias one blood urine sample another patient skin sensitivity thirty screened patients male female 28/2 age range 18 65 year old met inclusion criteria meet exclusion criteria trial entered study the patients receive antipsychotics week prior entering trial depot antipsychotics least 2 months study risperidone produced sobhan pharmaceutical company administered patients standard antipsychotic treatment it started 1 mg twice daily titrated 6 mg day patients week participants randomly allocated two equal groups n 15 one group received risperidone 6 mg day plus capsules zn sulfate 220 mg containing 50 mg elemental zn three times day another group received risperidone 6 mg day plus identical placebo capsules three times day 6 weeks placebo capsules prepared pharmaceutical sciences laboratory pharmacy school mazandaran university medical sciences patients also received trihexyphenidyl faced extrapyramidal symptoms received lorazepam case agitation insomnia the panss applied assess psychotic symptoms baseline week 2 4 6 study trained third year resident psychiatry the panss common scale assessment schizophrenia including 30 items measures positive negative symptoms well general psychopathology means semistructured patient interview intensity item identified scoring 1 7 manner severe symptoms get higher scores 29 the panss supplemental aggression risk subscale also used evaluate aggression risk patients times panss applied 30 mean decrease panss score baseline there significant difference psychotic symptoms two groups patients according panss scores baseline p 0.05 we aware zn sulfate possible side effects looking patients so far side effect zn sulfate reported occur significantly placebo metallic taste 14 31 gastrointestinal discomfort nausea vomiting abdominal pain diarrhea also reported rate placebo 14 31 skin dermatitis caused zn element dental fillings reported 32 present study side effects reported either patients nurses psychiatric ward recorded one patient zn sulfate group withdrew trial due generalized maculopapular reaction eligible participants stratified based age 25 25 45 45 years old gender male female subtype schizophrenia paranoid nonparanoid then 1:1 ratio using computer generated code patients assigned receive either zn sulfate placebo the assignments kept sealed opaque envelopes data analysis throughout study a person administrated medications panss rater patients blind assignments for descriptive analysis data statistical indicators like mean standard deviation sd used repeated measure analysis variance anova time treatment interaction used assess effects treatment two groups considered subjects factor four measurements treatment considered within subjects factor time this done positive negative general psychopathology subscale total panss supplemental aggression risk scores graphpad prism software version 5 graphpad software inc california usa used analyze graph present scientific data differences p from total 42 patients screened study 30 cases randomly allocated two groups trial medication 15 patients group figure 1 no significant difference found patients randomly assigned zn placebo group regarding basic demographic data including age gender marital status level education subgroup schizophrenia table 1 the mean standard deviation positive symptoms scale negative symptoms scale general psychopathology scale total panss score supplemental aggression risk subscale two groups patients shown table 2 there significant differences two groups week 0 baseline positive symptoms panss p 0.55 negative symptoms panss p 0.62 general psychopathology panss p 0.69 panss total score p 0.48 moreover significant difference two groups baseline regarding risk aggression p 0.12 the differences two groups positive scale negative scale general psychopathology scale total panss score panss supplemental aggression risk subscale scores demonstrated figures 2 6 respectively p 0.007 p 0.001 p 0.040 different control groups significant p 0.002 p 0.020 different control groups significant p 0.001 p 0.033 different control groups significant p 0.002 p 0.001 different control groups significant from total 42 patients screened study 30 cases randomly allocated two groups trial medication 15 patients group figure 1 no significant difference found patients randomly assigned zn placebo group regarding basic demographic data including age gender marital status level education subgroup schizophrenia table 1 the mean standard deviation positive symptoms scale negative symptoms scale general psychopathology scale total panss score supplemental aggression risk subscale two groups patients shown table 2 there significant differences two groups week 0 baseline positive symptoms panss p 0.55 negative symptoms panss p 0.62 general psychopathology panss p 0.69 panss total score p 0.48 moreover significant difference two groups baseline regarding risk aggression p 0.12 the differences two groups positive scale negative scale general psychopathology scale total panss score panss supplemental aggression risk subscale scores demonstrated figures 2 6 respectively p 0.007 p 0.001 p 0.040 different control groups significant p 0.002 p 0.020 different control groups significant p 0.001 p 0.033 different control groups significant p 0.002 p 0.001 different control groups significant schizophrenia estimated 8th leading cause disability adjusted life years worldwide age group 15 44 years 1 it characterized diverse range symptoms including positive symptoms hallucinations delusions negative symptoms social withdrawal diminished affective responsiveness cognitive deficits 33 its treatment involves combination psychosocial rehabilitation pharmacotherapy 3 despite improvement antipsychotics treatment schizophrenia thus several studies ongoing identifying drugs different classes dopamine antagonists may enhance response antipsychotics may even efficacy monotherapy 2 17 34 the results obtained present trial demonstrate adding zn atypical antipsychotic regimen effective improvement symptoms schizophrenia risk aggression patients schizophrenia both studied groups treated risperidone 6-week trial showed significant improvement panss total score subscales well supplemental aggression risk subscale the zn group significantly greater improvement total score panss positive negative symptoms risk aggression 6-week trial baseline characteristics patients including sex age marital status level education subgroup schizophrenia differ groups thus explain differences therapeutic outcome best knowledge this study first double blind placebo controlled clinical trial investigating efficacy zn treatment schizophrenia complementary medicines trace element supplements assumed proper candidates investigation chronic psychiatric disorders due lower risk side effects well better acceptance among people 35 zinc essential trace element body 6 7 required development brain also function 9 11 far positive effects supplemental zn depression 15 36 37 ocd 6 adhd 14 31 ad 11 reported studies best knowledge report kinetic interactions zn sulfate risperidone this leads us assume therapeutic effect observed zn sulfate symptoms schizophrenia likely result pharmacodynamic mechanism it reported zn serves endogenous neuromodulator several important transmitters 19 role used explaining mechanism action improvement schizophrenia there growing body evidence implicating glutamatergic system pathophysiology schizophrenia 4 17 18 38 along studies reporting efficacy nmda receptor allosteric agonists glycinb site schizophrenia 4 scientists hypothesized possible efficacy nmda antagonists disorder 4 39 a preliminary study even shown probable efficacy memantine noncompetitive nmda antagonist improvement schizophrenia 39 also zn modulate fast excitatory transmission number mechanisms 19 it suppresses increase extracellular glutamate 19 inhibits nmda receptors 16 an ex vivo study suggested low affinity nmda receptor antagonists might even interact dopamine receptors binding dopamine transporters 40 evidences gabaergic involvement pathophysiology schizophrenia also discussed several studies 22 23 however recent meta analysis find significant therapeutic benefits addition benzodiazepines antipsychotic regimen schizophrenic patients 41 small preliminary randomized trial selective benzodiazepine acting gabaa receptor improved working memory patients schizophrenia 22 although similar investigation greater sample size showed little benefit prodrug receptor remains promising target 42 moreover zn facilitates release gaba 6 19 20 may improve symptoms schizophrenia via mechanism there also many findings implying cholinergic dysfunction schizophrenia 25 26 43 two preliminary studies a cholinergic nicotinic partial agonist 25 muscarinic cholinergic agonist 43 showed efficacy improving symptom scores cognition patients schizophrenia results line the impact zn improvement negative symptoms schizophrenia also due antidepressant implications reported previous studies 15 36 37 zinc also antioxidant properties 5 8) considered another explanation effectiveness schizophrenia there studies reporting increased production reactive oxygen decreased antioxidant protection patients schizophrenia strengthen hypothesis suggesting role excessive free radical production oxidative stress pathophysiology disorder 33 one study the concentration zn scalp hair schizophrenic patients significantly lower healthy volunteers 37 reduced serum zn levels also reported patients schizophrenia 28 however extracellular zn concentration may good indicator zn concentration body 19 study adding zn risperidone effective reducing aggression a study demonstrated mean plasma zn values significantly lower criminal schizophrenic men compared noncriminal subjects 44 another study also reported blood copper zn ratios assaultive young males high compared control group young males history assaultive behavior 45 administration 220 mg zn sulfate three times day well tolerated major clinical side effects detected however due lack systematic recording side effects trial considered shortcoming study may missed side effects neither reported patients observed nurses limitations present study include using one dose zn sulfate small number participants short period follow lack plasma zn concentration indicate need future studies line hypothesis adding zn atypical antipsychotic particularly effective improvement positive negative symptoms subscales panss general psychopathology subscale total score panss well risk aggression patients schizophrenia

background : zinc can modulate fast - excitatory transmission , facilitate the release of amino butyric acid and potentiate nicotinic acetylcholine receptors . there are also emerging evidences discussing the implication of these neurotransmitters in pathophysiology of schizophrenia.objectives:the purpose of this study was to evaluate the efficacy of zn sulfate as an add - on therapy in the treatment of schizophrenia in a 6-week , double - blind and placebo - controlled trial.patients and methods : eligible participants were 30 inpatients with schizophrenia according to the diagnostic and statistical manual of mental disorders , fourth edition , text revision criteria . patients were randomly allocated into two equal groups ; one group of patients received risperidone 6 mg / day plus capsules of zn sulfate ( each containing 50 mg elemental zn ) three times a day and another group received risperidone 6 mg / day plus placebo . the positive and negative syndrome scale ( panss ) was applied to assess the psychotic symptoms and aggression risk at baseline , week 2 , 4 , and 6 of the study.results:the results of this study showed that both protocols significantly decreased the scores on all subscales of the panss and supplemental aggression risk subscale as well as panss total score over the study . however , this improvement was significantly higher in zn sulfate receiving group compared to the placebo group . no major clinical side - effects were detected.conclusions:it may be concluded that zn is an effective adjuvant agent in the management of patients with schizophrenia .

findings reported draw answers questions added two major cohort studies hiv positive people ontario ontario hiv treatment network cohort study ocs http://www.ohtncohortstudy.ca/ n 959 positive spaces healthy places cohort study pshp http://www.pshp.ca/ n 442 plus depth qualitative interviews 122 ocs participants drawing three data sources allows broad representation people living hiv accord epidemiology hiv prevalence ontario measured risk group age gender sexual orientation ethno cultural origin 122 interviews 8 conducted french ottawa rest english toronto n 93 ottawa n 21 83% hiv positive people ontario live ten interviews people kind direct experience criminal justice system either complainants defendants including convicted charges related non disclosure exposure hiv former sex partners contacted police testimony hiv related trials the cohort surveys asked study participants expectations casual sexual partners disclose disclosure practices partners well the pattern response analyzed variation range demographic categories age ethnicity language interview income education sexual orientation gender well casual sexual partner previous three months a subset ocs study participants broadly representative demographics hiv prevalence ontario invited interviewed gain insight perceptions disclosure expectations responsibilities questions asked recent sexual interactions circumstances leading non)disclosure well subsequent specific question lot debate people responsibility disclose hiv status do think circumstances someone hiv charged crime perhaps sent prison oral sex without condom without telling ? b unprotected vaginal anal sex without telling sexual partners hiv beforehand c unprotected sex undetectable viral load ? interviews transcribed examined common themes using constant comparative analysis nvivo software the study proposal reviewed accord tri council policy statement ethical conduct research involving humans research ethics boards university windsor university ottawa a community advisory committee representatives hiv positive people aids service legal organizations plus provincial ministry health assisted development research project an honorarium 30 provided interview participants recognition time travel expenses overall study participants three data sources following demographic characteristics shown table 1 questions added two large cohort studies show expectations people living hiv regarding disclosure sexual partners partners disclosure table 2 since ocs study participants could check one rationale regarding decision disclose pattern multiple responses also examined the frequent overlap responses 15 indicated necessary tell partner protected sex also checked tell partners hiv positive others statistical analysis pearson pshp data reveals variation attitudes practices different populations overall 18.3% expect sexual partner disclose hiv status varies sexual orientation gay men less expectation 26.7% followed bisexual men 23.1% heterosexual men 10.0% finally heterosexual women greatest expectation sexual partners disclose 5.1% p .015 the ocs data show similar pattern even higher numbers gay men expecting disclosure gay men 40.2% bisexual men 27.6% heterosexual men 11.5% heterosexual women 10.7% this variation evident ethnicity greater proportion african caribbean aboriginal populations female heterosexual compared white study participants the expectation sexual partners disclose 20.3% among white people 11.1% among african caribbean people 8.9% among aboriginal people p .048 ocs the comparable numbers 33.3% among white people 17.0% among african caribbean people 25.0% among aboriginal people p .01 hiv negative partners partners unknown hiv status 44.7% pshp respondents told partners hiv positive 32.4% partners type 48% ocs respondents report partners hiv negative unknown status 1 9% report alternative strategies disclosure including telling partners telling partners dropping hints hiv status others feel unnecessary tell protected sex partners presume everyone positive partner willing unprotected sex partner responsibility use condom wants 3 6% unemployed respondents pshp cohort likely disclose 10.3% p .008 drop hints 8.5% p .016 feel disclosure unnecessary protected sex 15.4% p .009 afraid disclose 21.4% p .003 gay bisexual men little likely disclose partners bisexual 19.2% gay 11.3% p .020 drop hints gay 7.2% p .047 feel disclosure unnecessary protected sex 12.0% p .031 compared without casual partners respondents casual partners likely tell partners 13.9% p .0001 feel unnecessary disclose protected sex 16.4% p .0001 feel unnecessary disclose partner presume everyone positive 8.0% p .002 partner willing unprotected sex 5.5%,p .013 partner responsibility use condom 7.5% p .0001 this finding comparable recent study british columbia found lower rates disclosure among reporting sex stranger hirsch allen et al 2014 most hiv positive people survey either disclose partners hiv negative unknown status non disclosure strategies assumptions reported relatively small sets people variation according employment status sexual orientation gender ethnicity casual partner how disclosure strategies work everyday life revealed interviews context conflicting dynamics create situations prove difficult navigate several people articulate double bind created obligation disclose fear rejection leading emotionally fraught choices deciding disclose one interviewee prosecuted non disclosure reflects tension inherent disclosure decisions.i went depression totally alone i nt remember many women number women many years nt tell well found positive hard disclose i felt told anybody would judged nobody would want close it took couple years program realize selfish move i afraid going lose nt want tell i nt know tell nt want afraid told walk away never see would lose nt trying get sick like trying get infected anything i nt remember many women number women many years nt tell well found positive hard disclose i felt told anybody would judged nobody would want close it took couple years program realize selfish move i afraid going lose nt want tell i nt know tell nt want afraid told walk away never see would lose nt trying get sick like trying get infected anything ( 041 african caribbean heterosexual male 40s others experience disclosure obligation runs tacit norm silence around hiv questions times disclosed asked flat positive negative? tell often discussed guys nt want talk whether positive negative it kind kills romance sort kind hotness potential getting together ( 013 white gay male 50s far see people talked say 99.9% people never tell anyone positive unless asked ( 011 white gay male 50s times disclosed asked flat positive negative? tell often discussed guys nt want talk whether positive negative it kind kills romance sort kind hotness potential getting together ( 013 white gay male 50s far see people talked say 99.9% people never tell anyone positive unless asked ( 011 white gay male 50s result tendency engage tacit dance assumptions intuitions along reading context order assess viability disclosure personal interactions.the last time bathhouse situation although nt exchange words situation kind knew coming ( 006 african caribbean gay male 40s last time bathhouse situation so already bit connection although nt exchange words situation kind knew coming ( 006 african caribbean gay male 40s considerable effort may go testing waters determine understanding person may one study participant describes disclosure process one feeling siege context disclosure may elicit stigmatizing reaction.the whole night talked fashion cares hiv act aids committee toronto outreach ( like much possible without saying infer might sound like beating around bush really kind like mean fucking write forehead real ? i probably told wary nt know sometimes chatting somebody kind drop hints nt seem pick walk away say well nt think person positive know going leave people hiv discussions also feel siege maybe less likely bring things look totally anonymous sex even name asked ( 078 white gay male 40s whole night talked fashion cares hiv act aids committee toronto outreach ( like much possible without saying infer ) it might sound like beating around bush really kind like mean fucking write forehead real 054 white gay male 50s ) i probably told wary nt know sometimes chatting somebody kind drop hints nt seem pick walk away say well nt think person positive know going leave people hiv discussions also feel siege maybe less likely bring things look totally anonymous sex even name asked ( 078 white gay male 40s reading situation especially gay context men presumed largely know hiv issues lead inference may also hiv positive man cautious disclosing.if someone wants something unprotected big signal it someone telling pause action verbally hiv ( 022 white gay male 40s)from gay perspective know generally know nt ask nt ask given hiv going probably unprotected sex if says play wrapped respect play wrapped ( 069 white gay male 40s someone wants something unprotected big signal it someone telling pause action verbally hiv ( 022 white gay male 40s gay perspective know generally know nt ask nt ask given hiv going probably unprotected sex says play wrapped respect play wrapped ( 069 white gay male 40s sometime tacit assumptions lead misunderstanding perception outright deception reported individuals circumstance led exposure hiv asked ever tested like phrasing would used clean? went got tests done like i too. fuck nt know mean nt ( come back say good ) i good want trying go like motions like going monogamous relationship ( 073 white queer female 20s)i went standard blood work required insurance company said well hiv positive, said impossible playing around two people one partner four years one friend i found knew telling everybody nt ( 018 white gay male 40s asked ever tested like phrasing would used clean? went got tests done like i too. fuck nt know mean nt ( come back say good ) i good want trying go like motions like going monogamous relationship ( 073 white queer female 20s went standard blood work required insurance company said well hiv positive, said impossible playing around two people one partner four years one friend i found knew telling everybody nt ( 018 white gay male 40s interviewed study point toward number circumstances factors make routine disclosure complex emotionally difficult accomplishment perhaps fundamental difficulty setting oneself rejection process seeking affection support some perceive required rupture norm silence least feel obliged ease prospective partners realization may positive disclosure undertaking fraught emotional pitfalls complicated personal histories misread cues felt deceived leading sero conversion negotiate stigmatized status new people.whenever tell somebody person run away creates huge problem ( 023 latin american heterosexual male 50s)i raised certain way got infected age 18 15 years deal 15 years dumped disclosed guys nt want you know hurts damn well hurts know ( 055 white gay male 30s whenever tell somebody person run away creates huge problem ( 023 latin american heterosexual male 50s raised certain way got infected age 18 15 years deal 15 years dumped disclosed guys nt want know hurts damn well hurts know some seek resolve disclosure problems pursuing hiv positive people sexual romantic connection time good many express reluctance unprotected sex even hiv positive people adam husbands murray maxwell 2005).my strain might totally different strain may pick strain may cause ill effects may produce rather nasty new strain capable passing vice versa may hell impact drug regimen ( 002 white gay male 60s)i wo nt infect hiv certainly nt want get infected hiv if go medication point nt want immune it pisses know hiv positive infecting person person person know ( 015 white gay male 40s)if sex somebody positive nt want kind virus strain ( 030 african caribbean heterosexual male 30s strain might totally different strain may pick strain may cause ill effects may produce rather nasty new strain capable passing vice versa may hell impact drug regimen ( 002 white gay male 60s wo nt infect hiv certainly nt want get infected hiv go medication point nt want immune it pisses know hiv positive infecting person person person know ( 015 white gay male 40s sex somebody positive nt want kind virus strain ( 030 african caribbean heterosexual male 30s others believe sex partner also hiv positive safer sex less concern experience sense relief longer feel like pariah.i got mixed bit crystal meth problem met there whole community guys disability never worked nt seem want work i think part many years drummed head got safe sex, suddenly whole group people nt feel like pariah everybody fine unprotected sex ( 020 white gay male 40s)i admit fairly flexible accommodating person wishes go barrier free it probably reflective fact condoms nt terrible amount fun guilty guess happy go along ( 042 white gay male 30s)online already posted so but generally clarify like way positive. hiv positive person open using condoms choice going fight ( 089 asian gay male 20s got mixed bit crystal meth problem met there whole community guys disability never worked nt seem want work i think part many years drummed head got safe sex, suddenly whole group people nt feel like pariah everybody fine unprotected sex ( 020 white gay male 40s admit fairly flexible accommodating person wishes go barrier free it probably reflective fact condoms nt terrible amount fun guilty guess happy go along ( 042 white gay male 30s online already posted time read sometimes havent but generally clarify like way positive. hiv positive person open using condoms choice going fight ( 089 asian gay male 20s pressure disclose produces disparate array effects everyday interaction heightened fear rejection makes disclosure even harder accomplish indirect partial disclosure readings tacit signs assumptions partners sero statuses avoidance need disclose pursuing hiv positive partners many study participants reflect meaning responsibility hiv exposure transmission many their sense responsibility consistent larger societal rhetoric individualism personal responsibility consenting adults contractual interaction moral reasoning widely propagated government business today constructs everyone self interested individual must take responsibility marketplace risks adam 2005).im adult adult you take responsibility give something fault sex finding ( 011 white gay male 50s)when people sex always protect you responsible nt understand charged ( 017 aboriginal gay male 40s)you take responsibility life place we ca nt nanny state everything perfect mentally incapable raped forced nobody bending arm you sex want sex taking care ? ( 021 white gay male 50s adult adult you take responsibility give something fault sex finding ( 011 white gay male 50s people sex always protect you responsible nt understand charged ( 017 aboriginal gay male 40s take responsibility life place we ca nt nanny state everything perfect mentally incapable raped forced nobody bending arm you sex want sex taking care ? ( 021 white gay male 50s many men interviewed articulated strong sense individual obligation responsibility conceived exclusively primarily problem falling hiv positive people responsibility health.its personal choice choose you live consequences decisions right way look ( 024 african caribbean gay male 40s)i nt think onus person positive necessarily person knows positive ( 054 white gay male 50s)you know decisions take responsible decisions i impose thoughts anybody nt go prison it person force person say put condom. f14 white gay male 30s translated french you live consequences decisions right way look ( 024 african caribbean gay male 40s nt think onus person positive necessarily person knows positive ( 054 white gay male 50s know decisions take responsible decisions i impose thoughts anybody nt go prison person force person say put condom. f14 white gay male 30s translated french it noteworthy male voices strongly represented constructions self autonomous male actor responsible protecting hiv many ways dominant discourses circulating neoliberal societies provide moral precepts rationales individualized constructions responsibility preclude need disclosure notions consistent longstanding messaging safe sex aids service organizations treat prospective sex partners potentially hiv positive others express sense responsibility embedded collective interpersonal loyalties rather individualism.i shame whatsoever i open first thing tell anybody ask fine mention i mention fact gay mention fact hiv positive the positive person responsible one 100% person maybe 50 70% negative person responsibility ( 016 white gay male 60s)what shocked fact somebody would sex another person without letting know hiv possibility transmission i lover 46 years still sex he hiv hep c. way transmission whatever fluids even though counts hiv undetectable last 8 10 years hep c supposedly zero the fear passing something unknowingly knowingly become part life ( 001 white gay male 60s shame whatsoever i open first thing tell anybody ask fine mention i mention fact gay mention fact hiv positive the positive person responsible one 100% person maybe 50 70% negative person responsibility ( 016 white gay male 60s shocked fact somebody would sex another person without letting know hiv possibility transmission i lover 46 years still sex he hiv hep c. way transmission whatever fluids even though counts hiv undetectable last 8 10 years hep c supposedly zero the fear passing something unknowingly knowingly become part life ( 001 white gay male 60s tension individualized collective notions responsibility circulates number narratives reflecting lineaments moral reasoning larger society rangel adam 2014 constructions self individual actors marketplace risk co exist sexual etiquette developed gay communities throughout aids era care self safer sex weeks 1995 casual sexual encounters partners may well known marketplace presumptions come fore sexual field green 2014 characterized brevity anonymity combined difficulties disclosure individualized notions responsibility may gain upper hand as court cases acquired extensive media attention last decade coverage turn influenced general public risk populations hiv positive people the result feedback loop accelerating 2000s criminal prosecutions failure disclose hiv status generated publicity implicitly instructed public respond hiv one participant study testifies thatmy ex charged found guilty ( charged really like police put head charge kind like weird fucked ( 073 white queer female 20s ex charged found guilty charged really like police put head charge kind like weird fucked ( 073 white queer female 20s official agencies like police public health put mind prosecute criminalization rises status primary response hiv transmission rather recourse last resort time increasing reliance criminal justice system enforce principle near universal disclosure hiv positive status even transmission unlikely presses hiv positive people untenable double bind must place risky position heightening possibility rejection stigmatization prosecution double binds constitute shaky foundation consistent practice effective public policy interviews people living hiv show examination everyday disclosure decisions shows range incommensurable rationalities shape decisions personal ethics morality ethical precepts circulating larger society fear rejection degree intimacy partners capacity self assertion factors disclosure dynamics this turn leads ways notions responsibility figure reflections people living hiv the gap everyday practices situations one hand rational deterrence presumptions criminal justice proceedings point towards ways criminalization hiv may work cross purposes effective hiv prevention perhaps paradoxically elevation disclosure strategy hiv prevention courts media coverage shifts perceptions negotiations hiv management ways may actually undermine effective hiv prevention making disclosure feel risky hiv positive people becomes act subject legal scrutiny as well may create generalized expectation hiv positive people always disclose therefore condom use unnecessary non disclosure comes signify hiv negative status obscured criminalization trends fact protected sex especially situation treatment succeeded attaining undetectable viral load hiv positive partner continues much reliable method avoiding hiv well several sexually transmitted infections disclosure the elevation disclosure primary strategy hiv prevention exerts increasing pressure double bind relied result decreased hiv risk may divert attention undermine safe sex practice

responses to the largest surveys of hiv - positive people in ontario show that most either disclose to or do not have partners who are hiv - negative or of unknown status . non - disclosure strategies and assumptions are reported by relatively small sets of people with some variation according to employment status , sexual orientation , gender , ethnicity , and having had a casual partner . interviews with 122 people living with hiv show that disclosure is an undertaking fraught with emotional pitfalls complicated by personal histories of having misread cues or having felt deceived leading up to their own sero - conversion , then having to negotiate a stigmatized status with new people . in gay communities , constructions of the self as individual actors in a marketplace of risk co - exist with the sexual etiquette developed throughout the aids era of care of the self and other through safer sex . among heterosexual populations , notions of responsibility show some divergence by gender . the findings of this study suggest that the heightened pressure of criminal sanction on decision - making about disclosure in personal interactions does not address difficulties in hiv transmission and is unlikely to result in enhanced prevention .

control pain complex subjective experience critical clinical success caring patients opioids oxycodone methadone morphine recommended therapy world health organization european association palliative care moderate severe pain however use opioids pain management requires careful dose escalation empirical adjustments based clinical response presence side effects adverse drug reactions adrs unfortunately successful pain management treatment defined adequate analgesia without excessive adverse effects challenging unpleasant opioid side effects nausea vomiting constipation sedation common lead absence work poor performance work resulting risk job loss diminished quality life the serious issues involve risk sedation depression respiration unintentional death due inability poor ability metabolize medications successfully an individual genetic makeup may predispose patient adverse effects reduced efficacy pharmacogenomic approaches offer insight genetic variables affect drug uptake transport activation target metabolism interaction medications excretion the use pharmacogenomics patients requiring pain management lead efficient opioid selection dose optimization minimization adrs improve patient outcome p glycoprotein efflux transporter also called adenosine triphosphate binding cassette subfamily b member 1 abcb1 multidrug resistance 1 mdrd1 it expressed hepatic intestinal renal epithelial cells also luminal side endothelial cells blood brain barrier major determinant pharmacokinetics pharmacodynamics several opioids morphine methadone fentanyl commonly used treat pain genetic variants 3435c p glycoprotein associated variability pain relief cancer patients treated morphine the analgesic effects morphine mediated interaction -opioid receptor located central nervous system cns p glycoprotein limit concentration pain management drugs morphine brain actively pumps drugs cns result homozygous carriers 3435c variant tt carriers experience greater pain relief heterozygous ct homozygous wild type cc carriers presumably higher concentrations morphine achieved cns clinically relevant pharmacogenomic targets pain management cytochrome p450 cyp system responsible metabolizing wide range therapeutic agents used pain relief cyp2d6 especially important activation inactivation several opioids used treat pain including codeine oxycodone tramadol typically genetic variability cyp grouped four phenotypes ultrarapid metabolizers um extensive metabolizers em intermediate metabolizers poor metabolizers pm um - classified patients typically contain multiple copies gene results increase drug metabolism em classified patients characteristic normal population single wild type copy gene whereas im classified patients show decreased enzymatic activity pm classified patients detectable enzymatic activity codeine prodrug requires demethylation active metabolite morphine cyp2d6 exert analgesic effect result cyp2d6 pm classified patients experience ineffective analgesia increased side effects parent drug codeine hand cyp2d6 um classified patients prescribed codeine pain management generate extensive concentrations morphine lead adrs tramadol another opioid commonly used pain management produces analgesia synergistic action two enantiomers metabolites tramadol undergoes metabolism cyp2d6 active metabolite desmethyl tramadol greater affinity -opioid receptor parent compound genetic variations cyp2d6 shown account variable pain response post operative period cyp2d6 activity clinically relevant impact level analgesia mediated -opioid receptor another important genetic target uridine diphosphate glucuronosyltransferase 2b7 ugt2b7 metabolizes morphine morphine 3-glucuronide m3 g morphine 6-glucuronide m6 g morphine commonly used control moderate severe pain associated sickle cell disease darbari et al showed presence ugt2b7 -840 g genotypes gg ga associated lower m3g morphine m6g morphine ratios aa genotypes result genetic polymorphisms ugt2b7 have shown decrease hepatic clearance morphine translates lower dosage requirements morphine another study the ugt2b7 2 polymorphism 802c also shown associated frequency morphine induced adrs nausea cancer patients the authors showed frequency nausea higher patients without ugt2b7 2 allele furthermore efficacy opioid analgesia enhanced co administration catecholamines involved modulation pain catechol methyltransferase comt responsible inactivation catecholamines dopamine adrenaline norepinephrine result genetic variability comt gene contribute differences pain sensitivity response analgesics it shown common variant allele 1947 g rs4680 results three- fourfold reduction comt enzyme activity homozygous wild type gg cancer patients required higher doses morphine control pain heterozygous homozygous variant aa alleles finally -opioid receptor encoded opioid receptor like 1 oprm1 gene primary site action commonly used opioids the 118a g polymorphism gene results less effective opioid analgesia reported cancer patients homozygous variant alleles gg required higher morphine doses pain relief homozygous wild type aa participants another study chou et al investigated correlation 118a g polymorphism patient controlled morphine consumption patients undergoing total knee arthroplasty patients homozygous variants gg consumed approximately 60% morphine patients heterozygous homozygous wild type aa first 48-hour post operative period patient demographics reported pain factors differ genotype groups similar study women homozygous variants 118a g polymorphism required 30% morphine achieve adequate pain control wild type aa first 24 hours total abdominal hysterectomy finally significant relationship degree pain relief 118a g genotypes shown cancer patients treated morphine first 2 months therapy first 7 days morphine treatment patients homozygous wild type allele aa pronounced decrease pain baseline homozygous variants gg whose response almost undetectable genomic variations clearly influence pain sensitivity likelihood developing chronic pain response pharmacotherapy management pain pharmacogenomic polymorphisms definitely important interindividual variability analgesic effects occurrence adrs commonly used medications prescribed pain management genetic factors provide partial answer interindividual variability observed factors including biological variations ethnicity age gender environmental factors smoking status co morbidity co medications potential drug drug interactions must considered along genetic variations together affect pharmacokinetics pharmacodynamics medications used pain management additional studies also needed characterize combined effects multiple genes along demographic clinical variables selecting appropriate opioid predicting appropriate opioid dose patients pain large randomized prospective studies needed develop appropriate dosing treatment algorithms facilitate use genotyping information appropriately physicians furthermore continued development regulator approved genotyping assays identify variant alleles allow greater access information aid day day clinical decisions acute chronic pain management the benefits patient care safety result incorporation knowledge standard care anesthesiologists pain management physicians near future pharmacogenomic approaches pain management could lead individualized therapy best select appropriate analgesic onset provide sustained efficacy lowest side effect profile adr adverse drug reaction cns central nervous system comt catechol methyltransferase em extensive metabolizer intermediate metabolizer m3 g morphine 3-glucuronide m6 g morphine 6-glucuronide pm poor metabolizer ugt2b7 uridine diphosphate glucuronosyltransferase 2b7 um ultra rapid metabolizer ncb serves speakers bureau advisory board king pharmaceuticals pfizer inc forest pharmaceuticals pjj associate professor pathology department medical college wisconsin he director clinical chemistry toxicology froedtert hospital dynacare laboratories pjj pharmacogenomic research interests funded pathology department medical college wisconsin

physicians continue to struggle with the clinical management of pain , in part because of the large interindividual variability in the efficacy , occurrence of side effects and undesired severe adverse drug reactions from the prescribed analgesics . pharmacogenomics , the study of how an individual 's genetic inheritance affects the body 's response to medications , has an important role and can explain some of this interindividual variability . genetic identification of known variant alleles that affect the pharmacokinetics or pharmacodynamics of medications used for pain management can enable physicians to select the appropriate analgesic drug and dosing regimen for an individual patient , instead of empirical selection and dosing escalation . in this article , clinically relevant pharmacogenomic targets for the management of opioid pain , including efflux transporters , proteins that metabolize drugs , enzymes that regulate the neurotransmitters that modulate pain , and opioid receptors , will be reviewed .

many circumstances people experience external events number different sensory modalities example someone talking auditory visual information initially processed specialized neural pathways ultimately though different sensory signals integrated coherent multimodal percept speaker many behavioural neurophysiological studies emphasized importance spatial co localisation temporal synchrony intersensory pairing occur e.g. welch warren 1980 bedford 1989 stein meredith 1993 radeau 1994 bertelson 1999 welch 1999 however accumulating evidence intersensory phenomena may require spatial alignment welch et al 1986 scheier et al 1999 morein zamir et al ; teder salejarvi et al 2005 vroomen keetels 2006 keetels et al 2007 present study explored importance spatial alignment audio visual av temporal recalibration temporal recalibration refers phenomenon brain adapts small temporal asynchronies multi modal percept this occurs despite fact natural asynchronies senses caused differences signal transduction time air differences neural transmission time at least two options available handle asynchronies one concerned immediate corrections important adaptation longer time scale concerns immediate effect several studies shown brain corrects small av temporal asynchronies shifting one modalities time scale temporal discordance reduced for example sound light presented slightly different onset times usually order 100 ms temporal asynchrony reduced capturing effect light sound phenomenon called temporal ventriloquism scheier et al 1999 fendrich corballis 2001 morein zamir et al 2003 vroomen de gelder 2004 stekelenburg vroomen 2005 vroomen keetels 2006 temporal ventriloquism example demonstrated use visual temporal order judgment toj task participants presented two lights various stimulus onset asynchronies soas judge light came first presenting sound first second light noticeable difference jnd improves i.e. participants become sensitive presumably two sounds attract temporal occurrence two lights thus effectively pull lights apart time scheier et al there also long term effects reflecting adaptive change av asynchrony phenomenon called temporal recalibration fujisaki et al for example vroomen et al studied temporal recalibration exposing participants 3 min sound light flashes constant time lag av toj av simultaneity task performed following exposure observers given av test stimuli judged whether sound light came first whether sound light simultaneous successive the results showed point subjective simultaneity pss point perceived temporal alignment sound light shifted direction exposure lag so following exposure train sound first stimulus pairs participants perceived sound first trials simultaneous light first exposure ( 2004 demonstrated similar findings also provided somewhat mixed evidence temporal recalibration may generalize different test stimuli ones presented exposure the authors adapted participants asynchronous tone flash stimulus pairs later tested bounce illusion sekuler et al two visual targets move across perceived either bounce stream a brief sound presented moment visual targets coincide generally biases visual perception favour bouncing motion without sound observers tend report streaming percept light pairs optimal delay obtaining bounce illusion shifted direction conditions magnitude effect smaller cross adaptation conditions tactile temporal recalibration exposing participants streams brief auditory tactile stimuli presented synchrony else auditory stimulus leading 75 ms rather shift pss observed jnd resolve audio tactile temporal order larger exposure desynchronized streams exposure synchronous streams the authors argued temporal window integration widened due audio tactile asynchrony the goal present study explore whether spatial disparity sound light affects temporal recalibration according common notion intersensory pairing intersensory effects bigger individual components multisensory stimulus come location e.g. welch warren 1980 bedford 1989 stein meredith 1993 radeau 1994 bertelson 1999 welch 1999 however vroomen keetels 2006 demonstrated least temporal ventriloquism spatial correspondence sound light important study a visual toj task used sound presented first second light temporal ventriloquism manifested improvement jnds crucially improvement unaffected whether sounds came different position lights whether sounds static moved whether sounds lights came opposite sides fixation ( 2007 examined principles auditory grouping bregman 1990 relate intersensory pairing they embedded two sounds normally enhance sensitivity visual temporal order judgement task sequence flanker sounds either different frequency rhythm location experiments temporal ventriloquism occurred two capture sounds differed flankers thus demonstrating intramodal grouping sounds auditory stream took priority intersensory pairing combining principles auditory grouping intersensory pairing also demonstrated capture sounds could counter intuitively effective locations differed lights rather came position thus demonstrating sound location mattered auditory grouping intersensory pairing examined whether like temporal ventriloquism spatial disparity ignored temporal recalibration stake participants exposed 3 min train asynchronous sounds lights came either different location following exposure participants performed av toj task sounds lights either different location first could test whether temporal recalibration affected spatial disparity sounds lights recalibration usually considered low level perceptual learning phenomenon necessary alignment senses bertelson de gelder 2004 observing effect following exposure spatially disparate sound light pairs would provide strong evidence spatial co occurrence even early stage necessary intersensory pairing occur secondly use exposure test design allowed us introduce change exposure test stimulus could test whether effects generalize different test stimuli here tested whether spatial similarity exposure test sound affects effects if spatial co location plays role intersensory pairing one would expect stimulus generalization across space complete thirty students tilburg university received course credits participation reported normal hearing normal corrected normal vision the study carried along principles laid helsinki declaration informed consent participants obtained visual stimuli presented green led positioned central location 70 cm subject eyes diameter 0.5 cm luminance 40 cd auditory stimuli 88 db sound bursts presented one two loudspeakers one directly behind green led placed laterally 70 cm distance either far left far right subject i.e. 90 degrees spatial separation sound light see fig 1 schematic view experimental set a small red led placed 2 cm green led constantly lit experiment served fixation point , subject exposed sound light pair 100 ms temporal offset either sound first light first exposure sounds either presented central c lateral location b test phase light pairs presented particular soa ranging 240 240 ms negative values indicating sound presented first sounds test stimulus pair either came central b lateral location c schematic illustration experimental conditions exposure phase subject exposed sound light pair 100 ms temporal offset either sound first light first exposure sounds either presented central c lateral location b test phase sound light pairs presented particular soa ranging 240 240 ms negative values indicating sound presented first sounds test stimulus pair either came central b lateral location c three within subjects factors used exposure lag exposure phase 100 100 ms negative values indicating sound presented first location sound exposure exposure sound central lateral soa sound light test stimuli 240 120 90 60 30 0 30 60 90 120 240 ms negative values indicating sound came first the location test sound central lateral subjects variable half participants tested central test sounds lateral test sounds these factors yielded 44 equi probable conditions location test sound 2 2 11 presented 12 times total 528 trials the location exposure sound constant within block soa sound light varied randomly the order blocks counterbalanced across participants half blocks lateral exposure sound each block started exposure phase consisting 240 repetitions 3 min sound light stimulus pair isi 750 ms constant lag 100 100 ms sound light after 2,500 ms delay first test trial started ensure participants fixating light exposure detect occasional occurrence offset 150 ms fixation light i.e. catch trial the test phase consisted two parts short av exposure phase followed three av test trials temporal order sound light judged the exposure phase consisted train ten sound light pairs lag isi sound location used immediately preceding exposure phase after 1 three av test trials presented variable soa sounds lights the participant task judge whether sound light test stimulus presented first an unspeeded response made pressing one two designated keys response box the next test stimulus presented 500 ms response exposure phase next trial started 1,000 ms response third test stimulus acquaint participants toj task experimental blocks preceded four practice blocks exposure preceded test trials the first two practice blocks acquaint participants response buttons consisted 16 trials largest soas presented 240 120 part participants received verbal feedback correct wrong whether gave correct response the next two practice blocks consisted 66 trials soas presented 6 times randomly without verbal feedback thirty students tilburg university received course credits participation reported normal hearing normal corrected normal vision the study carried along principles laid helsinki declaration informed consent participants obtained visual stimuli presented green led positioned central location 70 cm subject eyes diameter 0.5 cm luminance 40 cd auditory stimuli 88 db sound bursts presented one two loudspeakers one directly behind green led placed laterally 70 cm distance either far left far right subject i.e. 90 degrees spatial separation sound light see fig 1 schematic view experimental set a small red led placed 2 cm green led constantly lit experiment served fixation point , subject exposed sound light pair 100 ms temporal offset either sound first light first exposure sounds either presented central c lateral location b test phase light pairs presented particular soa ranging 240 240 ms negative values indicating sound presented first sounds test stimulus pair either came central b lateral location c schematic illustration experimental conditions exposure phase subject exposed sound light pair 100 ms temporal offset either sound first light first exposure sounds either presented central c lateral location b test phase light pairs presented particular soa ranging 240 240 ms negative values indicating sound presented first sounds test stimulus pair either came central b lateral location c ) three within subjects factors used exposure lag exposure phase 100 100 ms negative values indicating sound presented first location sound exposure exposure sound central lateral soa sound light test stimuli 240 120 90 60 30 0 30 60 90 120 240 ms negative values indicating sound came first the location test sound central lateral subjects variable half participants tested central test sounds lateral test sounds these factors yielded 44 equi probable conditions location test sound 2 2 11 presented 12 times total 528 trials the location exposure sound constant within block soa sound light varied randomly the order blocks counterbalanced across participants half blocks lateral exposure sound each block started exposure phase consisting 240 repetitions 3 min sound light stimulus pair isi 750 ms constant lag 100 100 ms sound light after 2,500 ms delay first test trial started ensure participants fixating light exposure detect occasional occurrence offset 150 ms fixation light i.e. catch trial the test phase consisted two parts short av exposure phase followed three av test trials temporal order sound light judged the exposure phase consisted train ten sound light pairs lag isi sound location used immediately preceding exposure phase after 1 three av test trials presented variable soa sounds lights the participant task judge whether sound light test stimulus presented first an unspeeded response made pressing one two designated keys response box the next test stimulus presented 500 ms response exposure phase next trial started 1,000 ms response third test stimulus acquaint participants toj task experimental blocks preceded four practice blocks exposure preceded test trials the first two practice blocks acquaint participants response buttons consisted 16 trials largest soas presented 240 120 part participants received verbal feedback correct wrong whether gave correct response the next two practice blocks consisted 66 trials soas presented 6 times randomly without verbal feedback trials practice session excluded analyses proportion light first responses participant calculated combination exposure lag 100 100 ms location exposure sound central lateral location test sound central lateral soa ranging 240 240 ms performance catch trials flawless indicating participants indeed looking fixation light exposure combination exposure lag location exposure sound location test sound individually determined psychometric function was calculated soas fitting cumulative normal distribution using maximum likelihood estimation the mean resulting distribution interpolated 50% crossover point point subjective simultaneity henceforth pss slope measure sharpness stimuli distinguished one another slope inversely related noticeable difference jnd represents interval absolute soa 25 75% visual first responses given the pss jnd data shown fig 2 table 1 temporal recalibration expected manifest shift pss direction exposure lag the temporal recalibration effect tre therefore computed subtracting pss following auditory first exposure visual first exposure 2the proportions visual first responses v first exposure lag 100 ms sound first 100 ms light first combination location exposure sound central lateral location test sound central lateral)table 1mean points subjective simultaneity psss ms mean noticeable differences jnd parentheseslocation test sound location exposure soundcentral lateralav lag ms)pss jnd)trepss jnd)trecentral10012.5 39.3)14.59.9 37.8)6.41002.0 40.8)3.5 38.6)lateral1006.1 38.2)14.214.3 36.4)16.810020.3 36.1)2.5 42.0)exposure stimulus pairs presented auditory visual lag av lag 100 100 ms sounds either central lateral location test stimulus sound either central lateral the temporal recalibration effect tre reflects difference psss 100 100 ms audio visual lags proportions visual first responses v first exposure lag 100 ms sound first 100 ms light first combination location exposure sound central lateral location test sound central lateral mean points subjective simultaneity psss ms mean noticeable differences jnd parentheses exposure stimulus pairs presented auditory visual lag av lag 100 100 ms sounds either central lateral location test stimulus sound either central lateral temporal recalibration effect tre reflects difference psss 100 100 ms audio visual lags overall 2 2 2 anova with as within subjects factors exposure lag location exposure sound subjects factor location test sound run jnds none effects significant p 0.08 except second order interaction exposure lag exposure location test location f(1,28 4.6 p 0.041 inspection table 1 shows differences jnds average 38.7 ms rather small unsystematic the anova tres showed significant effect exposure lag f(1,28 23.0 p 0.001 demonstrating predicted exposure phase shifted pss visual first responses sound first exposure light first exposure i.e. tre the overall size effect corresponds well previous reports fujisaki et al an average tre 6.7% furthermore main effects location exposure test sound crucial interaction location exposure test sound non significant f 1 temporal recalibration thus manifested matter whether exposure sounds came central lateral location whether location exposure test sounds changed the goal present study address whether spatially co located av asynchronous stimulus pairs induce temporal recalibration much spatially dislocated stimuli whether spatial correspondence exposure test sound affects size effect results showed cases clear temporal recalibration effects subjective simultaneity shifted direction adapted audiovisual lag the shift equally big spatially separated spatially co located exposure stimuli stimulus generalization across space also complete shift temporal alignment equally big exposure test sound came different positions the results therefore support notion spatial alignment senses unimportant av pairing temporal domain the results also line previous reports temporal ventriloquism keetels et al 2007 vroomen keetels 2006 shown spatial separation affect capturing effect light sound taken together findings provide strong evidence spatial co occurrence even early perceptual stages necessary constraint intersensory pairing one might object though spatial ventriloquism diminished potential effects spatial discordance it well known apparent location sound shifted towards visual stimulus presented approximately time howard templeton 1966 radeau bertelson 1978 welch 1978 bertelson radeau 1981 bertelson 1994 1999 radeau 1994 could av spatial discordance set diminished became unnoticeable due spatial ventriloquism ? if one may observe effect spatial separation temporal recalibration this argument though seems highly unlikely known spatial ventriloquism dramatically declines whenever spatial separation exceeds approximately 15 degrees slutsky recanzone 2001 godfroy et al given maximized spatial separation sound light i.e. 90 degrees azimuth informal testing indeed confirmed spatial separation clearly noticeable seems safe assume spatial ventriloquism diminish effect spatial discordance one might also ask whether visual task used exposure phase i.e. detection offset visual fixation resulted attentional shift towards visual modality according law prior entry titchener 1908 attending one sensory modality speeds perception stimuli modality resulting change pss see also shore et al 2001 2005 spence et al 2001 schneider bavelier 2003 zampini et al our visual task might thus result shift pss towards visual first responses however shift uniform conditions given temporal recalibration expressed difference pss exposure lags possible role attention subtracted a remarkable aspect data previous studies demonstrated av temporal order judgements become sensitive i.e. smaller jnd sound light test stimuli spatially separated see also bertelson aschersleben 2003 spence et al small trend direction average jnd 39.1 vs. 38.2 ms spatially co located vs. separated test stimuli respectively effect non significant possibly might picked difference effect measured within subjects factor current purpose though considered unpractical would doubled individual testing time despite that observe effect av spatial separation jnds data speak interpretation effect at least two explanations brought improved temporal sensitivity locations test sound light differ one intersensory integration consequence temporal discordance fused extra spatial cues help toj performance spence et al 2003 given results show intersensory pairing occurs independent spatial mismatch see also vroomen keetels 2006 keetels et al 2007 seems likely previously observed effects spatial separation temporal sensitivity induced availability redundant spatial cues rather fusion per se conclude our results provide strong evidence claim commonality space sound light relevant av pairing temporal domain this may first sight seem unlikely natural multisensory events spatially temporally aligned however critical assumption underlies idea spatial correspondence cross modal pairing space function vision audition this notion though arguable proposed role space hearing steer vision heffner heffner 1992 vision indispensable attribute kubovy van valkenburg 2001 one accepts auditory spatial perception evolved steering vision deciding whether sound light belong together reason cross modal interactions would require spatial co localization our results therefore also important implications designing multimodal devices creating virtual reality environments show brain ignore cross modal discordance space

it is known that the brain adaptively recalibrates itself to small ( 100 ms ) auditory visual ( av ) temporal asynchronies so as to maintain intersensory temporal coherence . here we explored whether spatial disparity between a sound and light affects av temporal recalibration . participants were exposed to a train of asynchronous av stimulus pairs ( sound - first or light - first ) with sounds and lights emanating from either the same or a different location . following a short exposure phase , participants were tested on an av temporal order judgement ( toj ) task . temporal recalibration manifested itself as a shift of subjective simultaneity in the direction of the adapted audiovisual lag . the shift was equally big when exposure and test stimuli were presented from the same or different locations . these results provide strong evidence for the idea that spatial co - localisation is not a necessary constraint for intersensory pairing to occur .

transcription factors enhancer binding proteins chromatin remodeling factors play role regulating gene expression in addition nucleosomes basic structural units chromatin thought also involved process 1,2 see also 3,4 the dissociation displacement nucleosomes dna action protein factors dna- histone modifying enzymes methylases kinases acetylases deacetylases likely gives basal transcription apparatus access promoter regions genes 57 a means assessing distribution nucleosomes along stretches regulatory dna would therefore useful addition understanding gene regulation in eukaryotic cells nucleosomes formed binding dna histones 8) the nucleosome consists 147 bp dna wound around histone octamer core 911 human dna most dna sequences neutral favorable nucleosome formation sequences virtue influence curvature flexibility dna double helix 12,13 unfavorable nucleosome formation called nucleosome exclusion sequences nxss thus nucleosomes uniformly randomly spaced along dna allowing variation access promoter regulatory regions basal transcription apparatus transcription factors proteins we developed program nxsensor available locates nxss dna defines regions nucleosomes unlikely formed presence sequences spacing distances less number base pairs nucleosome we applied nxsensor sets promoter sequences whose genes known differ expression patterns among different tissues able show agreement recent reports significant differences among promoter regions number position sequences dna sequences chosen nxss following based experimental observations 1416 g c)3n2]3;e.g.ggcaacgcttgggta ggccgcgcaggggct a10(=t10);e.g aaaaaaaaaa tttttttttt studies lend support unfavorability sequences nucleosome formation hindering dna bending flexibility 12,13,17 a nxs defined one dna sequences contiguous non overlapping dna sequence long enough comprise one full turn dna double helix the nxsensor program annotates individual dna regions marking nxss examining spacing find sequences nxss 147 bp length assumption nucleosomes unlikely form regions to test general validity nxss chosen test ability nxsensor program find annotate sequences dna sequences positioned nucleosomes listed nucleosome positioning region database nprd examined 18 ideally nucleosome associated dna sequences nxss defined we found nine 8% 112 positioned nucleosomes contained nxss sequences total 12 nxss comprised 199 bp total 16 829 nucleosome associated base pairs 1.18% represents reasonable agreement expectation exceptions nxs accomodated within nucleosome may result presence additional protein factors associated nucleosomal dna as test nxsensor sv40 viral sequence examined known contain nucleosome free segment 400500 bp within 5243 bp genome 1921 the results showed close correspondence experimentally determined location nucleosome free region nucleosome free region predicted nxsensor analysis dna sequence supplementary figure 1 final comprehensive test nxsensor used analyze promoter regions two sets human genes housekeeping hk tissue specific ts genes these two sets genes chosen order assess potential distribution nucleosomes promoters genes used differently different tissues substantiate conclusions researchers recently investigated question using different approaches demonstrate usefulness nxsensor tool one hundred genes set hk ts selected basis tissue expression patterns given novartis research foundation genomic institute symatlas 22 the genes selected two extremes tissue expression patterns hk genes showing significant expression 73 normal tissues symatlas ts genes showing according gene specific non cross hybridizing probe sets suffixes significant expression one two tissues avoid possible bias selecting hk genes included wide variety basic cell functions possible selecting ts genes wide variety cell- tissue types possible genes one region transcription initiation used instead widely spaced alternative transcription start sites tsss indicated ucsc genome browser double checked database transcriptional start sites dbtss the list genes available examine region around tss gene used sequence 1000 bases upstream would include complete promoter genes 1000 bases downstream tss 1000 1000 called 2000 bp stretch promoter region, centered tss the tss either predominant site site near middle cluster oligo capped cdna clones shown dbtss 23 cases oligo capped cdna clones available dbtss 21 100 hk genes 36 100 ts genes ) nucleosome segments option nxsensor annotates submitted sequence highlighting gray segments available nucleosome binding leaving open segments unlikely bound nucleosomes virtue number positions nxss figure 1 supplementary figure 1 nxscore defined number nxss window 147 bp given position within 2000 base promoter region estimates likelihood nucleosomes excluded promoter regions different distances tss this measure obverse nucleosome formation potential based nucleosome binding sequences used levitsky et al ( the nxscore averaged promoter regions class genes hk ts generate graph average nxscore versus position centered given window figure 2 the second measure accessibility score, measuring overall accessibility 2000 base promoter region protein factors the accessibility score defined proportion base pairs region likely free nucleosomes according number spacing nxss accessibility scores vary 0.0 sequences potentially occupied nucleosomes 1.0 sequences likely occupied nucleosomes calculating accessibility score acc(10 short exclusion sequences 10 bp less flanked two segments potential nucleosome binding considered open unlikelihood protein would able bind effectively short sequence two nucleosomes a direct comparison average number nxss per window 147 bases hk ts promoter regions shown figure 2 sets promoter regions nxss nearer tss there significant difference hk gene promoters ts gene promoters mean number nxss specific 147 bp window centered tss hk 2.10 ts 0.82 p 0.01 kolmogorov supplementary figure 2 gives illustrative example 10 000 bases around tss hk gene nxsensor analysis suggests essentially tss region free nucleosomes figure 2 also shows mean number nxss window hk genes significantly higher expected random sequence dna base composition hk gene promoter regions 2.10 hk genes 0.53 corresponding random sequence dna p 0.0014 in contrast mean number nxss window ts genes hardly different nxss expected random sequence dna ts promoter base composition 0.82 ts genes 0.22 corresponding random sequence dna p 0.06 nxsensor output obtained accessibility scores as shown figure 3a significant difference distributions accessibility scores hk genes ts genes hk genes significantly higher accessibility scores ts genes p 0.01 kolmogorov further analysis conducted using modified accessibility score acc(50 includes sequences least 50 bp length likely nucleosome free this length sequence estimated occupied basal transcription apparatus 25,26 acc(50 examined dna region 110 60 region basal transcription apparatus would bind order initiate transcription majority tsss clustered around modal central tss 1 27 the comparison tss region figure 3b showed 58% hk genes 22% ts genes acc(50 0.5 higher hk genes 45% acc(50 1.0 15% ts genes the overall distributions hk gene ts gene acc(50 scores significantly different kolmogorov work recent years shown nucleosomes neither uniformly randomly positioned along dna double helix number instances location nucleosomes control regions dna ( 1 basis nucleosome positioning region database nprd 18 nucleosome formation potential scores recently used demonstrate differences intergenic regions 28 specifically promoter regions 29 human hk ts genes we taken different approach utilizing combination published experimental observational data identify dna sequences unfavorable nucleosome formation influence dna bending flexibility one example tgga repeats 30 occurred infrequently sample 200 promoter regions influence results using nxsensor program shown expected nxss rare dna sequences occupied nucleosomes listed nprd nxsensor also accurately predicts location nucleosome free zone viral sv40 dna set hk ts promoter region dna sequences nxsensor analysis demonstrated promoter regions hk genes likely relatively nucleosome free finding may help explain wide tissue distribution expression this contrast ts genes whose promoter regions contain sequences favorable nucleosome formation 28,29 therefore likely require additional ts transcription factors modify displace nucleosomes genes expressed the promoter regions two sets genes differed base composition many cpg islands 31,32 the gc content promoter regions hk genes 56.86% compared 50.44% ts genes cpg islands characteristic 92 100 hk genes 19 100 ts genes agreement observations others 32 ) greater frequency nxss g c)3n2]3 type hk gene promoter regions compared ts gene promoter regions partly reflection higher gc content former 56.86% g c hk 50.44% g c ts however average number g c)3n2]3 sequences hk gene promoter regions 15.4 even higher 7.8 22.7 s.d expected random sequences length base composition p 0.05 addition spite higher gc content hk gene promoter regions almost many nucleosome unfriendly polya polyt tracts ts gene promoter regions 50 hk compared 52 ts these two observations show frequency types nxs hk gene promoters higher would expected base composition suggesting functional significance possibly related nucleosome exclusion it may speculated one component selection sequences tend exclude nucleosomes another possible component selection gc rich sequences bind certain ubiquitous transcription factors sp-1 these two components selection might related factors regulate expression hk genes may evolved bind nucleosome free regions we unable find correlation accessibility score expression levels genes given symatlas 22 see supplementary figure 3 it likely lower nucleosome occupancy promoter regions hk genes related expression levels primarily ubiquity expression different tissues the nxsensor web tool flexible enough allow different definitions regions likely free nucleosomes accessible protein factors nxsensor set stringent exclusion criteria increasing number tandem nxss required nucleosome exclusion the minimum length nucleosome free sequence increased accommodate space required larger protein complexes approach took show region immediately surrounding tsss hk genes likely accessible basal transcription apparatus corresponding region ts genes here applied nxsensor promoter regions individual genes classes genes nxsensor may also used investigate control regions farther coding sequences enhancer inhibitor regions well sites methylation imprinting recombination repair pre mrna splicing indeed dna sequences nucleosome location likely factor overall chromatin organization function 3338 nxsensor output two promoter regions 1000 1000 relative major tss highlighted green left column hk gene rbpms rna binding protein right column ts gene f12 coagulation factor xii top nucleosome segment output shaded regions show nucleosomes likely located unshaded regions likely nucleosome free bottom row locations nxss average number exclusion sequences per window 147 bases 100 hk solid blue line 100 ts dashed red line promoter regions centered tss also shown thinner horizontal straight lines expected numbers exclusion sequences random sequence base composition sum promoter regions class average number observed exclusion sequences window centered tss 2.10 hk promoters significantly higher p 0.0014 expected number 0.53 random sequence composition similarly ts promoters average number observed sequences window centered tss 0.82 higher expected number 0.22 random sequence composition significance level p 0.06 ( accessibility scores acc(10 promoter regions 1000 1000 relative tss open circles hk gene promoter regions dots ts gene promoter regions ( b accessibility scores acc(50 vicinity tss segment 110 60 accessibility basal transcription apparatus

nucleosomes , a basic structural unit of eukaryotic chromatin , play a significant role in regulating gene expression . we have developed a web tool based on dna sequences known from empirical and theoretical studies to influence dna bending and flexibility , and to exclude nucleosomes . nxsensor ( available at ) finds nucleosome exclusion sequences , evaluates their length and spacing , and computes an accessibility score giving the proportion of base pairs likely to be nucleosome - free . application of nxsensor to the promoter regions of housekeeping ( hk ) genes and those of tissue - specific ( ts ) genes revealed a significant difference between the two classes of gene , the former being significantly more open , on average , particularly near transcription start sites ( tsss ) . nxsensor should be a useful tool in assessing the likelihood of nucleosome formation in regions involved in gene regulation and other aspects of chromatin function .

term mucosa associated lymphoid tissue malt lymphoma first coined isaacson wright1 1983 malt lymphomas occur many locations including gastrointestinal tract salivary glands thyroid lung breast it histologically characterized lymphoepithelial lesions lymphoplasmic epithelial invasion.1,2 lymphomas occur colon account 10% 20% lymphomas gastrointestinal tract 2.5% lymphomas 0.2% 0.6% colorectal malignant tumors thus rare.2,3 colonic malt lymphomas present nonpedunculated protruding polypoid mass and/or ulceration cases primary colonic malt lymphoma reported korea presented multiple submucosal tumors one case),4 nonpedunculated protruding polypoid mass four cases),5,6,7,8 obstructive lesions colon caused mucosal edema tumor two cases),9,10 mucosal discoloration one case).11 report case colonic malt lymphoma presenting semipedunculated polyp removed endoscopic mucosal resection emr a 54-year old man visited daegu catholic university hospital screening colonoscopy revealed sigmoid colon polyp diagnosed pathologically tubular adenoma he denied symptoms abdominal pain weight loss fever general weakness loss appetite hematochezia his blood pressure 106/64 mm hg pulse rate 73 beats per minute respiratory rate 20 breaths per minute body temperature 36.7. consciousness clear lymphadenopathy evident head neck axillary inguinal region the laboratory findings follows white blood cells 11,400/mm neutrophils 81.8% eosinophils 0.4% lymphocytes 12.4% hemoglobin 13.4 g dl platelet count 202,000/mm the blood chemistry test showed following results aspartate aminotransferase 16 iu l alanine aminotransferase 21 iu l total bilirubin 0.6 mg dl alkaline phosphatase 129 iu l total protein 6.5 g dl albumin 4.4 g dl blood urea nitrogen 12.2 mg dl creatinine 0.9 mg dl na 139 meq l k 3.4 meq l cl 98 meq l the serum carcinoembryonic antigen level 2.69 ng ml within reference range colonoscopy revealed semipedunculated polyp approximately 2 cm size sigmoid colon in private clinics tumor diagnosed tubular adenoma however diagnosis submucosal tumor completely ruled we performed emr en bloc resection polyp flex knife snare injecting glycerin solution submucosa fig resected specimens histologically showed lymphoepithelial lesions diffuse proliferation atypical lymphocytes immunohistochemically stained positively cd20 cd5 bcl-6 negatively cd3 bcl-2 cyclin d1 these findings compatible low grade b cell malt lymphoma fig 2 evidence lymph node metastasis involvement organ except gallstone thoracic abdominal computed tomography performed staging according ann arbor staging system the resected lesion replaced normal mucosa sigmoidoscopy 2 months emr fig malt lymphoma subtype non hodgkin lymphoma classified extranodal marginal zone b cell lymphoma lymphoepithelial lesion characterized epithelial infiltration lymphoplasma cells.1,2 malt lymphoma stomach known associated helicobacter pylori infection,11 whereas nongastric malt lymphomas associated borrelia burgdorferi chlamydia psittaci hepatitis c virus campylobacter jejuni autoimmune disease.12 colonic malt lymphoma occurs average age 59.8 years shows sex preference clinically usually asymptomatic present nonspecific symptoms bloody diarrhea and/or abdominal pain however rare cases intestinal obstruction intussusception appear.9,10,13,14 systemic symptoms fever weight loss rare malt lymphomas well localized slow growing.12 according endoscopic findings malt lymphoma colon usually appears sessile protruding lesion ulcerative lesion former approximately 10 times common latter.14,15 sites tumor growth reported cecum 71.5% rectum 16.9% ascending colon 6.2% however sigmoid colon rarely affected.16 eight cases reported korea summarized table 1 these cases manifested polypoid lesions neoplastic lesions protruding lesions form submucosal tumors,4,5,6,7,8,10 rarely form luminal stenosis caused thickening large intestine wall color change mucosa.9,11 neoplastic polypoid lesions sessile accompanied ulcers nodularities mucosal lesion.5,6,7,8,10 terms regions occurrence five cases reported rectum,4,5,6,7,11 five cases appendix ileocecal valve,5,6,8,9,11 two cases ascending colon.6,9 accordingly malt lymphoma presenting semipedunculated polyp sigmoid colon extremely rare a malt lymphoma diagnosed surgery endoscopic biopsy case endoscopic biopsy the submucosa must collected lymphomas limited region.4 present case tumor diagnosed malt lymphoma emr included submucosal tissue whereas diagnosed tubular adenoma private clinics the specific histological findings malt lymphoma include lymphoepithelial lesions lymphoplasmic epithelial invasion centrocyte like cells reactive lymphoid follicles plasma cell differentiation observed one third malt lymphomas.17 however difficult differentiate malt lymphoma follicular lymphoma presence multiple lymphoid follicles.14 moreover malt lymphoma often confused mantle cell lymphoma histologic similarities however malt lymphoma usually presents single lesion whereas mantle cell lymphoma presents multiple lymphomatous polyposis gastrointestinal tract without lymphoepithelial lesions.18 immunohistochemically two types differentiated cyclin d1 status malt lymphomas mantle cell lymphomas immunonegative immunopositive cyclin d1 respectively.14 case histological findings showed lymphoepithelial lesions caused invasion mucosa atypical lymphocytes cyclin d1 negative ki-67 labeling index 10% 20% indicated diagnosis low grade malt lymphoma lack accepted etiology limited number cases guideline issued treatment colonic malt lymphomas locally extended low grade malt lymphomas currently treated endoscopic surgical excision whereas high grade malt lymphomas malt lymphomas multiple organ involvement may treated using different modalities surgery radiotherapy chemotherapy recently rituximab therapy.5 however standard treatment some reported antibiotic treatment h. pylori effective colonic malt lymphoma treatment influences even h. pylori negative patients,19 suggests strains sensitive antibiotics h. pylori eradication contribute malt lymphoma development patients grunberger et al.20 reported administration antibiotics h. pylori ineffective h. pylori positive malt lymphoma patients extragastric involvement some case reports published korea addressed efficacy h. pylori treatment malt lymphoma however results cases inconclusive presence h. pylori infection uncertain patients undergone radiotherapy.7 therefore efficacy h. pylori treatment malt lymphoma requires study our patient tested h. pylori malt lymphoma localized sigmoid colon measures endoscopic mucosal excision performed described case malt lymphoma presented semipedunculated polyp colonoscopy diagnosis treatment planning performed basis results emr more case reports studies colonic malt lymphoma presenting variable morphology needed establish guidelines treatment colonic malt lymphomas near future

mucosa - associated lymphoid tissue ( malt ) lymphomas are characterized by lymphoepithelial lesions pathologically . colonic malt lymphomas are relatively rarer than lymphomas of the stomach or small intestine . endoscopically , colonic malt lymphoma frequently appears as a nonpedunculated protruding polypoid mass and/or an ulceration in the cecum and/or rectum . we report a unique case of a colonic malt lymphoma presenting as a semipedunculated polyp . a 54-year - old man was found to have a 2-cm semipedunculated polyp in the sigmoid colon during screening colonoscopy . the polyp was removed by endoscopic mucosal resection . histologic examination of the resected polyp revealed diffuse epithelial infiltration by discrete aggregates of lymphoma cells . we diagnosed the tumor as low - grade b - cell malt lymphoma by immunohistochemical staining .

autogenous grafting commonly used surgical procedure bone reconstruction due advantages comparison graft materials biocompatibility bone regeneration potential several possibilities reported literature atrophic jaws reconstruction among solutions possible cite intra extra oral autogenous grafts allografts alloplastic xenogenic grafts without use membranes guided bone regeneration autogenous bone grafts considered suitable reconstruction defects oral maxillofacial regions mainly due characteristics osteoinduction osteoconduction it type graft provides live immunocompatible bone cells essential stage osteogenesis this makes type graft advantageous since higher amount transplanted living cells higher possibility new bone formation graft fixation fundamental procedure normal process bone regeneration last decade plates screws represented metallic biodegradable materials used preferably obtaining graft stability well fixation fractures whole craniofacial bone this due fact materials provide rigid fixation tridimensional control bone position hand disadvantages inflammatory reactions bone displacement technical difficulty guided medical dental researchers search alternative method graft fixation field tissue adhesives resource potentially capable providing stability healing process tissue adhesives based cyanoacrylate ca substances successfully employed skin laceration synthesis surgical incisions well stabilization thin bone fragments orbital fractures osteochondral fractures the interesting properties adhesives rapid polymerization strong adhesion surfaces applied biocompatibility bacteriostatic hemostatic actions besides quick atraumatic fixation method ethyl ca short chain ca one first adhesives tested medical use presenting excellent adhesive strength however apparent toxicity soft tissues conducted researches adhesives longer chain butyl octyl ca present higher biocompatibility spite findings adhesive capacity ethyl ca still tested biological use bone tissue fixation satisfactory results generally studies investigated ca behavior mineralized tissues fixation the purpose study perform histological histometric analyses repair process autogenous bone grafts fixed rat calvaria ethyl ca adhesive this study approved institutional research ethics committee protocol 2008 005587 thirty two male adult rats used rattus norvegicus albinus wistar mean weight 250 g divided 2 experimental groups 16 animals group control group ii adhesive whole experiment the animals kept cages vivarium department surgery integrated clinics fed solid animal chow guabi nutrilabor mogiana alimentos paulo sp brazil water ad libitum except fasting period 14 16 hours preceded surgical procedure received water anesthesia intramuscular xylazine hydrochloride 0.2 ml/250 g xilazin syntec brasil ltda cotia sp brazil ketamine hydrochloride cetamin syntec brasil ltda cotia sp brazil 0.1 ml/250 g shaving antisepsis accomplished 10% pvp frontoparietal region the animals received approximately 20-mm wide mid longitudinal incision scalp sagittal calvarial suture followed soft tissue dissection exposing parietal bones animal rounded osteotomy made right parietal bone 4-mm diameter trephine bur low speed constant saline irrigation obtain rounded bone fragment preserving integrity dura mater brain the defect kept cavity covered blood clot examined left side site would receive graft parietal bone decorticalized 8 spherical bur low speed group i graft positioned recipient site without type fixation material group ii graft fixed ethyl ca adhesive super bonder loctite henkel itapevi sp brazil applied microbrush the flap repositioned sutured continuous spiraled suture using mononylon 5 0 mononylon j&j ethicon jos dos campos sp brazil the animals euthanized anesthetic overdose 10 30 postoperative days 8 animals period the calvaria removed left parietal bones separated preserving supraperiosteal soft tissues pieces fixed 10% formaldehyde subjected routine laboratorial processing six micrometer thick cross sections obtained stained hematoxylin eosin histological histometric analyses histological qualitative analysis graft recipient site interface the presence following items assessed adhesive fragments inflammatory infiltrate fibroblastic proliferation new bone capillary formation superficial deep tissues histometric quantitative analysis the slides examined optical microscope aristoplan leitz leica wetzlar hesse germany 2.5x magnification camera axio cam mrc5 zeiss santo amaro sp brazil connected computer using axiovision 4.5 software images converted digital tif files standardizing height width number pixels per inch bone graft size 10 30 days quantified pixels using imagelab 2000 software diracon bio informtica ltda vargem grande sul the evaluation performed single trained examiner measurements done three different moments interval 1 week evaluations the mean three values assigned slide value used statistical analysis statistical analysis accomplished gmc 9 software statistical software created prof initially data submitted normal curve adherence test showed non parametric behavior thus kruskal wallis test used compare data 10 30 days all animals tolerated well experimental procedures way 10 days postoperatively soft tissues handled surgical procedures already healed aspect normality without signs infection wound dehiscence underneath graft observed osteocyte lacunae filled osteocytes interface graft recipient site possible observe thin layer compact fibrous connective tissue areas bone remodeling graft parietal bone peripheral regions new bone formation primary bone tissue asterisks graft fragment bone graft bg parietal bone hematoxylin eosin original 160x superficially possible observe thin fibrous capsule covering bone graft specimens predominance lymphocytes together large number neutrophils observed adjacent fibrous capsule possible notice bone graft osteocyte lacunae containing basophilic nucleus several bone lacunae found grafts containing multinucleate cells specimens large number neutrophils deeply adjacent graft fragments ca observed filling space graft recipient site adjacent bone surface recipient site several resorption areas large number osteoclastic type multinucleate cells a large number lymphocytes neutrophils observed medullar spaces bone tissue few fibroblasts could identified predominance resorption areas concerning new bone formation areas it still possible observe absence bone union bone graft recipient site figure 2 group ii 10 days bone graft bg osteocyte lacunae containing basophilic nucleus fragments cyanoacrylate ca observed filling space bone graft recipient site discrete areas new bone formation bn observed recipient site hematoxylin eosin original 63x 30 days periosteum layer graft showed signs hyperplasia presented discrete inflammatory infiltrate bone graft attached recipient site newly formed bone tissue interface region several specimens this new bone formation occurs central third graft margins remained joined donor area compact connective tissue figure 3 the graft aspect mature bone well vascularized osteocyte lacunae filled osteocytes havers systems group 30 days bone graft bg incorporated recipient site new bone formation interface observed graft central region extremities remained filled fibrous connective tissue hematoxylin eosin original 100x specimens fibrous capsule covered bone graft underneath fibrous capsule graft presents areas bone resorption external surface osteoclastic type multinucleate cells these resorptions could also observed bone fragment graft proximal areas specimens bone union recipient site was observed however animals union could identified region filled lymphocyte type inflammatory infiltrate blood vessels several collagen fibers maintained continuity capsule collagen fibers discrete areas new bone formation observed internal surfaces grafts surfaces contact ca more deeply graft recipient site space filled great amount ca observed several areas multinucleate cells could identified mainly regions adjacent graft proximal surface figure 4 few areas newly formed bone observed space time period studied regarding recipient site resorption areas new bone formation areas group ii 30 days underneath bone graft linked recipient site graft margin areas new bone formation bn observed internal surfaces grafts recipient site a space filled high amount cyanoacrylate ca remains graft recipient site discrete inflammatory infiltrate hematoxylin eosin original 63x group ii 30 days new bone formation observed bone graft recipient site contact cyanoacrylate ca hematoxylin eosin original 160x mean bone graft sizes pixels 319,865 21,611 302,268 18,099 group 10 30 days respectively 273,149 19,178 250,391 25,127 group ii 10 30 days respectively figure 6 statistical analysis when results 10 30 days compared statistically significant difference groups ii p<0.05 area bone graft fragment groups ii 10 30 days underneath graft observed osteocyte lacunae filled osteocytes interface graft recipient site possible observe thin layer compact fibrous connective tissue areas bone remodeling graft parietal bone peripheral regions new bone formation primary bone tissue asterisks graft fragment bone graft bg parietal bone hematoxylin eosin original 160x superficially possible observe thin fibrous capsule covering bone graft specimens predominance lymphocytes together large number neutrophils observed adjacent fibrous capsule possible notice bone graft osteocyte lacunae containing basophilic nucleus several bone lacunae found grafts containing multinucleate cells specimens large number neutrophils deeply adjacent graft fragments ca observed filling space graft recipient site adjacent bone surface recipient site several resorption areas large number osteoclastic type multinucleate cells a large number lymphocytes neutrophils observed medullar spaces bone tissue few fibroblasts could identified predominance resorption areas concerning new bone formation areas it still possible observe absence bone union bone graft recipient site figure 2 group ii 10 days bone graft bg osteocyte lacunae containing basophilic nucleus fragments cyanoacrylate ca observed filling space bone graft recipient site discrete areas new bone formation bn observed recipient site hematoxylin eosin original 63x 30 days periosteum layer graft showed signs hyperplasia presented discrete inflammatory infiltrate bone graft attached recipient site newly formed bone tissue interface region several specimens this new bone formation occurs central third graft margins remained joined donor area compact connective tissue figure 3 the graft aspect mature bone well vascularized osteocyte lacunae filled osteocytes havers systems group 30 days bone graft bg incorporated recipient site new bone formation interface observed graft central region extremities remained filled fibrous connective tissue hematoxylin eosin original 100x specimens fibrous capsule covered bone graft underneath fibrous capsule graft presents areas bone resorption external surface osteoclastic type multinucleate cells proximal areas specimens bone union recipient site observed however animals union could identified region filled lymphocyte type inflammatory infiltrate blood vessels several collagen fibers maintained continuity capsule collagen fibers discrete areas new bone formation observed internal surfaces grafts surfaces contact ca more deeply graft recipient site space filled great amount ca observed several areas multinucleate cells could identified mainly regions adjacent graft proximal surface figure 4 few areas newly formed bone observed space time period studied regarding recipient site resorption areas new bone formation areas could identified specimens figure 5 group ii 30 days underneath bone graft linked recipient site graft margin areas new bone formation bn observed internal surfaces grafts recipient site a space filled high amount cyanoacrylate ca remains graft recipient site discrete inflammatory infiltrate hematoxylin eosin original 63x group ii 30 days new bone formation observed bone graft recipient site contact cyanoacrylate ca hematoxylin eosin original 160x ) underneath graft observed osteocyte lacunae filled osteocytes interface graft recipient site possible observe thin layer compact fibrous connective tissue areas bone remodeling graft parietal bone peripheral regions new bone formation primary bone tissue asterisks graft fragment bone graft bg parietal bone hematoxylin eosin superficially possible observe thin fibrous capsule covering bone graft specimens predominance lymphocytes together large number neutrophils observed adjacent fibrous capsule possible notice bone graft osteocyte lacunae containing basophilic nucleus several bone lacunae found grafts containing multinucleate cells specimens large number neutrophils deeply adjacent graft fragments ca observed filling space graft recipient site adjacent bone surface recipient site several resorption areas large number osteoclastic type multinucleate cells large number lymphocytes neutrophils observed medullar spaces bone tissue few fibroblasts could identified predominance resorption areas concerning new bone formation areas it still possible observe absence bone union bone graft recipient site figure 2 group ii 10 days bone graft bg osteocyte lacunae containing basophilic nucleus fragments cyanoacrylate ca observed filling space bone graft recipient site discrete areas new bone formation bn observed recipient site hematoxylin eosin original 63x ) at 30 days periosteum layer graft showed signs hyperplasia presented discrete inflammatory infiltrate bone graft attached recipient site newly formed bone tissue interface region several specimens this new bone formation occurs central third graft margins remained joined donor area compact connective tissue figure 3 the graft aspect mature bone well vascularized osteocyte lacunae filled osteocytes havers systems group 30 days bone graft bg incorporated recipient site new bone formation interface observed graft central region extremities remained filled fibrous connective tissue hematoxylin eosin original 100x ) in specimens fibrous capsule covered bone graft underneath fibrous capsule graft presents areas bone resorption external surface osteoclastic type multinucleate cells these resorptions could also observed bone fragment graft proximal areas specimens bone union recipient site was observed however animals union could identified region filled lymphocyte type inflammatory infiltrate blood vessels several collagen fibers maintained continuity capsule collagen fibers discrete areas new bone formation observed internal surfaces grafts surfaces contact ca more deeply graft recipient site space filled great amount ca observed several areas multinucleate cells could identified mainly regions adjacent graft proximal surface figure 4 few areas newly formed bone observed space time period studied regarding recipient site resorption areas new bone formation areas could identified specimens figure 5 group ii 30 days underneath bone graft linked recipient site graft margin areas new bone formation bn observed internal surfaces grafts recipient site a space filled high amount cyanoacrylate ca remains graft recipient site discrete inflammatory infiltrate hematoxylin eosin original 63x group ii 30 days new bone formation observed bone graft recipient site contact cyanoacrylate ca hematoxylin eosin original 160x ) the mean bone graft sizes pixels 319,865 21,611 302,268 18,099 group 10 30 days respectively 273,149 19,178 250,391 25,127 group ii 10 30 days respectively figure 6 statistical analysis when results 10 30 days compared statistically significant difference groups ii p<0.05 area bone graft fragment groups ii 10 30 days graft fixation great importance graft resorption decrease volume loss variable inconstant ( 1990 screwed internal rigid fixation enhances life time onlay bone graft decreasing resorption compared graft fixed stabilized steel wire mainly great mobility areas present investigation possible use titanium screw graft fixation thin rat parietal bone makes impracticable use thus bone fragments fixed adhesive compared group graft remained juxtaposed recipient site the partial graft resorption natural process remodeling stage however presence inflammatory reaction micromovements tends accelerate intensify process it important emphasize bone graft rat calvaria proposed experimental model present study subjected many movements maintained position becomes properly incorporated recipient site observed control group 10 30 days differently calvaria mouth constant movements muscles food makes essential fixation bone graft blocks graft stability essential occurrence revascularization graft incorporation according clinical observations the technique using adhesive simple mechanically adhesive promoted good adhesion graft recipient site this demonstrated fact bone fragment remained stable studied periods confirming good adhesive capacity ethyl ca shown previous studies it reported smaller ester chain higher histotoxicity however regarding inflammatory reaction provided adhesive observed higher 10 days 30 days low intensity inflammation exhibited foreign body type multinucleate cells areas adjacent ca fragments these findings indicate intense inflammatory reaction produced material short duration according celik et al ( 1991 inflammation caused reaction dependent tissue oxygen explained transformation cellular membrane polyunsaturated fatty acids hydroperoxide lipids increases metabolism local arachidonic acid unleashing synthesis tromboxane prostaglandin clinical experimental studies demonstrated adhesive efficacy produce stable union bone segments however histological still remain conclusive ( 2006 histomorphometric study utilizing rabbits experimental models fixed autogenous graft fragments calvaria ethyl ca adhesive the results showed discrete inflammatory infiltrate first 15 postoperative days totally receded posterior periods present study fact however persistence discrete lymphocyte infiltrate associated presence multinucleated cells especially graft margins connective tissue direct contact adhesive allow us suggest material though well tolerated behave biocompatible way ( 2006 findings showed physical presence ethyl ca affected new bone formation ca fragments suffering phagocytosis granulation tissues containing fibroblasts newly formed blood vessels lymphocyte type inflammatory infiltrate proliferating area the formation osseous trabeculae occurred migration showing material osteoconductive osteoinductive behavior hampered immediate new bone formation graft incorporation recipient site this fact associated persistence discrete inflammatory process could explain higher graft resorption observed 10 30 postoperative days polymer degradation would necessary complete repair process providing results similar provided conventional internal rigid fixation however great amount ca still observed graft recipient site interface studies longer experimental periods suggested determine total bone filling area maintenance graft bone size according methodology employed study possible conclude although allowing maintenance stability graft fragment 30 days permanence adhesive bone graft interface allow graft incorporation recipient site producing low intensity persistent local inflammatory reaction

objectivethe purpose of this study was to perform histological and histometric analyses of the repair process of autogenous bone grafts fixed at rat calvaria with ethyl - cyanoacrylate adhesive . material and methodsthirty - two rats were divided into two groups ( n=16 ) , group i - control and group ii - adhesive . osteotomies were made at the right parietal bone for graft obtainment using a 4-mm - diameter trephine drill . then , the bone segments were fixed with the adhesive in the parietal region of the opposite side to the donor site . after 10 and 30 days , 8 animals of each group were euthanized and the calvarias were laboratorially processed for obtaining hematoxylin and eosin - stained slides for histological and histometric analyses . resultsan intense inflammatory reaction was observed at the 10-day period . at 30 days , this reaction was less intense , despite the presence of adhesive at the recipient - site / graft interface . graft incorporation to the recipient site was observed only at the control group , which maintained the highest graft size at 10 and 30 days . conclusionsalthough the fragment was stable , the presence of adhesive in group ii did not allow graft incorporation to the recipient site , determining a localized , discrete and persistent inflammatory reaction .

aluminium al ubiquitous environment represents third common element earth crust generally exists combined state elements the problem al contamination environment around 25 years despite remains neglected problem in particular al found materials used pharmaceutical industry manufactured foodstuffs cosmetics tap water overcoming body barriers al infiltrate blood promote toxic effects liver bone central nervous system when pregnant mice exposed al weights maternal spleen liver increase foetal top heel lengths decrease pregnancy pro oxidant effects chronic al exposure disrupt normal development baby rats rats exposed al shown al causes oxidative stress high intraperitoneal doses al causes important morphologic ultrastructural damage rat kidney liver testis 57 one reason might increased oxidative stress due erythrocyte al accumulation induction anaemia potentially disruption iron levels alteration iron homeostasis another systemic problem the skeletal system one targets al toxicity al intake lead osteomalacia however one sensitive targets al toxicity nervous system neurotoxic effects al indicated various treatments different salts al resulted oxidative damage range cellular biomolecules lipids proteins nucleic acids this al toxicity shown affect plants animals human effects seen disturbances various second messenger signalling systems cells including phosphoinositide derived signalling ca signalling pathways formation lipid peroxides time although al absorption diet low animals human al form complexes citrate transferrin cross blood brain barrier affect brain after systemic intravenous al exposure rats rabbits extracellular al concentrations seen increase primarily frontal cortex hippocampus brain studies rats neurochemical changes caused al brain depend duration exposure region specific memory learning disorders reported mice al shown cause oxidative stress brain applied cultured human brain cells according time concentration al exposure reductions cell growth rates seen terms effects al functions brain rat reported impaired neural function caused al related damage intracellular ca homeostasis this suggested linked disturbed k na currents whereby al damages rat hippocampal ca1 neurons promoting damage central nervous system this appears mediated changes amino acid transmitters increases glutamate glutamine levels accompanied decrease gamma aminobutyric acid levels this focused hippocampus spongiform changes neurons seen appear important mechanism al neurotoxicity proposed mechanisms al neurotoxicity rat inhibition acetylcholinesterase activity enzyme rate decreased vmax reported brain disturbance cellular communication gap junctions cultured foetal brain astrocytes similarly isolated cerebellar granule cell neurons al neurotoxicity resulted formation reactive oxygen species elevated intracellular ca concentrations the resulting cell death also related apoptosis activation caspase-3 increase annexin v binding particular relevance developmental aspects investigated present study the use al radioisotope provided tracer demonstrate following subcutaneous injection pregnant lactating rats considerable amounts found brain particularly cell nucleus fraction mother foetus indeed earlier study investigating effects al ontogenetic development cholinergic serotonin neurotransmitter receptors brain demonstrated time exposure al important effects seen also timing exposure thus study saw reduced muscarinic serotonin receptor sensitivities post natal exposure also paradoxical increase 5-ht2c receptor sensitivity rats prenatal exposure high al concentrations 3000 ppm al sulphate drinking water pregnancy present study we therefore investigated oxidative histopathological damage induced al development chick brain applied beginning incubation period eggs ross broiler chicks thirty five fertilized ross broiler eggs abalolu holding izmir turkey divided 3 study groups control group treatment n=10 sham treatment group n=12 active treatment group n=13 all eggs placed egg incubator vgs veyisoullar istanbul turkey first day incubation day 1 sham group 0.1 ml saline al treated active treatment group 500 g al sulphate 0.1 ml saline slowly injected air chambers nothing applied control group term day 21 the eggs opened live chicks 8/10 8/12 8/13 respectively sacrificed anaesthesia 50 mg kg ketamine 5 mg kg xylene merck germany their brains removed divided 2 parts right left hemispheres the right hemispheres used biochemical analyses left hemispheres used stereological cavalieri brain volume estimations study all procedures carried full accordance principles guide care use laboratory animals , protection animals study approved pamukkale university experimental animals ethics committee the malondialdehyde mda levels right hemisphere brain samples determined using method okhawa et al each half brain sample homogenized 150 mm potassium chloride solution using 10 strokes the assays mda levels included 0.4 ml brain homogenate 1.5 ml 0.8% thiobarbituric acid 1.5 ml 20% acetic acid ph 3.5 0.2 ml 8.1% sodium dodecyl sulphate these samples mixed incubated 100c 1 h. absorbance measured 532 nm ( 1979 modifications briefly homogenization samples mda measurements 0.5 ml homogenate mixed 3.0 ml deproteinization solution 5.13 nacl 0.2 metaphosphoric acid 6.8 mm edta distilled water ) sample centrifuged 1000g 5 min 0.5 ml supernatants added 2.0 ml 300 mm na2hpo4 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid reagent dtnb ellman reagent after dissection separation left chick brain hemispheres kept 3 days 10% formaldehyde brain volume measurements brain hemispheres rinsed water dehydrated graduated ethanol series 70% 100% ethanol rinsed xylene systematically randomized coronal sections taken brain block using leica rm-2125 microtome weltzlar germany basis 15 equally spaced 5 thick sections the brain volume estimations carried according cavalieri volume estimation formula volume total point number point invasion area average section thickness points counted monitor sony trinitron kv-14lt1e tv japan according uniform random placing using stereomicroscope zeiss stemi 200-c germany camera canon power shot g-2 tokyo japan attachment point catheter sections systematic uniform random quality acceptable coefficient error volume estimations 15 sections used sample approximately 250 points counted the data given means standard deviation box plot analyses given figures the data evaluated significant differences among groups using mann whitney u test kruskal wallis tests thirty five fertilized ross broiler eggs abalolu holding izmir turkey divided 3 study groups control group treatment n=10 sham treatment group n=12 active treatment group n=13 all eggs placed egg incubator vgs veyisoullar istanbul turkey first day incubation day 1 sham group 0.1 ml saline al treated active treatment group 500 g al sulphate 0.1 ml saline slowly injected air chambers nothing applied control group term day 21 the eggs opened live chicks 8/10 8/12 8/13 respectively sacrificed anaesthesia 50 mg kg ketamine 5 mg kg xylene merck germany their brains removed divided 2 parts right left hemispheres the right hemispheres used biochemical analyses left hemispheres used stereological cavalieri brain volume estimations study all procedures carried full accordance principles guide care use laboratory animals , protection animals study approved pamukkale university experimental animals ethics committee the malondialdehyde mda levels right hemisphere brain samples determined using method okhawa et al each half brain sample homogenized 150 mm potassium chloride solution using 10 strokes the assays mda levels included 0.4 ml brain homogenate 1.5 ml 0.8% thiobarbituric acid 1.5 ml 20% acetic acid ph 3.5 0.2 ml 8.1% sodium dodecyl sulphate these samples mixed incubated 100c 1 h. absorbance measured 532 nm ( 1979 modifications briefly homogenization samples mda measurements 0.5 ml homogenate mixed 3.0 ml deproteinization solution 5.13 nacl 0.2 metaphosphoric acid 6.8 mm edta distilled water each sample centrifuged 1000g 5 min 0.5 ml supernatants added 2.0 ml 300 mm na2hpo4 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid reagent dtnb ellman reagent the malondialdehyde mda levels right hemisphere brain samples determined using method okhawa et al each half brain sample homogenized 150 mm potassium chloride solution using 10 strokes the assays mda levels included 0.4 ml brain homogenate 1.5 ml 0.8% thiobarbituric acid 1.5 ml 20% acetic acid ph 3.5 0.2 ml 8.1% sodium dodecyl sulphate these samples mixed incubated 100c 1 h. absorbance measured 532 nm ( 1979 modifications briefly homogenization samples mda measurements 0.5 ml homogenate mixed 3.0 ml deproteinization solution 5.13 nacl 0.2 metaphosphoric acid 6.8 mm edta distilled water sample was centrifuged 1000g 5 min 0.5 ml supernatants added 2.0 ml 300 mm na2hpo4 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid reagent dtnb ellman reagent after dissection separation left chick brain hemispheres kept 3 days 10% formaldehyde brain volume measurements brain hemispheres rinsed water dehydrated graduated ethanol series 70% 100% ethanol rinsed xylene systematically randomized coronal sections taken brain block using leica rm-2125 microtome weltzlar germany basis 15 equally spaced 5 thick sections the brain volume estimations carried according cavalieri volume estimation formula volume total point number point invasion area average section thickness points counted monitor sony trinitron kv-14lt1e tv japan according uniform random placing using stereomicroscope zeiss stemi 200-c germany camera canon power shot g-2 tokyo japan attachment point catheter sections systematic uniform random quality acceptable coefficient error volume estimations 15 sections used sample approximately 250 points counted the data given means standard deviation box plot analyses given figures the data evaluated significant differences among groups using mann whitney u test kruskal wallis tests the al sulphate treatment ross broiler chicks first day incubation resulted increased mda levels decreased gsh levels indicators increased biochemical oxidative damage mda the mean sd levels control sham al treatments 158.6 41.2 142.8 107.2 423.7 276.5 nmol g tissue respectively as illustrated box plot figure 1 al induced 2.7-fold increase mda levels control treatment significant compared control p=0.001 sham p=0.015 groups the mean sd gsh levels seen control sham al treatments 293.6 51.4 268.8 41.1 184.6 79.9 nmol g tissue respectively again 37% decrease gsh levels control treatment significant compared control p=0.015 sham p=0.038 groups figure 2 parallel al sulphate treatment resulted decreased brain volume measure brain development ross broiler chicks the mean sd total brain volume estimations according cavalieri volume formula see methods control sham al treatments 10 354 1158 10 068 900 8621 1407 thus demonstrated significant 17% decrease brain volume active treatment group compared control group p=0.021 significance also maintained sham treatment p=0.021 figure 3 note the comparisons control sham treatment groups showed significant differences mda gsh levels brain volumes figures 13 similarly significant trend seen mortalities treatment period indicating treatment al followed present study result significant embryo death non treated sham treated samples in present study focused particular neurotoxic effects al terms growth development brain exposure developing chicks al indeed vitro study toxic effects al human embryonic cerebral neurocytes increases lipid peroxides seen indicative neurotoxic effects al caused lipid peroxidation resultant damage membranes similarly indicated developing mouse brain al exposure foetus via al treatment mother leads inhibitory effects post partum development general seen decreased weight body length pups delayed neurobehavioral development biochemical viewpoint developing rat exposed al treated mother lactation increased lipid peroxidation seen cerebrum cerebellum pup brains accompanied decreases superoxide dismutase catalase activities present study biochemical measures mda gsh proven relevant biological measures determination lipid peroxidation biochemical oxidative damage caused al mouse rabbit models also mainly rat models 3,14,24,25,3241 furthermore provided direct al treatment developing brain use chick embryonic development model indeed model shown previously useful measured dosing various teratogenic effects heavy metals specifically recent studies comparing herbicide heavy metal effects thus although model might directly parallel influence agents environmental contaminants provide direct measured dosing absorption monitoring effects embryo development time also monitored neuronal degeneration estimated stereologically using cavalieri brain volume estimation tool the increased lipid peroxidation oxidative damage caused al treatment chick embryonic development model present study support conclusions various animal models particular along present study number studies investigated whole brain others investigated specific areas brain thus effects al seen level cerebral cortex 3135,37,38,41 hippocampus cerebellum medulla oblongata hypothalamus brain stem thus biochemical data al treatment chick embryonic development model parallel indicators increased lipid peroxidation oxidative damage although level remains seen within regions developing chick brain neurotoxic effects might focused histopathologically al neurotoxicity appears followed fewer animal models rabbit study indicated biochemical measures mda gsh were accompanied morpho pathological examination cerebral cortex hippocampus light electron microscopy brain areas atrophy neuron apoptosis seen accompanied neurofibrillary degeneration argyrophilic inclusion schwann cell degeneration nerve fibre demyelination similarly histopathological examinations hippocampus 2 rat models following al treatment showed marked changes general brain histology indicated increased number vacuolated spaces specifically effects neuronal connectivity hippocampus al effects seen hippocampus brain damage model investigation learning memory functions was recently reported established via intragastric administration elemental al adult rats similarly adult mice rats treated alcl3 plus galactose represent model alzheimer disease due memory impairment high amyloid beta peptide levels found cerebral cortex hippocampus thus various studies literature using specific adult animal models support neurotoxic effects al seen present study model developing chick brain

summarybackgroundaluminium ( al ) is known to have neurotoxic effects that can result in oxidative damage to a range of cellular biomolecules . these effects appear to be of significance in the developmental stages of the brain . we therefore investigated the oxidative and histopathological damage induced by al during growth and development of the chick brain.material/methodswe used a chick embryonic development model , with al treatment of 500 g al sulphate in 0.1 ml saline injected into the egg air chambers at the beginning of their incubation period . the effects on chick - brain growth and development were then assessed at term ( day 21 ) . determination of malondialdehyde and glutathione levels were used as relevant biological measures for increased oxidative stress in terms of lipid peroxidation and biochemical oxidative damage , respectively . furthermore , we also monitored neuronal degeneration as estimated stereologically using the cavalieri brain volume estimation tool.resultsthis al treatment showed significantly increased mda levels and decreased gsh levels , as indicators of increased biochemical oxidative damage . this was accompanied by significantly decreased brain volume , as a measure of neuronal degeneration during brain development in this chick embryonic development model.conclusionsexposure to al during chick embryonic development results in increased oxidative stress in the brain that is accompanied by neuronal degeneration .

macula rhegmatogenous retinal detachment rd common cause ophthalmic emergency requires surgical treatment short period time prevent visual loss the annual incidence rd varies according recent references 15.4 18.2 per 100 000 peak incidence 52.5 per 100 000 people 55 59 years age myopia major risk factor 4-fold higher risk rd compared nonmyopic eye eyes mild myopia 10-fold higher risk eyes moderate high myopia greater 3 diopters the risk rd 4 times higher patients undergone cataract surgery 5 6 the repair rd improved last 20 years today goal reattach retina achieve adequate final vision the development better surgical techniques scleral buckling pneumatic retinopexy pars plana vitrectomy ppv continued improve anatomical success rates going 70% 90% achieving better functional outcomes 79 nevertheless proper end vision recovery challenge many cases rd besides adequate anatomical reattachment clinical factors identified determinants prevent good functional recovery the status macula main factor successful functional result 1012 even successful rd surgery clinically normal macular area poor visual acuity va color vision defects metamorphopsia described successful postoperative rd macula surgeries suggesting existence microstructural retina damage many series cases reported excellent anatomical results functional outcome rd surgery in fact many surgeons assume macula rd always better visual function prognosis macula papers dealing topic we performed pubmed search english language manuscripts reporting rd macula functional outcomes published since 2003 4 reports identified 10 11 13 14 for reason evaluated data collected prospective multicentric study including 17 centers spain portugal data rds consecutively treated primarily designed add information pvr development clinical risk factors 1519 the purpose report analyze macula rd cases anatomical successful treated experienced loss vision third month follow seventeen clinical ophthalmological institutions spain portugal participated study 1216 as mentioned project designed improve sensitivity specificity formula published rodrguez de la ra et al using clinical factors calculating risk developing proliferative vitreoretinopathy pvr rd surgery for project database record created collecting 83 variables included pre- intra- postoperative characteristics the study protocol approved research committee coordinating institution ioba university valladolid spain participating centers informed consent obtained patient inclusion data common database all patients consecutively admitted surgery october 2004 february 2008 rd minimum follow three months considered inclusion for present analysis patients macula rd time surgery macula entire follow included cases preoperative pvr grade c-1 higher according retina society classification posttraumatic rd excluded patients incomplete data regarding status macula also excluded final analysis period time when these patients included centers optical coherent tomography oct technology available considered routine component rd patient examination therefore status macula determined indirect ophthalmoscopy posterior biomicroscopy immediate preoperative period less 24 hours surgery from the rd patients included whole study 357 macula rds considered subject sample study the patients divided 4 groups analysis according status lens functional outcome 3 months follow a reduction least one line best corrected va bcva snellen chart third month follow considered visual loss group 1 g1 n 357 included whole sample macula patients group 2 g2 n 53 included macula patients reattached retina experienced visual loss third month follow group 3 g3 n 39 included phakic eyes g2 group 4 g4 n 14 involved pseudophakic eyes g2 the main preoperative characteristics recorded g2 g3 g4 retinal breaks type tear hole dialysis giant tear size retinal breaks clock hours extension rd quadrants presence preoperative pvr less grade c previous aphakia previous vitreous hemorrhage posterior vitreous detachment myopia preoperative visual acuity table 1 27 total 83 characteristics gathered whole study used analysis report surgeons participating study highly experienced rd treatment allowed treat patients criteria according personal experience the endotamponade ppv diverse including none air sf6 c3f8 silicone oil most technical details whole series already published 1520 anatomical success defined reattached retina last postoperative follow three months functional outcome recorded bcva snellen chart initial preoperative visit final 3-month follow visit for statistical analysis bcva data grouped three ranges 20/40 20/50 20/100 20/100 qualitative variables described percentages quantitative ones mean standard deviation sd cases 95% confidence intervals 95%ci calculated contingency tables constructed evaluate association categorical rd characteristics anatomical functional outcomes the independence checked chi square test fisher exact test sparse tables statistical analysis conducted spss v.19 spss chicago il usa r software the average age g1 rd subjects 52.9 15.6 years surgery performed the mean time onset rd signs symptoms surgery 13.3 24.9 days although patients macula time surgery comparing preoperative characteristics overall study patients g1 patients macula group statistically different following table 2 ( 1 absence clinical signs pvr preoperative examination frequent g1 ( 2 rd extension 1 quadrant frequent g1 3 percentage previous cataract surgery g1 slightly higher 4 eyes without myopia less frequent g1 and differences pre- intra- postoperative clinical characteristics statistically significant main preoperative characteristics g1 compared whole study series cohort shown table 2 g1 345 eyes 96.6% 95%ci 9498.2% reattached retinas end follow 12 eyes the central retina reattached therefore excluded analysis single reattachment procedures included ppv 67.2% 95%ci 62.172% scleral buckle 57.7% 95%ci 52.4% 62.9% explant 11.9% 95%ci 8.815.9% the mean bcva g1 0.57 0.3 preoperative visit 0.59 0.29 3 months follow the preoperative va g1 20/100 44 patients 12.3% 95%ci 8.9% 15.7% 20/100 20/40 79 eyes 22.1% 95%ci 17.8% 26.4% 20/40 234 eyes 65.6% 95%ci 60.6% 70.5% table 2 the postoperative va group end follow 20/100 37 eyes 10.4% 95%ci 7.2% 13.5% 20/100 20/40 80 eyes 22.4% 95%ci 18.1% 26.7% 20/40 240 eyes 67.2% 95%ci 62.4% 72.1% twenty six 37 eyes final va 20/100 7.3% 95%ci 4.9% 10.6% decreased va end follow in g2 table 1 included phakic pseudophakic eyes reattached retinas visual loss final va 0.23 0.14 lower initial va 0.65 0.25 p 0.0001 paired test despite reattachment retina ppv commonly performed surgery 88.7% 95%ci 80.297.2% followed scleral buckle surgery 58.5% 95%ci 45.271.8% cases procedures used g3 tables 1 3 included 39 phakic eyes reattached retinas reduction va end follow the mean time onset rd surgery 17.7 24.9 days preoperative va evaluation 82.1% eyes n 32 20/40 none 20/100 end third month 30.8% n 12 20/100 the main preoperative characteristics group following 1 pvr present 48.7% whereas pvr grades b present 33.3% 17.9% respectively 2 visible retinal tear unique break present 97.4% 52.6% respectively 3 rd extensions 2 3 quadrants found 59% complete posterior vitreous detachment pvd present 53,8% eyes 4 ppv performed 87.2% 95%ci 71.895.2% patients scleral buckle surgery 64.1% 95%ci 47.278.3% some patients received procedures g4 tables 1 4 comprised 14 pseudophakic patients macula successful surgery visual loss end follow average age 63.3 14.4 years the initial va 20/40 12 eyes 85.7% end follow va 20/100 50% 20/100 20/40 50% cases table 4 ppv performed 92.9% 95%ci 85.9% 99.8% patients scleral buckle surgery 42.9% 95%ci 29.5 56.2% p 0.05 while published data regarding improvement anatomical results rd surgery reports showing whether rd surgery results functional improvement 911 13 14 23 24 best knowledge report regarding visual loss macula rd successful surgery rd certain variables are thought significant predictors functional outcome instance status macula important factor macular elevation detached factors age patient 9 25 poor initial vision 9 25 interval onset rd surgery 23 2729 generally assumed surgeons macula status surgery guarantees good functional results cases means preserve patients previous va however experienced macula rd cases despite successful surgery visual results favorable this experience common among retinal surgeons mentioned specific publication topic thus although original study specifically set investigate event used data analyze frequency unfavorable outcomes add clinical information study 53 357 patients 14.9% 95%ci 11.419.1% meeting inclusion criteria experienced worsening va rd surgery although macula attached the american academy ophthalmology recognized status macula major factor related visual prognosis it recommends rd affect macula repair made within first 24 hours following diagnosis series mean time onset symptoms surgery 13.3 24.9 days nevertheless surgery always performed within 72 hours admittance hospital although symptoms started several days central vision affected rd it likely patients general practitioners underestimated severity disease may explain delayed diagnosis in addition photopsias could appear several days even weeks development rd this long interval surgery already mentioned group could fact related structure national health system patients complaining floaters flashes referred general practitioner instead ophthalmologist gp 16 30 it acknowledged time interval surgery crucial prevent progression subretinal fluid macula disruption photoreceptors causing possible loss va cases patients macula rds the evaluations made indirect ophthalmoscopy fundus biomicroscopy 24 48 hours prior surgery thus possible could detect presence small amount subretinal fluid macula limitation study it possible systematic analysis status macula oct may increase number macula patients also structural changes patients visual loss could detected recent studies used fourier domain oct evaluate postoperatively macula macula rds 32 33 foveal anatomical abnormalities discovered 62% patients macula cases disruption photoreceptor inner segment outer segment os junction line correspond ellipsoid portion photoreceptors ellipsoid 61% cases external limiting membrane elm observed 24% when followed overtime restoration normal os line occurred eyes without initially disrupted elm investigators also noted eyes os junction returned normal showed better va change take place it important take consideration however although oct currently widespread tool could take time patient performs considering timing management kind rd oct become sometimes indispensable auxiliary test as mentioned perform oct patients preoperatively rule subclinical extension subretinal fluid fovea reason could explain eyes similar alterations functional results significantly better others for phakic eyes experienced loss vision spite successful surgery especially operated vitrectomy possible low vision could caused progression cataracts however 14 pseudophakic eyes g4 group experienced visual loss could attributed progression lens opacity some factors intraoperative complications like rise intraocular pressure iop microscope light toxicity surgery well use silicon oil gas tamponade could produced retinal damage causing reduction inner retinal thickness due neuronal cell loss macular area however postsurgical rise iop detected series one received silicon oil tamponade groups variables safely excluded cause visual loss patients neither epiretinal membranes cystoid macular edema also causes visual loss rd surgery identified follow when conditions suspected patients evaluated oct possible as clinical differences found groups investigations elucidate causes visual loss related gross anatomic factor could photoreceptor damage caused diffusible factors released ischemic detached retina in fact oxidative damage tnf- factors used experimentally inducing damage rpe cells photoreceptors finally analysis retinas experimental retinal detachments cats reveals ultrastructural changes apoptosis gliosis occur beyond specific area detached retina these changes could one reasons impairment vision patients first study design intended solve question vision loss patients macula rd view lack reports va loss macula rd surgery considered data could interesting second limitation time inclusion patients oct available centers technology similar equipment so way know sure data may extrapolated geographical areas although retina 1 project reports yielded similar results rd surgery obtained neighboring countries 9 12 35 40 in summary added information prevalence clinically significant loss va following rd macula surgery condition affecting relevant percentage patients neither clinical surgical factors identified responsible this topic deserves study incorporating new technical devices swept source oct able identify structural changes level inner retina biochemical studies could also elucidate future whether molecule released detached retina may responsible damage

purpose . to quantify the frequency of visual loss after successful retinal detachment ( rd ) surgery in macula - on patients in a multicentric , prospective series of rd . methods . clinical variables from consecutive macula - on rd patients were collected in a prospective multicentric study . visual loss was defined as at least a reduction in one line in best corrected visual acuity ( va ) with snellen chart . the series were divided into 4 subgroups : ( 1 ) all macula - on eyes ( n = 357 ) ; ( 2 ) macula - on patients with visual loss at the third month of follow - up ( n = 53 ) which were further subdivided in ( 3 ) phakic eyes ( n = 39 ) ; and ( 4 ) pseudophakic eyes ( n = 14 ) . results . fifty - three eyes ( 14.9% ) had visual loss three months after surgery ( n = 39 phakic eyes ; n = 14 pseudophakic eyes ) . there were no statistically significant differences between them regarding their clinical characteristics . pars plana vitrectomy ( ppv ) was used in 67.2% of cases , scleral buckle in 57.7% , and scleral explant in 11.9% ( 36.1% were combined procedures ) . conclusions . around 15% of macula - on rd eyes lose va after successful surgery . development of cataracts may be one cause in phakic eyes , but vision loss in pseudophakic eyes could have other explanations such as the effect of released factors produced by retinal ischemia on the macula area . further investigations are necessary to elucidate this hypothesis .

reactive oxygen species ros normally produced aerobic metabolism function second messengers involved many cellular functions hand ros level increases oxidant treatments and/or defective antioxidant systems highly reactive compounds radicals become dangerous toxic agents in fact ros may cause severe damages several cellular macromolecules including proteins lipids dna thus contributing development many pathological conditions indeed several evidences reported indicating redox homeostasis finely regulated mechanism involved normal cellular functions prevention several stress associated pathologies many drugs toxic side effects provoke imbalance intracellular ros level past cellular death due chemical injury frequently linked necrotic process clear main effect provoked several drugs programmed cell death diclofenac nonsteroidal anti inflammatory drug nsaid widely used clinical therapeutics cytotoxic effects induces apoptosis many cultured cell lines 3 4 many experimental epidemiologic clinical studies suggest nsaids particular highly selective cyclooxigenase-2 inhibitors could act anticancer agents 5 6 it reported combination specific nsaid certain anticancer drugs potential clinical applications for instance diclofenac potentiates chemotherapeutic effects drugs neuroblastoma cell lines however little known effect nsaid nervous cell lines studies compound regard hepatic gastric kidney cells 3 4 9 particular ros involved diclofenac induced apoptosis cultured gastric cells well nephrotoxicity vivo 9 10 furthermore oxidative injury causes mitochondrial permeability transition diclofenac treated hepatocytes however molecular mechanisms underlying induction apoptosis diclofenac clarified neuronal cells paper investigated involvement mitochondrial dysfunction mechanism diclofenac induced apoptosis neuroblastoma cell line sh sy5y in particular analyzed role manganese superoxide dismutase sod2 process sod2 key enzyme mitochondrial matrix involved protection oxidative stress converts toxic superoxide anions hydrogen peroxide molecular oxygen numerous reports demonstrated sod2 essential role protection many apoptotic stimuli 1214 in fact mice partial deficiency sod2 gene sod2(+/ increases sensitivity apoptosis whereas overexpression antiapoptotic effect in particular sod2 involved inhibition mitochondrial permeability transition cell treatment tumor necrosis factor- ionizing radiations 1618 blocks fas mediated apoptosis 19 20 our data show treatment neuroblastoma cell line sh sy5y diclofenac induces decrease sod2 protein level increase ros concentration this impaired redox balance predisposes cell apoptosis mechanism involving mitochondrial pathway rpmi 1640 medium fetal bovine serum fbs l glutamine penicillin g streptomycin trypsin purchased cambrex rhodamine 123 r123 dichlorofluorescein diacetate dcfh da propidium iodide purchased sigma polyclonal antibody human sod2 purchased upstate polyclonal antibody gapdh obtained cell signaling polyclonal antibody -tubulin goat polyclonal antibody cox-4 monoclonal antibody cytochrome c secondary antibody conjugated horseradish peroxidase obtained santa cruz biotechnology recombinant thioredoxin a2 hyperthermophilic archaeon sulfolobus solfataricus sstrx obtained previously reported the human neuroblastoma cell line sh sy5y obtained american type culture collection sh sy5y cells grown rpmi 1640 medium supplemented 10% fbs 2 mm l glutamine 100 iu ml penicillin g 100 g ml streptomycin humidified incubator 37c 5% co2 atmosphere they split seeded plates 75 cm every three days used assays exponential phase growth an increasing concentration diclofenac added cultures cells incubated different times cytotoxicity quantitatively assessed measurements lactate dehydrogenase ldh activity released extracellular fluid damaged destroyed cells briefly different aliquots cell incubation media added 1-ml reaction mixture containing 0.1 tris hcl ph 7.5 125 nadh incubated 15 minutes 30c the reaction started addition 600 sodium pyruvate followed decrease absorbance 340 nm the results normalized 100% death caused cell sonication determine number apoptotic nuclei diclofenac treated cells 3 10 cells well seeded 96-well plates ; at end treatment cell suspensions centrifuged pellets resuspended hypotonic lysis solution containing 50 g ml propidium iodide after incubation 4c 30 minutes cells analysed flow cytometry evaluate presence nuclei dna content lower diploid the intracellular ros level detected using oxidation sensitive fluorescence probe dcfh da briefly cells seeded 6-well plate 3 10 cells well treated 150 diclofenac different times dcfh da added dark 10 final concentration 30 minutes end incubation cells collected washed 10 mm sodium phosphate ph 7.2 buffer containing 150 mm nacl pbs finally resuspended 500 l pbs fluorimetric analysis the measurement ros levels realised cary eclipse fluorescence spectrophotometer varian excitation emission wavelengths 485 nm 530 nm respectively excitation emission slits set 10 nm analysis sod2 mrna expression total rna extracted 1 10 cells using trizol reagent invitrogen described manufacturer the yield integrity rna sample checked spectrophotometrically 260 nm agarose gel electrophoresis respectively equal amounts rna 24 g subjected reverse transcriptase polymerase chain reaction rt pcr using specific kit invitrogen random primers three dilutions cdna amplified pcr using taq dna polymerase invitrogen dna amplification sod2 glyceraldehyde-3-phosphate dehydrogenase gapdh the pcr program 5 minutes initial denaturation 95c 2023 cycles amplification 95c 1 minute 50c 1 minute 72c 1 minute final extension step 72c 10 minutes the following primers used 5d tacgtgaacaacctgaacgt-3 sense 5d caagccatgtatctttcagtta antisense sod2 5d caccatcttccaggagcgag-3 sense 5d tcacgccacagtttcccgga-3 antisense gapdh sod2 pcr products normalized respective intensity house keeping gene gapdh briefly cells seeded 6-well plate 3 10 cells well incubated 37c 1 hour presence 5 r123 washed twice pbs placed fresh complete medium containing 150 diclofenac after different times drug treatment medium withdrawn collected cells washed twice pbs after detachment trypsin cells harvested pbs centrifuged 4c 10 minutes following aspiration supernatant cellular pellet resuspended 500 l pbs the fluorescence cell associated r123 measured mentioned fluorescence spectrophotometer using excitation emission wavelengths 490 nm 520 nm respectively excitation emission slits set 10 nm sh sy5y cells plated density 3 10 cells well 6-well plates 150 diclofenac added cultures drug treatment cells harvested washed pbs lysed ice cold modified ripa buffer 50 mm tris hcl ph 7.4 150 mm nacl 1% nonidet p-40 0.25% sodium deoxycolate 1 mm na3vo4 1 mm naf supplemented protease inhibitors incubated 30 minutes ice the supernatant obtained centrifugation 12,000 g 30 minutes 4c constituted total protein extract briefly protein samples dissolved sds reducing loading buffer run 14% sds page transferred immobilon p membrane millipore the filter incubated specific primary antibody 4c overnight horseradish peroxidase linked secondary antibody room temperature 1 hour membranes analyzed enhanced chemiluminescence reaction using super signal west pico kit pierce according manufacturer instructions signals visualized autoradiography sh sy5y cells plated density 2 10 cells plate 75 cm treatment 150 diclofenac cells harvested washed pbs resuspended buffer 5 mm hepes ph 7.4 250 mm mannitol 0.5 mm egta 0.1% bsa supplemented protease inhibitors homogenized the homogenate centrifuged 800 g 10 minutes 4c supernatant centrifuged 12,000 g 30 minutes 4c the resulting pellet mitochondrial fraction resuspended buffer final supernatant represented cytosolic fraction aliquots fractions cytosolic mitochondrial used western blotting analysis cytochrome c localization sh sy5y cells plated density 2 10 cells plate 75 cm one day plating 150 diclofenac added cultures cells collected different times previously indicated centrifuged 300 g 4c 5 minutes washed pbs finally resuspended 50 mm potassium phoshate ph 7.8 containing 1 mm edta the cellular suspension sonicated centrifuged 20,000 g 4c 30 minutes protein quantitation supernatant used activity gel assay particular aliquots cell extracts 50 g fractionated 10% polyacrylamide gel sod activity evaluated previously described this method based inhibitory effect sod reduction nitro blue tetrazolium superoxide anions generated photochemical reduction riboflavin sod visualized colourless band blue background all results presented histograms data average sd least three independent measurements particular data analyzed one way anova differences considered significant corresponding p values .05 bonferroni post hoc test to evaluate whether diclofenac cytotoxic effects neuronal cells human neuroblastoma cell line sh sy5y incubated 24 hours increasing concentrations diclofenac propidium iodide incorporation followed flow cytometric analysis showed dose dependent increase apoptotic nuclei sub diploid dna content figure 1(a the cytosolic enzyme lactate dehydrogenase ldh already used marker cytotoxic injury indeed significant increase ldh activity typically found culture media cells undergoing disruption plasma membrane aim assayed ldh activity culture media sh sy5y cells incubated 48 hours increasing concentrations diclofenac no significant release intracellular ldh observed 150 diclofenac shown taken maximal concentration compound causing significant cytotoxic effect mntc analyse time dependent increase apoptosis sh sy5y cells exposed 150 diclofenac analysed different times shown figure 1(b apoptotic process already evident 8-hour treatment progressively increased 72 hours it known nsaids alter redox state different cell types enhancement intracellular ros levels 911 therefore decided investigate whether diclofenac affects intracellular ros levels also sh sy5y cells using fluorescent probe dcfh da indeed cells incubated diclofenac dcfh da different times early increase ros level detected respect control cells furthermore ros production progressively continued least 4 hours figure 2 as sod2 primary antioxidant enzyme mitochondria protecting cells oxidative injuries evaluated role exerted enzyme sh sy5y cells course diclofenac treatment aim dose- time dependent effects drug sod2 protein levels sh sy5y cells analysed experiments reported figure 3 when neuronal cells incubated 24 hours increasing diclofenac concentrations dose dependent decrease sod2 protein level observed evaluated western blotting using antibodies human sod2 figure 3(a a similar picture emerged sh sy5y cells incubated 150 diclofenac analysed different times the decrease sod2 levels figure 3(b evident 24-hour treatment increased 48 hours investigate possibility reduction sod2 protein levels corresponded also decrease sod activity protein extracts obtained cells incubated 150 diclofenac analysed different times using sod activity gel allows detection activity mitochondrial sod2 cytosolic sod1 interestingly sod2 activity decreased time dependent manner figure 4 thus indicating reduction enzyme level caused lower efficiency defence superoxide anions vice versa activity sod1 affected diclofenac treatment shown we also evaluated whether diclofenac induced decrease sod2 levels activity depends regulation corresponding mrna aim sh sy5y cells incubated presence absence 150 diclofenac 4 8 24 hours order evaluate possible regulation enzyme transcriptional level rna extraction cdna obtained reverse transcriptase used template pcr realised presence specific oligonucleotides sod2 the data presented figure 5 indicate diclofenac treatment significantly alter mrna levels sod2 times investigated a similar picture proportionally lower signals emerged dilutions cdna template used rt pcr assay shown these results together low number amplification cycles used confirm employed pcr conditions fell linear dose response range thioredoxin trx small 12 kda ubiquitous protein involved many cellular functions potent disulphide oxidoreductase controlling reduced state intracellular proteins the crucial antioxidant power trx also takes advantage ability cross cellular membrane fact evidences reported trx released cells 2628 even enter living cell 29 30 moreover endogenously produced exogenously added trx increases sod2 expression lung carcinoma neuronal cells aim effect trxa2 hyperthermophilic archaeon sulfolobus solfataricus sstrx reduction sod2 levels caused diclofenac evaluated figure 6 sh sy5y cells treated 150 diclofenac sod2 protein level significantly reduced the addition increasing concentrations sstrx allowed restoration sod2 level thus counteracting effect diclofenac in particular presence 10 sstrx amount sod2 even higher compared untreated cells control experiment the addition 10 sstrx cause significant variation sod2 level absence diclofenac shown the possible protective effect sstrx diclofenac induced apoptosis also evaluated shown figure 7 addition sstrx partially reverted programmed cell death provoked drug in particular presence 10 sstrx apoptosis diclofenac treated cells reduced times investigated loss membrane mitochondrial potential occurs early event apoptosis induced specific stimuli cellular systems better evaluate molecular mechanisms underlying diclofenac induced apoptosis sh sy5y cells efficiency mitochondrial function evaluated measurements membrane potential using fluorescent probe r123 it known compound crosses mitochondrial membrane accumulates matrix transmembrane potential preserved therefore case loss membrane potential r123 fluorescence undergoes significant reduction shown figure 8 mitochondrial incorporation r123 sh sy5y cells treated 150 diclofenac underwent significant reduction compared measured untreated cells this hypopolarization mitochondrial membrane caused diclofenac became evident 2-hour treatment significantly increased incubation time a deeper insight involvement mitochondria diclofenac induced apoptosis realised western blotting analysis aimed evaluation cytochrome c release mitochondria in particular detection cytochrome c carried cytosolic mitochondrial protein fractions sh sy5y cells incubated absence presence 150 diclofenac different times figure 9 interestingly cytochrome c already present 8-hour incubation mainly cytosolic fraction diclofenac treated cells moreover amount mitochondrial marker cytosol significantly increased 24-hour treatment figure 9(a this behaviour confirmed concomitant analysis mitochondrial fraction reduction cytochrome c level observed diclofenac treated cells figure 9(b these data indicate cytochrome c released mitochondria consequence diclofenac treatment sh sy5y cells in paper describe effects diclofenac cultures neuroblastoma cell line sh sy5y thus extending neuronal cell knowledge possible toxicity drug already reported gastric hepatic renal cells indeed present evidence diclofenac induces apoptosis modulation mitochondrial function associated alteration redox homeostasis known apoptosis primary cell death induced drugs process mainly mediated mitochondrial pathway 36 37 here we show diclofenac induces apoptosis sh sy5y cells time- concentration dependent manner thus suggesting compound somehow toxic even neuronal type cell previous pharmacokinetic studies demonstrated blood level diclofenac basis therapeutic doses used patients 50150 mg day ranges 10 30 however circumstances local concentration drug might increase particular diclofenac concentration increases consequence long term treatments overdosing limited clearance forth previously reported 3942 reasons vitro studies used diclofenac concentration 150 value corresponded maximal concentration compound causing cytotoxicity determined cytotoxicity assays sh sy5y cells light large therapeutic usage diclofenac data relevant known ability drug cross blood brain barrier apoptosis regulated many signals metabolic events cellular redox state plays critical role process indeed several data showed ros mainly produced mitochondria involved programmed cell death induction oxidative stress in particular increased ros level frequently represents triggering event upstream mitochondrial membrane depolarization cytochrome c release caspase activation nuclear fragmentation an alteration ros levels already demonstrated diclofenac induced apoptosis gastric renal cells 9 10 also neuronal cell system diclofenac provokes early significant increase intracellular ros levels these results prompted us evaluate downstream effects altered ros levels course diclofenac treatment sh sy5y cells concern sod2 represents major antioxidant enzyme mitochondria intense cellular respiration may produce large amount ros therefore efficient sod2 activity required counteract mitochondrial dysfunction induced oxidative stress could lead programmed cell death usually observed various disease contexts antiapoptotic role sod2 even demonstrated resistance radiation induced damage reported cell lines overexpressing sod2 our data sh sy5y cells show diclofenac impairs sod2 functions thus suggesting enzyme involved apoptotic mechanism induced drug particular process associated significant concomitant reduction protein level enzymatic activity sod2 whereas rt pcr experiments showed corresponding mrna levels affected diclofenac treatment therefore transcriptional regulation sod2 gene diclofenac could excluded probably increased degradation protein levels could explain reduced activity enzyme the behaviour sod2 diclofenac response compared effects reported compounds various experimental systems for instance stautosporine protein kinase inhibitor affect mrna levels sod1 sod2 decreased protein activity levels enzymes other authors reported sod2 degraded caspases jurkat cells following oligomerization fas receptor hand rat astrocytes lipopolysaccharide induced increase sod2 mrna sod2 protein these observations confirm regulation sod2 functions following drug treatment however differences observed among various experimental systems indicate sod2 response multifactorial process poorly clarified it known induction sod2 mediated various macromolecules interleukyn-1 lipopolysaccarides tumor necrosis factor- furthermore thiol reducing agents affect sod2 biosynthesis demonstrated enhanced sod2 expression caused thioredoxin potent disulfide oxidoreductase in paper addition heterologous thioredoxin diclofenac treated cultures sh sy5y led enhancement sod2 levels well reduction apoptosis this result confirms involvement sod2 apoptotic processes induced drug suggests archaeal thioredoxin active also human cells furthermore speculate possible functional interaction heterologous components thioredoxin system purified archaeal sstrx added oxidised inactive form conversion reduced active form involves reaction putatively catalysed human thioredoxin reductase the increased ros level low functionality mitochondrial antioxidant enzyme sod2 together partial recovery sod2 properties heterelogous thioredoxin strongly suggest involvement mitochondria diclofenac induced apoptosis sh sy5y cells indeed excessive production ros decrease sod2 levels contribute mitochondrial dysfunction in particular significant loss mithocondrial membrane potential apoptosis inducing factors released mitochondria thus leading activation caspase cascade ultimately nuclear condensation 44 45 53 54 also system diclofenac treatment induces early mitochondrial hypopolarization correlated increase intracellular ros levels events representing typical features onset mitochondrial apoptosis another crucial marker intrinsic apoptosis cytocrome c release mitochondria consequence membrane depolarization our data showed cytochrome c translocates mitochondria cytosol diclofenac treatment sh sy5y cells this finding together mitochondrial membrane depolarization provides direct link mitochondria diclofenac induced apoptosis thus confirming programmed cell death sh sy5y follows mitochondrial pathway the results obtained work could relevant deeper insight therapeutic usage diclofenac pointing oxidative damage related cytotoxic effect in particular involvement main antioxidant mitochondrial enzyme apoptotic process may suggest use sod2 small interfering rna combination diclofenac order improve treatment cancer neuroblastoma hand diclofenac because ability alter cellular redox state neuronal cells could considered neurotoxic compound concern previous studies showed diclofenac indomethacin another nsaid enhance effects neurotoxins pc12 cells diclofenac inhibits proliferation differentiation neuronal stem cells our results protective effects sstrx open perspectives possible counteraction side effects caused diclofenac

diclofenac , a nonsteroidal anti - inflammatory drug , induces apoptosis on the neuroblastoma cell line sh - sy5y through a mitochondrial dysfunction , affecting some antioxidant mechanisms . indeed , the time- and dose - dependent increase of apoptosis is associated to an early enhancement of the reactive oxygen species ( ros ) . mitochondrial superoxide dismutase ( sod2 ) plays a crucial role in the defence against ros , thus protecting against several apoptotic stimuli . diclofenac decreased the protein levels and the enzymatic activity of sod2 , without any significant impairment of the corresponding mrna levels in the sh - sy5y extracts . when cells were incubated with an archaeal exogenous thioredoxin , an attenuation of the diclofenac - induced apoptosis was observed , together with an increase of sod2 protein levels . furthermore , diclofenac impaired the mitochondrial membrane potential , leading to a release of cytochrome c. these data suggest that mitochondria are involved in the diclofenac - induced apoptosis of sh - sy5y cells and point to a possible role of sod2 in this process .

bacterium escherichia coli widely used indicator bacteriological condition food environments due almost exclusively fecal origin the presence e. coli fresh marketed seafood indicates recent contamination usually attributed infected handlers storage contaminated ice the intensification production consequent increase stocking density made fish farming vulnerable disease 3 4 the indiscriminate use antibiotics treat infections promote growth shown inefficient long run put selective pressure bacterial populations favoring development resistant strains potentially hazardous public health 57 in fact bacterial strains resistant different families antibiotics isolated environmental samples number researchers 810 foodborne strains resistant antibiotics pose risk consumers health favor transference phenotype humans food chain 1113 there reports illnesses caused e. coli farmed fish resistant strains may selected due presence antibiotics culture environment leading dissemination mobile genetic elements resistance potentially pathogenic bacteria 1417 due importance tilapia farming northeastern brazil the aim present study investigate presence e. coli fresh marketed nile tilapia obtained supermarkets fortaleza brazil b establish antibiotic susceptibility profile e. coli strains isolated nile tilapia samples c determine whether resistance potentially chromosomal plasmidial determine multiple antibiotic resistance index strains isolated gills muscle body surface thirty six specimens nile tilapia oreochromis niloticus collected twelve supermarkets fortaleza cear brazil the specimens wrapped individually plastic film transported ice cooled isothermal boxes laboratory seafood environmental microbiology marine sciences institute federal university cear immediate bacteriological analysis the e. coli investigation followed guidelines fourth edition compendium methods microbiological examination foods released american public health association presumptive tests performed separately gills muscle body surface sample body surface area measuring 10 10 cm was stroked sterile cotton swab previously soaked difco brain heart infusion bhi broth subsequently immersed 9 ml 0.85% nacl solution vetec diluted serially 10 sample gills 25 g aliquot homogenized 225 ml 0.85% nacl solution shaken magnetic stirrer 30 min diluted serially 10 sample muscle 25 g aliquot ground homogenized 225 ml 0.85% nacl solution diluted serially 10 a 1 ml aliquot retrieved saline dilution seeded three repetitions test tube containing 10 ml lauryl sulfate tryptose lst difco aliquots positive lst tubes seeded 4 ml tubes containing ec broth incubated water bath 45c 48 hours e. coli isolated using eosin methylene blue agar plates difco 35 colonies suspected e. coli selectedand submitted imvic testing colonies considered e. coli positive indole methyl red test negative voges proskauer citrate test gram negative short rods gram staining test the antibiogram done disk diffusion method using mueller hinton agar difco initially emulsion sample saline solution prepared adjustment 0.5 mcfarland turbidity standard equivalent 1 10 cfuml clsi 2010 ) susceptibility e. coli strains tested relation several families antibiotics including aminoglycoside family amikacin ami 30 g gentamicin gen 10 g carbapenem family imipenem imp 30 g cephalosporin family cephalothin cet 30 g cefotaxime ctx 30 g fluoroquinolone family ciprofloxacin cip 5 g monobactam family aztreonam atm 30 g penicillin family ampicillin amp 30 g quinolone family nalidixic acid nal 30 g sulfonamide family sulfametoxazol trimetoprim sut 25 g tetracycline family tetracycline tc 30 g using sterile tweezers commercially available antibiotic disks laborclin placed individually surface mueller hinton agar 24 hours incubation 35c strains scored susceptible intermediate resistant antibiotic based measurement inhibition halo recommended clsi the multiple antibiotic resistance mar index determined total number e. coli strains type tissue sampled gills muscle body surface using formula a/(b c total resistance score strains b total number families antibiotics tested c number strains type tissue sampled resistant e. coli strains submitted plasmid curing using acridine orange dye 100 gml sigma following exposure mutagen strains rechallenged antibiotics initially resistant forty four isolates confirmed e. coli 25 56.82% isolated gills 15 34.09% body surface 4 9.09% muscle eleven e. coli strains isolated gills body surface resistant amp sut tc especially last gills n 4 surface n 3 hand strains isolated muscle samples susceptible antibiotics tested table 1 all strains isolated gills muscle body surface susceptible ami atm cet ctx cip gen imp according authors gills diversified microbiota qualitatively quantitatively due direct contact water especially plankton feeders nile tilapia 2326 also detected e. coli nile tilapia muscle samples many authors believe muscle relatively innocuous tissue 2830 nevertheless muscle may contaminated harvesting stressful process often causes injury body surface and/or storage contaminated ice 31 32 molinari et al add e. coli commonly found gut tilapia thus authors presence muscle indication poor handling practices four resistance profiles observed study resistance tc n 5 resistance amp n 4 resistance sut+tc n 1 resistance amp+sut+tc n 1 table 2 the profiles sut+tc amp+sut+tc involved one family drugs therefore considered profiles multiple antibiotic resistance the mar indexes strains isolated body surface gills 0.037 0.026 respectively study jiao et al occurrence e. coli gut farmed nile tilapia the isolated strains susceptible ami atm ctx gen matching findings supporting notion antibiotics little used aquaculture e. coli strains resistant amp sut tc also reported ryu et al likewise resistant strains e. coli tc found wang et al the authors suggest improperly handled seafood critical reservoir dissemination bacterial genes multiple resistance acridine orange curing 11 e. coli strains resistant amp sut tc revealed resistance plasmid mediated 4 cases potentially chromosomal 7 thus residues may detected 10 days administration suggesting possibility detecting bacteria resistant sut relatively long period the presence mobile genetic elements resistance especially plasmids integrons poses risk public health evidenced koo woo not surprisingly tendencia dela pea observed indiscriminate use antibiotics aquaculture paralleled significant increase number reports resistant bacteria isolated aquaculture stock the overall high antibiotic susceptibility e. coli strains isolated fresh marketed nile tilapia satisfactory although occasional finding plasmid mediated resistance points need close microbiological surveillance farming handling marketing conditions aquaculture products nevertheless necessary note origin marketed fish order evaluate potential risk consumer

the contamination of seafood by bacteria of fecal origin , especially escherichia coli , is a widely documented sanitary problem . the objective of the present study was to isolate e. coli strains from the gills , muscle , and body surface of farmed nile tilapias ( oreochromis niloticus ) fresh - marketed in supermarkets in fortaleza ( cear , brazil ) , to determine their susceptibility to antibiotics of different families ( amikacin , gentamicin , imipenem , cephalothin , cefotaxime , ciprofloxacin , aztreonam , ampicillin , nalidixic acid , tetracycline , and sulfametoxazol - trimetoprim ) , and to determine the nature of resistance by plasmid curing . forty - four strains ( body surface = 25 , gills = 15 , muscle = 4 ) were isolated , all of which were susceptible to amikacin , aztreonam , cefotaxime , ciprofloxacin , gentamicin , and imipenem . gill and body surface samples yielded 11 isolates resistant to ampicillin , tetracycline , and sulfametoxazol - trimetoprim , 4 of which of plasmidial nature . the multiple antibiotic resistance index was higher for strains isolated from body surface than from gills . the overall high antibiotic susceptibility of e. coli strains isolated from fresh - marketed tilapia was satisfactory , although the occasional finding of plasmidial resistance points to the need for close microbiological surveillance of the farming , handling , and marketing conditions of aquaculture products .

tumor produces catecholamines norepinephrine epinephrine leads well known clinical symptoms hypertension headache sweating palpitation orthostatic hypertension it usually found extra adrenal sites diagnosed subtype paraganglioma the high dopamine level tumor caused deficiency dopamine beta hydroxylase converts dopamine norepinephrine for reason tumor differs classic pheochromocytomas many respects clinical features also oncologic aspect only two original articles five case reports reported occurrence dopamine secreting paragangliomas retroperitoneum around adrenal glands 2 8 we report interesting case establish clinical concepts rare tumor reviewing related literature a 26-year old korean woman referred accidental detection adrenal mass right side she hypertension palpitation sweating headache flank pain mass upon palpation abdomen physical examination her blood pressure 110/90 mmhg heart rate 90 beats min the results laboratory tests including complete blood count liver renal function tests unremarkable serum norepinephrine epinephrine levels normal dopamine level high 425 ng l analysis 24-hour urine sample revealed marked elevation urinary dopamine level 1,565.3 g day normal levels vanillylmandelic acid vma norepinephrine epinephrine metanephrine normetanephrine computed tomography results showed 4.3 3.2 cm hypervascular mass right adrenal gland early washout enhancement pattern 1 magnetic resonance imaging revealed 2.8 cm sized tumor located right periadrenal area abutted adrenal gland laterally ivc medially fig 2 preoperative diagnosis dopamine producing paraganglioma right retroperitoneum hand assisted laparoscopic right adrenalectomy performed firm attachment tumor adjacent structures her blood pressure continuously normal fluctuations vital signs operation it well encapsulated homogenous yellowish cut surface internal hemorrhagic spots microscopic diagnosis neuroendocrine tumor whose clinical manifestations consistent paraganglioma an immunohistochemical study showed tumor positive neuroendocrine markers cd-56 synaptophysin chromogranin the tumor ki-67 index less 1 percent negative s-100 fig her 24-hour urine dopamine level returned normal 388.4 g day operation her general condition good recurrence 10-month follow among many types paraganglioma exclusively dopamine producing type extremely rare only seven cases listed worldwide database case ever reported south korea 2 8 the exclusive production dopamine ascribed deficiency dopamine -hydroxylase converts dopamine norepinephrine catecholamine biosynthesis pathway beginning tyrosine because abnormal catecholamine synthesis pathway levels dopamine end product homovanillic acid hva increased whereas levels norepinephrine epinephrine end product vma decreased consequence clinical presentation tumor different classical pheochromocytoma secretes norepinephrine epinephrine there absence hemodynamic changes called paroxysmal symptoms usually found patients catecholamine secreting pheochromocytoma result the patients exclusively dopamine producing paraganglioma mostly asymptomatic initial diagnosis constitutional symptoms fever malaise weight loss diarrhea may occur result increased circulating dopamine level because paragangliomas tend grow larger adrenal pheochromocytomas patients experience vague abdominal pain experience palpable abdominal mass 4 8 the asymptomatic features make difficult clinicians detect tumor early stage detection even challenging physicians working institutes without routine screening procedures detection catecholamine dopamine differential diagnosis achieved measuring dopamine levels serum 24-hour urine samples clinicians rule possibility rare tumor evaluating adrenal masses normal serum norepinephrine epinephrine urinary vma levels even radiologic images strongly suggest pheochromocytoma hand assisted laparoscopic surgery adapted removal large tumors rescue operative procedures complicated cases laparoscopic surgery minimize surgical mortality caused hypertensive crisis manipulation of the tumor preoperative administration -blocker essential norepinephrine epinephrine producing pheochromocytomas however -blocker treatment contraindicated exclusively dopamine secreting paraganglioma cause profound cardiovascular collapse surgery even result death following hypotensive crisis there two subtypes dopamine receptors d1 receptor relaxes smooth muscles blood vessels d2 receptor inhibits noradrenaline release postganglionic sympathetic neurons these two effects could explain pre operative hypotension dopamine secreting tumor patients blood pressure sometimes elevated removal tumor presumably mechanism dopamine secreting paragangliomas likely present malignant features classic catecholamine secreting type paragangliomas pheochromocytomas this rare tumor tends diagnosed patients asymptomatic tumor detected later tumors secrete norepinepnrine epinephrine concerning biochemical features one report suggests decreased activity dopamine -hydroxylase results poor differentiation tumor may explain dopamine secreting type shows advanced malignant features elevated dopamine hva levels 24-hour urine 120 nmol g correlated large tumor size malignant potential extra adrenal location tumor weight 80 g dna aneuploidy triploidy persistent postoperative hypertension also reported risk factors malignant pheochromocytoma rarity tumor definite criteria evaluating malignant potential conclusion lack clinical symptoms rarity tumor lead lack delay diagnosis in addition radiologic imaging dopamine assays serum 24-hour urine collection useful diagnostic tests

exclusively dopamine producing retroperitoneal paragangliomas are extremely rare . we have experienced the first korean case managed successfully based on the proper evaluation . a 26-year - old female patient came to our attention after the accidental detection of an adrenal mass . she had no symptoms and denied any family history . laboratory evaluations were normal but serum dopamine ( 425 ng / l ) and 24-hour urine dopamine levels ( 1,565.3 g / day ) were elevated . she underwent laparoscopic right adrenalectomy . histopathological diagnosis was a paraganglioma . after operation , dopamine levels in serum and 24-hour urine dropped to 0.09 ng / l and 388.4 g / day . dopamine producing paraganglioma elicit no clinical symptoms . only the dopamine level is elevated in serum and 24-hour urine samples . surgical resection without using preoperative alpha blockage is the treatment of choice . the prognosis for patients with this tumor tends to be poor because the diagnosis is usually delayed due to lack of symptoms .

venous thromboembolism vte term encompasses deep vein thrombosis dvt pulmonary embolism pe an evaluation national hospital discharge survey census date vte united states reported annual incidence 0.49 per 10,000 peak rates neonatal period adolescence.1)2 majority children vte multiple risk factors thromboembolic disease presentation catheter related thrombosis infection congenital prothrombotic disorders.3 pe rare event children mortality rate reported approximately 10%.4 hypereosinophilia rarely associated pe adults however condition reported children a 12-year old boy admitted hospital 10 days onset cough blood tinged sputum fever right flank pain non specific bilateral knee pain two weeks prior admission patient went 10 hour automobile trip ate raw fish leukocytosis eosinophilia peak ratio 35% thrombocytopenia minimum 33,000/mm elevated c reactive protein concentration 15.5 mg dl he treated antibiotics local hospital symptoms remit he transferred institute persistent symptoms newly found signs pulmonary hypertension echocardiogram trivial tricuspid valve regurgitation tr velocity 3.2 sec}. admission persistent cough blood tinged sputum physical examination tachycardia 100 beats per minute tachypnea 39 breaths per minute rales right lung field the biochemical profile admission follows hemoglobin 9.9 g dl white blood cell wbc count 19,080/mm 32.8% eosinophils platelet count 64,000/mm erythrocyte sedimentation rate 6 mm hr c reactive protein 9.2 mg dl a coagulation assay revealed slightly prolonged prothrombin time activated partial thromboplastin time elevated fibrinogen pt inr 1.33 aptt 46.5 sec fibrinogen 585 mg dl an echocardiogram showed probable mild pulmonary hypertension trivial tr velocity 3 sec abnormal findings myocardial thickness and a chest computerized tomography ct scan showed pe right upper lower lobar pulmonary arteries left lower lobar pulmonary artery a pulmonary infarction demonstrated right lower lobe chest ct scan fig a ct angiography showed dvt left mid femoral popliteal posterior tibial veins fig 2c diffuse decrease perfusion right lung focal decrease perfusion superior segment left lower lung the patient showed evidence allergic disease parasitic infection elevated eosinophil count peripheral blood bone marrow these data led us diagnose primary hypereosinophlia however end organ dysfunction might associated hypereosinophlic syndrome also failed find specific cause hypercoagulation antithrombin iii activity 91% protein c 75% protein 82% homocysteine 6.5 mol l antinuclear antibody anticardiolipin antibody lupus anticoagulant levels either negative within normal range after diagnosis pe initially treated heparin 50 u kg bolus followed 17 u kg hr low molecular weight heparin 1 mg kg dose q 12 hours 1 month one week admission platelet count dropped 38,000/mm 14th day admission peripheral eosinophil count increased 53.4% wbc 17,250/mm total eosinophil count 9,210/l 1 month eosinophilia thrombocytopenia resolved spontaneously his general condition gradually improved concomitant resolution pulmonary thromboembolism pulmonary hypertension the patient discharged 1 month admission warfarin adjusted pt inr 2.0 based doppler sonography thrombus lower extremity resolved 3 months he took warfarin 9 months anti platelet medication aspirin 1 year without complications fifteen months admission peripheral blood examination revealed following findings hemoglobin 14.8 g dl wbc count 5,920/mm 4.2% eosinophils platelet count 230,000/mm while remaining aspirin specific symptoms evaluation outpatient clinic fig a pe occurs segment thrombus within deep venous system detaches vessel goes lungs lodges pulmonary arteries the pelvic deep veins lower extremities common source pe.5 1856 rudolf virchow identified predisposing thrombotic factors include blood stasis endothelial injury vein alteration blood coagulability mutations genes anticoagulant proteins antithrombin protein c protein important risk factors circumstantial factors include increasing age immobilization surgery pregnancy oral contraceptives hormone replacement inflammatory conditions.1)3)6 thrombotic events occur one circumstantial risk factors occur together patient high percentage eosinophils onset thromboembolism hypercoagulation result hypereosinophilia previously reported,7)8 mechanism remains poorly understood previous studies demonstrated eosinophils release toxic cationic proteins include eosinophil cationic protein eosinophil derived neurotoxin major basic protein eosinophil peroxidase platelet activating factor.8 granular proteins may promote platelet activation coagulation inhibit anticoagulation activity thrombomodulin.7 9 patient presenting peripheral blood eosinophilia reactive causes investigated first including parasitic infections allergic disorders malignancies collagen vascular disease patient report history eating raw fish find evidence parasitic infection conditions excluded if eosinophilia persists unknown etiology diagnosis hypereosinophilic syndrome considered hypereosinophilic syndrome defined eosinophil count 1,500/l sustained 6 months without clear cause.10 patient transient eosinophilia recovered spontaneously although actual onset eosinophilia identified a pe may show non specific signs symptoms symptoms although fatal especially pediatric age group diagnosis pe may delayed longer adult age group pulmonary angiography gold standard diagnosing pe invasive time consuming ct the treatment vte hemodynamically stable patients anticoagulation thrombolytic therapy indicated massive iliofemoral dvt pe hemodynamic instability the echocardiographic evidence right ventricular dysfunction helpful determining whether patient needs thrombolytic therapy.11 duration therapy decided causes underlying conditions conclusion presented case pulmonary thromboembolism accompanied idiopathic hypereosinophila child

pulmonary thromboembolism is a very rare event in children , but the mortality rate is reported to be approximately 10% . the majority of children with thromboemboli have multiple risk factors , such as a catheter - related thrombosis , an infection , and a congenital prothrombotic disorder . hypereosinophilia is very rarely associated with pulmonary emboli in adults ; however , this condition has not been reported in children . we present a 12-year - old boy who had a pulmonary thromboembolism and deep vein thrombosis associated with hypereosinophilia and thrombocytopenia . the thromboembolism was managed with anticoagulant therapy and the hypereosinophilia resolved spontaneously .

indeed 2009 half canadian patients initiating renal replacement 65 years old 1 according estimates incidence chronic renal failure 242 individuals per one million worldwide 2 1 trillion spent end stage renal disease care globally 3 though hemodialysis consists common treatment method kidney failure however stressful procedure affects dimensions patients lives 1 2 3 interestingly hemodialysis patients experience various changes limitations daily lives including diet fluid constrictions physical cognitive impairment well inadequacy accomplish prior roles duties activities additionally patients frequently experience heavy psychological burden mainly anxiety depression exerts negative influence outcome disease depression related morbidity mortality impairment quality life shortness lifespan even worse suicidal attempts 4 9 nowadays that increase life expectancy hemodialysis patients ultimate goal care slowly acknowledged social support key element achieve effective treatment management 10 11 12 as support defined offer receive aid network crisis appears support usually obtained family friends significant others health care professionals peer group others 11 12 support broadly linked improved health outcomes chronic illnesses various mechanisms decreased levels depression stress alleviation improvement patients quality life assistance access health care services better compliance therapeutic regimen direct physiologic benefits immune system 10 the extent association anxiety depression social support hemodialysis patients seldom subject systematic enquiry purpose study explore effect perceived social support levels anxiety depression hemodialysis patients criteria patients inclusion study diagnosis end stage renal disease b current hemodialysis c native language greek volunteer participation all patients included study informed given signed consent the study approved medical research ethics committee dialysis center conducted accordance declaration helsinki 1989 world medical association data collected completion specially designed questionnaire method interview the data collected patient included socio demographic characteristics eg gender age education level marital status etc clinical therapy characteristics eg years first hemodialysis frequency hemodialysis etc relations medical nursing staff patients finally patients beliefs effect illness life eg life style affected dependency dialysis machine etc the multidimensional scale perceived social support mspss translated culturally adapted greek standards 11 12 used evaluate perceived social support hemodialysis patients this scale good internal reliability test retest reliability various samples 13 14 the scale comprised 3 groups depending source support significant others b family c friends more detail family 3 4 8 11 friends 6 7 9 12 significant person 1 2 5 10 item rated using 7 range scale varying definitely definitely yes. order calculate final score dimension social support add scores questions corresponding dimension divide number questions included dimension higher scores indicate higher support evaluation depression anxiety patients hospital anxiety depression scale hads used this scale proposed 1983 zigmond snaith rp 15 the scale consists 14 questions assess patients felt previous week patients able answer every question 4-point likert scale 0 3 seven 14 questions assess level depression seven level anxiety scores attributed questions summed separately anxiety depression leading two scores range 0 21 in addition proposed widely used literature following categorization score 0 7 indicating stress depression score 8 10 indicating moderate levels anxiety depression score>11 indicating high levels anxiety depression the scale hads translated tested validity reliability greek population mistakidou al 2004 categorical variables presented absolute relative frequencies percentages quantitative variables presented median interquartile range since follow normal distribution tested kolmogorov- smirnov test test existence association levels anxiety depression social support multinomial logistic regression performed estimate effect social support levels anxiety depression dependent variable adjusted potential confounders the analysis performed statistical package spss version 20 spss inc chicago il usa the study sample representative hemodialysis patients greece convenience sample also study cross sectional thus allowing causal relation anxiety depression social support socio demographic clinical characteristics patients presented table 1 data presented median iqr table 2 conclude patients felt highly supported significant others family median 6 subscales less friends median 4.5 neutral support levels regarding levels anxiety depression 32.9% patients high levels anxiety 30.2% high levels depression contrary majority patients anxiety 38.4% depression 44.2% descriptive statistics social support levels anxiety depression patients undergoing hemodialysis n=258 table 3 presents results association social support levels anxiety depression there statistically significant association anxiety depression social support significant others family friends p=<0,001 associations in particular patients high levels anxiety depression felt less support significant others family friends table 3 appears statistically significant difference support scores patients moderate levels anxiety depression anxiety /depression association social support levels anxiety depression patients undergoing hemodialysis n=258 lastly multinomial logistic regression performed assess effect social support levels anxiety depression adjusted various potential confounding factors affecting anxiety depression table 4 we conclude effect confounders relationship anxiety social support case support significant others family high levels anxiety adjusting confounders effect social support levels anxiety depression hemodialysis patients n=258 adjusted regression following factors gender marital status educational level years problem relations nursing medical staff patients lifestyle affected furthermore conclude adjusting confounding factors statistically significant effect social support friends anxiety levels p=0,004 specifically one point increase support friends reduces 57% chances patients high levels anxiety relation anxiety addition statistically significant effect social support significant others family friends depression p 0,001 p= 0,001 p=0,003 respectively in particular one point increase support significant others family friends reduces 77% 71% 56% chances patients high levels depression socio demographic clinical characteristics patients presented table 1 from table 2 conclude patients felt highly supported significant others family median 6 subscales less friends median 4.5 neutral support levels regarding levels anxiety depression 32.9% patients high levels anxiety 30.2% high levels depression contrary majority patients anxiety 38.4% depression 44.2% descriptive statistics social support levels anxiety depression patients undergoing hemodialysis n=258 ) table 3 presents results association social support levels anxiety depression there statistically significant association anxiety depression social support significant others family friends p=<0,001 associations in particular patients high levels anxiety depression felt less support significant others family friends table 3 appears statistically significant difference support scores patients moderate levels anxiety depression anxiety /depression association social support levels anxiety depression patients undergoing hemodialysis n=258 lastly multinomial logistic regression performed assess effect social support levels anxiety depression adjusted various potential confounding factors affecting anxiety depression table 4 we conclude effect confounders relationship anxiety social support case support significant others family high levels anxiety adjusting confounders effect social support levels anxiety depression hemodialysis patients n=258 adjusted regression following factors gender marital status educational level years problem relations nursing medical staff patients lifestyle affected furthermore conclude adjusting confounding factors statistically significant effect social support friends anxiety levels p=0,004 specifically one point increase support friends reduces 57% chances patients high levels anxiety relation anxiety in addition statistically significant effect social support significant others family friends depression p 0,001 p= 0,001 p=0,003 respectively in particular one point increase support significant others family friends reduces 77% 71% 56% chances patients high levels depression the results present study showed hemodialysis participants felt highly supported significant others family less friends nowadays growing interest relation perceived social support hemodialysis reason method kidney replacement may become barrier patients social integration 17 end spectrum a supportive environment exerts positive impact clinical outcome probably due deeper understanding illness better self management 18 19 20 results also showed 32.9% 30.2% participants experienced high levels anxiety depression respectively similar results coming greece vasilopoulou et al 7 showed 47.8% hemodialysis patients experienced high levels anxiety 38.2% high level depression raymond et al 8) claimed one third patients chronic kidney disease may experience depression taken serious consideration high incidence psychiatric co morbidity hemodialysis patients imperative enhance systematic psychiatric evaluation daily clinical practice failure early diagnosis treatment depression hemodialysis patients mainly attributed overlapping symptoms associated uremia anorexia fatigue sleep disturbances 7 21 22 23 present study there serious gaps knowledge patients either seek help usually record psychiatric disorders treatment johnson et al 23 stated untreated psychiatric illness hemodialysis patients associated mortality poor quality life increased risk suicide watnick al 24 demonstrated 16% depressed participants received treatment starting hemodialysis line thought kimmel et al ( 25 highlighted importance using globally accepted tool evaluate depression anxiety hemodialysis patients hads valid instrument widely used assess anxiety depression end stage renal disease patients 20 according stasiak et al ( 22 hemodialysis patients experience high levels anxiety depression reasons limit independence visits dialysis center every three days connection dialysis machine diet fluids restrictions loss available time it noteworthy present study 89,2% participants reported life enough depended dialysis machine 43% believed life affected moreover participants spend 3 days per week 4 hours day dialysis centers stasiak et al 22 also stated among demographic clinical characteristics related anxiety depression age diabetes antidepressants beta blockers the results also revealed patients high levels anxiety depression felt less support significant others family friends ( 26 illustrated persistently high anxiety depression associated reduced perceived social support similarly genz et al 27 demonstrated depressive symptoms associated lack perceived social support vzquez et al 28 supported trait anxiety related emotional disturbance reduced social relationships tezel et al 29 showed perceived social support family negatively correlated depression the researchers also claimed patients experience lack support usually follow maladaptive ways express inner world bisschop et al 30 showed psychosocial support alleviates depressive symptoms health professionals aware family behaviors beneficial patients illness management 31 present study 62,8% 30,6% participants reported good good relations nursing staff this finding far promising health professionals deeply wish enhance patients support level social support significant others family friends associated anxiety depression firstly essential health professionals develop intervention strategies strengthen hemodialysis patients social networks secondly encourage patients express feelings address psychological needs thus confronting psychological burden disease

purpose : of this study was to explore the effect of social support on the levels of anxiety and depression of hemodialysis patients.material and methods:258 patients undergoing hemodialysis were enrolled . a questionnaire developed for the purpose of the study was used to collect data through the interview process . apart from socio - demographic , clinical and other characteristics , the questionnaire also included the multidimensional scale of perceived social support ( mspss ) to assess social support from significant others , family and friends , and the questionnaire hospital anxiety and depression scale ( hads ) to assess the levels of anxiety and depression of patients.results:53,9% of the participants were male while 34,1% of the participants were > 70 years old . 32,9% and 30,2% of the participants felt high levels of anxiety and depression , respectively . analysis of data showed a statistically significant association between anxiety / depression and social support from significant others , family and friends ( p=<0,001 for all associations ) . in particular , patients with high levels of anxiety and depression felt less support from their significant others , family and friends . the multinomial logistic regression , showed a statistically significant effect of social support from friends in anxiety levels ( p=0,004 ) . an one point increase of the support from friends seems to reduce by 57% the probability of having high levels of anxiety . in addition , statistically significant effect of social support from significant others , family and friends was observed on the levels of depression ( p=<0,001 , p=0,001 & p=0,003 , respectively ) . specifically , an one point increase of the support from significant others , family and friends it was found to reduce by 77% , 71% and 56% respectively the probability of experiencing high levels of depression.conclusions:phyco-social evaluation is essential when providing holistic care to hemodialysis patients .

esophageal achalasia rare motility disorder esophagus involving smooth muscle layer lower esophagus sphincter les incomplete relaxation increased tone this pathology characterized difficulty swallowing regurgitation sometimes chest pain specific tests diagnosis esophageal achalasia barium swallow esophageal manometry esophago gastro duodenoscopy without endoscopic ultrasound also performed rule probability cancer management dilation stretching esophagus surgery injection muscle relaxing substances botulin toxin esophagus foreseen we present case esophagus achalasia diagnosed intense rest effort dyspnea persistent cough arterial hypotension chest discomfort 12-leads ecg showed sinus rhythm pulse rate 95 beats min left axial deviation diffuse disorders repolarization also seen chest x ray revealed massively dilated esophagus along right cardiac border figure 1 ct chest showed esophageal body dilatation filled food remaining compressed left atrium figure 2 the esophageal manometry evidenced body esophageal peristalsis low amplitude esophageal body contraction failed relaxation les water swallow left atrial compression induced extrinsic structure seen two dimensional trans thoracic echocardiography 2d tte this structure elongate form filled liquid drinking differentiate esophagus cardiac formation figure 3 diastolic mitral inflow pattern showed e waves ratio 1.1 dt measured 210 msec ivrt 87 msec three dimensional echocardiography 3d tte pointed extracardiac roundish esophageal cavity compressing left atrium clearly separated heart structures figure 4 the evaluation performed parasternal approach level aortic root consented identify pulmonary trunk subdivision right left pulmonary arteries figure 5 antero posterior chest x ray shows poorly defined borders median lower right lobe lung base ct chest pointed extrinsic compression level left atrium dilated esophagus arrow two dimensional echocardiography recorded apical 4 chambers view showing extrinsic compression left atrium due dilated lengthened formation evidenced drinking liquid arrow three dimensional echocardiography performed apical 2-chambers view evidence round structure arrow compressing left atrium b three dimensional echocardiography approach more evident dilated esophagus arrow located cardiac plane separated cardiac structures three dimensional echocardiography performed parasternal approach intermediate long short axis view level aortic root clear evidence dilated esophagus arrow compressing lower segment pulmonary trunk the symptoms consequence left atrial compression reduces volume causing impairment left ventricular diastolic filling in addition consequence increased left atrial pressure pulmonary pressure also rises causing intense dyspnea leading pulmonary edema esophageal achalasia usually diagnosed chest x ray ct mri esophageal manometry functional magnetic resonance imaging fmri recently proposed evaluation esophagus motility but test choice diagnosing extrinsic compression left atrium esophageal achalasia two dimensional echocardiography 2d tte 2d tte achalasia moves asynchronously atria contrast intrinsic atrial structures case 2d echocardiography performed apical long axis view evidenced compression left atrium extracardiac structure corresponding dilated esophagus evidenced liquid drink nevertheless 2d tte limited cases acceptable sonographic window presence poor sonographic space trans esophageal echocardiography three dimensional trans thoracic echocardiography 3d tte also performed patient this firstly carried individual esophageal achalasia patient 3d tte records consented better appreciate esophagus compressing left atrium lower part pulmonary trunk even though 3d tte explanatory 2d tte consented better evaluate dilated esophagus separated left atrium compressing neighboring structures without liquid drink

esophageal achalasia is a motility disorder characterized by impaired relaxation of the lower esophageal sphincter and dilatation of the distal two - thirds of the esophagus . this condition may be a non - frequent reason of extrinsic compression of left atrium . in turn , this can be a cause of some hemodynamic changes such as chest discomfort , dyspnea or reduced exercise tolerance , systemic hypotension and tachycardia . we describe a case of a patient with esophagus achalasia compressing the left atrium and inducing hemodynamic compromise . the diagnostic methods , as chest x - ray , computed tomography ( ct ) , manometry , and 2d - trans - thoracic echocardiography ( tte ) demonstrated the esophagus dilation , the impaired relaxation of the lower esophageal sphincter , and its compression on the left atrium . three - d trans - thoracic echocardiography ( 3d - tte ) was firstly performed also . this last examination pointed out better than 2d - tte the extrinsic compression of the left atrium due to the esophagus dilatation . therefore , 3d - tte is a true improvement for the echocardiographic diagnosis of the left atrial compression induced by esophageal achalasia .

constant shortage donor organs led research xenotransplantation first reported 1906 pigs currently considered appropriate source organs xenotransplantation humans based several advantages including physiological anatomical organ similarities reproductive characteristics possibility controlled breeding ethical considerations furthermore recently research avoid rejection grafted organs involved production genetically modified pigs 1,3-galactosyltransferase gene knock pig expression human complement regulatory proteins cd46 cd55 and/or cd59 reducing risk endogenous porcine retrovirus infection resolve existing hurdles prior clinical application pig organs appropriate method evaluating vascular system micropigs must established immunological barriers must addressed transplant micropig solid organs humans evaluation vascular system anatomical comparisons essential selection suitable organ well gather sufficient pre clinical data previously standard method preoperative angiographic evaluation donor vascular system conventional angiography whose disadvantages include invasive time consuming well fact requires use ionizing radiation large amounts contrast agents in contrast multidetector row computed tomographic angiography mdcta process using doses nonionic contrast media ionizing radiation exposure less conventional angiography furthermore venography needed obtain additional information regarding venous system prior organ transplantation remarkable advancements spatial temporal resolution this technology confirmed valuable method provide road map surgical planning well assist donor selection in addition mdcta several advantages traditional angiography less invasive permits visualization organ structures possible pathology the goal study confirm feasibility using mdcta evaluate vascular system micropigs establish standard reference values vascular diameter anatomy would useful selection suitable donor organs future all experimental protocols approved ethics committee chonnam national university korea cnu iacuc yb-2008 29 physiologically genetically intact male micropigs n 6 purchased pwg genetics korea korea animals kept individual cages university central animal facility received standard pig diet water ad libitum the mean age weight animals 360 days 30.50 1.24 kg respectively prior undergoing mdcta animals fasted 24 h. animals premedicated intramuscular injection azaperone 0.5 mg kg xylazine 8 mg kg anesthetized intramuscular injection combination zolazepam tiletamine 4.4 mg kg the examinations performed using 64-channel multi detector row helical ct scanner lightspeed vct ge healthcare usa according following parameters 0.5 sec per rotation 5 mm collimation 1.0 pitch tube current 120 kv per 140~200 milliamperes the mdcta images acquired spatial resolution 0.35 0.35 0.8 mm the ct angiographic scan obtained craniocaudal direction reconstruction thickness reconstruction increment 1 mm 0.5 mm respectively for administration intravenous contrast material 20-gauge peripheral line placed ear vein scout ct image obtained arterial phase volumetric image data sets acquired following initiation intravenous injection 60 ml nonionic contrast media ultravist 370 schering ag germany rate 3 ml sec using automated injector lf ct 9000 liebel flarsheim usa automatic bolus triggering software program systematically applied circular region interest positioned level superior vena cava svc threshold triggering data acquisition preset 100 hounsfield units obtain arterial phase images imaging extended c1 cervical vertebrae knee joint including pelvis thigh volumetric data sets transferred advantage workstation 4.3 ge healthcare usa equipped volume viewer plus three dimensional 3d software subsequent review transverse 0.625-mm thick sections reformatted maximum intensity projection images volume rendered images a single radiologist reviewed ct images workstation permitted editing ct volume data sets create optimal 3d cta images volume rendering techniques typically employed maximum intensity projection rendering also used adjunct display the 3d images reviewed scrolling acquisition displayed workstation monitor conjunction assessment conventional 2d axial images the aorta divided four sections ascending arch thoracic abdominal major aortic branches measured right left common carotids celiac trunk superior mesenteric splenic external iliac superficial femoral the diameter main arteries assessed appropriate point segment 1~1.5 cm ostium using workstation electronic cursor the presence anatomic variations intrinsic vascular disease atherosclerosis and/or calcification also recorded in addition morphological evaluation measurement diameter svc inferior vena cava ivc also performed the diameter svc measured point proximal svc right atrium junction the diameter ivc measured three segments hepatic suprarenal infrarenal the values presented study expressed mean sd data obtained micropigs compared pertinent human data published literature all experimental protocols approved ethics committee chonnam national university korea cnu iacuc yb-2008 29 physiologically genetically intact male micropigs n 6 purchased pwg genetics korea korea animals kept individual cages university central animal facility received standard pig diet water ad libitum the mean age weight animals 360 days 30.50 1.24 kg respectively prior undergoing mdcta animals fasted 24 h. animals premedicated intramuscular injection azaperone 0.5 mg kg xylazine 8 mg kg anesthetized intramuscular injection combination zolazepam tiletamine 4.4 mg kg the examinations performed using 64-channel multi detector row helical ct scanner lightspeed vct ge healthcare usa according following parameters 0.5 sec per rotation 5 mm collimation 1.0 pitch tube current 120 kv per 140~200 milliamperes the mdcta images acquired spatial resolution 0.35 0.35 0.8 mm the ct angiographic scan obtained craniocaudal direction reconstruction thickness reconstruction increment 1 mm 0.5 mm respectively for administration intravenous contrast material 20-gauge peripheral line placed ear vein scout ct image obtained arterial phase volumetric image data sets acquired following initiation intravenous injection 60 ml nonionic contrast media ultravist 370 schering ag germany rate 3 ml sec using automated injector lf ct 9000 liebel flarsheim usa automatic bolus triggering software program systematically applied circular region interest positioned level superior vena cava svc threshold triggering data acquisition preset 100 hounsfield units obtain arterial phase images imaging extended c1 cervical vertebrae knee joint including pelvis thigh volumetric data sets transferred advantage workstation 4.3 ge healthcare usa equipped volume viewer plus three dimensional 3d software subsequent review transverse 0.625-mm thick sections reformatted maximum intensity projection images volume rendered images a single radiologist reviewed ct images workstation permitted editing ct volume data sets create optimal 3d cta images volume rendering techniques typically employed maximum intensity projection rendering also used adjunct display the 3d images reviewed scrolling acquisition displayed workstation monitor conjunction assessment conventional 2d axial images the aorta divided four sections ascending arch thoracic abdominal major aortic branches measured right left common carotids celiac trunk superior mesenteric splenic external iliac superficial femoral the diameter main arteries assessed appropriate point segment 1~1.5 cm ostium using workstation electronic cursor the presence anatomic variations intrinsic vascular disease atherosclerosis and/or calcification also recorded in addition morphological evaluation measurement diameter svc inferior vena cava ivc also performed the diameter svc measured point proximal svc right atrium junction the diameter ivc measured three segments hepatic suprarenal infrarenal the values presented study expressed mean sd data obtained micropigs compared pertinent human data published literature ct examinations successfully performed six micropigs evidence vascular malformation arterial stenosis aneurysm atherosclerosis calcification found animal present study measured diameters major systemic vessels compared data previously published human data table 1 the mean diameters right left common carotid arteries measured 0.57 0.08 cm 0.55 0.05 cm respectively fig 1 significant differences micropigs humans regard anatomy diameter common carotid arteries the mean diameters micropig ascending descending thoracic aorta aortic arch svc 1.69 0.12 cm 1.23 0.11 cm 1.50 0.07 cm 1.93 0.33 cm respectively the anatomic structure thoracic aorta aortic arch micropigs similar humans fig 2 diameters vessels considerably smaller humans in addition significant anatomical differences svc micropig compared human observed abdominal region evaluated abdominal aorta celiac trunk superior mesenteric artery splenic artery hepatic suprarenal infrarenal ivc the mean diameters vessels 0.85 0.06 cm 0.52 0.08 cm 0.68 0.05 cm 0.38 0.05 cm 1.65 0.20/1.59 there anatomical variations micropigs relation humans however diameter abdominal aorta significantly smaller humans fig significant differences micropigs humans regards anatomy diameter ivc in pelvic region diameters external iliac artery superficial femoral artery 0.52 0.05 cm 0.48 0.05 cm respectively 42.4% 46.3% comparable human vessels respectively in six micropigs examined external internal iliac arteries arose directly aorta solid organ transplantation currently definitive solution end stage organ failure accurate preoperative imaging donor vasculature great importance vascular variations accessory arteries early branching particularly important determining optimal organ extraction procedures type anastomosis furthermore imaging evaluation vascular systems using mdcta plays critical role solid organ transplantation facilitate selection suitable donors planning surgical procedure revealing co existing pathology the gold standard technique preoperative donor evaluation conventional angiography procedure drawback invasive angiography using mdct fast safe minimally invasive routinely used preoperative evaluation potential human donors renal liver transplantation study performed anatomical evaluations diameter measurements major systemic vessels micropigs using 64-channel mdcta the morphology branching patterns major vessels constant micropigs anatomical variations found study in addition morphology major micropig vessels reveal significant differences compared humans except case iliac artery micropigs evaluated external internal iliac arteries arose directly aorta the external artery detached one branch deep femoral artery continued femoral artery there common iliac artery corresponding humans arises aorta branches external internal iliac arteries although differences vascular diameter morphology branching pattern micropigs human overcome modern surgical techniques time transplantation possibility function related micropig organs could compromised human systems following transplantation thus studies needed evaluate compare micropig organ function humans in addition smaller diameter micropig arteries compared human vessels may problematic terms perioperative complications it suggested smaller diameter donor artery may contribute increased incidence post transplantation complications for example hepatic arteries diameters less 3 mm considered present high surgical risk liver transplantation thus accurate preoperative evaluation arterial diameter essential successful organ transplantation previous studies reported cta replace conventional angiography traditionally used preoperative evaluation potential organ donors along rapid evolution technique number detectors gradually increased allowing shorter scan rotation times submillimeter slice acquisition parameters isotropic datasets mdcta appears ideal method evaluate hepatic arteries venous anatomy well detect potential hepatic transplant complications hepatic artery and/or portal vein stenosis thrombosis in addition mdcta reported accurate renal angiography evaluating arterial anatomy sensitive detecting venous parenchymal structures therefore mdcta suitable method evaluate anatomy vascular structures potential xenotransplantation donors well human recipients conclusion present cta data major systemic vessels micropigs used standard reference values xenotransplantation studies we determined 64-channel mdcta allows accurate evaluation major systemic vasculature micropigs

due primarily to the increasing shortage of allogeneic donor organs , xenotransplantation has become the focus of a growing field of research . currently , micropigs are the most suitable donor animal for humans . however , no standard method has been developed to evaluate the systemic vascular anatomy of micropigs and standard reference values to aid in the selection of normal healthy animals as potential organ donors are lacking . using 64-channel multidetector row computed tomographic angiography ( mdcta ) , we evaluated morphological features of the major systemic vessels in micropigs and compared our results to published human data . the main vasculature of the animals was similar to that of humans , except for the iliac arterial system . however , diameters of the major systemic vessels were significantly different between micropigs and humans . specifically , the diameter of the aortic arch , abdominal aorta , external iliac artery , and femoral artery , were measured as 1.50 0.07 cm , 0.85 0.06 cm , 0.52 0.05 cm , and 0.48 0.05 cm , respectively , in the micropigs . this mdcta data for micropig major systemic vessels can be used as standard reference values for xenotransplantation studies . the use of 64-channel mdcta enables accurate evaluation of the major systemic vasculature in micropigs .

add appropriate pre tested amount caspase 3 20 l 12 mg ml pak2 buffer 50 mm tris hcl 150 mm nacl 2 mm dtt ph 7.5 incubate 34 c 30 min fully cleave activate pak2 analyze cleavage products sds page 10 coommassie blue staining add cleaved pak2 activation buffer b 50 mm tris hcl 150 mm nacl 15 mm mgcl2 10 mm atp ph 7.5 20 l final concentration 10 mg ml pak2 incubate 34 c 30 min fully activate pak2 autophosphorylation 8 sites confirm full cleavage pak2 migration p34 p27 fragments determined sds page proper verification autophosphorylation conditions made via autoradiography separate experiment using p)atp mass spectrometry detect phosphopeptides add 1 ml 0.1 trifluroacetic acid tfa ph 2.5 wash agarose beads twice prior use then centrifuge samples 15 sec 2,000 x g remove beads add pak2 20 g 2 l 150 mm nacl 50 mm tris hcl 2 mm dtt ph 7.5 100 l 0.1 tfa incubate sample 5 min 30 l pepsin conjugated agarose beads equilibrate reverse phase hplc c18 column primary solvent system 0.1 tfa ph 2.5 the pepsin digest 50 l eluted using linear 100-min gradient 0 80 acetonitrile containing 0.1 tfa flow rate 0.2 ml min dry hplc fractions speed vac 3 h resuspend samples solution acetonitrile 5 l 0.1 tfa 5 l ph 2.5 initially fraction screened peptides using maldi tof perseptive biosystems voyager de str pe biosystems foster city ca usa 16 fractions containing peptides subjected tandem mass spectrometry using q tof mass spectrometer qstar xl omaldi ms ms identify fragments the sequence peptide verified product ions generated tandem mass spectrometry theoretical z ratios based primary sequence pak2 using protein prospector website http://prospector.ucsf.edu/ hold solutions reagents needed h exchange 25 c water bath atp dissolved water ph adjusted 7.0 prior use the additional 4 mm atp d2o buffer prevent atp dissociated pak2 dilution initiate h exchange addition 18 l buffered d2o 50 mm mops ph 6.98 125 mm nacl 2 l 20 g pak2 buffer containing 150 mm nacl 50 mm tris hcl ph 7.5 2 mm dtt resulting pak2 level 10 mg ml ph 7.0 0c incubate samples triplicate h exchange 0 0.5 1 3 5 10 min 24 h. quench h exchange process adding 180 l ice cold 0.1 tfa ph 2.2 brings ph 2.5 final volume 200 l samples containing atp 180 l ice cold 0.11 tfa ph 2.2 used maintain ph 2.5 quenched condition add aliquot 100 l quenched sample 30 l activated pepsin conjugated agarose beads the pepsin digestion allowed proceed ice five min samples vortexed every 30 sec terminate digestion centrifugation sample 15 sec 5,000 x g 4 c remove pepsin rapidly freeze samples liquid n2 store -80 c 2 days prior maldi tof analysis the matrix maldi 5 mg ml -cyano-4-hydroxycinnamic acid chca dissolved solution 1:1:1 acetonitrile ethanol 0.1 tfa ph 2.5 held 0 c partially thaw sample quickly mix 1 l sample 1 l matrix spot 4 c maldi target plate apply moderate vacuum plate dry spots 30 sec prior maldi tof analysis acquire data 2-ghz sampling rate 100,000 data channels 20,000-v accelerating voltage 65 grid voltage using delayed extraction 180-ns pulse delay the maldi tof instrument restricted brand particular software calculate back exchange based ratio actual incorporated deuteron number 24 hr h exchange divided possible exchangeable sites backbone amides except n terminal amide figure 1 caspase cleavage pak2 complete produces two fragments p27 p34 migrate separately the migration autophosphorylated p27 p34 shows overlap gel due retarded migration fully phosphorylated p27 fragment figure 2 h exchange experiments carried multiple times 0 10 min figure 3 example time course deuterium incorporation z peak 1697.85 inactive pak2 composed multiple isotopic peaks shown shift mass envelope time caspase cleaved pak2 left lane intact inactive pak2 middle lane caspase cleaved autophosphorylated pak2 right lane analyzed sds page coommassie blue staining inactive pak2 subjected h exchange 0 10 min analyzed maldi tof an example expanded isotopic distribution maldi tof peak z 1697.85 time course h exchange shown the red dotted line indicates average mass envelope shift mass envelope shows deuteration peptide add appropriate pre tested amount caspase 3 20 l 12 mg ml pak2 buffer 50 mm tris hcl 150 mm nacl 2 mm dtt ph 7.5 incubate 34 c 30 min fully cleave activate pak2 analyze cleavage products sds page 10 coommassie blue staining add cleaved pak2 activation buffer b 50 mm tris hcl 150 mm nacl 15 mm mgcl2 10 mm atp ph 7.5 20 l final concentration 10 mg ml pak2 incubate 34 c 30 min fully activate pak2 autophosphorylation 8 sites confirm full cleavage pak2 migration p34 p27 fragments determined sds page proper verification autophosphorylation conditions made via autoradiography separate experiment using p)atp mass spectrometry detect phosphopeptides add 1 ml 0.1 trifluroacetic acid tfa ph 2.5 wash agarose beads twice prior use centrifuge samples 15 sec 2,000 x g remove beads add pak2 20 g 2 l 150 mm nacl 50 mm tris hcl 2 mm dtt ph 7.5 100 l 0.1 tfa incubate sample 5 min 30 l pepsin conjugated agarose beads equilibrate reverse phase hplc c18 column primary solvent system 0.1 tfa ph 2.5 the pepsin digest 50 l eluted using linear 100-min gradient 0 80 acetonitrile containing 0.1 tfa flow rate 0.2 ml min dry hplc fractions speed vac 3 h resuspend samples solution acetonitrile 5 l 0.1 tfa 5 l ph 2.5 initially fraction screened peptides using maldi tof perseptive biosystems voyager de str pe biosystems foster city ca usa the 16 fractions containing peptides subjected tandem mass spectrometry using q tof mass spectrometer qstar xl omaldi ms ms identify fragments the sequence peptide verified product ions generated tandem mass spectrometry theoretical z ratios based primary sequence pak2 using protein prospector website http://prospector.ucsf.edu/ hold solutions reagents needed h exchange 25 c water bath atp dissolved water ph adjusted 7.0 prior use the additional 4 mm atp d2o buffer prevent atp dissociated pak2 dilution initiate h exchange addition 18 l buffered d2o 50 mm mops ph 6.98 125 mm nacl 2 l 20 g pak2 buffer containing 150 mm nacl 50 mm tris hcl ph 7.5 2 mm dtt resulting pak2 level 10 mg ml ph 7.0 0c incubate samples triplicate h exchange 0 0.5 1 3 5 10 min 24 h. quench h exchange process adding 180 l ice cold 0.1 tfa ph 2.2 brings ph 2.5 final volume 200 l samples containing atp 180 l ice cold 0.11 tfa ph 2.2 used maintain ph 2.5 quenched condition add aliquot 100 l quenched sample 30 l activated pepsin conjugated agarose beads the pepsin digestion allowed proceed ice five min samples vortexed every 30 sec terminate digestion centrifugation sample 15 sec 5,000 x g 4 c remove pepsin rapidly freeze samples liquid n2 store -80 c 2 days prior maldi tof analysis the matrix maldi 5 mg ml -cyano-4-hydroxycinnamic acid chca dissolved solution 1:1:1 acetonitrile ethanol 0.1 tfa ph 2.5 held 0 c partially thaw sample quickly mix 1 l sample 1 l matrix spot 4 c maldi target plate apply moderate vacuum plate dry spots 30 sec prior maldi tof analysis acquire data 2-ghz sampling rate 100,000 data channels 20,000-v accelerating voltage 65 grid voltage using delayed extraction 180-ns pulse delay the maldi tof instrument restricted brand particular software calculate back exchange based ratio actual incorporated deuteron number 24 hr h exchange divided possible exchangeable sites backbone amides except n terminal amide figure 1 caspase cleavage pak2 complete produces two fragments p27 p34 migrate separately the migration autophosphorylated p27 p34 shows overlap gel due retarded migration fully phosphorylated p27 fragment figure 2 h exchange experiments carried multiple times 0 10 min figure 3 example time course deuterium incorporation z peak 1697.85 inactive pak2 composed multiple isotopic peaks shown shift mass envelope time caspase cleaved pak2 left lane intact inactive pak2 middle lane caspase cleaved autophosphorylated pak2 right lane analyzed sds page coommassie blue staining inactive pak2 subjected h exchange 0 10 min analyzed maldi tof an example expanded isotopic distribution maldi tof peak z 1697.85 time course h exchange shown the red dotted line indicates average mass envelope shift mass envelope shows deuteration peptide identification pepsin digested fragments critical step h exchange experiment pepsin digested pak2 eluted reverse phase hplc c18 column obtain clean background experiments the peptides subjected tandem mass spectrometry q tof ms ms omaldi ms ms identify sequences the ms ms spectra peptide least three product ions confirm identification peptide the data explorer 4.0 computer program applied biosystems performs initial baseline correction noise filtration we calibrate spectrum theoretical mass undeuterated z 923.45 1697.84 the mass accuracy calibration reach 10 ppm upon deuteration mono isotope may shift higher mass unitary step increases z ratios yielded enhanced masses associated deuteration however peak intensities isotopic peaks particular mass envelope critical calculation average mass first step calculation incorporated deuteron subtracting peptide mass non deuterated sample deuterated sample three factors d2o dilution residual deuterons side chains back exchange need considered calculation figure 1 the d2o dilution dilution factor d2o mixing sample d2o buffer initiate h exchange the residual deuteron 4.5% side chains pepsin digested peptides needs subtracted the back exchange inevitable loss deuteration deuterated pepsin digested peptides mass measurement process solvent accessible peptide z 1105.60 ) after 24-hour h exchange represents full deuteration region incorporated deuteron number peptides difference centroid deuterated non deuterated pak2 peptic peptides the highly deuterated peptide z 1105 selected represent full deuteration pak2 24 hr h exchange the back exchange ratio calculated actual incorporated deuteron number 24 hr h exchange divided possible exchangeable sites peptide z 1105

amide hydrogen / deuterium exchange ( h / d exchange ) coupled with mass spectrometry has been widely used to analyze the interface of protein - protein interactions , protein conformational changes , protein dynamics and protein - ligand interactions . h / d exchange on the backbone amide positions has been utilized to measure the deuteration rates of the micro - regions in a protein by mass spectrometry1,2,3 . the resolution of this method depends on pepsin digestion of the deuterated protein of interest into peptides that normally range from 3 - 20 residues . although the resolution of h / d exchange measured by mass spectrometry is lower than the single residue resolution measured by the heteronuclear single quantum coherence ( hsqc ) method of nmr , the mass spectrometry measurement in h / d exchange is not restricted by the size of the protein4 . h / d exchange is carried out in an aqueous solution which maintains protein conformation . we provide a method that utilizes the maldi - tof for detection2 , instead of a hplc / esi ( electrospray ionization)-ms system5,6 . the maldi - tof provides accurate mass intensity data for the peptides of the digested protein , in this case protein kinase pak2 ( also called -pak ) . proteolysis of pak 2 is carried out in an offline pepsin digestion . this alternative method , when the user does not have access to a hplc and pepsin column connected to mass spectrometry , or when the pepsin column on hplc does not result in an optimal digestion map , for example , the heavily disulfide - bonded secreted phospholipase a2 ( spla2 ) . utilizing this method , we successfully monitored changes in the deuteration level during activation of pak2 by caspase 3 cleavage and autophosphorylation7,8,9 .

patients clinicians healthcare professionals assume clinical laboratory tests performed different laboratories different times sample specimen compared results reliably consistently interpreted 1 unfortunately assumptions always justified many laboratory test results still highly variable poorly standardized harmonized harmonization represents fundamental aspect quality laboratory medicine ultimate goal improve patient outcomes provision accurate actionable laboratory information 2 although initial focus large extent harmonize standardize analytical processes methods scope harmonization goes beyond include aspects total testing process ttp terminology units report formats reference intervals decision limits well tests test profiles request criteria interpretation 3 4 major reasons focus global picture harmonization represented nature errors laboratory medicine evidence high rates errors pre post analytical phases 5 6 b evidence large variations terminology units reference ranges 7 c increasing demand improving appropriateness test request result interpretation 8) finally risks patient safety related previous issues 9 as recently highlighted tate coll clinical laboratory testing global activity laboratories longer work isolation therefore increasing awareness importance urgency achieve harmonization steps total testing process ttp ensuring comparability interchangeability laboratory information several initiatives projects progress harmonizing pre pre analytical well pre analytical processes initial steps cycle issue demand management focuses ensuring appropriate requesting receiving increasing importance a step forward area achieved acceptance definition inappropriate test demand appears request made outside form agreed guidance 11 the type guidance may vary national international guidelines locally agreed behaviours basic concept application scientific evidence rather anecdote clinical practice 8) among several progress special attention deserved national minimum retesting interval project promoted clinical practice section association clinical biochemistry acb uk uses state art approach set consensus evidence based recommendations test repeated the importance standardize patient preparation sample collection requirements minimize uncertainty pre analytical phase already activated efforts provide better evidence recommendations further work optimize sample transportation procedures well identification indicators monitoring done premise future harmonization initiatives field 15 17 in addition harmonization procedures evaluating quality biological samples criteria acceptance rejection even use automated workstations serum indexes largely reported promoted 18 21 although terms standardization harmonization define two distinct albeit closely linked concepts laboratory medicine final goal equivalence measurement results among different routine measurement procedures time space according defined analytical clinical quality specifications 22 standardization allows establishment metrological traceability system units si represents recommended approach multitude measurands si yet apply particular components measurand comprise heterogeneous mixture past two decades several clinical laboratory tests standardized development reference measurement procedures ifcc playing major role project in particular standardization glycated haemoglobin contributed significant improvements diabetes 23 other important projects progress order standardize measurands high clinical value cardiac troponin 24 carbohydrate deficient transferrin 25 however matter fact huge number measurands neither reference method reference material available 26 for measurands harmonization available methods diagnostic systems promoted last years significant progress done establishing overarching control system harmonization process aspects improvements defining quality quantity human samples used standardization harmonization studies 27 28 b identifying new robust mathematical models statistical treatments data 29 30 major lesson learnt is standardization harmonization applied clinical chemistry measurands whole field laboratory medicine including molecular diagnostics 31 it highlighted one impressive effective examples harmonization laboratory medicine expression prothrombin results international normalized ratio inr pt results corrected mathematically inr raising pt ratio power equal international sensitivity index isi thus harmonizing results stemming different thromboplastins patients treatment vitamin k antagonists 32 therefore debate harmonization limited clinical chemistry scientists involve fields laboratory medicine provide comparability interchangeability tests usually performed clinical laboratories including omics under patient centered viewpoint supposed diatribe standardization harmonization concentrate joint efforts provide equivalence measurement results among different routine measurement procedures different clinical laboratories time space several issues post analytical phase increasingly acknowledged fundamental steps achieving higher harmonization effectiveness laboratory information current evidence collected uk australia demonstrates significant variation units used tests even widespread variation way represented screens paper well way appear electronic messages 33 this turn creates potential misinterpretation laboratory results risk patient safety 7 as test results increasingly transferred electronically argument adopting single standardized set units needs immediate uptake 34 reference intervals widely used decision making tool laboratory medicine serve basis many interpretations laboratory results numerous studies shown large variation reference intervals even laboratories use assay thus contributing different clinical interpretation risk patients unnecessary test repetition 35 36 the importance obtaining reference intervals traceable referent measurement systems reported 37 evidence based approaches harmonize reference intervals promoted 38 the nordic reference interval project norip one earliest reference interval harmonization initiatives established common reference intervals apparently healthy adult populations five nordic countries 25 common clinical chemistry analytes 39 several recent initiatives already provided data adopting common reference intervals huge geographical areas asia 40 canada 41 43 australasia 44 australasian approach selection common reference interval requires checklist assessment process adopted assess evidence use based criteria summarized table 1 the final decision common reference interval used involves weighing piece evidence importantly proposed reference limits also supported flagging rates provide indication clinical considerations reference interval 46 however use asterisks require considerations patients people training laboratory medicine direct access laboratory test results various practices number different terminologies extremely different values described literature affecting quality critical results management large variability critical results practices reported comparing different geographical areas even country 47 very recently study outcomes critical values notification demonstrated 40.0% cases unexpected findings notification led change treatment 98.0% patients admitted surgical 90.6% admitted medical wards thus confirming importance effective clinical decision making 48 several initiatives recommendations harmonization critical result management released 49 52 finally better awareness importance issue improving quality laboratory services patient safety achieved the definition implementation monitoring valuable analytical quality specifications played fundamental role improving quality laboratory services reducing rates analytical errors however body evidence accumulated relevance extra analytical phases namely pre analytical steps vulnerability impact overall quality laboratory information the identification establishment valuable quality indicators qis represents promising strategy collecting data quality total testing process ttp particularly detecting mistakes made individual steps ttp thus providing useful information quality improvement projects 53 in addition qis represent fundamental requirement accreditation clinical laboratories according international standard iso 15189(54 interesting programs indicators ttp developed countries consensus production joint recommendations focusing adoption universal qis common terminology total testing process a preliminary agreement achieved consensus conference organized padua 2013 revising model quality indicators mqi developed working group laboratory errors patient safety international federation clinical chemistry laboratory medicine ifcc the consensually accepted list qis takes consideration importance applicability could actually tested potentially interested clinical laboratories identify steps harmonization project 55 preliminary performance criteria based data collected proposed allow benchmark different laboratories support improvement initiatives 56 several initiatives projects progress harmonizing pre pre analytical well pre analytical processes initial steps cycle the issue demand management focuses ensuring appropriate requesting receiving increasing importance a step forward area achieved acceptance definition inappropriate test demand appears request made outside form agreed guidance 11 the type guidance may vary national international guidelines locally agreed behaviours basic concept application scientific evidence rather anecdote clinical practice 8) among several progress special attention deserved national minimum retesting interval project promoted clinical practice section association clinical biochemistry acb uk uses state art approach set consensus evidence based recommendations test repeated ( the importance standardize patient preparation sample collection requirements minimize uncertainty pre analytical phase already activated efforts provide better evidence recommendations further work optimize sample transportation procedures well identification indicators monitoring done premise future harmonization initiatives field 15 17 in addition harmonization procedures evaluating quality biological samples criteria acceptance rejection even use automated workstations serum indexes largely reported promoted 18 21 although terms standardization harmonization define two distinct albeit closely linked concepts laboratory medicine final goal equivalence measurement results among different routine measurement procedures time space according defined analytical clinical quality specifications 22 standardization allows establishment metrological traceability system units si represents recommended approach multitude measurands si yet apply particular components measurand comprise heterogeneous mixture past two decades several clinical laboratory tests standardized development reference measurement procedures ifcc playing major role project in particular standardization glycated haemoglobin contributed significant improvements diabetes 23 other important projects progress order standardize measurands high clinical value cardiac troponin 24 carbohydrate deficient transferrin 25 however matter fact huge number measurands neither reference method reference material available 26 for measurands harmonization available methods diagnostic systems promoted last years significant progress done establishing overarching control system harmonization process aspects improvements defining quality quantity human samples used standardization harmonization studies 27 28 b identifying new robust mathematical models statistical treatments data 29 30 major lesson learnt is standardization harmonization applied clinical chemistry measurands whole field laboratory medicine including molecular diagnostics 31 it highlighted one impressive effective examples harmonization laboratory medicine expression prothrombin results international normalized ratio inr pt results corrected mathematically inr raising pt ratio power equal international sensitivity index isi thus harmonizing results stemming different thromboplastins patients treatment vitamin k antagonists 32 therefore debate harmonization limited clinical chemistry scientists involve fields laboratory medicine provide comparability interchangeability tests usually performed clinical laboratories including omics patient centered viewpoint the supposed diatribe standardization harmonization concentrate joint efforts provide equivalence measurement results among different routine measurement procedures different clinical laboratories time space several issues post analytical phase increasingly acknowledged fundamental steps achieving higher harmonization effectiveness laboratory information current evidence collected uk australia demonstrates significant variation units used tests even widespread variation way represented screens paper well way appear electronic messages 33 this turn creates potential misinterpretation laboratory results risk patient safety 7 as test results increasingly transferred electronically argument adopting single standardized set units needs immediate uptake 34 reference intervals widely used decision making tool laboratory medicine serve basis many interpretations laboratory results numerous studies shown large variation reference intervals even laboratories use assay thus contributing different clinical interpretation risk patients unnecessary test repetition 35 36 the importance obtaining reference intervals traceable referent measurement systems reported 37 evidence based approaches harmonize reference intervals promoted 38 the nordic reference interval project norip one earliest reference interval harmonization initiatives established common reference intervals apparently healthy adult populations five nordic countries 25 common clinical chemistry analytes 39 several recent initiatives already provided data adopting common reference intervals huge geographical areas asia 40 canada 41 43 australasia 44 australasian approach selection common reference interval requires checklist assessment process adopted assess evidence use based criteria summarized table 1 final decision common reference interval used importantly proposed reference limits also supported flagging rates provide indication clinical considerations reference interval 46 however use asterisks require considerations patients people training laboratory medicine direct access laboratory test results various practices a number different terminologies extremely different values described literature affecting quality critical results management large variability critical results practices reported comparing different geographical areas even country 47 very recently study outcomes critical values notification demonstrated 40.0% cases unexpected findings notification led change treatment 98.0% patients admitted surgical 90.6% admitted medical wards thus confirming importance effective clinical decision making 48 several initiatives recommendations harmonization critical result management released 49 52 finally better awareness importance issue improving quality laboratory services patient safety achieved the definition implementation monitoring valuable analytical quality specifications played fundamental role improving quality laboratory services reducing rates analytical errors however body evidence accumulated relevance extra analytical phases namely pre analytical steps vulnerability impact overall quality laboratory information the identification establishment valuable quality indicators qis represents promising strategy collecting data quality total testing process ttp particularly detecting mistakes made individual steps ttp thus providing useful information quality improvement projects 53 in addition qis represent fundamental requirement accreditation clinical laboratories according international standard iso 15189(54 interesting programs indicators ttp developed countries consensus production joint recommendations focusing adoption universal qis common terminology total testing process a preliminary agreement achieved consensus conference organized padua 2013 revising model quality indicators mqi developed working group laboratory errors patient safety international federation clinical chemistry laboratory medicine ifcc the consensually accepted list qis takes consideration importance applicability could actually tested potentially interested clinical laboratories identify steps harmonization project 55 preliminary performance criteria based data collected proposed allow benchmark different laboratories support improvement initiatives 56 although standardization harmonization laboratory medicine recognized essential requirements improving quality value patients long time major barriers affected success projects in fact processes required achieve harmonization complicated costly time consuming systematic approach therefore needed well defined procedures transparent operations effective communication stakeholders consensus approach cooperation 57 the increasing demand standardization harmonization laboratory medicine requires incremental progress addressing issues cooperation many stakeholders laboratory professionals scientific societies federations clinicians vitro manufacturing industry accreditation regulatory bodies patients representatives 2 several organizations ifcc european federation clinical chemistry laboratory medicine eflm american association clinical chemistry aacc world health organization recently formed international consortium harmonization clinical laboratory results ichclr working field cooperate integrate efforts avoid duplication initiatives provide joint programs other scientific organizations clinical laboratory standards institute clsi joint committee traceability laboratory medicine jctlm recognized play major role providing guidelines lists reference materials reference procedures but first foremost laboratory professionals better understand urgent need improve harmonization everyday clinical practice take proactive role efforts assure comparability interchangeability laboratory information according patient centered viewpoint meaning harmonization context laboratory medicine information comparable irrespective measurement procedure used and/or measurement made represents major driver implementing harmonization initiatives recent years demanding drivers increased need relevance efforts harmonizing laboratory information first foremost evidence variations laboratory information cause confusion potentially dangerous there convincing evidence errors laboratory medicine affect patient outcomes affect patient safety 6 two major progresses made area harmonization laboratory medicine first awareness harmonization take consideration analytical phase steps ttp thus dealing request sample measurement report second processes required achieve harmonization complicated systematic approach needed a achievement recognition need also apply concepts harmonization standardization clinical research projects translational medicine 58 the cooperation laboratory professionals clinicians ivd manufacturers accreditation regulatory bodies essential

according to a patient - centered viewpoint , the meaning of harmonization in the context of laboratory medicine is that the information should be comparable irrespective of the measurement procedure used and where and/or when a measurement is made . harmonization represents a fundamental aspect of quality in laboratory medicine as its ultimate goal is to improve patient outcomes through the provision of an accurate and actionable laboratory information . although the initial focus has to a large extent been to harmonize and standardize analytical processes and methods , the scope of harmonization goes beyond to include all other aspects of the total testing process ( ttp ) , such as terminology and units , report formats , reference intervals and decision limits , as well as tests and test profiles request and criteria for interpretation . two major progresses have been made in the area of harmonization in laboratory medicine : first , the awareness that harmonization should take into consideration not only the analytical phase but all steps of the ttp , thus dealing with the request , the sample , the measurement , and the report . second , as the processes required to achieve harmonization are complicated , a systematic approach is needed . the international federation of clinical chemistry and laboratory medicine ( ifcc ) has played a fundamental and successful role in the development of standardized and harmonized assays , and now it should continue to work in the field through the collaboration and cooperation with many other stakeholders .

type 2 diabetes heterogeneous disorder characterized peripheral insulin resistance defects insulin secretion -cell apoptosis pancreatic -cell dysfunction central pathogenesis type 2 diabetes loss functional -cell mass type 2 diabetes least part secondary increased -cell apoptosis obesity well known risk factor diabetes characterized elevated levels circulating free fatty acids ffas prolonged exposure elevated levels ffas shown cause defective -cell proliferation increased -cell apoptosis therefore lipotoxicity plays important role underlying mechanism type 2 diabetes glucagon like peptide-1 glp-1 incretin hormone secreted intestinal l cells recent modality treatment type 2 diabetes glp-1 receptor agonists exhibit variety benefits diabetic patients glp-1 used hyperglycemia obesity t2 dm diabetic patients stimulating insulin secretion inhibiting glucagon secretion slowing gastric emptying promoting satiety among effects furthermore recent data shown glp-1 receptor agonists promote survival -cell lines challenged various apoptotic stimulators including hyperglycemia inflammatory cytokines oxidative stress endoplasmic reticulum stress 810 however whether exendin-4 glp-1 receptor agonist exerts cytoprotective effects pancreatic -cells lipotoxic condition determined completely therefore aim present study investigate potential antiapoptotic prosurvival actions exendin-4 pancreatic -cells chronic lipotoxic condition underlying signaling pathways involved fatty acid free bovine serum albumin bsa fraction v palmitate hoechst33258 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromides mtt pd98059 purchased sigma aldrich st louis mo usa the anti phospho erk1/2 anti total erk1/2 antibodies obtained cell signaling technology danvers usa the anti bax anti bcl-2 antibodies obtained santa cruz biotechnology heidelberg germany an enzyme linked immunosorbent assay- elisa- based bromodeoxyuridine brdu incorporation kit roche basel switzerland caspase-3 activity assay kit r&d systems minneapolis mn usa mouse pancreatic -cell line min6 kind gift biochemistry lab china medical university passage number 10 20 they maintained dulbecco modified eagle medium dmem containing 25 mm glucose 15% fetal bovine serum fbs 100 u ml penicillin 100 mg ml streptomycin 100 mg ml l glutamine 5 g l -mercaptoethanol 37c humidified atmosphere 5% co2 95% air cells 80% confluence washed phosphate buffered saline pbs preincubated overnight serum free dmem treatment min6 cells cultured high glucose 25 mm serum free dmem 0.5% bsa 0.4 mm palmitate added 0.5% bsa without erk1/2 inhibitor presence absence exendin-4 briefly 20 mm solution palmitate 0.01 naoh incubated 70c 30 min then 330 l 30% bsa 400 l palmitate naoh mixture mixed together filter sterilized added 20 ml dmem we selected 25 mm glucose concentration tests increased glucose concentration essential min6 proliferation 25 mm glucose protected min6 cells apoptosis graded doses exendin-4 1 10 100 500 nm prepared freshly tests cells incubated 1 mg ml mtt 1 h. medium removed formazan product solubilized 150 l dimethyl sulfoxide viability assessed spectrophotometry 570 nm absorbance using 96-well plate reader briefly min6 cells set onto 96-well plates 80% confluence incubated overnight serum free dmem experiments brdu added culture medium 1 h cells harvest cells fixed incubated peroxidase conjugated anti brdu antibody immune complexes quantified spectrophotometry the hoechst positive cells represent apoptotic cells characterized chromatin condensation fragmented nuclear membrane briefly hoechst staining performed exposing cell slides 10 g ml hoechst33258 10 min room temperature caspase-3 activity measured triplicate caspase-3 colorimetric assay kit according manufacturer manual brief two time washes ice cold pbs cells harvested centrifuged 10,000 rpm 10 min followed addition 1 l dithiothreitol dtt 100 l lysis buffer cell lysates placed 96-well plate incubated 2 h 37c 10 l caspase-3 colorimetric substrate devd pna 50 g protein samples 20 l buffer separated sds electrophoresis 12% gradient polyacrylamide gels transferred onto pvdf membranes the membranes incubated primary antibodies appropriate concentration including anti phospho erk1/2 antibody 1 1,000 anti total erk1/2 antibody 1 1,000 anti bax antibody 1 200 anti bcl-2 antibody 1 200 immunodetection performed ecl advance resulting images analyzed scion image software version 4.0.3.2 scion corporation frederick md differences groups determined one way analysis variance anova followed post hoc testing correction least significant difference dunnett test f ratio statistically significant turkey post hoc test considered to determine effects exendin-4 -cell survival proliferation min6 cells incubated 0.5% bsa bsa 0.4 mm palmitate added 0.5% bsa pa without increasing concentrations exendin-4 1500 nm ex 24 h. cell viability proliferation assessed mtt assay elisa based brdu incorporation kit respectively cell survival figure 1(a significantly reduced palmitate treatment 28% p 0.01 versus bsa exendin-4 treatment reversed palmitate induced reduction cell viability 100 nm exendin-4 displayed major effect restoring cell viability 27% p 0.01 versus pa exendin-4 treatment alone showed nonsignificant promotion cell survival 100 nm exendin-4 provided best potentiation 112% p 0.21 versus bsa cell proliferation figure 1(b decreased palmitate exposure 38% p 0.01 versus bsa this decrease inhibited exendin-4 treatment obviously 100 nm 29% p 0.01 versus pa exendin-4 treatment alone displayed nonsignificant increase cell proliferation 100 nm exendin-4 provided greatest tendency 120% p 0.11 versus bsa presence pa 100 nm exendin-4 achieved significant proliferative effect 91% p 0.03 versus pa we next assessed cell apoptosis hoechst33258 assay caspase-3 activity assay hoechst33258 assay min6 cells incubated without 0.4 mm palmitate presence absence 100 nm exendin-4 figure 1(c pa exposure 24 h induced apoptosis 34.3% p 0.01 versus bsa reversed 100 nm exendin-4 treatment decreasing apoptosis 11.9% p 0.01 pa ex versus pa apoptosis significantly increased cells treated pa alone 133% p 0.01 pa versus bsa 100 nm exendin-4 treatment pa presence resulted significant decrease apoptosis 87% p 0.01 pa ex versus pa we investigated effect exendin-4 erk1/2 phosphorylation palmitate treatment detecting ratio phosphorylated erk1/2 expression total erk1/2 expression figure 2(a the erk1/2 phosphorylation blocked palmitate exposure 0.624 0.048 versus 0.496 0.062 p 0.05 bsa versus pa ex 0 min end preincubation period 100 nm exendin-4 added the maximal effect observed 5 min 0.721 0.135 versus 0.496 0.062 p 0.01 pa ex 5 min versus pa ex 0 min exendin-4 also induced phosphorylation erk1/2 concentration dependent manner figure 2(b 100 nm exendin-4 treatment produced effective potentiation 0.744 0.083 versus 0.494 0.117 p 0.01 pa ex 100 nm versus pa establish induction phosphorylation erk1/2 exendin-4 treatment using pd98059 specific erk1/2 inhibitor figure 2(c the exendin-4-induced phosphorylation erk1/2 obviously suppressed pd98059 0.707 0.096 versus 0.556 0.050 p 0.05 ex pa versus ex pd pa whereas effect pd98059 erk1/2 phosphorylation without exendin-4 similar pa alone 0.459 0.057 versus 0.519 0.071 p 0.217 pa pd versus pa we also determined role erk1/2 inhibitor cytoprotective effect exendin-4 mtt assay hoechst33258 assay figures 2(d 2(e consistent aforementioned results exendin-4 treatment promoted cell survival 95.3 3.7% versus 68.4 6.9% p 0.01 ex pa versus pa prevented apoptosis min6 cells 21.2 2.1% versus 33.5 3.7% p 0.01 ex pa versus pa lipotoxic condition whereas pd98059 suppressed promotion cell survival 71.0 4.6% versus 95.3 3.7% p 0.05 ex pd pa versus ex pa attenuated restore apoptosis 29.2 3.2% versus 21.2 2.1% p 0.05 ex pd pa versus ex pa lipotoxic condition all results strongly suggested exendin-4 protected min6 cells lipotoxicity least part via activation erk1/2 signaling pathway western blot analysis bcl-2 bax conducted 24 h culture lipotoxic condition figure 3 we found significant decreased expression antiapoptotic protein bcl-2 figure 3(a p 0.01 versus bsa enhanced expression proapoptotic protein bax figure 3(b p 0.01 versus bsa min6 cells palmitate treatment exendin-4 treatment showed significant increased expression bcl-2 figure 3(a p 0.05 versus pa nonsignificant decreased expression bax levels figure 3(b p 0.22 versus pa compared parallel lipotoxic condition cultured without exendin-4 the incretin glucagon like peptide-1 glp-1 major gastrointestinal product proglucagon processing shown exert trophic effects -cells although roles exendin-4 cell proliferation antiapoptosis demonstrated -cells mechanisms fully understood moreover whether exendin-4 protects -cells lipotoxicity remains determined present study found exendin-4 inhibited palmitate induced apoptosis via activating erk1/2 pathway also inhibiting mitochondrial apoptosis pathway min6 cells physiologic levels lipids glucose toxic essential -cell function prolonged exposure pancreatic -cells high levels fatty acid impairs insulin gene expression inhibits insulin synthesis secretion induces -cell apoptosis 11 21 22 vivo the normal plasma concentration ffa less 0.6 mmol l could exceed 1 mmol l type 2 diabetic patients 23 24 palmitate oleate two represented ffas plasma 20 25% linked albumin circulation 25 26 mimic observed vivo used mixture palmitate 5% fatty acid free bsa this high albumin concentration used obtain appropriate albumin nonesterified fatty acid ratio study the direct effects long term elevated palmitate survival pancreatic -cells studied consistent previous observations 27 28 theoretically antilipotoxicity blockade apoptosis enhancement proliferation may novel approach protect pancreatic -cells accumulating evidence supports role glp-1 mimetics enhancers regulating proliferation protecting cellular apoptosis these agents constitute novel class antidiabetes medications might major impact treatment type 2 diabetes 2931 study demonstrated treatment exendin-4 glp-1 agonist protected pancreatic -cell palmitate induced toxicity enhancing proliferation inhibiting apoptosis dose dependent manner figure 1 addition exendin-4 treatment activated erk1/2 signaling pathway erk1/2 well known downstream target raf-1 shown participate pathways controlling -cell survival it reported several studies acute glucose protein kinase signaling may regulate -cell growth survival erk1/2 3234 hand others shown activation erk1/2 required human islet apoptosis response chronic exposure high glucose concentrations interleukin-1 the outcome may depend timing duration erk1/2 activation present study findings showed exposure min6 cells chronic lipotoxic conditions reduced phosphorylation erk1/2 in addition reduction reversed exendin-4 treatment rapid activation erk1/2 further treatment erk1/2 inhibitor pd98059 blocked protective effect exendin-4 figure 2 these data indicate exendin-4 exerted cytoprotective effect pancreatic -cells lipotoxicity least part via erk1/2 pathway the mechanisms underlying apoptosis regulated defined biochemical pathways involving members bcl-2 family mammalian cells the bcl-2 family proteins plays central role modulating mitochondrial dependent apoptosis both prosurvival proapoptotic bcl-2 family members critical death regulators via mitochondrial apoptosis pathway among bcl-2 family proteins prosurvival bcl-2 stabilizes mitochondrial membrane prevents cytochrome c release mitochondria followed activation caspases present study bcl-2 found downregulated proapoptotic bax upregulated accordance increased activity caspase-3 lipotoxic condition after exendin-4 treatment observed alterations partially counteracted figure 3 so results indicate exendin-4 conducts protective effect inhibiting mitochondrial apoptosis pathway promoting bcl-2 protein expression interestingly bcl-2 family proteins found involved erk1/2 signaling pathway reviewed cagnol chambard in contrast antiapoptotic proteins bcl-2 bcl xl downregulated erk1/2 activation hand phosphorylation proapoptotic protein bad was assumed involved erk1/2 promoted cell survival human pancreatic cancer cells inhibition erk1/2 activities caused downregulation antiapoptotic proteins bcl-2 mcl-1 bcl xl without affecting proapoptotic proteins bax bak these various reports might interpreted depending different cell types conditions study found erk1/2 activation enhanced bcl-2 expression induced exendin-4 treatment lipotoxic condition further study relation erk1/2 activation inhibition mitochondrial apoptosis pathway may reveal detailed molecular mechanism glp-1 mediated cytoprotective role pancreatic -cells compared insulin secreting cell lines min6 cells express glut-2 glucokinase display similar glucose stimulating insulin secretion normal primary -cells the insulin secretion min6 cells reaches maximal level approximately sevenfold basal level 25 mmol l consistent performance min6 cells data shown but immortalized cell line characters especially proliferative specific exact primary -cells could confounding factor within study aspect in conclusion likely exendin-4 induced erk1/2 activation important pathway exendin-4 exerts antiapoptotic actions palmitate induced lipotoxicity besides potential cytoprotective effect exendin-4 -cells involves mitochondrial apoptosis pathway upregulating bcl-2 because lipotoxicity supposed responsible -cell loss pathological process obesity associated type 2 diabetes antilipotoxic effects residual -cells exendin-4 may arouse interest considering therapeutic utilization type 2 diabetes treatment

type 2 diabetes is a heterogeneous disorder that develops as a result of relatively inappropriate insulin secretion and insulin resistance . increased levels of free fatty acids ( ffas ) are one of the important factors for the pathogenesis of type 2 diabetes and contribute to defective -cell proliferation and increased -cell apoptosis . recently , glucagon - like peptide-1 ( glp-1 ) receptor agonists have been shown to possess an antiapoptotic effect , by increasing -cell mass and improving -cell function . however , their effects on -cells in vitro against lipotoxicity have not been elucidated completely . in this study , we investigated whether the glp-1 receptor agonist exendin-4 displays prosurvival effects in pancreatic -cells exposed to chronic elevated ffas . results showed that exendin-4 inhibited apoptosis induced by palmitate in min6 cells . after 24 h of incubation , exendin-4 caused rapid activation of extracellular signal - related kinase 1/2 ( erk1/2 ) under lipotoxic conditions . the erk1/2 inhibitor pd98059 blocked the antilipotoxic effect of exendin-4 on min6 cells . exendin-4 also inhibited the mitochondrial pathway of apoptosis . this inhibition is associated with upregulation of bcl-2 . our findings suggested that exendin-4 may exert cytoprotective effects through activation of erk1/2 and inhibition of the mitochondrial apoptosis pathway .

activities cells partially specified respective ribonucleic acid rna content.1 respect mrna given time theoretical human cell would feature whole subset protein coding gene transcripts including splice variants estimated 21,000 coding genes average 6 splice variant forms per gene,2 the set messengers given human cell hold least 100,000 elements note estimate take account rna editing post transcriptional rna modifying events potentially increase number elements theoretical human set messenger rna mrna molecules.3 due biochemical properties mrnas dosed simultaneously multiplexed assays these array based methods make use fact single strands nucleic acids form duplex reverse complementary strand.4 multiplexing enabled designing series probes ie reverse complementary strands specific cognate mrna molecule within range hybridization parameter values microarray based approaches the probes deposited solid surface excess regards soluble complementary mrna fraction based kinetics hybridization homoduplex forming 2 complementary rna molecules the amount mrna bound immobilized probes equilibrium proportional concentration mrna assayed sample.5 pairing mrna molecule cognate probe microarray basic principle mrna quantification however nucleic acid molecules hybridized immobilized probes original mrna molecules extracted biosample the mrnas whose original quantities need dosed undergo molecular modifications aimed detecting respective occurrences microarray equilibrium reached one way achieve incorporate fluorophore colorimetric detection systems applied subsequent quantification.6 cartoon figure 1 displays set steps performed generic mrna quantification assay using array based method this drawing shown highlight fact mrna assay read represents outcome long series steps potentially contributing overall variability quantification operation the fact rna abundance sensitive biological chemical changes raises concern steps could alter original rna distribution matter final detection method applied newly introduced rna quantification technologies collectively referred rna seq skipping hybridization step yet require similar complex molecular transformations initial rna final molecular form used measurement.7 reminder objective mrna quantification assay assess amount mrna original biospecimen within biological systems investigation this level change according internal and/or external perturbations eg treatment pharmacologically active compound one common goals mrna quantification correlate change subset mrnas change biological phenotype implicitly goal dosage derive source biological variability hence minimize impact sources change confound variability typically brought quantification procedures figure 1 shows events original specimen investigated rna assay readout thus illuminating possible sources technical variability one sources choice microarray used measurement brand source featuring set probes for example one may use short oligonucleotides produced situ photolithographic synthesis another relies long oligonucleotide spotted arrays.8,9 acknowledged nature probe ie sequence affect hybridization equilibrium.10 results micro array based assays usually presented data matrices molecular identifier observations biosamples columns in widely used form molecular identifier gene identifier 1-to-1 relationship gene transcript implicit kind representation whether precisions accuracies measurements transcript means 2 different probes close enough make inter microarray data analyses relevant still matter legitimate debate.11 common practice literature refer observed microarray measurements gene expression levels gene expression levels context means steady state level mrna since quantity actually measured assay in contexts gene expression takes meaning de novo transcript initiation.12 mrna detected directly for example rna usually reverse transcribed single stranded complementary dna.13 reverse transcription primed either oligo dt primer matches 3poly tail mrnas random- hexamers which name indicates form duplexes various expectedly random positions mrna template.14 incorporation dye complementary dna achieved reverse transcription providing modified nucleotides15 handled rna dependent dna polymerase means covalently adding fluorophore 5 end rna strand figure 2a shows details successive steps soluble mrna isolated cells labeled nucleic acids hybridized cognate probes microarray 2 reasonable questions ask whether various labeling steps alter original distribution mrnas samples extent occur order address questions experiment could designed utilizing large quantity rna distinct contrasted biological systems the molecules would aliquoted aliquots partitioned groups according labeling protocol applied the various labeled nucleic acids would assayed replicates type microarray source variability actual rna labeling procedure everything else remaining constant the biological systems consisted set isogenic mice gender age distributed groups according diet various feeding conditions known determine values certain physiological phenotypes including body mass index blood chemistry these physiological responses also known specified activity liver the scope experiment assess extent liver cells activity measured level protein coding rna changing regards perturbation a corollary question whether every instance significant change steady state level particular mrna would suggest correlation activity cognate gene physiological response inferring bonafide relationship changes level given mrna molecule level change biological response study requires providing evidence observed variation explained mainly biological factor confounding event this report shows assay performed ie laboratory and/or method rna labeling used represent unexpected co factors actually mask source biological variability stated differently series procedures starting extraction rna biosample microarray readout without disturbing original distribution rna occurring biological sample the obvious consequence changes registered end assay attributed much experimental procedure confounding factor biological perturbations the quantity purity rna determined absorbance 260 nm 260/280 absorbance ratio respectively each total rna preparations individually assessed rna quality based 28s/18s ratio rna intergrity number rin measured agilent 2100 bioanalyzer system using rna 6000 nano labchip kit rna labeled according enzo bioarray highyield rna transcript labeling system affymetrix genechip 3 ivt express kit nugen applause systems fig the image file read scanning microarray converted numerical value per unit measurement the amount light intensity unit measurement microarray converted value relative abundance mrna molecule data reduction procedure reported izarrzi et al.17 data processing analyses performed affymetrix genechip command console gcos affymetrix http://www.affymetrix.com/ genedata analyst genedata ag www.genedata.com tibco spotfire decisionsite tibco http://spotfire.tibco.com/ umetrics simca p umetrics http://www.umetrics.com/ r bioconductor packages http://www.bioconductor.org/ physiological measurements performed following 2-week treatment phase significant variation series blood analytes physiological outcomes eg bmi observed a large quantity rna extracted liver mice 3 different treatments the 3 groups mice strain age gender growing conditions differed diet one could conclude regards mice strain balb c aforementioned caloric restriction induced significant change respective biological statuses to extent liver failure control homeostasis mouse physiological parameters correlated significant change level discrete rna represented scope subsequent measurement laboratory data set considered separately do return answer mrna level correlates biological condition data set processed according series transformations depicted figure 3 extraction numerical values raw image tiff file affymetrix genechip command console software,16 ii normalization according quantile normalization iii summarization individual probes values single mrna level value described irizarri et al.17 quantile normalization assumes overall quantity mrna across whole range binned values consistent across similar biological systems the outcome data transformation data matrix 3 conditions represented 5 replicates ~40,000 observations ie affymetrix probe sets representative cognate mrna this data processing performed exactly way 5 data sets parameters words variability brought laboratory set regards data operations figure 4 shows series diagnostic plots commonly used evaluate molecular integrity mrna quantified assay 3 feeding conditions 5 each laboratory initiated quantification source rna shown figure 2b rna samples branched different experimental paths step following rna extraction prior rna labeling procedure if conceptually group finite experimental steps span end rna extraction image acquisition step single experimental event data set hands associated 2 factors biological factor ie feeding conditions technical factor ie rna labeling procedure the rna degradation plot instance testifies extent rna molecules starting hydrolyzed there chemical biological eg ribonucleases mechanisms potentially remain active rna extraction procedure degrade rna strand 5 ends the steepness rna degradation plot therefore used quality control metric assay validation studies18 concluded whenever slopes values greater 3 would disqualify data set downstream analysis since advanced degradation rna would cause measurement unreliable the figure 4 provides quick overview overall quality 5 laboratory data sets it shows high quality therefore valid subsequent analyses the affymetrix genechips micro array based assays deliver large data sets 40,000 variables case the spread value 40,000 variables problem space evidently varies in addition based prior knowledge regulation gene expression reasonable state mrna level data matrix made 40,000 independent events instead fair amount redundancy the spread data across 40,000 dimensions assessed deriving principal components the score plots 5 laboratory data sets presented figure 4 showed biological variability seems conserved across 5 measurement sets in addition every laboratory measurement biological conditions clustered within area scatter plot 2 major principal components firstly information content regards biological input seems maintained prior inception experiment mice represented biological object animal outputting physiological phenotype values within range biological noise secondly animals divided 3 subgroups fed differently end experiment based observations aforementioned physiological values different environmental input submitted initially homogenous set animals produced 3 subsets different animals principle components analysis pca ) plots figure 4 suggest rna content liver 3 groups animals also different data output series molecular transformations kept difference the environmental challenge caused physiological change well change composition rna featured liver altogether initial explorations allowed conclusion rna molecules quantified study degraded suitable subsequent correlation studies the density plot normalization outcome shown figure 4 shows expected adjustment brought data set distributions the data sets regardless biological conditions centered value exhibited similar spread the normalization scope prevent artifactual shift mrna level matrix brought inherent technical variability eg optical instrument affymetrix scanner series observations data evidence yet would suggested source biological variability conserved 5 data matrices therefore looked one could confidently infer mrna molecules exhibited change correlating perturbation brought different feeding conditions reasonable approach identify elements perform parametric test assuming normal distribution mrna level populations this assumption might even required case given number replicates large enough rely central limit theorem an independent samples test run address question whether mouse liver mrna respective level shifted different distribution whenever mice high caloric food intake opposed low caloric in words 2 conditions 3 original design chosen exploration data set given large number elements set compared ie ~40,000 ) test followed correction multiple comparisons using false discovery rate fdr analysis case.19 pairwise comparison run initially 1 laboratory data set table 1 shows top lower q value affymetrix probe set elements returned test q value lower 1.10e-7 allows us conclude fairly high confidence 20 elements belong distribution reference ie distribution level mrna extracted low caloric fed mice following test 1 laboratory data set exact comparison exact data analyses procedure table 1 shows top 20 lower q value affymetrix probe set elements 3 5 laboratory data sets unexpectedly 20% affymetrix probe set elements common values across 5 lists the pca discussed figure 4 suggested mrna level data sets maintained sources biological variability the result table 1 argued information content data sets addition biology liver cells the whole data set included 5 laboratory measurements analyzed single data set 75 cel cell intensity files referred cel files used input robust multi array rma normalization operation single normalized data matrix featuring 75 conditions created the pca score plot figure 5 shows 1 source variability accounted mouse liver cell physiology the data points clustered regards laboratory rna processed these differences rna labeling subtle might seem obviously modify final nucleic acids composition mix applied microarray plots figure 4 show 5 data sets contained biologically meaningful informational contents plots figures 5 6 results table 1 indicate post rna extraction manipulations potentially modify original rna composition however ample gene expression studies reported literature variability rna content attributed exclusively biological variability physiological measurements performed following 2-week treatment phase significant variation series blood analytes physiological outcomes eg bmi observed a large quantity rna extracted liver mice 3 different treatments the 3 groups mice strain age gender growing conditions differed diet one could conclude regards mice strain balb c aforementioned caloric restriction induced significant change respective biological statuses to extent liver failure control homeostasis mouse physiological parameters correlated significant change level discrete rna represented scope subsequent measurement when laboratory data set considered separately return answer mrna level correlates biological condition data set processed according series transformations depicted figure 3 extraction numerical values raw image tiff file affymetrix genechip command console software,16 ii normalization according quantile normalization iii summarization individual probes values single mrna level value described irizarri et al.17 quantile normalization assumes overall quantity mrna across whole range binned values consistent across similar biological systems the outcome data transformation data matrix 3 conditions represented 5 replicates ~40,000 observations ie affymetrix probe sets representative cognate mrna this data processing performed exactly way 5 data sets parameters words variability brought laboratory set regards data operations figure 4 shows series diagnostic plots commonly used evaluate molecular integrity mrna quantified assay 3 feeding conditions 5 each laboratory initiated quantification source rna shown figure 2b rna samples branched different experimental paths step following rna extraction prior rna labeling procedure if conceptually group finite experimental steps span end rna extraction image acquisition step single experimental event data set hands associated 2 factors biological factor ie feeding conditions technical factor ie rna labeling procedure the rna degradation plot instance testifies extent rna molecules starting hydrolyzed there chemical biological eg ribonucleases mechanisms potentially remain active rna extraction procedure degrade rna strand 5 ends the steepness rna degradation plot therefore used quality control metric assay validation studies18 concluded whenever slopes values greater 3 would disqualify data set downstream analysis since advanced degradation rna would cause measurement unreliable the figure 4 provides quick overview overall quality 5 laboratory data sets it shows high quality therefore valid subsequent analyses the affymetrix genechips micro array based assays deliver large data sets 40,000 variables case the spread value 40,000 variables problem space evidently varies in addition based prior knowledge regulation gene expression reasonable state mrna level data matrix made 40,000 independent events instead fair amount redundancy the spread data across 40,000 dimensions assessed deriving principal components the score plots 5 laboratory data sets presented figure 4 showed biological variability seems conserved across 5 measurement sets in addition every laboratory measurement biological conditions clustered within area scatter plot 2 major principal components firstly information content regards biological input seems maintained prior inception experiment mice represented biological object animal outputting physiological phenotype values within range biological noise secondly animals divided 3 subgroups fed differently end experiment based observations aforementioned physiological values different environmental input submitted initially homogenous set animals produced 3 subsets different animals the principle components analysis pca plots figure 4 suggest rna content liver 3 groups animals also different data output series molecular transformations kept difference the environmental challenge caused physiological change well change composition rna featured liver altogether initial explorations allowed conclusion rna molecules quantified study degraded suitable subsequent correlation studies the density plot normalization outcome shown figure 4 shows expected adjustment brought data set distributions the data sets regardless biological conditions centered value exhibited similar spread the normalization scope prevent artifactual shift mrna level matrix brought inherent technical variability eg optical instrument affymetrix scanner series observations data evidence yet would suggested source biological variability conserved 5 data matrices therefore looked one could confidently infer mrna molecules exhibited change correlating perturbation brought different feeding conditions reasonable approach identify elements perform parametric test assuming normal distribution mrna level populations this assumption might even required case given number replicates large enough rely central limit theorem an independent samples test run address question whether mouse liver mrna respective level shifted different distribution whenever mice high caloric food intake opposed low caloric words 2 conditions 3 original design chosen exploration data set given large number elements set compared ie ~40,000 test followed correction multiple comparisons using false discovery rate fdr analysis case.19 pairwise comparison run initially 1 laboratory data set table 1 shows top lower q value affymetrix probe set elements returned test q value lower 1.10e-7 allows us conclude fairly high confidence 20 elements belong distribution reference ie distribution level mrna extracted low caloric fed mice following test 1 laboratory data set exact comparison exact data analyses procedure table 1 shows top 20 lower q value affymetrix probe set elements 3 5 laboratory data sets table 2 shows overlap 5 data sets unexpectedly 20% affymetrix probe set elements common values across 5 lists the pca discussed figure 4 suggested mrna level data sets maintained sources biological variability the result table 1 argued information content data sets addition biology liver cells the whole data set included 5 laboratory measurements analyzed single data set 75 cel cell intensity files referred cel files used input robust multi array rma normalization operation single normalized data matrix featuring 75 conditions created the pca score plot figure 5 shows 1 source variability accounted mouse liver cell physiology the data points clustered regards laboratory rna processed these differences rna labeling subtle might seem obviously modify final nucleic acids composition mix applied microarray plots figure 4 show 5 data sets contained biologically meaningful informational contents plots figures 5 6 results table 1 indicate post rna extraction manipulations potentially modify original rna composition however ample gene expression studies reported literature variability rna content attributed exclusively biological variability the ease rna content measured high throughput manner made biomolecule choice whole range biological studies objective correlate change biological factor respect change discrete rna molecule content the assumption studies variability mrna level data captured either micro array based and/or pcr based methodology uniquely attributable change biology report show seldom case therefore suggest revisions experimental designs made prior confident biological knowledge obtained studies the experimental design current report exception thus unlikely become norm however data set gave us opportunity unravel extent post- extraction rna processing impacts final read the alignment loading scoring plot figure 6 allowed us identify variable ie probe set measurement actually contributed spread data points score plot due biological factor score plot figure 6a relative position dot corresponds sample the samples cluster regards laboratory measurement done also biological condition in words data set features two pieces information original distribution rna unique contributor variability samples would clustered two groups loading plot fig the clustering samples regards biological conditions specified probe sets co- localized two 3- dimensional plots the loading plot therefore provides means interpret score plot identify independent variable ie mrna contribute biological variability these probe sets highlighted red loading plot map 25% overlap table 1 expected these rna present different quantity liver mouse cell prior rna extraction the remaining changes rna composition due effect rna labeling procedure as 1 high throughput method devised since early days dna microarrays almost 20 years ago legitimate concerns raised relevance comparing 1 data set acquired 1 method eg affymetrix genechip another method eg agilent microarray debate also moved comparison array based methods pcr based methods exemplified quantitative real time pcr the latest update matter released fda study group called microarray quality control maqc advised research community overall data sets collected various platforms perform relatively concordance other.10 2 comments might added current recommendations maqc group study performed respect component high throughput rna measurement ie preparation labeled rna ii despite overlap results return biological sample 2 distinct assay platforms remains large fraction observations due idiosyncrasy measurement artifacts usually filtered research community rather tend accumulate knowledge based derived transcriptomic studies order illustrate latter point used 100 lowest q value elements 5 laboratory data sets argument 1 implementations algorithm altogether referred gene set enrichment analysis gsea).20 5 queries return similar answers the scope gene set enrichment query identify significant contribution 1 1 genes classes according gene ontology classification.20 genes grouped categories case 3 including biological component cellular location biochemical activity this classification relies prior knowledge falls within gene ontology classification.21 gsea queried gene ontology database query set 100 elements assign element cognate attributes value applies nonparametric test eg kolmogorov smirnov test infer occurrence gene ontology attributes values carried 100-element set significantly overrepresented the scope gsea provide means interpret outcome high throughput gene expression result described article meant derive biological information list genes to extent gsea result interpreted light pca plots shown figures 4 5 analyses provided evidence data set outcome long series molecular transformation holds valuable biological information the overlap 5 data sets shown table 1 likely genuinely differential mrna levels correlating environmental challenge submitted biological system these rna species identified gsea since share common gene ontology attributes values the fact significant gene ontology classes retrieved suggests remaining subset different mrna levels recorded data sets stochastic events caused various methods applied label rna the biochemical molecular methods applied raw rna labeled nucleic acids assayed microarray disturbed original distributions rna eventually causing partial loss biological information a matter concern lies inference procedure used gsea results instances authors would assign gene ontology class returned gsea query elements query list the rationale given gsea returned expected outcome whole query set bona fide material reliably provide biological knowledge gsea scenario basically used additional qc metric case study would allow us conclude 100 elements gsea query involved carbohydrate metabolism the literature unfortunately populated growing number reports lists genes assigned particular phenotype virtue aforementioned inference procedure accordance investigators engaged genomic research recently reported need vigilant transparent regards documentation recording published data,22 report reinforces recommendations high throughput genomics data sets needs recorded settings minimize source confounding effects the ease rna content measured high throughput manner made biomolecule choice whole range biological studies objective correlate change biological factor respect change discrete rna molecule content the assumption studies variability mrna level data captured either micro array based and/or pcr based methodology uniquely attributable change biology report show seldom case therefore suggest revisions experimental designs made prior confident biological knowledge obtained studies the experimental design current report exception thus unlikely become norm however data set gave us opportunity unravel extent post- extraction rna processing impacts final read the alignment loading scoring plot figure 6 allowed us identify variable ie probe set measurement actually contributed spread data points score plot due biological factor score plot figure 6a relative position dot corresponds sample the samples cluster regards laboratory measurement done also biological condition in words data set features two pieces information original distribution rna unique contributor variability samples would clustered two groups loading plot fig the clustering samples regards biological conditions specified probe sets co- localized two 3- dimensional plots the loading plot therefore provides means interpret score plot identify independent variable ie mrna contribute biological variability these probe sets highlighted red loading plot map 25% overlap table 1 expected these rna present different quantity liver mouse cell prior rna extraction the remaining changes rna composition due effect rna labeling procedure as 1 high throughput method devised since early days dna microarrays almost 20 years ago legitimate concerns raised relevance comparing 1 data set acquired 1 method eg affymetrix genechip another method eg agilent microarray the debate also moved comparison array based methods pcr based methods exemplified quantitative real time pcr the latest update matter released fda study group called microarray quality control maqc advised research community overall data sets collected various platforms perform relatively concordance other.10 2 comments might added current recommendations maqc group study performed respect component high throughput rna measurement ie preparation labeled rna ii despite overlap results return biological sample 2 distinct assay platforms remains large fraction observations due idiosyncrasy measurement artifacts usually filtered research community rather tend accumulate knowledge based derived transcriptomic studies order illustrate latter point used 100 lowest q value elements 5 laboratory data sets argument 1 implementations algorithm altogether referred gene set enrichment analysis gsea).20 5 queries return similar answers the scope gene set enrichment query identify significant contribution 1 1 genes classes according gene ontology classification.20 genes grouped categories case 3 including biological component cellular location biochemical activity this classification relies prior knowledge falls within gene ontology classification.21 gsea queried gene ontology database query set 100 elements assign element cognate attributes value applies nonparametric test eg kolmogorov smirnov test infer occurrence gene ontology attributes values carried 100-element set significantly overrepresented the scope gsea provide means interpret outcome high throughput gene expression result described article meant derive biological information list genes to extent gsea result interpreted light pca plots shown figures 4 5 both analyses provided evidence data set outcome long series molecular transformation holds valuable biological information the overlap 5 data sets shown table 1 likely genuinely differential mrna levels correlating environmental challenge submitted biological system these rna species identified gsea since share common gene ontology attributes values the fact significant gene ontology classes retrieved suggests remaining subset different mrna levels recorded data sets stochastic events caused various methods applied label rna the biochemical molecular methods applied raw rna labeled nucleic acids assayed microarray disturbed original distributions rna eventually causing partial loss biological information a matter concern lies inference procedure used gsea results instances authors would assign gene ontology class returned gsea query elements query list the rationale given gsea returned expected outcome whole query set bona fide material reliably provide biological knowledge gsea scenario basically used additional qc metric case study would allow us conclude 100 elements gsea query involved carbohydrate metabolism the literature unfortunately populated growing number reports lists genes assigned particular phenotype virtue aforementioned inference procedure accordance investigators engaged genomic research recently reported need vigilant transparent regards documentation recording published data,22 report reinforces recommendations high throughput genomics data sets needs recorded settings minimize source confounding effects

ribonucleic acids ( rna ) are hypothesized to have preceded their derivatives , deoxyribonucleic acids ( dna ) , as the molecular media of genetic information when life emerged on earth . molecular biologists are accustomed to the dramatic effects a subtle variation in the ribose moiety composition between rna and dna can have on the stability of these molecules . while dna is very stable after extraction from biological samples and subsequent treatment , rna is notoriously labile . the short half - life property , inherent to rna , benefits cells that do not need to express their entire repertoire of proteins . the cellular machinery turns off the production of a given protein by shutting down the transcription of its cognate coding gene and by either actively degrading the remaining mrna or allowing it to decay on its own . the steady - state level of each mrna in a given cell varies continuously and is specified by changing kinetics of synthesis and degradation . because it is technically possible to simultaneously measure thousands of nucleic acid molecules , these quantities have been studied by the life sciences community to investigate a range of biological problems . since the rna abundance can change according to a wide range of perturbations , this makes it the molecule of choice for exploring biological systems ; its instability , on the other hand , could be an underestimated source of technical variability . we found that a large fraction of the rna abundance originally present in the biological system prior to extraction was masked by the rna labeling and measurement procedure . the method used to extract rna molecules from cells and to label them prior to hybridization operations on dna arrays affects the original distribution of rna . only if rna measurements are performed according to the same procedure can biological information be inferred from the assay read out .

coronary heart diseases responsible almost half deaths developed countries 25% deaths developing countries open heart surgery median sternotomy commonly performed patients blocked heart vessels it impede normal respiration deep breathing effective coughing sputum clearance may result respiratory dysfunction hypoxemia atelectasis pneumonia so effective pain management leads earlier recovery reduces postoperative complications duration hospitalization increases patient satisfaction one simplest cheapest nonpharmacologic ways relieve pain use cold cold therapy effective safe method complications side effects there paucity scientific evidence use cold therapy patients cardiac surgery this study conducted investigate following hypotheses questions 1 cold gel pack reduce pain associated deep breathing coughing db c cardiac surgery ? ( 2 sensations patients application cold gel packs sternal incision dressing 3 patients undergoing open heart surgery prefer cold therapy prior db c ? this study randomized controlled trial rct crossover design conducted cardiac surgery intensive care unit icu university affiliated hospital urmia iran the crossover design allows subject serve control effectively remove subject subject variation investigation relative effect treatment reduces variability directly increases power data gathered 8 a.m. 5 p.m. order reduce variablity among patients cold therapy applied first post surgical day oriented place time able report pain all patients performed four episodes dbandc two cold gel pack two without every 2 h. seqence gel pack application randomized half patients given gel pack 15 min followed period treatment ( called washout period given gel pack the half started without gel pack first followed washout period treatment gel pack given the washout period 2 h. random allocation groups performed using random number table inclusion criteria patients included 1 male female patients scheduled coronary artery bypass graft cabg surgery median sternotomy 2 age 21 years 3 able understand speak persian 4 minimum literacy reading writing 5 willing give written informed consent exclusion criteria patients included 1 mechanically ventilated patients 2 patients diseases affect pain measurement delirium dementia major depression severe visual hearing verbal impairment 3 contraindication cold therapy use e.g. reynaud disease cryoglobulinemia clumping plasma protien sickle cell anemia cold allergic conditions areas impaired sensation 4 diabetic patients 5 postoperative complications infection bleeding uncontrolled atrial fibrillation wound dehiscence gel packs used cold source weighed 320 g measured 25 cm 10 cm they kept freezer patient service unit frozen temperature reached 0c 5c removed freezer placed cotton bag the timer activated 15 min gel pack used directly sternal wound dressing literature controversy exists regarding recommended length application time ranges 5 60 min achieve therapeutic effect cold therapy so 15-min application time selected study achieve desired effect patients asked rate severity pain using horizontal scale numbered 0 absence pain 10 intense pain possible numerical rating scale nrs well known acceptable reliablity validity approved many authors patients different diagnoses the following open ended questions asked every 5 min session using cold gel pack assess patients perception cold therapy gel pack feel chest ? can describe sensation assess preferences cold therapy following questions asked end fourth session prefer cold therapy prior dbandc ? data collection instruments used research follows patient profile form specifically designed study completed patients this five part form consisted 1 demographic information part stating age sex level education marital status religion employment 2 general information part stating height weight body temperature amount hemoglobin 3 present history information part stating diagnosis type cardiac surgery 4 past history part stating underlying diseases like diabetes hypertension previous heart surgery 5 nursing history part included history smoking opioid addiction analgesics prescribed administered type amount time medication administered)nrs measuring intensity painpatients description form regarding sensations preferences transcribed verbatim paper a patient profile form specifically designed study completed patients this five part form consisted 1 demographic information part stating age sex level education marital status religion employment 2 general information part stating height weight body temperature amount hemoglobin 3 present history information part stating diagnosis type cardiac surgery 4 past history part stating underlying diseases like diabetes hypertension previous heart surgery 5 nursing history part included history smoking opioid addiction analgesics prescribed administered type amount time medication administered nrs measuring intensity pain patients description form regarding sensations preferences transcribed verbatim paper a cosecutive sample 50 patients hospitilized confirmed diagnosis coronary artery disease cad entered study 24 june 2012 20 august 2012 the ethics committee urmia medical sciences university umsu hospital authorities approved research protocol diseases raynaud syndrome sickle cell anemia ruled cardiac surgeon also patient enquired allergy cold the voluntary nature study confidentiality information freedom withdraw time assured the investigator described study aims nsr techniques db c patient operation patients randomly allocated begin db c sessions either gel pack without gel pack prior beginning db c sessions the patients rated baseline pain 0 10 nsr gel pack sessions the investigator brought gel pack freezer placed dressing covering patient chest incision the investigator remained patients 15 minutes gel pack used fifteen minutes15 min gel pack application the patients asked describe sensation shethey felt gel pack application after 15 minutes gel pack picked upremoved head bed elevated 45c 90c preparation dbandc sessions without gel pack sessions investigator prepared patients dbandc manner gel pack sessions a pillow folded sheet given patients splinting purposes dbandc started groups session three cycles three deep breaths performed followed episode coughing the patient asked rate pain 0 10 nsr completion third cycle end fourth session the patients ranged age 22 75 years average age 58.3 10.7 years group began trial gel pack 60.7 11.1 years group began trial without gel pack there 50 patients 35 males 15 females recruited study post cardiac surgery icu side effects complications due cold therapy via gel pack reported all patients one graft saphenous vein used also results showed statistically significant differences variables age gender moglobin level time receiving analgesic intervention body mass index bmi two groups beginning study p 0.5 average pain scores group started gel pack mean 4.56 standard deviation sd 1.64 group started without gel pack 5.36 sd 1.7 significantly different 1.7 df 48 p 0.1 2 intervention 2 session 2 time within subjects repeated measures analysis variance r anova conducted pain intensity scores db c patients undergoing open heart surgery median sternotomy the three independent variables intervention two levels gel pack gel pack application session two levels a.m. p.m. time two levels befor pain scores db c average 6.18/10 without gel pack compared 3.81/10 gel pack the interaction intervention time significant p 0.001 table 2 indicated pain scores db c significantly lower patients used gel pack the main effects regard intervention session pain significant p 0.001 regard time non signficant p 0.052 means standard deviations pain intensity scores pre- post db c interactions intervention session time found rm anova first time applying cold gel pack 48 96% patients reported feeling coolness 2 4% patients felt numbness second time applying cold gel pack 37 74% patients reported feeling coolness 4 8% patients felt cold 9 18% experienced numbness one experienced tingling of 50 patients 45 90% stated would use gel pack pain management future pain thoracotomy probably severe pain experienced surgeries patients underwent cardiac surgeries report severe pain coughing deep breathing despite implementing pharmacologic interventions use nonsteroidal anti inflammatory drugs nsaids opioids pain control inadequete might impede deep breathing effective coughing study pain scores dbandc lower gel pack compared without gel pack four sessions the results study showed cold therapy effective method management sternal incision pain associated dbandc cardiac surgery patients similar study participants underwent four episodes dbandc two gel pack two without similar results obtained cold therapy various conditions chest tube removal soft tissue injuries hernia orthopedic injuries according nrs pain intensity pain scores 1 3 10-point scale are considered mild pain scores 3 6 moderate pain patients study reported pain moderate 3.81/10 using gel pack compared severe pain 6.18/10 reported without gel pack the decrease 2.37 10-point pain intensity scale statistically significant p 0.001 rm anova application cold gel packs resulted decreased skin temperature feeling coolness cold numbess patients no one experienced negative sensations tingling aching burning application gel pack feeling coolness prevalent sensation application cold gel pack five patients like experience cold like feeling cold chailler et al reported 28% n 9 72% n 23 participants felt cold coolness application cold gel pack sternal insicion site most patients n 45 90% expressed would reapply gel pack future main reasons preferring cold gel pack pain reduction n 31 69% feeling coolness n 3 6.7% n 11 24.4% cooling sternum cold gel packs seems appealing method pain management perceived effective pain reduction the samples study consisted mainly males limiting factor future studies investigate effects cold application combined different pharmacologic nonpharmacologic therapeutic techniques both superficial deep temperature changes depend method cold application future studies could also probe information effects different temperatures time periods ways cold application e.g. ice pack ice towel ice massage ice chip application cold gel pack effective reducing incisional pain associated db c cardiac surgery patients nurses spend time patients compared members treatment team clinical centers best position pain management they make important decisions regarding use nonpharmacologic therapeutic interventions pain management cold therapy one nonpharmacologic methods easily use

background : coughing and deep breathing after sternotomy causes severe pain . this study was conducted to assess the effect of cold therapy on the pain in patients undergoing open heart surgery.materials and methods : in a randomized controlled trial ( rct ) with crossover design , 50 eligible and consenting patients were recruited and randomly allocated to gel pack and non - gel pack groups on the first postoperative day . all patients performed four episodes of deep breathing and coughing ( db and c ) every 2 h. pain intesity was measured and compared at rest and after db and c in both groups . at the end of the study , all patients were asked about their preferences for the cold gel pack application prior to db and c. the study hypotheses were analyzed using repeated measures analysis of variance ( rm - anova).results : data analysis showed significant reduction in pain scores ( p < 0.001 ) after cold gel application . forty - five ( 90% ) patients were inclined to reapply the gel pack in the future.conclusion:cold gel pack can reduce the pain associated with db and c in cardiac surgery patients .

symptomatic trigeminal neuralgia tn caused demonstrable structural lesion vascular compression typically posterior fossa tumors multiple sclerosis 1 2 this pain may either persistent intermittent sometimes occurring brief attacks may reproduce tn features we report case patient wallenberg syndrome started shock like painful paroxysms first division trigeminal nerve v1 a 41-year old man visited hospital reporting 48-h lasting pain localized right side neck three hours entering emergency room patient felt sudden dizziness gait instability clumsiness right limbs his past medical history remarkable non controlled hypertension well frequent alcohol occasional cocaine intake the patient denied drug intake past days general physical examination relevant the neurologic examination revealed moderate dysarthria right horner syndrome vertical nystagmus extreme gaze positions absent right gag reflex right facial left two limb hypoalgesia thermoanesthesia mild paresis right limbs severe right limb ataxia an early brain computed tomography ct scan detect significant abnormalities magnetic resonance imaging mri showed recent infarction right lateral medulla fig in addition complete occlusion right vertebral artery demonstrated magnetic resonance angiography mra fig 2 there evidence vascular contact root entry zone right trigeminal nerve.fig a axial t2-weighted flair mri shows slight hyperintensities right lateral medulla right cerebellum b diffusion weighted mri demonstrates restricted water motion lesion shown indicating recent infarctionfig coronal maximum intensity projection mra reveals occlusion right vertebral artery likely due artery dissection magnetic resonance imaging mri a axial t2-weighted flair mri shows slight hyperintensities right lateral medulla right cerebellum b diffusion weighted mri demonstrates restricted water motion lesion shown indicating recent infarction magnetic resonance angiography mra coronal maximum intensity projection mra reveals occlusion right vertebral artery likely due artery dissection forty eight hours admission patient suffered aspiration pneumonia breathing compromise required intubation intensive care unit icu after several lung complications eventually extubated returned hospital ward 1 month stroke moment we found neurologic signs presented onset though milder including sensory impairment right side face two days leaving icu patient started brief electric shock like pains whole distribution first division v1 right trigeminal nerve pain attacks fulfilled diagnostic criteria symptomatic tn according international classification headache disorders 2nd edition ichd ii they lasted 35 occurred least 10 times per hour given score 8 10 visual analogue pain intensity scale treatment gabapentin initiated dose 300 mg t.i.d patient experienced decrease pain frequency intensity plus restriction pain circumscribed periocular area when gabapentin titrated 600 mg t.i.d pain finally controlled discharge he maintained dose recurrences pain 2-month follow it widely accepted commonest cause tn compression trigeminal root entry zone blood vessel the term classical tn applied cases potential vascular compression unknown etiology when causative lesion vascular compression demonstrated diagnosis symptomatic tn made overall symptomatic tn accounts 15% cases nt majority caused cerebellopontine angle tumors multiple sclerosis although brainstem infarction previously suggested possible cause tn balestrino leandri reported first well documented case 1997 these authors discovered small ischemic lacune right lateral part pons patient 4-year history ipsilateral second division v2 tn slight sensory loss 1998 golby et al described patient started lancinating pain v1 v2 distributions left side he experienced sudden hemifacial numbness 1 year mri demonstrated old ischemic lesion root entry zone trigeminal nerve 2004 peker et al reported female patient suddenly developed neuralgic pain left chin cheek a slight hypoesthesia found v2 v3 territories mri showed chronic infarction transecting central trigeminal pathways within pons 2006 warren et al described female patient presented concurrent left trigeminal glossopharyngeal neuralgia katsuno teramoto recently reported patient sudden onset facial numbness tn right v2 dermatome mri showed acute pontine infarction root entry zone right trigeminal nerve the pathogenesis tn secondary brainstem ischemic lesion uncertain main hypothesis states demyelination central trigeminal pathways would cause ephaptic transmission thereby abnormal electric impulses happens multiple sclerosis other theories postulate irritation trigeminal structures bed made scar would base excessive reactivity epileptic like manner facial pain may feature wallenberg lateral medullary syndrome along decrease pain temperature sensation face other clinical features include vertigo eye movement disorders ipsilateral horner syndrome ipsilateral limb ataxia contralateral sensory deficit reviewing literature pain incidence rates following lateral medullary infarction vary largely higher rates follow observations the pain may start stroke onset patients latency 2 weeks 6 months some patients feel constant boring pain others describe short pain attacks occur either spontaneously related innocuous stimulus therefore wallenberg syndrome typical cause central post stroke pain pain may occasionally take attributes symptomatic tn among 12 patients wallenberg syndrome fitzek et al found 6 patients facial pain the latency stroke pain onset ranged 1 month 2 years facial pain always ipsilateral infarction mostly localized periorbital region these patients reported short pain attacks lasting seconds minutes three also persistent pain although diagnosis tn made shortest pain attacks i.e lasting seconds apparently typical tn features patient also neuralgiform pain attacks association wallenberg syndrome the painful paroxysms brief intense fulfilling ichd ii diagnostic criteria symptomatic tn they started latency 1 month stroke onset line fitzek series hypoesthesia extended territory three trigeminal branches pain occurred v1 distribution this also accordance fitzek cases whose pain mostly centered periorbital region contrast classical tn usually starts v2 v3 rarely affects v1 1 11 the somatotopic arrangement trigeminal fibers may possibly account topographical differences tn due nerve root compression tn due lateral medullary infarction lesions dorso lateral medulla involve trigeminal descending tract trigeminal spinal nucleus may lead sensory impairment pain ipsilateral face fitzek s clinical series wallenberg syndrome patients facial pain lesions covering trigeminal spinal tract nucleus lower medulla demonstrated mri in addition r2 blink reflex component abnormal patients facial pain likewise sensory thresholds ipsilateral face specifically elevated patients presenting facial pain 3 10 the existing studies deal tn associated multiple sclerosis small open label trials three trials including total 19 patients multiple sclerosis reported effect gabapentin alone associated carbamazepine in fact gabapentin pregabalin amitriptyline currently recommended first line treatment central neuropathic pain indeed experienced significant improvement drug initiated complete relief titration conclusion ischemic lesions covering trigeminal spinal tract nucleus lower levels medulla seem involved pathogenesis pain gabapentin might effective drug symptomatic tn related lateral medullary infarction

symptomatic trigeminal neuralgia due to a brainstem infarction is said to be rare . however , facial pain is not uncommon in wallenberg s syndrome . facial pain related to a wallenberg s syndrome may be either persistent of intermittent , and occasionally occurs in brief attacks . here , we report a patient with a right lateral medullary infarction who started having first division trigeminal neuralgia 1 month after the stroke . the pain paroxysms were suppressed with gabapentin .

primary hyperparathyroidism phpt disease characterized hypercalcemia due autonomous production parathyroid hormone pth phpt third common endocrine disorder west diabetes mellitus thyroid disorders overall 1% adults phpt west figure rises 2% people older 55 years advent multichannel biochemical screening 1970s the clinical profiles phpt remarkably differ regions world developing countries india phpt still uncommonly diagnosed overtly symptomatic disease skeletal muscular renal manifestations in contrast phpt become asymptomatic disease west classic manifestations seen 2% cases nowadays study describe clinical characteristics biochemical profile outcome 78 patients phpt seen period two decades single center kashmir valley all patients underwent evaluation surgery phpt january 1996 december 2015 sher kashmir institute medical sciences included study a total 78 patients identified two decades 29 patients studied retrospectively 19962012 remaining 49 patients studied prospectively 20122015 the diagnosis phpt based following persistent elevation serum calcium upper limit normal range 10.5 mg dl ii increased intact pth ipth iii histological evidence parathyroid surgery parathyroid adenoma hyperplasia evaluation patients included measurement serum total calcium inorganic phosphorus total alkaline phosphatase alp ipth 25-hydroxy vitamin 25-ohd serum albumin 24 hour urinary calcium creatinine serum total calcium inorganic phosphorus total alp serum creatinine measured automated techniques the normal laboratory range 8.510.5 mg dl total serum calcium 2.54.5 mg dl serum phosphorus 30140 iu l serum alp radiological survey hands skull lumbar spine pelvis suspected known site fracture performed imaging studies localization parathyroid adenoma included ultrasonography usg neck technetium-99 tc sestamibi scan serum ipth measured chemiluminescent immunometric assay serum 25-ohd measured radioimmunoassay vitamin deficiency defined serum 25-ohd level 20 ng ml patients in single parathyroid adenoma localized tc sestamibi scan unilateral neck exploration performed removal adenoma patients doubtful lesion nonlocalized lesions underwent bilateral neck exploration parathyroid glands examined removal 3 glands statistical analysis done pc windows using statistical package social sciences spss version 11.5.0 spss inc pearson chi square method used comparing proportions percentages whereas student test used comparing continuous variables anova used wherever needed data uniformly distributed nonparametric test mann smirnov z test kruskal wallis h test used p 0.05 taken statistically significant in patients single parathyroid adenoma localized tc sestamibi scan unilateral neck exploration performed removal adenoma patients doubtful lesion nonlocalized lesions underwent bilateral neck exploration parathyroid glands examined removal 3 glands statistical analysis done pc windows using statistical package social sciences spss version 11.5.0 spss inc pearson chi square method used comparing proportions percentages whereas student test used comparing continuous variables anova used wherever needed data uniformly distributed nonparametric test mann smirnov z test kruskal wallis h test used p 0.05 taken statistically significant the clinical characteristics patients shown table 1 overwhelming majority 67/78 85.7% patients females giving male female ratio 1:6 the mean age patients 44.72 12.46 median 45 years range 1670 years nephrolithiasis and/or nephrocalcinosis figure 1 common presentation seen 50 64.10% patients followed bone pain 26 44.1% abdominal pain 24 39% constipation 16 26% myopathy 11 14.10% skeletal involvement osteopenia sub periosteal resorption pathological fractures salt pepper appearance skull brown tumors present 31 39.74% patients 8 10.25% fractures figure 2 about one fourth 19 24.38% patients renal skeletal manifestations clinical characteristics 78 patients primary hyperparathyroidism radiograph abdomen showing extensive bilateral nephrolithiasis b striking improvement successful parathyroid surgery radiograph showing advanced bone disease fracture femur b brown tumor tibia fifty patients nephrolithiasis 15 30% past history least one surgery renal stones prior diagnosis phpt another four patients received extracorporeal shock wave lithotripsy least prior diagnosis phpt the mean serum calcium level 12.5 1.7 mg dl median12 range 10.719 the mean serum ipth level 377.6 386.1 pg ml median 224.5 range 701900 hypophosphatemia serum inorganic phosphorus 2.5 mg dl documented 54 69.23% patients the mean serum inorganic phosphorus level 2.2 0.6 mg dl median 2.2 hypercalciuria 24 h urinary calcium 4 mg kg present 41 52.56% patients the mean serum alp 255.1 336.8 iu l median 154 biochemical variables 78 patients primary hyperparathyroidism serum 25-ohd available 54 patients the mean 25-ohd level 37.2 58.1 ng ml median 22.8 range 4.3312 we find correlation vitamin status biochemical parameters serum calcium ipth adenoma weight two females aged 25 23 years phpt microprolactinoma whereas 58-year old female patient phpt acromegaly two patients associated adrenal incidentalomas causing sub clinical cushing syndrome one 27-year old female patient presented postpartum period nephrogenic diabetes insipidus sole manifestation phpt settled immediately parathyroid surgery all patients underwent usg neck tc-99 sestamibi scan localization parathyroid adenoma series sensitivity usg tc-99 sestamibi scan localization adenoma 89.8% 95.3% respectively time surgery single adenoma involved 69 88.46% double adenomas 6 8.57% 2 gland involvement 3 4.28% patients among 69 patients single adenoma right inferior gland involved often 40 57.97% followed left inferior 22 31.88% right superior 7 0.14% none patients involvement left superior gland on histopathology adenoma found 75 94.44% hyperplasia 3 3.79% patients the mean parathyroid gland weight 2.05 3.03 g median 1.05 range 0.113.8 using pearson correlation coefficient the mean postoperative serum ipth level 61.8 43.8 pg ml range 10.7154 postoperative hungry bone syndrome hbs observed 8 10.12% patients this managed oral calcium calcitriol five patients whereas three patients needed parenteral calcium gluconate infusion permanent hypoparathyroidism observed single patient postoperative pancreatitis documented one patient no patient sustained permanent vocal cord paralysis wound infection sepsis surgical success cure phpt defined maintenance eucalcemia arbitrarily accepted interval 6 months surgery based definition overall cure rate series 96.15% 75 78 patients achieved cure one patients men-1 phpt acromegaly underwent removal four parathyroid glands the second patient young male preoperatively left inferior adenoma localized persistent disease however achieved cure second surgery out 75 patients achieved cure long term follow one year range 19 years available 41 patients follow period none recurrence phpt at time surgery single adenoma involved 69 88.46% double adenomas 6 8.57% 2 gland involvement 3 4.28% patients among 69 patients single adenoma right inferior gland involved often 40 57.97% followed left inferior 22 31.88% right superior 7 0.14% none patients involvement left superior gland on histopathology adenoma found 75 94.44% hyperplasia 3 3.79% patients the mean parathyroid gland weight 2.05 3.03 g median 1.05 range 0.113.8 using pearson correlation coefficient the mean postoperative serum ipth level 61.8 43.8 pg ml range 10.7154 postoperative hungry bone syndrome hbs observed 8 10.12% patients this managed oral calcium calcitriol five patients whereas three patients needed parenteral calcium gluconate infusion permanent hypoparathyroidism observed single patient postoperative pancreatitis documented one patient no patient sustained permanent vocal cord paralysis wound infection sepsis surgical success cure phpt defined maintenance eucalcemia arbitrarily accepted interval 6 months surgery based definition overall cure rate series 96.15% 75 78 patients achieved cure one patients men-1 phpt acromegaly underwent removal four parathyroid glands the second patient young male preoperatively left inferior adenoma localized persistent disease however achieved cure second surgery out 75 patients achieved cure long term follow one year range 19 years available 41 patients follow period the traditional age presentation phpt india 4 decade study our results reflect shift presentation phpt fourth fifth decade india however patients continue much younger patients developed countries comparison present study indian studies renal stone disease 50:64.10% patients common presentation series the prevalence renal stones fallen 57% 5% west due detection asymptomatic cases thirty percent patients renal stones past history least one surgery renal stones another four patients 8% received lithotripsy prior diagnosis phpt surprisingly none patients serum calcium estimation advised previous evaluation this significant delay diagnosis phpt reflects lack awareness among urologists nephrologists general practitioners regarding phpt mishra et al 2001 study 29 patients reported osteitis fibrosa cystica fractures 57% patients in study 52 patients reported bone disease 67% fractures 48% patients a systematic review phpt india reported fractures 40% brown tumors 42% patients a recent indian study reported fractures 25.8% phpt patients brown tumors none study fractures present 10.25% brown tumors 6.41% patients this lowest prevalence fractures cohort phpt patients india our results reflect changing trend presentation phpt india wherein overt skeletal disease form fractures brown tumors decline the remarkably low prevalence fractures series probably due earlier diagnosis phpt last years half subjects enrolled 2013 onwards the improvement vitamin nutrition reflected mean serum 25-ohd 37.2 ng ml patients the frequency specific radiological manifestations phpt united states declined 23% 1960s remarkably low 2% 1990s the difference severity skeletal disease phpt western eastern populations determined calcium vitamin nutrition additional factors also play role previous data india report 1213% patients phpt pancreatitis series the mechanisms phpt induced pancreatitis include hypercalcemia induced activation trypsinogen trypsin ductal obstruction due pancreatic calculi finally genetic risk factors all patients hypercalcemia mean serum calcium level 12.5 mg dl remarkably similar reported indian studies a previous indian study reported hypophosphatemia 65% patients phpt another indian study reported normal mean serum phosphorus phpt patients the mean serum ipth level patients 377.6 pg ml lower reported previous indian studies elevated alp consistently reported indian series due high prevalence bone disease phpt patients the mean parathyroid weight 2.05 3.03 g study markedly lower reported indian studies table 3 we found strong correlation parathyroid gland weight serum calcium ipth reported previously the mean serum 25-ohd 37.2 58.1 ng ml study higher reported previous indian studies however vitamin deficiency present 38% patients an inverse correlation serum 25-ohd concentration parathyroid gland weight reported previously we find correlation vitamin status biochemical parameters serum calcium ipth adenoma weight the likely reason possibility prior vitamin treatment uncertainty timing amount could confounded 25-ohd measurements time presentation in addition vitamin may significant factor development bone disease phpt patients factors could playing significant role the preoperative localization abnormal parathyroid gland reduce operative time postoperative morbidity need repeat surgery the imaging methods localization include high resolution usg tc sestamibi scan computerized tomography magnetic resonance imaging the sensitivity usg localize adenoma reported 6577% whereas sensitivity tc sestamibi scan reported 86.9100% series sensitivity usg tc sestamibi scan localization adenoma 89.8% 95.3% respectively sensitivity 89.8% conclude usg effective localization modality inexpensive widely available mishra et al study 29 patients reported cure rate 100% previous indian studies reported postoperative hbs large proportion patients 24% 82% study our results agreement recent indian study postoperative hbs seen four patients 8% fifty our policy treat patients preoperative serum 25-ohd level 30 ng ml vitamin probability responsible much lower prevalence postoperative hbs series consistent data recurrent phpt long term follow revealing recurrence rates zero 41.6% none 41 patients series follow available 19 years recurrence phpt the strengths study include large size largely prospective nature two thirds 62% subjects evaluated prospectively lack data bone mineral density many patients vitamin status limitations study in conclusion study reflects changing trend clinical profile phpt india there shift age presentation phpt fourth fifth decade renal stone disease emerging common presentation whereas overt skeletal disease form fractures brown tumors decline

background : although primary hyperparathyroidism ( phpt ) has become an asymptomatic disease in the west , in india , phpt is still an uncommonly diagnosed , overtly symptomatic disease with skeletal , muscular , and renal manifestations.aims:to describe the profile and surgical outcome of 78 consecutive phpt patients over a period of two decades at a single center.materials and methods : all patients who underwent evaluation and surgery for phpt from january 1996 to december 2015 were included . evaluation included measurement of serum total calcium , inorganic phosphorus , alkaline phosphatase , intact parathyroid hormone , 25-hydroxy vitamin d , 24 hour urinary calcium and radiological survey . ultrasonography neck and technetium-99 m sestamibi scan were used for preoperative localization.results:a total of 78 patients were identified during the two decades of whom 29 patients were studied retrospectively and 49 patients prospectively . mean age of patients was 44.72 12.46 , and male : female ratio was 1:6 . the most common presenting features were nephrolithiasis and/or nephrocalcinosis ( 64.10% ) , bone pain ( 44.1% ) , abdominal pain ( 39% ) , constipation ( 26% ) , and myopathy ( 14.10% ) . fractures were present only in 10.25% , and brown tumors in 6.41% patients . the cure rate in our series was 96.15% . the mean parathyroid gland weight was 2.05 3.03 g. none of the 41 patients in whom long - term follow - up was available , had recurrence of phpt.conclusions:the profile of phpt is changing with older age at presentation , and emergence of renal stone disease and decline in overt skeletal disease as common presentation . the parathyroid weight in our study resembles that reported from developed countries .

parkinson disease pd age related progressive neurodegenerative disorder associated selective loss dopaminergic neurons substantia nigra pars compacta region midbrain pd broadly classified familial form resulting genetic alterations like mutations multiplication snca gene encoding alpha synuclein -syn early onset form idiopathic form unknown etiology late onset form the majority idiopathic pd cases represent late onset sporadic form cytoplasmic -syn aggregates major component lewy bodies lewy neurites characteristic proteinacious cytoplasmic deposits pathological hallmark disease increasing evidence suggest oxidative stress key contributor pathogenesis pd causes damage nucleic acids dna rna proteins lipids cellular macromolecules whose functions indispensable cell survival the metabolism dopamine da contributes oxidative stress renders nigral neurons particularly vulnerable pd the frequent dna lesion generated oxidative stress 8-oxo-7,8-dihydroguanine 8-oxodg oxidized form guanine often associated neurodegenerative diseases including pd alzheimer disease ad 8-oxodg nonbulky dna lesion high mutagenic potential misincorporation adenine instead cytosine causing g ct transversion mutation 8-oxodg also implicated event called transcriptional mutagenesis tm whereby misincorporated adenine transcribing mrna leads generation mutated species protein figure 1 it well documented oxidative dna damage accumulates ageing brains accumulation significantly increased brains patients pd ad compared age matched controls these increased levels dna damage also corroborated decrease dna repair capacity specific enzymes 8-oxodg dna glycosylase1 ogg1 in addition involvement tumor development tm may important role neurodegenerative disorders nucleation dependent protein aggregation process pivotal role neuronal degeneration seen pd ad as shown -syn a53 mutant species reported familial form pd pathologically misfolded proteins drive template directed misfolding native monomeric proteins contributes nucleation dependent fibrillation process moreover compared replicating cells neurons post mitotic cells might even vulnerable 8-oxodg mediated tm pathogenic effects caused mutant species generated tm events could accumulated lifetime following review we discuss importance oxidative damage pd scope pathogenesis disease 8-oxodg mediated tm events but greatest paradox remains fact production reactive oxygen species ros product oxygen metabolism highly toxic cells it include free radicals like superoxide hydroxyl radical nitric oxide containing highly reactive unpaired electrons molecules like hydrogen peroxide peroxynitrite post mortem brain tissues patients pd ad amyotrophic lateral sclerosis als clearly demonstrated higher amount ros selective areas undergoes neurodegeneration oxidative stress originates rate ros production significantly higher compared elimination system for example elevated levels malondialdehyde 4-hydroxynonenal markers oxidized lipids observed cortex hippocampus patients ad substantia nigra patients pd spinal fluid patients als oxidative modification unsaturated fatty acids result generation lipid peroxides cause oxidation unsaturated fatty acids chain like event finally leading disruption plasma membranes membranes cellular organelles like mitochondria the levels protein carbonyls marker protein oxidation also reported consistently elevated hippocampus neocortex individuals ad lewy bodies case pd motor neurons als patients oxidation proteins disrupt active site enzymes lead conformational change disrupt protein protein interactions alter binding capacity dna eventually threatening cell survival in addition increased levels oxidative damage dna rna bases consistent neurodegenerative conditions like pd ad als although dna bases could potentially oxidized guanine susceptible base oxidative damage it gets readily oxidized form 8-oxodg serves marker oxidative damage ad level nuclear dna damage brain regions including frontal parietal temporal lobes significantly higher compared age matched controls overall concluded oxidative stress commonly associated neurodegenerative conditions critical role mediating disease processes the origin oxidative stress subsequent accumulation damage attributed overproduction ros also inefficient cellular defense repair machinery oxidative stress the defense machinery refers antioxidant enzymes like superoxide dismutase glutathione peroxidase glutathione reductase catalase among many others whose primary function scavenge ros generated cells for example superoxide dismutase converts superoxide hydrogen peroxide subsequently converted water either catalase glutathione peroxidase glutathione peroxidase detoxifies hydrogen peroxide using reduced glutathione process glutathione oxidized subsequently reduced glutathione reductase number reports have shown reduced activity antioxidant machinery ad familial als mutations copper- zinc containing superoxide dismutase lead toxic gain function rendering superoxide dismutase pro oxidant protein involved ros generation pd also characterized significant loss reducing agent glutathione substantia nigra one earliest known indicators nigral neuronal degeneration together evidences comprehensively indicate reduced antioxidant potential might critical factor toward increased oxidative stress associated neurodegenerative disorders discussed previously accumulation ros induced dna damage like oxidation bases single strand breaks implicated etiology ad pd als neurological disorders this accumulation dna damage may imply defect dna repair machinery cells it shown ros induced dna damages primarily repaired via highly conserved base excision repair pathway neuronal dysfunctions linked mutations differential expression base excision repair enzymes like ogg1 xrcc1 single strand break repair enzymes like tdp1 aprataxin double strand break repair enzymes like atm nbs1 furthermore shown ogg1 knockout mice exhibit age associated loss nigrostriatal pathways increased sensitivity dopaminergic neuronal toxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine wild type littermates together evidences strongly suggest oxidative stress mediated damage cellular macromolecules including dna coupled inefficient repair leads progressive neurodegeneration seen ad pd als others the high metabolic activity neurons along long life span makes highly susceptible oxidative damage moreover dopaminergic neurons substantia nigra affected brain region pd particularly vulnerable oxidative stress although exact causes selective vulnerability yet elucidated da metabolism considered major culprit selective degeneration da capacity auto oxidize normal ph toxic quinone species producing superoxide hydrogen peroxide monoamine oxidase also enzymatically deaminate da nontoxic metabolite 3,4-dihydroxyphenylacetic acid hydrogen peroxide hydrogen peroxide turn broken hydroxyl radical reaction catalyzed iron the level iron reportedly higher nigral dopaminergic neurons compared regions brain owning binding affinity neuromelanin therefore synthesized transported cells extracellular space da rapidly stored synaptic vesicles provides stable environment da without monoamine oxidase low ph conditions pd nigral neurons appear exaggerated oxidative stress causing severe damage cellular macromolecules damage nucleic acids particularly hazardous amongst cellular macromolecules change genetic information present nuclear mitochondrial genome dna damage oxidative stress result production either nonbulky dna lesions like 8-oxodg repaired base excision repair pathway bulky dna lesions generally repaired nucleotide excision repair pathway 8-oxodg frequent dna lesion caused oxidative stress often associated neurodegenerative diseases including pd immunocytochemical analysis 8-oxodg revealed significant increase dna oxidation marker substantia nigra patients pd although extent nuclear 8-oxodg accumulation high mitochondrial 8-oxodg despite presence 8-oxodg specific dna repair enzyme ogg1 significant percentage dna lesion remains unrepaired accumulated disease conditions moreover reported overall activity ogg1 brain decreases ageing mouse model the 8-oxodg generated direct oxidation dna base paired adenine well cytosine replication consequently lead spontaneous g c transversion mutation however majority cells body including neurons exist nonproliferating quiescent state neurons post mitotic cells face major challenge dna repair transcription failure maintain transcriptional translational fidelity expected result functional impairment cells studies shown many nonbulky lesions present sense strand dna could bypassed rna polymerase transcription leading misinsertion ribonucleotides growing mrna strands producing mutant transcripts this phenomenon referred tm event cells since significant increase 8-oxodg was observed substantia nigra patients pd highly possible tm event might significantly contribute pathogenesis pd next sections review perspective tm pd closely explored emphasis -syn reckoned major pathogenic molecule dna damage mediated mutagenesis replication based model provided wide range information better understanding origin mutation subsequently contribution pathogenesis human diseases cancers however discussed briefly last section majority cells normal physiological conditions frequently engaged division undergo continuous cycles replication most multicellular organs eukaryotes including brain heart mainly comprised nondividing terminally differentiated cells maintenance complex physiological functions organs primarily depends securing high fidelity transcription translation accumulation tm derived mutant transcripts subsequently generated erroneous proteins potential produce functional impairment nonproliferating cells organs as aging process may accompanied progressive deterioration normal cellular functions dna repair machinery antioxidation processes tm mediated adverse effects cells could exacerbated aging in fact vitro conditions allowing tm event shown round transcription keeps producing mutant transcript long 8-oxodg lesion repaired this event expected generate fairly large population mutant transcripts translated multiple times leading relatively large amount mutant protein a number studies shown plethora dna damage lead tm event the structural analysis yeast rna polymerase ii 8-oxodg lesion revealed possible mechanism tm study shown 8-oxodg mispair adenine instead cytosine hoogsteen base paring 8-oxodg lesion polymerase active center thereby escaping proofreading polymerase maintained nascent rna stand the potential 8-oxodg cause tm event demonstrated bacterial system using escherichia coli role developing antibiotic resistance later using luciferase based reporter system tm derived mutation event also proved mammalian cells demonstrating tm event strongly affected factors promoter strength gene flanking sequence around 8-oxodg lesion position lesion reference promoter study ogg1 knockout cells showed frequent tm event compared cells lacking transcription coupled repair machinery suggesting 8-oxodg lesion efficiently recognized transcriptional machinery initiating repair rather ogg1 critical role preventing tm replacement guanine 8-oxodg codon 61 hras proto oncogene led generation constitutively active mutant form hras q61k tm event moreover condition ogg1 null background mouse embryonic fibroblast sufficient amount mutant protein generated activate downstream mapk pathway leading erk phosphorylation together suggests 8-oxodg lesion often bypassed rna polymerase ii without efficient detection transcription coupled repair base excision repair machinery generating transcription mutant species contributing pathogenesis various diseases including cancer neurodegeneration cardiovascular disease it exist random coil state well -sheet conformation upon aggregation -helical conformation upon binding membranes sequence -syn divided three regions distinct characteristics figure 2 1 amphipathic lysine rich n terminus residues 160 mainly involved membrane interactions 2 middle hydrophobic region non component amyloid plaques residues 6195 prone -sheet formation fibrillization 3 c terminus residues 96140 highly acidic proline rich region primarily controls nuclear localization interaction proteins multiplication well various single nucleotide polymorphisms snca reported dominantly inherited early onset pd -syn mutant species a30p a53 e46k shown alter aggregation process interfere oligomerization fibril formation distribution cellular compartments more recently three additional mutations -syn h50q g51d a53e identified pd patients increasing body evidence various experimental models shown elevated levels wild type various mutant species prone accelerate aggregation process misfolded state the mutant -syn proteins transformed amyloid fibrillar species consisting -sheets properties serve templates drive soluble proteins adopt similar structural changes leading formation highly ordered aggregated structure increased oxidative stress key contributor pathogenesis pd several vitro vivo experiments linked oxidative stress -syn aggregation exposure neuronal cells various oxidative stressors including ferrous ions hydrogen peroxide mpp 1-methyl-4-phenylpyridinium rotenone nitric oxide superoxide promoted aggregation process vivo studies also corroborated idea chronic systemic exposure rodents rotenone 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine paraquat leads selective nigrostriatal dopaminergic lesions accompanying degeneration -syn aggregation thus 8-oxodg mediated tm event might critical role process -syn fibrillogenesis depends whether mutant species generated process acquire misfolded state eventually act seed nucleation dependent aggregation process seen reported mutant -syn proteins if 8-oxodg mediated tm mutant species stable -sheet form limited amount tm species could enough promote prion like nucleation -syn past years increasing number studies provided evidence -syn aggregates propagate one brain region another prion like manner this self perpetuating cycle -syn fibrillation propagation could initiated addition minute amount pathogenic proteins potentially serve aggregate seeding 8-oxodg derived tm species may trigger process leading pathogenesis pd paraquat based animal model pd shown nuclear 8-oxodg accumulation substantia nigra clearly correlated increase proteinase k resistant species -syn aggregates a recent study pointed genomic distribution 8-oxodg random event instead localized preferentially specific areas chromosome negatively correlated transcriptional activity gene this fact implies tm could affect various genes context chromatin structure mutant species originating tm event outnumbered normal physiological form therefore proteins generation small portion nonfunctional tm species would likely cause entire functional impairment however -syn could become cytotoxic nucleation dependent oligomerization process small addition mutant -syn species wild type population may initiate seeding process fibrillogenesis this unique biochemical feature -syn would strongly support feasibility proposed model all possible mutant -syn proteins could generated tm mediated replacement cytosine adenine mrna strand listed figure 3 among tm generated -syn mutants the following mutants a30e h50n a53e mutations amino acid position familial forms mutants a30p h50q a53e a53 respectively it would strongly suggest tm mutants could similarly cause nucleation dependent -syn fibrillation apart mutant forms several residues might disrupt native structure protein get mutated make prone aggregation to predict aggregation propensity expected tm species used tango statistical mechanics algorithm enables identifying -aggregating regions within protein based sequence information tango algorithm indicated couple expected tm proteins significantly higher -aggregation scores wild type -syn include l38i s42y h50n q62k n terminal non component amyloid plaques domain predicting increases aggregation property figure 4 post translational modifications phosphorylation serine 87 129 may also affect -syn aggregation process tm event replace serine 129 position tyrosine together propose hypothetical model 8-oxodg lesions protein coding region snca could yield small amount tm protein species higher aggregation propensity potentially serve seeding accelerating aggregation wild type -syn leading self propagation aggregates causing degeneration nigrostriatal pathway pd figure 5 the majority idiopathic pd cases late onset sporadic form cytoplasmic -syn aggregates indicates increasing degree aggregation depend genetic mutations snca however till date approaches understand molecular mechanism -syn aggregation focused primarily biochemical properties mutant protein species identified rare familial form pd behavior within cells the proposed model give insight novel mechanism called transcriptional mutagenesis caused accumulation oxidatively damaged dna lesions 8-oxodg snca gene comprehensive investigation age dependent changes -syn mrna profiles well identification tm species supported functional studies mutant proteins definitely add new dimension understanding -syn pathology conjunction oxidative stress

parkinson 's disease ( pd ) is an age - related progressive neurodegenerative disease associated with selective loss of dopaminergic neurons . the characteristic hallmark of the disease is intracytoplasmic proteinacious inclusion bodies called lewy bodies , primarily consisting of a presynaptic protein -synuclein . oxidative stress - mediated damage to macromolecules have been shown to occur frequently in pd . oxidative damage to dna in the form of oxidized guanine ( 8-oxodg ) accumulates in both the mitochondrial and nuclear dna of dopaminergic neurons of the substantia nigra in pd . 8-oxodg - mediated transcriptional mutagenesis has been shown to have the potential to alter phenotype of cells through production of mutant pool of proteins . this review comprehensively summarizes the role of oxidative stress - mediated damage incurred during neurodegeneration , and highlights the scope of transcriptional mutagenesis event in leading to -synuclein aggregation as seen in pd .

stroke cerebrovascular event supply blood delivered brain significantly altered1,2,3 the resulting deficits impairments following stroke vary according location extent lesion often include hemiparesis communication disorders cognitive deficits4 isolation combined deficits often lead significant difficulty completing activities daily living even extensive rehabilitation 50% stroke survivors experience lingering motor deficits4 5 although majority stroke patients able walk independently reach walking level enables perform daily activities impaired walking function including reduced gait stability asymmetric walking common neurological deficit following stroke4 for example laufer et al reported nonparetic lower limb assumes 6180% full body weight normal walking patients hemiparesis5 asymmetric walking caused hemiparalysis become cause instability daily activities patients higher rate falls elderly individuals general population4 thus gait recovery major objective rehabilitation programs patients stroke studies focused especially musculoskeletal effects stroke strength muscle density implicated gait balance problems6,7,8 diminished muscle activity identified factor contributing balance impairment patients hemiplegia treatment increase muscle activity attempted method improve balance capacity9 trunk muscles activated rhythmic movement part execution gait core strengthening exercises used specifically strengthen trunk muscles become specialty area field rehabilitation10 recently united states europe pilates become target interest useful exercise pilates exercises developed joseph h. pilates 18801967 exercise method relax strengthen body the exercises scientific rational system adjusting center body11 pilates training based 8 principles control breathing flowing movement precision centering stability range motion opposition mat based pilates exercises developed use equipment exercise vigorously due injury poor health as strength based exercises directly connected health effective method improve balance ability also used correct postural deviations flexible balanced body11 12 recent study balance pilates demonstrated pilates effective enhancing static dynamic equilibrium capacity university students 16-week mat exercise course13 another study changgiun14 based findings hypothesized pilates exercise training could effective post stroke rehabilitation method address impairments frequently encountered patients stroke flexibility somatosensory loss muscular strength balance15,16,17,18 currently studies pilates training programs focused orthopedic remedial exercise19,20,21 balance improvement elderly16 21 22 reported patients low back pain described lower level functional disability 4 weeks pilates intervention21 bird et al reported 5-week pilates training course elderly contributed greater benefits static dynamic balance compared usual activity16 of majority focused patients multiple sclerosis22,23,24,25,26 studies conducted rehabilitation patients chronic stroke therefore purpose study investigate effects 8-week mat based pilates exercise training program static dynamic balance abilities patients chronic stroke thirty participants initially recruited rehabilitation center disabled located uijeongbu gyeonggi province korea the inclusion criteria stated participant must least 2 years post stroke medically stable physician release granting approval initiate complete exercise program able walk independently without assistive device willing participate pilates exercise class participants excluded visual impairment hearing damage uncontrolled high blood pressure unable understand nature experiment participants receiving physical therapy separately also excluded study total 10 participants excluded participating individual physical therapy sessions one participant dropped control group due hospital admission intervention period finally nineteen individuals chronic hemiparetic stroke participated study age 64.7 6.9 years height 161.7 7.9 weight 67.0 11.1 the research protocol approved institutional review board sahmyook university following participant selection they randomized two groups pilates exercise training group pg control group cg intervention period the pg given pilates exercise training cg given exercises treatment center disabled the pilates training program based mat classes lasting one hour per class three times week 8 weeks study two certified pilates instructors one physical therapist charge class one instructor demonstrated movements patients follow instructor physical therapist assisted patients exercise all movements included pilates training based 8 1 set 8 repetitions per exercise to improve core stability breathing exercises conducted sitting position training sessions the mat based pilates training composed spine mobility exercises upper limb exercises lower limb strengthening exercises the exercises composed following detailed movements 1 spine mobility- chin forward spine stretch side spine stretch sitting theraband 2 upper limb exercise- draw sword deltoid lift sitting theraband 3 lower limb strengthening exercise- top leg pulse bottom leg pulse sidelying using magic circle foot ankle strengthening sitting theraband unlike general pilates training lower limb strengthening exercises help strengthen quadriceps gluteus medius adductor magnus gastrocnemius anterior tibialis additionally gluteal activation gluteal series including charlie chaplin exercises swimming heel squeeze prone ball chest performed along prone bridge verify effects 8-week pilates training course static dynamic balance patients chronic stroke two data collection protocols conducted one week training the variables assessed center pressure cop sway velocity measure static balance participants wore familiar shoes asked stand instrumented treadmill fit bertec corp usa)with eyes open arms sides comfortably 30 seconds each foot placed separate force plate located treadmill belts foot position measured maintained evaluation measure dynamic balance participants asked walk instrumented treadmill self selected velocity the ground self selected velocity determined participant beforehand treadmill belt speed set match velocity evaluation determined subjects exhibiting natural walking movements 35 seconds a total 5 static dynamic trials conducted subject average values trials used data analysis and anterior posterior p medial lateral l directional cop sway well velocity time series computed evaluated the 8-week pilates training effects assessed using paired test independent samples test conducted compare differences subordinate variables groups no significant differences general characteristics noted groups p>0.05 table 1table 1.general characteristics subjectspg n=10)cg n=9)gender male female 10 5/5 9 5/4)age years)66.80 5.761.11 6.6height cm)159.75 8.9163.57 10.4weight kg 65.01 12.6 66.43 10.9duration years)12.80 3.013.20 6.3stroke type hemorrhage infarction)10 4/6)9 5/4)paretic side left right)10 6/4)9 5/4)pg pilates training group cg control group for static balance cop sway significantly decreased pg p l directions p<0.05 table 2table 2.changes static balance abilityvariablespg n=10)cg n=9)m l cop range mm)pre10.85 5.011.72 5.4post7.11 2.216.10 6.1pre post3.74 3.3 1.61 3.0a p cop range mm)pre14.75 8.016.10 6.1post10.47 3.716.82 5.0pre post4.28 4.9 0.72 4.6m l cop velocity mm s)pre83.94 42.184.24 45.0post66.48 26.686.69 41.9pre post17.46 24.4 2.45 4.8a p cop velocity mm s)pre122.00 47.6130.48 45.8post104.55 42.0135.78 43.2pre post17.45 11.9 5.30 7.2a p cop anterior posterior center pressure l cop medial lateral center pressure all dynamic balance parameters legs improved significantly pg training p<0.05 tables 3table 3.changes dynamic balance ability paretic side stance phasevariablespg n=10)cg n=9)m l cop range mm)pre15.0 2.116.0 2.4post12.0 1.416.3 2.4pre post3.0 2.4**0.4 1.0a p cop range mm)pre27.0 3.226.2 3.7post22.4 2.726.5 2.9pre post4.6 1.2***0.3 1.2m - l cop velocity mm s)pre88.6 33.591.8 39.8post76.5 25.692.6 38.8pre post12.1 8.4 0.7 2.2a p cop velocity mm s)pre114.8 31.2117.0 30.6post98.3 25.2117.1 29.1pre post16.5 6.6**0.1 2.7a p cop anterior posterior center pressure l cop medio lateral center pressure * means significant difference within group means significant difference groups 4table 4 changes dynamic balance ability non paretic side stance phasevariablespg n=10)cg n=9)m l cop range mm)pre12.7 1.213.7 2.2post10.4 0.814.2 1.9pre post2.4 0.6***0.44 0.62a p cop range mm)pre23.2 2.422.1 3.6post18.2 1.222.9 3.3pre post5.0 1.6***0.77 1.1m 21.287.16 26.3pre post12.5 7.5 1.12 2.6a p cop velocity mm s)pre89.7 28.896.9 27.5post73.2 17.997.0 25.1pre post16.6 11.3 0.1 3.3a p cop anterior posterior center pressure l cop medial lateral center pressure * means significant difference within group means significant difference groups static dynamic balance parameters significant differences training found pg cg although significance differences baseline p<0.05 tables 3 4 a p cop anterior posterior center pressure l cop medial lateral center pressure * means significant difference within group means significant difference groups p cop anterior posterior center pressure l cop medio lateral center pressure * means significant difference within group means significant difference groups p cop anterior posterior center pressure l cop medial lateral center pressure we examined effects pilates exercise training static dynamic balance patients chronic stroke to knowledge investigation first show improvements static dynamic balance following pilates training population one important purposes study determine whether training performed balance improvement elderly could effectively applied patients chronic stroke16 18 22 23 27 28 study the pg demonstrated 26% 34% improvement static balance p l directions respectively table 2 p<0.05 the results study support findings studies conducted effects pilates training elderly study newell et al 8-week pilates training course contributed 40% improvement p cop sway elderly28 bird et al reported 5-week pilates training course led 1622% improvement l cop sway p<0.001 challenging balance tasks16 study improvement static balance attributed 8-week pilates training course improved muscle control deeper abdominal muscles i.e. transversus abdominis lumbar multifidus respiratory pelvic diaphragms conversely bird et al found significant training effects balance performance standing firm surface16 the reason results differ may due difference training period frequency present study stroke survivors trained 3 times week 8 weeks patients study bird et al this suggests may dose response effect verified future studies study the pg demonstrated significant improvements 1522% dynamic stability p l directions paretic nonparetic foot training tables 3 4 p<0.05 sator et al reported polyneuropathy patients demonstrated 20% reduction cop velocity midfoot walking 12-week ankle strengthening program p<0.05)29 lim yoon revealed elderly exhibited 32% decrease cop sway obstacle walking result 12-week underwater training program p<0.05)30 it reported dynamic situations i.e. walking cop velocity directly related center mass com acceleration represents human movement along cop sway reduction cop variables represents increased balance walking31 unlike general pilates training lower limb strengthening exercises this could help patients increase muscles force production subsequently improve dynamic balance given cop variables l direction closely related risk falls32 33 improvement cop variables direction increases expectation pilates training may influence reduction fall risk patients chronic stroke knowledge first study using pilates training intervention improve static dynamic balance patients chronic stroke despite documented effects balance pilates training yet applied rehabilitation patients chronic stroke however result study 8-week pilates training program proven fully effective treatment static dynamic balance patients chronic stroke however using intervention rehabilitation patients chronic stroke careful attention needed several points first unlike general muscular strength training aerobic exercises maintaining correct posture important pilates training carried qualified instructors supervising small number participants per session study number participants class restricted 811 class offered 6 times week patients would inconvenienced attending classes 3 days week second given previous finding 5-week pilates training program elderly influence balance firm surfaces15 minimum 8-weeks suggested suitable training period as pilates training patients chronic stroke reported study could compared studies pilates training elderly moreover study include variables e.g. gait parameters emg activity may used assess static dynamic balance improvements pilates training therefore follow studies performed investigate impact pilates training gait parameters lower limb emg activity related balance measures this study proved 8-week pilates training program improved static dynamic balance patients chronic stroke if pilates training strengthens deeper abdominal muscles sustained duration results obtained therefore training parameters used clinic becomes appropriate patient pilates program effective treatment recovery walking ability highest objective rehabilitation patients chronic stroke given results pilates training considered rehabilitation intervention balance improvement patients chronic stroke

[ purpose ] the purpose of this study was to analyze the effects of pilates exercise on static and dynamic balance in chronic stroke patients . [ subjects and methods ] nineteen individuals with unilateral chronic hemiparetic stroke ( age , 64.7 6.9 years ; height , 161.7 7.9 cm ; weight , 67.0 11.1 kg ) were randomly allocated to either a pilates exercise group ( pg , n=10 ) or a control group ( cg , n=9 ) . the pg attended 24 exercise sessions conducted over an 8-week period ( 3 sessions / week ) . center of pressure ( cop ) sway and cop velocity were measured one week before and after the exercise program and compared to assess training effects . [ results ] pilates exercise positively affected both static and dynamic balance in patients with chronic stroke . for static balance , cop sway and velocity in the medial - lateral ( m - l ) and anterior - posterior ( a - p ) directions were significantly decreased in the pg after training while no significant differences were found in the cg . for dynamic balance , measured during treadmill walking , the pg showed significantly reduced cop sway and velocity in the m - l and a - p directions for both the paretic and non - paretic leg . [ conclusions ] the findings provide initial evidence that pilates exercise can enhance static and dynamic balance in patients with chronic stroke .

whereas incidence increased 1 10,000 50,000 spontaneous pregnancies assisted reproductive technology procedures incidence 1% 70-fold increased risk there several approaches heterotopic cervical pregnancy management generally purpose conservative management fertility preservation surgical treatments including uterine artery ligation embolization foley catheter insertion cervical curettage without cerclage medical treatments include transvaginal potassium chloride kcl methotrexate mtx injection 1994 frates et al reported first live birth heterotopic cervical pregnancy managed transvaginal ultrasound guided selective reduction kcl since live births heterotopic cervical pregnancy reported we present case rare event heterotopic pregnancy possible maintain intrauterine pregnancy iup term without complications reviewed literature suggest best treatment successful pregnancy outcome a 36-year old woman visited medical center seek treatment primary infertility first visit dilatation curettage performed due missed abortion conceived first cycle ivf et cycle a total seven oocytes retrieved five oocytes fertilized intracytoplasmic sperm injection two embryos transferred the initial serum b hcg level 191.44 miu ml 11 days embryo transfer follow levels 1,540 miu ml 7,970 miu ml 15 days 18 days et respectively 4 weeks 5 days gestation 8 mm gestational sac yolk sac was seen intrauterine cavity 3 mm gestational sac like shadow seen cervical canal first tvs figure 1a the patient hemodynamically stable time presentation hemoglobin 11.5 g dl 5 weeks+2 days gestation follow sonography confirmed heterotopic cervical pregnancy figure 1b explaining treatment options patient wanted try conserve iup she decided transvaginal pregnancy reduction cervical pregnancy accepting risk severe bleeding potential need emergency hysterectomy selective reduction cervically located gestational sac planned readiness hysterectomy careful intracervical gestational sac reduction without harming endometrial area carried ovum forceps abdominal ultrasound guidance the postoperative course uneventful postoperative hemoglobin level 11.3 g dl the patient discharged seventh postoperative day good health intact iup figure 2 regular check ups the iup followed without complications emergency cesarean section performed 40 weeks+5 days gestation due failure progress an uncomplicated birth live newborn weighing 3,360 g occurred apgar scores 8 9 1 5 minutes respectively written informed consent obtained patient publication case report accompanying images report approved institutional review board cha gangnam medical center heterotopic cervical pregnancy extremely rare cases associated assisted reproductive technology early diagnosis heterotopic cervical pregnancy provide opportunity successful conservative management general aims conservative approach protection coexisting iup minimization blood loss fertility preservation however specific recommendations best treatment heterotopic cervical pregnancy universally accepted treatment modality therefore reviewed literature identify best treatment heterotopic cervical pregnancy successful pregnancy outcome up present total 37 cases heterotopic cervical pregnancy including one described reported english language literature only four cases heterotopic cervical pregnancy conceived spontaneously naturally 4 7 patients received infertility treatment 30 cases in preserving iup attempted attempt successful 25 cases 24 live births one case followed 12 weeks gestational age 5 cases intrauterine fetal demise occurred among 24 live births cases classified according absence presence major obstetric complications tables 1 2 respectively 16 cases the iup preserved followed birth without complications table 1 hand the iup preserved major obstetric complications including placenta accreta severe bleeding subsequent hysterectomy eight cases table 2 different techniques attempted eliminate cervical embryo among following factors considered mtx agonist folic acid participates dna synthesis capacity stop proliferative cell activity transvaginal ultrasound guided intra amniotic injection mtx successfully used cervical pregnancy treatment risk systemic adverse effects thrombocytopenia leukopenia elevated serum liver enzymes especially teratogenic effect taken consideration however technique may result radiation viable iup influence endometrial receptivity could decrease future fertility although several cases managed kcl injection possibility major bleeding remaining products conception if chorionic tissue remains cervix bleeding cervical mass infection could cause intrauterine infection premature rupture membrane postpartum bleeding sometimes occur placenta accreta remains risk possibility chorionic infiltration cervix literature review 58.3% 7 12 cases developed serious complications evacuation performed regardless initial procedure 91.7% 11 12 whose treatment included complete evacuation cervical pregnancy major complications in fact complication one case placenta abruption might associated remnant chorionic tissue cervix we described case heterotopic cervical pregnancy successfully treated reviewed literature although general treatment strategy suggested small number cases complete removal cervical conception considered successful pregnancy outcome

heterotopic pregnancy is rare event and the risk is increased with assisted reproductive technology procedures . heterotopic cervical pregnancy is even more unusual . we report a rare case of heterotopic cervical pregnancy that was managed successfully . a 36-year - old women who conceived by ivf - icsi was diagnosed with heterotopic cervical pregnancy . she visited the emergency room with vaginal bleeding at 5 weeks of gestation and underwent careful intracervical gestational sac reduction with forceps under abdominal guidance the next day . the postoperative course was uneventful and with regular check - ups , the intrauterine pregnancy ( iup ) progressed unremarkably through 41 weeks with delivery of a healthy newborn . we reviewed a total of 37 cases of heterotopic pregnancy that have been reported in the english language literature . there have been many attempts to eliminate the cervical embryo while preserving the iup , and complete cervical evacuation is important in order to avoid infection , bleeding , and premature birth .

despite increased prevalence weight concern weight control practices among teenagers obesity increasing steadily 1 2 females attach much importance appearance preoccupied weight young age on hand males value muscular physique often associate health 4 5 achieve ideal teenagers engage weight control behaviours teenagers incorrectly judge actual body size express certain degree body dissatisfaction 9 10 healthy overweight individuals perceive overweight fat likely engage weight reduction activities whereas individuals excess body weight perceive overweight involve weight loss behaviours 11 12 teenagers adopt healthy balanced diet exercise dissatisfied body want lose weight adopt smoking use laxatives purging fasting behaviours 13 14 evidence supports decline physical activity levels consumption fruits vegetables breakfast adolescence among teenagers perceive overweight body weight perception influenced number factors including age gender family peers media ethnicity 16 17 studies reported even children eight years old preoccupied body size preoccupation intensified peaked adolescence 18 19 females inclined perceive overweight engage undue weight loss practices 12 20 while weight reduction desirable overweight obese individual unnecessary weight loss practices potentially harmful consequences adolescents including nutritional deficiencies growth retardation 22 23 teenagers adopt behaviours attitudes prevail among peers pressure thin negative impact body weight perception media constantly depicts images slender women muscular men leads acceptance figures social norm may predictive body size overestimation underestimation the prevalence obesity chronic diseases well documented ministry health quality life mohql the global school based student health survey documented health behaviours protective factors among mauritian teens however little data available body weight perception weight control practices among mauritian teens given implications body weight perception weight control behaviours issue needs examined among local teenagers the aim study investigate body weight perception among male female teenagers aged 13 18 years age using conceptual framework adapted wang et al the objectives study investigate relationship actual body weight status body weight perception among teenagers document impact body weight perception weight control practices among teenagers the study questionnaire based survey carried among sample 180 teenagers 90 boys 90 girls aged 13 18 years old participants mauritians healthy i.e. suffering known diseases the questionnaires distributed participants requested complete questionnaire undertaking anthropometric measurements anthropometric measurements included weight height measured described tiwari sankhala the scale metre rule used measure weight height respectively participants weight taken nearest 0.5 kg standard error 0.5 kg height assessed nearest 0.01 standard error 0.01 each respondent assigned weight status based age gender calculated bmi score weight status defined per cdc growth chart bmi 5th percentile underweight bmi 5th 85th percentile normal weight bmi 85th 95th percentile overweight bmi 95th percentile obese 30 31 however study due small number overweight obese teenagers bmi 85th percentile classified overweight body weight perception question adapted brener et al measured question describe following response set available underweight normal weight overweight overweight obese analytical purposes overweight overweight weight control referred current change changes made past 3 months eating habits physical activity behaviour attempt lose gain weight it assessed yes question example trying control weight trying weight lose weight gain weight choices provided latter question questions methods weight control practices adapted studies yost et al wardle et al the list weight control practices included exercise reducing fat consumption reducing number snacks eaten meal increasing fruits vegetable consumption consuming balanced diet reducing amount food eaten meal time skipping meal fasting whole fruits apple pear orange kiwi banana different sizes small medium big measuring cups shown students assist estimating amount fruits vegetables ate the minimum recommended intake 5 servings fruits vegetables suggested 2005 dietary guidelines americans taken meeting recommendation fruits vegetables questions global health school based survey used measure physical activity level the frequency duration multiplied give total number hours physical activity per week a student whose total hours physical activity per week 7 hours classified meeting recommended level physical activity per day equal number boys girls 90 boys 90 girls participated study the average age participant 16 years based body mass index bmi table 1 ) 16.6% underweight 10.0% boys versus 23.3% girls 11.7% overweight 16.7% boys versus 4.4% girls rest participants 71.7% normal weight 73.3% boys versus 70.0% girls less half 42.2% table 1 students surveyed correctly perceived weight body weight overestimation reported 61.1% girls 14.4% boys among participants normal underweight bmi normal weight underweight girls inaccurate self evaluation current weight status 58.3% finding overweight compared 10.7% normal weight underweight boys there substantial gender difference body weight perception bwp chi test value 2.8 10 half surveyed population engaged weight control practices 43.3% respondents reported trying lose weight 6.7% reported engaged weight gain activities more twice many girls participants 61.1% involved weight loss practices compared boys 25.6% based bmi table 2 80.8% involved weight loss behaviours bmi 85th percentile 47.8% boys versus 94.5% girls there considerable correlation body weight perception weight control activities 88.5% involved weight loss behaviours overestimate body weight body weight perception strong determinant weight control practices chi test value3.1 10 the result study showed appearance health two cited weight concerns 55.6% respondents reported appearance 43.3% reported health gender difference observed weight concern chi test value 0.17 the commonly cited methods respondents reducing fat consumption 84.7% exercise 80.8% increasing fruit vegetable consumption 66.7% reducing amount food eaten meal times 59.0% reducing quantity snacks consumed meals 48.8% balanced diet 32.1% skipping meal 11.5% fasting 5.1% ) however 4.8% reported recourse exercise lose weight achieving recommended daily one hour physical activity 3.5% reported increasing fruits vegetables actually meeting minimum 3 servings vegetables 2 servings fruits per day no gender difference observed type weight loss use healthy unhealthy methods lose weight the current study reveals media 62% major source information purpose followed parents 24% peers 14% only 3.8% respondents 8.7% boys versus 1.8% girls reported trying lose weight meeting daily one hour physical activity results study show general intake fruits vegetables low a meagre 1.7% population sampled consuming 5 servings fruits vegetables every day the purpose study investigate body weight perception weight control practices among teenagers outcome study supports general trend exists many females overestimated body weight engaged weight loss activities males studies demonstrated body weight perception tends inaccurate compared bmi 12 13 consistent studies outcome survey indicated body weight exaggeration prevalent girls boys the outcome survey indicated similar trend among students involved weight control the prevalence weight loss practices higher among girls 61.1% girls versus 25.6% boys studies reported body weight perception strong determinant factor weight control rather actual bmi 3 5 7 8 36 the findings study corroborate earlier reports large proportion 88.5% teenagers engaged weight reduction activities perceived overweight even though 19.2% actually bmi 85th percentile growth chart research evidence support female adolescents likely diet engage unhealthy weight loss behaviours frequently males however current study male female teenagers equally likely use food manipulation adopt healthy unhealthy methods weight control lowry et al documented high school adolescents exercised reduced intake fat ate fruits vegetables lose weight the 3 commonly adopted behaviours lose weight reduction intake fat 84.6% exercise 80.8% consuming fruits vegetables 66.7% reducing amount food eaten meal times was reported half boys girls 52.2% boys 61.8% boys skipping meal fasting weight loss strategies reported 11.5% 5.1% respectively numbers lower reported lowry et al . documented adolescents reported trying lose weight higher physical activity level fruit vegetable intake others although aim study assess association individual reported tendencies weight loss practices well physical activity level fruits vegetables intake observed reported exercising relatively inactive meeting international recommendations fruits vegetables respectively this agreement nowak reported difference exercise frequency australian adolescents trying lose weight results herein indicate similar pattern overall response rate 6.1% meeting international recommendations physical activity there difference physical activity level weight loss nonweight loss students in fact 14.5% weight loss girls exercise possible due body dissatisfaction hinders participation physical activity 39 40 the majority weight loss teens 95.8% expressed body dissatisfaction perceived overweight could partly explain poor engagement physical activity similar adolescents population 5 41 students current study low fruit vegetable intake there difference consumption pattern fruits vegetables reported trying lose weight others only 2.6% weight loss students met minimum recommended 5 servings fruit vegetable per day statistics us showed 1137% school children adolescents breakfast regularly the current study demonstrated similar scenario difference observed breakfast consumption weight loss nonweight loss adolescents the findings study demonstrated body weight perception poorly associated bmi among mauritian teenagers gender difference observed body weight perception many female adolescents overestimating body size teenagers perceived overweight engaged weight reducing activities exercise reducing fat intake two commonly reported methods weightloss genders light high prevalence body weight misperception existing among teenagers fact body weight perception motivated weight control behaviours promotion healthy body image perception healthy eating schools health organisations important since media holds important place influencing body weight perception media used vehicle healthful messages one major limitation study sample size may representative teenagers future studies consider latter influences body image weight control practices

background . weight - loss behaviours are highly prevalent among adolescents , and body weight perception motivates weight control practices . however , little is known about the association of body weight perception , and weight control practices among teenagers in mauritius . the aim of this study is to investigate the relationships between actual body weight , body weight perception , and weight control practices among teenagers . methods . a questionnaire - based survey was used to collect data on anthropometric measurements , weight perception and weight control practices from a sample of 180 male and female students ( 90 boys and 90 girls ) aged between 13 and 18 years old . results . based on bmi , 11.7% of students were overweight . overall , 43.3% of respondents reported trying to lose weight ( 61.1% girls and 25.6% boys ) . weight - loss behaviours were more prevalent among girls . among the weight - loss teens , 88.5% students perceived themselves as overweight even though only 19.2% were overweight . reducing fat intake ( 84.6% ) , exercising ( 80.8% ) , and increasing intake of fruits and vegetables ( 73.1% ) and decreasing intake of sugar ( 66.7% ) were the most commonly reported methods to lose weight . conclusion . body weight perception was poorly associated with actual weight status . gender difference was observed in body weight perception .

obesity major cause morbidity canada many parts world increasing worldwide indicated body mass index bmi greater equal 30 kg obesity risk factor cardiovascular disease type 2 diabetes several types cancer asthma gallbladder disease osteoarthritis chronic back pain 1 2 class ii+ obesity bmi 35 kg also associated increased risk cause mortality obesity associated comorbidities exact heavy toll health care systems expenditures canada the 2006 direct medical cost overweight obesity 6.0 billion global background comprising 500 million obese adults obesity reached historic high canada one quarter adults 9% children meeting definition federal government statistical agencies statistics canada national center health statistics use large population based studies track nationwide obesity trends researchers usually use bmi proxy gauge obesity large national studies according health canada although bmi direct measure individual body fat useful indicator health risks associated overweight population level in addition using bmi despite limitations large scale research must rely heavily self reported obesity estimates due economic logistical constraints even though estimates distorted reporting bias error 7 8 result bias error self reported values underestimate prevalence obesity consequently overestimate associations excess body fat chronic diseases 79 accurate obesity prevalence data are needed public health planners policy makers also conduct obesity research direct bmi measurements gold standard bmi data expensive method data collection researchers recently developed recommended use correction equations based measured data correct self reported values 7 1015 it established correction equations vary time survey- population specific for example bias error self reported bmi physical measurements rise increasing body weight therefore although connor gorber colleagues 7 15 generated correction equations 2008 canadians general reassessed 2011 given population specific may hold atypical regions canada atlantic canada unique sociodemographic characteristics highest obesity rates country the purpose study determine whether correction equations developed canadian population appropriate use atlantic canada compare accuracy national equations equations developed specifically atlantic canadian population this study involved secondary data analysis large national representative survey specifically canadian community health survey cchs 2007 2008 answer following main research question well national correction equations correct self reported estimates obesity atlantic canada significant difference atlantic canadian national correction equations yielding corrected obesity estimates closer measured data compared self reported values ? the study approved interdisciplinary committee ethics human research memorial university furthermore study approval obtained statistics canada social sciences humanities research council canada sshrc the cchs collects data health status health care utilization health determinants canadian population details 2007 2008 cchs published elsewhere 17 18 the target population 2007 2008 cchs persons aged 12 years living private dwellings provinces territories the survey excludes persons living aboriginal reserves settlements institutions full time members canadian forces residents certain remote regions the 2007 2008 cchs three sampling frames select sample households 49% sample households came area frame 50% list frame telephone numbers 1% came random digit dialing sampling frame the national response rate cchs 2007 2008 cycle 78% 2007 75% 2008 total 131,959 canadian respondents 17,126 atlantic respondents weight mhw data collected 2008 trained interviewers calibrated equipment subsample 5,000 canadians atlantic canadian region the provincial response rates mhw subsample ranged 84% 90% household level 51% 67% direct measurement component yielding overall response rates 45% 60% the mhw subsample size current study 318 atlantic canadian adults minimize nonresponse bias statistics canada created sampling weight redistributing sampling weights nonrespondents respondents using response propensity classes the data analyses included 2007 2008 cchs atlantic canadian respondents exception pregnant breastfeeding women children age 18 bmi intended use groups outliers differences self reported measured bmis three standard deviations mean also excluded analyses descriptive analyses conducted describe sociodemographic characteristics atlantic canadian population compared rest canada using correction method employed connor gorber et al atlantic correction equations developed mhw subsample multiple regression models used predict bmi using self reported counterpart independent variable no independent variables e.g. age utilized previously shown gains predictive value minimal canadian population self reported bmi corrected multiplying self reported estimate corresponding model coefficient adding model intercept the correction model namely bmimeasured b0 b1(bmiself reported error employed study equivalent connor gorber colleagues model 4 bmi estimates derived 95% confidence intervals ci exact variance estimates computed using bootstrap methods since bias bmi known differ sex data analyses run males females separately we used following health canada bmi categories underweight bmi 18.5 normal weight bmi 18.524.9 overweight bmi 25.029.9 obese bmi 30 however due limited sample sizes underweight normal weight categories combined statistics canada guidelines tabulation analysis release followed 17 18 for instance statistics canada mandates cells computed fewer 10 respondents suppressed estimates computed 10 respondents coefficient variation cv 16.6% 33.3% released caution cvs greater 33.3% suppressed 17 18 all data analyses conducted atlantic research data centre ardc dalhousie university using sas 9.2 statistical software sas institute inc cary nc usa table 1 shows sociodemographic characteristics 2007 2008 cchs respondents atlantic canada compared regions canada atlantic canada females full time workers p .01 also atlantic respondents significantly less educated lower household incomes canadians p .0001 among 2007 2008 cchs respondents residents atlantic canada twice likely live rural area besides slightly older mean age 44.6 years 95% ci 44.544.7 versus 43.2 years 95% ci 43.243.3 atlantic canadians also differed significantly canadian counterparts terms ethnicity immigrant status most atlantic region white 92.2% canadian born 95.3% compared three quarters canadians p .0001 the correction equations atlantic region males bmi corrected 1.36 1.09bmi reported females bmi corrected 1.71 .98bmi reported males bmi corrected 1.36 1.09bmi reported females bmi corrected 1.71 .98bmi reported table 2 displays information direction magnitude bias error self reported bmi sexes atlantic canada negative difference between self reported measured bmi indicates underreporting whereas positive difference indicates overreporting mean bmi values based self reported height weight data significantly lower p .0001 based measurements sexes however male female corrected bmi means obtained national atlantic specific correction methods significantly different equivalent measured means men women equally underreported bmi 1.4 kg average the corrected bmi means 0.1 0.2 kg 0.3 as presented table 3 degree misreporting varied bmi category categorical increase bmi therefore underestimation bmi highest among obese individuals obese men reporting bmi 2.6 kg average obese women reporting bmi average 3.1 kg table 3 also provides information performance national atlantic correction equations across different bmi categories equations among men underweight normal weight self reported corrected bmi means significantly different measured counterpart among women underweight normal weight the self reported bmi mean significantly different measured mean case either corrected mean respect overweight obese men women corrected bmi means accurate i.e. closer corresponding measured mean comparable means calculated self reported data indeed overweight men women corrected bmi means significantly better equivalent self reported means identical nearly identical bmi means based measurements while recognizing deficiencies researchers use self reported bmi data necessity large surveys cchs canada national health interview survey united states initial attempts correct bmi values based self report led plankey et al publicize 1997 prediction equations eliminate systematic error self reported bmi data although corrected estimates usually identical direct measurements recent years bmi correction equations successful bridging gap self reported numbers measurements 7 915 the recent success correction equations may partly due changing nature reporting bias error since dawn correction equations reporting bias error doubled canada improves odds corrected bmi values significantly closer physical measurements corresponding self reported figures 7 16 the latest correction equations show great promise notwithstanding caveats use reporting bias error can vary one population next may stable time correction equations need developed specifically particular population monitored periodically in addition observed another canadian study equations bring self reported overweight obesity estimates closer measured values important line research 7 8 23 noted process skews underweight normal weight data atlantic canada holds unfavourable distinction highest obesity rates country moreover results present analysis comparing atlantic canada rest nation number sociodemographic characteristics demonstrate atlantic canadians distinct canadians several respects given correction equations population specific compared national equations ones developed specifically unique region canada both correction equations significantly improved accuracy self reported atlantic canadian obesity data the results current study suggest national equations starting used elsewhere country generalizable even atypical regions canada the success correction equations used herein also corroborates current assertions international researchers 7 1015 equations provide better obesity estimates based self report keeping studies 716 2224 mean bmi based self reported height weight data significantly lower mean bmi based measurements current study most research area demonstrated trend reporting slightly pronounced among women 7 8 10 11 1316 2224 in sharp contrast jain found reporting obesity prevalence united states 0.7% lower females males perhaps context survey used jain i.e. national health nutrition examination survey nhanes played role anomalous finding pointed recent publication bias self reported bmi depends survey context whether respondents know measured report weight height nhanes time self reported weight height respondents aware later measured case cchs current study other researchers 7 9 10 1214 2224 documented similar results canadian national study this relationship observed outside underweight category men women alike among underweight bmi overestimated males significant difference self reported measured bmi females corresponding results found among american college students current study merged underweight normal weight bmi categories due small sample sizes notwithstanding difference observed significant difference self reported measured bmi males females underweight normal weight category canadian regional statistics levels obesity normally derived self report questionnaires account sample size limitations measured data our measured bmi results suggest obesity may record level region country the data analysis revealed measured mean bmi 29.1 kg 95% ci 28.030.1 men 27.7 kg 95% ci 26.628.9 women atlantic region 2008 according analysis canadian health measures survey data measured mean bmi canadian men 27.5 kg 95% ci 27.127.9 26.6 kg 95% ci 25.927.4 canadian women 2007 2009 second study innovative equips researchers data supporting utilization national correction equations throughout atlantic region absence measured data the national equations could used future analyses self reported bmi data cchs four atlantic provinces bearing mind considerable attention drawn issue obesity health authorities researchers region future research using obesity estimates lies ahead currently stands cursory search pubmed using search terms obesity since obesity prevalence data foundation obesity related research analyses accuracy prevalence data essential the application national correction equations strengthen research conducted self reported atlantic canadian obesity data could maintain separate bmi categories underweight normal weight precluded refined analysis groups ideally would larger subsample size compute correction equations atlantic region however used best data largest subsample size available furthermore regression models used compute correction equations sexes highly significant f(1 188 1185.8 p .0001 f(1 108 593.0 p .0001 females males respectively cv estimate either model less 7.0 indicating level precision well within acceptable limits in atlantic canada provincial overall response rates mhw subsample 45% 60% similar response rate mhw subsample rest country although sampling weight created statistics canada used adjust differential participation rates characteristics non respondents mean bmi significantly different respondents non response bias may tainted study an additional study limitation involved measurement height weight trained interviewers calibrated equipment were used collect data exclude significant measurement error intra- interrater reliability evaluated also although bmi frequently used measure adiposity population level well documented limitations bmi tool quantify body fat furthermore shields colleagues 7 9 15 caution indiscriminate use correction equations change time dependent upon population survey context particular correction method used study sensitivity values reduced normal weight population words postcorrection percentages provide accurate estimation overweight obesity precorrection percentages better estimation normal weight reporting bias error lower bmi category this study provides evidence generalizability national correction equations atypical regions canada also results study add small accumulating body research supporting efficacy bmi correction equations light reports that self reported bmi statistics underestimate prevalence obesity overestimate associations obesity chronic diseases 7 8 23 strongly recommend use correction equations researchers analysing obesity data collected self report in particular given nature bmi correction equations recommend canadian researchers use national correction equations absence measured data compute correction equations measured self reported obesity data

objectives . to determine whether obesity correction equations for the canadian general population , which are dependent on the prevalence of obesity , are appropriate for use in atlantic canada , which has the highest obesity rates in the country . also , to compare the accuracy of the national equations to equations developed specifically for the atlantic canadian population . methods . the dataset consisted of canadian community health survey ( cchs ) 2007 - 2008 data collected on 17,126 atlantic canadians and a subsample of adults , who provided measured height and weight ( mhw ) data . atlantic correction equations were developed in the mhw subsample . using separate multiple regression models for men and women , self - reported body mass index ( bmi ) was corrected by multiplying the self - reported estimate by its corresponding model coefficient and adding the model intercept . paired t - tests were used to determine whether corrected mean bmi values were significantly more accurate ( i.e. , closer to measured data ) than the equivalent means based on self - reported data . the analyses were repeated using the national equations . results . both the atlantic and the national equations yielded corrected obesity estimates that were significantly more accurate than those based on self - report . conclusion . the results provide some evidence of the generalizability of the national equations to atypical regions of canada .

main structures related human memory papez circuit basolateral limbic circuit basal forebrain communicate white matter tracts damage structures including communication tracts hemorrhages infarctions tumors result memory disturbances.1,2 addition structures valenstein et al suggested retrosplenium could supplementary pathway limbic system connecting anterior thalamus medial temporal lobe structures.3 retrosplenium is located posterior cingulate cortex surrounding splenium cytoarchitecturally distinct structure forming brodmann areas 29 304 fig we report patient developed verbal visual memory deficits acute infarction retrosplenial cortex a 57-year old right handed man suffered diabetes mellitus 10 years admitted emergency room due acute memory loss one month prior admission diagnosed syphilis began treatment penicillin g. day symptom onset daughter noted asked repeatedly phone appointment time clinic visit after conversation asked daughter day week two days later accompanied daughter went hospital order receive treatment syphilis know therefore transferred emergency room evaluation initial evaluation emergency room his blood pressure 103/63 mmhg heart rate 75 beats min regular his score initial mini mental state examination mmse 22/30 memory registration 3/3 memory recall 0/3 orientation time 4/5 orientation place 3/5 calculation concentration 4/5 reading 0/1 the visual fields eyes constricted due previous panretinal photocoagulation procedure diabetic retinopathy cranial nerve examinations normal a cerebrospinal fluid csf analysis showed normal wbc count 2 /ml mild elevated protein 81.5 mg ml in addition csf serum glucose ratio 0.474 csf vdrl test negative the memory patient began improve second day hospitalization could remember home address phone number he underwent formal neuropsychological test four days onset symptoms table 1 time score mmse 27/30 memory registration 3/3 memory recall 1/3 calculation concentration 4/5 on rey auditory verbal learning test avlt score free recall 13 3.75%ile age matched control subjects 20 min delayed recalls 0 0.04%ile the scores immediate delayed recalls 2/36 3.07%ile 3/36 1.07%ile respectively on recognition rey copying test four true positives one false positive five days later memory appeared recovered considerably still could remember home address brain mri 3.0-tesla device philips performed two days onset symptoms diffusion weighted sagittal t2-weighted mri images fig 2-a 2-b revealed high signal intensity lesion left splenium retrosplenium appeared low intensity signal apparent diffusion coefficient adc map b 1000 values in addition point lesion center thalamus small scattered lesions area supplied left posterior cerebral artery pca fig 3 magnetic resonance angiography mra images occlusion p2 portion left pca fig the blood flow pca region delayed slightly based images time peak ttp maps fig after discharge patient demonstrated marked improvement visual verbal memory impairments complain cognitive dysfunctions repeated neuropsychological tests demonstrated impairment time admission two months symptom onset demonstrated improvement rey avlt near normal recall score rey osterrieth complex figure test table 1 figure 2-a shows cerebral infarction restricted left splenium little area retrosplenium we considered amnesia patient due retrosplenial lesion memory related structures retrosplenium intact although mild perfusion delay left pca territory might contributed amnesia significant changes relative cerebral blood volume cerebral blood flow compared corresponding contralateral regions fig however could exclude possibility small infarctions present areas related memory function observe point lesions left central thalamus left pca territory in contrast reported cases single right retrosplenial lesion causing visual verbal memory deficits.5 strong evidence right medial temporal lobe involved navigation appears input hippocampus related structures receive convey right retrosplenial cortex similar spatial preference left medial temporal left retrosplenial cortices appear primarily concerned general aspects episodic memory.3,4,6 however recent studies explain presence visual verbal amnesias case most functional neuroimaging studies shown navigation orientation large scale space activate retrosplenial cortex usually bilaterally.4 addition functional mri studies shown episodic memory bilateral retrosplenial areas activated.7 although tendency predominance retrosplenium must involved visual verbal memories although bilateral retrosplenial lesions tend poor prognosis retrosplenial amnesia generally recovers rapidly.4,8 retrosplenium receives major inputs contralateral retrosplenium orbital dorsolateral prefrontal cortex anterior cingulate cortex parahippocampal cortex superior temporal sulcus precuneus claustrum anterior lateral thalamic nuclei.9 therefore good prognosis may partly due functional substitution counterpart retrosplenium parts cerebrum in addition prognosis may influenced location retrosplenial lesion saito et al.1 reported case transient global amnesia tga resulting retrosplenial infarction similar location case however case yasuda et al.,5 showed poor prognosis lesion encroached retrosplenium posteriorly although size location cerebral infarction similar case in contrast takahashi et al.6 reported three cases retrosplenial lesions extended even inferior precuneus showed good prognosis therefore specific areas retrosplenium may critically affect prognosis could elucidated functional neuroimaging would improve understanding function retrosplenium

the retrosplenial cortex is a cytoarchitecturally distinct brain structure located in the posterior cingulate gyrus and bordering the splenium , precuneus , and calcarine fissure . functional imaging suggests that the retrosplenium is involved in memory , visuospatial processing , proprioception , and emotion.we report on a patient who developed reversible verbal and visual memory deficits following a stroke . neuropsychological testing revealed both anterograde and retrograde memory deficits in verbal and visual modalities . brain diffusion - weighted and t2-weighted magnetic resonance imaging ( mri ) demonstrated an acute infarction of the left retrosplenium .

asthma chronic inflammatory disease lower airways among common chronic conditions affecting children adults it characterized increased airway responsiveness variety stimuli resulting airflow obstruction typically recurrent reversible asthma treatment duration play role severity aforementioned clinical manifestations i.e. severity asthma the severe clinical manifestations asthma greater difficulty managing disease a history wheezing reported 46.6% children living city salvador brazil trend toward increase rate physician diagnosed asthma among children adolescents brazil 2003 the programa de controle da asma e da rinite alrgica na bahia proar bahia state program control asthma allergic rhinitis created the proar multidisciplinary education research treatment program integrating sistema nico de sade sus brazilian unified health care system federal university bahia located city salvador the proar focuses preventing treating asthma allergic rhinitis providing free medication regularly reducing hospitalizations emergency room visits mortality improving quality life qol information obtained assessing qol patients treated given health care facility inform decisions regarding choice procedures treatments achieving optimal patient health , qol assessment relevant clinical practice treatment planning progression focused patient rather disease they also state holistic approach required order assess qol seen purely terms treatment outcome the asthma quality life questionnaire aqlq disease specific instrument developed 1992 specifically use clinical studies the aqlq comprises domains assessing multiple aspects daily life asthma patients assesses physical emotional status thus allowing assessment subjective experience asthma the use inhaler devices pharmacotherapy asthma requires patient education inhaler technique handling optimal inhaler use increases lung drug deposition consequently treatment efficacy resulting asthma control important better qol the level patient satisfaction inhaler device found positive influence patient reported outcomes asthma resulting fewer emergency room visits fewer nocturnal exacerbations improved qol questionnaires developed order assess level asthma control studies assessed correlation asthma control qol the asthma control questionnaire acq instrument used clinical practice clinical trials cross sectional studies acq scores correlating well aqlq scores severe asthma associated numerous comorbidities related poor asthma control increased use health care system reduced qol management reported positive impact asthma outcomes comorbidities common include allergic rhinitis obesity osteoporosis gastroesophageal reflux disease tuberculosis hypertension diabetes the risk drug interactions adverse drug reactions increases exponentially number drugs used iatrogenic complications lead addition medications polypharmacy therefore public health problem negative impact patient qol in bahia patients severe asthma access program provides treatment inhaled corticosteroids ics bronchodilators well asthma education guidance use inhalers however given complexity pharmacological treatment severe asthma clinical manifestations underlying disease asthma management involves disease control access drugs context pharmaceutical care studies examined impact pharmacotherapy qol patients severe asthma given importance issue the objective present study identify characterize factors associated qol patients severe asthma treated referral center city salvador well determine association qol related factors aqlq scores overall individual domain scores this cross sectional study assess qol patients severe asthma the data collected database randomized controlled clinical trial conducted sus asthma outpatient clinic proar headquartered the study population consisted patients 18 years age older treated proar outpatient clinic presenting severe asthma refractory asthma uncontrolled asthma meeting clinical criteria severe asthma receiving drugs regularly proar pharmacy using polypharmacy high dose ics presenting comorbidities fev1 60% predicted single time point qol assessed aqlq administered three previously trained pharmacists the aqlq disease specific questionnaire consisting 32 items grouped four domains activity limitation 11 items symptoms 12 items emotional function 5 items environmental stimuli 4 items ) the overall aqlq score arithmetic mean items minimum score 1 extremely low qol maximum score 7 excellent qol the level asthma control assessed acq administered time point aqlq the acq consists seven questions five questions regarding symptoms one question regarding use short acting 2 agonists one question regarding fev1 all items weight level asthma control given arithmetic mean items ranging zero well controlled asthma six severely uncontrolled asthma the following data collected aforementioned database sociodemographic data gender age level education race occupation clinical data history smoking history pulmonary tuberculosis presence respiratory diseases diagnosis refractory asthma bmi presence comorbidities percent predicted fev1 acq scores clinical data pharmacotherapy starting dose ics types inhalers number inhalers number drugs used qol data aqlq scores given aqlq administered single time point cut score 4 moderate qol used reference scores 4 considered indicate moderate excellent qol whereas scores 4 considered indicate moderate poor qol acq scores 1.5 considered indicate controlled asthma whereas scores 1.5 considered indicate uncontrolled asthma high dose ic use defined use 800 g budesonide equivalent descriptive statistics calculated sociodemographic clinical qol pharmacotherapy variables the kolmogorov smirnov test used order determine whether quantitative variables normally distributed variables normal distribution summarized means whereas non normal distribution summarized medians variables normal distribution student test was used order assess significant differences comparison groups variables non normal distribution the value p derived two tests accordance characteristics study variables the variables interest dichotomized follows gender male female age 60 years/ 60 years number inhalers used combination 2 inhalers/ 2 inhalers ic dose 800 g/ 800 g polytherapy yes level asthma control acq 1.5/acq 1.5 number comorbidities 5 comorbidities/ 5 comorbidities overall aqlq score individual aqlq domain scores 4 4 the odds ratios ors associations study variables overall aqlq score domains thus estimated finally factors associated qol study sample identified characterized association overall aqlq score individual aqlq domain scores determined independent variables associated better qol 0 1 associated worse qol > an 1 indicated association given independent variable qol the present study approved research ethics committee federal university bahia professor edgard santos university hospital caae 128/2008 city salvador statistical analysis performed statistical package social sciences version 14.0 spss inc of 50 patients whose data available database 49 98% evaluated present study 1 2% excluded analysis missing data table 1sociodemographic clinical characteristics 49 patients severe refractory asthma treated brazilian unified health care system asthma outpatient clinic city salvador brazil characteristicresultage years53.6 13.4genderfemale41 84)male8 16)raceblack22 45)mulatto7 14)white7 14)other6 13)no data7 14)occupationhomemaker18 37)workers commercial sector3 6)legal assistant7 14)retired10 20)seamstress2 4)housekeeper2 4)unemployed1 2)other6 14)level educationilliterate2 4)9 years schooling28 57)high school12 25)college7 14)history smokingyes19 38)no30 62)history pulmonary tuberculosisyes12 25)no37 76)refractory asthmayes10 20)no39 80)obesityyes14 29)no35 71)fev1 predicted47.6 15.8avalues expressed n mean sd table 2descriptive statistics independent variables associated pharmacotherapy patients severe asthma treated asthma referral center city salvador brazil variableresultacq score 2.73 1.37number comorbidities 4 2 8)inhaled corticosteroid dose g 1,600 800 1,800)combined use inhaler devices dpi mdi)19 39)aerolizer used primary treatment asthma28 57)mdi used add device30 61)concomitant use least 5 drugs31 62)acq asthma control questionnaire dpi dry powder inhaler mdi metered dose inhaler acq asthma control questionnaire dpi dry powder inhaler mdi metered dose inhaler the aqlq scores reveal moderate qol sample approximately 4 regarding overall aqlq scores aqlq domain scores table 3 neither overall aqlq score individual aqlq domain scores showed significant differences regarding gender age number inhalers used combination although overall aqlq score show statistically significant differences regarding ic dose polytherapy number comorbidities individual aqlq domain scores there statistically significant difference level asthma control mean acq scores overall aqlq score p 0.01 regarding aqlq domain scores there statistically significant differences polytherapy ic dose aqlq activity limitation domain scores there statistically significant difference number comorbidities aqlq environmental stimuli domain scores asthma control acq scores found show statistically significant differences aqlq emotional function symptoms domain scores table 4 table 4association independent variables overall asthma quality life questionnaire score individual domains variableoverall scoresymptoms domain scoreactivity limitation domain scoreemotional function domain scoreenvironmental stimuli domain scoreor 95% ci)por 95% ci)por 95% ci)por 95% ci)por 95% ci)pgender2.215 0.382 11.828)0.3820.962 0.201 4.604)0.9614.480 0.503 39.919)0.1491.920 0.344 10.711)0.4520.864 0.190 3.932)0.851age1.064 0.467 5.512)0.4511.830 0.528 6.342)0.3382.100 ( 0.599 7.361)0.2420.808 0.225 2.896)0.7433.231 0.901 11.586)0.069number inhalers0.900 0.285 2.843)0.8580.750 0.234 2.408)0.6280.889 0.274 2.885)0.8451.067 0.334 3.40)0.9132.489 0.787 7.870)0.121polytherapy1.800 0.554 5.845)0.3262.100 0.638 6.916)0.2193.651 1.061 12.561)0.0361.008 0.306 3.318)0.9901.029 0.325 3.253)0.962acq score0.380 0.004 0.341)0.0000.086 0.016 0.476)0.0010.262 0.062 1.111)0.0600.086 0.016 0.476)0.0010.298 0.067 1.330)0.105number comorbidities0.461 0.122 1.741)0.2530.317 ( 0.075 1.330)0.1100.587 0.154 2.237)0.4380.808 0.225 2.896)0.7455.042 1.316 19.317)0.015ic dose0.500 0.148 1.691)0.2660.435 0.127 1.487)0.1840.249 0.070 0.885)0.0290.643 0.189 2.187)0.4831.771 0.522 6.003)0.362acq asthma control questionnaire ic inhaled corticosteroid the ors associations study variables overall aqlq score domains shown table 4 in present study neither overall aqlq score individual aqlq domain scores significantly associated gender age number inhalers used combination in contrast overall aqlq score domains symptoms activity limitation emotional function environmental stimuli significantly associated following variables polytherapy ic dose acq score number comorbidities study variables polytherapy ic dose are directly related pharmacological treatment asthma contrast acq score number comorbidities indirectly related pharmacological treatment asthma the acq score indirectly related pharmacological treatment asthma latter aimed controlling disease reducing airway remodeling reducing mortality the number comorbidities also related pharmacological treatment asthma form polytherapy use untreated conditions therefore association variables qol assessed aqlq many studies assessed qol asthma patients showing severe asthma strong impact qol given present study cross sectional study aqlq administered single time point aqlq score 4 i.e. moderate qol used cut point association independent variables qol another cross sectional study the cut point used order assess qol asthma patients single time point the aqlq instrument cross sectionally longitudinally correlated clinical measures studies shown polytherapy improve qol patients well showing drug interaction rates high 50% possibility iatrogenic complications concomitant use least five drugs present study it assumed use polytherapy increased likelihood worse qol outcomes activity limitation domain although mean overall scores likely negatively influenced activity limitation domain score 4 i.e. moderate poor qol significant association polypharmacy overall aqlq score confirm assumption the level asthma control measured acq found protective factor overall aqlq score aqlq symptoms emotional function domain scores acq score 1.5 controlled asthma increased likelihood better overall aqlq scores 4 better aqlq symptoms emotional function domain scores other studies shown association well controlled asthma better qol patients well controlled asthma higher overall aqlq scores present study association found number comorbidities aqlq environmental stimuli domain scores it note patients fewer five comorbidities likely worse environmental stimuli domain scores consequently overall aqlq scores likely negatively influenced environmental stimuli domain scores although association statistically significant although study design allow causal interpretations possible sample patients respiratory diseases medical conditions influenced factors associated environmental stimuli factors played role lack asthma control atopy difficult control allergic rhinitis etc therefore possible patient perception qol negatively influenced presence comorbidities regardless number comorbidities the results present study differ studies according heyworth et al higher number chronic conditions translates greater negative impact qol the use 800 g budesonide equivalent found associated better qol outcomes activity limitation domain score 4 i.e. moderate excellent qol present study patients using 800 g budesonide equivalent likely better aqlq activity limitation domain scores therefore possible use 800 g budesonide equivalent contributed positively overall aqlq score however statistically significant association found use 800 g budesonide equivalent overall aqlq score confirm assumption the results present study differ study patients moderate severe asthma treatment high dose fluticasone equivalent 1,600 g budesonide the overall aqlq score correlated better qol individual aqlq domain scores therefore possible degree association study different present study in addition aforementioned study conducted brazil meaning various patient related factors might influenced qol outcomes present study impossible assess aspects pharmacotherapy adherence treatment adverse reactions ics drugs use medicinal plants herbal medicines stratification drug class available data insufficient studies cross sectional design preclude establishment causal relationships qol independent variables however importance issue results presented herein lack qol studies taking pharmacotherapy consideration warrant longitudinal studies establish relationships importance issue results present study indicate need studies investigating pharmacotherapy related factors influencing qol patients severe asthma treated sus referral outpatient clinic regard goals established clinical protocols treatment guidelines asthma control improving the qol patients severe asthma important choosing appropriate pharmaceutical interventions drug therapies given qol reflects patients perceive asthma management outcomes live disease pharmacists play extremely important role management severe asthma recognizing pharmacotherapy related factors associated qol measures aiding choosing appropriate drug therapy controlling asthma reducing morbidity reducing mortality enhancing patient well identificar caracterizar e medir associao de fatores relacionados qualidade de vida qv de pacientes asmticos sob perspectiva da farmacoterapia estudo de corte transversal com 49 pacientes 18 anos portadores de asma grave controlada ou asma refratria atendidos em um ambulatrio especializado sistema nico de sade em uso regular de altas doses de corticoides inalatrios cis e ou de diversos medicamentos e com comorbidades obtiveram se medidas de qv atravs da aplicao questionrio asthma quality life questionnaire aqlq num nico momento escore global e dos domnios aqlq foram relacionados com variveis demogrficas gnero e idade escore asthma control questionnaire terapia medicamentosa dose inicial de ci dispositivos inalatrios e politerapia e comorbidades melhores escores aqlq associaram se com asma controlada escore global 0,38 ic95% 0,004 0,341 p 0,001 e domnios sintomas 0,086 ic95% 0,016 0,476 p 0,001 e funo emocional 0,086 ic95% 0,016 0,476 p 0,001 e com dose de ci 800 g domnio limitao de atividades 0,249 ic95% 0,070 0,885 p 0,029 piores escores aqlq correlacionaram se com politerapia domnio limitao de atividades 3,651 ic95% 1,061 12,561 p 0,036 e com nmero de comorbidades 5 domnio estmulo ambiental 5,042 ic95% 1,316 19,317 p 0,015 nossos resultados importncia tema e escassez de estudos sob perspectiva da farmacoterapia apontam necessidade da realizao de estudos longitudinais para se estabelecer uma relao de causalidade entre os fatores identificados e qv em pacientes com asma a asma uma doena inflamatria crnica das vias areas inferiores e est entre condies crnicas mais comuns afetando tanto crianas quanto adultos apresenta um caracterstico aumento da responsividade das vias areas estmulos diversos resultando consequentemente em obstruo ao fluxo areo com tpica reversibilidade e recorrncia o grau em que essas manifestaes clnicas se apresentam depende tratamento que necessrio ao controle da doena modificando se com tempo de tratamento e podendo denominar se tambm como gravidade da doena quanto mais graves e mais intensas manifestaes clnicas da asma maior ser complexidade envolvida cuidado ao paciente no brasil estima se uma prevalncia de asma em torno de 10% prevalncias mdias de sintomas indicativos de asma em grandes cidades brasileiras para crianas e adolescentes respectivamente 24,3% e 19,0% h registros de histria de sibilncia em 46,6% das crianas na cidade de salvador ba assim como uma tendncia de aumento diagnstico de asma em crianas e adolescentes brasil em 2003 criou se programa de controle da asma e da rinite alrgica na bahia proar trata se de um projeto multiprofissional de ensino pesquisa e assistncia que integra sistema nico de sade sus e universidade pblica o proar objetiva principalmente coordenao das aes preventivas e de assistncia pacientes portadores de asma e de rinite alrgica com intuito de fornecer medicamentos gratuitos regularmente e promover redues tanto nas internaes como nos atendimentos de emergncia e na mortalidade assim como melhoria na qualidade de vida qv informaes obtidas pela avaliao da qv em um determinado servio de sade podem direcionar tomada de deciso por um procedimento ou tratamento entre diversos disponveis que deve ser institudo ao paciente de modo serem obtidos os melhores resultados para sua sade segundo la scala et al.,"talvez maior razo para se falar em qv na prtica clnica fato de que planejamento tratamento e sua evoluo se focam indivduo e na doena a qv significa apenas resultado final tratamento mas sim ter qualidade em todos os aspectos que compem indivduo ... o instrumento doena especfico mais utilizado e citado nos estudos de asma asthma quality life questionnaire aqlq criado em 1992 especificamente para ser aplicado em estudos clnicos contm domnios relacionados situaes comumente presentes cotidiano paciente asmtico mas tambm avalia suas condies fsicas e emocionais que torna mensurvel subjetividade indivduo foi validado para uso brasil em 2007 sendo portanto aplicvel realidade brasileira o surgimento dos dispositivos inalatrios na farmacoterapia da asma trouxe necessidade de cuidados ao paciente acerca da educao da tcnica inalatria e manuseio desses dispositivos melhor uso dispositivo possibilita alcance medicamento ao local de ao e como consequncia efetividade tratamento obtendo se controle da asma que importante para uma melhor qv o nvel de satisfao com dispositivo em uso relatado como um fator que influencia alcance de um melhor desfecho na asma com reduo de idas servios de emergncia e de exacerbaes noturnas assim como melhoria da qv estudos demonstram uma correlao entre nvel de controle de sintomas da asma e qv questionrios foram desenvolvidos para avaliao controle da asma e correlao desse controle com qv j foi mensurada o asthma control questionnaire acq por exemplo um instrumento que pode ser utilizado na prtica clnica em ensaios clnicos ou em estudos transversais e tem boa correlao com aqlq a asma grave tem sido associada inmeras comorbidades que se relacionam um pior controle da asma aumento da utilizao sistema de sade e reduo da qv cujos manejos tm incrementado positivamente os desfechos em asma comum ocorrncia concomitante de outras morbidades rinite alrgica obesidade osteoporose doena refluxo gastresofgico tuberculose hipertenso e diabetes em paralelo diversas patologias diagnosticadas quase sempre paciente asmtico tem estabelecimento seu tratamento uma polifarmcia risco de interaes medicamentosas e de reaes adversas aumenta exponencialmente com aumento nmero de medicamentos em uso a iatrogenia tambm favorece adio de outros medicamentos tornando polifarmcia um problema de sade pblica que impacta negativamente na qv paciente na bahia apesar acesso um programa que possibilita tratamento com corticoides inalatrios broncodilatadores educao em asma e orientaes sobre uso dos dispositivos inalatrios pacientes portadores de asma grave complexidade da terapia medicamentosa aliada manifestao clnica da doena de base impelem expanso cuidado para alm controle da asma ou acesso ao(s medicamento(s no contexto da assistncia farmacutica entanto escassos estudos focados especificamente na qv paciente asmtico grave sob perspectiva da farmacoterapia tendo em vista importncia tema frente populao de pacientes com asma grave atendidos em um centro de referncia objetivou se com presente estudo identificar e caracterizar os fatores relacionados qv nessa populao assim como verificar associao desses achados com questionrio doena especfico aqlq e seus domnios trata se de um estudo de corte transversal para avaliar qv de pacientes com asma grave estudo foi realizado perodo entre setembro e novembro de 2013 os dados provenientes de um banco de dados de um ensaio clnico randomizado controlado realizado ambulatrio especializado em asma da rede sus onde funciona proar a populao estudada foi composta por pacientes com idade 18 anos com asma grave asma refratria ou asma controlada e ou com critrios clnicos de gravidade admitidos ambulatrio proar que recebiam medicamentos regularmente na farmcia em uso de diversos medicamentos e ou em uso de doses elevadas de corticosteroides inalatrios que apresentavam comorbidades e tinham vef1 60% valor predito os dados de medidas de qv foram obtidos atravs da aplicao em um nico momento aqlq por trs farmacuticas treinadas previamente o aqlq um questionrio doena especfico que apresenta 32 perguntas agrupadas em quatro domnios limitao de atividades 11 itens sintomas 12 itens funo emocional 5 itens e estmulo ambiental 4 itens foi desenvolvido para ser aplicado por um entrevistador ou ser autoaplicado escore global questionrio mdia aritmtica de todos os itens sendo escore mnimo de 1 qv extremamente baixa e mximo de 7 qv excelente o controle da asma foi mensurado pelo acq mesmo momento da aplicao aqlq um questionrio com cinco questes referentes sintomas uma questo sobre uso de 2-agonistas de curta durao e uma questo sobre vef1 os itens possuem mesmo peso e nvel de controle da asma resultante da mdia das sete questes variando entre zero asma bem controlada seis asma extremamente controlada extraram se desse banco os dados sociodemogrficos gnero idade escolaridade raa e ocupao dados clnicos histria de tabagismo histria de tuberculose pulmonar presena de outras patologias respiratrias diagnstico de asma refratria imc presena de comorbidades vef1 predito e escore acq dados clnicos referentes farmacoterapia dose inicial de corticoide inalatrio tipos e nmero de dispositivos inalatrios e quantidade de medicamentos em uso e dados de qv escores aqlq por conta de aqlq ter sido aplicado em um nico momento utilizou se como referncia ponto de corte igual 4 qv mediana valores maiores que 4 foram interpretados como qv de mediana excelente enquanto valores menores ou iguais 4 como qv de mediana ruim como asma controlada enquanto valores acima ponto de corte foram considerados como asma controlada adotou se como definio de politerapia uso de pelo menos cinco medicamentos pelo paciente foi considerada como dose alta de corticoide inalatrio como uso acima de 800 g de budesonida ou equivalente fizeram se anlises descritivas das variveis sociodemogrficas clnicas das medidas de qv e daquelas referentes terapia medicamentosa a fim de comprovar distribuio normal das variveis quantitativas utilizou se teste de kolmogorov smirnov quando variveis tiveram distribuio normal foram utilizadas suas mdias para os clculos estatsticos quando distribuio era normal medianas foram consideradas o teste de student serviu verificao entre variveis com distribuio normal na avaliao de diferenas significativas entre os grupos comparados para variveis cuja distribuio foi normal utilizou se teste de mann whitney desses dois testes estatsticos foi extrado valor de p obedecendo se caractersticas das variveis estudadas variveis de interesse foram dicotomizadas da seguinte forma gnero feminino masculino idade 60 anos/ 60 anos nmero de dispositivos inalatrios associados 2 dispositivos associados/ 2 dispositivos inalatrios associados dose de corticoide inalatrio 800 g/ 800 g politerapia sim controle da asma acq 1,5/acq 1,5 nmero de comorbidades 5 comorbidades/ 5 comorbidades escore global e dos domnios de aqlq 4/ 4 calculou se deste modo medida estimada da associao de odds ratio de cada uma das variveis com escore global e de cada domnio aqlq ao final foram identificados e caracterizados os fatores associados qv para nossa amostra assim como foi avaliada associao desses fatores com escore global e com cada um dos quatro domnios aqlq as variveis independentes foram consideradas fatores de proteo para qv quando 0 1 considerou se que houve associao entre variveis independentes e pior qv quando 1 no caso de 1 considerou se haver associao entre varivel independente e qv o presente estudo foi submetido e aprovado pelo comit de tica em pesquisa complexo hospitalar universitrio professor edgard santos da universidade federal da bahia caae 128/2008 a anlise estatstica foi realizada por meio programa estatstico statistical package social sciences verso 14.0 spss inc no presente estudo foram avaliados os dados de 49 pacientes 98% dos 50 pacientes registrados em nosso banco de dados um paciente 2% foi excludo da anlise pela indisponibilidade os dados sociodemogrficos e clnicos dos pacientes estudados encontram se dispostos na tabela 1 tabela 1caractersticas sociodemogrficas e clnicas de 49 pacientes com diagnstico de asma grave ou asma refratria atendidos em um ambulatrio especializado da rede sistema nico de sade em salvador ba caractersticasresultadosidade anos53,6 13,4gnerofeminino41 84)masculino8 16)raa cornegra22 45)mulata7 14)branca7 14)outras6 13)no declaradas7 14)ocupaodona de casa18 37)comercirio3 6)assistente jurdico7 14)aposentado10 20)costureira2 4)diarista2 4)desempregado1 2)outros6 14)escolaridadeanalfabetos2 4)ensino fundamental28 57)ensino mdio12 25)ensino superior7 14)histria de tabagismo sim19 38)no30 62)histria de tuberculose pulmonarsim12 25)no37 76)asma refratriasim10 20)no39 80)obesidadesim14 29)no35 71)vef1 predito47,6 15,8 tabela 2estatstica descritiva das variveis independentes relativas terapia medicamentosa dos pacientes com asma grave de um centro de referncia em asma em salvador ba variveisresultadosescore acq pontos 2,73 1,37nmero de comorbidades 4 2 8)dose de corticoide inalatrio g 1.600 800 1.800)combinao de dispositivos inalatrios ipo ip)19 39)aerolizer como dispositivo principal28 57)ip como dispositivo associado30 61)quantidade de medicamentos em uso 5 31 62)acq asthma control questionnaire ipo inalador de p e ip inalador pressurizado valores expressos como mediana variao).avalores expressos em n ou em mdia dp acq asthma control questionnaire ipo inalador de p e ip inalador pressurizado os valores aqlq revelam uma qv mediana nessa amostra em torno de 4 tanto em relao ao escore global como aos escores dos domnios questionrio tabela 3 tabela 3escore global e dos domnios asthma quality life questionnair e. aqlq pontosresultadosescore global3,66 1,41sintomas3,69 1,52limitao das atividades3,59 1,45funo emocional3,60 1,87estmulo ambiental4 1 7)aqlq asthma quality life questionnaire no houve diferenas significativas quanto ao escore global aqlq ou aos de seus domnios quando os pacientes foram comparados em relao gnero idade e nmero de dispositivos inalatrios associados quando comparados quanto dose de corticoide politerapia e nmero de comorbidades houve diferenas estatisticamente significativas entre eles quanto ao escore global aqlq mas essa ocorreu particularmente em relao alguns dos seus domnios houve uma diferena estatisticamente significativa apenas quando se avaliaram os pacientes quanto ao controle da asma mdia valor acq em relao ao escore global aqlq p 0,01 referentes aos domnios aqlq observaram se diferenas estatisticamente significativas quando os pacientes foram avaliados quanto politerapia e dose de corticoide inalatrio em relao ao domnio limitao de atividades em relao ao domnio estmulo ambiental houve uma diferena estatisticamente significativa quando os pacientes foram avaliados quanto ao nmero de comorbidades quanto aos domnios funo emocional e sintomas houve diferenas estatisticamente significativas quando se avaliaram os pacientes quanto ao controle da asma acq tabela 4 tabela 4associao entre variveis independentes e escore global e dos domnios asthma quality life questionnaire .variveisescore globalsintomaslimitao de atividadesfuno emocionalestmulo ambientalor ic95%)por ic95%)por ic95%)por ic95%)por ic95%)pgnero2,215 0,382 11,828)0,3820,962 0,201 4,604)0,9614,480 0,503 39,919)0,1491,920 ( 0,344 10,711)0,4520,864 0,190 3,932)0,851idade 1,064 0,467 5,512)0,4511,830 0,528 6,342)0,3382,100 0,599 7,361)0,2420,808 0,225 2,896)0,7433,231 0,901 11,586)0,069nmero de dispositivos inalatrios 0,900 0,285 2,843)0,8580,750 0,234 2,408)0,6280,889 0,274 2,885)0,8451,067 0,334 3,40)0,9132,489 0,787 7,870)0,121politerapia1,800 0,554 5,845)0,3262,100 0,638 6,916)0,2193,651 1,061 12,561)0,0361,008 0,306 3,318)0,9901,029 0,325 3,253)0,962acq0,380 0,004 0,341)0,0000,086 0,016 0,476)0,0010,262 0,062 1,111)0,0600,086 0,016 0,476)0,0010,298 0,067 1,330)0,105nmero de comorbidades0,461 0,122 1,741)0,2530,317 0,075 1,330)0,1100,587 0,154 2,237)0,4380,808 0,225 2,896)0,7455,042 1,316 19,317)0,015dose de ci0,500 0,148 1,691)0,2660,435 0,127 1,487)0,1840,249 0,070 0,885)0,0290,643 0,189 2,187)0,4831,771 0,522 6,003)0,362acq asthma control questionnaire e ci corticoide inalatrio associao de cada uma das variveis com escore global e os dos domnios de aqlq est apresentada na tabela 4 os resultados obtidos presente estudo revelaram que houve associaes estatisticamente significativas entre escore global aqlq ou de seus domnios com variveis gnero idade e nmero de dispositivos inalatrios associados por outro lado constataram se associaes significativas aqlq e de seus domnios sintomas limitao de atividades funo emocional e estmulo ambiental com seguintes variveis politerapia dose de corticoide inalatrio escore acq e nmero de comorbidades associadas dentre variveis analisadas politerapia e dose de corticoide inalatrio esto diretamente vinculadas ao tratamento medicamentoso o acq e nmero de comorbidades contudo esto indiretamente ligados ao tratamento medicamentoso o acq vincula se indiretamente ao tratamento medicamentoso uma vez que com instituio desse tratamento objetiva se controle da asma reduo remodelamento das vias areas e da mortalidade o nmero de comorbidades vincula se ao campo tratamento medicamentoso como possvel instituio de politerapia ou mesmo como condies tratadas por conta disso houve incluso dessas variveis na avaliao de associaes com qv aqlq muitos estudos tm avaliado qv em asma demonstrando quo impactante essa patologia para paciente asmtico grave por se tratar de um estudo de corte transversal com uma nica medida de aqlq adotou se como ponto de corte valor 4 qv mediana para verificao da associao das variveis independentes qv num estudo de corte transversal mesmo ponto de corte foi utilizado para avaliaes da qv em pacientes asmticos em um nico momento o aqlq um instrumento que apresenta correlao transversal e longitudinal com medidas clnicas estudos revelam que na presena de politerapia h um aumento da qv dos pacientes assim como se estima uma alta proporo 50% de interao medicamentosa e possibilidade de iatrogenia partir da quantidade de cinco medicamentos usados concomitantemente politerapia esteve associada significativamente ao aqlq quanto ao domnio limitao das atividades supe se que para esses pacientes instituio da politerapia aumentou chance de se ter uma pior qv quesito limitaes das atividades houve uma maior chance tambm de escore global ter valor mdio final influenciado negativamente pelo valor obtido para esse domnio 4 ou seja qv de mediana ruim embora tenha havido uma associao significativa entre varivel polifarmcia e escore global aqlq para comprovar essa suposio o controle da asma medido pelo acq revelou se como um fator protetor em relao ao escore global aqlq e de seus domnios sintomas e funo emocional para esses pacientes escore acq 1,5 asma controlada resultou em uma maior chance de haver um melhor escore global aqlq 4 assim como para os domnios sintomas e funo emocional associao entre um bom ndice de controle da asma e uma melhor qv foi constatada em outros estudos que demonstraram que pacientes com asma bem controlada tambm tiveram escores globais de aqlq maiores constatou se uma associao nmero de comorbidades com domnio estmulo ambiental os pacientes que apresentavam menos que cinco comorbidades curiosamente tiveram uma maior chance de ter resultados piores escore estmulo ambiental por consequncia esses pacientes tiveram uma maior chance de ter escore global da qv influenciado negativamente pelo valor desse domnio mas isso foi estatisticamente significativo embora seja possvel estabelecer causalidade atravs desse desenho de estudo existe possibilidade de que grupo estudado houvesse pacientes com outras patologias respiratrias ou com condies clnicas que sofressem influncia de questes relacionadas ao estmulo ambiental e que essas questes estivessem implicando controle da asma atopia rinite alrgica de difcil controle etc dessa maneira influncia de comorbidades como essas ainda que houvesse um nmero menor de patologias associadas poderia gerar uma pior percepo da qv por parte dos pacientes , quanto maior nmero de condies crnicas maior seria influncia negativa na qv dose de budesonida ou equivalente de corticoide 800 g revelou se um fator de proteo para uma melhor qv em relao limitao de atividades 4 ou seja qv de mediana excelente houve uma maior chance de que houvesse pacientes com uma melhor qv referente esse domnio quando utilizada essa faixa de dose por conseguinte houve possibilidade de essa medida contribuir positivamente escore global de qv por outro lado tambm houve associao estatisticamente significativa entre essa varivel e escore global de aqlq para comprovar tal suposio h um resultado diverso na literatura para uso de altas doses de corticoide inalatrio fluticasona equivalentes 1.600 g de budesonida comparando se mesmo grupo de pacientes com asma moderada e grave em dois perodos antes e aps tratamento o escore global aqlq assim como de seus domnios foram correlacionados com uma melhor qv tratava se contudo de um estudo longitudinal com uma amostra de 60 pacientes e por conta disso nvel de associao pode ter sido diferente encontrado presente estudo alm disso estudo foi realizado em um pas diferente podendo se considerar aspectos variados relativos ao paciente influenciando os resultados de qv no foi possvel avaliar outros aspectos relativos terapia medicamentosa como adeso ao tratamento reaes adversas corticoides inalatrios ou outros medicamentos uso de plantas medicinais e ou fitoterpicos e estratificao da terapia medicamentosa por classe de medicamentos por haver dados disponveis suficientes para tais anlises atravs de um estudo de corte transversal se pode estabelecer causalidade entre variveis independentes estudadas e qv porm diante da importncia tema e pelos resultados apresentados necessria realizao de um estudo longitudinal para estabelec la tendo em vista escassez de investigao acerca da qv sob perspectiva da terapia medicamentosa a importncia tema frente populao de pacientes com asma grave atendidos em um ambulatrio da rede sus referncia para asma e os resultados encontrados presente estudo indicam necessidade de fomentar novos estudos acerca dos fatores da farmacoterapia que influenciam qv dessa populao o direcionamento das intervenes farmacuticas e instituio da terapia medicamentosa portanto que concerne alcance das metas estabelecidas com protocolo e diretrizes teraputicas para controle da asma importantes quanto alcance de uma melhor qv desses pacientes pois se trata ponto de vista paciente quanto aos resultados dos manejos da asma e da sua convivncia com patologia para essa populao de extrema importncia colaborao profissional farmacutico para reconhecimento dos aspectos da terapia medicamentosa nas medidas de qv auxiliando direcionamento da farmacoterapia para alcance controle da asma reduo de morbidade e da mortalidade alm bem estar paciente

abstractobjective : to identify , characterize , and quantify associations of various factors with quality of life ( qol ) in patients with asthma , according to the pharmacotherapy employed . methods : this was a cross - sectional study involving 49 patients ( 18 years of age ) with severe uncontrolled or refractory asthma treated at a specialized outpatient clinic of the brazilian unified health care system , regularly using high doses of inhaled corticosteroids ( ics ) or other medications , and presenting comorbidities . at a single time point , qol was assessed with the asthma quality of life questionnaire ( aqlq ) . the overall aqlq score and those of its domains were correlated with demographic variables ( gender and age ) ; asthma control questionnaire score ; pharmacotherapy ( initial ic dose , inhaler devices , and polytherapy ) ; and comorbidities . results : better aqlq scores were associated with asthma control - overall ( or = 0.38 ; 95% ci : 0.004 - 0.341 ; p < 0.001 ) , " symptoms " domain ( or = 0.086 ; 95% ci : 0.016 - 0.476 ; p = 0.001 ) , and " emotional function " domain ( or = 0.086 ; 95% ci : 0.016 - 0.476 ; p = 0.001)-and with ic dose 800 g-"activity limitation " domain ( or = 0.249 ; 95% ci : 0.070 - 0.885 ; p = 0.029 ) . worse aqlq scores were associated with polytherapy-"activity limitation " domain ( or = 3.651 ; 95% ci : 1.061 - 12.561 ; p = 0.036)-and number of comorbidities 5-"environmental stimuli " domain ( or = 5.042 ; 95% ci : 1.316 - 19.317 ; p = 0.015 ) . conclusions : our results , the importance of this issue , and the lack of studies taking pharmacotherapy into consideration warrant longitudinal studies to establish a causal relationship between the identified factors and qol in asthma patients .

antibiotic resistance become one important public health problems worldwide due morbidity mortality healthcare costs although spanish national health system snhs population coverage almost 100% 30% antibiotic use occurs outside snhs largely due dispensing antibiotics without medical prescription dawmp although practice unlawful common spain favoured fact punishable offence this turn means dispensing depends attitude individual pharmacist this study sought estimate percentage pharmacists employ dawmp ii identify pharmacists personal professional traits well knowledge attitudes view potential link practice dawmp although undertaking observational study ethics committee clinical research galicia informed approval granted n 2007/107 we carried exhaustive sampling study population comprised community pharmacists region north western spain september 2012 183 pharmacies 393 pharmacists a self administered questionnaire used available supplementary data jac online the statements classified three blocks personal professional information ii knowledge attitudes antibiotics antibiotic resistance iii dawmp four situations urinary dental upper respiratory tract infections cases patient promised bring prescription later point time last block respondents given three options situations yes patient someone known pharmacist agreement statements measured using unnumbered horizontal visual analogue scale 7 cm long replies scored 0 total disagreement 10 total agreement the questionnaire based previous qualitative focus group study conducted research group ( ii data analysed grouped categories complacency insufficient knowledge indifference external responsibility ( iii categories transformed statements based expressions used participants focus groups ( iv content face validity reviewed aid pharmacology psychology public health experts ( v structure questionnaire revised wording content items improved ( vi assess reproducibility degree agreement among answers pilot test conducted 30 pharmacists the questionnaire delivered twice pharmacist interval 4 weeks a research team member m. z .- c personally delivered retrieved questionnaires pharmacists pharmacy time visit included study participants replied yes patient someone known pharmacist least one four scenarios classified dawmp the reproducibility questionnaire assessed using intraclass correlation coefficient icc based results obtained first second answers pharmacist to take account distribution independent variables calculated interquartile odds ratio effect exposure change 25th 75th percentile when 1 calculated inverse interquartile 1/interquartile effect exposure changes 75th 25th percentile although undertaking observational study ethics committee clinical research galicia informed approval granted n 2007/107 we carried exhaustive sampling study population comprised community pharmacists region north western spain september 2012 183 pharmacies 393 pharmacists a self administered questionnaire used available supplementary data jac online the statements classified three blocks personal professional information ii knowledge attitudes antibiotics antibiotic resistance iii dawmp four situations urinary dental upper respiratory tract infections cases patient promised bring prescription later point time last block respondents given three options situations yes patient someone known pharmacist agreement statements measured using unnumbered horizontal visual analogue scale 7 cm long replies scored 0 total disagreement 10 total agreement the questionnaire based previous qualitative focus group study conducted research group ( ii data analysed grouped categories complacency insufficient knowledge indifference external responsibility ( iii categories transformed statements based expressions used participants focus groups ( iv content face validity reviewed aid pharmacology psychology public health experts ( v structure questionnaire revised wording content items improved ( vi assess reproducibility degree agreement among answers pilot test conducted 30 pharmacists the questionnaire delivered twice pharmacist interval 4 weeks a research team member m. z .- c personally delivered retrieved questionnaires pharmacists pharmacy time visit included study participants replied yes patient someone known pharmacist least one four scenarios classified dawmp the reproducibility questionnaire assessed using intraclass correlation coefficient icc based results obtained first second answers pharmacist associations independent variables dawmp modelled multiple logistic regression take account distribution independent variables calculated interquartile odds ratio effect exposure change 25th 75th percentile when 1 calculated inverse interquartile 1/interquartile effect exposure changes 75th 25th percentile in pilot study scale items icc 0.4 pharmacies visited 22 12.0% refused participate study of 286 pharmacists 72.8% completed questionnaire 185 stated carried dawmp 64.7% none personal professional traits showed relationship dawmp table 1 table 2 shows degree agreement attitudes influence dawmp the changes exposure 25th 75th percentile increased probability dawmp 14% 95% ci 1%30% insufficient knowledge 119% 95% ci 42%236% external responsibility health system 46% 95% ci 11%92% indifference 484% 95% ci 235%915% complacency case external responsibility investigation change 75th 25th percentile assessment opinion would mean 80% increase 95% ci 19%170% probability dawmp table 1.influence personal professional traits dawmptraitsdawmp n analysisnoyesor 95% ci)pgender female79 78.2)145 78.4)1.00 male20 19.8)35 18.9)1.01 0.482.14)0.974 md2 2.0)5 2.7)age years 3927 26.7)58 31.4)1.00 394834 33.7)55 29.7)0.70 0.222.25)0.546 4827 26.7)60 32.4)0.81 0.312.16)0.680 md13 12.9)12 6.5)work status owner56 55.4)86 46.5)1.00 staff43 42.6)98 53.0)0.85 0.421.71)0.639 md2 2.0)1 0.5)population rural47 46.5)89 48.1)1.00 semi rural20 19.8)29 15.7)0.67 0.311.43)0.298 urban32 31.7)65 35.1)0.69 0.271.78)0.444 md2 2.0)2 1.1)years experience community pharmacist 1128 27.7)58 31.4)1.00 112038 37.6)67 36.2)0.99 0.293.42)0.989 2026 25.7)49 26.5)0.83 0.312.21)0.705 md9 8.9)11 5.9)medication dispensed per day 8021 20.8)56 30.3)1.00 8015039 38.6)74 40.0)1.11 0.413.06)0.837 15015 14.9)33 17.8)0.82 0.351.94)0.658 md26 25.7)22 11.9)antibiotics dispensed per day 524 23.8)54 29.2)1.00 51035 34.7)88 47.6)1.40 0.464.28)0.554 1014 13.9)23 12.4)1.74 0.724.20)0.220 md28 27.7)20 10.8)md missing data.adjusted effects variables included table.categorized tertiles total sample table 2.influence attitudes opinions dawmpattitudespercentilesor 95% ci)interquartile 95% ci)inverse interquartile 95% ci)p255075(1 antibiotic resistance important public health issue.9.010.010.01.14 1.011.30)1.14 1.011.30)0.041(2 fact antibiotic prescribed patient influence appearance resistance.1.03.87.50.96 0.891.02)1.35 0.862.13)0.193(3 prescription antibiotics less strict private insurance galician health service servizo galego de sade sergas).0.52.05.51.17 1.071.27)2.19 1.423.36)<0.001(4 dispensing antibiotics warn patient importance correct therapeutic compliance.10.010.010.00.94 0.711.27)1.00 1.001.00)0.711(5 dispensing possible interactions antibiotic drugs patient taking evaluated.9.510.010.01.00 0.831.21)0.988(6 antibiotics sometimes dispensed without medical prescription patient known difficulty gaining access doctor.0.94.57.01.33 1.221.46)5.84 3.3510.15)<0.001(7 main cause appearance antibiotic resistance inappropriate use patients.8.09.510.00.98 0.891.08)1.04 0.851.27)0.693(8 wrong antibiotic sometimes knowingly dispensed pharmacists time explain correct one.0.51.03.31.15 1.041.27)1.46 1.111.92)0.007(9 convinced new antibiotics developed solve resistance issue.4.95.59.50.88 0.810.96)1.80 1.192.70)0.005(10 use antibiotics animals important cause appearance new resistance.5.07.510.01.04 0.951.13)1.20 0.791.83)0.381(11 patients feel need antibiotic dispensed try obtain another pharmacy.2.55.59.51.17 1.091.26)3.04 1.825.10)<0.001(12 phenomenon resistance antibiotics mainly problem hospital settings.1.02.55.81.06 0.981.15)1.32 0.921.92)0.132insufficient knowledge.external responsibility.complacency.indifference influence personal professional traits dawmp adjusted effects variables included table the results study indicate pharmacists knowledge attitudes strongly associated dawmp indifference complacency external responsibility insufficient knowledge identified attitudes increase risk dawmp since attitudes potentially modifiable results would indicate educational strategies specifically aimed changing certain attitudes could substantially improve antibiotic dispensing our data confirm sale pharmacies antibiotics without medical prescription continues widespread spain since 60% pharmacists study acknowledged practice one possibility pharmacists feel competent undertake dawmp particularly case minor infections our results indicate much greater propensity dispense case urinary dental infections case respiratory infections some authors shown agreement dispensing antibiotics counter cases minor urinary infections although controversial when performed second analysis excluding dispensing minor urinary infections influence attitudes dispensing habits unchanged data shown when pharmacist knew patient complacency increased probability dawmp consistent another study conducted setting some pharmacists explain practice saying regular customers familiar clinical history since income depends sales behaviour could nevertheless motivated fear losing regular customer moreover pharmacists believe patient would find antibiotic pharmacy increase probability dawmp probably foster customer loyalty fear losing sale another factor might influence dawmp pressure exerted patients obtain antibiotic medical prescribing influenced patients expectations similar pattern behaviour could well arise dispensing process particularly countries like spain patients prone use antibiotics even treating minor complaints and/or viral illnesses this paradoxical effect explained give importance immediate efficacy patient satisfaction individual point view potential long term antibiotic resistance population collective point view responsibility professionals pharmacists medical staff patients healthcare system use antibiotics animals another attitude associated dawmp common among health professionals a possible limitation study bias caused respond however level participation high extent one highest type study 72.8% another possible limitation percentage pharmacists acknowledged dawmp might underestimated such acknowledgement could indicate professionals placed trust anonymity questionnaire presumably issued academic institution another possible study limitation difficulty assessing validity criterion since reference method measuring attitudes however fact knowledge attitudes discriminate dispensing antibiotics without prescription supports construct validity statements results study may applicable environments legislative framework regarding dawmp stricter case northern europe north america the results study could used design interventions improve antibiotic dispensing these interventions could emphasize high level dawmp responsibility ii importance resistance association antibiotic use outpatients insufficient knowledge indifference iii pharmacist patient communication health education complacency the results study could used design interventions improve antibiotic dispensing these interventions could emphasize high level dawmp responsibility ii importance resistance association antibiotic use outpatients insufficient knowledge indifference iii pharmacist patient communication health education complacency this work supported health research fund fondo de investigacin sanitaria grants pi 081239 pi09/90609 spanish ministry health a. f. p. l .- v designed study a. f. p. l .- v data collection carried m. z .- c also undertook database management statistical analysis the text drafted m. z .- c a. f. discussed depth m. z .- c a. f. c. g .- a. f. p. l .- v designed study a. f. p. l .- v data collection carried m. z .- c also undertook database management statistical analysis the text drafted m. z .- c a. f. discussed depth m. z .- c a. f. c. g .-

objectivesantibiotic resistance is a major public health concern and is greatly exacerbated by inappropriate antibiotic use at a community level . the aim of this study was to ascertain which attitudes of community pharmacists were related to inappropriate antibiotic dispensing.methodswe conducted a cross - sectional study of community pharmacists in a region situated in northern spain ( n = 393 ) . personal interviews were conducted using a self - administered questionnaire . the degree of agreement with each item of knowledge and attitude was measured using an unnumbered , horizontal visual analogue scale , with replies being scored from 0 ( total disagreement ) to 10 ( total agreement ) . the data were analysed using logistic regression.resultsof the total of 286 pharmacists ( 72.8% ) who completed the questionnaire , 185 ( 64.7% ) acknowledged having undertaken dispensing of antibiotics without a medical prescription ( dawmp ) . attitudes such as patient complacency , external responsibility , indifference and insufficient knowledge were shown to be related to dawmp . in contrast , no association was found with any of the pharmacists ' personal or professional traits.conclusionsthis study confirms that , albeit unlawful , dawmp is a common practice in spanish pharmacies . dawmp was seen to be usually associated with some of the attitudes evaluated .

morphea also known localized scleroderma ls inflammatory skin disorder characterized excessive collagen deposition it primarily affects dermis sometimes extends subcutaneous fat fascia producing thickening hardening skin due fibrosis it estimated approximately half patients undergo spontaneous remission skin softening ~2.7 years onset disease.1 however severe end spectrum morphea may progress years resulting significant atrophy joint contractures functional cosmetic psychologic disabilities epidemiologic data suggest morphea progresses systemic sclerosis 0.9%5.7% patients.2 morphea shows great variety clinical presentation classified circumscribed linear including scleroderma en coup de sabre generalized pansclerotic mixed variant morphea.3 therapeutic options include use topical oral corticosteroids vitamin analogs calcitriol tacrolimus psoralen ultraviolet puva photochemotherapy uva1 cyclosporin penicillamine antimalarial drugs methotrexate mtx).48 although treatment algorithms morphea subtypes suggested fett werth still consistent recommendations treatment morphea based disease characteristics.9,10 study attempts assess clinical efficacy safety mtx refractory generalized morphea this retrospective study conducted april 2010 may 2015 clinic autoimmune dermatoses andreas sygros hospital first department skin venereal diseases national kapodistrian university athens medical school greece inclusion criteria following 1 age 18 years 2 clinical diagnosis generalized plaque scleroderma defined 4 indurated plaques 3 cm affecting least 2 anatomic areas 3 confirmation clinical diagnosis histologic serologic examination 4 generalized morphea refractory topical treatment corticosteroids calcineurin inhibitors vitamin analogs puva oral corticosteroids patients additionally failed systemic treatments combination treatment excluded study a total 52 patients generalized plaque scleroderma attended clinic autoimmune dermatoses time period thirty two patients demonstrated significant clinical improvement treated following treatments topical corticosteroids calcineurin inhibitors vitamin analogs puva oral corticosteroids the frequencies concomitant diseases patients medical history following coronary artery disease 7 patients 35% diabetes 4 patients 20% elevated cholesterol 5 patients 25% furthermore failed puva although high dose uva1 light likely effective ultraviolet light therapy morphea available hospital a total 2 3 2 patients response later treated penicillamine hydroxychloroquine combination oral corticosteroids topical calcineurin inhibitors respectively clinical characteristics patients recorded comprising disease duration past treatments morphea extracutaneous manifestations disease family history autoimmune diseases also indicated laboratory examinations included antinuclear antibodies anas anti topoisomerase antibodies anti scl-70 complement fractions c3 c4 anti pm scl anti sm anti u1-rnp anti ro ssa anti la ssb antibodies standard screening prior treatment initiation mtx consisted full blood count liver biochemistry serum urea creatinine these tests performed twice weekly first 3 months treatment four times weekly second 3 months treatment thereafter thrice monthly case stable dose toxicity.11 serology tests hepatitis b hbv hepatitis c hcv tuberculosis testing considered high risk patients a chest x ray appropriate patients lung disease asthma bronchitis smoker cough treatment ceased cases good improvement lack improvement progressive disease manageable adverse events based judgment clinical team fourteen 20 patients 70% received mtx sole systemic treatment whereas ones administered combination oral mtx and/or topical emollients clinical assessment skin lesions performed based 3 criteria erythema skin thickness induration size lesion this evaluation outcomes represented mannequin documented patients medical files a physician global assessment pga scale also used evaluate efficacy treatment mtx 6 9 12 months therapy based improvement mentioned 3 criteria treatment failure defined improvement 3 criteria and/or appearance disease activity function worsening sclerosis presence lilac ring increase lesion size presence new lesions within previous visit very good response defined improvement 3 criteria good improvement 2 3 criteria fair response improvement 1 3 criteria moreover patients asked complete dermatology life quality index dlqi questionnaire evaluate impact disease patient quality life.12 study conducted dermatology department andreas sygros hospital cutaneous venereal diseases athens the study protocol approved ethics committee hospital written informed consent obtained patients this retrospective study conducted april 2010 may 2015 clinic autoimmune dermatoses andreas sygros hospital first department skin venereal diseases national kapodistrian university athens medical school greece inclusion criteria following 1 age 18 years 2 clinical diagnosis generalized plaque scleroderma defined 4 indurated plaques 3 cm affecting least 2 anatomic areas 3 confirmation clinical diagnosis histologic serologic examination 4 generalized morphea refractory topical treatment corticosteroids calcineurin inhibitors vitamin analogs puva oral corticosteroids patients additionally failed systemic treatments combination treatment excluded study a total 52 patients generalized plaque scleroderma attended clinic autoimmune dermatoses time period thirty two patients demonstrated significant clinical improvement treated following treatments topical corticosteroids calcineurin inhibitors vitamin analogs puva oral corticosteroids the frequencies concomitant diseases patients medical history following coronary artery disease 7 patients 35% diabetes 4 patients 20% elevated cholesterol 5 patients 25% furthermore failed puva although high dose uva1 light likely effective ultraviolet light therapy morphea available hospital a total 2 3 2 patients response later treated penicillamine hydroxychloroquine combination oral corticosteroids topical calcineurin inhibitors respectively clinical characteristics patients recorded comprising disease duration past treatments morphea extracutaneous manifestations disease family history autoimmune diseases also indicated laboratory examinations included antinuclear antibodies anas anti topoisomerase antibodies anti scl-70 complement fractions c3 c4 anti pm scl anti sm anti u1-rnp anti ro ssa anti la ssb antibodies standard screening prior treatment initiation mtx consisted full blood count liver biochemistry serum urea creatinine these tests performed twice weekly first 3 months treatment four times weekly second 3 months treatment thereafter thrice monthly case stable dose toxicity.11 serology tests hepatitis b hbv hepatitis c hcv tuberculosis testing considered high risk patients a chest x ray appropriate patients lung disease asthma bronchitis smoker cough treatment ceased cases good improvement lack improvement progressive disease manageable adverse events based judgment clinical team fourteen 20 patients 70% received mtx sole systemic treatment whereas ones administered combination oral mtx and/or topical emollients clinical assessment skin lesions performed based 3 criteria erythema skin thickness induration size lesion this evaluation outcomes represented mannequin documented patients medical files physician global assessment pga scale also used evaluate efficacy treatment mtx 6 9 12 months therapy based improvement mentioned 3 criteria treatment failure defined improvement 3 criteria and/or appearance disease activity function worsening sclerosis presence lilac ring increase lesion size presence new lesions within previous visit very good response defined improvement 3 criteria good improvement 2 3 criteria fair response improvement 1 3 criteria moreover patients asked complete dermatology life quality index dlqi questionnaire evaluate impact disease patient quality life.12 this study conducted dermatology department andreas sygros hospital cutaneous venereal diseases athens the study protocol approved ethics committee hospital written informed consent obtained patients the patients study mean disease duration 27 months initiation mtx treatment clinically patients general started show signs experienced marked moderate improvement within first 3 months therapy continued improve throughout next months a significant improvement clinical manifestation reflected scoring systems including dlqi score table 1 according pga 3 months treatment patients good good fair response 2 failed treatment thus treatment discontinued cases table 2 after 12 months therapy good response achieved 6 patients 30% good response 10 patients 50% these patients followed mean time interval 21 months follow period new skin lesions generalized morphea appeared exacerbation disease observed nausea abdominal pain observed 4 patients 20% 1 patient developed acute elevation liver biochemistry normalized reducing dosage mtx 10 mg weekly 2 consecutive weeks seven patients 35% ana positive 1 patient 5% anti scl-70 positive c3 c4 within normal range patients anti pm scl anti sm anti u1-rnp anti ro ssa anti la ssb antibodies detected patients morphea 4 lesions affecting least 2 anatomic areas usually limited skin subcutaneous tissue attends self limited course.3,13 however prognosis may unpredictable.14 topical treatments available usually effective inflammatory phase it well accepted practice use systemic medications treat severe disabling forms morphea including lesions resistant topical therapy either cosmetically significant site face scalp transverse joint deep subcutaneous involvement.15 mtx studied treatment option morphea systemic sclerosis this enzyme involved pyrimidine dna synthesis.16 inhibition enzyme leads depletion tetrahydrofolates essential synthesis dna rna protein.14 advantages treatment mtx include weekly dosage schedule low cost relatively safe profile.17 whereas adverse events like nausea vomiting fatigue mucositis common rarely life threatening while pulmonary toxicity rare hepatic toxicities toxicity common mtx usually severe particularly dose low managed dose reduction needed.17 consequently frequent blood monitoring required although uncontrolled study appear encouraging results since majority patient group 80% study showed good good response 12 months mtx treatment only 2 patients discontinue treatment due response therapy worsening clinical condition according literature mtx proved effective well tolerated treatment achieving disease remission pediatric patients ls.15,1820 however studies conducted adult population cohort study kroft et al demonstrated efficacy mtx various sclerotic skin diseases ls eosinophilic fasciitis pseudoscleroderma adult patients.21 another study improvement observed adult patients severe morphea treated pulsed intravenous corticosteroids plus mtx.22 van den hoogen et al shown mtx therapy systemic sclerosis resulted reduction skin thickness improvement general well being.23 similar findings reported pope et al.24 addition recent retrospective chart review adult patients morphea treated mtx showed younger age treatment initiation associated higher rates disease remission suggesting early treatment preferred morphea.25 mechanism action mtx fully understood this may attributed anti inflammatory effect possible direct effect skin fibroblasts both seyger et al adult ls series van den hoogen et al adult systemic sclerosis trial suggested mtx may anti fibrotic action.23,26 possible mechanism mtx modifying morphea interfering cytokine expression decreased levels circulating soluble interleukin-2 receptors decreased serum levels interleukin-6 interleukin-8 mtx treatment reported juvenile adult rheumatoid arthritis increased levels mentioned cytokines related active phase morphea.2730 addition recent study showed suppression jak stat pathway likely principal anti inflammatory immunosuppressive mechanism action low dose mtx.31 mtx considered safe strategy management specific clinical subset morphea the overall tolerability treatment high adverse events observed mild reversible nevertheless uncontrolled study disease tendency spontaneous improvement difficult certain improvement due mtx

introductionmorphea is an inflammatory skin disorder characterized by excessive collagen deposition . although treatment algorithms for morphea subtypes have been suggested , no consistent recommendations are available . this study attempts to evaluate the clinical efficacy of methotrexate ( mtx ) as monotherapy in refractory generalized morphea.methodsit is a retrospective study , including 20 patients who had already been treated with various topical and systemic therapies with minimal clinical improvement . patients received orally mtx at a of dosage 15 mg once weekly . duration of the use , dosage of mtx , and adverse events were recorded . clinical assessment of skin lesions was performed and documented.resultsthe mean disease duration was 27 months before the initiation of mtx treatment . after 12 months of therapy , very good response was achieved in 6 patients ( 30% ) , good response in 10 patients ( 50% ) , and fair response in 2 patients ( 10% ) , while 2 patients ( 10% ) had failed treatment . patients were followed up for a mean time interval of 21 months . no serious adverse event was recorded.conclusionmtx has been already proved to be an effective and well - tolerated treatment in pediatric patients with morphea . the majority of the group of adult patients showed very good and good improvement when treated with mtx . although this is an uncontrolled study , mtx monotherapy was considered a safe and effective treatment for the management of this specific clinical subset of morphea in adults .

observational cohort study healthy subjects glaucoma suspects open angle glaucoma oag patients enrolled diagnostic innovations glaucoma study digs completed oct imaging angiovue optovue inc fremont ca usa optic nerve head imaging using sd oct avanti optovue inc participants underwent ophthalmologic examination including assessment best corrected visual acuity slit lamp biomicroscopy intraocular pressure iop measurement goldmann applanation tonometry gonioscopy ultrasound pachymetry dilated fundus examination simultaneous stereophotography optic disc visual field testing inclusion criteria 1 greater 18 years age 2 open angles gonioscopy 3 best corrected visual acuity bcva 20/40 better healthy subjects 1 iop 21 mm hg history elevated iop 2 normal appearing optic disc intact neuroretinal rim rnfl 3 minimum two reliable normal visual fields defined pattern standard deviation psd within 95% confidence limits glaucoma hemifield test ght result within normal limits eyes classified glaucomatous repeatable glaucomatous visual field damage defined ght outside normal limits psd outside 95% normal limits glaucoma suspects defined glaucomatous optic neuropathy suspicious appearing optic discs based stereophotograph reviewed two experienced graders and/or ocular hypertension iop 21 mm hg without evidence repeatable glaucomatous visual field damage the diagnostic category participant determined based diagnosis worse eye participants history intraocular surgery except uncomplicated cataract surgery glaucoma surgery coexisting retinal pathologies nonglaucomatous optic neuropathy uveitis ocular trauma excluded study participants also excluded diagnosis parkinson disease alzheimer disease dementia history stroke participants systemic hypertension diabetes mellitus included unless diagnosed diabetic hypertensive retinopathy participants unreliable visual field poor quality oct optic nerve head sd oct scans also excluded study systemic measurements included two blood pressure bp measurements obtained using omron automatic model bp791it omron healthcare inc mean arterial pressure calculated one third systolic bp two thirds diastolic bp mean ocular perfusion pressure mopp defined difference two thirds mean arterial pressure iop optical coherence tomography angiography sd oct images obtained operator visit using angiovue dual modality oct system the angiovue angiographic platform implemented existing commercially available sd oct platform informed consent obtained participants methods adhered tenets declaration helsinki health insurance portability accountability act approved institutional review boards university california san diego standard automated perimetry visual field tests completed using swedish interactive threshold algorithm standard 24 2 humphrey field analyzer carl zeiss meditec dublin ca usa strategies the quality visual fields reviewed visual field assessment center visfact staff reliable tests 33% fixation losses false negative errors 15% false positive errors visual fields without rim eyelid artifacts evidence inattention fatigue effects evidence abnormal results visual field caused disease glaucoma included visual field result considered abnormal ght outside normal limits psd fell outside 95% normal confidence limits the angiovue provides noninvasive oct based method visualizing vascular structures retina it uses 840-nm light source scan rate 70,000 scans bandwidth 50 nm each volume contains 304 304 scans two consecutive b scans captured fixed position each volume scan acquired 3 seconds consists two orthogonal volumes used minimize motion artifacts arising microsaccades fixation changes the split spectrum amplitude decorrelation angiography ssada method used capture dynamic motion red blood cells provide high resolution 3d visualization perfused retinal vasculature the angiovue characterizes vascular information various user defined retinal layers vessel density map quantitatively vessel density fig vessel density automatically calculated proportion measured area occupied flowing blood vessels defined pixels decorrelation values acquired ssada algorithm threshold level retinal nerve fiber layer vessel density map healthy glaucoma suspect open angle glaucoma eyes bottom row area vessel density color coded map report analyzed vessel density peripapillary rnfl images 4.5 4.5-mm field view centered optic disc vessel density within rnfl measured internal limiting membrane ilm rnfl posterior boundary using standard angiovue software version 2015.1.0.90 whole enface image vessel density wivd measured entire 4.5 4.5-mm image circumpapillary vessel density cpvd calculated region defined 750-m wide elliptical annulus extending optic disc boundary fig image quality review completed scans according standard protocol established university california san diego imaging data evaluation analysis idea reading center trained graders reviewed scans excluded poor quality images defined images 1 signal strength index less 48 2 poor clarity 3 residual motion artifacts visible irregular vessel pattern disc boundary enface angiogram 4 local weak signal 5 rnfl segmentation errors the location disc margin reviewed accuracy adjusted manually required all subjects also underwent optic nerve head imaging commercially available sd oct system avanti a70-khz axial line rate 840-nm central wavelength 22-m focal spot diameter axial resolution 5 tissue optic nerve head onh ) map protocol used obtain rnfl thickness measurements rnfl measurements calculated 10-pixel wide band along circle 3.45 mm diameter centered onh good quality images defined scans signal strength index 37 without segmentation failure artifacts included overall average rnfl thickness used analysis the distribution numerical data tested normality using shapiro wilk test descriptive statistics calculated mean standard deviation normally distributed variables median first quartile third quartile nonnormally distributed variables age adjusted anova used comparison groups tukey kramer honest significant difference hsd post hoc test performed adjust multiple comparisons groups within analysis diagnostic accuracy differentiating 1 healthy glaucoma eyes 2 healthy glaucoma suspect eyes evaluated calculating area receiver operating characteristic auroc curves analysis vessel density participant contributed eyes either glaucoma patient group glaucoma suspect group if eyes glaucoma patient show evidence repeatable visual field damage eye without visual field damage excluded analyses glaucoma eyes glaucoma suspect eyes completeness diagnostic accuracy also calculated differentiating 1 healthy subjects glaucoma patients 2 healthy subjects glaucoma suspect participants using mean vessel density eyes unit analysis subject the auroc curves adjusted age differences groups using covariate adjustment regression method analysis eye a cluster variance estimator used adjust including eyes subject model pairwise comparisons aurocs performed using method suggested pepe al evaluate whether statistically significant differences roc curves all statistical analyses performed commercially available software stata version 14 statacorp college station tx usa jmp version 11.2.0 sas inc this observational cohort study healthy subjects glaucoma suspects open angle glaucoma oag patients enrolled diagnostic innovations glaucoma study digs completed oct imaging angiovue optovue inc fremont ca usa optic nerve head imaging using sd oct avanti optovue inc participants underwent ophthalmologic examination including assessment best corrected visual acuity slit lamp biomicroscopy intraocular pressure iop measurement goldmann applanation tonometry gonioscopy ultrasound pachymetry dilated fundus examination simultaneous stereophotography optic disc visual field testing inclusion criteria 1 greater 18 years age 2 open angles gonioscopy 3 best corrected visual acuity bcva 20/40 better healthy subjects 1 iop 21 mm hg history elevated iop 2 normal appearing optic disc intact neuroretinal rim rnfl 3 minimum two reliable normal visual fields defined pattern standard deviation psd within 95% confidence limits glaucoma hemifield test ght result within normal limits eyes classified glaucomatous repeatable glaucomatous visual field damage defined ght outside normal limits psd outside 95% normal limits glaucoma suspects defined glaucomatous optic neuropathy suspicious appearing optic discs based stereophotograph reviewed two experienced graders and/or ocular hypertension iop 21 mm hg without evidence repeatable glaucomatous visual field damage the diagnostic category participant determined based diagnosis worse eye participants history intraocular surgery except uncomplicated cataract surgery glaucoma surgery coexisting retinal pathologies nonglaucomatous optic neuropathy uveitis ocular trauma excluded study participants also excluded diagnosis parkinson disease alzheimer disease dementia history stroke participants systemic hypertension diabetes mellitus included unless diagnosed diabetic hypertensive retinopathy participants unreliable visual field poor quality oct optic nerve head sd oct scans also excluded study systemic measurements included two blood pressure bp measurements obtained using omron automatic model bp791it omron healthcare inc mean arterial pressure calculated one third systolic bp two thirds diastolic bp mean ocular perfusion pressure mopp defined difference two thirds mean arterial pressure iop optical coherence tomography angiography sd oct images obtained operator visit using angiovue dual modality oct system the angiovue angiographic platform implemented existing commercially available sd oct platform informed consent obtained participants methods adhered tenets declaration helsinki health insurance portability accountability act approved institutional review boards university california san diego standard automated perimetry visual field tests completed using swedish interactive threshold algorithm standard 24 2 humphrey field analyzer carl zeiss meditec dublin ca usa strategies the quality visual fields reviewed visual field assessment center visfact staff reliable tests 33% fixation losses false negative errors 15% false positive errors visual fields without rim eyelid artifacts evidence inattention fatigue effects evidence abnormal results visual field caused disease glaucoma included visual field result considered abnormal ght outside normal limits psd fell outside 95% normal confidence limits the angiovue provides noninvasive oct based method visualizing vascular structures retina it uses 840-nm light source scan rate 70,000 scans bandwidth 50 nm each volume contains 304 304 scans two consecutive b scans captured fixed position each volume scan acquired 3 seconds consists two orthogonal volumes used minimize motion artifacts arising microsaccades fixation changes the split spectrum amplitude decorrelation angiography ssada method used capture dynamic motion red blood cells provide high resolution 3d visualization perfused retinal vasculature the angiovue characterizes vascular information various user defined retinal layers vessel density map quantitatively vessel density fig vessel density automatically calculated proportion measured area occupied flowing blood vessels defined pixels decorrelation values acquired ssada algorithm threshold level retinal nerve fiber layer vessel density map healthy glaucoma suspect open angle glaucoma eyes bottom row area vessel density color coded map report analyzed vessel density peripapillary rnfl images 4.5 4.5-mm field view centered optic disc vessel density within rnfl measured internal limiting membrane ilm rnfl posterior boundary using standard angiovue software version 2015.1.0.90 whole enface image vessel density wivd measured entire 4.5 4.5-mm image circumpapillary vessel density cpvd calculated region defined 750-m wide elliptical annulus extending optic disc boundary fig image quality review completed scans according standard protocol established university california san diego imaging data evaluation analysis idea reading center trained graders reviewed scans excluded poor quality images defined images 1 signal strength index less 48 2 poor clarity 3 residual motion artifacts visible irregular vessel pattern disc boundary enface angiogram 4 local weak signal 5 rnfl segmentation errors the location disc margin reviewed accuracy adjusted manually required all subjects also underwent optic nerve head imaging commercially available sd oct system avanti a70-khz axial line rate 840-nm central wavelength 22-m focal spot diameter axial resolution 5 tissue optic nerve head onh map protocol used obtain rnfl thickness measurements ; rnfl measurements calculated 10-pixel wide band along circle 3.45 mm diameter centered onh good quality images defined scans signal strength index 37 without segmentation failure artifacts included overall average rnfl thickness used analysis the distribution numerical data tested normality using shapiro wilk test descriptive statistics calculated mean standard deviation normally distributed variables median first quartile third quartile nonnormally distributed variables age adjusted anova used comparison groups tukey kramer honest significant difference hsd post hoc test performed adjust multiple comparisons groups within analysis diagnostic accuracy differentiating 1 healthy glaucoma eyes 2 healthy glaucoma suspect eyes was evaluated calculating area receiver operating characteristic auroc curves for analysis vessel density participant contributed eyes either glaucoma patient group glaucoma suspect group if eyes glaucoma patient show evidence repeatable visual field damage eye without visual field damage excluded analyses glaucoma eyes glaucoma suspect eyes completeness diagnostic accuracy also calculated differentiating 1 healthy subjects glaucoma patients 2 healthy subjects glaucoma suspect participants using mean vessel density eyes unit analysis subject the auroc curves adjusted age differences groups using covariate adjustment regression method analysis eye a cluster variance estimator used adjust including eyes subject model pairwise comparisons aurocs performed using method suggested pepe al evaluate whether statistically significant differences roc curves all statistical analyses performed commercially available software stata version 14 statacorp college station tx usa jmp version 11.2.0 sas inc two hundred sixty one eyes 164 healthy subjects glaucoma suspects oag patients good quality scans included analysis mean age healthy group significantly lower glaucoma glaucoma suspect group p 0.001 table 1 therefore comparisons roc curves adjusted age differences groups compared glaucoma suspect healthy subjects glaucoma patients significantly lower iops p 0.001 p 0.042 respectively also thinner central corneas compared glaucoma suspect group p 0.040 ) demographic ocular characteristics healthy subjects glaucoma suspects glaucoma patients statistically significant differences systolic diastolic mean bp mean ocular perfusion pressure measurements among groups however self reported history hypertension frequent glaucoma patients glaucoma suspects compared healthy controls p 0.006 statistically significant differences found glaucoma patients healthy subjects ocular parameters except disc area visual field mean deviation psd significantly different glaucoma suspects healthy controls p 0.819 p 0.870 respectively however glaucoma suspects average thinner rnfl smaller rim areas compared healthy subjects p 0.05 age adjusted 1-way anovas showed vessel density values significantly different among three groups p 0.001 wivd cpvd the wivd values significantly lower glaucoma eyes 46.2% followed glaucoma suspect eyes 51.3% healthy eyes 56.6% three pairwise comparisons statistically significant tukey kramer hsd p 0.05 comparisons cpvd pairwise comparisons showed glaucoma eyes 55.1% significantly lower cpvd values compared glaucoma suspects eyes 60.3% healthy eyes 64.2% tukey kramer hsd p 0.001 however significant difference cpvd glaucoma suspect healthy eyes p 0.426 table 2 fig age adjusted mean values diagnostic accuracy auroc oct vessel density spectral domain oct rnfl thickness measurements healthy participants glaucoma suspects glaucoma patients boxplots illustrating distribution whole image vessel density top circumpapillary vessel density middle average retinal nerve fiber layer thickness bottom measurements healthy glaucoma suspect glaucoma eyes overall auroc se discriminating healthy glaucomatous eyes highest wivd 0.94 0.03 followed rnfl 0.92 0.03 cpvd 0.83 0.06 pairwise comparisons showed age adjusted auroc wivd 0.94 higher cpvd 0.83 p 0.05 diagnostic accuracies similar rnfl thickness 0.92 p 0.05 differentiating glaucoma healthy eyes table 2 fig the auroc differentiating glaucoma suspect eyes healthy eyes highest wivd 0.70 0.10 followed rnfl thickness 0.65 0.09 cpvd 0.65 0.10 area receiver operator characteristic curves whole image vessel density 0.94 circumpapillary vessel density 0.83 average rnfl 0.92 differentiating glaucoma eyes healthy eyes area receiver operator characteristic curves whole image vessel density 0.70 circumpapillary vessel density 0.65 average rnfl 0.65 differentiating glaucoma suspect eyes healthy eyes similar analyses completed comparing healthy subjects glaucoma patients healthy subjects glaucoma suspect patients using mean eyes analysis overall auroc se discriminating healthy glaucomatous participants highest wivd 0.87 0.05 followed rnfl thickness 0.87 0.04 cpvd 0.71 0.08 the auroc differentiating healthy glaucoma suspects highest wivd 0.70 0.11 followed cpvd 0.62 0.10 rnfl thickness 0.62 0.09 in current study demonstrated oct vessel density measured rnfl superficial layer retina distinguishes among groups glaucoma glaucoma suspect healthy participants specifically wivd performs well rnfl thickness discriminating healthy glaucoma patients differentiating healthy glaucoma suspect groups the wivd also significantly better diagnostic accuracy cpvd differentiating glaucoma patients healthy groups present study the diagnostic accuracy vessel density measurements evaluated differentiating glaucoma eyes healthy eyes well glaucoma patients healthy subjects regardless whether analysis completed participant unit analysis whether eye unit analysis conclusion drawn vessel density measures similar diagnostic accuracy rnfl thickness glaucoma glaucoma suspect detection however compared analysis participant unit analysis auroc eyes unit analysis larger auroc values 0.87 0.94 respectively analysis participant included mean eyes analysis regardless whether fellow eye visual field damage these results consistent previous reports showed differences oct microvasculature glaucoma healthy groups optic disc peripapillary region however reports assessed superficial deep capillary beds calculated vascular parameters thicker retinal slab ilm rpe knowledge first study using oct evaluate microvascular bed rnfl layer largely reflects rpcs these findings oct vessel density measurements oct based rnfl thickness measurements similar auroc glaucoma detection also consistent studies reporting high auroc peripapillary vessel density measures thicker slab ilm rpe sd oct rnfl thickness measurements aurocs 0.94 0.97 respectively although structural measurements rnfl optic nerve head parameters rim cup etc shown associated disc size best knowledge studies evaluated effect disc size vessel density measurements current study significant correlation disc area wivd cpvd measurements healthy eyes r 0.04 p 0.815 r 0.01 p 0.474 respectively reason also found wivd performs well rnfl thickness discriminating glaucoma suspect eyes healthy controls aurocs se 0.70 0.10 0.65 0.09 respectively p 0.497 there evidence rnfl thinning detectable ocular hypertensive eyes preperimetric glaucomatous eyes even morphologic changes optic disc become visible visual field defects occur there also evidence changes blood flow detectable glaucoma suspects visual field defect however ability oct discriminate glaucoma suspects healthy subjects reported previously an unexpected finding current study significantly better diagnostic accuracy wivd compared cpvd differentiating healthy glaucoma groups first larger measurement area advantage detecting changes rpcs rnfl capillary plexus additional superficial vascular bed accompanying axons extend eccentrically along temporal vessels in contrast rnfl thickness assessment measures virtually ganglion cell axons exit eye optic nerve measuring cpvd may fully capture presence rpcs regard some studies suggest rpcs originate retinal vessels ganglion cell layer arch abruptly supply rnfl whereas others report originate optic disc there however consensus regarding anatomy rpcs distinct elongated microvascular networks run parallel rgc axons prominent peripheral arcuate rnfl region therefore larger measurement area wivd may least part explain better performance measurements compared cpvd as suggested figure 1 vessel dropout visible qualitatively areas image including periphery outside measurement area cpvd thus limited measurement size cpvd may include regions sparse vasculature diagnostic value finally study population comprises high proportion early glaucoma patients larger measurement area may detecting early vessel dropout associated focal rnfl damage early glaucoma apparent peripapillary retina farther circumpapillary region included cpvd impairment blood flow optic nerve peripapillary retina glaucoma patients well documented however studies found significant differences blood flow neuroretinal rim peripapillary area glaucoma patients healthy controls results studies relating ocular blood flow glaucoma difficult compare due variety techniques applied different parameters ocular hemodynamics investigated differences glaucoma populations studied measurement ocular blood flow challenging noted oct directly measure blood flow a number methods used document differences blood flow glaucoma normal eyes none appropriate routine clinical use the high variability doppler flowmetry laser speckle flowgraphy measurements limited resolution mri invasive nature time intensiveness fluorescein angiography limit ability provide information vascular components contribute pathophysiology glaucoma doppler oct used measuring total retinal blood flow better level precision doppler methods however technique able assess flow larger retinal vessels provide information microvascular networks primary interest glaucoma the rnfl largely comprised axons rgcs one metabolically active cells human these cells tremendous metabolic requirements depend regional capillary networks meet despite critical role rnfl capillary plexus relative glaucomatous damage suggested several investigators our previous inability quantify microvascular network features prevented evaluation clinical characteristics rnfl capillary beds obtaining comprehensive understanding rgc axonal damage glaucoma based results current study hypothesize oct provides new imaging target early diagnosis management glaucoma first healthy participants significantly younger glaucoma suspects glaucoma patients moreover unlikely main finding vessel density measures performed well rnfl thickness differentiating healthy glaucoma participants would affected age healthy controls subjects used analyses in addition due cross sectional noninterventional design study possible evaluate potentially confounding impact ocular hypotensive eye drops bp lowering medications vascular measurements most participants glaucoma 83.7% glaucoma suspect 73.0% groups treated using ocular antihypertensive medications time oct imaging further 41.3% glaucoma patients 35.2% glaucoma suspects taking multiple ocular antihypertensive medications it also noted present study patients excluded based systemic conditions systemic medication order better reflect general population outlined table 1 45.2% glaucoma patients 32.4% glaucoma suspects 17.4% healthy participants self reported history hypertension taking antihypertensive medications therefore could rule impact systemic conditions systemic medications vessel density measurements further studies needed address influence oct measurements ocular hypotensive treatment systemic medications specifically finally possible characterize causal relationship altered vessel density glaucomatous damage therefore longitudinal studies needed elucidate temporal relationship retinal vascular change glaucomatous optic neuropathy the current study demonstrated oct vessel density lower glaucoma patients compared healthy controls glaucoma suspects similar diagnostic accuracy rnfl thickness discriminating healthy subjects glaucoma suspects glaucoma patients this study unique compared diagnostic accuracy oct measures standard sd oct rnfl thickness discriminating healthy glaucoma suspect glaucoma patients the ability oct noninvasively evaluate capillary networks shows promise characterizing glaucomatous retinal vascular changes may role glaucoma management longitudinal studies needed determine whether lower vessel density found glaucoma patients precedes follows optic nerve damage whether information used improve glaucoma management

purposethe purpose of this study was to compare retinal nerve fiber layer ( rnfl ) thickness and optical coherence tomography angiography ( oct - a ) retinal vasculature measurements in healthy , glaucoma suspect , and glaucoma patients.methodstwo hundred sixty - one eyes of 164 healthy , glaucoma suspect , and open - angle glaucoma ( oag ) participants from the diagnostic innovations in glaucoma study with good quality oct - a images were included . retinal vasculature information was summarized as a vessel density map and as vessel density ( % ) , which is the proportion of flowing vessel area over the total area evaluated . two vessel density measurements extracted from the rnfl were analyzed : ( 1 ) circumpapillary vessel density ( cpvd ) measured in a 750-m - wide elliptical annulus around the disc and ( 2 ) whole image vessel density ( wivd ) measured over the entire image . areas under the receiver operating characteristic curves ( auroc ) were used to evaluate diagnostic accuracy.resultsage-adjusted mean vessel density was significantly lower in oag eyes compared with glaucoma suspects and healthy eyes . ( cpvd : 55.1 7% , 60.3 5% , and 64.2 3% , respectively ; p < 0.001 ; and wivd : 46.2 6% , 51.3 5% , and 56.6 3% , respectively ; p < 0.001 ) . for differentiating between glaucoma and healthy eyes , the age - adjusted auroc was highest for wivd ( 0.94 ) , followed by rnfl thickness ( 0.92 ) and cpvd ( 0.83 ) . the aurocs for differentiating between healthy and glaucoma suspect eyes were highest for wivd ( 0.70 ) , followed by cpvd ( 0.65 ) and rnfl thickness ( 0.65).conclusionsoptical coherence tomography angiography vessel density had similar diagnostic accuracy to rnfl thickness measurements for differentiating between healthy and glaucoma eyes . these results suggest that oct - a measurements reflect damage to tissues relevant to the pathophysiology of oag .

wegener granulomatosis wg uncommon necrotizing vasculitis commonly affects upper airways lungs kidneys involve organ the disease presents varying symptoms signs early recognition initiation adequate immunomodulatory therapy essential limiting potentially life threatening aspects disorder we report case illustrating wg may present localized cutaneous manifestations preceding systemic disease an 18-year old caucasian man presented painful rash truncus developed course weeks the patient known type-1 diabetes mellitus since age 8 otherwise healthy reported recent travel activity antecedent trauma affected area objective examination skin revealed inflamed cystic nodular lesions confined chest left shoulder significant suppuration apparent signs infection the condition resembled case severe acne initial histopathological examination skin biopsy supported preliminary clinical diagnosis a weeks later patient developed sore throat signs upper respiratory tract infection including cough dyspnoea mild chest pain the skin changes remained limited chest shoulder clearly progressed appeared deep vasculitic ulcerations including multiple elements 0.5 cm deep figure 1 these findings symptoms accompanied several weeks fever 39.6c malaise substantial unilateral facial pain patient admitted department nephrology investigation treatment figure 1cystic nodular lesions chest notice necrotic wounds element size ranging millimeters 2 cm consistence vasculitis elements inflamed blanch pressure cystic nodular lesions chest notice necrotic wounds element size ranging millimeters 2 cm the blood leukocyte thrombocyte counts normal liver renal function tests c reactive protein crp 300 mg l normal range less 10 mg l anti neutrophil cytoplasmic antibodies including specific identification proteinase 3 c anca pr3-anca 223 ku l normal range less 7 the patient kidney function continually assessed monitored levels creatinine urea remained within normal ranges examination urine including microbiological analysis revealed abnormalities chest x ray examination performed several lung infiltrates caverns noted a subsequent ct guided lung biopsy demonstrated sign infection significant inflammation tissue observed diagnosis wg concomitant mononeuritis multiplex involving trigeminal nerve established the patient received systemic methylprednisolone cyclofosfamide pulse therapy resulted prompt improvement clinical condition skin lesions well decrease crp anca titers shortly however patient developed fever renewed elevation c anca pr3-anca treatment supplemented rituximab leading immediate resolution symptoms residual pulmonary cutaneous sequelae recent follow our patient initially presented localized rash truncus condition insidiously complicated malaise fever progression cutaneous lesions ultimately diagnosis systemic wg established the etiology disease remains unknown however several studies suggest infectious antigens especially s. aureus may contribute pathogenesis vasculitis susceptible hosts clinical presentation wg complex found dependent number organs affected duration disease case the clinical course wg characterized initial localized phase may affect organ followed generalized systemic phase approximately 80% cases however patients specific cutaneous findings develop concurrently onset systemic involvement affect head extremities case confined truncus preceded systemic symptoms signs seldomly described wg specific cutaneous lesions seen approximately 15% cases usually associated renal disease musculoskeletal affection noted patient patients may develop one type cutaneous lesion may change time treatment several studies identified palpable purpura characteristic cutaneous lesion nodules papules ulcerations deep erythema nodusum like subcutaneous nodules complete clinical spectrum oral involvement uncommon wg observed patient course disease present case the level c nca pr3-anca markedly elevated anca positivity found occur 9095% cases active wg however levels correlate disease activity relapses absence anca rare repeat testing evaluation blood biochemistry order follow course disease highly recommended as illustrated case diagnosis wg represents challenge based anamnestic information closely correlated clinical features pathologic findings anca testing relevant differential diagnoses numerous include leukocytoclastic vasculitis henoch schnlein purpura pyoderma gangrenosum lymphoma erythema nodosum rheumatoid arthritis drug reactions variety infectious conditions however like wg conditions often present varying uncharacteristic symptoms signs case dermatological evaluation may provide valuable diagnostic information if untreated systemic wg leads 90% mortality first two years hence early recognition initiation adequate immunomodulatory treatment essential associated significantly decreased morbidity mortality high dose corticosteoroids pulsed intravenous cyclofosfamide remain mainstay initial therapy relapse refractory wg still represent therapeutic challenges however data recent studies evaluating biological therapies including tnf- blockers infliximab monoclonal antibodies rituximab promising future treatment regimes hopefully improve outcome patient group we report case illustrating patients wg may initially present localized cutaneous symptoms signs preceding serious systemic disease prompt recognition condition initiation early adequate immunomodulatory therapy crucial order reduce mortality morbidity dermatologists therefore need aware wg possible differential diagnosis especially patients presenting characteristic skin manifestations accompanying systemic symptoms signs

wegener s granulomatosis ( wg ) is a rare , systemic vasculitis involving multiple organs . the clinical presentation is highly diverse , and there is considerable risk of mortality if diagnosis and treatment are delayed . we present a case illustrating that patients with wg may initially present with localized cutaneous symptoms and signs .

primary spontaneous pneumothorax psp benign disease usually occurring young patients without known underlying lung disorder the occurrence rate reported 9 individuals per 100 000 year depending individual severity therapeutic options include simple observation needle aspiration tube thoracostomy definite operation surgery indicated video assisted thoracoscopic surgery vats using endoscopic linear cutter resect involved blebs currently popular treatment nevertheless try avoid using endoscopic staple device hospital payment device excluded national health insurance system taiwan thanks increased experience therapeutic thoracoscopy gained recent years used technique thoracoscopic suturing imbricate blebs without resection treat air leakage psp patients report early results from january 2001 april 2002 50 episodes primary spontaneous pneumothorax 49 patients referred operation among 26 patients 26 episodes received transaxillary thoracotomy without assisted thoracoscopy inspection twenty one patients 22 episodes psp received vats wedge closure suturing study dealt solely vats group study patients included 2 female 19 male patients mean age 25 years ranging 16 52 years these 2 female patients much older patients 52 45 years age respectively abnormal pulmonary disease except attack pneumothorax the surgical indications included recurrences 11 episodes 10 patients prolonged air leakage 5 days 4 episodes 4 patients apical blebs seen radiography 2 episodes 2 patients five patients 5 episodes underwent operation owing fear recurrence thus fitting indications the patients kept lateral decubitus position anesthesia administered single lung ventilation the first 10-mm port created 7th intercostal space ics mid axillary line the second 5-mm third 10-mm ports created 5th ics anterior axillary posterior axillary line respectively after full exploration lung surface involved blebs sutured absorbable 3 0 vicryl polyglactin suture ethicon endo surgery inc cincinatti oh the curved needle straightened could put trocar port if bleb found apical scar area sutured way coagulation parietal pleura endo instrument routinely performed patients achieve pleurodesis the mean disease duration attack operation 5 days ranging 1 30 days the mean operation time 133 minutes ranging 80 minutes 270 minutes the mean hospital stay operation 4 days ranging 3 8 days three patients complained prolonged intermittent intercostal neuralgia follow period 1 patient suffered dehiscence chest tube port mean 6-month follow ranging 1 16 months patients recovered well except 2 patients experienced recurrences vats endo suturing leaking area performed apical pleurectomy patient the suture puncture leaking blebs instead normal tissue prior operation condemned no bleb found prior vats relationship attack menstruation no matter surgical approach executed goal treatment find offending bleb remove perform manipulations encourage adhesion formation recently video assisted thoracoscopic surgery vats shown produce results comparable obtained following open thoracotomy yet reduction postoperative pain respiratory dysfunction catabolic response trauma decrease wound related complications we believe psp vats best treatment abdala et al recommend allows us treat ruptured bleb radically avoiding recurrence however treatment choice physicians due high cost equipment stapling devices needed wedge resection involved blebs taiwan due financial policy national health system charge high price endo stapling instruments patient always concerns us yim report finding way replace endo stapling method endo suturing new skill widely applied laparoscopic surgery nevertheless using endosuturing method treat spontaneous pneumothorax reported yim 1995 english literature because incurred blebs always idiopathic patients primary spontaneous pneumothorax think necessary remove furthermore preserved bleb tissues help wound healing prevent air leakage wound shorten duration chest tube insertion therefore length suturing problem 1 case 10-cm suturing line performed without prolonged air leakage without adequate treatment the recurrence rate first pneumothorax side 25% second episode 50% although general agreement exists best time surgical intervention ie first second episode vats therapy accepted definite treatment even first episode study they well informed conventional indication surgery included study ventilation 1 lung mandatory procedure complete lung collapse promotes effect suturing the suture tension becomes tight enough stop air leaks lung fully expands in addition tissue bleb used buttress enforce suturing area the recurrence rate vats operation reported high 13.7% 20% due newly formed blebs bullae unidentified operation recently favorable 2.1% recurrence rate vats reported maier et al use rotating brush supplement cause recurrence thought improper suturing direct puncture blebs operation thus leakage area repaired well reoperation vats the air leak found near previous sutured area adhered intensively parietal pleura step step dissection carefully executed prevent tissue damage second look operation therefore 9.1% 2/22 recurrence rate acceptable compared vats reports the coagulation pleurodesis seems ineffective definite treatment ruptured blebs accurately executed it thought limited pleura applied via 3 small ports vats renders coagulation pleurodesis ineffective the incidence chronic postoperative complaints minimally invasive procedures spontaneous pneumothorax relatively high majority patients two patients complained intermittent anterior chest pain ipsilateral side may due concurrent injury intercostal nerve trocar site the vats wedge closure blebs suturing without resection involved blebs feasible effective alternative treatment primary spontaneous pneumothorax cost endo stapler regarded major problem

background and objectives : if surgery is indicated for primary spontaneous pneumothorax ( psp ) , video - assisted thoracoscopic surgery ( vats ) using an endoscopic linear cutter to resect the involved blebs is the most popular treatment . we tried to determine whether closure of the blebs with sutures without resection is also efficacious enough to treat psp.methods:we prospectively analyzed 22 episodes of psp in 21 patients from january 2001 to april 2002 . we endosutured the blebs , without removing them , no matter what the size and the number of the blebs were . coagulation pleurodesis was added in every case . only 3 ports were needed during the procedure.results:morbidity and cost efficiency were acceptable . two recurrences were experienced . the reasons for the recurrences were poor performance of the endo - suture in 1 patient , and no obvious blebs found in the other.conclusions:we believe that vats wedge closure of blebs by imbricating and buttressing them , without resection , is a feasible and effective alternative treatment for primary spontaneous pneumothorax .

adenoma solitary 8590% patients others multiple adenomas parathyroid hyperplasia accurate preoperative localization essential good surgical outcome inability locate adenoma ectopic gland may delay diagnosis nuclear imaging accurately localizes tumor 90% cases obviating need advanced imaging modalities rarely patients present localization failure posing great challenge treating endocrinologist operating surgeon we report use novel imaging method leading successful outcome patient primary hyperparathyroidism failed first surgery a 54-year old lady presented body pains muscle aches 1-year duration peripheral hospital investigations revealed high serum calcium 11.6 mg dl low phosphorus 2.6 mg dl elevated alkaline phosphatase 677 u l intact parathyroid hormone ipth 116 pg ml normal 10 65 pg ml sestamibi scan revealed right inferior parathyroid adenoma diagnosed case primary hyperparathyroidism she underwent adenomectomy along thyroidectomy showed features hungry bone syndrome postoperatively there confirmation parathyroid adenomectomy using intraoperative pth levels frozen section removed tissue her clinical symptoms persisted surgery histopathological examination specimen removed showed thyroid tissue evidence parathyroid adenoma she reported us 6 months initial surgery persisting complaints body aches myalgia her clinical examination unremarkable normotensive blood pressure well healed scar neck serum biochemistry revealed elevated calcium 10.8 mg dl low phosphorus 2.8 mg dl elevated alkaline phosphatase 280 bone mineral density estimation revealed score -2.2 hip joint z score -2.3 serum 25 hydroxy vitamin level 22 ng l parathyroid hormone elevated ipth-140 pg ml localization sestamibi scan revealed right inferior parathyroid adenoma tracer uptake thyroid bed figure 1 abdominal sonography showed normal renal parenchyma ultrasonography neck plain ct neck show parathyroid adenoma tc 99 sestamibi scan showing right inferior parathyroid adenoma view past history failed surgery tc 99 sestamibi single photon emission computed tomography ct spect done precise localization adenoma prior exploration it revealed ectopic parathyroid adenoma located suprasternally pretracheal region right side figure 2 histopathological examination specimen confirmed parathyroid adenoma last follow 1 year second surgery patient free symptoms normal serum calcium phosphorus alkaline phosphatase values sestamibi emission computed tomography ct showing parathyroid adenoma pretracheal location coronal sagittal views ) the disease detected asymptomatic stage developed countries encounter advanced spectrum disease severe metabolic bone disease precise localization important prevent delay definitive therapy biochemical confirmation diagnosis parathyroid glands derived pharyngeal pouches superior parathyroid glands 4 inferior 3 pouch subsequent caudal migration the modalities available precise localization parathyroid adenoma palpation ultrasonography usg ct mri nuclear scintigraphy combination tests ultrasonography useful wide availability convenience cost guiding tool surgeon surgery however sensitivity specificity usg reported 73% 100% respectively ct mri scans provide excellent spatial resolution often miss small parathyroid adenoma this recommended mostly cases failed surgery recurrent disease planned limited surgical exploration immediate imaging reveals tracer uptake thyroid parathyroid gland along adenoma adenomatous tissue shows retention tracer delayed images spect scan advance radionuclide studies three dimensional 3-d reconstruction increasing sensitivity adenoma localization spect scan 3-d capability combined ct images helpful directing surgeon particularly recurrent residual hyperparathyroidism recent reports suggest spect ct superior spect scan alone localization parathyroid adenoma nodular goiter distorted neck anatomy ectopic parathyroid glands to conclude patient ectopic parathyroid adenoma resulting failed initial surgery use novel imaging modality like spect helped accurate localization adenoma prior repeat surgical exploration

primary hyperparathyroidism often presents with protean manifestations , resulting in delayed diagnosis . at times , aberrant development and migration of the gland leads to ectopic location leading to problems in localization . judicious use of combination methods of localization is recommended in treatment failure or recurrent disease . we report the use of single photon emission computed tomography - ct in precise localization of parathyroid adenoma in a patient with failed initial surgery .

symptomatic disc herniation located thoracic spine relatively uncommon disease estimated annual incidence 1:1000 1:10000003,9,10 hand thought represent 0.25 0.75% symptomatic disc herniations making common enough spine surgeon occasionally face problem2,3 these patients may present subtle complaints localized radiated pain well severe myelopathy motor sensory deficits usually requiring prompt surgical treatment1,6,23 since first description herniated thoracic disc c. a. key 1838 surgical management thoracic disc herniation tdh proven challenge mixter barr famous 1934 report surgery disc herniation four patients tdhs three underwent surgery disastrous results two developed paraplegia postoperatively third died unknown causes10,21 poor results replicated throughout early mid twentieth century soon recognized secondary cord manipulation laminectomy posterior approach17,18 consequently several posterolateral anterior approaches developed avoid cord manipulation lateral extracavitary12 variant costotransversectomy15 transthoracic transpleural16 transpedicular23 video assisted thoracoscopic19 transthoracic retropleural either open20 minimally invasive28 today cord manipulation recognized extremely deleterious kept minimum accordingly neurologic morbidity rates decreased steeply new techniques introduced other complications commonly encountered today resulting transthoracic exposure pleural effusion post thoracotomy pain etc incomplete cord decompression1,3,9,29 given limited visualization anterior dura afforded posterolateral approaches frequently calcified nature tdhs preferred approach midline tdhs anteriorly thoracic cavity either transpleural recently described retropleural3,10,29 we present case application intraoperative ultrasound us enabled us successfully perform transpedicular approach midline calcified tdh discuss potential applications deficiencies a 41-year old woman prior medical history coccidioides meningitis requiring ventriculoperitoneal shunt vps 2010 presented complaint inability walk involuntary movements lower extremities nocturia 4 months exam could stand assistance unable walk 2 3 steps nurick 4 spastic paraparesis mrc 4/5 nurick 4 patellar ankle clonus going toes plantar stimulation noted a diagnosis thoracic myelopathy made computed tomography ct magnetic resonance imaging mri obtained a large calcified midline tdh found t7 8 causing cord deformation signal change fig brain imaging also obtained remained unchanged compared vps three years following endotracheal intubation continuous blood pressure monitoring patient positioned prone open jackson frame care taken times maintain mean blood pressure least 80 mm hg intraoperative somatosensory evoked potential ssep motor evoked potential mep monitoring set the spinous transverse articular processes t6 t8 exposed bovie cautery vertebral levels confirmed anteroposterior fluoroscopy laminectomies t6 t8 performed high speed bur epidural bleeding controlled combination hemostatic agents point ultrasound probe ust-9120 3.75 10 mhz multi frequency convex probe hitachi aloka tokyo japan brought field utilized localize anterior tdh thus confirming t7 8 level fig this probe brought intermittently operative field use surgeon cavity would filled warm saline care maintained times provide minimum working distance 3 cm exposed dura left t7 inferior articular process t8 superior articular process pedicle removed high speed bur thus completely exposing left t8 nerve root t7 8 disc fig ligation t8 nerve root necessary found typical location rostral part foramen the t7 8 disc incised 11 blade expected little material could obtained calcified midline tdh could palpated delimited variety angled curettes instruments we thus proceeded create cavity t8 vertebral body described jefferson utilized combination angled instruments dissect calcified mass anterior dura plane delimited calcified mass pushed anterior crevice removed piecemeal13 alternatively angled instrument also inserted opposite side used push mass towards left could manipulated require additional removal right articular processes beyond standard laminectomy fig 2c the us probe frequently brought field assess cord decompression progress calcified tdh completely resected fig no objective instability observed right t7 8 zygapophysial joint rendered almost intact vertebral body cavity estimated less 10% vertebral body instrumented fusion considered necessary estimated blood loss ebl 150 ml procedure lasted 2 hours ssep mep monitoring remained unchanged patient woke surgery neurological baseline she discharged home postoperative day 3 gait improved steadily first days three months surgery able walk unassisted though gait returned normal nurick 2 a 41-year old woman prior medical history coccidioides meningitis requiring ventriculoperitoneal shunt vps 2010 presented complaint inability walk involuntary movements lower extremities nocturia 4 months exam could stand assistance unable walk 2 3 steps nurick 4 spastic paraparesis mrc 4/5 nurick 4 patellar ankle clonus going toes plantar stimulation noted a diagnosis thoracic myelopathy made computed tomography ct magnetic resonance imaging mri obtained a large calcified midline tdh found t7 8 causing cord deformation signal change fig brain imaging also obtained remained unchanged compared vps three years following endotracheal intubation continuous blood pressure monitoring patient positioned prone open jackson frame care taken times maintain mean blood pressure least 80 mm hg intraoperative somatosensory evoked potential ssep motor evoked potential mep monitoring set the spinous transverse articular processes t6 t8 exposed bovie cautery vertebral levels confirmed anteroposterior fluoroscopy laminectomies t6 t8 performed high speed bur epidural bleeding controlled combination hemostatic agents point ultrasound probe ust-9120 3.75 10 mhz multi frequency convex probe hitachi aloka tokyo japan brought field utilized localize anterior tdh thus confirming t7 8 level fig this probe brought intermittently operative field use surgeon cavity would filled warm saline care maintained times provide minimum working distance 3 cm exposed dura left t7 inferior articular process t8 superior articular process pedicle removed high speed bur thus completely exposing left t8 nerve root t7 8 disc fig ligation t8 nerve root necessary found typical location rostral part foramen the t7 8 disc incised 11 blade expected little material could obtained the calcified midline tdh could palpated delimited variety angled curettes instruments we thus proceeded create cavity t8 vertebral body described jefferson utilized combination angled instruments dissect calcified mass anterior dura plane delimited calcified mass pushed anterior crevice removed piecemeal13 alternatively angled instrument also inserted opposite side used push mass towards left could manipulated require additional removal right articular processes beyond standard laminectomy fig the us probe frequently brought field assess cord decompression progress calcified tdh completely resected fig no objective instability observed right t7 8 zygapophysial joint rendered almost intact vertebral body cavity estimated less 10% vertebral body instrumented fusion considered necessary estimated blood loss ebl 150 ml procedure lasted 2 hours ssep mep monitoring remained unchanged patient woke surgery neurological baseline she discharged home postoperative day 3 gait improved steadily first days three months surgery able walk unassisted though gait returned normal nurick 2 surgical approaches tdh evolved dramatically since first surgical report adson 19224,13 while laminectomy alone abandoned due dismal neurological outcomes time honored open transthoracic transpleural approach still poses considerable challenges access surgeon double lumen endotracheal intubation ipsilateral lung deflation chest tube typically required recent series open transthoracic cases ayhan et al report good neurological outcomes 90% improved stabilized myelopathy reported figures concerning approach may applicable sickest patients 605 ml mean ebl four days chest drainage seven days hospital stay average3 vats described mack et al tdhs though less invasive open alternative still requires access surgeon lung deflation chest tube additional training utilizing 2d optics required3,19 the latest development anterior approaches tdh minimally invasive mis lateral approach tubular channel these may performed retro- transpleural described without assistance access surgeon double lumen intubation lung deflation7,28,29 a chest tube may may required depending surgeon preference neurological outcomes good ebl better equivalent vats3,28,29 long working distances also pose less challenge today since special retractors made available though may still concern surgeons unfamiliar tubular techniques reported patient working distances would order 140 mm regardless type anterior approach risk injury chest wall vessels exists instances episodes inferred major report quoted maximum ebl series ranged 1500 3000 ml1,3,29 posterolateral approaches tdhs developed 1960s applications greatly expanded they preferable feasible anterior approaches reported minimally invasive variation well5,8,10,14 however visualization anterior dura limited posterolateral approaches created set complications especially inadequate anterior decompression spinal cord9 posterolateral approaches therefore typically reserved soft tdhs located midline8,9,10 order circumvent visualization problem applied ultrasound guidance transpedicular approach previously described patterson arbit23 intraoperative us guidance spine surgery first reported 1978 reid intrinsic cord lesions since applied anterior posterior approaches degenerative disease across vertebral segments11,22,24,25 it inexpensive accurate method supply surgical team real time imaging without use ionizing radiation compared intraoperative ct minimal training equipment is required probe utilization intuitive surgeon familiar spine anatomy27 us guidance applied tdh stone et al localize intradural disc herniation different posterolateral approach26 this however first time applied transpedicular approach assess cord decompression midline calcified tdh applicable open posterolateral approach considered important surgical adjunct surgical management midline calcified tdh daunting task even experienced surgeons posterolateral approaches especially transpedicular approaches become procedure choice midline tdhs the utilization intraoperative us expands application encompass midline calcified tdhs enabling surgeon avoid cord manipulation it still unclear us technique could applied every midline tdh particularly suspected intradural component continued utilization answer question this viable alternative midline tdhs especially surgeons unfamiliar tubular techniques patients risk potential complications anterior approach intraoperative ultrasound simple yet valuable tool provide real time visualization dura disc interface objective assessment spinal cord decompression disc removal transpedicular thoracic discectomy direct visualization limited spine surgeons take valuable tool consideration choosing surgical approaches thoracic disc herniations real time visualization provided intraoperative us increases safety profile posterior approaches may make thoracotomy unnecessary selected group patients especially patient existing pulmonary disease otherwise medically fit transthoracic approach

objectivesymptomatic thoracic disc herniation often requires prompt surgical treatment to prevent neurological deterioration and permanent deficits . anterior approaches offer direct visualization and access to the herniated disc and anterior dura but require access surgeons and are often associated with considerable postoperative pain and pulmonary complications . a disadvantage with using posterior approaches in the setting of central calcified thoracic disc herniation however , has been the limited visualization of anterior dura and difficulty to accurately assess the extent of decompression.methodswe report our experience with intraoperative ultrasound ( us ) guidance during a modified posterior transpedicular approach for removal of a central calcified thoracic disc herniation with a review of pertinent literature.resultsthe herniated thoracic disc was successfully removed with posterior approach with the aid of intraoperative us . the patient had significant neurological improvement at three months follow-up.conclusionintraoperative ultrasound is a simple yet valuable tool for real - time imaging during transpedicular thoracic discectomy . visualization provided by intraoperative us increases the safety profile of posterior approaches and may make thoracotomy unnecessary in a selected group of patients , especially when a patient has existing pulmonary disease or is otherwise not medically fit for the transthoracic approach .

acute hemorrhagic leukoencephalitis ahle rare fatal disease presenting acute onset neurological abnormalities it categorized group diseases called acute disseminated encephalomyelitis adem disease an acute rapidly progressive hemorrhage white matter leads fulminant clinical course the first presentations fever rapid deterioration consciousness may finally lead death within days acute onset rapidly progressive neurological disorder asymmetric involvement brain polymorphonuclear predominant peripheral leukocytosis cerebrospinal fluid csf pleocytosis specific findings serial computed tomography scans magnetic resonance imaging mri main criteria diagnosis the areas involved majority cases parietal lobes lesions seen subcortical white matter mid brain pons corpus callosum basal ganglia medulla cerebellum even spinal cord the imaging techniques may also complicate diagnosis computed tomography mri might show nonspecific findings hematoma basal ganglia ventricles in addition symmetrical low density areas bilateral white matter might result false preliminary diagnosis hemorrhagic cerebrovascular disease case report present case ahle children a 13-year old girl loss consciousness right sided parotiditis referred center imam reza hospital mashhad university medical sciences hospital herat northern afghanistan she admitted center 4 days previously fever loss consciousness according girl mother the right side face swollen evening first admission the loss consciousness begun drowsiness progressed unresponsiveness verbal stimuli poor response painful stimuli midnight eventually patient become completely unresponsive stimuli hospital herat initiation supportive measures performance lumbar puncture intravenous ceftriaxone vancomycin acyclovir 30 mg kg commenced patient after admitted center informed consent obtained parents her consciousness deteriorated even became completely unresponsive verbal stimuli within 2 days developed respiratory failure decerebrated posture subsequently spasticity four limbs rigidity left leg her initial mri revealed multifocal hemorrhages without edema right temporal white matter figure 1 complete blood count lumbar puncture performed hospital afghanistan csf showed elevated white blood cell count 3 4 cells mm increased protein level 69 mg dl the culture csf regarding bacterial viral infections negative although limitations serological tests including deficit technical instrumentations hospital the result immunological microbiological studies comprising hepatitis b surface antigen anti hepatitis virus hepatitis b virus polymerase chain reaction herpes simplex virus negative the laboratory tests mycoplasma tuberculosis well csf culture also negative coagulation tests bleeding time prothrombin time partial thromboplastin time platelet count normal no abnormality found electrolyte analysis biochemical studies blood sugar liver function tests a second mri 20 days later showed multiple hemorrhagic lesions pons thalamus sides figure 2 our diagnosis according clinical radiological laboratory findings pathological examinations confirm there multiple hemorrhagic lesions pons thalamus sides diagnosis ahle our patient treated methylprednisolone 20 mg kg pulse therapy intravenous immunoglobulin ivig acyclovir 30 mg kg plasmapheresis 3-hour sessions 3 times after 29 days stay pediatric intensive care unit supervision pediatric toxicologists neurologists extubated attained remarkable healing her mri demonstrated improvement figure 3 one year follow treatment completely successful neurological examinations comprised mental status motor skills sensory skills balance coordination reflexes functioning nerves normal ahle rare demyelinating disease characterized acute rapidly progressive fulminant inflammation white matter it severe form adem characterized fulminant clinical course it usually preceded infectious illness measles mumps rubella respiratory infections nevertheless virus infectious agent isolated csf brain case adem considering clinical imaging findings differential diagnosis disease hemorrhagic cerebrovascular disease infectious encephalitis meningitis vasculitis fulminant multiple sclerosis causes adem venous sinus thrombosis most patients experience viral bacterial parasitical infection usually fever time admission however infectious encephalitis meningitis similar ahle usually preceded infectious disease measles mumps respiratory tract infections our patient parotiditis admission favor viral infection in two different reports befort francisci presented cases ahle epstein barr virus infection adults nonetheless observed patient besides differences clinical presentations course disease vasculitis usually manifests mri smaller multiple lesions cortex white matter moreover serological tests collagen diseases used diagnosis vasculitides negative patient fever leukocytosis csf features seen patient compatible diagnosis acute fulminant multiple sclerosis the absence oligoclonal bands another characteristic exclusion acute fulminant multiple sclerosis it difficult distinguish causes adem ahle based clinical mri findings diagnosis basically made via biopsy however certain epidemiological clinical laboratory pathological distinctions instance adem mainly disease children whereas ahle common young adults in addition ahle presents acutely larger edematous lesions features hemorrhage patient several findings including acute fulminant course disease history parotiditis csf profiles indicative immunological bacteriological tests mri results strongly supported diagnosis ahle previous studies shown treatment iv methylprednisolone ivig acyclovir plasmapheresis helpful life saving following protocol patient recovered extubated still evidence ahle might biphasic presentation patient followed longer time period several mris ahle rare severe demyelinating disease mortality morbidity lessened early detection treatment steroid therapy ivig acyclovir plasmapheresis

acute hemorrhagic leukoencephalitis ( ahle ) is a rare demyelinating disease characterized by an acute rapidly progressive fulminant inflammation of the white matter . in this case report , we introduce a case of ahle in children with an interesting and lengthy process and successful treatment.a previously healthy 13-year - old girl was admitted to the hospital because of fever and loss of consciousness . after 4 days , she was referred to our pediatric intensive care unit in mashhad , iran . on admission , she had right - sided parotiditis . with a diagnosis of ahle , our patient was treated with methylprednisolone , intravenous immunoglobulin , acyclovir , and plasmapheresis.ahle is a rare and severe demyelinating disease , the mortality and morbidity of which can be decreased by early detection and treatment with steroid therapy , intravenous immunoglobulin , acyclovir , and plasmapheresis .

prostate cancer common malignant disease men western countries 1 its incidence continuously increasing korea age standardized incidence rates per 100,000 men 4.6 cases 8th highest cause among organ specific malignant tumors 2007 2 many pre treatment prognostic factors proposed used determine one treatment modalities gleason system proved one important prognostic factors histological variation within tumor brought two grades predominant primary grade less extensive secondary grade 3 biopsy derived gleason score bgs used one important pretreatment prognostic factors 4 5 though overall accuracy gleason grade needle biopsies found good predicting prostatectomy specimen grade upgrading downgrading large difference 2 points biopsy derived post prostatectomy gleason scores pgs may confuse clinicians consulting patients at 14 medical centers korea medical records 1,582 men underwent radical prostatectomy prostate cancer 1995 2007 reviewed retrospectively prostate biopsy recommended patients abnormal finding digital rectal examination whose serum prostate specific antigen psa level 3.0 4.0 ng ml according policy prostate biopsy medical center all pathologic slides 18-gauge needle biopsy surgical prostate specimen involved medical centers reevaluated single expert uropathologist according 2005 international society urological pathology isup consensus gleason grading prostatic carcinoma 8) bgs defined summation primary gs highest grade gs biopsy cores pgs defined summation primary secondary gs prostate specimen tumor volume measured whole mount section resected prostate pathologist the patients took neoadjuvant therapy including androgen deprivation radiation therapy patients whose pathological slides showed poor quality reevaluate excluded biochemical failure defined serum psa elevation 0.2 ng ml nadir radical prostatectomy time biochemical failure measured time interval radical prostatectomy biochemical failure needle biopsy specimen taken 6 10.9% 8 8.4% 10 14.8% 12 cores 65.8% additional cores suspicious nodules clinical stage classified ct1 ct2 ct3 based digital rectal examination mri findings operation procedure included 1,036 radical retropubic prostatectomies 71.6% 220 radical perineal prostatectomies 15.2% 125 laparoscopic radical prostatectomies 8.6% 65 robot assisted radical prostatectomies 4.5% mean age 64.9 38 85 yr old preoperative spsa 11.8 ng ml distribution bgs 46.7% 39.5% 13.8% gs 6 7 8 respectively table 1 according difference bgs pgs patients divided three groups group decreased pgs 2 group b control group changed pgs within 1 point group c increased pgs 2 we evaluated various clinicopathological factors prostate cancer including age preoperative spsa number biopsy cores highest cancer biopsy cores clinical pathological stage volume distribution cancer cells surgical specimen surgical margin status univariately multivariately anova chi square test used analysis variables three groups scheffe method dunnett c method used post hoc test identifying groups made difference kaplan meier method log rank test cox regression hazard model this study reviewed approved institutional review board samsung medical center this study reviewed approved institutional review board samsung medical center each group included 30 2.1% 1,361 94.1% 55 3.8% patients group included bgs 7 9 10 26.7% 70.0% 3.3% respectively group c bgs 4 5 6 7 8 5.5% 7.3% 21.8% 63.6% 1.8% table 1 comparison clinicopathological factors three groups number biopsy cores maximal cancer positive cores clinical pathological stage cancer volume surgical margin status significantly different table 2 group a c maximal tumor biopsy cores p 0.001 p 0.032 respectively margin positivity p 0.025 p 0.002 respectively higher control group b pathological stage also worse group c control group b p 0.006 p 0.001 respectively group c the number biopsy core significantly lower tumor volume pathology specimen significantly higher tumor widely distributed prostate specimen control group b p 0.001 different aspects group table 3 of patients group 73.3% diagnosed prostate cancer bgs 9 10 pgs fell pgs 7 8 though pgs 8 patients 26.7% diagnosed bgs 7 decreased 5 pathological stage 7 pt2c higher hazard ratio hr biochemical failure significantly higher groups group hr 2.385 95% ci 1.222 4.656 p 0.011 group c hr 1.750 95% ci 1.147 2.672 p 0.009 fig the median time biochemical failure group c 46.0 62.6 months respectively control group reach median value within follow period in multivariate analysis however difference bgs pgs independent prognostic factor biochemical recurrence well known prognostic factors prostate cancer pgs p 0.045 pt stage p < 0.001 surgical margin p 0.004 significant multivariate analysis table 4 it noted 20%-40% discrepancy bgs pgs pathology prostate cancer 6 7 9 interestingly univariate analysis result current study demonstrated patients large difference gs pre- post prostatectomy showed worse clinicopathological findings worse prognosis biochemical failure control group irrespective increase decrease pgs compared bgs similar study in patients classified three groups namely upgraded downgraded unchanged proposed gs upgrading associated adverse pathological outcome compared downgraded unchanged groups included higher rates extraprostatic extension lymph node metastasis positive surgical margins seminal vesicle invasion 7 patients showed two points some diagnosed pgs 5 however pathological stage pt2c higher one reasons discrepancy bgs pgs may sampling error biopsy heterogenic multicentric prostate cancer 10 prostate cancer showed uniform pattern histology reported 12%-33% several studies 11 needle biopsy specimen could obtained mainly high grade tertiary component would ignored prostatectomy specimen if biopsy specimen contained small amount high grade prostate cancer pathologists would tend diagnose needle biopsy specimen aggressive cancer study analyzing 101 completely sectioned whole mounted radical prostatectomy samples average number different grades 2.7 range 1 5 12 extended study 155 tumors 61 whole mounted radical prostatectomy samples 15% tumors included three histological grades 13 a recent meta analysis revealed presence tertiary grade correlated pathological stage psa recurrence clinical progression 14 in several studies samples characterized pathological variables poor outcome extraprostatic extension positive surgical margins contained high grade tertiary component consistently higher frequency 15 16 therefore bgs patients group rather pgs may reflect prognosis considered one important prognostic factors together pathological stage the patients showed two points increase pgs bgs also demonstrated aggressive tumor burden poor prognosis biochemical failure patients a recent study 301 patients low risk prostate cancer clinical stage t1c t2a psa 10 ng ml bgs 6 underwent extended 10-core prostate needle biopsy men assessed 10 12 cores rate gs upgrading 47.9% significantly higher 23.5% 18 cores 17 another study authors proposed prostate size number sampling associated gleason upgrading 18 the mean prostate volume patients group c smaller control group on hand tumor volume whole mount prostate bigger thus insufficient number prostate sampling especially small prostate containing aggressive cancer might cause gleason upgrading however multivariate analysis showed clinical significance difference bgs pgs well known prognostic factors prostate cancer spsa bgs pgs pt stage surgical margin clinical settings even clinicians patients would confused somewhat large discrepancy bgs pgs ignored compared well known prognostic clinicopathological factors however clinicians better kept mind many patients showed large discrepancy bgs pgs might unfavorable clinicopathological factors prostate cancer bias related interobserver variation pathologic result gleason score gleason sum would one major limitation kind study a considerable interobserver variation gleason scores prostate cancer referred several studies reported 19 20 in addition review tertiary component prostate cancer specimen group survival analysis included due short follow period practically large gleason score gap 2 points bgs pgs rarely occurs current study the total number reviewed patients 1,582 however number focused patients small addressed another limit point summary clinical significance large difference 2 points biopsy post prostatectomy pathological gleason scores patients prostate cancer changhee yoo cheol young oh jin seon cho cheryn song seong il seo hanjong ahn tae kon hwang jun cheon kang hyun lee tae gyun kwon tae young jung moon kee chung sang eun lee hyun moo lee eun sik lee young deuk choi byung ha chung hyung jin kim wun jae kim seok soo byun han yong choi large difference 2 points biopsy derived bgs post prostatectomy gleason scores pgs may confuse clinicians consulting patients prostate cancer present study compared prognosis patients difference pgs bgs pgs changed bgs 2 points patients showed poor prognosis strikingly even decreased group pgs bgs showed poor prognosis however large difference bgs pgs independent prognostic factor one cautious interpretation scoring values

we investigated the clinical significance of large difference ( 2 points ) between biopsy - derived ( bgs ) and post - prostatectomy gleason scores ( pgs ) . at 14 medical centers in korea , 1,582 men who underwent radical prostatectomy for prostate cancer were included . according to the difference between bgs and pgs , the patients were divided into three groups : a ( decreased in pgs 2 , n = 30 ) , b ( changed in pgs 1 , n = 1,361 ; control group ) , and c ( increased in pgs 2 , n = 55 ) . we evaluated various clinicopathological factors of prostate cancer and hazards for biochemical failure . group a showed significantly higher mean maximal percentage of cancer in the positive cores ( max% ) and pathological t stage than control . in group c , the number of biopsy core was significantly smaller , however , tumor volume and max% were significantly higher and more positive biopsy cores were presented than control . worse pathological stage and more margin - positive were observed in group a and c than in control . hazard ratio for biochemical failure was also higher in group a and c ( p = 0.001 ) . however , the groups were not independent factors in multivariate analysis . in conclusion , large difference between bgs and pgs shows poor prognosis even in the decreased group . however it is not an independent prognostic factor for biochemical failure .

microbiological confirmation bacterial infection rarely achieved children acute lower respiratory tract infections alrtis inability obtain material infection site ie lung treatment therefore mostly empirical irrevocably leads overtreatment sometimes undertreatment sputum induction nebulized hypertonic saline help adequately produce sputum children otherwise unable sputum induction routinely used obtain samples microbial cultures pediatric illnesses cystic fibrosis tuberculosis it may also useful establishing causative diagnosis alrti otherwise healthy children the purpose study determine effectiveness sputum induction obtaining good quality sputum children clinically suspected alrti everyday busy general hospital setting a prospective study 2 large regional hospitals jeroen bosch hospital mxima medical centre netherlands conducted october 2009 october 2011 children aged 6 months 18 years presenting suspected alrti eligible inclusion suspected alrti clinical diagnosis attending physician tachypnea 1 following symptoms dyspnea fever cough and/or abdominal pain exclusion criteria participation recent severe asthma exacerbation oxygen saturation 92% anatomical airway abnormalities use -blockers diuretics blood inflammation parameters ie leukocyte count c reactive protein crp level blood culture chest x ray performed initiation study procedure part routine diagnostics sputum induction performed hypertonic saline nacl 5.8% inhalation using nebulizing device oxygen flow when patient unable expectorate sputum induction sterile suction catheter used obtain secretions oropharynx specimens considered good quality 25 squamous epithelial cells 25 leukocytes present per low power field 10x lens objective sputum samples cultured 48 hours using routine microbiological procedures concomitant nasopharyngeal lavage sample also obtained used routine bacterial culture also infection influenza influenza b respiratory syncytial virus rsv human metapneumovirus hmpv ) was routinely investigated polymerase chain reaction nasopharyngeal specimens considered necessary treating physician taking account anticipated seasonal circulation continuous data first analyzed normality using stem leaf plots quantile quantile plots either test mann whitney u test nonparametric data performed assess agreement sputum nasopharyngeal bacterial cultures simple coefficient calculated spss version 22.0 ibm corp armonk ny used statistical analyses a prospective study 2 large regional hospitals jeroen bosch hospital mxima medical centre netherlands conducted october 2009 october 2011 children aged 6 months 18 years presenting suspected alrti eligible inclusion suspected alrti clinical diagnosis attending physician tachypnea 1 following symptoms dyspnea fever cough and/or abdominal pain exclusion criteria participation recent severe asthma exacerbation oxygen saturation 92% anatomical airway abnormalities use -blockers diuretics blood inflammation parameters ie leukocyte count c reactive protein crp level blood culture chest x ray performed initiation study procedure part routine diagnostics sputum induction performed hypertonic saline nacl 5.8% inhalation using nebulizing device oxygen flow when patient unable expectorate sputum induction sterile suction catheter used obtain secretions oropharynx specimens considered good quality 25 squamous epithelial cells 25 leukocytes present per low power field 10x lens objective sputum samples cultured 48 hours using routine microbiological procedures concomitant nasopharyngeal lavage sample also obtained used routine bacterial culture also infection influenza influenza b respiratory syncytial virus rsv human metapneumovirus hmpv ) was routinely investigated polymerase chain reaction nasopharyngeal specimens considered necessary treating physician taking account anticipated seasonal circulation continuous data first analyzed normality using stem leaf plots quantile quantile plots either test mann whitney u test nonparametric data performed assess agreement sputum nasopharyngeal bacterial cultures simple coefficient calculated spss version 22.0 ibm corp armonk ny used statistical analyses informed consent obtained 126 patients suspected alrti 28 patients 22% complete study procedure excluded analysis microbiological sputum data figure 1 3 patients the final study group consisted 98 patients median age 2.6 years range 0.5 16.8 years study drop groups significantly different terms age p .694 sex p .365 leukocyte count p .725 crp level p .444 radiological diagnosis p .289 flow diagram study group sputum samples 89/98 91% patients only 4 patients unable produce sputum completing induction procedure 5 samples poor quality therefore processed figure 1 mild adverse reactions reported 6 patients cough n 3 vomiting n 1 wheezing n 1 transiently decreased oxygen saturation n 1 mild epistaxis n 1 no treatment needed adverse reactions serious adverse events reported bacterial pathogens isolated 22/89 sputum cultures 25% 13 samples grew 1 pathogen haemophillus influenzae n 8) streptococcus pneumoniae ( n 1 staphylococcus aureus n 2 moraxella catarrhalis n 1 sphingomonas paucimobilis n 1 9 samples 2 bacterial pathogens isolated h influenzae catarrhalis n 3 h influenzae streptococcus pneumoniae n 5 streptococcus pyogenes pseudomonas aeruginosa n 1 the detection bacteria sputum samples similar patients without radiologically confirmed pneumonia 24% vs 27% p .483 comparing detection bacteria sputum cultures concomitant nasopharyngeal bacterial cultures n 76 different pathogens frequently found 15 sputum samples a bacterial pathogen also found concomitant nasopharyngeal culture 19 nasopharyngeal cultures yielded bacterial pathogens found concomitant sputum cultures 6 sputum samples bacterial pathogen detected sputum concomitant nasopharyngeal aspirate moraxella catarrhalis n 3 haemophilus influenzae n 4 sphingomonas paucimobilis n 1 significant associations sputum nasopharyngeal bacterial yield found exception haemophilus influenzae 0.538 viral co)infections rsv hmpv influenza influenza b found 35/75 47% nasopharyngeal specimens the viral presence differ bacterial sputum culture positive negative groups p .484 children without radiologically confirmed pneumonia p .87 this study shows good quality sputum samples could obtained induced sputum collection procedure everyday busy general hospital setting 91% children clinically suspected alrti our success rate significantly higher previously reported using similar definitions sputum quality bacterial pathogens found 25% induced sputum samples unexpectedly haemophilus influenzae streptococcus pneumoniae moraxella catarrhalis found frequently 29% positive sputum cultures the bacterial pathogen found sputum concomitant nasopharyngeal aspirate culture suggesting origin lower respiratory tract these findings support hypothesis sputum induction useful support etiological diagnoses every day practice yield significantly higher compared blood culture acute phase serology the relatively low percentage bacterial pathogens detected induced sputum samples probably result fact many alrtis fact viral infections common young children induced sputum identifies bacterial pathogens also help exclude bacterial infections thus reduce overtreatment antibiotics when comparing results similar study performed mermond et al difference bacterial sputum yield 25% vs 50% however good quality sputum yield significantly lower 91% vs 25% attributed authors methodological problems another study lahti et al found evidence bacterial infection induced sputum 79% cases included patients radiologically confirmed pneumonia cohort found difference presence common viral and/or bacterial pathogens radiological diagnosis use radiology diagnosis alrtis major point discussion study inclusion based clinical suspicion alrti probably gives realistic reflection everyday practice even though found significant difference baseline characteristics groups the drop percentage inclusion 22% limitation study similar study lahti et al study currently seen justification sputum induction alrtis another limitation study rule possibility occasionally induced sputum reflect etiology alrti compare induced sputum cultures material retrieved directly lungs bronchoalveolar lavage thoracocentesis would obviously unethical perform non critically ill children the majority bacteria found sputum cultures also present concomitant nasopharyngeal cultures this could either mean sputum sample contaminated passing upper respiratory tract expectoration invasive infection colonizing bacterial pathogen taken place known phenomenon respiratory tract infections it likely many bacteria cultured induced sputum acute respiratory tract infection play causative role conclusion found sputum induction children suspected alrtis general hospital setting provides good quality sputum cases infrequent mild adverse events it useful tool general pediatrician promote pathogen based treatment alrtis everyday clinical practice iyb contributed conception design contributed acquisition analysis interpretation data drafted manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy mm contributed acquisition interpretation data critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy rvg contributed acquisition data critically revised analysis first drafts manuscript could give final approval deceased mhvl contributed acquisition interpretation data critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy mh contributed analysis data critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy aw contributed conception design contributed interpretation critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy pcw contributed conception design contributed interpretation critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy edv contributed conception design contributed acquisition analysis interpretation data codrafted manuscript critically revised manuscript gave final approval agrees accountable aspects work ensuring integrity accuracy

we prospectively studied the feasibility and effectiveness of sputum induction in obtaining good quality sputum and its subsequent bacterial yield in children with clinically suspected acute lower - respiratory - tract infection ( alrti ) . good quality sputum was collected in 89/98 ( 91% ) patients . sputum cultures revealed 1 bacterial pathogens in 22 cases ( 25% ) . adverse events were infrequent and mild ( 6% ) . sputum induction is feasible in young children and leads to an increased number of etiological diagnoses of alrti .

blood pressure levels elderly scattered younger elderly middle aged persons initial blood pressure increase occurred seventh decade sexes furthermore levels blood pressure elderly paradoxical inverse relationship morbidity mortality the described covariates consequences blood pressure decline shorter survival 46 cognitive decline 7 8 dementia 912 heart studies showed demented patients lower blood pressure thinner left ventricle posterior wall cognitive impairment also common subjects heart failure combined hypotension 14 15 studies describing ambulatory blood pressure abpm mainly focused younger elderly middle aged persons mainly essential hypertension seldom comprising population based samples 1620 frequency sustained white coat reverse hypertension elderly also unknown study centers a profile abpm younger elderly middle aged persons used predictor vascular events later life elderly level abpm should regarded predictor target organ damage also mirror general vascular status the aim study assess profile abpm cohort octogenarian men longitudinally followed since random inclusion population city malm sweden contrary previous studies assessed impact vascular life style risk factors observed age 68 time progress atherosclerotic disease abpm profile subjects reached age 82 years it includes men born even months 1914 city malm sweden a total 809 men invited participate study 703 men took part first health examination 68 years old 465 men cohort additional 95 new residents invited attend new examination the recent followup cohort started subjects reached 81 82 years age 281 men found still alive of 185 agreed take part 66% new investigation including physical psychological examinations blood pressure data psychological data available 171 ages 68 81 following year study subjects spouses answered questionnaire focusing life style factors prescribed medicines previous diseases all underwent medical examination including hachinski ischemic score evaluate role established vascular risk factors measured levels blood glucose cholesterol triglycerides fasting conditions body mass index bmi age 68 at recent followup age 81 medical examination repeated 185 men answered questionnaire focusing lifestyle health markers possible dementia classified according dsm iv criteria one subject diagnosed demented two established markers vascular disease examined carotid stenosis determined using carotid ultrasound age 81 low peripheral circulation lower extremities estimated using ankle brachial pressure index abi ages 68 81 the clinic blood pressure cbp measured sphygmomanometrically upper right arm supine position 15 min rest age 68 age 81 using calibrated mercury manometer rubber cuffs 12 35 cm normal 15 cm obese subjects hypertension defined systolic diastolic brachial bp 160 mmhg 90 mmhg respectively medication hypertension these hypertension criteria used previously valid world health organization drew new ones 1999 all subjects monitored treated lifetime according hypertension criteria thus used statistical analysis study ambulatory blood pressure monitoring performed using micro recorder model ki5600 kontron instruments readings 20-minute intervals day 06.20 09.40 pm 60 min intervals night 10.00 pm 06.00 performed the ambulatory bp measurement performed auscultatory method case measurement failure examination immediately repeated using oscillometric method accuracy ki5600 confirmed simultaneous measurement standard mercury sphygmomanometer accepted within 10 mmhg standard method exclusion patients made according quality criteria deficit measurement time intervals least 6 h accumulated daytime 3 h accumulated nighttime 3 h consecutively daytime least 2 h consecutively nighttime for individual data relative nocturnal bp fall calculated using formula daytime bp nighttime bp 100/daytime bp expressed preawakening sbp defined mean measurements 04.00 05.00 06.00 postawakening sbp mean measurements 06.20 06.40 07.00 07.20 07.40 08.00 morning sbp surge defined difference postawakening sbp mean sbp nighttime ankle blood pressure estimated ages 68 81 years placing cuff ankle level using doppler signal tibial posterior artery dorsal foot artery detect peripheral blood flow supine position arithmetic average duplicate recordings used leg ankle brachial pressure index abi calculated dividing ankle systolic pressure highest upper arm systolic pressure value the examination carotid arteries made age 81 using computed sonography system acuson xp 10 acuson mountain view calif usa 7 mhz b mode real time linear scanner including 5 mhz pulsed color coded doppler the color coded doppler used localize areas high flow velocities internal carotid artery maximum flow velocity measured pulsed doppler differences vascular risk factors markers calculated mann whitney rank sum test local ethical committee lund university accepted study informed consent obtained participants values abpm daytime nighttime sbp dbp systolic diastolic variability mean sd sbp sd dbp nocturnal sbp fall morning sbp surge preawakening sbp postawakening sbp presented table 1 levels clinic blood pressure p cholesterol triglycerides b glucose well markers vascular disease carotid stenosis ankle brachial index time change follow also presented compared sample 70-year old population uppsala sweden subjects study lower mean daytime sbp 9 mmhg mean dbp pp 5 mmhg variability standard deviation nighttime data cohort uppsala cohort were similar concerning sbp dbp pp compared sample age 73 6 population madrid spain daytime mean values sbp dbp pp sd similar 1 2 mmhg differences the observed compared nighttime values except nighttime pp lower 5 mmhg study compared 15-year younger japanese population based sample ohasama study mean age 66.7 subjects study similar daytime sbp dbp higher nighttime sbp mean 5 mmhg compared italian pamela population study mean age 69.0 2.3 subjects study similar daytime values higher nighttime sbp 6 mmhg dbp 25 26 compared oldest sample population based study dublin ireland age 5079 subjects study lower daytime sbp 2 mmhg daytime dbp 4 mmhg higher nighttime sbp 7 mmhg equal mean nighttime dbp daytime values irish study similar study sample age 4049 y. compared uruguayan population sample men untreated hypertension age 70 subjects study lower mean daytime sbp 3 mmhg dbp 5 mmhg mean nighttime sbp 3 mmhg similar nighttime dbp compared younger elderly 5059 6069 subjects study similar daytime nighttime sbp lower daytime dbp 7 mmhg nighttime dbp 3 mmhg population study denmark compared subgroup age 7079 subjects study lower daytime sbp mean 7 mmhg daytime dbp 3 mmhg higher nighttime sbp 3 mmhg lower dbp 2 mmhg compared subgroup age 6069 subjects study lower daytime sbp mean 12 mmhg daytime dbp 10 mmhg nighttime sbp lower dbp 3 mmhg compared subgroup age 5059 subjects study lower daytime sbp mean 3 mmhg daytime dbp 5 mmhg higher nighttime sbp 6 mmhg lower dbp 2 mmhg small samples danish study presented high standard deviation bp value hypertension diagnosed treated first followup age 68 tested possible predictor abpm 14 years later table 2 right columns the values abpm differ subjects hyper- normotensive age 68 hypertension defined criteria age 81 table 2 left columns values abpm examined year differed groups presented hypertensive subjects higher daytime sbp pp higher nocturnal sbp pp higher pre- postawakening sbp but we previously shown blood pressure dynamics differed study subjects followup those presented higher clinic bp levels age 68 prone declining sbp age 81 study time course sbp correlated positively mean sbp daytime nighttime pre- postawakening sbp levels figure 2 highest daytime sbp variability observed subjects increasing office sbp estimate impact vascular risk factors age 68 future abpm levels calculated correlation office bp levels p cholesterol triglycerides glucose age 68 abpm levels 14 years later table 3 without recording significant values however bmi levels age 68 correlated negatively daytime dbp variability sd dbp in addition abi levels age 68 correlated negatively future sbp variability pulse pressure daytime presenting lowest abi levels subjects highest daytime sbp variability pulse pressure abpm values splitted according smoking profile age 68 table 4 those subjects still current smokers age 68 higher systolic diastolic pressure variability sd sbp sd dbp daytime nighttime the absolute values sbp dbp differ groups neither daytime nighttime age 82 cbp correlated positively daytime sbp sd sbp dbp pp nighttime sbp dbp pp well pre- postawakening sbp table 5 clinic dbp expressed better daytime sbp dbp levels clinic sbp carotid stenosis correlated positively nocturnal preawakening sbp daytime pp daytime sbp dbp values ankle brachial index lowest subjects higher nocturnal sbp pp sbp variability preawakening sbp the time course abi age 68 82 showed largest abi decline reflected higher daytime nighttime systolic variability sd sbp higher pp well higher pre- postawakening sbp levels daytime nighttime sbp dbp levels age 82 this study provides longitudinal observation data population based sample elderly men ages 68 82 years the baseline data abpm performed study subjects age 82 discussed light population based samples the majority previously published studies abpm included either preselected hypertensive elderly patients examined younger elderly populations compared latter studies performed cohorts aged 7079 octogenarians study generally lower daytime levels sbp dbp cases even lower nighttime sbp dbp levels in danish study similar profile increasing abpm values younger samples age 70 observed decreasing abpm subgroup age 80 this age related threshold abpm values could supported observation higher level office bp suffering hypertension age 68 predict higher abpm neither daytime nighttime age 82 instead longitudinal change clinic bp 13 years correlated abpm values analyzing abpm values hypertensive normotensive subjects age 82 could conclude low values abpm whole cohort partly due low abpm values men hypertensive age 68 time developed decline clinic bp 80-ties side higher values abpm were observed subjects highly hypertensive 68 developed hypertension last decade largest increase vascular burden time these observations could confirmed data showing established laboratory risk factors age 68 predict future levels ambulatory blood pressure however lower ankle brachial index particularly current smoking age 68 predicted larger bp variability daytime nighttime yet measured age 81 clinic bp diagnosed hypertensive age 81 could strongly reflected higher values abpm especially diurnal pulse pressure pp abpm could also adequately express grade atherosclerotic process age 82 higher nighttime preawakening bp levels higher nighttime bp variability pp values men higher grade carotid stenosis lower abi extended abi decline 14-year followup possible explanation lower abpm values elderly compared younger population samples could selective mortality subjects cohort died age 68 first followup due early hypertension metabolic syndrome intensive smoking advanced atherosclerosis another explanation could fact survivors included sample less exposed vascular risk factors declined take part last followup died prior however whole examined sample sbp decreased mean 7 mmhg dbp 9 mmhg points fact selective mortality explanatory factor also part cohort expresses bp decline last 14 observation years results lower abpm levels compared younger population cigarette smoking strongest risk factor age 68 predict absolute values bp octogenarians increasing sbp dbp variability sd ca 20% daytime nighttime similarly lower abi level age 68 predicted higher daytime sbp variability pp absolute abpm values age 81 subjects defined hypertensive expressed higher nighttime daytime sbp post- preawakening sbp higher pp the values clinic bp age 81 correlated values abpm mainly clinic dbp high values reflected higher daytime nighttime sbp dbp sd sbp pre- postawakening sbp well daytime pp it suggests elderly men clinic dbp seems express overall 24-h bp profile adequate way clinic sbp diurnal pp used important complement clinic diurnal bp measurements nocturnal values abpm could used risk factor marker vascular burden octogenarian men nighttime preawakening sbp daytime pp correlated best grade carotid stenosis similar result observed concerning abi high nighttime sbp sd sbp pp high preawakening sbp observed subjects diminished peripheral leg circulation the largest progress peripheral arterial disease expressed decreasing abi 14 years observed subjects high absolute abpm values expressed high pp high sbp variability night- daytime larger pre- postawakening sbp in conclusion population sample cohort 82-year old men high daytime nighttime abpm measurements reflected increasing office bp aggravating atherosclerosis last decade subjects early developed hypertension peripheral atherosclerosis active smokers already 60 ties reached inflection point blood pressure development express increasing abpm values eighties longer

to assess an impact of vascular risk factors on ambulatory blood pressure measurement ( abpm ) in the elderly , we followed up a population - based cohort of men from 68 until 82 years , when 104 survivors underwent abpm . results . at age 68 , hypertension and high clinic blood pressure ( cbp ) did not predict abpm level . smoking and low ankle - brachial index ( abi ) predicted higher abpm variability and pulse pressure ( pp ) , but not absolute abpm values . at age 82 , hypertension , high or increasing cbp , strongly positively correlated with all variables of abpm . carotid stenosis , low or declining abi during followup , correlated with higher nocturnal abpm and pp . concluding . hypertension and vascular risk factors in a cohort of 68-year - old men do not result in higher abpm at age 82 , possibly due to inflection point in their pressure development . higher abpm reflects instead an increasing cbp and aggravating atherosclerosis during the preceding decade in that part of the cohort with previously favorable risk factor status .

regenerative medicine emerging field biotechnology combines various aspects medicine cell molecular biology materials science bioengineering order regenerate repair replace tissues the oral surgery maxillofacial surgery role treatment traumatic degenerative diseases lead tissue loss frequently rehabilitate minuses use techniques improved time since 1990 tissue engineering developed protocols proposed use platelet concentrates showed enormous benefits patient favored accelerated post surgical provided support tissue regeneration due growth factors contained several authors 1 4 described importance growth factors tissue repair processes fact important elements new tissue production moreover perform feedback controls inflammatory processes within tissue graft cases regenerative surgery whitman5 marx6 published first studies use growth factors contained platelet gel called platelet rich plasma prp thanks marx studies possible verify platelet concentrate effective tool modulation wound healing tissue regeneration however prp showed number disadvantages need run complex expensive protocol production overcome problems prgf plasma rich growth factors ) the prgf considered evolution prp 7,8 allows higher concentration growth factors platelet preparation among advantages prgf cite lesser amount blood taken preparation procedure relatively faster among disadvantages mention rapid clot formation require speed surgical use 2001 choukroun et coll prf derived simple preparation protocol require alteration blood platelet concentrate rich gfs contains three dimensional matrix autologous elastic flexible fibrin have shown platelet cytokines pdgf tgfbeta1 igf-1 present three dimensional fibrin matrix derived platelet concentrates moreover prf matrix traps glycosaminoglycans heparin hyaluronic acid considerable affinity peptides present bloodstream therefore show strong ability chemotaxis diapedesis useful healing tissue damaged example trauma 9 moreover shown matrix valuable support transplantation bone morphogenetic proteins bmp issued progressive manner induce osteogenic differentiation demonstrated recent studies muscle preparations10,11 results wiltfang et al are encouraging fact show improvement osteoblast proliferation cases used prf compared prp 12 described case documented filling prf large osteolytic cavity complete bone reformation 13 have suggested osteoinductive potential prf related neoangiogenic ability concentration gfs relation fibrin content platelet cytokines present suitable totipotent cell migration activation pre osteoblastic cells present surgical site fundamental aspects bone regeneration 14 platelets concentrates thus versatile products surgery regard biological properties easy manipulation form gel membranes features allow use prf well platelet concentrates cases example maxillary surgical sites surgery maxillary sinus 15 the frontier regenerative medicine nowadays represented mesenchymal stem cells mscs overcoming ethical problems thanks use mesenchymal stem cells adult patient increasingly sophisticated technology support manipulation mscs undoubtedly future medicine regenerative showing perspectives unimaginable years ago most recent studies aimed tissues regeneration using mscs taken sites even accessible rich stem cells oral cavity turned important source mscs advantage easily accessible surgeon thus avoiding increase morbidity patient the aim regenerative medicine tissue engineering regenerate repair damaged cells tissues order establish normal functions 16 the regenerative medicine involves use biomaterials growth factors stem cells 17 regeneration tissues exists naturally due presence stem cells potential self regenerate differentiate one specialized cell types this regenerative potential decreases age regeneration sufficient repair damages produced degenerative inflammatory tumor based diseases18 stem cells immature unspecialized cells ability renew divide indefinitely self renewal able differentiate multiple cell lineages 19 the stem cells use regenerative medicine fit following criteria found abundant numbers differentiated multiple cell lineages reproducible controllable manner b isolated minimally invasive procedure minimal morbidity patients c produced accordance gmp good manufacture practice transplanted safely 20,21 last decade several improvements produced comprehension stem cells properties view fact cells important role repair every organ tissue general stem cells divided three main types utilized tissue repair regeneration embryonic stem cells derived embryos es 22,23 ii adult stem cells derived adult tissue24 iii induced pluripotent stem ips cells produced artificially via genetic manipulation somatic cells 25 es ips cells considered pluripotent stem cells develop types cells three germinal layers both stem cells technical moral obstacles addition cells easy control form tumors injection22 contrary adult stem cells multipotent differentiate restricted number cell types adult stem cells also termed postnatal stem cells somatic stem cells discovered particular area tissue named stem cell niche different type postnatal stem cells resides numerous mesenchymal tissues cells time referred mesenchymal stem cells mscs)24,26 mscs first isolated characterized bone marrow bmscs friedenstein et al 1974 27 subsequently different studies showed mscs isolated tissues peripheral blood umbilical cord blood amniotic membrane adult connective adipose dental tissues28 32 recently orofacial dental tissues acquired interest accessible source mesenchymal stem cells 33 due fact oral area rich mscs table 1 today every cell population following characteristics independently tissue source usually referred mscs adhere plastic fibroblast like morphology ii capacity self renewal could differentiate cells mesenchymal lineage osteocytes chondrocytes adipocytes in addition mscs also also differentiate appropriate conditions cells endoderm ectoderm lineages hepatocytes neurons respectively 34,35 phenotypically mscs express cd13 cd29 cd44 cd59 cd73 cd90 cd105 cd146 stro-1 surface antigens express cd45 leukocyte marker cd34 primitive hematopoietic progenitor endothelial cell marker cd14 cd11 monocyte macrophage markers cd79 cd19 b cell markers hla class ii 36 research related msc oral origin began 2000 37 every year numerous investigations demonstrated oral tissues simply available dentists rich source mesenchymal stem cells 33,38 today numerous types mscs have isolated teeth 2000 mscs first isolated gronthos et al dental pulp dpscs)37,38 these cells possess phenotypic characteristics similar bmscs 39 definitive stem cell properties self renewal multi- differentiation capacity form dentin pulp structure transplanted immunocompromised mice 40 moreover dpscs participate regeneration non orofacial tissues fact cells differentiated hair follicle- hepatocyte- neuron- islet- myocyte- cardiomyocyte like cells 41 46 subsequently mscs also isolated dental pulp human exfoliated deciduous teeth sheds these cells like dpscs ability differentiate vitro odontoblasts osteoblasts adipocytes neuron like cells also sheds able form dentin bone transplanted ha tcp vivo47 the periodontal ligament another adult mscs source dental tissue periodontal ligament stem cells pdlscs isolated extracted teeth 48 pdlscs ability regenerate periodontal tissues cementum periodontal ligament alveolar bone 49 moreover mscs also isolated developing dental tissues dental follicle dfpcs)50 apical papilla scaps 51 dfpcs ability regenerate periodontal tissues whereas scaps demonstrate better proliferation better regeneration dentin matrix transplanted immunocompromised mice compared dpscs 50,52,53 zhang et al isolated mesenchymal stem cells gingiva mscs exhibited higher clonogenicity self renewal multipotent differentiation capacity similar bmscs 54 moreover salivary glands derived mscs could differentiate salivary gland duct cells well mucin amylase producing acinar cells vitro 55 addition de bari et al demonstrated single cell derived clonal populations adult human periosteal cells possess mesenchymal multipotency differentiate osteoblast chondrocyte adipocyte skeletal myocyte lineages vitro vivo therefore expanded mscs isolated periosteum could useful functional tissue engineering especially bone regeneration 56 the mscs contained within bone marrow aspiration iliac crest liposuction extra oral tissue easily accessible stem cells on contrary orofacial bone marrow periosteum salivary glands dental tissues accessible stem cell sources moreover isolation mscs sources may still convenient requires surgical methods tooth pulp extraction in addition even impacted wisdom teeth could mesenchymal stem cell source mscs present low percentage therefore difficult isolate purify expand furthermore adults need extraction wisdom teeth overcome limitations recently marrelli et al demonstrated mscs derived periapical cysts hpcy mscs mesenchymal stem cell immunophenotype ability differentiate osteogenic adipogenic lineages 57 the periapical cyst tissue easily obtainable whose cells simply expanded patients minimal discomfort seems promising source adult stem cells dentistry regenerative medicine in fact recent study marrelli et al showed hpcy mscs similarly dpscs neural progenitor like properties expressing spontaneously neuron astrocyte specific proteins neural related genes differentiation furthermore hpcy mscs appropriate neural stimulation acquire neural morphology significantly express several neural markers protein transcriptional level press yet published research marrelli et al it reported mscs isolated whole bone marrow aspirates combination scaffolds growth factors able repair cranial defects several animal models 58 60 these studies demonstrated mscs alleviate complications craniofacial surgical procedures required allogenic tissue grafts extraction autologous bone secondary sites this approach may alleviate donor site morbidity allow virtual unlimited source cellular material derived allogenic mscs 61 the identification msc residing oral cavity tissues increases clinical interest mscs cell source regeneration connective tissues cementum dentin periodontal ligament pdl many research studies research performed assess capacity dental derived mscs enhance periodontal regeneration seo et al demonstrated human pdlscs able generate cementum pdl like structures transplanted immunocompromised mice consequently transplantation pdlscs could considered therapeutic approach regeneration tissues damaged periodontal diseases 48 moreover kim et al compared alveolar bone regeneration achieved implantation pdlscs bmscs identified significant difference regenerative potential vivo mscs 62 the three key elements field tissue engineering stem cells scaffolds growth factors 63 recently researchers trying identify ideal scaffold facilitate growth cell spreading adhesion integration differentiation mscs this scaffold biocompatible biodegradable optimal physical features mechanical properties 64 different material designed constructed tissue engineering approaches using natural synthetic polymers inorganic materials fabricated porous scaffolds nanofibrous material hydrogels microparticles natural materials include collagen elastin fibrin silk chitosan glycosaminoglycans 65 recently hydrogels investigated tissue engineering applications offer numerous properties including biocompatibility mechanical characteristics similar native tissue synthetic poly lactic co glycolic acid plga titanium provide excellent chemical mechanical properties bone tissue regeneration vivo using dpscs 68 furthermore recent studies demonstrated dpscs loaded onto scaffolds chitosan formed dentine pulp complex vivo 69 whereas dpscs cultured hydroxyapatite ha placed subcutaneously nude mice formed bone 70 a great number investigations evaluating vivo application mscs isolated oral cavity carried animal models a clinical study conducted papaccio group gave evidence possibility utilise dpscs repair bone defect humans in fact showed dpscs collagen biocomplex completely restored human mandible bone defects subsequent dpscs transplantation 71 the future regeneration whole organs complex biological systems consisting many different tissues starting initial stem cell line probably using innovative scaffolds together nano engineering biological tissues approach already research topic several international research institutes best way merge numerous skills needed get ambitious result multicenter collaboration the authors closely collaborating together high level international universities develop protocols aimed control lead tissues regeneration this goal could make born new generation stem cells based therapies open door new highly performing regenerative medicine starting 2000 fifteen years researchers changed face tissues engineering expectation quality life 2 billions patients undergone regenerative surgery challenge continue make patient life better make surgery predictable simply replace damaged degenerated tissues mscs dental oral sources

regenerative medicine is an emerging field of biotechnology that combines various aspects of medicine , cell and molecular biology , materials science and bioengineering in order to regenerate , repair or replace tissues.the oral surgery and maxillofacial surgery have a role in the treatment of traumatic or degenerative diseases that lead to a tissue loss : frequently , to rehabilitate these minuses , you should use techniques that have been improved over time . since 1990 , we started with the use of growth factors and platelet concentrates in oral and maxillofacial surgery ; in the following period we start to use biomaterials , as well as several type of scaffolds and autologous tissues . the frontier of regenerative medicine nowadays is represented by the mesenchymal stem cells ( mscs ) : overcoming the ethical problems thanks to the use of mesenchymal stem cells from adult patient , and with the increasingly sophisticated technology to support their manipulation , mscs are undoubtedly the future of medicine regenerative and they are showing perspectives unimaginable just a few years ago . most recent studies are aimed to tissues regeneration using mscs taken from sites that are even more accessible and rich in stem cells : the oral cavity turned out to be an important source of mscs with the advantage to be easily accessible to the surgeon , thus avoiding to increase the morbidity of the patient.the future is the regeneration of whole organs or biological systems consisting of many different tissues , starting from an initial stem cell line , perhaps using innovative scaffolds together with the nano - engineering of biological tissues .

dyslipidemia disorder lipid lipoprotein metabolism including overproductivity deficiencies changes lipid metabolism results abnormal amounts lipids lipoproteins blood dyslipidemia manifest elevation total cholesterol tc low density lipoprotein ldl)cholesterol triglyceride tg concentration reduction high density lipoprotein hdl)cholesterol concentration blood goldberg 2013 abnormal lipid levels one essential causes atherosclerosis coronary artery disease cad vance vance 2008 world health organization h.g.p 1999 when lipoproteins plasma hence arterial wall fall certain threshold level atherogenesis occur however absolute value threshold varies among individuals may low subjects genetic and/or environmental factors render arteries highly susceptible atherogenic processes vance vance 2008 world health organization h.g.p 1999 polygenic hypercholesterolemia characterized moderate elevations ldl cholesterol 3.637.77 mmol l serum tg concentrations within reference range like extreme monogenic diseases although main causes dyslipidemia high fat intake particularly saturated fats obesity genetic factors also considered important many individuals vary responses dietary cholesterol however clear pattern inheritance combination several genetic variants generally required type hypercholesterolemia durrington 2003 epidemiological studies established reduction plasma tc reduces risk coronary heart disease chd bhagavan 2002 indicating importance characterizing strongly associated snps main risk factors elevated blood lipid levels this characterization facilitate early diagnosis risk factors development cad symptoms administration appropriate treatment recent genome wide association studies gwas human genetic studies localized many common snps many loci influence levels different blood lipids including previously known loci potentially involved lipid metabolism aulchenko et al 2009 braun et al burkhardt et al 2008 chasman et al 2008 edmondson et al heid et al 2008 hiura et al 2009 igl et al johansen et al kathiresan et al 2009 suchindran et al wallace et al 2008 waterworth et al willer et al 2008 ) more 40 loci associated levels one blood lipid parameters contain many snps associations confirmed populations aulchenko et al 2009 burkhardt et al 2008 chasman et al 2008 heid et al 2008 hiura et al 2009 igl et al kathiresan et al 2009 suchindran et al wallace et al 2008 waterworth et al willer et al 2008 et al pollin et al 2008 ridker et al 2009 kooner et al 2008 sabatti et al 2009 sandhu et al 2008 saxena et al 2007 frequent polymorphisms abca1 angptl3 apoa1 apoa5 apob apoe celsr2 cetp cilp2 dock7 fads2 galnt2 gckr gpr109a b gpr81 hmgcr kntc1 lcat ldlr lipc lipg lpl mlxipl ncan niacr1 niacr2 pcsk9 pltp tomm40 trib1 ttc39b loci shown significantly associated blood levels one lipid parameters many populations aulchenko et al 2009 chasman et al 2008 et al ridker et al 2009 khovidhunkit et al it demonstrated number missense mutations loci cause different types monogenic hypercholesterolemia for example mutations abca1 gene cause familial hdl deficiency tanger disease bhagavan 2002 similarly mutations apoa5 apob apoe genes cause different types hyperlipoproteinemias even familial hypercholesterolemia type b bhagavan 2002 marcais et al 2005 soria et al 1989 rare usually severe phenotypes confirmation previously identified associations different ethnic groups give additional support underlying genetic architecture associated loci especially data related populations compared baba et al 2009 genetic structure studies europeans shown populations baltic countries estonia latvia lithuania together poland western part russia form rather homogeneous group distinct rest europe nelis et al 2009 however little information available snps associated blood lipid levels countries report associations common snps plasma levels different plasma lipids relatively large sample latvian population the main aims study investigate associations informative snps previous gwas four blood lipid parameters tc hdl cholesterol ldl cholesterol tg latvian population provide additional information characterize genetic factors influence blood lipid levels we conducted research using dna samples genome database latvian population lgdb included 18,888 participants september 2011 study sample selected ignatovica et al 2011 we selected individuals dataset information four blood lipid parameters tc hdl ldl tg body mass index bmi glucose levels sex age resulting 1581 samples we filtered subjects cardiovascular disease undergoing lipid lowering therapies resulting finally 1345 samples one sample excluded outlier extremely high tg level proportion 56.5% samples matched used previous study based genotyping panel radovica et al the genotypes samples obtained database remaining 585 samples genotyped study written informed consent acquired lgdb participants the study protocol approved central medical ethics committee latvia protocol 2007 a-7 01 29.1/25 we previously created genotyping panel gwas contained 144 snps associated one lipid traits aulchenko et al 2009 burkhardt et al 2008 chasman et al 2008 edmondson et al heid et al 2008 hiura et al 2009 2009 wallace et al 2008 waterworth et al willer et al 2008 et al pollin et al 2008 2009 kooner et al 2008 sabatti et al 2009 sandhu et al 2008 saxena et al 2007 khovidhunkit et al these snps occurred 30 loci including abca1 angptl3 apoa1 apoa5 apob apoe celsr2 cetp cilp2 dock7 fads2 galnt2 gckr gpr109a b hmgcr lcat ldlr lipc lipg lpl mlxipl ncan niacr1 niacr1/kntc1 niacr2 niacr2/gpr81 pcsk9 pltp tomm40 trib1 ttc39b snp selection procedure described detail previous publication radovica et al 2013 all 144 snps genotyped illumina beadxpress system illumina goldengate genotyping assay according manufacturer instructions the quality control procedure applied raw data found previous article radovica et al 2013 after quality control remaining sample consisted 1273 individuals 139 genotyped snps successful genotyping rate 99.76% the normal distributions quantitative variables tested two important parameters mean value standard deviation sd altman 1991 shapiro wilk test therefore assess influence covariates used linear regression applying less stringent normality criteria 689599.7 rule three sigma rule according 68% values fit within interval one sd 95% two sds 99.7% three sds among variables tested the tg levels normally distributed log transformed statistical analysis we applied linear regression analysis without covariates age sex bmi glucose levels tested epistasis hardy weinberg equilibrium plink v2.050 software http://pngu.mgh.harvard.edu/purcell/plink/ purcell et al the bonferroni correction used calculate significance level 0.05/139 3.5 10 calculate joint effects snps genes one nominally associated snp divided haploblocks using hapmap data haploview software v4.2 barrett 2009 barrett et al 2005 and the joint effect analyses performed spss v13.0 software using one sample test a gene gene interaction analysis performed plink v2.050 software gmdr software beta 0.9 http://sourceforge.net/projects/gmdr/ lou et al 2007 imputation performed impute2 v2.2.2 software https://mathgen.stats.ox.ac.uk/impute/impute_v2.html#home howie et al 2009 marchini et al 2007 loci containing five snps reference haplotypes the imputation region set based coordinates first- last tested snp locus the snptest v2.4.1 software used calculate association imputed snps four lipid parameters https://mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html#download_and_compilation marchini et al 2007 to accommodate uncertain genotypes used method threshold option threshold value 0.9 the bonferroni threshold calculated follows 0.05/number genotyped snps n 139 loci statistical power calculated quanto v1.2.4 software gauderman morrison 2006 the minor allele frequencies mafs genotyped snps ranged 0.020 0.474 taking account range mafs study sufficient power 80% detect beta coefficients following range parameters increased tc 0.500.15 increased ldl cholesterol 0.450.15 reduced hdl cholesterol 0.200 increased tg 0.300.10 we conducted research using dna samples genome database latvian population lgdb included 18,888 participants september 2011 study sample selected ignatovica et al 2011 we selected individuals dataset information four blood lipid parameters tc hdl ldl tg body mass index bmi glucose levels sex age resulting 1581 samples we filtered subjects cardiovascular disease undergoing lipid lowering therapies resulting finally 1345 samples one sample excluded outlier extremely high tg level proportion 56.5% samples matched used previous study based genotyping panel radovica et al the genotypes samples obtained database remaining 585 samples genotyped study written informed consent acquired lgdb participants the study protocol approved central medical ethics committee latvia protocol 2007 a-7 01 29.1/25 we previously created genotyping panel gwas contained 144 snps associated one lipid traits aulchenko et al 2009 burkhardt et al 2008 chasman et al 2008 edmondson et al heid et al 2008 hiura et al 2009 2009 wallace et al 2008 waterworth et al willer et al 2008 et al pollin et al 2008 ridker et al 2009 kooner et al 2008 sabatti et al 2009 sandhu et al 2008 saxena et al 2007 khovidhunkit et al these snps occurred 30 loci including abca1 angptl3 apoa1 apoa5 apob apoe celsr2 cetp cilp2 dock7 fads2 galnt2 gckr gpr109a b hmgcr lcat ldlr lipc lipg lpl mlxipl ncan niacr1 niacr1/kntc1 niacr2 niacr2/gpr81 pcsk9 pltp tomm40 trib1 ttc39b snp selection procedure described detail previous publication radovica et al 2013 all 144 snps genotyped illumina beadxpress system illumina goldengate genotyping assay according manufacturer instructions the quality control procedure applied raw data found previous article radovica et al 2013 after quality control remaining sample consisted 1273 individuals 139 genotyped snps successful genotyping rate 99.76% the normal distributions quantitative variables tested two important parameters mean value standard deviation sd altman 1991 shapiro therefore assess influence covariates used linear regression applying less stringent normality criteria 689599.7 rule three sigma rule according 68% values fit within interval one sd 95% two sds 99.7% three sds among variables tested the tg levels normally distributed log transformed statistical analysis we applied linear regression analysis without covariates age sex bmi glucose levels tested epistasis hardy weinberg equilibrium plink v2.050 software http://pngu.mgh.harvard.edu/purcell/plink/ purcell et al 2007 the bonferroni correction used calculate significance level 0.05/139 3.5 10 calculate the joint effects snps genes one nominally associated snp divided haploblocks using hapmap data haploview software v4.2 barrett 2009 barrett et al 2005 one snp chosen haploblock the joint effect analyses performed spss v13.0 software using one sample test a gene gene interaction analysis performed plink v2.050 software gmdr software beta 0.9 http://sourceforge.net/projects/gmdr/ lou et al 2007 imputation performed impute2 v2.2.2 software https://mathgen.stats.ox.ac.uk/impute/impute_v2.html#home howie et al 2009 marchini et al 2007 loci containing five snps reference haplotypes the imputation region set based coordinates first- last tested snp locus the snptest v2.4.1 software used calculate association imputed snps four lipid parameters https://mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html#download_and_compilation marchini et al 2007 to accommodate uncertain genotypes used method threshold option threshold value 0.9 the bonferroni threshold calculated follows 0.05/number genotyped snps n 139 loci statistical power calculated quanto v1.2.4 software gauderman morrison 2006 the minor allele frequencies mafs genotyped snps ranged 0.020 0.474 taking account range mafs study sufficient power 80% detect beta coefficients following range parameters increased tc 0.500.15 increased ldl cholesterol 0.450.15 reduced hdl cholesterol 0.200 increased tg 0.300.10 we performed linear regression analyses 139 snps four blood lipid parameters tc hdl ldl logtg unadjusted analyses 26 snps nine loci associated tc 22 snps 10 loci ldl 58 snps 13 loci hdl 40 snps 14 loci logtg nominally significant level p 0.05 after age sex bmi glucose levels added covariates linear regression analysis 24 snps 11 loci associated tc 23 snps nine loci ldl 56 snps 13 loci hdl 40 snps 14 loci logtg significance level data associations snps shown supplementary table 1 total 16 snps remained significantly associated bonferroni correction applied table 2 10 snps cetp cholesteryl ester transfer protein locus two snps mlxipl mlx integrating protein like locus associated reduced hdl cholesterol levels one snp tomm40 translocase outer mitochondrial membrane 40 locus associated increased ldl cholesterol four snps located mlxipl locus associated increased logtg levels order explore ld association changes blood lipids detailed haplotype analysis performed genes one significantly associated snp mlxipl cetp we thus selected snps panel located within near proximity cetp mlxipl gene assigned haploblocks generated hapmap1/3 data total one haploblock identified mlxipl locus four found cetp locus acquired haplotype data used haplotype association test reconstructed haplotypes exceeded frequency 0.01 results association test shown table 3 detailed description cetp haplotypes genomic localization found previous paper radovica et al 2013 pair wise snp snp interactions 139 snps analyzed epistasis option implemented plink software package determine whether interactions two snps associated lipid levels one interacting snp pair associated reduced hdl cholesterol levels rs1551894 hmgcr encoding 3-hydroxy-3-methylglutaryl coa reductase interacting rs6586891 lpl encoding lipoprotein lipase two snp pairs associated increased ldl cholesterol levels rs4803750 tomm40 interacting rs157580 apoe encoding apolipoprotein e rs157580 apoe interacting rs405509 tomm40 one pair snps associated increased logtg rs10889353 angptl3 encoding angioprotein like 3 interacting rs166358 lipc encoding hepatic lipase gene epistasis test gmdr software analysis revealed significant gene we performed imputation subsequent association analyses 11 loci contained five snps celsr2 apob hmgcr mlxipl lpl apoa1/5 kntc1/niacr1 lipc cetp tomm40/apoe using 1000 genomes phase integrated variant set haplotypes reference coordinates outer snps 11 loci interval boundaries four loci apob apolipoprotein b cetp lpl tomm40 number snps displayed p values lower bonferroni threshold one lipid traits to illustrate results created manhattan plots four loci shown fig 1 the p values beta coefficients 71 corrected snps associated one lipid traits imputation snptest shown supplementary table 2 thus apob lpl imputed snps reached appropriate significance level association ldl tc hdl one nucleotide deletion chr2:21428937 apob locus showed strongest association ldl cholesterol levels rs289 located sixth intron lpl gene displayed strongest association hdl cholesterol we found number imputed snps tomm40 locus reached appropriate significance level associations ldl cholesterol levels lower p values genotyped snps the strongly associated snp rs62117206 located intron bcl3 gene b cell leukemia lymphoma 3 we found many snps appropriate significance level cetp locus association hdl cholesterol however none snps p value lower rs3764261 genotyped panel most associated snps found within introns although located 5 3 untranslated regions none occurred coding region effects individual snps rather small decided investigate summary effects associated snps blood lipid parameters using risk allele dosage test snps nominally associated different blood lipid levels bonferroni correction represented one haploblock sixteen snps representing abca1 angptl3 apob apoe dock7 hmgcr lcat lipc tomm40 loci included case tc 24 snps representing abca1 apoa1 cetp hmgcr niacr1 lcat lipc lpl mlxipl pltp trib1 loci included cases hdl cholesterol 15 snps representing abca1 angptl3 apoa1 apob apoe dock7 hmgcr lcat tomm40 loci included case ldl cholesterol 27 snps representing abca1 angptl3 apoa1 apoa5 apob cetp cilp2 dock7 gckr lipc lpl mlxipl ncan tomm40 loci included case logtg the distribution risk allele number within group lipid parameters analyzed almost normally distributed therefore divided sample three equivalent groups based range risk allele distribution separately lipid parameter we performed one sample test spss software calculate differences three groups we found number risk alleles correlated strongly blood lipid levels four parameters the results analysis shown fig 2 case tc group individuals 410 risk alleles mean tc level 0.53 mmol l lower median group represented individuals 1118 risk alleles p 1.59e 44 group 1926 risk alleles the mean tc level 0.40 mmol l higher p 4.18e 97 median group the mean hdl cholesterol level 0.24 mmol l higher p 1.59e 44 group 1321 risk alleles 0.18 mmol l lower p 7.51e 241 group 31 40 risk alleles compared value median group 2230 risk alleles the mean ldl cholesterol level 0.56 mmol l lower p 1.36e 22 group two nine risk alleles 0.51 mmol l higher p 7.91e 140 group 1017 risk alleles compared value median group 1017 risk alleles the mean logtg value 0.07 log mmol l lower p 1.06e 31 group 1321 risk alleles 0.09 log mmol l higher p 1.76e 34 group 3039 risk alleles compared median group 2229 risk alleles we performed linear regression analyses 139 snps four blood lipid parameters tc hdl ldl logtg unadjusted analyses 26 snps nine loci associated tc 22 snps 10 loci ldl 58 snps 13 loci hdl 40 snps 14 loci logtg nominally significant level p 0.05 after age sex bmi glucose levels added covariates linear regression analysis 24 snps 11 loci associated tc 23 snps nine loci ldl 56 snps 13 loci hdl 40 snps 14 loci logtg significance level data associations snps shown supplementary table 1 total 16 snps remained significantly associated bonferroni correction applied table 2 10 snps cetp cholesteryl ester transfer protein locus two snps mlxipl mlx integrating protein like locus associated reduced hdl cholesterol levels one snp tomm40 translocase outer mitochondrial membrane 40 locus associated increased ldl cholesterol four snps located mlxipl locus associated increased logtg levels in order explore ld association changes blood lipids detailed haplotype analysis performed genes one significantly associated snp mlxipl cetp we thus selected snps panel located within near proximity cetp mlxipl gene assigned haploblocks generated hapmap1/3 data total one haploblock identified mlxipl locus four found cetp locus acquired haplotype data used haplotype association test reconstructed haplotypes exceeded frequency 0.01 results association test shown table 3 detailed description cetp haplotypes genomic localization found previous paper radovica et al 2013 pair wise snp snp interactions 139 snps analyzed epistasis option implemented plink software package determine whether interactions two snps associated lipid levels one interacting snp pair associated reduced hdl cholesterol levels rs1551894 hmgcr encoding 3-hydroxy-3-methylglutaryl coa reductase interacting rs6586891 lpl encoding lipoprotein lipase two snp pairs associated increased ldl cholesterol levels rs4803750 tomm40 interacting rs157580 apoe encoding apolipoprotein e rs157580 apoe interacting rs405509 tomm40 one pair snps associated increased logtg rs10889353 angptl3 encoding angioprotein like 3 interacting rs166358 lipc encoding hepatic lipase gene epistasis test gmdr software analysis revealed significant gene gene interactions we performed imputation subsequent association analyses 11 loci contained five snps celsr2 apob hmgcr mlxipl lpl apoa1/5 kntc1/niacr1 lipc cetp tomm40/apoe using 1000 genomes phase integrated variant set haplotypes reference coordinates outer snps 11 loci interval boundaries four loci apob apolipoprotein b cetp lpl tomm40 number snps displayed p values lower bonferroni threshold one lipid traits to illustrate results created manhattan plots four loci shown fig 1 the p values beta coefficients 71 corrected snps associated one lipid traits imputation snptest shown supplementary table 2 thus apob lpl imputed snps reached appropriate significance level association ldl tc hdl one nucleotide deletion chr2:21428937 apob locus showed strongest association ldl cholesterol levels rs289 located sixth intron lpl gene displayed strongest association hdl cholesterol we found number imputed snps tomm40 locus reached appropriate significance level associations ldl cholesterol levels lower p values genotyped snps the strongly associated snp rs62117206 located intron bcl3 gene b cell leukemia lymphoma 3 we found many snps appropriate significance level cetp locus association hdl cholesterol however none snps p value lower rs3764261 genotyped panel most associated snps found within introns although located 5 3 untranslated regions none occurred coding region because effects individual snps rather small decided investigate summary effects associated snps blood lipid parameters using risk allele dosage test snps nominally associated different blood lipid levels bonferroni correction represented one haploblock sixteen snps representing abca1 angptl3 apob apoe dock7 hmgcr lcat lipc tomm40 loci included case tc 24 snps representing abca1 apoa1 cetp hmgcr niacr1 lcat lipc lpl mlxipl pltp trib1 loci included cases hdl cholesterol 15 snps representing abca1 angptl3 apoa1 apob apoe dock7 hmgcr lcat tomm40 loci included case ldl cholesterol 27 snps representing abca1 angptl3 apoa1 apoa5 apob cetp cilp2 dock7 gckr lipc lpl mlxipl ncan tomm40 loci included case logtg the distribution risk allele number within group lipid parameters analyzed almost normally distributed therefore divided sample three equivalent groups based range risk allele distribution separately lipid parameter we performed one sample test spss software calculate differences three groups we found number risk alleles correlated strongly blood lipid levels four parameters in case tc group individuals 410 risk alleles mean tc level 0.53 mmol l lower median group represented individuals 1118 risk alleles p 1.59e 44 group 1926 risk alleles the mean tc level 0.40 mmol l higher p 4.18e 97 median group the mean hdl cholesterol level 0.24 mmol l higher p 1.59e 44 group 1321 risk alleles 0.18 mmol l lower p 7.51e 241 group 31 40 risk alleles compared value median group 2230 risk alleles the mean ldl cholesterol level 0.56 mmol l lower p 1.36e 22 group two nine risk alleles 0.51 mmol l higher p 7.91e 140 group 1017 risk alleles compared value median group 1017 risk alleles the mean logtg value 0.07 log mmol l lower p 1.06e 31 group 1321 risk alleles 0.09 log mmol l higher p 1.76e 34 group 3039 risk alleles compared median group 2229 risk alleles the aim study identify associations 144 snps selected published gwas blood lipid levels latvian population this first report many genetic loci involved number lipid related metabolic pathways simultaneously studied relatively large group representing latvian population 420 males 853 females detailed data see table 1 our study convincingly identified associations 16 139 strongly associated snps one blood lipid parameters previous case control study reported strong associations 10 snps cetp reduced hdl cholesterol radovica et al 2013 in study confirmed strong evidence association cetp gene hdl cholesterol levels discovered new association two snps mlxipl locus table 2 using quantitative analyses moreover haplotype analyses also confirmed associations demonstrated previous study radovica et al 2013 these results also agree well studies around world chasman et al 2008 heid et al 2008 hiura et al 2009 2008 kathiresan et al 2009 willer et al 2008 et al ridker et al 2009 khovidhunkit et al thompson et al 2005 thompson et al 2007 supported well known function cetp lipid metabolism cetp promotes transfer cholesteryl esters hdl particles apolipoprotein b containing particles exchange tg allowing receptor mediated uptake cholesterol esters liver reducing hdl cholesterol levels vance vance 2008 in contrast cetp deficiency increases hdl cholesterol levels supporting association snps mlxipl locus hdl cholesterol their relationship within lipid metabolic pathways direct snp cetp association the protein encoded mlxipl gene helix loop helix leucine zipper transcription factor forms heterodimer mlx bind dna cairo et al 2001 this transcription factor complex activated high glucose inhibited cyclic adenosine monophosphate camp kawaguchi et al 2001 repress e box dependent transcription cairo et al 2001 carbohydrate response element motifs promoters lipogenic enzymes adipose tissues mlxipl major determinant adipose tissue fatty acid synthesis systemic insulin sensitivity herman et al therefore plausible changes mlxipl expression indirectly influence hdl cholesterol levels various metabolic pathways we also found strong associations four snps mlxipl locus increased logtg table 2 mlxipl transcription factor influences fatty acid synthesis adipose tissue plausible snps gene indirectly affect tg levels we also found snp tomm40 locus associated increased ldl cholesterol levels table 2 more precisely snp located first intron bcl3 gene fig the protein encoded bcl3 gene inhibitor subunit two nuclear factor kappa b nf-b franzoso et al 1992 wulczyn et al 1992 because interactions bcl3 nf-b yet linked lipid metabolism think snp might linkage disequilibrium ld functional snps one genes encoding various apolipoproteins located downstream tomm40 gene for example mutations apoe gene located immediately downstream tomm40 cause hyperlipoproteinemia type iii utermann et al 1979 alternatively associated snps may located within upstream regulatory elements apolipoprotein genes distance tomm40 gene example apoe gene rather large 2.1 mbp arguing simple ld based explanation since number associated snps found cetp mlxipl gene estimated association individual haplotypes lipid levels first noted case cetp results hdl associations corresponded exactly previous findings radovica et al most associated snps fall second third haploblock table 3 these haploblocks cover region starting 2 kb upstream cetp gene promoter region include first 10 kb cetp gene interestingly strongest association observed two protective haplotypes increased hdl levels haplotype 2.1 second haploblock 3.1 third haploblock second haploblock it clear effect explained presence risk alleles two snps rs173539 rs3764261 strong ld r 0.94 case third haploblock allele rs9939224 second intron cetp gene present two risk haplotypes may linked increased expression functionality cetp thus decreasing hdl c levels suggested previous observations radovica et al 2013 the effect protective haplotype may explained presence rs1800775 allele linked changes binding site sp1/sp3 functional studies dachet et al 2000 thompson et al 2004 case mlxipl one protective haplotype was identified associated increased hdl decreased logtg levels one risk haplotype associated decreased hdl due strong ld however less clear tested snps may responsible effects we found four pairs snps showed probable interactions associations blood lipid parameters two pairs snps located tomm40 apoe genes showed functional ld based interactions affected ldl cholesterol levels another two interactions associated hdl cholesterol hmgcr lpl logtg levels angptl3 lipc the hmgcr gene encodes 3-hydroxy-3-methylglutaryl coa reductase catalyzes crucial step cholesterol biosynthesis vance vance 2008 contrast lpl gene encodes lipoprotein lipase hydrolyzes tgs derived blood lipid particles these taken cells fatty acids stored delivered cholesterol tg synthetic pathways vance vance 2008 encodes angiopoietin like 3 protein belongs specific vascular endothelium growth factor protein family camenisch et al 2002 homozygous compound heterozygous mutations angptl3 cause familial hypobetalipoproteinemia type ii musunuru et al the lipc gene encodes hepatic lipase synthesized liver acts uptake lipoproteins cholesteryl esters hepatocytes thus directly influencing plasma lipid levels cai et al it known two proteins interact influence lipid metabolism interactions excluded however noted majority genes selected study well established functions lipid metabolism therefore attempts explain interactions statistically based relationships protein functions highly biased cases investigation required large well characterized cohorts unfortunately findings supported gmdr software perhaps specific algorithms used ghmdr taking account example covariates course dimensionality criteria included plink toolset therefore better exclude false positive results chen et al detailed analysis find strongly associated snps test loci performed imputation 11 loci contained five snps celsr2 apob hmgcr mlxipl lpl apoa1/5 kntc1/niacr1 lipc cetp tomm40/apoe we found many imputed snps cetp gene associated changes hdl cholesterol levels although none associations stronger originally genotyped snps fig these results agree well previous study cetp strongest common genetic factor influence hdl cholesterol levels latvian population imputed snps another three loci apob lpl tomm40 significantly associated one lipid trait fig 1 all snps located noncoding regions many already associated disease phenotypes including cad myocardial infarction atherosclerosis the apob lpl genes known directly involved lipid metabolism number functional mutations genes already reported cause different types monogenic familial hypercholesterolemia http://www.hgmd.org/ therefore likely common variants smaller effects may play roles milder forms dyslipidemia it also possible cohort contained number patients undiagnosed monogenic hypercholesterolemia this may influenced association results either ld mutations markers used study simply adding stronger genetic modifier a number imputed snps tomm40 locus reached appropriate significance level associations ldl cholesterol levels again role tomm40 regulation ldl metabolism unclear see discussion achieve aim performed allele dosage association test nominally associated snps representing one haploblock four blood lipid parameters calculate influence number risk alleles lipid levels we divided sample three equivalent groups based number risk alleles there strong correlation number risk alleles plasma lipid levels four lipid parameters fig 2 therefore possible discovery inclusion additional lipid influencing snps similar analyses lead development prognostic tests dyslipidemia prescription appropriate drugs the results study confirm genes included analysis cetp mlxipl tomm40 genetic factors strongly influence plasma lipid levels study population also shown risk alleles strong cumulative effects lipid parameters it noted first replication study relatively large sample population baltic states eastern europe cadcoronary artery diseasetctotal cholesterolsnpsingle nucleotide polymorphismldllow density lipoproteinhdlhigh density lipoproteintgtriglyceridebmibody mass indexmafminor allele frequencychrchromosomemaminor allelegwasgenome wide association studiescampcyclic adenosine monophosphateldlinkage disequilibriumsdstandard deviation coronary artery disease single nucleotide polymorphism low density lipoprotein high density lipoprotein minor allele frequency genome wide association studies cyclic adenosine monophosphate linkage disequilibrium following supplementary data related article.supplementary table 1association data 139 snps used present study.supplementary table 2imputed snps associated one lipid traits

backgroundabnormal lipid levels are considered one of the most significant risk factors for atherosclerosis and coronary artery disease , two of the main causes of death worldwide . apart from monogenic cases of hypercholesterolemia , most of the common dyslipidemias are caused by a number of low - impact polymorphisms . it has recently been reported that frequent polymorphisms at a large number of loci are significantly associated with one or more blood lipid parameters in many populations . identifying these associations in different populations and estimating the possible interactions between genetic models are necessary to explain the underlying genetic architecture of the associated loci and their ultimate impact on lipid - associated traits.methodswe estimated the association between 144 common single - nucleotide polymorphisms ( snps ) from published genome - wide association studies and the levels of total cholesterol , low- and high - density lipoprotein cholesterol , and triglycerides in 1273 individuals from the genome database of the latvian population . we analyzed a panel of 144 common snps with illumina goldengate genotyping assays on the illumina beadxpress system.resultsten snps at the cetp locus and two at the mlxipl locus were associated with reduced high - density lipoprotein cholesterol levels ; one snp at the tomm40 locus was associated with increased low - density lipoprotein cholesterol ; and four snps at the mlxipl locus were associated with increased log triglyceride levels . there was also a significant correlation between the number of risk alleles and all the lipid parameters , suggesting that the coexistence of many low - impact snps has a greater effect on the dyslipidemia phenotype than the individual effects of found snps.conclusionwe conclude that the cetp , mlxipl , and tomm40 loci are the strongest genetic factors underlying the variability in lipid traits in our population .

27-year old hispanic man admitted queens hospital center cough weakness night sweats weight loss patient well 1 month admission started weakness coughing sweats on return united states saw physician symptoms prescribed azithromycin 5 days however symptoms progressively worsened weeks presentation also included drenching night sweats dizziness his coworkers noted paler interview noted lost 25 pounds 4 6 weeks he fatigue felt early satiety due pressure left upper quadrant abdomen he denied travel countryside significant outdoor activities hiking spelunking he also denied bright red blood per rectum melena myalgia arthralgia hematuria dark colored urine he non smoker drank socially take illicit recreational drugs his father recently diagnosed multiple myeloma mother diabetes mellitus physical examination patient alert oriented the blood pressure 119/76 mmhg temperature 100.0f pulse 119/min regular rhythm respiratory rate 16/min oxygen saturation 100% ambient air the patient pale conjunctiva icteric sclera non tender left supraclavicular cervical lymphadenopathy hepatomegaly palpable liver edge 23 cm right costal margin splenomegaly hospital day ( hd 1 complete blood count showed white blood cell count 3,100/mcl hemoglobin 6.6 g dl hematocrit 20% platelets 76,000/mcl liver function tests lfts abnormal alkaline phosphatase 611 u l aspartate aminotransferase ast 42 u l gamma glutamyl transpeptidase ggt 68 u l lactate dehydrogenase ldh 581 u l total bilirubin 2.67 mg dl conjugated bilirubin 1.25 mg dl anemia workup revealed reticulocyte count 1,231/l reticulocytes 5.53% 0.5%1.5% iron 60 g dl 60160 g dl total iron binding capacity tibc 213 g dl 250460 g dl ferritin 3,128 ng ml 15200 ng ml vitamin b12 level 1,387 pg ml 200900 pg ml serum folate 11.25 ng ml 2.520 ng ml initial review peripheral blood smear showed thrombocytopenia occasional large platelets poikilocytosis polychromasia decreased white blood cells without toxic granulation schistocytes tests hemolysis including direct anti globulin test haptoglobin level negative hd 2 computed tomography ct scan chest abdomen pelvis done hd 1 revealed enlarged lymph nodes mediastinum retroperitoneum splenomegaly hepatomegaly a lymph node biopsy requested given pancytopenia concurrent lymphadenopathy performed hd 6 the bone marrow biopsy showed markedly hypercellular marrow 90%100% erythroid hyperplasia left shifted granulocytic series increased megakaryocytes atypical dysplastic forms suggesting myelodysplastic myeloproliferative disorder the bone marrow aspirate smears showed occasional abnormal mononuclear cells likely vacuolated lymphoid precursors mature myeloid erythroid lines evidence blasts the findings later interpreted unusual reaction hodgkin lymphoma hl cytogenetic analysis bone marrow specimen revealed tetraploidy aneuploidy multiple abnormalities including xxy add(2)(p25 add(5)(p15)2 add(6)(q27 add(10)(q23 add(13)(p11 add(14 del(10)(q22,q23 5 8 9 the liver enzymes including total direct bilirubin worsened awaiting results biopsies a magnetic resonance cholangiopancreatography show intra extra hepatic biliary obstruction clear involvement liver lymphoma identified multiple hypodensities spleen a hepatobiliary iminodiacetic acid scan showed marked hepatomegaly smooth contour evidence focal defects drug induced hepatitis considered patient fluconazole acetaminophen course hospital stay lfts showed predominantly obstructive pattern initially serum acetaminophen level presentation less 10 g ml prednisone started hd 14 attempt stop decline lfts despite steroids total bilirubin hd 20 had increased 9.22 mg dl conjugated bilirubin 5.76 mg dl a left cervical lymph node biopsy revealed mixed cellularity classical hl multiple reed sternberg hodgkin cells immunohistochemical expression pax5 cd30 cd15 background cd3 positive cells cd 20-positive residual follicles due elevated lfts major dose reductions omission chemotherapeutic agents would needed gemcitabine considered ability used even hepatic impairment effectiveness salvage regimen after first dose gemcitabine methylprednisone total bilirubin conjugated bilirubin alkaline phosphatase levels decreased thirteen days administration gemcitabine lfts still abnormal improved sufficiently dose reduced adriamycin bleomycin vinblastine dac arbazine abvd could administered a follow bone marrow biopsy done completing six cycles abvd showed 70% cellularity trilineage hematopoiesis three cell lines proceeding maturity cytogenetic evidence abnormal clone repeat ct scan chest abdomen pelvis showed decrease size mediastinal left supraclavicular abdominal pelvic lymph nodes a follow whole body positron emission tomography ct scan showed evidence fluorodeoxy fdg avid tumor decreased splenomegaly hl originates clonotypic b cells.1 standard regimens used usa time patient presented abvd stanford v regimen less commonly dose escalated beacopp bleomycin etoposide adriamycin cyclophosphamide vincristine procarbazine prednisone older regimens mopp mechlorethamine vincristine procarbazine prednisone less effective abvd.2,3 paucity data published case reports treatment patients hl severely impaired liver function patient presented case reports published using chemotherapy agents patients hl presenting high bilirubin levels.46 many active agents used treatment hl require extensive dose reduction severe liver impairment table 3 liver involvement uncommon presentation patients hl exceptionally rare absence splenic involvement.7,8 hepatic involvement could range hepatic infiltration lymphoma biliary obstruction lymph node masses infiltration common bile duct.911 lfts case revealed cholestatic picture high alkaline phosphatase conjugated hyperbilirubinemia vanishing bile duct syndrome cause jaundice also reported associated hl.4,12,13 one case report bilirubin level normalized two cycles mopp one cycle reduced dose p(v)ag prednisone vinblastine excluded due potential neurotoxicity doxorubicin gemcitabine followed six cycles full dose p(v ag 5.4 0.15 mg dl.4 however treatment course case complicated prolonged fever pancytopenia severe peripheral polyneuropathy toxic interstitial pneumonitis requiring intensive care receiving two cycles mopp case report successful use dhap full dose dexamethasone high dose cytarabine cisplatin patient stage iv nodular sclerosis classical hl severe hepatic dysfunction resulted significant improvement hepatic function administration dhap regimen evidenced normalization serum bilirubin 6.5 mg dl 1.2 mg dl.5 gemcitabine shown effective salvage regimen patients refractory hl response rate 39% mild drug related toxicities.14 currently three gemcitabine based regimens gvd gemcitabine vinorelbine pegylated liposomal doxorubicin),15 gdp gemcitabine dexamethasone cisplatin),16 gcd(r gemcitabine carboplatin dexamethasone rituximab)17 evaluated use relapsed and/or refractory hl a retrospective study shown gemcitabine combined vinorelbine cisplatinum steroid effective treatment option manageable toxicity profile patients post transplant progression hl patients eligible allogeneic second autologous stem cell transplantation pre transplant option.18 manufacturer drug package insert phase pharmacokinetic trials gemcitabine patients hepatic renal dysfunction demonstrated dose adjustments necessary elevated transaminases elevated bilirubin creatinine levels.19,20 finally chromosomal abnormalities hl well studied characterize coherent cytogenetic picture.21 recent studies designated common chromosomal aberrations including gains short arm chromosome 2 involving rel oncogene locus1,22 chromosomal breakpoints involving immunoglobulin loci.23 frequent occurrence abnormalities involving 1p 1q 6q chromosomal arms shown case series.21 cytogenetic studies case typical hl except 6q involvement clinical significance chromosomal findings disappearance complete remission still remains elucidated summary present unusual case hl severe hepatic impairment splenomegaly multiple chromosomal abnormalities treated successfully gemcitabine steroids initially improve lfts six cycles abvd could given

hodgkin s lymphoma ( hl ) originates from clonal b cells and is the most common malignancy in the second decade of life . liver involvement is uncommon at presentation in patients with hl and there is a paucity of data for treatment of patients with severely impaired liver function . we present an unusual case of hl with severe hepatic impairment , splenomegaly and multiple chromosomal abnormalities that was treated initially with gemcitabine and steroids . once liver function tests improved , six cycles of adriamycin , bleomycin , vinblastine , and dacarbazine were administered . the patient remains in remission at 3.5 years of follow - up .

cancer related inflammation affects many aspects malignancy including proliferation survival malignant cells angiogenesis therapeutic response previous study utilizes mouse model showed inflammatory response elicited early stages postsurgical wound healing process leading increase number inflammatory cells peritoneum this increases pro matrix metalloproteinase-9 pro mmp-9 plays key role growth progression peritoneal metastases based experimental results hypothesize local metastatic microenvironment changed early inflammatory phase process wound healing clinically efforts demonstrate correlation operative systemic inflammation cancer some biomarkers representing degree systemic inflammation glasgow prognostic score neutrophil lymphocyte ratio nlr platelet lymphocyte ratio plr shown prognostic value many kinds cancer patients 5 8 however results focus effects preoperative cancer inflammation regardless etiology inflammation now research regarding postoperative systemic inflammation cancer prognosis study examine effect preoperative inflammatory state cancer also effects early postoperative systemic inflammation cancer prognosis based previous animal study results six hundred thirty nine consecutive patients underwent surgery colorectal cancer yeouido st mary hospital catholic university korea january 2006 december 2009 patients excluded colorectal cancer adenocarcinoma carcinoma situ however patients preoperative radiation therapy able undergo curative resection included routine laboratory measurements including white blood cell wbc count neutrophil count lymphocyte count monocyte count platelet count performed preoperatively daily day four postoperatively subsequently every two days we consider preoperative infection inflammatory condition postoperative infection inflammatory condition patients divided three groups based days spent leukocyte count drop 10,000/mm surgery dsnlc group 0 1 days group ii 2 3 days group iii 4 days comparative analysis results study grouping variables wbc count neutrophil count lymphocyte count monocyte count platelet count " right side colon defined right colon transverse colon " left side colon defined left colon recto sigmoid colon peritoneal reflection staging evaluation carried according guidelines american joint committee cancer sixth edition this study approved institutional review board college medicine sc11tisi0080 relationship number days required leukocyte count drop 10,000/mm surgery group i 0 1 day group ii 2 3 days group iii 4 days clinicopathologic factors assessed using chi squared fisher exact tests the overall duration survival calculated date surgery date death the duration cancer free survival calculated date surgery date detection disease recurrence defined using clinical radiographic pathological findings overall cancer free survival rates calculated using kaplan meier method differences among curves tested using log rank test variables significantly related survival rate univariate analysis subsequently included multivariate analysis employing cox multiple regression model this method finds best variables p<0.05 effects prognosis significant also independent correlated factors included model all statistical tests two tailed significance level set 0.05 six hundred thirty nine consecutive patients underwent surgery colorectal cancer yeouido st mary hospital catholic university korea january 2006 december 2009 patients excluded colorectal cancer adenocarcinoma carcinoma situ however patients preoperative radiation therapy able undergo curative resection included routine laboratory measurements including white blood cell wbc count neutrophil count lymphocyte count monocyte count platelet count performed preoperatively daily day four postoperatively subsequently every two days we consider preoperative infection inflammatory condition postoperative infection inflammatory condition patients divided three groups based days spent leukocyte count drop 10,000/mm surgery dsnlc group 0 1 days group ii 2 3 days group iii 4 days comparative analysis results study grouping variables wbc count neutrophil count lymphocyte count monocyte count platelet count " right side colon defined right colon transverse colon " left side colon defined left colon recto sigmoid colon peritoneal reflection staging evaluation carried according guidelines american joint committee cancer sixth edition this study approved institutional review board college medicine sc11tisi0080 the relationship number days required leukocyte count drop 10,000/mm surgery group 0 1 day group ii 2 3 days group iii 4 days clinicopathologic factors assessed using chi squared fisher exact tests the overall duration survival calculated date surgery date death the duration cancer free survival calculated date surgery date detection disease recurrence defined using clinical radiographic pathological findings overall cancer free survival rates calculated using kaplan meier method differences among curves tested using log rank test variables significantly related survival rate univariate analysis subsequently included multivariate analysis employing cox multiple regression model this method finds best variables p<0.05 effects prognosis significant also independent correlated factors included model all statistical tests two tailed significance level set 0.05 the male female ratio patients 1.48:1 mean age 62.311.5 years three hundred fifty patients 58.2% 65 years old 250 patients 41.7% 65 years old the follow period ranged 1 72 months mean 27.418.2 months tumors localized right side colon 156 patients 26.0% left side colon 250 patients 41.7% rectum 184 patients 30.7% multiple areas 10 patients 1.7% there differences groups regards complication cancer defined perforating obstructing colorectal lesions among rectal cancer patients laparoscopic treatment performed 69 patients 11.5% conventional treatment performed 531 patients 88.5% five hundred thirty one patients 88.5% underwent r0 resection 69 patients 11.5% underwent r1 resection we observed stage disease 140 patients 23.3% stage ii disease 178 patients 29.7% stage iii0 disease 208 patients 34.7% stage iv disease 52 patients 8.7% there differences characteristics patients three groups neoadjuvant rt surgical approach methods p=0.003 p=0.005 respectively table 1 total 548 patients 91.3% preoperative wbc counts 10,000/mm 52 patients 8.7% increased preoperative wbc counts 10,000/mm postoperative wbc counts exceeded 10,000/mm 417 patients 69.5% including 74 cases 45.8% group 198 cases 33.0% group ii 127 cases 21.2% group iii preoperative wbc counts correlated significantly disease stage p=0.047 particular increased preoperative wbc counts noted patients stages ii iii data shown however neither postoperative wbc counts number days required leukocyte count fall 10,000/mm correlated disease stage p=0.394 p=0.402 respectively patients received preoperative radiotherapy patients laparoscopic surgery statistically significant shorter wbc normalization periods compared patients without preoperative radiotherapy conventional surgery the results show significant difference postoperative wbc normalization period combined resection organs p=0.329 the duration postoperative hospital stay according wbc normalization period follows group 127.1 days median 11.0 days group ii 12.37.3 days median 10.0 days group iii 14.87.9 days median 12.0 days however significant differences groups ii significant correlations groups regards preoperative neutrophil count p<0.001 lymphocyte count p=0.001 monocyte count p<0.001 platelet count p=0.001 correlation preoperative nlr p=0.47 table 1 in univariate survival analyses tumor node metastasis tnm stage monocyte count significantly associated cancer free survival p<0.01 parameters in addition cancer free survival outcomes significantly worse patients required four days normalization wbc count hazard ratio hr 1.652 95% confidence interval ci 1.105 2.468 p=0.014 a tnm stage greater ii nlr significantly associated duration overall survival p<0.050 p=0.045 respectively correlation observed dsnlc duration overall survival table 2 cancer free overall survival curves shown according stage time leukocyte count decline 10,000/mm monocyte count figs 1 2 3 respectively no correlation revealed elevated preoperative postoperative wbc counts 1010 cancer free overall survival multivariate analysis significant variables except curative resection tnm stage stage ii hr 3.545 95% ci 1.571 7.997 p=0.002 stage iii hr 6.115 95% ci 2.818 13.447 p<0.001 stage iv hr 15.928 95% ci 6.974 36.378 p<0.001 interval longer four days normalization wbc counts hr 1.509 95% ci 0.999 2.278 p=0.050 monocyte count hr 2.133 95% ci 1.262 3.605 p=0.005 independently associated cancer free survival table 3 the male female ratio patients 1.48:1 mean age 62.311.5 years three hundred fifty patients 58.2% 65 years old 250 patients 41.7% 65 years old the follow period ranged 1 72 months mean 27.418.2 months tumors localized right side colon 156 patients 26.0% left side colon 250 patients 41.7% rectum 184 patients 30.7% multiple areas 10 patients 1.7% there differences groups regards complication cancer defined perforating obstructing colorectal lesions among rectal cancer patients laparoscopic treatment performed 69 patients 11.5% conventional treatment performed 531 patients 88.5% five hundred thirty one patients 88.5% underwent r0 resection 69 patients 11.5% underwent r1 resection we observed stage disease 140 patients 23.3% stage ii disease 178 patients 29.7% stage iii0 disease 208 patients 34.7% stage iv disease 52 patients 8.7% there differences characteristics patients three groups neoadjuvant rt surgical approach methods p=0.003 p=0.005 respectively table 1 in total 548 patients 91.3% preoperative wbc counts 10,000/mm 52 patients 8.7% increased preoperative wbc counts 10,000/mm postoperative wbc counts exceeded 10,000/mm 417 patients 69.5% including 74 cases 45.8% group 198 cases 33.0% group ii 127 cases 21.2% group iii preoperative wbc counts correlated significantly disease stage p=0.047 particular increased preoperative wbc counts noted patients stages ii iii data shown however neither postoperative wbc counts number days required leukocyte count fall 10,000/mm correlated disease stage p=0.394 p=0.402 respectively patients received preoperative radiotherapy patients laparoscopic surgery statistically significant shorter wbc normalization periods compared patients without preoperative radiotherapy conventional surgery the results show significant difference postoperative wbc normalization period combined resection organs p=0.329 the duration postoperative hospital stay according wbc normalization period follows group 127.1 days median 11.0 days group ii 12.37.3 days median 10.0 days group iii 14.87.9 days median 12.0 days however significant differences groups ii significant correlations groups regards preoperative neutrophil count p<0.001 lymphocyte count p=0.001 monocyte count p<0.001 platelet count p=0.001 correlation preoperative nlr p=0.47 table 1 univariate survival analyses tumor node metastasis tnm stage monocyte count in addition cancer free survival outcomes significantly worse patients required four days normalization wbc count hazard ratio hr 1.652 95% confidence interval ci 1.105 2.468 p=0.014 a tnm stage greater ii nlr significantly associated duration overall survival p<0.050 p=0.045 respectively correlation observed dsnlc duration overall survival table 2 cancer free overall survival curves shown according stage time leukocyte count decline 10,000/mm monocyte count figs 1 2 3 respectively no correlation revealed elevated preoperative postoperative wbc counts 1010 cancer free overall survival multivariate analysis significant variables except curative resection tnm stage stage ii hr 3.545 95% ci 1.571 7.997 p=0.002 stage iii hr 6.115 95% ci 2.818 13.447 p<0.001 stage iv hr 15.928 95% ci 6.974 36.378 p<0.001 interval longer four days normalization wbc counts hr 1.509 95% ci 0.999 2.278 p=0.050 monocyte count hr 2.133 95% ci 1.262 3.605 p=0.005 independently associated cancer free survival table 3 in univariate survival analyses tumor node metastasis tnm stage monocyte count significantly associated cancer free survival p<0.01 parameters in addition cancer free survival outcomes significantly worse patients required four days normalization wbc count hazard ratio hr 1.652 95% confidence interval ci 1.105 2.468 p=0.014 a tnm stage greater ii nlr significantly associated duration overall survival p<0.050 p=0.045 respectively correlation observed dsnlc duration overall survival table 2 cancer free overall survival curves shown according stage time leukocyte count decline 10,000/mm monocyte count figs 1 2 3 respectively no correlation revealed elevated preoperative postoperative wbc counts 1010 cancer free overall survival multivariate analysis significant variables except curative resection tnm stage stage ii hr 3.545 95% ci 1.571 7.997 p=0.002 stage iii hr 6.115 95% ci 2.818 13.447 p<0.001 stage iv hr 15.928 95% ci 6.974 36.378 p<0.001 interval longer four days normalization wbc counts hr 1.509 95% ci 0.999 2.278 p=0.050 monocyte count hr 2.133 95% ci 1.262 3.605 p=0.005 independently associated cancer free survival table 3 first inflammatory diseases increase risk developing many types cancer inflammatory cells second chemokines cytokines present microenvironment tumors experimental animal models humans earliest stages development mentioned experimental mouse model creates inflammatory reaction peritoneum confers increased metastatic burden wound site compared undamaged normal peritoneal tissues furthermore model demonstrates abundance pro inflammatory cells wound site likely induces mesothelial cells peritoneum consequently increase mesothelial cells inflammatory cells constitute pro metastatic microenvironment normal peritoneum in addition early stages wound healing wound metastasis occurs wounds continued inflammation confirmed wound metastasis occurs even seven days wound healing glasgow prognostic score gps includes serum c reactive protein serum albumin prognostic value independent stage patients advanced primary operable cancer in addition nlr plr shown independent prognostic value variety cancers 5 8 these studies demonstrate prognostic values nlr plr independent tumor stage conventional scoring systems treatment modalities furthermore studies conducted leitch et al show monocyte count gps independently associated cancer specific survival study monocyte count significantly associated cancer free survival univariate survival analysis postoperative wbc count 1010 reveal correlation cancer free survival overall survival most studies mentioned examined effects preoperative inflammatory condition however research presented report focus one point time rather certain period inflammatory condition great effect metastatic microenvironment this idea brought fact mmp-9 increases first three days postoperatively wound healing early postoperative changes affect peritoneal metastasis observed author prior animal model experiment study 4 12 thus current study regardless preoperative postoperative inflammatory status groups classified normalization wbc count the period metastatic microenvironment exposed inflammation defined period wbc count normalized the results show significant differences groups cancer location extent curative resection stage these results demonstrate differences surgical methods according stage affect postoperative wbc count dsnlc univariate analysis presence increased wbcs preoperative stages affect duration disease free survival overall survival on hand sustained inflammation four days affect disease free survival overall survival we analyze sustained inflammation also systematic effect like result three day inflammatory cell increase wound healing process effect peritoneal metastasis moreover dsnlc independently associated cancer free survival multivariate survival analysis other studies shown elevated gps may reflect altered innate immune response gps also associated increased numbers neutrophils monocytes this may suggest activation innate immunity rather regulation acquired immunity important factor determining poor outcome patients colorectal cancer one study also revealed early increase wbcs surgery correlates increased innate immune response in addition increase wbcs better prognostic parameter increase monocytes nlr study an early operative increase wbc correlates increased innate immunity increase predictive poorer outcome colorectal cancer monocyte nlr increase shows increase innate immunity one point time preoperative wbc count shows correlation increase cancer stage exception stage iv iv since neoadjuvant chemotherapy performed increase wbcs may lower stages ii iii in addition patients receiving preoperative radiation show statistically significant shorter periods normalization wbc counts compared patients receiving radiation therapy generally radiation therapy numerous inflammatory cells recruited irradiation field gross inflammatory scores microscopic inflammatory scores significantly higher colonic anastomotic line preoperative irradiation however colorectal cancer systemic effect radiotherapy may substantial instead accompanying chemotherapy may reason shorter period normalization wbc count in addition shorter wbc count normalization period following laparoscopic surgery advantage minimally invasive surgery en bloc resection radical lymphadenectomy is performed laparoscopic surgery center manner open surgery since difference operative extent surgical methods shorter wbc count normalization period decreased persistence inflammation attributable laparoscopic surgery however difference duration disease free survival laparoscopic open surgery postoperative increase wbc count many contributory factors cancer cell surgical complications radiation therapy chemotherapy surgical methods whatever causative factor increase postoperative wbcs affects metastatic microenvironment eventually contributes cancer recurrences wbc count decrease observed cases preoperative radiation chemotherapy laparoscopic surgery more research necessary relatively cases thus factors selection bias influence results complicated cancer defined perforating obstructing colorectal lesions shows correlation increase preoperative wbc count p=0.004 differences groups p=0.694 data shown this fact shows complicated colorectal cancer correlative normalization wbc count unless lesion persists in addition wbc count normalization period surgery correlate presence combined resection rather correlated duration postoperative hospital stay study three factors surgical approach method preoperative radiation therapy postoperative hospital stay found associated difference time period normalization wbc count postoperative complications factors preoperative period factors affect cancer may also considered among additional factors unfortunately postoperative complications recorded prospectively postoperative complications omitted factor leading inaccuracy retrospective study represents shortcoming study taking account postoperative hospital stay inferred postoperative complications likely correlation in summary postoperative early inflammatory phase preoperative monocyte count correlate poor prognosis colon cancer even calibration stage thus conclude preoperativeand postoperative inflammatory response period unfavorably affect metastatic microenvironment

purposecancer - related inflammation affects many aspects of malignancy . we confirm the effects of early postoperative systemic inflammation on cancer prognosis.materials and methodssix hundred consecutive patients underwent surgery for colorectal cancer from 2006 to 2009 . measurements of white blood cells , neutrophils , lymphocytes , monocytes , and platelet counts were performed preoperatively , daily until the fourth postoperative day , and subsequently every two days . patients were divided into three groups based on the days spent on the leukocyte count to drop below 10,000/mm3 after surgery.resultspreoperative white blood cell ( wbc ) counts correlated with stage of disease . in univariate survival analyses , tumor , node , metastasis ( tnm ) stage , and monocyte count were associated with cancer - free survival . in addition , cancer - free survival outcomes were worse in patients who required more than four days for the normalization of wbc count . a tnm stage greater than ii and the neutrophil lymphocyte ratio were associated with the duration of overall survival . in a multivariate analysis of these significant variables , tnm stage , an interval longer than four days for normalization of wbc counts and monocyte count independently associated with cancer - free survival.conclusionpostoperative early inflammatory phase and preoperative monocyte count correlate with poor colon cancer prognosis . we can conclude that preoperative and postoperative inflammatory response and period unfavorably affect the metastatic microenvironment .

tailgut cysts also known retrotrectal cystic hamartomas rare congenital developmental lesions arising postnatal primitive gut remnants generally occur retrorectal space also described prerectal perirenal locations the retrorectal space potential space bound anteriorly mesorectum posteriorly sacrum the superior border formed peritoneal reflection inferior border formed rectosacral fascia the lateral borders retrorectal space formed ureters iliac vessels sacral nerve roots lateral stalks rectum the retrorectal space contains loose connective tissue middle sacral iliolumbar middle hemorrhoidal vessels branches sympathetic parasympathetic nervous systems lymphatics the anatomical position rarity lesion lead difficulty first diagnosis lesion often misdiagnosed second surgical management condition often suboptimally managed these tailgut cysts predominantly occur women average age presentation 35 years rertrorectal tumors frequently asymptomatic found incidentally evaluation unrelated physical complaints half patients present symptoms low back rectal pain pain defecation rectal bleeding urinary frequency etc furthermore retrorectal lesions women mimic gynecological pathology risk malignant transformation tailgut cyst always exists despite role preoperative biopsy retrorectal tumors controversial authors agree harmful useful option this preoperative high resolution modern imaging techniques pelvic computed tomography ct magnetic resonance imaging mri play crucial role differential diagnostics retrorectal tumors planning surgical management retrorectal lesions including tailgut cysts complete surgical resection negative margins still remains cornerstone surgical treatment eliminates potential recurrence hemorrhage infection compression malignant changes a 40-year old female referred institution history lower back swelling since 2 years she consulted surgeon regional hospital 1 year back misdiagnosed abscess the swelling subjected incision drainage regional hospital without success later patient referred us ultrasonography pelvic organs demonstrated ill defined large cystic lesion 8 cm 7 cm posterior uterus the margins could well defined due distal acoustic shadowing adjacent gut loops a lumbosacral contrast enhanced ct cect figures 1 2 demonstrated well defined fluid density mass collection enhancing walls retrorectal presacral precoccygeal area measuring 7.9 cm 11.2 cm 11.5 cm anterolateral displacement rectum left side extending posterior sacrum coccyx infracoccygeal region forming fluid collection enhancing walls 4.5 cm 4.8 cm 13.5 cm cect report suggested lesion likely represent tailgut duplication cyst retrorectal cystic hamartoma bilobed retrorectal cyst axial view retro rectal tailgut cyst following discussion decided surgical excision lesion appropriate course action given symptomatology uncertain malignant potential a vertical incision given swelling sacrococcygeal area facilitated en bloc removal sacrococcygeal cystic mass figures 3 4 the peritoneum overlying pelvic brim incised posterolaterally mesorectal plane entered the rectum fully mobilized allowing cyst adherent also mobilized removed intact previous scar incision drainage mucoid color fluid aspiration cyst surgical excision cyst posterior approach histopathology revealed multiloculated tailgut cyst containing abundant mucoid material lined glandular mucinous epithelium fibrous tissue showing intestinal glands figure 5 evidence malignancy she remains well 1-year follow evidence recurrence serial pelvic imaging histopathology showing intestinal glands within cyst wall confirming tailgut cyst h e 100 ) embryologically tailgut cysts believed arise vestigial remnants embryonic hindgut the largest reported case series 53 tailgut cysts 35-year period 1950 1985 described hjermstad helwig they found cysts predominantly occurred women female male ratio 3:1 the ages ranged 4 days 73 years average age presentation 35 years symptoms occur due local mass effect surrounding organs rectal fullness constipation painful defecation lower abdominal and/or back pain genitourinary obstruction dysuria infection cysts secondary infection typical symptoms anorectal pelvic abscess fistula perianal sinus bleeding malignant transformation degeneration pain anorectal region retrorectal cystic hamartomas presacral space usually well defined thin walled multicystic unilocular despite fact majority tailgut cysts benign rarely undergo malignant transformation common histopathologic diagnoses adenocarcinoma carcinoid they lined variety epithelia varied among multiple cysts multicystic lesions also within cyst the contents varied clear fluid dense mucous due location tailgut cysts almost palpable rectal examination extrinsic contained fluctuant masses the differential diagnoses classified congenital neurogenic osseous miscellaneous inflammatory excluding inflammatory processes congenital lesions account approximately two thirds retrorectal lesions these include developmental cysts chordomas remnants notochord anterior sacral meningoceles developmental cysts divided according origin histopathological features tailgut cysts enteric duplication cysts dermoid cysts epidermoid cysts teratomas plain films investigation presacral masses limited use may show evidence bony destruction suggesting malignancy osseous lesion rarely may identify sacrococcygeal anomaly associated tailgut cysts transrectal ultrasound may useful demonstrating integrity layers rectum well revealing cystic lesion clarifying whether unilocular multilocular the appearance tailgut cyst ct imaging usually well defined thin walled uni- multi locular nonenhancing lesion retrorectal space calcification tend feature tailgut cysts reported present may suggest possibility malignancy case get mri scan done quite obvious ct scan mri become modality choice image tailgut cysts multiplanar imaging capability allowing imaging surgically relevant planes well good soft tissue contrast mri typically demonstrates retrorectal lesion low signal intensity t1-weighted images high signal intensity t2 weighted images although may vary depending cyst content malignancy suspected focal irregular wall thickening intermediate signal intensity contrast t1- t2-weighted images enhancement contrast historically classical treatment area consists different approaches anterior transabdominal posterior approaches inter sphincteric trans sphincteric parasacrococcygeal trans sacral trans sacrococcygeal trans anorectal transvaginal current case combined approach posterior trans abdominal undertaken lesion could removed solely posterior approach due large retrorectal component adhesions rectum on follow patient relieved discomfort constipation swelling patient advised visit hospital 36 monthly 1 year yearly fresh complaints appear there standard recommendation follow tailgut cysts literature follow rare condition therefore clinical case specific if patient develops symptomatology targeted cross sectional imaging instituted presence abnormal histology serial perineal examination cross sectional imaging advised the anatomical position rarity tailgut cyst lead difficulty firstly diagnosis lesion often misdiagnosed secondly surgical management condition often suboptimally managed surgical excision treatment choice tailgut cysts provides definitive diagnosis relieves symptoms prevents possible complications infection fistula formation malignant degeneration preoperative imaging ct mri essential plan appropriate surgical approach one alert separating cyst rectal wall prevent inadvertent injury rectum

retrorectal cystic hamartoma , also known as tailgut cyst , is a rare congenital developmental lesion arising from postnatal primitive gut remnants in the retrorectal space . the rarity of the lesion and its anatomical position usually leads to difficulty in diagnosis and surgical management . this cyst predominantly occurs in women ( female to male ratio , 3:1 ) . tailgut cysts can present as incidental findings during the routine examination but over half of the patients are thought to present with symptoms . computed tomography or magnetic resonance imaging has a crucial role in diagnosing these misdiagnosed cysts . complete surgical excision is the treatment of choice for tailgut cysts as this provides a definitive diagnosis , relieves symptoms , and prevents possible complications such as infection , fistula formation , and malignant degeneration . we present a case of a 40-year - old female , who presented to us with lower back swelling ( 7 cm 5 cm ) for last 2 years , which had become more prominent to her while sitting . the patient was investigated . ultrasonography demonstrated ill - defined large cystic lesion ( 8 cm 7 cm ) , posterior to the uterus . fine needle aspiration cytology suggested sebaceous cyst . a lumbosacral contrast - enhanced computed tomography demonstrated well - defined fluid density mass / collection with enhancing walls in the retrorectal , presacral , precoccygeal area , and suggested tailgut duplication cyst / retrorectal cystic hamartoma . surgical complete excision of the cystic mass was done with both anterior ( transabdominal ) and posterior approach . histopathology confirmed a tailgut cyst .

ala al din abu al hassan ali ibn abi hazm al qarshi al dimashqi known ibn al nafis 1210 1288 ad muslim syrian physician primarily famous first describe pulmonary circulation blood the voluminous books alshamel fi sanaat tebbiat comprehensive medical encyclopedia the aim review article tribute ibn al nafis introduce valuable neglected encyclopedia materia medica ibn al nafis traditional approach alshamel fi sanaat tebbiat book studied present article alshamel fi sanaat tebbiat covers three branches knowledge first category devoted theoretical traditional medicine the third category materia medica covering aspect unani medicine 28 volumes comprehensive book traditional medicine found far the latter introduces mono ingredient medications alphabetical order chapter several parts is dedicated botanical characteristics nature mono ingredient medication addition book explains traditional pharmacokinetic every single medication human body organs based pharmaco mechanistic perspective alshamel fi sanaat tebbiat could considered main reference book traditional medicine pharmacy worthy revival

background : ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi , known as ibn al - nafis ( 1210 - 1288 ad ) , was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood . the most voluminous of his books is alshamel fi sanaat tebbiat , which is a comprehensive medical encyclopedia . it comprised 300 volumes of notes , from which only 80 volumes are published . his writings are cataloged in many libraries around the world . the aim of this review article , as a tribute to ibn al - nafis , was to introduce his valuable but neglected encyclopedia of materia medica.methods:ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article.results:alshamel fi sanaat tebbiat covers three branches of knowledge . the first category is devoted to theoretical traditional medicine . the second is in four sections where much of it is not available yet . the third category is on materia medica covering the aspect of unani medicine , from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far . the latter , introduces mono - ingredient medications in alphabetical order . each chapter , in several parts , is dedicated to the botanical characteristics and nature of each mono - ingredient medication . in addition , this book explains traditional pharmacokinetic of every single medication for each human body organs.conclusion:based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat , it could be considered as the main reference book on traditional medicine and pharmacy , worthy of revival .

fondaparinux sodium new synthetic sulfated pentasaccharide selective coagulation factor xa inhibitor safe effective antithrombotic agent indicated preventing thrombus formation patients acute coronary syndromes including st segment elevation myocardial infarction stemi non stemi nstemi unstable angina it pure unique chemical entity consisting five saccharide units pentasaccharide obtained entirely chemical synthesis however inhibition factor xa results effective linear dose dependent inhibition thrombin generation whether triggered intrinsic extrinsic pathways unlike conventional antithrombotics lmwhs enoxaparin act multiple targets within coagulation cascade thereby increasing propensity causing bleeding complications thus fondaparinux favorable tolerability profile particularly regard risk major bleeding oasis-5 trial fondaparinux shown reduce major bleeding similar short term efficacy enoxaparin lowers death stroke long term follow patients acute coronary syndromes undergoing percutaneous coronary intervention similarly shown superior enoxaparin reducing death ischemic events 9 days maintaining efficacy 6 months patients unstable angina nstemi major bleeding occurring fewer fondaparinux enoxaparin recipients on comparison heparin based therapy fondaparinux reduce mortality ischemic events major bleeding across full spectrum acute coronary syndromes thus assumed projected existing knowledge fondaparinux selective action may prove safe efficacious there reports heparin induced thrombocytopenia hit related fondaparinux patient previously exposed unfractionated heparin ufh delayed onset hit caused prophylaxis in contrast used sometimes label management hit thrombosis major bleeding known exist use fondaparinux previously exposed heparin user best knowledge exist isolated case report presenting fondaparinux induced major bleeding elderly postmenopausal women prescribed recently diagnosed nstemi we hereby report rare case fondaparinux induced major bleeding 58-year old postmenopausal woman known hypertensive type 2 diabetes mellitus t2 dm patient prescribed nstemi reported adrm centre the patient presented emergency complaints chest pain relieved sublingual nitrate examination pulse rate 94/min regular normal volume radio femoral delay vessel wall palpable blood pressure bp measured limbs 160/90 mmhg laboratory investigations revealed hb 11g% tlc 8400/cmm platelet count 2.4 lacs cmm rbs 194 mg% blood urea 29 mg serum creatinine 0.9 mg hba1c 7.8% serum cholesterol 245 mg% serum triglyceride 185 mg% hdl 35 mg% ecg done immediately showed nstemi positive 10 hour troponin assay patient treated oxygen morphine beta blocker ace inhibitor statins aspirin clopidogrel fondaparinux 2.5 mg daily subcutaneous route third day patient developed purpura extensive ecchymosis right arm forearm figures 1 2 the patient also developed epistaxis lasting 10 min required ent intervention well macroscopic hematuria lasting 3 days there signs deep venous thrombosis pulmonary embolism gangrene retroperitoneal intracranial intraocular hemorrhage patients suggested usg abdomen mri brain based clinical laboratory findings diagnosis fondaparinux induced major bleeding established after platelet count hb rapidly reestablished 1.5 l cmm 8.9 g% she discharged satisfactory condition 15 days hospitalization regular follow prophylaxis treatment mi since adr serious likely thought associated fondaparinux previous known reports extensive ecchymoses right arm forearm patient extensive ecchymoses right arm forearm patient closer view de challenge drug blood platelet transfusion caused adr ameliorate challenge done fear reappearance adr due ethical constrains thus appearance major bleeding could explained concurrent disease drug chemicals de challenge improved condition probable likely per causality assessment score 6 since adr studied dose dependent response unpredictable unusual per mechanism action known hence could clearly labeled type b class adr anticoagulation traditionally ufh cornerstone therapy patients unstable coronary artery disease cad however ufh exhibits unpredictable anticoagulant effect requires frequent monitoring low bioavailability due high protein binding induced thrombocytopenia an effort avoid inherent limitation ufh led introduction low molecular weight heparin lmwh enoxaparin dalteparin nadoparin reviparin latest addition armamentarium countering thrombotic events unstable cad fondaparinux it synthetic pentasaccharide acts selective inhibitor activated factor x. mechanism action fondaparinux involves high affinity reversible binding antithrombin iii resultant conformational change serpin reactive loop greatly enhances antithrombin iii basal rate factor xa inactivation fondaparinux acts antithrombin iii catalyst one molecule fondaparinux leading inhibition many factors xa molecules because selectively proposed devoid major bleedings unlike current report as longevity constantly increasing numbers elderly patients require anticoagulation also rising steadily managing elderly patients receiving anticoagulants challenging patients high risk thrombosis bleeding moreover older patients commonly frail substantial chronic comorbid conditions including renal impairment frequent acute illnesses often many medicines there remains clear need optimize use anticoagulant drugs patients suggested current case report the current case report highlights need clinicians sound understanding anticoagulant pharmacology dosing toxicity individualized approach predicting risk bleeding prescribed advancing age persons

fondaparinux sodium is a synthetic , sulfated pentasaccharide , selective factor xa inhibitor , a safe and effective antithrombotic agent indicated for preventing thrombus formation in patients with acute coronary syndromes , including those with st - segment elevation myocardial infarction ( stemi ) , non - stemi ( nstemi ) , or unstable angina . major bleeding is rarely known to exist with the use of fondaparinux and to best of our knowledge there exist no isolated case report presenting with fondaparinux - induced major bleeding prescribed for recently diagnosed nstemi . the case report highlights , a need for clinicians to have a sound understanding of anticoagulant pharmacology , dosing , toxicity , individualized approach , and predicting the risk of bleeding before they are prescribed to advancing age persons .

orotracheal intubation suitable assessing dental relationship occlusion nasotracheal intubation contraindicated patients nasoorbitoethmoidal fractures fractures base skull owing potential complications cerebrospinal fluid leakage meningitis tracheostomy provides alternative surgical intervention associated increased post operative care complication rates morbidity we present two cases submental intubation using reinforced endotracheal tube non detachable universal connector patients complex maxillofacial trauma an 18-year old male patient 60 kg 170 cm scheduled open reduction internal fixation nasoorbitoethmoidal fracture fig preliminary investigations indicated otherwise healthy preanesthetic evaluation unremarkable except signs sinus bradycardia 41 bpm as intra operative assessment dental occlusion required orotracheal intubation indicated nasotracheal intubation also inappropriate due nasoorbitoethmoidal fracture order avoid tracheostomy the patient monitored pulse oximetry electrocardiography noninvasive blood pressure measurements anesthetic induction after preoxygenation 100% oxygen 3 minutes anesthesia induced propofol 100 mg fentanyl 100 g after successful ventilation facial mask rocuronium 50 mg administered intravenously prior intubation universal connector reinforced endotracheal tube ett detached gently tube reattached could easily disconnected procedure fig orotracheal intubation performed using 7.5-mm internal diameter reinforced ett lo contour oral nasal tracheal tube cuffed mallinckrodt ireland anesthesia maintained sevoflurane 100% oxygen increase apneic reservoir procedure approximately 3 cm lateral mandibular midline submental horizontal incision 1.5 cm placed fingerbreadth mandibular inferior border blunt dissection toward mouth floor performed using thin mosquito hemostat forming orocutaneous tunnel a kelly forceps introduced tunnel outside widen at moment ett disconnected ventilator circuit connector removed the ett grasped tip kelly forceps pulled tunnel sub mental incision followed pilot balloon ett shifted then ett repositioned using magill forceps stay suture applied silk order fix tube skin prevent accidental extubation fig stay suture removed ett pilot balloon retracted oral cavity removed via mouth brought back orotracheal position the submental incision layer sutured wet gauze dressing applied site wound mouth floor facilitate secondary healing following procedure extubation performed patient transferred post anesthetic care unit the post operative period unremarkable negligible submental scarring two months post operation 48-year old male patient 65 kg 175 cm sustained bilateral orbital wall maxillary fractures skull base fracture motor vehicle accident he undergone brain surgery epidural hematoma removal 11 days prior level consciousness alert intubation following operation unnecessary the patient monitored pulse oximetry electrocardiography noninvasive blood pressure measurements after preoxygenation 100% oxygen 3 minutes anesthesia induced propofol 80 mg rocuronium 50 mg following orotracheal intubation reinforced ett internal diameter 7.5 mm tube removed submental area using aforementioned method after operation patient transferred intensive care unit extubated post operative day 1 an 18-year old male patient 60 kg 170 cm scheduled open reduction internal fixation nasoorbitoethmoidal fracture fig preliminary investigations indicated otherwise healthy preanesthetic evaluation unremarkable except signs sinus bradycardia 41 bpm as intra operative assessment dental occlusion required orotracheal intubation indicated nasotracheal intubation also inappropriate due nasoorbitoethmoidal fracture order avoid tracheostomy the patient monitored pulse oximetry electrocardiography noninvasive blood pressure measurements anesthetic induction after preoxygenation 100% oxygen 3 minutes anesthesia induced propofol 100 mg fentanyl 100 g after successful ventilation facial mask rocuronium 50 mg administered intravenously prior intubation universal connector reinforced endotracheal tube ett detached gently tube reattached could easily disconnected procedure fig orotracheal intubation performed using 7.5-mm internal diameter reinforced ett lo contour oral nasal tracheal tube cuffed mallinckrodt ireland anesthesia maintained sevoflurane 100% oxygen increase apneic reservoir procedure approximately 3 cm lateral mandibular midline submental horizontal incision 1.5 cm placed fingerbreadth mandibular inferior border blunt dissection toward mouth floor performed using thin mosquito hemostat forming orocutaneous tunnel a kelly forceps introduced tunnel outside widen at moment ett disconnected ventilator circuit connector removed the ett grasped tip kelly forceps pulled tunnel sub mental incision followed pilot balloon ett shifted then ett repositioned using magill forceps stay suture applied silk order fix tube skin prevent accidental extubation fig stay suture removed ett pilot balloon retracted oral cavity removed via mouth brought back orotracheal position the submental incision layer sutured wet gauze dressing applied site wound mouth floor facilitate secondary healing following procedure extubation performed patient transferred post anesthetic care unit the post operative period unremarkable negligible submental scarring two months post operation a 48-year old male patient 65 kg 175 cm sustained bilateral orbital wall maxillary fractures skull base fracture motor vehicle accident he undergone brain surgery epidural hematoma removal 11 days prior level consciousness alert intubation following operation unnecessary the patient monitored pulse oximetry electrocardiography noninvasive blood pressure measurements after preoxygenation 100% oxygen 3 minutes anesthesia induced propofol 80 mg rocuronium 50 mg following orotracheal intubation reinforced ett internal diameter 7.5 mm tube removed submental area using aforementioned method after operation patient transferred intensive care unit extubated post operative day 1 although orotracheal intubation frequently used route securing airway interferes surgical field disturbs intra operative assessment dental occlusion alternative orotracheal intubation nasotracheal intubation nasotracheal intubation contraindicated cases skull base trauma due incidence accidental intracranial placement possible cerebral spinal fluid leakage and/or meningitis tracheostomy good route secure airway patients complex maxillofacial injuries particularly need prolonged intubation however procedure associated risk hemorrhage pneumothorax infection tracheal stenosis used attractive option intra operative airway control specific complex maxillofacial injuries submental intubation also applied bimaxillary orthognathic surgeries simultaneous rhinoplasty orthognathic surgeries patients large pharyngeal flaps anatomic anomalies precluding nasotracheal intubation other possible indications technique certain base skull procedures cancrum oris submental intubation contraindicated patients severe neurological defects require long term airway support maintenance cases tracheostomy considered patients history severe keloid formation technique contraindicated first case endotracheal intubation indicated circumstances prevented intra operative assessment dental occlusion nasotracheal intubation also inappropriate due nasoorbitoethmoidal fracture healthy exception nasoorbitoethmoidal fracture and did require prolonged ventilatory support decision choose submental intubation tracheostomy greater significance second case nevertheless submental intubation chosen alert mental status addition unrequired use long term airway support flexible kink resistant ett required maintain airway patency despite acute angle airway particularly submental route ball et al reported submental intubation using flexible tracheal tube supplied intubating laryngeal mask ilm intavent uk however rare market expensive compared reinforced tube lo contour oral nasal tracheal tube cuffed mallinkrodt ireland the universal connector standard reinforced ett used bounded firmly tube prevent accidental detachment prior intubation important detach reattach connector gently ett using mosquito forceps easily disconnected procedure as discussed tracheostomy associated increased postoperative care complication rate morbidity comparison the complications associated submental intubation less severe lower frequency respect surgery as maxillofacial trauma often result dental disarrangement dental occlusion becomes clinically important submental intubation removes ett surgical field thereby providing clear surgical field also assists preventing injuries ett additional advantages submental intubation include minimally invasive nature esthetically acceptable nature resulting scar the serious complication accidental extubation however prevented via stay suture used cases other complications superficial skin infections damage ett tube dislodgement obstruction transient lingual nerve paresthesia venous bleeding submental scarring the submental intubation technique reliable alternative tracheostomy patients undergoing complex maxillofacial surgeries require prolonged ventilatory support it minimal morbidity low complication rate avoids potential complications associated tracheostomy

airway management in patients with complex maxillofacial injuries is a challenge to anesthesiologists . submental intubation is a useful technique that is less invasive than tracheostomy in securing the airways where orotracheal and nasotracheal intubation can not be performed . this procedure avoids the use of tracheostomy and bypasses its associated morbidities . a flexible and kink - resistant reinforced endotracheal tube with detachable universal connector is commonly used for submental intubation . herein , we report cases involving submental intubation using a reinforced endotracheal tube with a non - detachable universal connector in patients with complex maxillofacial injuries .

fixed drug eruption fde distinctive variant drug induced dermatoses characterized sharply demarcated erythematous patches without blistering develop within hours administration causative drug heals postinflammatory residual hyperpigmentation it usually recurs site skin mucous membrane upon subsequent exposure similar group drugs fluoroquinolones widely used antimicrobials cause cutaneous adverse drug reactions 1 2% patients however bullous fde rarely reported herein report rare case fde induced ciprofloxacin followed ofloxacin administration a 37-year old male presented outpatient dermatology department hospital puducherry history multiple fluid filled blisters hands feet figures 1 2 he stated lesions appeared within 5 h taking single dose oral ofloxacin obtained counter drug fever local private medical shop history itching hands feet followed burning sensation subsequent development multiple fluid filled lesions present there previous history medical conditions allergy atopic dermatitis on inquiry recalled history similar episode 1 year back ciprofloxacin prescribed fever time physical examination revealed multiple flaccid bullous lesions intact roof blister erythematous base seen proximal metacarpophalangeal joint left thumb left instep sole right dorsal big toe little toe left foot diagnosis fde caused ofloxacin made taking account previous history fde induced ciprofloxacin clinical signs patch test done patient give consent the causative drug ofloxacin discontinued patient treated antihistaminics topical emollients lesions symptoms improved gradually within week leaving behind residual hyperpigmentation patient advised take fluoroquinolones future well defined bullous lesion instep left foot bullous lesions right dorsal toe fluoroquinolones commonly used antimicrobials effective gram negative gram positive bacteria treatment various bacterial infections generally well tolerated common side effects include gastrointestinal effects nausea vomiting diarrhea neuropsychiatric symptoms headache insomnia photosensitivity morbilliform rash reported fluoroquinolones fde quite uncommon large number drugs reported elicit fdes trimethoprim sulfamethoxazole tetracyclines penicillin erythromycin nonsteroidal antiinflammatory drugs barbiturates valproate phenytoin phenolphthalein nitroimidazoles even though pathogenesis fde known certain serum factors antibodies cell mediated immunity attributed causative factors localized tissue damage results intra epidermal cd cells activated kill surrounding keratinocytes release cytokines interferon gamma microenvironment quinolones cause delayed type ige mediated hypersensitivity reactions case the following criteria considered previous conclusion reports reaction 1 adverse event appeared ofloxacin administered 2 adverse event improved ofloxacin discontinued 1 adverse event reappeared ofloxacin administered 0 alternate causes could solely caused reaction 2 reaction reappeared placebo given 0 drug detected blood fluids concentration known toxic 0 reaction severe dose increased less severe dose decreased 0 patient similar reaction ciprofloxacin previous exposure 1 adverse event confirmed objective evidence 1 probable reaction ofloxacin administration according uppsala monitoring centre causality assessment system patient fde ciprofloxacin 1 year back followed similar reaction ofloxacin current admission cross reaction quinolone families clinically manifested fde rarely reported literature best knowledge only one case cross reactivity ciprofloxacin ofloxacin reported far proposed probable mechanism would complex quinolone piperazine residue antigenic determinant ciprofloxacin ofloxacin bullous fde due fluoroquinolones included differential diagnosis fde suspected our case described cross sensitivity two fluoroquinolones ciprofloxacin ofloxacin used within 1 year interval time hence health care providers aware diagnosis proper management fde patients warned use anti microbials without physician advice

fixed drug eruptions ( fde ) are the common dermatological adverse drug reaction accounts for 1621% of all cutaneous drug reactions in india . drugs most frequently implicated in fde are antimicrobials , anticonvulsants , and nonsteroidal antiinflammatory drugs . here , we report a rare case of bullous fde due to ciprofloxacin followed by ofloxacin administration .

fierce competition better mating partners driving force evolution diverse forms behaviors sex related traits fertilization sperms multiple males this natural experimentation every single fertilization selected sperms work best fertilization environment leading diversification sperm morphology result sperm competition although tadpole like sperm morphology mammals represents remarkable perfection swimming cell machinery extensive diversification sperm morphology physiology has observed across species serving resource resolving species phylogenies evolution sperm tail insects arthropods particularly rapid diverse ranging aflagellate multi flagellate cases develops extraordinary long tails sperm competition any advantageous traits sperm outdo competitors better swimmer longer survival blocking competitors dimorphism etc directly contribute fertilization reproductive success descendant females also strong evolutionary pressure gain control fertilization process pick sperms particular male choice among taxa wide birds reptiles insects females sperm storage organs specially adapted sperm selection thus co evolution sperm female sperm storage organ reported many species sometimes leading develop bizarre morphology organs the co evolution male female reproductive traits drosophila makes unique powerful model exploring evolutionary consequences post copulatory sexual selection fig the drosophilidae great variation sperm length ranging 300 6 cm the female two storage organs seminal receptacle spermathecae sperms stay fertile state waiting ovulation it shown length primary storage organ seminal receptacle positively correlates sperm length across 46 drosophilidae species the length seminal receptacle range 400 8 cm cases slightly longer sperm length it suggested inside thin tubular seminal receptacle sperm different males mixed compete chance reach ovulated egg longer tail helpful position sperm head closer exit seminal receptacle indeed empirically demonstrated longer sperm tail advantageous reproduction it hypothesized length seminal receptacle sperm tail co evolved length incompatibility suppresses fertilization efficiency thereby promoting reproductive isolation order understand genetic basis sperm competition drosophila knowledge cellular basis sperm tail elongation necessary we undertaken cell biological approach identify mechanism sperm tail elongation drosophila two giant mitochondria elongate together microtubules push cell membrane elongating sperm tail study sperm morphogenesis slow due lack genetic tool vitro culture system detailed observation spermatogenesis noguchi miller previously shown carefully dissected spermatids 64 cell cyst model animal drosophila melanogaster testes cultured vitro elongated spermatids separated single sperms individualization axoneme major structure sperm tail propels swimming motion dispensable tail elongation spermatids axoneme less mutants dsas-4 elongated reasonably well vitro consistent previous observation immobile well elongated sperms testes mutants however microtubule inhibitor experiments demonstrated yet another microtubule based structure essential sperm tail elongation fluorescent microscopy electron microscopic analyses revealed cytoplasmic microtubules located vicinity mitochondria arranged parallel longitudinal axis sperm tail based live imaging local drug treatment data found microtubules tail tip region particularly fast turn rate active sliding motion essential sperm tail elongation through genetic perturbation mitochondrial functions discovered mitochondria play essential role sperm tail elongation postmeiotic spermatids a testis specific mitofusin fuzzy onions promotes massive fusion mitochondria form two large pieces mitochondrial derivatives called nebenkern spermatid elongation giant mitochondrial lobes elongate parallel axoneme fill entire length sperm tail fig when final mitochondrial length reduced mutations fuzzy onions mitochondrial derivative sperm tails failed elongate maximum length similar defect elongation observed mutants milton dmiro complex adaptor linking mitochondria microtubule motor protein kinesin in addition found surface spermatid mitochondria serves microtubule organizing center mtoc promoting assembly microtubule array around we propose double membrane architecture mitochondria combined cytoplasmic microtubules serve structural support sustainable elongation sperm tail elongation sliding microtubules growth zone would stretch folded mitochondria expose open surface new microtubule assembly repetition stretch cycle giant mitochondria self promoted structural scaffold addition original role energy sources needed flagellar motion first demonstrated mitochondria play novel role cell morphogenesis acting inner skeleton sperm tail in words mitochondria double membrane organelle mtoc activity actually determine extracellular morphology sperm another double membrane organelle nucleus showing similar morphological diversification sperm across species also likely serving alternative shaping tool sperm morphogenesis second detailed cell biological study tissue specific mitochondrial morphogenesis poorly understood field mitochondria biogenesis typical mitochondria somatic cells 34 length 1 diameter moving along microtubules undergo fusion fission process however cells many specialized tissues great variations mitochondrial number size morphology reported many suggested related tissue specific functions case drosophila sperm morphogenesis motor complex milton dmiro kinesin used mitochondrial trafficking neuronal cells converted elongation machinery much larger mitochondria intriguing questions whether conversion microtubule motor complex mitochondrial trafficking mitochondria dependent microtubule nucleation general mechanisms required morphogenesis mitochondria type cells ordered arrays within muscle fibers muscle cells elongated forms photoreceptor cells human retina having outlined process sperm tail elongation position starting comparative analysis spermatid elongation drosophila melanogaster strains long short sperm since sperm length variation appears occur rapidly regional separation possible search rapidly evolving genes among genes involved key steps spermatid elongation in addition gigantic sperms drosophilidae appear multiple evolutional origins interest search crucial process may permitted appearance long sperm asking step sperm elongation differs closely related species long short sperm measurement size spermatocyte nebenkern speed elongation time required reach full length requirement microtubules mitochondria clarify whether mitochondria driven elongation mechanism used drosophilidae species extremely long sperms one main questions speciation identification mechanism reproductive isolation reducing gene exchange two populations enhancing chance speciation genes fix among them giant sperm reported range taxa including coleopterans divales bipustulatus ptinella patella hemipteran notonecta glauca lepidopteran xenosoma geometrina also large mitochondria frequent feature sperms among insects arthropods thus sperm elongation mechanism described report might general system facilitating sperm size variation among insects giant mitochondria thereby enhancing sexual selection reproductive isolation moreover recent advance transgenesis gene knockout technologies made genetic analysis non model insects feasible therefore cell biological analyses performed drosophila melanogaster may applied species taken together study revealed novel mechanism cell elongation set road map future study address genetic basis sperm competition reproductive isolation

sexual competition has selected a number of extreme phenotypes like the tail ornament of peacock male . sperm tail of drosophilidae elongate up to 6 cm as a result of evolutionary selection for reproductive fitness among competing sperms . sperm elongation takes place post meiotically and can proceed in the absence of an axoneme . here , we used primary cultures of elongating spermatids of d. melanogaster to demonstrate that sperm elongation is driven by interdependent extension of giant mitochondria and microtubule array that is formed around the mitochondrial surface . this work established that , in addition to functioning as an energy source , mitochondria can serve as internal skeleton for shaping cell morphology .

ceramic composite resin esthetic dental materials continuously developing meet functional esthetic demand indirect restorations require appropriate cement long term use changeable oral conditions also meet patients esthetic expectations success indirect restorations it important indirect restorations firmly attached tooth structure resin based cement several different types light curing unit lcu conventional quartz tungsten halogen qth lamps argon laser employed qth lamps emit light electrical energy heats small tungsten filament high temperatures qth curing lights work wavelengths 400 500 nm output ranging 400 800 mw cm light emitting diode led solid state led instead hot filaments used halogen bulbs leds use junctions doped semiconductors generating light recently polywave led units two spectral peaks introduced using two different led colors meaning spectral output ranges blue 460 nm violet wavelengths 410 nm light these lights polymerize composite resins containing conventional alternative photoinitiators since manufacturers direct resin based restorative materials provide details photoinitiators contained products narrow blue led light spectra emission ideal photopolymerization camphorquinone containing materials may efficient photoinitiators 1-phenyl-1,2-propanedione present light composite shades high color value used repair bleached teeth this situation addressed manufacturing dual wave polywave led lcus emitting violet 410 nm blue 470 nm component light spectrum third generation polywave leds used led lcus while many publications discussed physical properties led light cured materials investigated color stability resin based restorative materials cured qth led lights monowave polywave led lcus qth lcus previously compared terms efficiency curing resin cement indirect restorative materials shade matching whether visual instrumental methods requires understanding color harmony tolerance words the e value 2.5 exhibited borderline value recognizable people color test color changes considered visually perceptible e 1 clinically acceptable e 3.3 the cie l*a*b based color difference formula widely used cie l*a*b color appearance attributes frequently used calculate cie l*a*b color difference e equations color differences e calculated using cielab35 color notation system namely l lightness ranging 0 100 higher numbers brighter green red direction b blue yellow direction cielab parameters l b specimen recorded initial final f the purpose study therefore evaluate effect color changes resin cement material polymerized different restorations using different light polymerizing units the hypothesis study would different curing systems different interface materials effects resin cement color stability different time interval conventional halogen qth polywave monowave led lcus interface materials polystyrene strip ceramic composite resin used a list curing lights including specifications manufacturers given table 1 kuraray japan lot 0015 aa resin cement used test groups curing regimes curing conditions the protocol involved 18 groups n 5 three interface materials three different curing systems two time intervals resin cement firmly pressed 5 kgf load 3 min teflon cylindrical mold glass slide covered polystyrene strip kerrhawe stopstrip kerrhawe sa bioggio switzerland lot 70501264 produce uniform thickness resin cements polymerized interfaces prefabricated ceramic a2 vita porcelain sckingen germany composite resin a2 esthet x hd dentsply caulk milford de lot 090119 simulated ceramic composite restoration the resin cement exposed light upper glass slide contact curing 9-mm light tip 20 40 case qth units 20 40 monowave led units 3 6 polywave led units table 1 the output curing light checked radiometer curing radiometer model 100 kerr corp no polishing techniques used order avoid modification surfaces might influenced results the color specimen measured three times polymerization twice polymerization 20/40 qth monowave led 3/6 polywave led using colorimeter shade eye nnc shofu japan the measurements performed according cie l*a*b system mean l b values material calculated total color change e obtained calculated specimen using equation l b differences respective values polymerization data obtained analyzed using three way analysis variance anova followed duncan test significant difference tests comparisons among groups 0.05 level significance conventional halogen qth polywave monowave led lcus interface materials polystyrene strip ceramic composite resin used a list curing lights including specifications manufacturers given table 1 kuraray japan lot 0015 aa resin cement used test groups curing regimes curing conditions the protocol involved 18 groups n 5 three interface materials three different curing systems two time intervals resin cement firmly pressed 5 kgf load 3 min teflon cylindrical mold glass slide covered polystyrene strip kerrhawe stopstrip kerrhawe sa bioggio switzerland lot 70501264 produce uniform thickness resin cements polymerized interfaces prefabricated ceramic a2 vita porcelain sckingen germany composite resin a2 esthet x hd dentsply caulk milford de lot 090119 simulated ceramic composite restoration the resin cement exposed light upper glass slide contact curing 9-mm light tip 20 40 case qth units 20 40 monowave led units 3 6 polywave led units table 1 the output curing light checked radiometer curing radiometer model 100 kerr corp no polishing techniques used order avoid modification surfaces might influenced results the color specimen measured three times polymerization twice polymerization 20/40 qth monowave led 3/6 polywave led using colorimeter shade eye nnc shofu japan the measurements performed according cie l*a*b system mean l b values material calculated total color change e ) obtained calculated specimen using equation l b differences respective values polymerization data obtained analyzed using three way analysis variance anova followed duncan test significant difference tests comparisons among groups 0.05 level significance resin cement colorimetric values l*a*b resin cement polymerized ceramic composite discs three light polymerizing units polymerization given table 2 color changes e test groups presented table 3 figure 1 l b values mean sd test groups n=5 e values sd test groups n 5 color changes e test groups presented three way anova revealed significance interface materials curing units relation e p 0.05 the interaction polymerizing units material time significant p 0.05 table 4 results three way anova interface materials ceramic composite resin induced less color change control group p 0.05 monowave led exhibited significantly higher color changes materials p 0.05 e 2.94 composite specimens qth induced significantly less color changes p 0.05 e 0.87 0.41 figure 1 this study investigated color indirect composite ceramic restoration cementation resin cement using differently lcus the color stability indirect restorations luting materials important esthetics laminate veneers ceramic crowns indirect composite restorations one important benefits ceramic crowns semi translucency material allows light transmission this optical property improves esthetics ceramic crowns compared metal ceramic crowns allow light transmission metal however translucency esthetic indirect restorations important terms complex color matching process the color tooth luting cement affect appearance indirect restorations several studies reported importance color clinical appearance esthetic crown led lcus become gold standard photopolymerization resin based dental materials since contemporary led lights provide superior irradiance expanded lifetime little light output degradation time qth light led lights expected optimally polymerize resin materials even effectively qth current study color changes specimens polymerized monowave led statistically greater halogen based polymerizing units polywave led lcus p 0.05 polywave led devices portrayed maximum theoretical polymerization efficacy also characteristics need developed polywave led units spectral emission uniformly distributed across light tip compounding effects beam inhomogeneity this may explain color changes specimens polymerized polywave led lcus used study greater color change values specimens polymerized monowave led lcus present study significant difference showed interface materials prepared purpose representing indirect restorations the greatest color change obtained control group since polymerization effective p 0.05 ceramic composite interface materials seen able cause decrease polymerization efficacy inadequate polymerization cement type factors may cause color changes followed polymerization clearfil sa cement dual cure cement polymerized two stages physically chemically such reaction may occur higher monomer conversion allows polymerization deeper layers resin however thickness light transmittance indirect restoration applied resin cement able allow sufficient polymerization resin cement study similarly ceramic disc used study translucent composite caused higher polymerization passing light composite block watanabe et al shown high intensity led unit effective qth units polymerization dual cure cement trough ceramic material has reported led units emit homogenous light thus yield uniform distribution surface hardness knoop hardness number resin composite halogen units study monowave led exhibited significantly higher color changes the color appearance layered ceramic disk specimen strongly influenced core veneer thicknesses also interaction in contrast 1.0-mm thick ips empress 1 ceramic material affected shades substrate luting composite cement tested the effects two different cement shades vita a1 a3 water storage leucite reinforced ceramic color time showed changes experimental design may explain different results different studies contents materials color test specimens color measuring instruments it also important realize impossibility establishing exact comparability vitro vivo tests considering methodology applied limitations vitro study concluded different curing units interface materials significant effect final color resin cement more studies needed evaluate efficiency polymerization mono polywave led lcus evaluate effect different interface materials color stability resin cement

aim : the aim of the study was to investigate the effects of different interface materials and curing units on color changes in a resin cement material.materials and methods : three interface materials and different curing systems , quartz - tungsten - halogen and polywave and monowave light - emitting diode ( led ) light curing units , were studied at two - time intervals . polystyrene strip was used as a control group . all measurements were made on a white background for standard color measurement . according to the cie l*a*b * color space , the baseline color values of each specimen were measured . differences between the measurements were calculated as e , l , a , and b . data were analyzed using analysis of variance ( anova ) and duncan 's tests ( = 0.05 ) with spss 20.0 software ( spss inc . , chicago , il , usa ) . anova revealed significance for interface materials and curing units and time for e ( p < 0.05).results : interaction between polymerizing units , material and time was not significant ( p > 0.05 ) . monowave led exhibited significantly higher color changes than the other units ( [ p < 0.05 ] [ e 2.94 0.44 ] ) . qth promoted composite specimens significantly less color change ( [ p < 0.05 ] [ e 0.87 0.41]).conclusion : this study concluded that color of resin cement used in the adhesion of indirect restorations was affected by curing device light and indirect restoration material type .

advantages phacoemulsification surgery include excellent potential visual outcome small corneal incision possibility employ premium intraocular lenses.23 however easy master technique due steep learning curve some rely self learning methods videos expert surgeons request training vendor phacoemulsification units willing offer tips beginners.4 get trained practicing animal eyes wet lab although good opportunity know functioning machine human eyes differ considerably animal eyes due difference thickness lens capsule lack nucleus animal lens phacoemulsification animal eyes human eyes teaching centers formal training provided beginner learns procedure supervision expert intervenes at if complications occur duration surgery long.456 stepwise training program phacoemulsification surgery divided various steps proficiency one step leads next step guidance supervision expert trainer.7 centers developed world use simulators.89 road sics aided phacoemulsification said slippery vitreous numerous studies resident training focus preserving posterior capsule limiting vitreous loss.710111213 novel technique reverse method training final steps surgical technique taught first initial steps taught last attempted brazil.14 however never compared traditional start finish supervised method teaching phacoemulsification surgery the aim study compare start finish conventional method reverse method training regards posterior capsular rupture pcr phacoemulsification surgery teaching institute this study conducted lions national association blind nab eye hospital tertiary referral teaching center western maharashtra india the incidence pcr depends level skill surgeon hence surgeons learning phacoemulsification surgery institution divided two groups it also doctors enrolling short term phacoemulsification training 30 days course these ophthalmologists done residency years ago joined enhance skills beginners thus novice surgeons performing cataract surgery 1 time experience manual sics upgrading skills phacoemulsification chronology steps beginner learned surgery start finish reverse method demonstrated serially march 2008 february 2009 beginners learned start finish method teaching were considered group start finish conventional whereas march 2009 february 2010 beginners learned using reverse method considered group b reverse the beginners groups well versed tunnel construction continuous curvilinear capsulorhexis hydro dissection performing manual sics independently good results the hospital authorities considered criterion beginning phacoemulsification training safest approach transition phacoemulsification similar centers india.515 therefore first three steps groups each beginner respective group given 3 5 cases learn particular step step number four on acquiring adequate skill particular step allowed move next step the fourth step removing washing viscoelastic material anterior chamber case completed trainer the fifth step aspiration cortex case trainer already emulsified nucleus the seventh step involved beginner taught crack nucleus already trenched trainer the eighth step involved teaching beginner trenching nucleus ninth step nucleus rotation taught the final tenth step bag implantation poly methyl methacrylate lens 5 mm optics reverse method steps 4 9 exact reversals conventional method after 30 case surgeons asked perform surgery conventional method graduated trainee group groups nucleus emulsification taught divide conquer method irrigation aspiration taught bimanual method order steps phacoemulsification taught variety techniques teaching phacoemulsification three supervising surgeons used divide conquered technique familiar method considered easiest transition most trainees experience manual sics proficient tunnel construction capsulorhexis familiar nuclear advanced cortical cataracts formed bulk training cases suturing tunnel performed uncertainty integrity wound closure the outcome measure incidence pcr group beginners trainees statistical analysis performed two two chi square test thirty two ophthalmologists learning phacoemulsification first 100 surgeries participated study they supervised 3 trainers 2 female experience least 8000 cataract surgeries least 1000 phacoemulsification cases comparison posterior capsular rupture methods training fifteen beginners first 30 cases performed 287 surgeries conventional method pcr occurred 18 6.2% cases eleven beginners later performed 679 surgeries trainee group next 31 100 cases pcr occurred 32 4.7% cases seventeen beginners performed 322 surgeries using reverse method pcr occurred 15 4.6% cases p 0.38 chi square test comparison beginners two groups twelve surgeons taught reverse method later performed 722 phacoemulsification surgeries trainee group next 31 100 cases pcr occurred 31 4.3% cases p 0.705 chi square test comparison trainees two groups table 3 presents 18 cases pcr conventional training method pcr occurred aspirating cortex 8 2.8% cases followed rupture emulsification nuclear fragments 5 1.7% cases 15 cases pcr reverse training method pcr occurred nucleus fragmentation emulsification cortical aspiration 4 1.2% cases steps surgery posterior capsular rupture occurred the transition sics conventional extracapsular cataract extraction ecce phacoemulsification steep learning curve.1112 akin new driver initially poor hand foot eye brain coordination learning drive car the use foot switch new individuals requires experience judicious use ultrasound energy vacuum flow rate learned experience those trained simulators less intraoperative complications shorter learning curves.9 hand foot activated surgical tools simulated ophthalmic surgery also used assess dexterity.8 reverse training method transition new technique gradual a study assessing difficulty various steps phacoemulsification surgery reported incidence pcr 9%.16 difficult steps phacoemulsification nucleus capsulorhexis.16 steps considered challenging carried greatest risks emulsification nucleus cortex aspiration current study steps taught towards end training steps adequately performed washing viscoelastic first step conversion trainee surgeon familiarized use foot switch gained experience nuances foot pedal control cortex aspiration without use ultrasound energy emulsification already divided nucleus cracking already divided nucleus helped build confidence surgeons the reverse training method resulted almost third lower incidence pcr beginner group compared conventional groups 31 100 learning cases incidence pcr similar cortical aspiration step the incidence pcr decreased 50% reverse method compared conventional method nucleus cracking step the incidence pcr 0.89% reverse method compared conventional method however differences statistically significant two proportion z test the decreased incidence pcr could due trainer surgeons performing initial steps e.g. continuous curvilinear capsulorhexis hydro dissection rotation nucleus diligently the trainer surgeons experienced left clean clear field trainees operate thus decreasing chance capsular damage however experienced difficulty cortical aspiration nucleus fragment emulsification likely due unfamiliarity using foot switch thomas observed two residents early stage learning phacoemulsification noted incidence pcr 10% although familiar sics.13 hennig stated unsupervised learning formal training stepwise formal training incidence pcr 15% 10% 4.8% respectively thus advocating stepwise formal training beginner.4 studies complications surgical residency training germany usa reported incidence pcr 3.8% 3.1% respectively phacoemulsification training.710 reports taiwan usa evaluating learning curve phacoemulsification resident surgeons reported incidence pcr 4.9% 5.1% respectively.1112 us study noticed incidence pcr decreased 5.1% 1.9% 80 surgeries indicating safety efficiency improved experience our study comparable results although reverse technique made training safer terms pcr the brazilian council ophthalmology partnership alcon brazil used reverse method teach phacoemulsification surgery was slightly different progress three 2 -year resident surgeons monitored five checkpoints incidence pcr study 13.1%.14 india large pool young ophthalmologists need phacoemulsification training.17 feedback residency training programs showed surgical training residents considered inadequate many respondents.18 one reason residency chief believed surgical teaching may compromise quality patient care.1920 many young ophthalmologists therefore seek special phacoemulsification training completion residency fellowship programs the limitations study include nonrandomized design data single center reported a larger comparison multiple centers would help refute validate relatively greater safety reverse method preserving posterior capsule in addition beginners surgeons experience manual sics residents performing cataract surgery 1 time familiar ecce this study revealed stepwise supervised start finish conventional reverse methods training phacoemulsification safe effective

purpose : comparison of the rates of posterior capsule rupture ( pcr ) associated with conventional versus a reverse method of teaching phacoemulsification.methods:trainees were taught conventional ( start - to - finish ) phacoemulsification beginning with an incision ( tunnel construction ) to capsulorhexis , sculpting , nucleus cracking , segment removal , cortex aspiration , intraocular lens implantation , and viscoelastic removal . in the reverse method , after incision and capsulorhexis , the trainees were progressively taught viscoelastic wash , cortex aspiration , segment removal , nucleus cracking , sculpting , and intraocular lens implantation . trainees from a tertiary eye care centre were classified as beginners , for their first 30 cases and then trainees for their next 70 surgeries . data were collected on posterior capsular rent and vitreous loss during each step of training.results:thirty-two ophthalmic surgeons learning phacoemulsification surgery on 609 cataracts cases were supervised by 3 trainers . fifteen beginners performed 287 surgeries using the conventional method , and 17 beginners performed 322 surgeries with the reverse method . the incidence of pcr was 18/287 ( 6.2% ) with the conventional method and 15/322 ( 4.6% ) with the reverse method ( p = 0.38 ) . pcr occurred during cortex aspiration ( 8/287 , 2.8% ) and segment removal ( 5/287 , 1.7% ) in the conventional method . pcr occurred during nucleus cracking , segment removal , and cortex aspiration ( 4/322 surgeries for each step , 1.2% ) . in the follow , 70 cases ( trainees ) there was no difference in pcr with either method ( 4.7% vs. 4.3% , p = 0.705).conclusion : conventional and reverse method for training phacoemulsification were both safe in a supervised setting .

deficits working memory wm limited capacity system supports online manipulation temporary storage information considered hallmark alzheimer disease ad even earliest stages deficits span tasks 3 4 dual task procedures 5 6 emerge early stages ad attributed central executive dysfunction of particular interest finding individuals genetic risk developing ad show poor wm performance relative genetic risk 8 9 highlighting potential tasks detect early ad this study considered usefulness subject performed task spt manipulation improving wm early ad healthy older adult controls task measuring ability verbally repeat short sequences instructions the subject performed task involves verbally presenting participants words instructions consisting sets simple actions e.g. open book required enact encoding phase recall actions subsequently tested typically via verbal recall recognition general research shows enacted encoding facilitates later memory performance relative control conditions enactment occurs encoding cohen originally hypothesised spt effects nonstrategic nature encoding spt rely active verbal organisational strategies necessary basic verbal encoding the enactment effect may also attributable development richer set representations supporting performance including visual spatial motoric information specifically impact increased motor coding alternatively kormi nouri proposes enacted encoding strategic nature involvement self spt leads enhanced remembering spt found enhance recall several clinical groups including parkinson disease autism spectrum disorder asd yet research ad participants generated mixed findings several studies explored effect using episodic long term memory ltm tasks 1720 first study investigate spt individuals ad failed find enactment effect ltm studies observed effect the majority found instances cued recall free recall in contrast recent study investigate enactment effect mild ad patients demonstrated superior recall spt relative verbal encoding tasks free recall well semantic cued recall object cued recall in fact study demonstrated benefit object cued recall greater ad patients neurologically intact older adults thus highlighting encoding specificity principle might enhance recall ad to summarize present study examines advantage spt verbal encoding tasks individuals early ad using recently developed wm task knowledge first study type adopt wm approach enactment ad patients the present study uses modified version following instruction task designed explore links wm decrements difficulty retaining repeating implementing complex instructions original version task children heard verbal instructions e.g. touch red pencil put black box required either perform sequence repeat immediately presentation wm task it features minimal delay presentation test instruction sequences comparatively shorter frequently used spt literature as instruction task shown rely heavily wm abilities patients early ad wm deficits predicted group would perform poorer relative older adult control group it expected healthy older adult control participants would show substantial benefit encoding based enactment as benefit spt suggested rely involvement self research suggests ad might accompanied disrupted sense self see evidence intact self reference effect ad might predict individuals ad fail benefit enacted encoding in contrast instead benefit enacted encoding relies automatic nonstrategic multimodal encoding predict spt enhance remembering ad patients well older adult controls words the potential nonstrategic nature spt might allow patients overcome executive demands involved constructing memory representations thus facilitate recall performance twelve individuals diagnosed mild ad 5 males two diagnosed mild cognitive impairment mci female recruited participation memory clinic leeds uk received formal diagnosis psychiatrist number participants medicated acetylcholinesterase inhibitors time testing medication stabilised least 8 weeks prior testing regarding ad severity all patients scored 19 mini mental state examination mmse mean 23.42 sd 3.18 patients mci scored 25 fifteen older adult controls 5 males recruited volunteer panel held university leeds uk older adult controls reported good physical mental health none taking medication known affect central nervous system living independently time testing participants screened symptoms ad using mmse scored cut 26 points mean 29.07 sd 0.70 significant group differences age t(27 1.79 p 0.09 0.66 predicted full scale iq fsiq t(27 1.44 p 0.16 0.54 national adult reading test nart mean fsiq scores 116.36 sd 10.26 range 92128 ad group 121.2 7.77 range 103129 older adult control group mean age ad participants 82.43 6.14 range 7192 78.60 5.41 range 6890 older adult group the method used modified version used wojcik et al action object pairings generated combining 8 actions thumb spin push drag flip tap lift shake 15 objects erasers rulers pens boxes folders red yellow blue versions each action combined object create action object pairs e.g. tap yellow ruler instruction sequences generated contained three seven action object pairs instance flip red ruler 1 spin blue pen 2 shake yellow box 3 example three action object sequence importantly order minimize ltm contributions focus wm meaningful preexisting relationships actions objects as instruction sequences included seven action object pairs colours e.g. red objects e.g. box appeared within single instruction sequence sequence used particular object e.g. red box twice participants attempted 5 sequences length beginning sequences containing 3 pairs progressing next sequence length this continued sequence lengths completed participant unable correctly recall action object pairs instruction sequence instructions read loud experimenter verbal task vt read experimenter performed participant subject performed task spt see figure 1 schematic representation encoding task spt condition each action object pair performed participant immediately verbal presentation instance tap yellow ruler enactment>. vt condition participants listened restricted touching objects the performance actions self paced spt condition two second delay separated verbal presentation action object pair vt condition control in conditions test phase immediately followed verbal presentation instruction sequence participants asked verbally recall entire multiaction sequence a practice phase consisting two practice trials involving two action object pairs given prior condition actions demonstrated participants prior testing conditions separated ten minute break nart mmse administered assess cognitive impairment estimate fsiq groups written informed consent obtained participants full ethical approval granted university leeds ethics committee prior start testing ethical approval research also granted nhs ethics committee prior testing performance scored mean proportion elements correctly recalled sequence participants received credit individual action object colour correctly recalled analysis serial order recall elements recalled order presented yielded evidence floor effects several participants failing recall elements correct serial positions therefore serial ordering mechanisms primary interest experiment free order performance elements recalled regardless original order reported analysis carried three action object pair sequences four action object pair sequences participants groups completed sequence lengths a 2 group 2 encoding condition 2 sequence length mixed anova performed this revealed main effect group f(1,27 14.16 p 0.001 p 0.34 older adult control participants recalled significantly elements action object instruction sequences ad patients a main effect encoding condition also found f(1 27 46.71 p 0.001 p 0.63 direction predicted recall significantly higher spt condition compared vt condition across group sequence length analysis also revealed main effect sequence length f(1,27 47.5 p 0.001 p 0.64 proportion correctly recalled information higher 3 action object pair sequences 4 pair sequences there significant interaction encoding condition group f(1,27 2.67 p 0.11 p 0.09 though effects spt slightly larger older adult group there also interaction condition sequence length f(1,27 1.09 p 0.31 p 0.04 overall spt led improved performance across participant groups number action object pairs a significant interaction sequence length group found f(1,27 10.12 p 0.004 p 0.27 inspection figure 2 suggests older adults show greater proportional decline sequence length increased 3 action object pair sequences 4 pair sequences this regardless encoding condition significant 3-way interaction f(1,27 0.87 p 0.36 p 0.04 in order explore group length interaction data collapsed across encoding condition paired samples tests indicated increasing sequence length greater effect recall performance older adult controls ad participants t(29 7.08 p 0.001 1.38 t(27 2.95 p 0.006 0.56 respectively this likely due already relatively poor performance ad participants shorter sequence length all analyses repeated without mci participants determine whether effect findings case basic patterns findings replicated this study examined memory performance individuals early ad older adult controls instruction task required temporary storage wm subsequent recall action object sequences following self enactment spt baseline control condition vt participants ad tended show deficit remembering relative older adult controls supporting extensive existing literature indicating wm deficits early ad the primary focus present study establish whether wm performance ad patients would benefit self enactment encoding the findings reveal verbal recall older adults individuals ad significantly facilitated performance actions objects encoding knowledge first study indicate beneficial enactment effect wm older adults ad patients suggests manipulation might useful applications amelioration cognitive deficits early ad more generally basic task following recalling instructions might useful detecting early stage ad ability follow instructions observed particularly deficient children identified poor wm analogous deficit may also emerge result ad what implications might findings enactment effect wm nature cognitive deficit ad ? wojcik et al observed substantial benefits encoding based enactment similar wm task typical children children autism spectrum disorder though accuracy measured physical enactment rather verbal recall taken together findings indicate positive encoding based enactment effect wm across populations response measures this benefit might reflect development richer set representations supporting performance including visual spatial motoric information specifically impact increased motor coding linked spt based enactment also attributed boost item based encoding possibly expense relational information may relevant improvements observed present study task emphasize serial order if enactment indeed lead capture information multiple sources one storage capacity integrating retaining information may episodic buffer component wm recently developed baddeley an important aspect many theoretical approaches enactment spt gains manipulation automatic nonstrategic nature alzheimer disease characterised relative preservation automatic cognitive processes progressive loss controlled cognitive processes this may help explain ad group able also benefit manipulation despite possible deficits wm control executive ability this observation significant enactments wm free recall tasks differs findings ltm literature 17 19 though fits work lekeu colleagues a common factor work present study availability cues encoding retrieval whilst previous research herlitz et al found memory improvement spt free recall tasks showed ad patients experience enactment effect semantic cued recall in fact herlitz colleagues demonstrated enacted encoding sufficient improve ltm performance patients severe dementia semantic cues present recall this suggests patients require support encoding retrieval order enhanced recall via self performance study objects remained view response phase though recall verbal nature it may enactment effect indeed nonstrategic nature ad relies cue availability order enable significant performance facilitation in contrast kormi nouri argued enactment emphasizes involvement self form processing suggested impaired ad the present observation significant effects manipulation observed ad might suggest enactment particularly engage self used wm tasks however conclusions issue necessarily tentative fact enactment slightly larger benefit older adults ad patients though interaction significant means research necessary our results demonstrate positive encoding based enactment effect wm across older adults patients early ad findings also support previous research shows recall facilitated ad availability cues encoding retrieval due nature cognitive deficits ad replication using this group extension similar paradigms might prove useful elucidating mechanisms responsible enactment effect of particular importance role manipulation might play ameliorating cognitive deficits present early ad

this study examines the enactment effect in early alzheimer 's disease using a novel working memory task . free recall of action - object instruction sequences was measured in individuals with alzheimer 's disease ( n = 14 ) and older adult controls ( n = 15 ) . instruction sequences were read out loud by the experimenter ( verbal - only task ) or read by the experimenter and performed by the participants ( subject - performed task ) . in both groups and for all sequence lengths , recall was superior in the subject - performed condition than the verbal - only condition . individuals with alzheimer 's disease showed a deficit in free recall of recently learned instruction sequences relative to older adult controls , yet both groups show a significant benefit from performing actions themselves at encoding . the subject - performed task shows promise as a tool to improve working memory in early alzheimer 's disease .

though minor major spontaneous post operative bleeding common presentation rare disorder several case reports thrombotic complications also there reports myocardial infarction mi literature patients afibrinogenemia a 33-year old man confirmed case congenital afibrinogenemia diagnosed six years back excessive bleeding following trauma face persisted even suturing area presenting us severe retro sternal chest pain 10 h duration he past history myocardial infarction mi two years back advised dual antiplatelet therapy he born second degree consanguineous marriage history sibling death birth admission electrocardiogram showed 2 mm st segment elevation leads ii iii avf st depression leads avl figure 1 troponin obtained admission strongly positive 1.24 ng ml normal- 0.1 ng ml coagulation profile sent admission tests revealed absent fibrinogen using clauss method markedly reduced fibrinogen antigen level normal platelet count bleeding time infinitely prolonged activated partial thromboplastin time aptt prothrombin time pt thrombin time prominent q wave st segment elevation wave inversion lead ii iii avf st segment depression seen lead avl right sided chest leads v4r v6r showed 1 mm st segment elevation patient high risk bleeding thrombolysis primary percutaneous transluminal coronary angioplasty ptca advised though ongoing chest pain he treated dual antiplatelet therapy aspirin plus clopidogrel statins betablocker angiotensin converting enzyme inhibitors injection nitroglycerin ntg after hours treatment chest pain subsided st segment showed evolving changes his admission lipid profile normal low density lipoprotein 112 mg dl triglyceride 128 mg dl high density lipoprotein 40 mg dl the patient experience recurrence angina discharged three days admission dual antiplatelet therapy fibrinogen major coagulation protein blood mass normal fibrinogen levels vary 1.5 3.5 bleeding usually manifests already neonatal period 85% cases presenting umbilical cord bleeding main complication afibrinogenemia paradoxically arterial venous thromboembolic complications also reported afibrinogenemic patients these complications occur presence concomitant risk factors co inherited thrombophilic risk factor replacement therapy first even absence fibrinogen platelet aggregation possible due action von willebrand factor contrast patients hemophilia afibrinogenemic patients able generate thrombin initial phase limited production also secondary burst thrombin generation second increase prothrombin activation fragments thrombin antithrombin complexes observed reflecting enhanced thrombin generation so antithrombin role also attributed fibrinogen absence clearance thrombin impaired though several reports arterial venous thrombosis afibrinogenemia cases reported patients developed mi recurrent mi treatment mi presence bleeding disorder like afibrinogenemia difficult administration thrombolysis anticoagulant increase bleeding so treated aspirin clopidogrel case patient stopped taking dual antiplatelet therapy recurrence mi chest pain subsided starting injection ntg area myocardial involvement also small managed patient conservatively discharged dual antiplatelet therapy further study needed aspect determine best treatment provide until dual antiplatelet therapyshould recommended patient hereditary bleeding disorder close supervision bleeding diathesis since without treatment may recurrences

afibrinogenemia is a rare autosomal recessive bleeding disorder with an estimated prevalence of 1:1,000,000 . usual presentation of this disorder is spontaneous bleeding , bleeding after minor trauma and excessive bleeding during interventional procedures . paradoxically , few patients with afibrinogenemia may also suffer from severe thromboembolic complications . the management of these patients is particularly challenging because they are not only at risk of thrombosis but also of bleeding . we are presenting a case of 33-year - old male patient of congenital afibrinogenemia who had two episodes myocardial infarction in a span of two years . the patient was managed conservatively with antiplatelet therapy and thrombolytic therapy was not given due to high risk for bleeding .