Datasets:
GPT007
/
Scratch-platformers-10k

Dataset card Viewer Files Community
1
title
stringlengths
5
100
content
stringlengths
10
791k
instructions
stringlengths
0
8.7k
Icy's Platformer *melting!*
@Stage\n\nwhen flag clicked\nhide variable [volume v]\nset [volume showing? v] to [0]\nset [volume v] to [70]\nswitch backdrop to (backdrop3 v)\n\nwhen I receive [start project v]\nswitch backdrop to (backdrop1 v)\nforever\n play sound [Cheerful Memory v] until done\nend\n\nwhen I receive [start project v]\nset volume to (100) %\nforever\n if <key (v v) pressed?> then\n if <(volume showing?) = [0]> then\n show variable [volume v]\n set [volume showing? v] to [1]\n else\n hide variable [volume v]\n set [volume showing? v] to [0]\n end\n wait until <not <key (v v) pressed?>>\n end\n set volume to (volume) %\nend\n\nwhen I receive [start! v]\nswitch backdrop to (level1 v)\n\n@Icy\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop2 v]\nswitch costume to (icy1 v)\nwait (1) seconds\nswitch costume to (icy1 v)\nwait (1) seconds\nswitch costume to (icy1 v)\n\nset y to (-112)\nwait (0.4) seconds\ngo to x: (-215) y: (-90)\nswitch costume to (icy1 v)\nset size to (150) %\n\nwhen I receive [start! v]\nforever\n if <(costume [number v]) = [4]> then\n set size to (150) %\n set y to (-112)\n wait (0.4) seconds\n go to x: (-215) y: (-90)\n switch costume to (icy1 v)\n set size to (150) %\n end\nend\n\nwhen I receive [start project v]\nshow\ngo to x: (-163) y: (61)\nset size to (300) %\nswitch costume to (icy1 v)\n\nwhen I receive [start! v]\nset [stop v] to [0]\nset size to (150) %\ngo to x: (-201) y: (-85)\nset [y v] to [0]\nset [x v] to [0]\nforever\n change [y v] by (-1)\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n set [x v] to ((X) * (0.9))\n change x by (X)\n if <touching color (#00cccc)?> then\n change y by (1)\n end\n if <touching color (#00cccc)?> then\n change y by (1)\n end\n if <touching color (#00cccc)?> then\n change y by (1)\n end\n if <touching color (#00cccc)?> then\n change y by (1)\n end\n if <touching color (#00cccc)?> then\n change y by (-4)\n change x by ((X) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (X) ) = (X)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (Y)\n if <touching color (#00cccc)?> then\n change y by ((Y) - ((Y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#00cccc)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if <touching color (#ffff00)?> then\n switch costume to (icy melted v)\n end\n if <touching color (#666666)?> then\n switch costume to (icy melted v)\n end\n if <(backdrop [name v]) = [Backdrop2]> then\n set [stop v] to [1]\n else\n if <touching (freezer v)?> then\n next backdrop\n go to x: (-215) y: (-90)\n switch costume to (icy1 v)\n set size to (150) %\n end\n end\nend\n\nwhen I receive [start! v]\nforever\n if <(STop) = [0]> then\n wait (1) seconds\n next costume\n repeat (15)\n change size by (-1)\n end\n wait (0.8) seconds\n repeat (15)\n change size by (-1)\n end\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen I receive [start! v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [start project v]\nset size to (200) %\ngo to x: (0) y: (-70)\nshow\nforever\n go to x: (0) y: (-70)\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n broadcast (Start! v)\n end\nend\n\n@Freezer\n\nwhen I receive [start! v]\nset size to (20) %\ngo to x: (190) y: (-82)\n\nwhen backdrop switches to [backdrop2 v]\ngo to x: (-187) y: (111)\nset size to (30) %\n\nwhen I receive [start project v]\nswitch costume to (freezerclipart v)\nshow\ngo to x: (163) y: (-55)\nset size to (30) %\n\nwhen flag clicked\nhide\n\n@Sprite2\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level1 v]\nhide\n\nwhen I receive [start project v]\ngo to x: (-26) y: (51)\nshow\ngo to [front v] layer\n\n@Sprite3\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level13 v]\ngo to x: (-7) y: (57)\nshow\nset size to (150) %\nswitch costume to (light on v)\nrepeat until <(backdrop [name v]) = [Level14]>\n wait (0.9) seconds\n next costume\nend\n\nwhen backdrop switches to [level14 v]\nhide\n\n@Sprite4\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop2 v]\nshow\nset size to (8) %\nforever\n set x to (([x position v] of [icy v]) + (54))\n set y to (([y position v] of [icy v]) - (3))\nend\n\n@igaby logo\n\nwhen I receive [start! v]\nhide\n\nwhen I receive [start project v]\ngo to x: (-180) y: (-120)\ngo to [front v] layer\nset size to (30) %\nshow\n\nwhen flag clicked\nhide\n\n@Note\n\nwhen flag clicked\nNote\nbroadcast (start project v)\n\ndefine Note\ngo to x: (0) y: (0)\npoint in direction (90)\nswitch costume to (note v)\ngo to [front v] layer\nshow\nset [ghost v] effect to (0)\nwait until <not <mouse down?>>\nwait until <<mouse down?> and <touching (mouse-pointer v)?>>\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\n\n@old icy\n\n
All instructions are in the game except...\n Press "v" to show the volume. Press "v" again to hide it.
Hidden
@Stage\n\nwhen flag clicked\nforever\n if <(Slide) = [1]> then\n play sound [Oppressive Gloom v] until done\n end\nend\n\nwhen flag clicked\nset [slide v] to [1]\nswitch backdrop to (game v)\nhide variable [time v]\nhide variable [deaths v]\n\nwhen flag clicked\nforever\n if <(Slide) = [1]> then\n switch backdrop to (game v)\n hide variable [time v]\n hide variable [deaths v]\n else\n stop all sounds\n switch backdrop to (end v)\n show variable [time v]\n show variable [deaths v]\n play sound [Unteld v] until done\n end\nend\n\n@Thumbnail\n\nshow\ngo to x: (0) y: (0)\ngo to [front v] layer\nclear graphic effects\nswitch costume to (thumbnail v)\nset [deaths v] to [0]\nset [time v] to [0]\nhide variable [time v]\nhide variable [deaths v]\n\nwhen flag clicked\nforever\n if <<key (z v) pressed?> and <(username) = [Blackswift]>> then\n ask [Level] and wait\n set [level v] to (answer)\n end\nend\n\nwhen flag clicked\nset [level v] to [`]\nset [time v] to [0]\nset [deaths v] to [0]\nset [ghost v] effect to (0)\ngo to [front v] layer\nshow\nwait (1) seconds\nrepeat (50)\n change [ghost v] effect by (2)\nend\nhide\nrepeat until <(Slide) = [2]>\n wait (1) seconds\n change [time v] by (1)\nend\n\n@Levels\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [slide v] to [1]\nswitch costume to (1 v)\nforever\n if <(Slide) = [1]> then\n if <(Level) = [27]> then\n repeat (50)\n change [ghost v] effect by (2)\n end\n hide\n set [slide v] to [2]\n else\n show\n switch costume to (Level)\n end\n else\n hide\n end\nend\n\n@Colt\n\nwhen flag clicked\nhide\nwait (3) seconds\nshow\nerase all\nset [xstart v] to [-212]\nset [ystart v] to [-130]\nset [walljumpenabled? v] to [yes]\nset [level v] to [1]\ngo to x: (XStart) y: (YStart)\nforever\n if <(Slide) = [1]> then\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-8)\n end\n end\n end\n end\n end\n end\n end\n end\n else\n change [yvelocity v] by (-0.3)\n if <not <(YVelocity) > [0]>> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-0.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-1.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-2.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-3.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-4.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-5.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-6.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-7.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-8.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-9.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-10.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n if <(YVelocity) < [-11.5]> then\n if <not <touching color (#555555)?>> then\n change y by (-1)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n else\n set [yvelocity v] to [0]\n end\n end\n else\n set [yvelocity v] to [0]\n end\n end\n else\n set [yvelocity v] to [0]\n end\n end\n else\n set [yvelocity v] to [0]\n end\n end\n else\n set [yvelocity v] to [0]\n end\n end\n end\n end\n if <touching color (#4c0703)?> then\n start sound [Dead v]\n switch costume to (death v)\n repeat (10)\n change [ghost v] effect by (10)\n end\n set [xvelocity v] to [0]\n set [yvelocity v] to [0]\n change [deaths v] by (1)\n go to x: (XStart) y: (YStart)\n set [ghost v] effect to (0)\n end\n if <(y position) < [-187]> then\n set [xvelocity v] to [0]\n set [yvelocity v] to [0]\n change [deaths v] by (1)\n go to x: (XStart) y: (YStart)\n set [ghost v] effect to (0)\n end\n if <(x position) > [235]> then\n set [xvelocity v] to [0]\n set [yvelocity v] to [0]\n erase all\n change [level v] by (1)\n go to x: (XStart) y: (YStart)\n end\n end\n change y by (1)\n if <<key (w v) pressed?> or <key (up arrow v) pressed?>> then\n change y by (-1)\n if <touching color (#555555)?> then\n start sound [Jump v]\n set [yvelocity v] to [7]\n end\n change y by (1)\n end\n if <not <touching color (#555555)?>> then\n if <not <(YVelocity) < [0]>> then\n if <(YVelocity) > [0.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [1.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [2.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [3.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [4.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [5.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n if <(YVelocity) > [6.5]> then\n if <not <touching color (#555555)?>> then\n change y by (1)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n if <touching color (#555555)?> then\n set [yvelocity v] to ((YVelocity) * (-1))\n change y by (-1)\n if <touching color (#555555)?> then\n change y by (-1)\n if <touching color (#555555)?> then\n change y by (-1)\n if <touching color (#555555)?> then\n change y by (-1)\n if <touching color (#555555)?> then\n change y by (-1)\n end\n end\n end\n end\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n if <(XVelocity) < [4]> then\n change [xvelocity v] by (0.5)\n end\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n if <(XVelocity) > [-4]> then\n change [xvelocity v] by (-0.5)\n end\n end\n if <<not <<key (left arrow v) pressed?> or <key (a v) pressed?>>> and <not <<key (right arrow v) pressed?> or <key (d v) pressed?>>>> then\n set [xvelocity v] to ((XVelocity) * (0.88))\n end\n if <<(XVelocity) > [-0.05]> and <(XVelocity) < [0.05]>> then\n set [xvelocity v] to [0]\n end\n if <<(XVelocity) < [-3.5]> and <not <touching color (#555555)?>>> then\n change x by (-1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) > [3.5]> and <not <touching color (#555555)?>>> then\n change x by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (-1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) < [-2.5]> and <not <touching color (#555555)?>>> then\n change x by (-1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) > [2.5]> and <not <touching color (#555555)?>>> then\n change x by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (-1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) < [-1.5]> and <not <touching color (#555555)?>>> then\n change x by (-1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) > [1.5]> and <not <touching color (#555555)?>>> then\n change x by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <touching color (#555555)?> then\n change x by (-1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) < [-0.5]> and <not <touching color (#555555)?>>> then\n change x by (-1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n if <(WallJumpEnabled?) = [yes]> then\n set [xvelocity v] to [6]\n set [yvelocity v] to [7]\n end\n end\n if <touching color (#555555)?> then\n change x by (1)\n end\n end\n end\n end\n end\n end\n if <<(XVelocity) > [0.5]> and <not <touching color (#555555)?>>> then\n change x by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (1)\n if <touching color (#555555)?> then\n change y by (-3)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <<key (right arrow v) pressed?> or <key (d v) pressed?>>> then\n if <(WallJumpEnabled?) = [yes]> then\n set [xvelocity v] to [-6]\n set [yvelocity v] to [7]\n end\n end\n if <touching color (#555555)?> then\n change x by (-1)\n end\n end\n end\n end\n end\n end\n else\n hide\n end\nend\n\nwhen flag clicked\nforever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n switch costume to (right v)\n else\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n switch costume to (left v)\n else\n if <not <touching color (#4c0703)?>> then\n switch costume to (still v)\n end\n end\n end\nend\n\nwhen [r v] key pressed\ngo to x: (XStart) y: (YStart)\nchange [deaths v] by (1)\n\nwhen flag clicked\nforever\n if <(Level) = [27]> then\n repeat (50)\n change [ghost v] effect by (2)\n hide\n stop [other scripts in sprite v]\n stop [this script v]\n end\n end\nend\n\n@Moving Stuff\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n if <(Level) = [14]> then\n show\n go to x: (0) y: (0)\n switch costume to (swingy v)\n Swing\n else\n if <(Level) = [15]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (hammery thingy v)\n show\n Stomp\n else\n if <(Level) = [19]> then\n point in direction (90)\n go to x: (100) y: (0)\n switch costume to (moving dude v)\n show\n Jump\n else\n if <(Level) = [20]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (moving dudes v)\n show\n Jump\n else\n if <(Level) = [21]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (moving dudes2 v)\n show\n Jump\n else\n if <(Level) = [22]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (moving dudes3 v)\n show\n Jump\n else\n if <(Level) = [25]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (hammery thingy2 v)\n show\n Stomp\n else\n if <(Level) = [26]> then\n point in direction (90)\n go to x: (0) y: (0)\n switch costume to (moving dudes4 v)\n show\n Jump\n else\n hide\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\ndefine Swing\nturn left (Swing) degrees\n\nwhen flag clicked\npoint in direction (180)\nset [swing v] to [0]\nset [ghost v] effect to (0)\nset [crush v] to [0]\nset [jump v] to [2]\nforever\n if <(Level) = [14]> then\n repeat (15)\n change [swing v] by (1)\n end\n repeat (30)\n change [swing v] by (-1)\n end\n repeat (15)\n change [swing v] by (1)\n end\n end\n if <<(Level) = [15]> or <(Level) = [25]>> then\n set [crush v] to [0]\n repeat (40)\n change [crush v] by (-5)\n end\n wait (0.5) seconds\n repeat (10)\n change [crush v] by (20)\n end\n wait (0.2) seconds\n end\n if <<<(Level) = [19]> or <(Level) = [20]>> or <<(Level) = [21]> or <<(Level) = [22]> or <(Level) = [26]>>>> then\n repeat (20)\n change [jump v] by (((Jump) * (0.2)) * (-1))\n end\n set [jump v] to [2]\n repeat (20)\n change [jump v] by ((Jump) * (0.2))\n end\n wait (0.1) seconds\n end\nend\n\ndefine Stomp\nchange y by ((Crush) * (-1))\n\ndefine Jump\nchange y by ((Jump) * (-1))\n\nwhen flag clicked\nforever\n if <(Level) = [27]> then\n repeat (50)\n change [ghost v] effect by (2)\n hide\n stop [other scripts in sprite v]\n stop [this script v]\n end\n end\nend\n\n@Levels2\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\nset [ghost v] effect to (100)\nwait until <(Level) = [27]>\nshow\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nset [slide v] to [2]\nrepeat (50)\n change [ghost v] effect by (2)\nend\nhide\n\n
.: Levels - A Platformer :.
@Stage\n\nwhen flag clicked\nforever\n play sound [Video Game 1 v] until done\n set volume to (70) %\nend\n\n@Level\n\nwhen flag clicked\nset [level v] to [1]\nshow\ngo to [front v] layer\nset [yv v] to [0]\ngo to x: (-200) y: (-136)\nset [xv v] to [0]\nforever\n if <<touching color (#ccd8ff)?> and <touching (level's land v)?>> then\n start sound [Pew v]\n if <(level) = [1]> then\n set [yv v] to [0]\n go to x: (-200) y: (-136)\n set [xv v] to [0]\n end\n if <(level) = [2]> then\n set [yv v] to [0]\n go to x: (-200) y: (-21)\n set [xv v] to [0]\n end\n if <(level) = [3]> then\n set [yv v] to [0]\n go to x: (-200) y: (65)\n set [xv v] to [0]\n end\n if <(level) = [4]> then\n set [yv v] to [0]\n go to x: (-200) y: (-136)\n set [xv v] to [0]\n end\n if <(level) = [5]> then\n set [yv v] to [0]\n go to x: (-200) y: (-21)\n set [xv v] to [0]\n end\n if <(level) = [6]> then\n set [yv v] to [0]\n go to x: (-200) y: (65)\n set [xv v] to [0]\n end\n if <(level) = [7]> then\n set [yv v] to [0]\n go to x: (-200) y: (-136)\n set [xv v] to [0]\n end\n if <(level) = [8]> then\n set [yv v] to [0]\n go to x: (-200) y: (-21)\n set [xv v] to [0]\n end\n if <(level) = [9]> then\n set [yv v] to [0]\n go to x: (-200) y: (65)\n set [xv v] to [0]\n end\n if <(level) = [10]> then\n set [yv v] to [0]\n go to x: (-200) y: (-136)\n set [xv v] to [0]\n end\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.7)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.7)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by (1.6)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by (1.6)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by (1.6)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by (1.6)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by (1.6)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change x by ((Xv) * (-1))\n change y by (8)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [14]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <<touching color (#ffffff)?> and <touching (level's land v)?>> then\n if <key (up arrow v) pressed?> then\n start sound [Coin v]\n set [yv v] to [16]\n end\n end\n if <touching (level up v)?> then\n start sound [Collect v]\n broadcast (nextlevel v)\n change [level v] by (1)\n set [yv v] to [0]\n set [xv v] to [0]\n if <(level) = [2]> then\n go to x: (-200) y: (-21)\n end\n if <(level) = [3]> then\n go to x: (-200) y: (65)\n end\n if <(level) = [4]> then\n go to x: (-200) y: (-136)\n end\n if <(level) = [5]> then\n go to x: (-200) y: (-21)\n end\n if <(level) = [6]> then\n go to x: (-200) y: (65)\n end\n if <(level) = [7]> then\n go to x: (-200) y: (-136)\n end\n if <(level) = [8]> then\n go to x: (-200) y: (-21)\n end\n if <(level) = [9]> then\n go to x: (-200) y: (65)\n end\n if <(level) = [10]> then\n go to x: (-200) y: (-136)\n end\n end\n change y by (1)\nend\n\n@Level's Land\n\nwhen flag clicked\nswitch costume to (level 1 v)\n\nwhen I receive [nextlevel v]\nnext costume\n\n@Level Shadow\n\nwhen flag clicked\ngo to x: (-247) y: (-88)\nclear graphic effects\nset [ghost v] effect to (40)\nforever\n point towards (level v)\n move ((distance to [level v]) / (6)) steps\nend\n\n@Level Up\n\nwhen flag clicked\nshow\ngo to x: (215) y: (-122)\nforever\n if <(level) = [1]> then\n go to x: (213) y: (-122)\n end\n if <(level) = [2]> then\n go to x: (213) y: (6)\n end\n if <(level) = [3]> then\n go to x: (213) y: (91)\n end\n if <(level) = [4]> then\n go to x: (213) y: (-122)\n end\n if <(level) = [5]> then\n go to x: (213) y: (6)\n end\n if <(level) = [6]> then\n go to x: (213) y: (91)\n end\n if <(level) = [7]> then\n go to x: (213) y: (-122)\n end\n if <(level) = [8]> then\n go to x: (213) y: (6)\n end\n if <(level) = [9]> then\n go to x: (213) y: (91)\n end\n if <(level) = [10]> then\n go to x: (213) y: (-122)\n end\n if <(level) = [11]> then\n hide\n go to x: (0) y: (0)\n end\nend\n\n@Game Over!\n\nwhen flag clicked\ngo to x: (0) y: (116)\nhide\nforever\n if <(level) = [11]> then\n show\n if <touching (mouse-pointer v)?> then\n set [size v] to (((0.8) * (size)) + (((90) - (size)) * (0.2)))\n change size by (size)\n else\n set [size v] to (((0.8) * (size)) + (((75) - (size)) * (0.2)))\n change size by (size)\n end\n end\nend\n\n@Thumbnail\n\nwhen flag clicked\nforever\n show\n go to [front v] layer\n set [ghost v] effect to (100)\n go to x: (0) y: (0)\nend\n\n
Colorless: A Platformer - Part 2
@Stage\n\nwhen I receive [changesong v]\nstop [other scripts in stage v]\nbroadcast (soundcheck v)\nbroadcast (backdropcheck v)\nstop all sounds\nif <(Song) = [0]> then\n play sound [Josh Kramer - Call to Destiny.mp3 v] until done\n broadcast (changesong v)\nelse\n if <(Song) = [1]> then\n play sound [Vexento - My Love v] until done\n play sound [Vexento - Lights v] until done\n broadcast (changesong v)\n else\n if <(Song) = [2]> then\n broadcast (TrialBackground v)\n play sound [Heart of Courage -TSFH v] until done\n set [song v] to [2]\n broadcast (changesong v)\n else\n play sound [Josh Kramer - Call to Destiny.mp3 v] until done\n set [song v] to [5]\n broadcast (changesong v)\n end\n end\nend\n\nwhen I receive [soundcheck v]\nforever\n if <key (m v) pressed?> then\n wait (0.5) seconds\n if <not <(volume) = [0]>> then\n repeat (3)\n set volume to (0) %\n end\n else\n repeat (3)\n set volume to (100) %\n end\n end\n end\nend\n\nwhen I receive [backdropcheck v]\nif <(Level) = [1]> then\n switch backdrop to (snow1 v)\nend\nif <(Level) = [5]> then\n switch backdrop to (snow2 v)\nend\n\nwhen I receive [start v]\nstop [other scripts in stage v]\nset [song v] to [1]\nbroadcast (changesong v)\nbroadcast (backdropcheck v)\n\nwhen I receive [volup v]\nchange volume by (10)\n\nwhen I receive [story time! v]\nswitch backdrop to (snow1 v)\n\nwhen I receive [cutscenep2 v]\nswitch backdrop to (cave1 v)\nstop all sounds\nstop [other scripts in stage v]\nforever\n play sound [ Victory.mp3 v] until done\nend\n\nwhen I receive [voldown v]\nchange volume by (-10)\n\nwhen flag clicked\nswitch backdrop to (titlescreen v)\nset volume to (100) %\nbroadcast (soundcheck v)\nbroadcast (changesong v)\nset [song v] to [0]\n\nwhen I receive [soundcheck v]\nforever\n set [volume v] to (volume)\nend\n\nwhen I receive [victory!!!!! wahooo!!! v]\nstop [other scripts in stage v]\nset [song v] to [5]\nswitch backdrop to (victory v)\nbroadcast (changesong v)\nbroadcast (backdropcheck v)\n\nwhen I receive [trialbuttons v]\nif <not <(Checkpoint#) = [6]>> then\n switch backdrop to (trialbuttons v)\nend\n\nwhen I receive [trialstart v]\nset [song v] to [2]\nbroadcast (changesong v)\n\nwhen I receive [options menu v]\nswitch backdrop to (titlescreen v)\n\nwhen I receive [next stage v]\nbroadcast (backdropcheck v)\n\nwhen I receive [trialbackground v]\nrepeat until <(Checkpoint#) = [6]>\n if <(TrialGroundName) = [Trial 1-1]> then\n switch backdrop to (trial v)\n else\n switch backdrop to (trial2 v)\n end\nend\n\nwhen I receive [trialvictory v]\nswitch backdrop to (snow2 v)\n\nwhen I receive [timecalculate v]\nswitch backdrop to (victory2 v)\n\n@Player\n\nwhen I receive [options menu v]\nhide\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [start v]\nset size to (60) %\nshow\nClear Velocity\ngo to x: (-183) y: (-104)\n\nwhen I receive [map v]\nset [play v] to [0]\nhide\n\nwhen I receive [title screen v]\nswitch costume to (costume1 v)\ngo to x: (37) y: (60)\nhide\n\nwhen I receive [start v]\nset [play v] to [1]\nforever\n Move [Ground]\nend\n\nwhen flag clicked\nset [death count: v] to [0]\nset [dead v] to [0]\nhide variable [death count: v]\nhide variable [☁ deaths in world record time: v]\nset [time: v] to [0]\nhide variable [time: v]\nhide variable [☁ world record time: v]\nset [level v] to [0]\nhide variable [world record: v]\nhide variable [endgame deaths: v]\nset [victory v] to [0]\nhide variable [average time v]\nset [skips v] to [0]\nhide\n\nwhen I receive [levelspawn v]\ngo to x: (item (Level) of [respawnposx v]) y: (item (Level) of [respawnposy v])\nClear Velocity\n\ndefine DeathCheck\nforever\n if <(Play) = [1]> then\n if <(LDM MODE) = [0]> then\n if <(Dead) = [1]> then\n set [brightness v] effect to (50)\n repeat (10)\n change [ghost v] effect by (10)\n change [brightness v] effect by (1)\n end\n wait (0.2) seconds\n set [dead v] to [0]\n set [ghost v] effect to (0)\n set [brightness v] effect to (0)\n go to x: (item (Level) of [respawnposx v]) y: (item (Level) of [respawnposy v])\n end\n else\n if <(Dead) = [1]> then\n wait (0.2) seconds\n set [dead v] to [0]\n set [ghost v] effect to (0)\n set [brightness v] effect to (0)\n go to x: (item (Level) of [respawnposx v]) y: (item (Level) of [respawnposy v])\n end\n end\n end\nend\n\nwhen I receive [start v]\nforever\n if <key (z v) pressed?> then\n if <(Level) = [10]> then\n broadcast (cutscenep1 v)\n change [death count: v] by (10)\n change [skips v] by (1)\n wait until <not <key (z v) pressed?>>\n else\n broadcast (next stage v)\n change [death count: v] by (10)\n change [skips v] by (1)\n broadcast (levelspawn v)\n wait until <not <key (z v) pressed?>>\n end\n end\nend\n\nwhen I receive [start v]\nDeathCheck\n\nwhen I receive [start2 v]\nDeathCheck\n\nwhen I receive [cutscenep2 v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [mapback v]\nset [play v] to [1]\nshow\n\nwhen I receive [start v]\nforever\n if <key (r v) pressed?> then\n if <(Dead) = [0]> then\n Clear Velocity\n change [death count: v] by (1)\n set [dead v] to [1]\n wait (0.25) seconds\n end\n end\nend\n\nwhen I receive [start v]\nforever\n if <(Play) = [1]> then\n if <<(x position) = [250]> or <(x position) > [250]>> then\n if <(Level) = [10]> then\n broadcast (cutscenep1 v)\n hide\n go to x: (0) y: (0)\n else\n broadcast (next stage v)\n broadcast (levelspawn v)\n end\n end\n if <(Dead) = [0]> then\n if <<touching (obstacles v)?> or <<touching (changingground v)?> and <(GroundColor) = [2]>>> then\n if <(Clones?) = [1]> then\n set [xv v] to [0]\n set [yv v] to [0]\n change [death count: v] by (1)\n set [dead v] to [1]\n end\n end\n end\n end\nend\n\ndefine XPosTrialCheck\nif <<(x position) = [250]> or <(x position) > [250]>> then\n if <not <(letter (9) of (TrialGroundName)) = [5]>> then\n broadcast (stageright v)\n wait (0) seconds\n go to x: (-180) y: (y position)\n end\nend\nif <<(x position) = [-192]> or <(x position) < [-192]>> then\n if <not <(letter (9) of (TrialGroundName)) = [1]>> then\n broadcast (stageleft v)\n wait (0) seconds\n go to x: (240) y: (y position)\n end\nend\n\ndefine YPosTrialCheck\nif <<(y position) = [200]> or <(y position) > [200]>> then\n if <not <(letter (7) of (TrialGroundName)) = [3]>> then\n broadcast (stageup v)\n wait (0) seconds\n go to x: (x position) y: (-104)\n end\nend\nif <<(y position) = [-120]> or <(y position) < [-120]>> then\n if <not <(letter (7) of (TrialGroundName)) = [1]>> then\n broadcast (stagedown v)\n wait (0) seconds\n go to x: (x position) y: (190)\n end\nend\n\nwhen I receive [trialstart v]\nforever\n if <(Play) = [1]> then\n if <(Dead) = [0]> then\n XPosTrialCheck\n YPosTrialCheck\n if <<touching (trialobstacles v)?> or <<touching (changingground v)?> and <(GroundColor) = [2]>>> then\n change [death count: v] by (1)\n set [dead v] to [1]\n Clear Velocity\n TrialDeath\n end\n end\n end\nend\n\ndefine Move (ground)\nif <(Play) = [1]> then\n if <(Dead) = [0]> then\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1.1)\n switch costume to (costume1 v)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1.1)\n switch costume to (costume2 v)\n end\n set [xv v] to ((xv) * (0.82))\n change x by (xv)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change x by ((xv) * (-1))\n change y by (-5)\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [9]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (yv)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <<touching ((ground) v)?> or <<touching (changingground v)?> and <(GroundColor) = [1]>>> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [14]\n end\n end\n change y by (1)\n end\nend\n\ndefine TrialSpawn\ngo to x: (item (Checkpoint#) of [trialspawnx v]) y: (item (Checkpoint#) of [trialspawny v])\n\ndefine TrialDeath\nset [brightness v] effect to (50)\nrepeat (10)\n change [ghost v] effect by (10)\n change [brightness v] effect by (1)\nend\nwait (0.2) seconds\nbroadcast (trialspawn v)\nwait (0) seconds\nTrialSpawn\nset [ghost v] effect to (0)\nset [brightness v] effect to (0)\nset [dead v] to [0]\n\nwhen I receive [trialstart v]\ngo to x: (-183) y: (-105)\nshow\nforever\n TrialMove [TrialGround]\nend\n\ndefine Clear Velocity\nset [yv v] to [0]\nset [xv v] to [0]\n\nwhen I receive [trialstart v]\nforever\n if <key (r v) pressed?> then\n if <(Dead) = [0]> then\n Clear Velocity\n change [death count: v] by (1)\n set [dead v] to [1]\n TrialDeath\n wait (0.25) seconds\n end\n end\nend\n\nbroadcast (trialspawn v)\n\ndefine TrialMove (ground)\nif <(Play) = [1]> then\n if <(Dead) = [0]> then\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1.1)\n switch costume to (costume1 v)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1.1)\n switch costume to (costume2 v)\n end\n set [xv v] to ((xv) * (0.82))\n change x by (xv)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by (1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change x by ((xv) * (-1))\n change y by (-5)\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [9]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (yv)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <<touching ((ground) v)?> or <<<touching (changingground v)?> and <(GroundColor) = [1]>> or <<touching (doors v)?> and <(Doors) = [1]>>>> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [14]\n end\n end\n change y by (1)\n end\nend\n\nwhen I receive [trialstart v]\nif <(Difficulty) = [1]> then\n forever\n if <key (z v) pressed?> then\n if <<<(TrialGroundName) = [Trial 1-3]> and <(Checkpoint#) = [1]>> or <<<(TrialGroundName) = [Trial 2-4]> and <(Checkpoint#) = [2]>> or <<<(TrialGroundName) = [Trial 3-3]> and <(Checkpoint#) = [3]>> or <<<(TrialGroundName) = [Trial 2-1]> and <(Checkpoint#) = [4]>> or <<(TrialGroundName) = [Trial 1-5]> and <(Checkpoint#) = [5]>>>>>> then\n if <<(TrialGroundName) = [Trial 1-5]> and <(Checkpoint#) = [5]>> then\n change [death count: v] by (10)\n change [skips v] by (1)\n change [checkpoint# v] by (1)\n Clear Velocity\n broadcast (Endcutscene v)\n set [play v] to [0]\n wait until <not <key (z v) pressed?>>\n else\n change [death count: v] by (10)\n change [skips v] by (1)\n change [checkpoint# v] by (1)\n Clear Velocity\n if <(TrialGroundName) = [Trial 2-1]> then\n repeat (2)\n replace item (3) of [locked? v] with [0]\n end\n broadcast (TrialSkip2 v)\n else\n broadcast (TrialSkip v)\n end\n wait until <not <key (z v) pressed?>>\n end\n else\n if <(TrialGroundName) = [Trial 1-4]> then\n repeat (2)\n replace item (1) of [locked? v] with [0]\n end\n end\n if <(TrialGroundName) = [Trial 2-4]> then\n repeat (2)\n replace item (2) of [locked? v] with [0]\n end\n end\n if <(TrialGroundName) = [Trial 2-1]> then\n repeat (2)\n replace item (3) of [locked? v] with [0]\n end\n end\n if <<(TrialGroundName) = [Trial 1-3]> and <(Checkpoint#) = [5]>> then\n set [checkpoint# v] to [5]\n end\n change [death count: v] by (10)\n change [skips v] by (1)\n Clear Velocity\n if <(TrialGroundName) = [Trial 2-1]> then\n broadcast (TrialSkip2 v)\n else\n broadcast (TrialSkip v)\n end\n wait until <not <key (z v) pressed?>>\n end\n end\n end\nend\n\nwhen I receive [trialbuttons v]\nset [play v] to [0]\nhide\n\nwhen I receive [trialskip v]\nhide\nset [play v] to [0]\nClear Velocity\nrepeat (3)\n if <<[trialpath2 v] contains (TrialGroundName)?> and <(Checkpoint#) = [5]>> then\n go to x: (item (item # of (TrialGroundName) in [trialpath2 v]) of [trialskipx2 v]) y: (item (item # of (TrialGroundName) in [trialpath2 v]) of [trialskipy2 v])\n else\n go to x: (item (item # of (TrialGroundName) in [trialpath v]) of [trialskipx v]) y: (item (item # of (TrialGroundName) in [trialpath v]) of [trialskipy v])\n end\nend\nshow\nwait (0.1) seconds\nset [play v] to [1]\n\nwhen I receive [trialskip2 v]\ngo to x: (-173) y: (102)\n\nwhen I receive [trialvictory v]\nhide\n\nwhen I receive [endcutscene v]\nstop [other scripts in sprite v]\n\n@Ground\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nhide variable [skips v]\nset [level v] to [0]\nhide\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [timecalculate v]\nif <(Difficulty) = [2]> then\n change [time: v] by (-50)\nelse\n if <(Difficulty) = [3]> then\n change [time: v] by (-100)\n else\n if <(Difficulty) = [4]> then\n change [time: v] by (-250)\n end\n end\nend\nif <<(Time:) < (☁ World Record Time:)> and <(Skips) = [0]>> then\n repeat (3)\n set [☁ world record time: v] to (Time:)\n set [☁ deaths in world record time: v] to (Death Count:)\n end\n repeat (3)\n set [world record: v] to (join [Time: ] (join (☁ World Record Time:) (join [ Deaths: ] (☁ Deaths in World Record Time:))))\n end\nend\nset [☁ completions v] to ((☁ Completions) + (1))\nset [☁ total time v] to ((☁ Total Time) + (Time:))\nset [average time v] to ((☁ Total Time) / (☁ Completions))\nshow variable [time: v]\nshow variable [death count: v]\nshow variable [world record: v]\nshow variable [skips v]\nshow variable [average time v]\n\nwhen I receive [next stage v]\nif <(Level) < [11]> then\n next costume\n change [level v] by (1)\nend\nif <<(Level) > [10]> and <not <(Level) = [30]>>> then\n if <(Level) = [16]> then\n broadcast (victorycutscene v)\n else\n next costume\n change [level v] by (1)\n go to x: (-2) y: (-38)\n broadcast (levelspawn v)\n end\nend\n\nwhen I receive [start v]\nswitch costume to (level 1 v)\nset [level v] to [1]\nshow\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\nwhen I receive [start v]\nbroadcast (levelspawn v)\n\nwhen flag clicked\ndelete (all) of [respawnposx v]\nadd [-183] to [respawnposx v]\nadd [-149] to [respawnposx v]\nadd [-187] to [respawnposx v]\nadd [-137] to [respawnposx v]\nadd [-169] to [respawnposx v]\nadd [-172] to [respawnposx v]\nadd [-172] to [respawnposx v]\nadd [-135] to [respawnposx v]\nadd [-136] to [respawnposx v]\nadd [-158] to [respawnposx v]\n\nwhen flag clicked\ndelete (all) of [respawnposy v]\nadd [-105] to [respawnposy v]\nadd [-70] to [respawnposy v]\nadd [93] to [respawnposy v]\nadd [120] to [respawnposy v]\nadd [-101] to [respawnposy v]\nadd [-69] to [respawnposy v]\nadd [-101] to [respawnposy v]\nadd [22] to [respawnposy v]\nadd [22] to [respawnposy v]\nadd [-26] to [respawnposy v]\n\nwhen I receive [cutscenep2 v]\nhide\n\nwhen flag clicked\nforever\n set [groundcostume v] to (costume [number v])\nend\n\n@Background\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\ngo [backward v] (100) layers\nhide\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [next stage v]\nif <(Level) < [11]> then\n next costume\nend\nif <<(Level) > [10]> and <not <(Level) = [30]>>> then\n if <(Level) = [16]> then\n hide\n else\n next costume\n end\nend\n\nwhen I receive [start v]\nswitch costume to (level 1 v)\nshow\n\nwhen I receive [start v]\nbroadcast (levelspawn v)\n\nwhen I receive [cutscenep2 v]\nhide\n\n@Obstacles\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nhide\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [start v]\nswitch costume to (level 1 v)\nshow\n\nwhen I receive [cutscenep2 v]\nhide\n\nwhen I receive [start v]\nbroadcast (levelspawn v)\n\nwhen I receive [next stage v]\nif <(Level) < [11]> then\n next costume\nend\nif <<(Level) > [10]> and <not <(Level) = [30]>>> then\n if <(Level) = [16]> then\n hide\n else\n next costume\n end\nend\n\nwhen I receive [start2 v]\nshow\ngo to x: (-2) y: (-38)\nswitch costume to (level 13 v)\n\nwhen I receive [next stage v]\ngo to [front v] layer\ngo [backward v] (1) layers\n\n@Foreground\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nswitch costume to (level 7 v)\nhide\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [next stage v]\nif <(Level) > [5]> then\n if <(Level) < [11]> then\n if <(Level) = [6]> then\n switch costume to (level 7 v)\n show\n go to [front v] layer\n else\n show\n go to [front v] layer\n next costume\n end\n end\n if <<(Level) > [10]> and <not <(Level) = [30]>>> then\n go to [front v] layer\n next costume\n go to x: (-2) y: (-38)\n end\nelse\n hide\nend\n\nwhen I receive [start2 v]\nshow\ngo to x: (-2) y: (-38)\nswitch costume to (level 13 v)\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [cutscenep2 v]\nhide\n\nwhen I receive [next stage v]\nforever\n if <<(Level) > [5]> and <not <(Level) = [10]>>> then\n go to [front v] layer\n end\nend\n\n@LevelText\n\nwhen I receive [start v]\nTextCheck\n\nwhen flag clicked\nhide\n\nwhen I receive [cheater!!! v]\nhide\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\nwhen I receive [start2 v]\nTextCheck\n\nwhen I receive [aboveaverage v]\nswitch costume to (above average v)\nshow\n\nwhen I receive [belowaverage v]\nswitch costume to (below average v)\nshow\n\nwhen I receive [cutscenep2 v]\nstop [other scripts in sprite v]\nhide\n\ndefine TextCheck\nif <(LDM MODE) = [0 ]> then\n show\n forever\n if <(Level) = [ 1 ]> then\n hide\n go to x: (217) y: (-26)\n switch costume to (leveltext1 v)\n show\n end\n if <(Level) = [2]> then\n hide\n go to x: (81) y: (-23)\n switch costume to (leveltext2 v)\n show\n end\n if <(Level) = [3]> then\n hide\n go to x: (204) y: (-9)\n switch costume to (leveltext3 v)\n show\n end\n if <(Level) = [4]> then\n hide\n go to x: (20) y: (20)\n switch costume to (leveltext4 v)\n show\n end\n if <(Level) = [5]> then\n hide\n switch costume to (leveltext5 v)\n go to x: (-2) y: (23)\n show\n end\n if <(Level) = [6]> then\n hide\n go to x: (0) y: (10)\n switch costume to (leveltext6 v)\n show\n end\n if <(Level) = [7]> then\n hide\n go to x: (0) y: (0)\n switch costume to (leveltext7 v)\n show\n end\n if <(Level) = [8]> then\n hide\n go to x: (0) y: (5)\n switch costume to (leveltext8 v)\n show\n end\n if <(Level) = [9]> then\n hide\n go to x: (20) y: (7)\n switch costume to (leveltext9 v)\n show\n end\n if <(Level) = [10]> then\n hide\n go to x: (20) y: (20)\n switch costume to (leveltext10 v)\n show\n end\n end\nend\n\nwhen I receive [sign v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [signback v]\nTextCheck\nshow\n\nwhen I receive [trialstart v]\nforever\n if <<(TrialGroundName) = [Trial 1-4]> and <(Checkpoint#) = [1]>> then\n switch costume to (trialtext1 v)\n show\n else\n if <(TrialGroundName) = [Trial 2-1]> then\n switch costume to (trialtext2 v)\n show\n else\n hide\n end\n end\nend\n\nwhen I receive [victory!!!!! wahooo!!! v]\nstop [other scripts in sprite v]\nswitch costume to (endtext v)\nset [ghost v] effect to (100)\ngo to x: (-10) y: (100)\nshow\nwait (2) seconds\nrepeat (20)\n change [ghost v] effect by (-5)\n wait (0) seconds\nend\nwait (4) seconds\nrepeat (20)\n change [ghost v] effect by (5)\n wait (0) seconds\nend\nwait (1.5) seconds\nswitch costume to (endtext2 v)\nrepeat (20)\n change [ghost v] effect by (-5)\n wait (0) seconds\nend\nwait (3) seconds\nrepeat (20)\n change [ghost v] effect by (5)\n wait (0) seconds\nend\nwait (1) seconds\nbroadcast (TimeCalculate v)\n\n@StoryText\n\nwhen flag clicked\ngo to x: (6) y: (27)\nset [play v] to [0]\nset [start v] to [0]\nhide\n\nwhen I receive [story time! v]\nshow\nset [story v] to [1]\nswitch costume to (story1 v)\nwait until <key (space v) pressed?>\nnext costume\nchange [story v] by (1)\nwait (0.5) seconds\nwait until <key (space v) pressed?>\nbroadcast (Start v)\nhide\n\n@Map\n\nwhen flag clicked\ngo to x: (-15) y: (3)\nhide\n\nwhen I receive [map v]\ngo to [front v] layer\nshow\nset size to (105) %\n\nwhen I receive [mapback v]\nhide\n\n@MapLocation\n\nwhen flag clicked\nset size to (105) %\nhide\n\nwhen flag clicked\nforever\n if <<(Level) = [1]> or <<(Level) = [2]> or <(Level) = [3]>>> then\n go to x: (96) y: (-115)\n end\n if <(Level) = [4]> then\n go to x: (100) y: (-109)\n end\n if <(Level) = [5]> then\n go to x: (105) y: (-98)\n end\n if <(Level) = [6]> then\n go to x: (115) y: (-79)\n end\n if <(Level) = [7]> then\n go to x: (137) y: (-50)\n end\n if <(Level) = [8]> then\n go to x: (146) y: (-46)\n end\n if <(Level) = [9]> then\n go to x: (156) y: (-41)\n end\n if <(Level) = [10]> then\n go to x: (173) y: (-34)\n end\nend\n\nwhen I receive [mapback v]\nhide\n\nwhen I receive [map v]\nif <(LDM MODE) = [0]> then\n show\n repeat (10)\n go to [front v] layer\n end\nend\n\nwhen I receive [ldm mode on v]\nstop [other scripts in sprite v]\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\n\n@MapButtons\n\nwhen flag clicked\nswitch costume to (mapbutton v)\ngo to x: (195) y: (149)\nset [map v] to [0]\nhide\n\nwhen this sprite clicked\nif <<(Map) = [0]> and <(Sign) = [0]>> then\n broadcast (Map v)\n set [map v] to [1]\nelse\n broadcast (MapBack v)\n set [map v] to [0]\nend\n\nwhen I receive [cutscenep2 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [mapback v]\ngo to x: (204) y: (147)\nswitch costume to (mapbutton v)\ngo to [front v] layer\nshow\n\nwhen I receive [map v]\nswitch costume to (back v)\nrepeat (2)\n go to [front v] layer\nend\n\nwhen I receive [start v]\nshow\nwait (1) seconds\ngo to [front v] layer\n\nwhen I receive [start v]\nforever\n if <(Map) = [1]> then\n if <touching (mouse-pointer v)?> then\n set size to (125) %\n go to x: (-187) y: (129)\n wait until <not <touching (mouse-pointer v)?>>\n else\n set size to (100) %\n go to x: (-192) y: (133)\n end\n end\nend\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\n@Menu\n\nwhen flag clicked\nhide\n\nwhen I receive [story time! v]\nstop [other scripts in sprite v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\nwhen I receive [options menu v]\nstop [other scripts in sprite v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\nwhen I receive [start2 v]\nwait (1) seconds\nrepeat until <(Level) = [30]>\n change [time: v] by (1)\n wait (1) seconds\nend\n\nwhen I receive [title screen v]\nset [menuclone v] to [1]\nwait (1) seconds\nswitch costume to (costume1 v)\ncreate clone of (_myself_ v)\nchange [menuclone v] by (1)\nswitch costume to (costume2 v)\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nrepeat until <(Play) = [1]>\n if <([abs v] of ((mouse y) - ((y position) + (10))) ) < [10]> then\n set volume to ((Volume) * (0.5)) %\n start sound [131658__bertrof__game-sound-selection v]\n wait until <not <([abs v] of ((mouse y) - ((y position) + (10))) ) < [10]>>\n end\nend\ndelete this clone\n\nwhen I start as a clone\nshow\nset [ghost v] effect to (0)\ngo to x: (-215) y: (-180)\nrepeat until <(Play) = [1]>\n change y by ((((-85) - ((costume [number v]) * (25))) - (y position)) / (3))\n if <([abs v] of ((mouse y) - ((y position) + (10))) ) < [10]> then\n if <mouse down?> then\n change x by (((-180) - (x position)) / (3))\n if <(MenuClone) = [1]> then\n broadcast (Story Time! v)\n end\n if <(MenuClone) = [2]> then\n broadcast (Options Menu v)\n end\n else\n change x by (((-200) - (x position)) / (3))\n end\n else\n change x by (((-220) - (x position)) / (3))\n end\nend\ndelete this clone\n\nwhen I receive [start v]\nwait (1) seconds\nstop [other scripts in sprite v]\nforever\n if <(Play) = [1]> then\n change [time: v] by (1)\n wait (1) seconds\n end\nend\n\nwhen I receive [cutscenep1 v]\nset [play v] to [0]\n\nwhen I receive [trialstart v]\nset [play v] to [1]\n\n@UpArrow\n\nwhen I receive [options menu v]\nset [ghost v] effect to (0)\nshow\n\nwhen flag clicked\nset [volume v] to [0]\n\nwhen this sprite clicked\nif <not <(Volume) = [100]>> then\n broadcast (VolUp v)\nend\n\nwhen flag clicked\ngo to x: (80) y: (-72)\nset size to (80) %\nhide\n\nwhen flag clicked\nset [option menu v] to [0]\n\nwhen I receive [title screen v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [part1story v]\nhide\n\n@DownArrow\n\nwhen I receive [options menu v]\nset [ghost v] effect to (0)\nshow\n\nwhen flag clicked\ngo to x: (87) y: (-60)\nset size to (79) %\nhide\n\nwhen I receive [title screen v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen this sprite clicked\nif <not <(Volume) = [0]>> then\n broadcast (VolDown v)\nend\n\nwhen I receive [part1story v]\nhide\n\n@Back\n\nwhen flag clicked\ngo to x: (0) y: (-172)\nset size to (90) %\nhide\n\nwhen I receive [title screen v]\nset [title screen v] to [1]\nset [option menu v] to [0]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [options menu v]\nset [option menu v] to [1]\nset [ghost v] effect to (0)\nshow\nforever\n if <<([abs v] of ((mouse y) - ((y position) + (70))) ) < [20]> and <([abs v] of ((mouse x) - (x position)) ) < [40]>> then\n if <mouse down?> then\n change size by (((80) - (size)) / (2))\n broadcast (title screen v)\n else\n change size by (((120) - (size)) / (2))\n end\n else\n change size by (((100) - (size)) / (2))\n end\nend\n\nwhen I receive [part1story v]\nstop [other scripts in sprite v]\nhide\n\n@Volume\n\nwhen flag clicked\nhide\n\nwhen I receive [options menu v]\nset [ghost v] effect to (0)\nshow\ngo to x: (-60) y: (-14)\nrepeat until <(Title Screen) = [1]>\n if <(Volume) = [100]> then\n switch costume to (vol100 v)\n end\n if <(Volume) = [90]> then\n switch costume to (vol90 v)\n end\n if <(Volume) = [80]> then\n switch costume to (vol80 v)\n end\n if <(Volume) = [70]> then\n switch costume to (vol70 v)\n end\n if <(Volume) = [60]> then\n switch costume to (vol60 v)\n end\n if <(Volume) = [50]> then\n switch costume to (vol50 v)\n end\n if <(Volume) = [40]> then\n switch costume to (vol40 v)\n end\n if <(Volume) = [30]> then\n switch costume to (vol30 v)\n end\n if <(Volume) = [20]> then\n switch costume to (vol20 v)\n end\n if <(Volume) = [10]> then\n switch costume to (vol10 v)\n end\n if <(Volume) = [0]> then\n switch costume to (vol0 v)\n end\nend\n\nwhen I receive [title screen v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [part1story v]\nhide\n\n@LDM Mode\n\nwhen I receive [start v]\nif <(LDM MODE) = [1]> then\n broadcast (LDM Mode On v)\nend\n\nwhen I receive [part1story v]\nhide\n\nwhen this sprite clicked\nif <(LDM MODE) = [0]> then\n set [ldm mode v] to [1]\n switch costume to (ldm on v)\nelse\n switch costume to (ldm off v)\n set [ldm mode v] to [0]\nend\n\nwhen I receive [options menu v]\ngo to x: (-35) y: (40)\nset size to (100) %\nset [ghost v] effect to (0)\nshow\n\nwhen I receive [title screen v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nhide\nswitch costume to (ldm off v)\nhide variable [ldm mode v]\nset [ldm mode v] to [0]\n\n@Part1Story\n\nwhen I receive [part1story v]\ngo to x: (-30) y: (0)\nswitch costume to (story1 v)\nswitch backdrop to (snow1 v)\nrepeat until <(costume [number v]) = [11]>\n wait until <key (space v) pressed?>\n next costume\n wait (0.3) seconds\nend\nwait until <key (space v) pressed?>\nbroadcast (options menu v)\nswitch backdrop to (titlescreen v)\n\nwhen this sprite clicked\nbroadcast (Part1Story v)\n\nwhen I receive [options menu v]\ngo to x: (-15) y: (110)\nswitch costume to (part1story v)\nset size to (100) %\nset [ghost v] effect to (0)\nshow\n\nwhen I receive [title screen v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nhide\nswitch costume to (part1story v)\n\n@Cutscene\n\nwhen flag clicked\nswitch costume to (costume1 v)\nset [cutscene2 v] to [0]\ngo to x: (2) y: (-68)\nhide\n\nwhen I receive [trialbuttons v]\nhide\n\nwhen I receive [cutscenep2 v]\nshow\n\nwhen I receive [cutscenep4 v]\nwait (1) seconds\nswitch costume to (costume2 v)\n\nwhen I receive [trialvictory v]\nswitch costume to (costume1 v)\nshow\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\n@TextCutscene\n\nwhen flag clicked\nswitch costume to (scenetext1 v)\ngo to x: (-76) y: (3)\nhide\nset [cutscene v] to [0]\nset [cutscenetext v] to [0]\n\nwhen I receive [cutscenep2 v]\nset [cutscenetext v] to [1]\nswitch costume to (scenetext1 v)\nshow\n\nwhen I receive [cutscenetext v]\nswitch costume to (scenetext3 v)\nchange [cutscenetext v] by (1)\n\nwhen I receive [trialbuttons v]\nhide\n\nwhen [space v] key pressed\nif <(CutsceneText) = [11]> then\n broadcast (victorycutscene v)\nelse\n if <(Cutscene) = [1]> then\n Text\n end\nend\nwait until <not <key (space v) pressed?>>\n\ndefine Fade\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\ndefine Reappear\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\ndefine Text\nif <(CutsceneText) = [1]> then\n Fade\n change [cutscenetext v] by (1)\n next costume\n wait (0.1) seconds\n Reappear\nelse\n if <(CutsceneText) = [2]> then\n broadcast (cutscenep3 v)\n set [cutscene v] to [0]\n end\n if <(CutsceneText) = [3]> then\n broadcast (cutscenep4 v)\n set [cutscene v] to [0]\n end\n if <<(CutsceneText) > [3]> and <(CutsceneText) < [7]>> then\n Fade\n change [cutscenetext v] by (1)\n next costume\n wait (0.1) seconds\n Reappear\n else\n if <(CutsceneText) = [7]> then\n broadcast (cutscenep5 v)\n set [cutscene v] to [0]\n end\n if <<(CutsceneText) = [8]> or <(CutsceneText) = [9]>> then\n Fade\n change [cutscenetext v] by (1)\n next costume\n wait (0.1) seconds\n Reappear\n else\n if <(CutsceneText) = [10]> then\n broadcast (cutscenep6 v)\n set [cutscene v] to [0]\n end\n end\n end\nend\n\nwhen I receive [cutscenetext2 v]\nshow\nswitch costume to (scenetext4 v)\nchange [cutscenetext v] by (1)\n\nwhen I receive [cutscenetext3 v]\nshow\nswitch costume to (scenetext8 v)\nchange [cutscenetext v] by (1)\n\nwhen I receive [trialvictory v]\nset [cutscenetext v] to [11]\nswitch costume to (scenetext11 v)\nshow\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\n@Fade In/Out\n\nwhen I receive [cutscenep1 v]\nif <(LDM MODE) = [0]> then\n show\n Fade\n wait (2) seconds\n broadcast (cutscenep2 v)\n Reappear\n set [cutscene v] to [1]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (cutscenep2 v)\n set [ghost v] effect to (100)\n set [cutscene v] to [1]\nend\n\nwhen I receive [cutscenep3 v]\nif <(LDM MODE) = [0]> then\n Fade\n wait (2) seconds\n broadcast (cutscenetext v)\n Reappear\n set [cutscene v] to [1]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (cutscenetext v)\n set [ghost v] effect to (100)\n set [cutscene v] to [1]\nend\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (0) y: (0)\nhide\nset [ghost v] effect to (100)\n\ndefine Fade\ngo to [front v] layer\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\ndefine Reappear\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwhen I receive [intro v]\nshow\nFade\nwait (1) seconds\nReappear\nbroadcast (title screen v)\nset [title screen v] to [1]\nhide\n\nwhen I receive [victorycutscene v]\nif <(LDM MODE) = [0]> then\n go to [front v] layer\n Fade\n wait (2) seconds\n broadcast (victory!!!!! wahooo!!! v)\n Reappear\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (victory!!!!! wahooo!!! v)\n set [ghost v] effect to (100)\nend\nforever\n set [play v] to [0]\nend\n\nwhen I receive [cutscenep4 v]\nif <(LDM MODE) = [0]> then\n Fade\n wait (2) seconds\n broadcast (cutscenetext2 v)\n go to [front v] layer\n Reappear\n set [cutscene v] to [1]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (cutscenetext2 v)\n set [ghost v] effect to (100)\n set [cutscene v] to [1]\nend\n\nwhen I receive [cutscenep6 v]\nif <(LDM MODE) = [0]> then\n Fade\n wait (2) seconds\n broadcast (TrialButtons v)\n go to [front v] layer\n Reappear\n set [cutscene v] to [0]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (TrialButtons v)\n set [ghost v] effect to (100)\n set [cutscene v] to [0]\nend\n\nwhen I receive [cutscenep5 v]\nif <(LDM MODE) = [0]> then\n Fade\n wait (2) seconds\n broadcast (cutscenetext3 v)\n go to [front v] layer\n Reappear\n set [cutscene v] to [1]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (cutscenetext3 v)\n set [ghost v] effect to (100)\n set [cutscene v] to [1]\nend\n\nwhen I receive [endcutscene v]\nif <(LDM MODE) = [0]> then\n Fade\n wait (2) seconds\n broadcast (TrialVictory v)\n go to [front v] layer\n Reappear\n set [cutscene v] to [1]\nelse\n set [ghost v] effect to (0)\n wait (2) seconds\n broadcast (TrialVictory v)\n set [ghost v] effect to (100)\n set [cutscene v] to [1]\nend\n\n@Intro\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (0) y: (0)\nswitch costume to (intro v)\nclear graphic effects\nshow\nwait (2) seconds\nrepeat (10)\n change [brightness v] effect by (-10)\n wait (0.01) seconds\nend\nbroadcast (intro v)\nwait (1) seconds\nhide\n\n@Snow\n\nwhen I start as a clone\ngo to x: (pick random (-230) to (182)) y: (180)\nset size to (pick random (40) to (15)) %\nset [y-var v] to (pick random (-3) to (-5))\nif <(LDM) = [0]> then\n show\n repeat until <(y position) < [-175]>\n change y by (y-var)\n end\nend\ndelete this clone\n\nwhen I receive [cheater!!! v]\nstop [other scripts in sprite v]\n\nwhen I receive [start v]\nforever\n if <<(Level) = [4]> or <(Level) < [4]>> then\n if <<(LDM) = [0]> and <(LDM MODE) = [0]>> then\n create clone of (_myself_ v)\n wait (0.3) seconds\n end\n end\nend\n\nwhen flag clicked\ngo [backward v] (10) layers\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [cutscenep5 v]\nset [ldm v] to [1]\nset [y-var v] to [-40]\nwait (3) seconds\nstop [other scripts in sprite v]\n\nwhen I receive [ldm mode on v]\nforever\n stop [other scripts in sprite v]\nend\n\n@Ending\n\nwhen I receive [timecalculate v]\nwait (4) seconds\nset [ldm v] to [0]\nforever\n if <<(LDM) = [0]> and <(LDM MODE) = [0]>> then\n create clone of (_myself_ v)\n wait (1) seconds\n end\nend\n\nwhen I receive [ldm mode on v]\nforever\n stop [other scripts in sprite v]\nend\n\nwhen I start as a clone\ngo to x: (pick random (-230) to (182)) y: (180)\nset size to (pick random (45) to (20)) %\nswitch costume to (pick random (1) to (2))\nset [y-var v] to (pick random (-3) to (-5))\nif <(LDM) = [0]> then\n show\n repeat until <(y position) < [-175]>\n change y by (y-var)\n end\nend\ndelete this clone\n\nwhen flag clicked\nset [ldm v] to [0]\nforever\n if <key (l v) pressed?> then\n wait (0.1) seconds\n if <not <(LDM) = [0]>> then\n repeat (3)\n set [ldm v] to [0]\n broadcast (ldmoff v)\n end\n else\n repeat (3)\n set [ldm v] to [1]\n end\n end\n end\nend\n\nwhen flag clicked\ngo [backward v] (10) layers\ngo to x: (0) y: (0)\nhide\n\n@Stopnail\n\nwhen flag clicked\nset [titlescreen v] to [0]\ngo to x: (0) y: (0)\nforever\n hide\n reset timer\nend\n\nwhen [timer v] > (0.1)\nif <(TitleScreen) = [1]> then\n hide variable [level v]\n hide variable [trialgroundname v]\n go to [front v] layer\n show\nend\n\nwhen I receive [title screen v]\nset [titlescreen v] to [1]\n\n@Signs\n\nwhen flag clicked\nswitch costume to (sign v)\ngo to x: (-113) y: (-130)\nset size to (80) %\nhide\n\nwhen I receive [cutscenep2 v]\nstop [other scripts in sprite v]\n\nwhen I receive [start v]\nforever\n if <(Level) = [7]> then\n show\n else\n hide\n end\nend\n\nwhen I receive [start v]\nforever\n if <(Level) = [7]> then\n if <touching (player v)?> then\n switch costume to (signtext v)\n if <key (e v) pressed?> then\n broadcast (sign v)\n set [play v] to [0]\n set [sign v] to [1]\n wait (0.5) seconds\n wait until <key (e v) pressed?>\n broadcast (signback v)\n set [play v] to [1]\n set [sign v] to [0]\n wait until <not <key (e v) pressed?>>\n end\n else\n switch costume to (sign v)\n end\n end\nend\n\nwhen I receive [sign v]\ngo to x: (0) y: (15)\nswitch costume to (signpopup v)\ngo to [front v] layer\n\nwhen I receive [signback v]\nswitch costume to (signtext v)\ngo to x: (-112) y: (-130)\n\n@TrialButtons\n\ndefine buttonsound\nif <(Sign) = [0]> then\n start sound [Suction Cup v]\n wait (0.1) seconds\nend\n\nwhen I start as a clone\nforever\n if <(Play) = [1]> then\n stop [other scripts in sprite v]\n delete this clone\n end\nend\n\nwhen I start as a clone\nshow\nif <(costume [number v]) = [1]> then\n forever\n if <touching (mouse-pointer v)?> then\n switch costume to (easy2 v)\n buttonsound\n repeat until <not <touching (mouse-pointer v)?>>\n if <mouse down?> then\n set [difficulty v] to [1]\n set [dead v] to [0]\n broadcast (trialstart v)\n end\n end\n else\n switch costume to (easy v)\n end\n end\nelse\n if <(costume [number v]) = [3]> then\n forever\n if <touching (mouse-pointer v)?> then\n switch costume to (medium2 v)\n buttonsound\n repeat until <not <touching (mouse-pointer v)?>>\n if <mouse down?> then\n set [difficulty v] to [2]\n set [dead v] to [0]\n broadcast (trialstart v)\n end\n end\n else\n switch costume to (medium v)\n end\n end\n else\n if <(costume [number v]) = [5]> then\n forever\n if <touching (mouse-pointer v)?> then\n switch costume to (hard2 v)\n buttonsound\n repeat until <not <touching (mouse-pointer v)?>>\n if <mouse down?> then\n set [difficulty v] to [3]\n set [dead v] to [0]\n broadcast (trialstart v)\n end\n end\n else\n switch costume to (hard v)\n end\n end\n else\n forever\n if <touching (mouse-pointer v)?> then\n switch costume to (extreme2 v)\n buttonsound\n repeat until <not <touching (mouse-pointer v)?>>\n if <mouse down?> then\n set [dead v] to [0]\n set [difficulty v] to [4]\n broadcast (trialstart v)\n end\n end\n else\n switch costume to (extreme v)\n end\n end\n end\n end\nend\n\nwhen I receive [victory!!!!! wahooo!!! v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [trialstart v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [trialbuttons v]\nif <not <(Checkpoint#) = [6]>> then\n go to [front v] layer\n hide\n go to x: (230) y: (-10)\n switch costume to (easy v)\n create clone of (_myself_ v)\n go to x: (450) y: (-10)\n switch costume to (medium v)\n create clone of (_myself_ v)\n go to x: (230) y: (-100)\n switch costume to (hard v)\n create clone of (_myself_ v)\n go to x: (450) y: (-100)\n switch costume to (extreme v)\n create clone of (_myself_ v)\nend\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nset volume to (100) %\nset [difficulty v] to [0]\nswitch costume to (easy v)\nclear graphic effects\nset size to (250) %\nhide\n\n@TrialButtons2\n\nwhen I receive [trialstart v]\nhide\n\nwhen I receive [trialstart v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [trialbuttons v]\nif <not <(Checkpoint#) = [6]>> then\n go to [front v] layer\n show\n go to x: (-3) y: (-46)\n forever\n if <touching (mouse-pointer v)?> then\n switch costume to (signpopup v)\n set [sign v] to [1]\n go to [front v] layer\n wait until <not <touching (mouse-pointer v)?>>\n switch costume to (questions v)\n set [sign v] to [0]\n end\n end\nelse\n hide\n stop [this script v]\nend\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nset volume to (70) %\nset [sign v] to [0]\nswitch costume to (questions v)\nclear graphic effects\nset size to (70) %\nhide\n\n@TrialGround\n\nwhen flag clicked\ndelete (all) of [trialspawny v]\nadd [-106] to [trialspawny v]\nadd [69] to [trialspawny v]\nadd [-105] to [trialspawny v]\nadd [71] to [trialspawny v]\nadd [-2] to [trialspawny v]\n\nwhen flag clicked\nset [checkpoint# v] to [0]\ndelete (all) of [trialspawnx v]\nadd [-183] to [trialspawnx v]\nadd [30] to [trialspawnx v]\nadd [-155] to [trialspawnx v]\nadd [-12] to [trialspawnx v]\nadd [-170] to [trialspawnx v]\n\nwhen I receive [trialstart v]\nforever\n set [trial l-r # v] to (letter (9) of (costume [name v]))\nend\n\nwhen I receive [trialstart v]\nforever\n set [trial u-d # v] to (letter (7) of (costume [name v]))\nend\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [victory!!!!! wahooo!!! v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [cutscenep2 v]\nstop [other scripts in sprite v]\nhide variable [level v]\nhide\n\nwhen I receive [trialspawn v]\nif <(Checkpoint#) = [2]> then\n switch costume to (trial 1-3 v)\nelse\n if <(Checkpoint#) = [3]> then\n switch costume to (trial 2-4 v)\n else\n if <(Checkpoint#) = [4]> then\n switch costume to (trial 3-3 v)\n else\n if <(Checkpoint#) = [5]> then\n switch costume to (trial 2-1 v)\n else\n switch costume to (trial 1-1 v)\n end\n end\n end\nend\n\nwhen I receive [trialstart v]\nif <(ShowLevel?) = [1]> then\n show variable [trialgroundname v]\nend\nforever\n if <key (t v) pressed?> then\n if <(ShowLevel?) = [0]> then\n set [showlevel? v] to [1]\n show variable [trialgroundname v]\n wait until <not <key (t v) pressed?>>\n else\n set [showlevel? v] to [0]\n hide variable [trialgroundname v]\n wait until <not <key (t v) pressed?>>\n end\n end\nend\n\nwhen I receive [start v]\nforever\n if <key (t v) pressed?> then\n if <(ShowLevel?) = [0]> then\n set [showlevel? v] to [1]\n show variable [level v]\n wait until <not <key (t v) pressed?>>\n else\n set [showlevel? v] to [0]\n hide variable [level v]\n wait until <not <key (t v) pressed?>>\n end\n end\nend\n\nwhen flag clicked\ndelete (all) of [trialpath v]\nadd [Trial 1-2] to [trialpath v]\nadd [Trial 2-2] to [trialpath v]\nadd [Trial 2-3] to [trialpath v]\nadd [Trial 1-3] to [trialpath v]\nadd [Trial 1-4] to [trialpath v]\nadd [Trial 1-5] to [trialpath v]\nadd [Trial 2-5] to [trialpath v]\nadd [Trial 2-4] to [trialpath v]\nadd [Trial 3-5] to [trialpath v]\nadd [Trial 3-4] to [trialpath v]\nadd [Trial 3-3] to [trialpath v]\nadd [Trial 3-2] to [trialpath v]\nadd [Trial 3-1] to [trialpath v]\nadd [Trial 2-1] to [trialpath v]\ndelete all of [trialpath2 v]\nadd [Trial 2-3] to [trialpath2 v]\nadd [Trial 1-3] to [trialpath2 v]\nadd [Trial 1-4] to [trialpath2 v]\nadd [Trial 1-5] to [trialpath2 v]\n\nwhen I receive [trialbuttons v]\nhide\n\nwhen flag clicked\ndelete all of [trialskipx v]\nadd [-147] to [trialskipx v]\nadd [95] to [trialskipx v]\nadd [-169] to [trialskipx v]\nadd [30] to [trialskipx v]\nadd [-158] to [trialskipx v]\nadd [-181] to [trialskipx v]\nadd [-127] to [trialskipx v]\nadd [-155] to [trialskipx v]\nadd [155] to [trialskipx v]\nadd [217] to [trialskipx v]\nadd [225] to [trialskipx v]\nadd [238] to [trialskipx v]\nadd [238] to [trialskipx v]\nadd [233] to [trialskipx v]\ndelete all of [trialskipx2 v]\nadd [-49] to [trialskipx2 v]\nadd [30] to [trialskipx2 v]\nadd [-158] to [trialskipx2 v]\nadd [-181] to [trialskipx2 v]\n\nwhen flag clicked\ndelete all of [trialskipy v]\nadd [-105] to [trialskipy v]\nadd [-104] to [trialskipy v]\nadd [145] to [trialskipy v]\nadd [69] to [trialskipy v]\nadd [-105] to [trialskipy v]\nadd [-85] to [trialskipy v]\nadd [-46] to [trialskipy v]\nadd [-105] to [trialskipy v]\nadd [-93] to [trialskipy v]\nadd [63] to [trialskipy v]\nadd [-41] to [trialskipy v]\nadd [-3] to [trialskipy v]\nadd [23] to [trialskipy v]\nadd [179] to [trialskipy v]\ndelete all of [trialskipy2 v]\nadd [128] to [trialskipy2 v]\nadd [69] to [trialskipy2 v]\nadd [-105] to [trialskipy2 v]\nadd [-85] to [trialskipy2 v]\n\nwhen I receive [trialskip v]\nif <<[trialpath2 v] contains (TrialGroundName)?> and <(Checkpoint#) = [5]>> then\n switch costume to (item (TrialSkip#2) of [trialpath2 v])\nelse\n switch costume to (item (TrialSkip#) of [trialpath v])\nend\ngo to x: (-2) y: (-38)\n\nwhen I receive [trialstart v]\nforever\n if <<[trialpath2 v] contains (TrialGroundName)?> and <(Checkpoint#) = [5]>> then\n set [trialskip#2 v] to ((item # of (TrialGroundName) in [trialpath2 v]) + (1))\n else\n set [trialskip# v] to ((item # of (TrialGroundName) in [trialpath v]) + (1))\n set [trialskip#2 v] to [0]\n end\nend\n\nwhen I receive [trialskip2 v]\nswitch costume to (trial 2-2 v)\n\nwhen I receive [trialvictory v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [stageright v]\nswitch costume to (join [Trial ] (join (Trial U-D #) (join [-] ((Trial L-R #) + (1)))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stageleft v]\nswitch costume to (join [Trial ] (join (Trial U-D #) (join [-] ((Trial L-R #) - (1)))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stageup v]\nswitch costume to (join [Trial ] (join ((Trial U-D #) + (1)) (join [-] (Trial L-R #))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stagedown v]\nswitch costume to (join [Trial ] (join ((Trial U-D #) - (1)) (join [-] (Trial L-R #))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [trialstart v]\nbroadcast (trialspawn v)\nforever\n set [trialgroundname v] to (costume [name v])\nend\n\nwhen I receive [trialstart v]\nset [checkpoint# v] to [1]\nset size to (100) %\nshow\ngo to [front v] layer\nswitch costume to (trial 1-1 v)\nrepeat (3)\n go to x: (-2) y: (-38)\nend\n\nwhen flag clicked\nhide variable [trialgroundname v]\nset [showlevel? v] to [0]\ngo to x: (-2) y: (-38)\nhide\n\n@TrialObstacles\n\nwhen I receive [trialspawn v]\ngo to x: (-2) y: (-38)\nif <(Checkpoint#) = [2]> then\n switch costume to (trial 1-3 v)\nelse\n if <(Checkpoint#) = [3]> then\n switch costume to (trial 2-4 v)\n else\n if <(Checkpoint#) = [4]> then\n switch costume to (trial 3-3 v)\n else\n if <(Checkpoint#) = [5]> then\n switch costume to (trial 2-1 v)\n else\n switch costume to (trial 1-1 v)\n end\n end\n end\nend\n\nwhen I receive [trialstart v]\nforever\n if <(TrialGroundName) = [Trial 2-3]> then\n go to [front v] layer\n go [backward v] (5) layers\n go to x: (-2) y: (-12)\n else\n go to x: (-2) y: (-38)\n end\nend\n\nwhen I receive [trialstart v]\nif <(length of [deathlist v]) = [0]> then\n add (Death Count:) to [deathlist v]\nelse\n replace item (1) of [deathlist v] with (Death Count:)\nend\nif <(length of [deathlist v]) < [2]> then\n add ((Death Count:) - (item (1) of [deathlist v])) to [deathlist v]\nelse\n replace item (2) of [deathlist v] with ((Death Count:) - (item (1) of [deathlist v]))\nend\nif <(Difficulty) = [2]> then\n set [trialdeathmax v] to [50]\nelse\n if <(Difficulty) = [3]> then\n set [trialdeathmax v] to [25]\n else\n if <(Difficulty) = [4]> then\n set [trialdeathmax v] to [10]\n else\n set [trialdeathmax v] to [0]\n end\n end\nend\nwait (1) seconds\nwait until <not <(item (2) of [deathlist v]) = ((Death Count:) - (item (1) of [deathlist v]))>>\nforever\n if <not <(TrialDeathMax) = [0]>> then\n if <not <(item (2) of [deathlist v]) < (TrialDeathMax)>> then\n broadcast (TrialButtons v)\n if <(length of [deathlist v]) = [3]> then\n replace item (3) of [deathlist v] with ((item (2) of [deathlist v]) + (item (3) of [deathlist v]))\n else\n add (item (2) of [deathlist v]) to [deathlist v]\n end\n stop [this script v]\n end\n end\nend\n\nwhen I receive [trialstart v]\nforever\n if <not <(item (2) of [deathlist v]) = ((Death Count:) - (item (1) of [deathlist v]))>> then\n replace item (2) of [deathlist v] with ((Death Count:) - (item (1) of [deathlist v]))\n end\nend\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\ndelete all of [deathlist v]\n\nwhen I receive [trialskip v]\nif <<[trialpath2 v] contains (TrialGroundName)?> and <(Checkpoint#) = [5]>> then\n switch costume to (item (TrialSkip#2) of [trialpath2 v])\nelse\n switch costume to (item (TrialSkip#) of [trialpath v])\nend\ngo to x: (-2) y: (-38)\n\nwhen I receive [trialskip2 v]\nswitch costume to (trial 2-2 v)\ngo to x: (-2) y: (-38)\n\nwhen I receive [trialvictory v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [stageright v]\nswitch costume to (join [Trial ] (join (Trial U-D #) (join [-] ((Trial L-R #) + (1)))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stageleft v]\nswitch costume to (join [Trial ] (join (Trial U-D #) (join [-] ((Trial L-R #) - (1)))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stageup v]\nswitch costume to (join [Trial ] (join ((Trial U-D #) + (1)) (join [-] (Trial L-R #))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [stagedown v]\nswitch costume to (join [Trial ] (join ((Trial U-D #) - (1)) (join [-] (Trial L-R #))))\ngo to x: (-2) y: (-38)\n\nwhen I receive [trialstart v]\nset size to (100) %\nshow\ngo to [front v] layer\nswitch costume to (trial 1-1 v)\nrepeat (3)\n go to x: (-2) y: (-38)\nend\n\nwhen flag clicked\nset [trialskip# v] to [0]\nset [trialskip#2 v] to [0]\ngo to x: (-2) y: (-38)\nhide\n\n@ChangingGround\n\nwhen I start as a clone\nshow\nforever\n if <(LDM MODE) = [0]> then\n if <(size) = [90]> then\n turn right (4) degrees\n end\n if <(size) = [130]> then\n turn right (3) degrees\n end\n if <(size) = [190]> then\n turn right (2) degrees\n end\n end\n if <(size) = [100]> then\n if <(CloneID) = [Vertical]> then\n if <(TrialGroundName) = [Trial 1-2]> then\n glide (1) secs to x: (-100) y: (-20)\n wait (0.5) seconds\n glide (1) secs to x: (-100) y: (-100)\n wait (0.5) seconds\n else\n glide (4) secs to x: (x position) y: (-200)\n delete this clone\n end\n end\n if <(CloneID) = [Horizontal]> then\n if <(TrialGroundName) = [Trial 2-2]> then\n glide (1) secs to x: (-115) y: (50)\n wait (0.5) seconds\n glide (1) secs to x: (20) y: (50)\n wait (0.5) seconds\n else\n if <(TrialGroundName) = [Trial 2-3]> then\n glide (5) secs to x: (-260) y: (y position)\n delete this clone\n end\n end\n end\n if <(CloneID) = [Disappearing]> then\n if <(TrialGroundName) = [Trial 2-4]> then\n if <(costume [number v]) = [1]> then\n repeat until <not <(TrialGroundName) = [Trial 2-4]>>\n switch costume to (clone1 v)\n wait (1.5) seconds\n switch costume to (clone3 v)\n wait (1.5) seconds\n end\n delete this clone\n end\n if <(costume [number v]) = [5]> then\n repeat until <not <(TrialGroundName) = [Trial 2-4]>>\n switch costume to (clone5 v)\n wait (3) seconds\n switch costume to (clone3 v)\n wait (3) seconds\n end\n delete this clone\n end\n else\n if <(TrialGroundName) = [Trial 3-5]> then\n if <(costume [number v]) = [5]> then\n repeat until <not <(TrialGroundName) = [Trial 3-5]>>\n switch costume to (clone5 v)\n wait (2) seconds\n switch costume to (clone3 v)\n wait (2) seconds\n end\n delete this clone\n end\n if <(costume [number v]) = [1]> then\n repeat until <not <(TrialGroundName) = [Trial 3-5]>>\n switch costume to (clone1 v)\n wait (2) seconds\n switch costume to (clone3 v)\n wait (2) seconds\n end\n delete this clone\n end\n else\n if <(TrialGroundName) = [Trial 3-1]> then\n if <(costume [number v]) = [4]> then\n repeat until <not <(TrialGroundName) = [Trial 3-1]>>\n switch costume to (clone4 v)\n wait (1.5) seconds\n switch costume to (clone3 v)\n wait (1.5) seconds\n end\n delete this clone\n else\n if <(costume [number v]) = [6]> then\n repeat until <not <(TrialGroundName) = [Trial 3-1]>>\n switch costume to (clone6 v)\n wait (1.5) seconds\n switch costume to (clone3 v)\n wait (1.5) seconds\n end\n delete this clone\n end\n end\n end\n end\n end\n end\n else\n if <(CloneID) = [Disappearing]> then\n if <(TrialGroundName) = [Trial 3-1]> then\n if <(costume [name v]) = [Blade]> then\n repeat until <not <(TrialGroundName) = [Trial 3-1]>>\n switch costume to (blade v)\n repeat (60)\n wait (0.01) seconds\n turn right (3) degrees\n end\n switch costume to (clone3 v)\n wait (3) seconds\n end\n delete this clone\n end\n end\n end\n end\nend\n\nwhen I receive [story time! v]\nhide\n\nwhen I receive [next stage v]\nhide\nwait (0.1) seconds\nif <(Level) = [2]> then\n set [clones? v] to [1]\n switch costume to (clone1 v)\n go to x: (-57) y: (-10)\n create clone of (_myself_ v)\n go to x: (-175) y: (47)\n create clone of (_myself_ v)\n go to x: (-40) y: (87)\n create clone of (_myself_ v)\n go to x: (183) y: (-24)\n create clone of (_myself_ v)\nend\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\nwhen I start as a clone\nif <(Level) = [2]> then\n wait (0.2) seconds\n show\n repeat until <not <(Level) = [2]>>\n switch costume to (clone1 v)\n set [groundcolor v] to [1]\n wait (6) seconds\n switch costume to (clone2 v)\n set [groundcolor v] to [2]\n wait (3) seconds\n end\nend\n\nwhen flag clicked\nset [clones? v] to [1]\nset [cloneid v] to [0]\nset [groundcolor v] to [1]\nswitch costume to (clone1 v)\nset size to (100) %\nhide\n\nwhen I start as a clone\nif <(Level) = [2]> then\n wait until <(Level) = [3]>\n repeat (3)\n delete this clone\n end\nend\n\ndefine Set (X,Y)\nhide\ngo to [front v] layer\nset [cloneid v] to [0]\nif <(TrialGroundName) = [Trial 1-1]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n point in direction (90)\n set size to (190) %\n go to x: (-3) y: (-100)\n create clone of (_myself_ v)\n go to x: (195) y: (-80)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 1-2]> then\n set [groundcolor v] to [2]\n set [cloneid v] to [Vertical]\n go to x: (-100) y: (-100)\n switch costume to (clone4 v)\n point in direction (90)\n set size to (100) %\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 1-3]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n set size to (130) %\n point in direction (90)\n go to x: (-120) y: (100)\n create clone of (_myself_ v)\n go to x: (120) y: (100)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 1-4]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n set size to (190) %\n point in direction (90)\n go to x: (9) y: (27)\n create clone of (_myself_ v)\n go to x: (21) y: (27)\n create clone of (_myself_ v)\n set size to (130) %\n go to x: (10) y: (-170)\n create clone of (_myself_ v)\n go to x: (60) y: (-170)\n create clone of (_myself_ v)\n set size to (90) %\n point in direction (90)\n go to x: (100) y: (160)\n create clone of (_myself_ v)\n go to x: (130) y: (160)\n create clone of (_myself_ v)\n go to x: (160) y: (160)\n create clone of (_myself_ v)\n go to x: (190) y: (160)\n create clone of (_myself_ v)\n go to x: (220) y: (160)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 1-5]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n set size to (190) %\n point in direction (90)\n go to x: (16) y: (-131)\n create clone of (_myself_ v)\n go to x: (220) y: (0)\n create clone of (_myself_ v)\n set size to (130) %\n go to x: (230) y: (60)\n create clone of (_myself_ v)\n go to x: (230) y: (-60)\n create clone of (_myself_ v)\n set size to (90) %\n go to x: (-5) y: (25)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 2-2]> then\n set [groundcolor v] to [2]\n set [cloneid v] to [Horizontal]\n switch costume to (clone2 v)\n set size to (100) %\n point in direction (90)\n go to x: (-115) y: (50)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 2-3]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n set size to (130) %\n point in direction (90)\n go to x: (-200) y: (-105)\n create clone of (_myself_ v)\n go to x: (-200) y: (-12)\n create clone of (_myself_ v)\n go to x: (200) y: (-105)\n create clone of (_myself_ v)\n go to x: (200) y: (-12)\n create clone of (_myself_ v)\n set [cloneid v] to [Horizontal]\n set size to (100) %\n switch costume to (clone2 v)\n go to [back v] layer\n repeat until <not <(TrialGroundName) = [Trial 2-3]>>\n go to x: (282) y: (46)\n create clone of (_myself_ v)\n go to x: (282) y: (-45)\n create clone of (_myself_ v)\n go to x: (282) y: (-138)\n create clone of (_myself_ v)\n wait (1.5) seconds\n end\nend\nif <(TrialGroundName) = [Trial 2-4]> then\n set [cloneid v] to [Disappearing]\n set [groundcolor v] to [1]\n set size to (100) %\n switch costume to (clone1 v)\n go to x: (-170) y: (-93)\n create clone of (_myself_ v)\n switch costume to (clone5 v)\n go to x: (100) y: (30)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 3-1]> then\n set [cloneid v] to [Disappearing]\n set [groundcolor v] to [2]\n set size to (100) %\n switch costume to (clone4 v)\n go to x: (60) y: (130)\n create clone of (_myself_ v)\n switch costume to (clone6 v)\n go to x: (-121) y: (100)\n create clone of (_myself_ v)\n set size to (190) %\n switch costume to (blade v)\n go to x: (130) y: (15)\n create clone of (_myself_ v)\n go to x: (-19) y: (-120)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 3-2]> then\n set [cloneid v] to [Vertical]\n set [groundcolor v] to [2]\n set size to (100) %\n switch costume to (clone4 v)\n go to [back v] layer\n repeat until <not <(TrialGroundName) = [Trial 3-2]>>\n go to x: (4) y: (210)\n create clone of (_myself_ v)\n go to x: (121) y: (210)\n create clone of (_myself_ v)\n go to x: (-110) y: (210)\n create clone of (_myself_ v)\n wait (1.6) seconds\n end\nend\nif <(TrialGroundName) = [Trial 3-4]> then\n set [groundcolor v] to [2]\n switch costume to (blade v)\n set size to (130) %\n go to x: (76.5) y: (75)\n create clone of (_myself_ v)\n go to x: (8) y: (150)\n create clone of (_myself_ v)\n go to x: (104) y: (-135)\n create clone of (_myself_ v)\n go to x: (165) y: (-125)\n create clone of (_myself_ v)\nend\nif <(TrialGroundName) = [Trial 3-5]> then\n set [cloneid v] to [Disappearing]\n set [groundcolor v] to [1]\n set size to (100) %\n switch costume to (clone1 v)\n go to x: (99) y: (-22)\n create clone of (_myself_ v)\n wait (2) seconds\n if <(TrialGroundName) = [Trial 3-5]> then\n switch costume to (clone5 v)\n go to x: (-80) y: (-120)\n create clone of (_myself_ v)\n end\nend\n\nwhen I receive [stageleft v]\nClones\n\nwhen I receive [stageright v]\nClones\n\nwhen I receive [stageup v]\nClones\n\nwhen I receive [stagedown v]\nClones\n\nwhen I receive [trialstart v]\nrepeat (3)\n Clones\nend\n\nwhen I receive [trialspawn v]\nClones\n\ndefine Clones\nset [clones? v] to [0]\nset [cloneid v] to [0]\nwait (0) seconds\nset [clones? v] to [1]\nSet (X,Y)\n\nwhen I start as a clone\nforever\n if <<(Clones?) = [0]> or <(Play) = [0]>> then\n delete this clone\n end\nend\n\nif <(Level) = [9]> then\n set size to (140) %\n set [cloneid v] to [1]\n go to x: (70) y: (0)\n create clone of (_myself_ v)\n set [cloneid v] to [2]\n go to x: (0) y: (0)\n create clone of (_myself_ v)\n set [cloneid v] to [3]\n go to x: (-70) y: (0)\n create clone of (_myself_ v)\nend\n\nwhen I receive [trialbuttons v]\nset [clones? v] to [0]\nset [cloneid v] to [0]\nhide\n\nwhen I receive [trialskip v]\nset [clones? v] to [0]\nset [cloneid v] to [0]\nwait (0.2) seconds\nset [play v] to [1]\nset [clones? v] to [1]\nSet (X,Y)\n\nwhen I receive [trialskip2 v]\nset [clones? v] to [0]\nset [cloneid v] to [0]\nwait (0.2) seconds\nset [play v] to [1]\nset [clones? v] to [1]\nSet (X,Y)\n\nwhen I receive [trialvictory v]\nset [clones? v] to [0]\nset [cloneid v] to [0]\nhide\n\nwhen I receive [mapback v]\nhide\nwait (0.1) seconds\nif <(Level) = [2]> then\n set [clones? v] to [1]\n switch costume to (clone1 v)\n go to x: (-57) y: (-10)\n create clone of (_myself_ v)\n go to x: (-175) y: (47)\n create clone of (_myself_ v)\n go to x: (-40) y: (87)\n create clone of (_myself_ v)\n go to x: (183) y: (-24)\n create clone of (_myself_ v)\nend\n\n@TrialBackground\n\nwhen I receive [victory!!!!! wahooo!!! v]\nhide\n\nwhen flag clicked\ngo to x: (-2) y: (-38)\nhide\n\nwhen I receive [trialstart v]\nforever\n if <(TrialGroundName) = [Trial 2-3]> then\n switch costume to (trial 2-3 v)\n go to x: (-2) y: (-38)\n go to [front v] layer\n go [backward v] (4) layers\n show\n else\n if <(TrialGroundName) = [Trial 3-2]> then\n switch costume to (trial 3-2 v)\n go to x: (-2) y: (0)\n go to [front v] layer\n go [backward v] (4) layers\n show\n else\n hide\n end\n end\nend\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\nhide\n\n@Gems\n\nwhen I receive [trialstart v]\nforever\n if <(TrialGroundName) = [Trial 1-3]> then\n if <(Checkpoint#) = [1]> then\n switch costume to (gem1 v)\n go to x: (-5) y: (30)\n show\n else\n hide\n end\n else\n if <(TrialGroundName) = [Trial 1-5]> then\n switch costume to (gem5 v)\n go to x: (-146) y: (-135)\n if <(Checkpoint#) = [6]> then\n hide\n else\n show\n end\n else\n if <(TrialGroundName) = [Trial 2-4]> then\n if <(Checkpoint#) = [2]> then\n switch costume to (gem2 v)\n go to x: (-190) y: (-80)\n show\n else\n hide\n end\n else\n if <(TrialGroundName) = [Trial 3-3]> then\n if <(Checkpoint#) = [3]> then\n switch costume to (gem3 v)\n go to x: (-46) y: (37)\n show\n else\n hide\n end\n else\n if <(TrialGroundName) = [Trial 2-1]> then\n if <(Checkpoint#) = [4]> then\n switch costume to (gem4 v)\n go to x: (-205) y: (-40)\n show\n else\n hide\n end\n else\n hide\n end\n end\n end\n end\n end\nend\n\ndefine Collect\nset [ghost v] effect to (0)\nrepeat (10)\n change [ghost v] effect by (10)\n turn right (2) degrees\n change y by (2)\nend\nturn left (20) degrees\nset [ghost v] effect to (0)\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset size to (45) %\npoint in direction (90)\nhide\n\nwhen I receive [trialstart v]\nforever\n if <touching (player v)?> then\n start sound [Connect v]\n Collect\n change [checkpoint# v] by (1)\n if <(Checkpoint#) = [6]> then\n broadcast (Endcutscene v)\n stop [this script v]\n end\n wait until <not <touching (player v)?>>\n end\nend\n\nwhen I receive [trialbuttons v]\nhide\n\nwhen I receive [trialvictory v]\nstop [other scripts in sprite v]\nhide\n\n@Doors\n\ndefine Fade\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\ndefine Appear\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\ndefine Animate\nforever\n if <(TrialGroundName) = [Trial 1-4]> then\n set [doors v] to (item (1) of [locked? v])\n if <(item (1) of [locked? v]) = [1]> then\n wait until <(item (1) of [locked? v]) = [0]>\n set [doors v] to (item (1) of [locked? v])\n Fade\n end\n if <(item (1) of [locked? v]) = [0]> then\n wait until <(item (1) of [locked? v]) = [1]>\n Appear\n set [doors v] to (item (1) of [locked? v])\n end\n end\nend\n\nwhen I receive [trialbuttons v]\nhide\n\ndefine Set X,Y\nstop [other scripts in sprite v]\nclear graphic effects\nwait (0) seconds\nhide\nif <(TrialGroundName) = [Trial 1-4]> then\n switch costume to (locked v)\n go to x: (209) y: (-124)\n show\n if <(item (1) of [locked? v]) = [1]> then\n go to [back v] layer\n else\n set [ghost v] effect to (100)\n end\nelse\n if <(TrialGroundName) = [Trial 1-5]> then\n switch costume to (locked2 v)\n go to x: (-140) y: (-129)\n show\n set [doors v] to (item (3) of [locked? v])\n if <(item (3) of [locked? v]) = [1]> then\n go to [front v] layer\n else\n set [ghost v] effect to (100)\n end\n else\n if <(TrialGroundName) = [Trial 2-5]> then\n switch costume to (locked3 v)\n go to x: (0) y: (170)\n show\n set [doors v] to (item (2) of [locked? v])\n if <(item (2) of [locked? v]) = [1]> then\n go to [front v] layer\n else\n set [ghost v] effect to (100)\n end\n end\n end\nend\nAnimate\n\nwhen I receive [stagedown v]\nSet X,Y\nAnimate\n\nwhen I receive [trialspawn v]\nSet X,Y\nAnimate\n\nwhen I receive [stageleft v]\nSet X,Y\nAnimate\n\nwhen I receive [stageright v]\nSet X,Y\nAnimate\n\nwhen I receive [stageup v]\nSet X,Y\nAnimate\n\nwhen I receive [trialskip2 v]\nSet X,Y\nAnimate\n\nwhen I receive [endcutscene v]\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset size to (100) %\ngo to [back v] layer\nswitch costume to (locked v)\nhide\n\nwhen I receive [trialskip v]\nSet X,Y\nAnimate\n\n@Levers\n\nwhen flag clicked\ndelete all of [locked? v]\nrepeat (3)\n add [1] to [locked? v]\nend\n\ndefine Animate\nif <(costume [number v]) = [3]> then\n repeat (5)\n next costume\n wait (0.05) seconds\n end\n replace item (Lever#) of [locked? v] with [0]\nelse\n switch costume to (levertext6 v)\n switch costume to (levertext5 v)\n wait (0.05) seconds\n switch costume to (levertext4 v)\n wait (0.05) seconds\n switch costume to (levertext3 v)\n wait (0.05) seconds\n switch costume to (levertext2 v)\n wait (0.05) seconds\n switch costume to (levertext v)\n replace item (Lever#) of [locked? v] with [1]\nend\n\nwhen I receive [trialstart v]\nforever\n go to [front v] layer\nend\n\ndefine Epress\nif <key (e v) pressed?> then\n Animate\nend\n\ndefine Costume\nif <(item (Lever#) of [locked? v]) = [1]> then\n switch costume to (lever v)\nelse\n switch costume to (lever2 v)\nend\n\ndefine CostumeTouching\nif <(item (Lever#) of [locked? v]) = [1]> then\n switch costume to (levertext v)\nelse\n switch costume to (levertext6 v)\nend\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [trialskip v]\nif <(TrialGroundName) = [Trial 1-5]> then\n replace item (1) of [locked? v] with [0]\nend\nif <(TrialGroundName) = [Trial 3-1]> then\n replace item (2) of [locked? v] with [0]\nend\nif <(TrialGroundName) = [Trial 2-1]> then\n replace item (3) of [locked? v] with [0]\nend\n\nwhen I receive [trialskip v]\nSet X,Y\n\nwhen I receive [trialskip2 v]\nSet X,Y\n\ndefine Set X,Y\nwait (0) seconds\nhide\nif <(TrialGroundName) = [Trial 1-4]> then\n set [lever# v] to [1]\n switch costume to (lever v)\n go to [front v] layer\n go to x: (172) y: (95)\n show\nelse\n if <(TrialGroundName) = [Trial 2-4]> then\n set [lever# v] to [2]\n switch costume to (lever v)\n go to [front v] layer\n go to x: (-44) y: (-15)\n show\n else\n if <(TrialGroundName) = [Trial 2-1]> then\n set [lever# v] to [3]\n switch costume to (lever v)\n go to [front v] layer\n go to x: (102) y: (-83)\n show\n else\n hide\n end\n end\nend\n\nwhen I receive [stagedown v]\nSet X,Y\n\nwhen I receive [trialspawn v]\nSet X,Y\n\nwhen I receive [stageleft v]\nSet X,Y\n\nwhen I receive [stageright v]\nSet X,Y\n\nwhen I receive [stageup v]\nSet X,Y\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset size to (100) %\ngo to [front v] layer\nhide\n\nwhen I receive [trialstart v]\nforever\n if <touching (player v)?> then\n if <<(TrialGroundName) = [Trial 1-4]> and <(Checkpoint#) > [1]>> then\n CostumeTouching\n Epress\n end\n if <<(TrialGroundName) = [Trial 2-4]> and <(Checkpoint#) > [2]>> then\n CostumeTouching\n Epress\n end\n if <<(TrialGroundName) = [Trial 2-1]> and <(Checkpoint#) > [4]>> then\n CostumeTouching\n Epress\n end\n else\n Costume\n end\nend\n\n@Easter Egg\n\nwhen I receive [trialbuttons v]\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\ngo to x: (-184) y: (151)\nset size to (65) %\nhide\n\nwhen I receive [trialstart v]\nforever\n if <(TrialGroundName) = [Trial 2-2]> then\n show\n if <touching (player v)?> then\n start sound [Crash Cymbal v]\n wait until <not <touching (player v)?>>\n end\n else\n hide\n end\nend\n\nwhen I receive [endcutscene v]\nstop [other scripts in sprite v]\nhide\n\n
-Short- A Platformer
@Stage\n\n@Sprite1\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nswitch costume to (costume2 v)\nshow\ngo to x: (-230) y: (-141)\nset [x v] to [0]\nset [y v] to [0]\nforever\n change [y v] by (-1)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (-4)\n change x by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#000008)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n go to x: (-227) y: (41)\n end\n if <(x position) > [222]> then\n next backdrop\n go to x: (-230) y: (-141)\n end\nend\n\n@Sprite2\n\n
Look at this~ https://scratch.mit.edu/projects/179963222/
The Splatformer (A Splatoon Platformer Game)
@Stage\n\nwhen flag clicked\nclear graphic effects\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [start\(0.5\) v]\nswitch backdrop to (blue sky2 v)\n\nwhen flag clicked\nset volume to (100) %\nset [muted? v] to [No]\nforever\n play sound [Octo_Canyon_Low_Tide.mp3 v] until done\nend\n\nif <(Level) = [41]> then\n\nwhen I receive [next level v]\nclear graphic effects\nif <(Level) < [11]> then\n switch backdrop to (blue sky2 v)\nend\nif <<(Level) > [10]> and <(Level) < [21]>> then\n switch backdrop to (blue sky3 v)\nend\nif <<(Level) > [20]> and <(Level) < [31]>> then\n switch backdrop to (blue sky4 v)\nend\nif <<(Level) > [30]> and <(Level) < [41]>> then\n switch backdrop to (blue sky5 v)\nend\nif <(Level) = [41]> then\n switch backdrop to (blue sky6 v)\nend\n\nwhen [f v] key pressed\nset [muted? v] to [Yes]\nset volume to (0) %\n\nwhen [m v] key pressed\nif <(muted?) = [No]> then\n set [muted? v] to [Yes]\n set volume to (0) %\nelse\n set [muted? v] to [No]\n set volume to (100) %\nend\n\nwhen I receive [start v]\nforever\n if <key (d v) pressed?> then\n ask [Debug command: set level] and wait\n set [level v] to (answer)\n broadcast (next level v)\n end\nend\n\nwhen [i v] key pressed\nset [muted? v] to [Yes]\nset volume to (0) %\n\nwhen [v v] key pressed\nswitch backdrop to (backdrop1 v)\nwait until <not <key (v v) pressed?>>\nif <(Level) < [11]> then\n switch backdrop to (blue sky2 v)\nend\nif <<(Level) > [10]> and <(Level) < [21]>> then\n switch backdrop to (blue sky3 v)\nend\nif <<(Level) > [20]> and <(Level) < [31]>> then\n switch backdrop to (blue sky4 v)\nend\nif <<(Level) > [30]> and <(Level) < [41]>> then\n switch backdrop to (blue sky5 v)\nend\nif <(Level) = [41]> then\n switch backdrop to (blue sky6 v)\nend\n\nwhen I receive [next level v]\nif <(Level) = [41]> then\n hide variable [level v]\n set volume to (0) %\nelse\n show variable [level v]\nend\n\nwhen I receive [boss start v]\nset volume to (100) %\n\nwhen I receive [boss start v]\nset volume to (0) %\nstop all sounds\n\nwhen I receive [boss start v]\nwait until <(Boss HP) < [1]>\nstop [other scripts in sprite v]\nset volume to (0) %\n\nstop [other scripts in sprite v]\n\nstop [this script v]\n\nwhen I receive [gun disappear v]\nswitch backdrop to (blue sky6 v)\nclear graphic effects\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch backdrop to (backdrop1 v)\nclear graphic effects\n\nwhen I receive [ending v]\nstop [other scripts in sprite v]\nwait (1) seconds\nbroadcast (ending0.1 v)\nset volume to (100) %\nplay sound [Maritime Memory \(Staff Roll\) - Splatoon \[OST\] v] until done\nbroadcast (ending2 v)\n\nwhen I receive [ending0.1 v]\nwait (30) seconds\nwait until <key (9 v) pressed?>\nstop all sounds\n\n@Inkling Girl\n\nwhen flag clicked\nset [form v] to [kid]\ngo to [front v] layer\nset size to (200) %\nswitch costume to (run 1 \(idle\) v)\ngo to x: (0) y: (0)\n\nwhen I receive [start v]\nshow\nshow variable [hp v]\nset [form v] to [kid]\nset [speed y v] to [0]\nset [falling? v] to [0]\nset rotation style [left-right v]\nforever\n if <(Level) < [11]> then\n if <(form) = [kid]> then\n switch costume to (hitbox v)\n if <<key (up arrow v) pressed?> and <(falling?) < [3]>> then\n set [speed y v] to ((12) * (ee mult #))\n end\n if <key (down arrow v) pressed?> then\n if <touching (ground ink v)?> then\n set [form v] to [squid \(ink\)]\n start sound [squid v]\n switch costume to (squid \(ink\) v)\n end\n end\n if <key (left arrow v) pressed?> then\n walk (-90) ((-4) * (ee mult #))\n else\n if <key (right arrow v) pressed?> then\n walk (90) ((4) * (ee mult #))\n else\n set [frame v] to [0]\n end\n end\n else\n if <(form) = [squid \(ink\)]> then\n switch costume to (squid \(ink\) hitbox v)\n if <key (left arrow v) pressed?> then\n walk (-90) ((-10) * (ee mult #))\n else\n if <key (right arrow v) pressed?> then\n walk (90) ((10) * (ee mult #))\n end\n end\n end\n end\n change [speed y v] by (-1)\n change y by (speed y)\n touch ground <(speed y) > [0]>\n if <(y position) < [-175]> then\n if <not <(HP) < [1]>> then\n hide\n play sound (pick random (12) to (18)) until done\n wait (0.2) seconds\n play sound (pick random (19) to (23)) until done\n set [falling? v] to [0]\n go to x: (-200) y: (100)\n show\n set [speed y v] to [-2]\n point in direction (90)\n show\n set [hp v] to [10]\n set [form v] to [kid]\n end\n end\n set costume\n else\n stop [this script v]\n end\nend\n\ndefine touch ground <up?>\nif <<<(form) = [squid \(ink\)]> or <(form) = [kid]>> or <(form) = [teleport]>> then\n change [falling? v] by (1)\n repeat until <<not <touching (callie pillar v)?>> and <not <touching (ground v)?>>>\n if <up?> then\n change y by (-1)\n else\n change y by (1)\n set [falling? v] to [0]\n end\n set [speed y v] to [0]\n end\nend\n\ndefine walk (direction) (speed)\npoint in direction (direction)\nchange x by (speed)\nset [slope v] to [0]\nrepeat until <<(slope) = [8]> or <not <touching (ground v)?>>>\n change y by (1)\n change [slope v] by (1)\nend\nif <(slope) = [8]> then\n change x by ((0) - (speed))\n change y by ((0) - (slope))\nend\nif <(form) = [kid]> then\n change [frame v] by (0.5)\nelse\n if <<(costume [number v]) = [6]> and <(sqT) > [0.9]>> then\n switch costume to (squid 2 v)\n set [sqt v] to [0]\n else\n if <<(costume [number v]) = [7]> and <(sqT) > [0.9]>> then\n switch costume to (squid 1 v)\n set [sqt v] to [0]\n end\n end\nend\n\ndefine set costume\nif <(form) = [kid]> then\n if <(falling?) < [3]> then\n if <(frame) = [0]> then\n switch costume to (run 1 \(idle\) v)\n else\n switch costume to ([floor v] of ((1) + ((frame) mod (3))) )\n end\n else\n if <(speed y) > [0]> then\n switch costume to (jump v)\n else\n switch costume to (jump v)\n end\n end\nelse\n if <(form) = [squid \(ink\)]> then\n switch costume to (squid \(ink\) v)\n end\nend\n\nif <(form) = [squid]> then\n if <(frame) = [0]> then\n switch costume to (squid 1 v)\n else\n switch costume to ([floor v] of ((6) + ((frame) mod (7))) )\n end\nend\n\nwhen I receive [start v]\nforever\n set [player direction v] to (direction)\nend\n\nset [sqt v] to [0]\nforever\n wait (0.5) seconds\n change [sqt v] by (1)\nend\n\nstop all sounds\nstart sound [squid v]\nset [form v] to [squid]\nswitch costume to (squid 1 v)\n\nif <(form) = [squid]> then\n if <key (2 v) pressed?> then\n stop all sounds\n start sound [squid v]\n set [form v] to [kid]\n switch costume to (run 1 \(idle\) v)\n end\n if <key (left arrow v) pressed?> then\n if <touching (ink v)?> then\n walk (-90) (-6)\n else\n walk (-90) (-1)\n end\n else\n if <key (right arrow v) pressed?> then\n if <touching (ink v)?> then\n walk (90) (6)\n else\n walk (90) (1)\n end\n else\n set [frame v] to [0]\n end\n end\nend\n\nwhen flag clicked\nclear graphic effects\nset [hp v] to [10]\nhide variable [hp v]\nset [lvspec v] to [0]\nhide\n\nwhen I receive [next level v]\nset [speed y v] to [0]\nset [hp v] to [10]\nset [falling? v] to [0]\nset [form v] to [kid]\nswitch costume to (run 1 \(idle\) v)\ngo to x: (-200) y: (100)\nif <(lvspec) = [1]> then\n set [speed y v] to [-1000]\n wait until <(speed y) = [0]>\nend\n\nwhen I receive [start\(1.5\) v]\n\nwhen I receive [start\(1.5\) v]\n\nset [level v] to [3]\n\nwhen I receive [hurt v]\nstart sound (pick random (4) to (11))\nchange [hp v] by (-1)\nif <(HP) < [1]> then\n set [hp v] to [0]\n set [dying? v] to [true]\n hide\n go to x: (-200) y: (100)\n play sound (pick random (12) to (18)) until done\n wait (0.2) seconds\n play sound (pick random (19) to (23)) until done\n set [falling? v] to [0]\n set [speed y v] to [-5]\n go to x: (-200) y: (100)\n point in direction (90)\n set [level v] to (Level)\n if <not <(Level) = [41]>> then\n broadcast (next level v)\n end\n set [dying? v] to [false]\nend\nwait (0.1) seconds\n\nrepeat (10)\n change [mosaic v] effect by (5)\nend\n\nclear graphic effects\n\nif <<(form) = [squid]> and <touching color (#ff9400)?>> then\n hide\nelse\n show\nend\n\nwhen I receive [start v]\n\nforever\n if <(HP) < [10]> then\n wait (3) seconds\n change [hp v] by (1)\n end\nend\n\nif <key (up arrow v) pressed?> then\n start sound [squid v]\n set [form v] to [kid]\nend\n\nif <touching (launchpad v)?> then\n set [form v] to [squid \(ink\)]\n start sound [squid v]\n switch costume to (squid \(ink\) v)\n play sound [super jump v] until done\nend\n\nwhen I receive [next level v]\nforever\n if <<<<(Level) = [10]> or <(Level) = [20]>> or <(Level) = [30]>> or <(Level) = [40]>> then\n wait until <touching (launchpad v)?>\n stop [other scripts in sprite v]\n go to (launchpad v)\n touch ground <(speed y) > [0]>\n switch costume to (squid \(ink\) v)\n play sound [squid v] until done\n wait (0.5) seconds\n start sound [super jump v]\n start sound (pick random (25) to (28))\n glide (0.1) secs to x: (x position) y: (180)\n wait (2) seconds\n change [level v] by (1)\n set [lvspec v] to [1]\n broadcast (next level v)\n else\n stop [this script v]\n end\nend\n\nwhen I receive [next level v]\npoint in direction (90)\nif <(Level) > [10]> then\n show\n show variable [hp v]\n set [form v] to [kid]\n set [speed y v] to [0]\n set [falling? v] to [0]\n set rotation style [left-right v]\n forever\n if <(dying?) = [false]> then\n if <(form) = [kid]> then\n switch costume to (hitbox v)\n if <<key (up arrow v) pressed?> and <(falling?) < [3]>> then\n if <not <touching (teleporter v)?>> then\n set [speed y v] to ((12) * (ee mult #))\n end\n end\n if <key (down arrow v) pressed?> then\n if <touching (ground ink v)?> then\n set [form v] to [squid \(ink\)]\n start sound [squid v]\n switch costume to (squid \(ink\) v)\n end\n if <touching (teleporter v)?> then\n set [form v] to [teleport]\n start sound [squid v]\n switch costume to (blank v)\n end\n end\n if <key (left arrow v) pressed?> then\n if <not <touching (teleporter v)?>> then\n if <<touching (ground water v)?> or <touching (enemy ink v)?>> then\n walk (-90) ((-1) * (ee mult #))\n else\n walk (-90) ((-4) * (ee mult #))\n end\n end\n else\n if <key (right arrow v) pressed?> then\n if <not <touching (teleporter v)?>> then\n if <<touching (ground water v)?> or <touching (enemy ink v)?>> then\n walk (90) ((1) * (ee mult #))\n else\n walk (90) ((4) * (ee mult #))\n end\n end\n else\n set [frame v] to [0]\n end\n end\n else\n if <(form) = [squid \(ink\)]> then\n switch costume to (squid \(ink\) hitbox v)\n if <key (left arrow v) pressed?> then\n walk (-90) ((-10) * (ee mult #))\n else\n if <key (right arrow v) pressed?> then\n walk (90) ((10) * (ee mult #))\n end\n end\n end\n end\n change [speed y v] by (-1)\n change y by (speed y)\n touch ground <(speed y) > [0]>\n if <(y position) < [-175]> then\n if <not <(HP) < [1]>> then\n hide\n play sound (pick random (12) to (18)) until done\n wait (0.2) seconds\n play sound (pick random (19) to (23)) until done\n set [falling? v] to [0]\n go to x: (-200) y: (100)\n show\n set [speed y v] to [-2]\n point in direction (90)\n show\n set [hp v] to [10]\n set [form v] to [kid]\n end\n end\n set costume\n end\n end\nend\n\ngo to x: (-200) y: (100)\nset [falling? v] to [0]\n\nplay sound (pick random (1) to (10)) until done\ngo to x: (-200) y: (100)\nset [falling? v] to [0]\nset [form v] to [kid]\n\nwhen I receive [start v]\n\nif <not <<key (left arrow v) pressed?> or <key (right arrow v) pressed?>>> then\n stop all sounds\nend\n\nwhen I receive [next level v]\nforever\n if <touching (enemy ink v)?> then\n if <<(HP) > [0]> and <(x position) > [-175]>> then\n broadcast (hurt v)\n wait (1) seconds\n end\n end\nend\n\nwhen I receive [next level v]\nforever\n if <key (r v) pressed?> then\n wait until <not <key (r v) pressed?>>\n broadcast (next level v)\n end\nend\n\nwhen I receive [next level v]\nforever\n if <<(x position) > [235]> and <touching (_edge_ v)?>> then\n change [level v] by (1)\n broadcast (next level v)\n end\nend\n\nwhen I receive [next level v]\nforever\n if <(form) = [squid \(ink\)]> then\n if <not <touching (ground ink v)?>> then\n set [form v] to [kid]\n start sound [squid v]\n switch costume to (run 1 \(idle\) v)\n end\n end\nend\n\nwhen I receive [start\(1.5\) v]\nrepeat until <(Level) = [2]>\n if <<(x position) > [235]> and <touching (_edge_ v)?>> then\n change [level v] by (1)\n broadcast (next level v)\n end\nend\n\nwhen I receive [next level v]\nforever\n if <<<touching (octo bomb v)?> or <touching (callie bomb v)?>> and <touching color (#ff00bf)?>> then\n set [hp v] to [1]\n broadcast (hurt v)\n end\nend\n\nforever\n if <(form) = [squid \(ink\)]> then\n wait (0.3) seconds\n end\nend\n\nwhen I receive [start v]\nforever\n if <key (b v) pressed?> then\n if <(ink bomb #) = [0]> then\n repeat until <not <key (b v) pressed?>>\n point towards (mouse-pointer v)\n end\n end\n end\nend\n\nwhen I receive [next level v]\nif <(Level) = [16]> then\n wait until <(goal met) = [2]>\n wait until <touching (launchpad v)?>\n stop [other scripts in sprite v]\n go to (launchpad v)\n touch ground <(speed y) > [0]>\n switch costume to (squid \(ink\) v)\n play sound [squid v] until done\n wait (0.5) seconds\n start sound [super jump v]\n start sound (pick random (25) to (28))\n glide (0.1) secs to x: (x position) y: (180)\n wait (2) seconds\n change [level v] by (1)\n set [lvspec v] to [1]\n broadcast (next level v)\nend\nif <(Level) = [23]> then\n wait until <(goal met) = [1]>\n wait until <touching (launchpad v)?>\n stop [other scripts in sprite v]\n go to (launchpad v)\n touch ground <(speed y) > [0]>\n switch costume to (squid \(ink\) v)\n play sound [squid v] until done\n wait (0.5) seconds\n start sound [super jump v]\n start sound (pick random (25) to (28))\n glide (0.1) secs to x: (x position) y: (180)\n wait (2) seconds\n change [level v] by (1)\n set [lvspec v] to [1]\n broadcast (next level v)\nend\nif <(Level) = [32]> then\n wait until <(goal met) = [1]>\n wait until <touching (launchpad v)?>\n stop [other scripts in sprite v]\n go to (launchpad v)\n touch ground <(speed y) > [0]>\n switch costume to (squid \(ink\) v)\n play sound [squid v] until done\n wait (0.5) seconds\n start sound [super jump v]\n start sound (pick random (25) to (28))\n glide (0.1) secs to x: (x position) y: (180)\n wait (2) seconds\n change [level v] by (1)\n set [lvspec v] to [1]\n broadcast (next level v)\nend\n\nchange [level v] by (1)\nbroadcast (next level v)\n\nwhen I receive [teleport v]\nif <(teleport x) < [95]> then\n set x to (95)\nelse\n set x to (teleport x)\nend\nif <(teleport y) < [-100]> then\n set y to (-100)\nelse\n set y to (teleport y)\nend\nset [form v] to [kid]\nstart sound [squid v]\nswitch costume to (run 1 \(idle\) v)\n\nbroadcast (next level v)\n\nwhen I receive [hurt v]\nset [level v] to (Level)\n\nwhen I receive [next level v]\nforever\n if <<color (#060e03) is touching (#00baff)?> or <touching (ground water v)?>> then\n broadcast (hurt v)\n change [hp v] by (-1)\n wait (0.2) seconds\n end\nend\n\nwhen I receive [start v]\nset [dying? v] to [false]\n\nwhen I receive [next level v]\nset [dying? v] to [false]\n\nwhen I receive [easter egg 2 v]\nrepeat until <(ee2) = [0]>\n change [color v] effect by (5)\n change [hp v] by (1)\nend\nset [color v] effect to (0)\nset [hp v] to [10]\n\nwhen I receive [next level v]\nforever\n if <(ee2) = [0]> then\n clear graphic effects\n end\nend\n\nwhen I receive [next level v]\nif <(Level) = [41]> then\n forever\n if <(x position) > [-43]> then\n change x by (-4)\n end\n end\nend\n\nwhen I receive [portal v]\nwait until <touching (portal v)?>\nstop [other scripts in sprite v]\nbroadcast (gun disappear v)\nstart sound [VoiceFJetEcho v]\nrepeat (20)\n change [pixelate v] effect by (5)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\nwait (3) seconds\nbroadcast (ending v)\n\n@ground\n\nwhen flag clicked\nset [level v] to [0]\n\nwhen I receive [start\(0.5\) v]\ngo [backward v] (5) layers\nswitch costume to (level1 v)\nset [level v] to [1]\nshow\ngo to x: (0) y: (0)\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [next level v]\ngo to [back v] layer\nshow\nswitch costume to ((Level) + (1))\n\nwhen I receive [gun disappear v]\nshow\nrepeat (20)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\n\nbroadcast (gun disappear v)\n\n@woomy text\n\nwhen I receive [start v]\nclear graphic effects\nhide\nforever\n if <key (w v) pressed?> then\n create clone of (_myself_ v)\n wait ((.42) / (ee mult #)) seconds\n end\nend\n\nwhen I start as a clone\ngo to [front v] layer\nclear graphic effects\nshow\nset size to (50) %\ngo to (inkling girl v)\nif <(pick random (1) to (100)) = [100]> then\n start sound [VoiceMDefeat09 v]\n set [color v] effect to (100)\nelse\n start sound (pick random (1) to (5))\nend\nrepeat (20)\n change y by (2)\n change [ghost v] effect by (5)\nend\n\nwhen [h v] key pressed\nset [hp v] to [10]\n\n@ink\n\nwhen flag clicked\nhide\n\ndefine touch ground (ink)\nrepeat until <not <touching (ground v)?>>\n change y by (1)\nend\n\ngo to x: (pick random (-100) to (100)) y: (50)\n\nwhen I start as a clone\n\nwhen I start as a clone\nswitch costume to (ink v)\nset size to (200) %\ngo to [front v] layer\ngo [backward v] (1) layers\nshow\npoint in direction ([direction v] of [sprite1 v])\ngo to (sprite1 v)\nrepeat (50)\n move (10) steps\n change [ghost v] effect by (-2)\n if <<touching (_edge_ v)?> or <touching (ground v)?>> then\n delete this clone\n end\n if <touching (octoling v)?> then\n broadcast (octo hurt v)\n delete this clone\n end\n if <touching (bomb octoling v)?> then\n broadcast (octo hurt 2 v)\n delete this clone\n end\n if <touching (hyperbomb v)?> then\n if <[20] > (hyperbomb damage)> then\n broadcast (hyperbomb damage v)\n delete this clone\n end\n end\n if <touching (callie pillar v)?> then\n delete this clone\n end\n if <touching (weak point v)?> then\n delete this clone\n end\nend\nhide\nclear graphic effects\ndelete this clone\n\ntouch ground (ink)\n\nclear graphic effects\nset size to (100) %\nswitch costume to (ground ink v)\nset size to (pick random (200) to (300)) %\nshow\ngo to (sprite1 v)\nset [speed y \(ink\) v] to [0]\npoint in direction (player direction)\nrepeat until <touching (ground v)?>\n move (pick random (5) to (10)) steps\nend\nswitch costume to (ground ink v)\nwait (5) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nclear graphic effects\ndelete this clone\n\nrepeat until <touching (ground v)?>\n change y by (speed y \(ink\))\n change [speed y \(ink\) v] by (-1)\n if <(y position) < [-179]> then\n delete this clone\n end\nend\nforever\n if <touching color (#000000)?> then\n repeat until <not <touching color (#000000)?>>\n change y by (-0.5)\n change x by (0.01)\n end\n end\nend\n\nwhen I receive [start v]\nhide\nforever\n if <(form) = [kid]> then\n if <key (z v) pressed?> then\n create clone of (_myself_ v)\n start sound [ink v]\n wait (0.1) seconds\n end\n end\nend\n\nwhen I receive [next level v]\ndelete this clone\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen I receive [start v]\nset size to (150) %\ngo to [front v] layer\nswitch costume to (n-zap v)\nforever\n if <<<(form) = [kid]> and <(HP) > [0]>> and <not <<([costume # v] of [inkling girl v]) = [8]> or <([costume # v] of [inkling girl v]) = [10]>>>> then\n show\n point in direction ([direction v] of [inkling girl v])\n go to (inkling girl v)\n if <([y position v] of [inkling girl v]) < [-175]> then\n hide\n wait until <([y position v] of [inkling girl v]) = [100]>\n go to (inkling girl v)\n show\n end\n else\n hide\n end\nend\n\nwhen I receive [hurt v]\nif <(HP) < [1]> then\n hide\n wait until <([y position v] of [inkling girl v]) = [100]>\n show\nend\n\nwhen I receive [gun disappear v]\nstop [other scripts in sprite v]\nrepeat (20)\n change [pixelate v] effect by (5)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\n\n@ground ink\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nshow\nswitch costume to ((Level) + (1))\n\nwhen I receive [next level v]\ngo to [front v] layer\nif <(Level) = [3]> then\n go to x: (86) y: (-158)\nelse\n if <(Level) = [5]> then\n go to x: (117) y: (-131)\n else\n if <(Level) = [6]> then\n go to x: (117) y: (-133)\n else\n if <(Level) = [8]> then\n go to x: (67) y: (-93)\n else\n if <(Level) = [14]> then\n go to x: (115) y: (60)\n else\n if <(Level) = [22]> then\n go to x: (170) y: (-167)\n else\n if <(Level) = [24]> then\n go to x: (148) y: (-133)\n else\n if <(Level) = [25]> then\n go to x: (15) y: (-133)\n else\n if <(Level) = [26]> then\n go to x: (240) y: (65)\n else\n if <(Level) = [30]> then\n go to x: (65) y: (-60)\n else\n if <(Level) = [31]> then\n go to x: (65) y: (-60)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\nset [level v] to [8]\nbroadcast (next level v)\n\nwhen I receive [hyperbomb explode v]\nshow\n\nwhen I receive [next level 2 v]\nif <(hyperbomb level?) = [Yes]> then\n hide\nend\nif <(hyperbomb level?) = [Yes]> then\n hide\nend\n\n@marie icon\n\nwhen flag clicked\nhide variable [level v]\ngo to [front v] layer\nset size to (50) %\nshow\ngo to x: (0) y: (0)\nset [text v] to [Press space to start!]\nstart sound [marie sound clip18 v]\ntalk (123)\nwait until <key (space v) pressed?>\nsay []\nbroadcast (start\(0.5\) v)\n\nwhen I receive [start\(0.5\) v]\nshow\nset size to (25) %\nglide (0.5) secs to x: (-180) y: (130)\nwait (0.5) seconds\nset [text v] to [Hello.]\nstart sound [marie sound clip5 v]\ntalk (123)\nset [text v] to [My name is Marie.]\nstart sound [marie sound clip13 v]\ntalk (123)\nset [text v] to [Y'know, of the Squid Sisters?]\nstart sound [marie sound clip2 v]\ntalk (123)\nset [text v] to [You don't know me?]\nstart sound [marie sound clip9 v]\ntalk (123)\nset [text v] to [Ugh. You're just like Agent 4.]\nstart sound [marie sound clip19 v]\ntalk (123)\nset [text v] to [Anyways, you're here to help me, right?]\nstart sound [marie sound clip6 v]\ntalk (123)\nwait (0.5) seconds\nset [text v] to [No?]\nstart sound [marie sound clip15 v]\ntalk (123)\nset [text v] to [Well, I'm making you do it.]\nstart sound [marie sound clip11 v]\ntalk (123)\nset [text v] to [Callie, the other Squid Sister, has gone missing. \(again\)]\nstart sound [marie sound clip16 v]\ntalk (123)\nset [text v] to [All you need to do is find her.]\nstart sound [marie sound clip10 v]\ntalk (123)\nset [text v] to [With my help, of course.]\nstart sound [marie sound clip13 v]\ntalk (123)\nbroadcast (start v)\n\ndefine talk (waitlength)\nset [textletter v] to [0]\nset [lastphrase v] to []\nrepeat ((length of (text)) + (1))\n say (join (lastphrase) (letter (textletter) of (text)))\n set [lastphrase v] to (join (lastphrase) (letter (textletter) of (text)))\n change [textletter v] by (1)\nend\nif <(waitlength) = [123]> then\n wait until <key (space v) pressed?>\n say []\nelse\n if <not <(waitlength) = [234]>> then\n wait (waitlength) seconds\n say []\n end\nend\n\nwhen I receive [start v]\ngo to x: (-180) y: (130)\nshow variable [level v]\ngo to [front v] layer\nshow\nstop all sounds\nif <(Level) = [1]> then\n set [text v] to [Use the arrow keys to move and jump.]\n start sound [marie sound clip5 v]\n talk (123)\n set [text v] to [Go to the right side.]\n broadcast (start\(1.5\) v)\n start sound [marie sound clip9 v]\n talk (234)\n wait until <not <(Level) = [1]>>\n set [text v] to [Good job. Keep doing that.]\n start sound [marie sound clip5 v]\n talk (123)\nend\n\nwhen I receive [next level v]\ngo to [front v] layer\nif <(Level) = [3]> then\n set [text v] to [Press down when you are on top of ink to swim in it. You swim faster than you run.]\n start sound [marie sound clip21 v]\n talk (234)\nelse\n if <(Level) = [4]> then\n set [text v] to [That's an octoling. Stay out of sight and you'll be fine.]\n start sound [marie sound clip16 v]\n talk (234)\n else\n if <(Level) = [5]> then\n set [text v] to [Press z to shoot. Octolings die after 10 hits.]\n start sound [marie sound clip4 v]\n talk (234)\n else\n if <(Level) = [6]> then\n set [text v] to [Octolings can't see you while you're in ink.]\n start sound [marie sound clip15 v]\n talk (234)\n else\n if <(Level) = [7]> then\n set [text v] to [Parkour, I guess.]\n start sound [marie sound clip12 v]\n talk (234)\n else\n if <(Level) = [8]> then\n set [text v] to [Swim in ink to squeeze through tight gaps.]\n start sound [marie sound clip11 v]\n talk (234)\n else\n if <(Level) = [9]> then\n set [text v] to [I think you're almost to the end!]\n start sound [marie sound clip18 v]\n talk (234)\n else\n if <(Level) = [10]> then\n set [text v] to [Go to the launchpad to blast off to the next stage!]\n start sound [marie sound clip15 v]\n talk (234)\n else\n if <(Level) = [11]> then\n set [text v] to [You'll slowly take damage in the octoling's ink. Your movement is also slowed. Jumping is a good idea.]\n start sound [marie sound clip12 v]\n talk (234)\n else\n if <(Level) = [12]> then\n set [text v] to [I don't think I trust that ink too much...]\n start sound [marie sound clip21 v]\n talk (234)\n else\n if <(Level) = [13]> then\n set [text v] to [That green octoling throws bombs that will instantly kill you if you're near when they explode.]\n start sound [marie sound clip14 v]\n talk (234)\n else\n if <(Level) = [14]> then\n set [text v] to [Climb to the top!]\n start sound [marie sound clip15 v]\n talk (234)\n else\n if <(Level) = [15]> then\n set [text v] to [You can throw bombs too. Press and hold b to aim with your mouse, then release to throw.]\n start sound [marie sound clip4 v]\n talk (234)\n else\n if <(Level) = [16]> then\n set [text v] to [Some levels have goals. The goal of this one is to defeat the octolings.]\n start sound [marie sound clip15 v]\n talk (234)\n else\n if <(Level) = [17]> then\n set [text v] to [You'll need to semi-wall-jump to get past this level.]\n start sound [marie sound clip15 v]\n talk (234)\n else\n if <(Level) = [18]> then\n set [text v] to [Sometimes I won't talk, and that's just because I have no comment.]\n start sound [marie sound clip9 v]\n talk (234)\n else\n if <(Level) = [19]> then\n set [text v] to [...]\n start sound [marie sound clip10 v]\n talk (234)\n else\n if <(Level) = [20]> then\n set [text v] to [I bet you can blast through walls with the launchpad!]\n start sound [marie sound clip17 v]\n talk (234)\n else\n if <(Level) = [21]> then\n set [text v] to [If you press down while you're on the teleporter, you can choose where you want to teleport using the mouse and teleport by pressing t.]\n start sound [marie sound clip8 v]\n talk (234)\n else\n if <(Level) = [22]> then\n set [text v] to [Hmm...]\n start sound [marie sound clip4 v]\n talk (234)\n else\n if <(Level) = [23]> then\n set [text v] to [You need to hit that octoling somehow...]\n start sound [marie sound clip21 v]\n talk (234)\n else\n if <(Level) = [27]> then\n set [text v] to [Water will quickly deplete your health. It's best to avoid it completely.]\n start sound [marie sound clip20 v]\n talk (234)\n else\n if <(Level) = [28]> then\n set [text v] to [Seems like this is quite the challenge...]\n start sound [marie sound clip5 v]\n talk (234)\n else\n if <(Level) = [29]> then\n set [text v] to [Looks like you're gonna have to risk your health.]\n start sound [marie sound clip8 v]\n talk (234)\n else\n if <(Level) = [31]> then\n set [text v] to [I can sense Callie's presence nearby. She seems... different... somehow.]\n start sound [marie sound clip4 v]\n talk (234)\n else\n if <(Level) = [32]> then\n set [text v] to [Hit that octoling!]\n start sound [marie sound clip17 v]\n talk (234)\n else\n if <(Level) = [33]> then\n set [text v] to [Hmmmmm....]\n start sound [marie sound clip16 v]\n talk (234)\n else\n if <(Level) = [34]> then\n set [text v] to [Press and hold the V key to turn the background white if you can't see the ground.]\n start sound [marie sound clip13 v]\n talk (234)\n else\n if <(Level) = [40]> then\n set [text v] to [I think this is it!]\n start sound [marie sound clip17 v]\n talk (234)\n else\n say []\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\nset [level v] to [16]\nbroadcast (next level v)\n\nwhen I receive [start\(0.5\) v]\nforever\n if <key (down arrow v) pressed?> then\n stop [other scripts in sprite v]\n broadcast (start v)\n stop [this script v]\n end\nend\n\nwhen I receive [next level v]\n\nwhen flag clicked\ngo to [front v] layer\nhide variable [boss hp v]\n\nif <not <(([costume # v] of [ground v]) - (1)) = (Level)>> then\n set [text v] to [That's funny. You should not be on this level. if you messed around with the code, then you can keep doing that.]\n start sound [marie sound clip20 v]\n talk (234)\nelse\n say []\n stop [this script v]\nend\n\nwhen I receive [next level v]\nhide variable [boss hp v]\nif <(Level) = [41]> then\n set [text v] to [Callie?]\n start sound [marie sound clip9 v]\n talk (123)\n broadcast (z_talk1 v)\nend\n\nwhen I receive [z_talk2 v]\nset [text v] to [Is it just me or is this deja vu?]\nstart sound [marie sound clip21 v]\ntalk (123)\nset [text v] to [By the way, there's an invisible barrier in the middle.]\nstart sound [marie sound clip20 v]\ntalk (123)\nset [text v] to [Even when the pillar goes down, you can't advance past the middle.]\nstart sound [marie sound clip3 v]\ntalk (123)\nset [text v] to [However, your ink and bombs are only stopped by the visible pillar.]\nstart sound [marie sound clip12 v]\ntalk (123)\nset [text v] to [When the pillar goes down, use your ink gun to hit that red circle.]\nstart sound [marie sound clip13 v]\ntalk (123)\nset [text v] to [It's Callie's weak point.]\nstart sound [marie sound clip15 v]\ntalk (123)\nbroadcast (z_talk3 v)\n\nwhen I receive [z_talk4 v]\nset [text v] to [Woah. Is she possessed?]\nstart sound [marie sound clip15 v]\ntalk (123)\nset [text v] to [Never mind that, she's definitely not herself.]\nstart sound [marie sound clip16 v]\ntalk (123)\nset [text v] to [Bring her back to her senses!]\nstart sound [marie sound clip18 v]\ntalk (123)\nbroadcast (boss start v)\n\nwhen I receive [boss start v]\nset [boss hp v] to [50]\nshow variable [boss hp v]\n\nwhen [3 v] key pressed\nif <(Level) = [41]> then\n stop [other scripts in sprite v]\n say []\n broadcast (boss start v)\nend\n\nwhen I receive [boss start v]\nset [text v] to [Go defeat Callie!]\nstart sound [marie sound clip18 v]\ntalk (123)\n\nwhen I receive [boss start v]\nwait until <(HP) < [1]>\nstop [other scripts in sprite v]\nset [text v] to [Are you okay?]\nstart sound [marie sound clip15 v]\ntalk (123)\nset [text v] to [Press R.]\nstart sound [marie sound clip14 v]\ntalk (234)\n\nwhen I receive [boss dead v]\nset [text v] to [She's...... gone.......]\nstart sound [marie sound clip21 v]\ntalk (123)\nset [text v] to [Okay, enter the portal now.]\nstart sound [marie sound clip20 v]\ntalk (234)\nbroadcast (portal v)\n\nwhen I receive [gun disappear v]\nsay []\nshow\nhide variable [hp v]\nhide variable [boss hp v]\nrepeat (20)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\n\n@Octoling\n\ndefine touch ground (octo)\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [octo speed y v] to [0]\nend\n\nwhen I receive [next level v]\nif <(Level) = [4]> then\n point in direction (-90)\n show\n set x to (90)\n set y to (0)\n if <(seen) = [No]> then\n repeat until <not <(Level) = [4]>>\n repeat (50)\n walk (90) (3)\n end\n repeat (50)\n walk (-90) (-3)\n end\n end\n end\nelse\n if <(Level) = [5]> then\n point in direction (-90)\n show\n set x to (90)\n set y to (-50)\n else\n if <(Level) = [6]> then\n point in direction (-90)\n show\n set x to (90)\n set y to (-50)\n if <(seen) = [No]> then\n repeat until <not <(Level) = [6]>>\n repeat (50)\n walk (90) (3)\n end\n repeat (50)\n walk (-90) (-3)\n end\n end\n end\n else\n if <(Level) = [9]> then\n point in direction (-90)\n show\n set x to (90)\n set y to (-50)\n repeat until <not <(Level) = [9]>>\n wait (1.5) seconds\n jump\n end\n else\n if <(Level) = [14]> then\n point in direction (90)\n show\n set x to (-75)\n set y to (120)\n else\n if <(Level) = [16]> then\n point in direction (-90)\n show\n set x to (0)\n set y to (0)\n else\n if <(Level) = [23]> then\n point in direction (-90)\n show\n set x to (150)\n set y to (200)\n else\n if <(Level) = [32]> then\n point in direction (-90)\n show\n set x to (150)\n set y to (200)\n else\n hide\n end\n end\n end\n end\n end\n end\n end\nend\n\nwhen I receive [next level v]\nset volume to (100) %\nset [octo speed y v] to [0]\nforever\n change y by (octo speed y)\n change [octo speed y v] by (-1)\n touch ground (octo)\nend\n\ndefine walk (direction) (speed)\npoint in direction (direction)\nchange x by (speed)\n\nwhen flag clicked\nset [octo level? v] to [False]\nset [octo hp v] to [10]\nswitch costume to (idle v)\nset size to (200) %\nhide\n\nwhen I receive [next level v]\nset [octo hp v] to [10]\nforever\n if <<(Level) = [4]> or <(Level) = [6]>> then\n if <(seen) = [No]> then\n wait (0.05) seconds\n if <(costume [number v]) = [3]> then\n switch costume to (walk 1 \(idle\) v)\n else\n next costume\n end\n end\n else\n if <(Level) = [5]> then\n switch costume to (walk 1 \(idle\) v)\n else\n if <(Level) = [9]> then\n wait until <(octo speed y) > [0]>\n switch costume to (walk 3 v)\n wait until <(octo speed y) = [0]>\n switch costume to (walk 1 \(idle\) v)\n else\n if <(Level) = [14]> then\n switch costume to (walk 1 \(idle\) v)\n else\n stop [this script v]\n end\n end\n end\n end\nend\n\nwhen I receive [seen v]\nswitch costume to (walk 1 \(idle\) v)\nstart sound (pick random (15) to (17))\nwait until <(octo speed y) = [0]>\nrepeat until <(seen) = [No]>\n if <([x position v] of [inkling girl v]) > (x position)> then\n point in direction (90)\n else\n point in direction (-90)\n end\nend\n\nwhen I receive [octo hurt v]\nif <<(octo HP) = [10]> or <<(octo HP) = [8]> or <<(octo HP) = [6]> or <<(octo HP) = [2]> or <<(octo HP) = [1]> or <(octo HP) = [4]>>>>>> then\n start sound (pick random (1) to (3))\nend\nchange [octo hp v] by (-1)\nif <(octo HP) < [1]> then\n hide\n play sound (pick random (10) to (11)) until done\n play sound (pick random (7) to (9)) until done\nend\n\ndefine jump\nset [octo speed y v] to [12]\nwait (0.1) seconds\n\nwhen I receive [next level v]\nif <<<<<<<<(Level) = [4]> or <(Level) = [5]>> or <(Level) = [6]>> or <(Level) = [9]>> or <(Level) = [14]>> or <(Level) = [32]>> or <(Level) = [16]>> or <(Level) = [23]>> then\n set [octo level? v] to [True]\nelse\n set [octo level? v] to [False]\nend\nbroadcast (next level 2 v)\n\nwhen I receive [start v]\nforever\n if <touching color (#cc7700)?> then\n set [octo hp v] to [1]\n broadcast (octo hurt v)\n end\nend\n\nwhen flag clicked\nset [goal met v] to [0]\n\nwhen I receive [next level v]\nset [goal met v] to [0]\nif <<<(Level) = [16]> or <(Level) = [23]>> or <(Level) = [32]>> then\n wait until <(octo HP) = [0]>\n change [goal met v] by (1)\nend\n\nwhen I receive [easter egg 2 v]\nrepeat until <(ee2) = [0]>\n if <touching (inkling girl v)?> then\n set [octo hp v] to [1]\n broadcast (octo hurt v)\n end\nend\n\nwhen I receive [next level v]\nset [octo hp v] to [10]\n\n@octoshot\n\nwhen flag clicked\nset size to (200) %\nhide\n\nwhen I receive [next level 2 v]\nif <(Octo level?) = [True]> then\n show\nelse\n hide\nend\n\nwhen I receive [start v]\ngo to [front v] layer\ngo [backward v] (3) layers\nforever\n go to (octoling v)\n point in direction ([direction v] of [octoling v])\n if <(octo HP) < [1]> then\n hide\n end\nend\n\n@octovision\n\nwhen flag clicked\nset size to (85) %\nhide\ngo to [back v] layer\n\nwhen I receive [next level v]\ngo to [back v] layer\nset [seen v] to [No]\nif <(Octo level?) = [True]> then\n set [ghost v] effect to (50)\n show\nelse\n hide\nend\n\nwhen I receive [next level v]\nforever\n if <(Octo level?) = [True]> then\n go to (octoling v)\n else\n stop [this script v]\n end\nend\n\nwhen I receive [start v]\nforever\n if <<<<touching (inkling girl v)?> or <touching (sprite1 v)?>> and <(seen) = [No]>> and <(form) = [kid]>> then\n set [seen v] to [Yes]\n broadcast (seen v)\n wait until <not <<touching (inkling girl v)?> or <touching (sprite1 v)?>>>\n set [seen v] to [No]\n end\nend\n\nwhen I receive [next level v]\nforever\n if <(octo HP) < [1]> then\n hide\n end\nend\n\n@octo ink\n\nwhen flag clicked\nclear graphic effects\nhide\n\nwhen I receive [seen v]\n\nwhen I start as a clone\ngo to (octoshot v)\nset size to (200) %\nshow\npoint in direction ([direction v] of [octoshot v])\nrepeat (50)\n move (10) steps\n change [ghost v] effect by (-2)\n if <<touching (_edge_ v)?> or <touching (ground v)?>> then\n delete this clone\n end\n if <touching (inkling girl v)?> then\n broadcast (hurt v)\n delete this clone\n end\nend\nhide\nclear graphic effects\ndelete this clone\n\npoint towards (inkling girl v)\n\nwhen I receive [next level 2 v]\nhide\nforever\n if <(Octo level?) = [True]> then\n if <(seen) = [Yes]> then\n repeat until <(seen) = [No]>\n create clone of (_myself_ v)\n play sound [ink v] until done\n wait (0.1) seconds\n end\n end\n else\n stop [this script v]\n end\nend\n\nwhen I receive [next level v]\ndelete this clone\n\nset [level v] to [4]\nbroadcast (next level v)\n\n@Launchpad\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nif <(Level) = [10]> then\n go to [front v] layer\n show\n go to x: (160) y: (-124)\n set size to (400) %\nelse\n if <(Level) = [16]> then\n hide\n wait until <(goal met) = [2]>\n go to [front v] layer\n start sound [water drop v]\n show\n go to x: (160) y: (-124)\n set size to (400) %\n else\n if <(Level) = [20]> then\n go to [front v] layer\n show\n go to x: (160) y: (-124)\n set size to (400) %\n else\n if <(Level) = [23]> then\n hide\n wait until <(goal met) = [1]>\n go to [front v] layer\n start sound [water drop v]\n show\n go to x: (50) y: (-124)\n set size to (400) %\n else\n if <(Level) = [30]> then\n go to [front v] layer\n show\n go to x: (197) y: (-124)\n set size to (400) %\n else\n if <(Level) = [32]> then\n hide\n wait until <(goal met) = [1]>\n go to [front v] layer\n start sound [water drop v]\n show\n go to x: (-125) y: (-124)\n set size to (400) %\n else\n if <(Level) = [40]> then\n go to [front v] layer\n show\n go to x: (200) y: (25)\n set size to (400) %\n else\n hide\n end\n end\n end\n end\n end\n end\nend\n\n@enemy ink\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nshow\nswitch costume to ((Level) + (1))\n\nwhen I receive [next level v]\ngo to [front v] layer\nif <(Level) = [11]> then\n go to x: (117) y: (-131)\nelse\n if <(Level) = [12]> then\n go to x: (116) y: (-175)\n else\n if <(Level) = [31]> then\n go to x: (35) y: (-30)\n else\n if <(Level) = [28]> then\n go to x: (-39) y: (-130)\n else\n if <(Level) = [41]> then\n go to x: (25) y: (-125)\n end\n end\n end\n end\nend\n\nif <(Level) = [3]> then\n\nset [level v] to [8]\nbroadcast (next level v)\n\n@Bomb Octoling\n\ndefine touch ground (octo)\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [octo speed y v] to [0]\nend\n\nwhen I receive [next level v]\nif <(Level) = [13]> then\n switch costume to (walk 1 \(idle\) v)\n show\n set x to (120)\n set y to (0)\n point in direction (-90)\n repeat until <(octo HP 2) < [1]>\n wait (3) seconds\n if <(octo HP 2) > [0]> then\n broadcast (octo bomb v)\n end\n end\nelse\n if <(Level) = [14]> then\n switch costume to (walk 1 \(idle\) v)\n show\n set x to (120)\n set y to (-20)\n point in direction (-90)\n repeat until <(octo HP 2) < [1]>\n wait (3) seconds\n if <(octo HP 2) > [0]> then\n broadcast (octo bomb v)\n end\n end\n else\n if <(Level) = [15]> then\n switch costume to (walk 1 \(idle\) v)\n show\n set x to (120)\n set y to (20)\n point in direction (-90)\n repeat until <(octo HP 2) < [1]>\n wait (3) seconds\n if <(octo HP 2) > [0]> then\n broadcast (octo bomb v)\n end\n end\n else\n if <(Level) = [16]> then\n switch costume to (walk 1 \(idle\) v)\n show\n set x to (120)\n set y to (20)\n point in direction (-90)\n repeat until <(octo HP 2) < [1]>\n wait (3) seconds\n if <(octo HP 2) > [0]> then\n broadcast (octo bomb v)\n end\n end\n else\n if <(Level) = [20]> then\n switch costume to (walk 1 \(idle\) v)\n show\n set x to (100)\n set y to (-100)\n point in direction (-90)\n repeat until <(octo HP 2) < [1]>\n wait (3) seconds\n if <(octo HP 2) > [0]> then\n broadcast (octo bomb v)\n end\n end\n else\n hide\n set [octo hp 2 v] to [10]\n stop [this script v]\n end\n end\n end\n end\nend\n\nwhen I receive [next level v]\nset [octo speed y v] to [0]\nforever\n change y by (octo speed y)\n change [octo speed y v] by (-1)\n touch ground (octo)\nend\n\ndefine walk (direction) (speed)\npoint in direction (direction)\nchange x by (speed)\n\nwhen flag clicked\nset [octo hp 2 v] to [10]\nswitch costume to (idle v)\nset size to (200) %\nhide\n\nwhen I receive [next level v]\nset [octo hp 2 v] to [10]\n\nwhen I receive [seen v]\n\nwhen I receive [octo hurt 2 v]\nif <<(octo HP 2) = [10]> or <<(octo HP 2) = [8]> or <<(octo HP 2) = [6]> or <<(octo HP 2) = [2]> or <<(octo HP 2) = [1]> or <(octo HP 2) = [4]>>>>>> then\n start sound (pick random (1) to (3))\nend\nchange [octo hp 2 v] by (-1)\nif <(octo HP 2) < [1]> then\n hide\n play sound (pick random (10) to (11)) until done\n play sound (pick random (7) to (9)) until done\nend\n\ndefine jump\nset [octo speed y v] to [12]\nwait (0.1) seconds\n\nswitch costume to (walk 1 \(idle\) v)\nstart sound (pick random (15) to (17))\nwait until <(octo speed y) = [0]>\nrepeat until <(seen) = [No]>\n if <([x position v] of [inkling girl v]) > (x position)> then\n point in direction (90)\n else\n point in direction (-90)\n end\nend\n\nwhen I receive [next level v]\nforever\n if <<<<<(Level) = [13]> or <(Level) = [14]>> or <(Level) = [15]>> or <(Level) = [16]>> or <(Level) = [20]>> then\n point towards (inkling girl v)\n else\n stop [this script v]\n end\nend\n\nwhen I receive [octo bomb v]\nstart sound (pick random (4) to (6))\n\nwhen I receive [next level v]\nset [goal met v] to [0]\nif <(Level) = [16]> then\n wait until <(octo HP 2) = [0]>\n change [goal met v] by (1)\nend\n\nwhen I receive [next level v]\nset volume to (100) %\nset [octo hp 2 v] to [10]\n\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [octo speed y v] to [0]\nend\n\nwhen I receive [next level v]\nforever\n if <touching color (#cc7700)?> then\n set [octo hp 2 v] to [1]\n broadcast (octo hurt 2 v)\n end\nend\n\nwhen I receive [easter egg 2 v]\nrepeat until <(ee2) = [0]>\n if <touching (inkling girl v)?> then\n set [octo hp 2 v] to [1]\n broadcast (octo hurt 2 v)\n end\nend\n\n@Octo Bomb\n\nwhen flag clicked\nset [bomb# v] to [0]\nhide\n\nrepeat until <touching (ground v)?>\nend\n\nchange [bomb x speed v] by (1)\nforever\nend\n\nif then\n set [bomb x speed v] to [0]\nend\n\nplay sound [bomb explode v] until done\n\nif then\nelse\nend\n\nchange x by (10)\n\nwhen I receive [next level v]\n\nwhen I start as a clone\nif <(bomb#) = [0]> then\n clear graphic effects\n switch costume to (costume1 v)\n set [bomb y speed v] to [0]\n set [bomb x speed v] to [15]\n change [bomb# v] by (1)\n go to (bomb octoling v)\n set size to (200) %\n show\n start sound [bomb 1 v]\n point in direction ([direction v] of [bomb octoling v])\n repeat until <(bomb x speed) < [0.1]>\n move (bomb x speed) steps\n change [bomb x speed v] by (pick random (-1) to (0))\n if <touching (_edge_ v)?> then\n change [bomb# v] by (-1)\n delete this clone\n end\n end\n play sound [bomb 2 v] until done\n go to [front v] layer\n switch costume to (hero-splat-3 v)\n start sound [bomb explode v]\n wait (0.1) seconds\n switch costume to (hero-splat-2 v)\n repeat (10)\n change [ghost v] effect by (10)\n end\n change [bomb# v] by (-1)\n delete this clone\nelse\n delete this clone\nend\n\nwhen I receive [octo bomb v]\nif <(bomb#) < [2]> then\n create clone of (_myself_ v)\nend\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [bomb y speed v] to [0]\nend\n\nwhen I start as a clone\nforever\n if <(costume [number v]) = [1]> then\n change y by (bomb y speed)\n change [bomb y speed v] by (-1)\n touch ground\n end\nend\n\nif then\n stop [other scripts in sprite v]\n change [bomb# v] by (-1)\n hide\nend\n\nwhen I receive [next level v]\nset [bomb# v] to [0]\nhide\ndelete this clone\n\n@Ink bomb\n\nwhen I start as a clone\nif <(ink bomb #) = [0]> then\n clear graphic effects\n switch costume to (costume1 v)\n set [ink bomb y speed v] to [0]\n set [ink bomb x speed v] to [15]\n change [ink bomb # v] by (1)\n go to (inkling girl v)\n set size to (200) %\n show\n point in direction ([direction v] of [arrow1 v])\n start sound [bomb 1 v]\n if <(bomb power) < [1]> then\n set [ink bomb x speed v] to [2]\n else\n if <<(bomb power) > [0.9]> and <(bomb power) < [2]>> then\n set [ink bomb x speed v] to [7]\n else\n if <<(bomb power) > [1.9]> and <(bomb power) < [3]>> then\n set [ink bomb x speed v] to [10]\n else\n if <<(bomb power) > [2.9]> and <(bomb power) < [4]>> then\n set [ink bomb x speed v] to [12]\n else\n if <<(bomb power) > [3.9]> and <(bomb power) < [5]>> then\n set [ink bomb x speed v] to [15]\n else\n if <(bomb power) > [4.9]> then\n set [ink bomb x speed v] to [18]\n end\n end\n end\n end\n end\n end\n repeat until <(ink bomb x speed) < [0.1]>\n move (ink bomb x speed) steps\n change [ink bomb x speed v] by (pick random (-1) to (0))\n if <touching (callie pillar v)?> then\n set [ink bomb x speed v] to [0]\n set [ink bomb y speed v] to [-3]\n change y by (-1)\n repeat until <not <touching (callie pillar v)?>>\n change x by (-2)\n end\n end\n if <touching (_edge_ v)?> then\n change [ink bomb # v] by (-1)\n delete this clone\n end\n end\n play sound [bomb 2 v] until done\n go to [front v] layer\n switch costume to (hero-splat-2 v)\n start sound [bomb explode v]\n wait (0.1) seconds\n switch costume to (hero-splat-3 v)\n repeat (10)\n change [ghost v] effect by (10)\n end\n change [ink bomb # v] by (-1)\n delete this clone\nelse\n delete this clone\nend\n\nwhen I receive [ink bomb throw v]\nif <(ink bomb #) < [2]> then\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nforever\n if <(costume [number v]) = [1]> then\n change y by (ink bomb y speed)\n change [ink bomb y speed v] by (-1)\n touch ground\n end\nend\n\nwhen flag clicked\nset [ink bomb # v] to [0]\nhide\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [ink bomb y speed v] to [0]\nend\n\ndefine bomb slope\nset [bomb slope v] to [0]\nrepeat until <<(bomb slope) = [8]> or <not <touching (ground v)?>>>\n change y by (1)\n change [bomb slope v] by (1)\nend\nif <(bomb slope) = [8]> then\n change x by ((0) - (ink bomb x speed))\n change y by ((0) - (bomb slope))\nend\n\nbomb slope\n\nwhen I receive [next level v]\nset [ink bomb # v] to [0]\nhide\ndelete this clone\n\n@Arrow1\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\nclear graphic effects\nset [bomb power v] to [0]\nset [bomb done 1 v] to [No]\n\nwhen I receive [start v]\nforever\n if <key (b v) pressed?> then\n if <(ink bomb #) = [0]> then\n clear graphic effects\n go to [front v] layer\n show\n set [ghost v] effect to (50)\n repeat until <<not <key (b v) pressed?>> or <(HP) < [0.1]>>\n if <(bomb power) < [5]> then\n change [bomb power v] by (0.2)\n change [ghost v] effect by (-2)\n else\n if <(bomb done 1) = [No]> then\n start sound [bomb done v]\n set [bomb done 1 v] to [Yes]\n end\n change [color v] effect by (5)\n end\n go to (inkling girl v)\n point towards (mouse-pointer v)\n end\n broadcast (ink bomb throw v)\n set [bomb done 1 v] to [No]\n hide\n wait (1) seconds\n set [bomb power v] to [0]\n end\n end\nend\n\n@Ball\n\nwhen flag clicked\nhide\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [arrow direction y speed v] to [0]\nend\n\nwhen I receive [start v]\nforever\n change y by (arrow direction y speed)\n change [arrow direction y speed v] by (-1)\n touch ground\nend\n\nwhen I receive [next level v]\n\nforever\n if <key (b v) pressed?> then\n if <(ink bomb #) = [0]> then\n set size to (10) %\n go to (arrow1 v)\n show\n repeat until <not <key (b v) pressed?>>\n set [arrow direction y speed v] to (([direction v] of [arrow1 v]) / (9))\n go to (arrow1 v)\n point in direction ([direction v] of [arrow1 v])\n if <(bomb power) < [1]> then\n set [arrow direction x speed v] to [1]\n else\n if <<(bomb power) > [0.9]> and <(bomb power) < [2]>> then\n set [arrow direction x speed v] to [5]\n else\n if <<(bomb power) > [1.9]> and <(bomb power) < [3]>> then\n set [arrow direction x speed v] to [10]\n else\n if <<(bomb power) > [2.9]> and <(bomb power) < [4]>> then\n set [arrow direction x speed v] to [12]\n else\n if <<(bomb power) > [3.9]> and <(bomb power) < [5]>> then\n set [arrow direction x speed v] to [15]\n else\n if <(bomb power) > [4.9]> then\n set [arrow direction x speed v] to [18]\n end\n end\n end\n end\n end\n end\n repeat until <(arrow direction x speed) < [1]>\n change x by (arrow direction x speed)\n change [arrow direction x speed v] by (-0.5)\n stamp\n end\n erase all\n end\n erase all\n hide\n end\n end\nend\n\n@something\n\nwhen flag clicked\nset [ee mult # v] to [1]\ngo to [front v] layer\nswitch costume to (costume1 v)\nhide\nset volume to (0) %\n\nwhen [s v] key pressed\nset volume to (0) %\nstop [other scripts in sprite v]\nset [ee2 v] to [0]\nset [ee mult # v] to [1]\npoint in direction (90)\nswitch costume to (costume1 v)\nhide\n\nwhen [f v] key pressed\nforever\n point in direction (105)\n change [color v] effect by (25)\n wait (0.35) seconds\n change [color v] effect by (25)\n point in direction (90)\n wait (0.35) seconds\nend\n\nturn right (15) degrees\n\nturn left (15) degrees\n\nwhen [f v] key pressed\nbroadcast (easter egg v)\nclear graphic effects\ngo to [front v] layer\npoint in direction (90)\nshow\ngo to x: (0) y: (0)\nswitch costume to (easter egg 1 v)\nset volume to (100) %\nplay sound [Easter egg 1 v] until done\nset volume to (0) %\nstop [other scripts in sprite v]\npoint in direction (90)\nswitch costume to (costume1 v)\nclear graphic effects\nhide\n\nwhen [i v] key pressed\nset volume to (100) %\nset [ee mult # v] to [3]\nset [ee2 v] to [1]\nbroadcast (easter egg 2 v)\nplay sound [Easter egg 2 v] until done\nset [ee2 v] to [0]\nset [ee mult # v] to [1]\nset volume to (0) %\n\n@semiquaver-151930_640\n\nwhen flag clicked\nhide\n\nwhen I start as a clone\nset size to (25) %\nshow\ngo to [front v] layer\ngo to (something v)\npoint in direction (pick random (-180) to (180))\nrepeat until <touching (_edge_ v)?>\n move (10) steps\nend\ndelete this clone\n\nwhen flag clicked\n\nrepeat until <not <key (f v) pressed?>>\n create clone of (_myself_ v)\n wait (0.1) seconds\nend\n\nwhen [f v] key pressed\n\nwhen I receive [easter egg v]\nrepeat until <not <([volume v] of [something v]) = [100]>>\n create clone of (_myself_ v)\n wait (0.1) seconds\nend\n\nforever\n if <([volume v] of [something v]) = [100]> then\n end\nend\n\n@Teleporter\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nif <(Level) = [21]> then\n set size to (300) %\n go to x: (-100) y: (-129)\n show\nelse\n if <(Level) = [22]> then\n set size to (300) %\n go to x: (-100) y: (-129)\n show\n else\n if <(Level) = [26]> then\n set size to (300) %\n go to x: (-100) y: (-129)\n show\n else\n hide\n end\n end\nend\n\nwhen I receive [next level v]\nclear graphic effects\nforever\n if <<<(Level) = [21]> or <(Level) = [22]>> or <(Level) = [26]>> then\n change [color v] effect by (5)\n else\n stop [this script v]\n end\nend\n\nwhen I receive [next level v]\nforever\n if <(form) = [teleport]> then\n set x to (100)\n set y to (0)\n set [ghost v] effect to (50)\n repeat until <key (t v) pressed?>\n point towards (mouse-pointer v)\n go to (mouse-pointer v)\n end\n set [teleport x v] to (x position)\n set [teleport y v] to (y position)\n broadcast (teleport v)\n start sound [zoop v]\n hide\n end\nend\n\nif <(direction) < [180]> then\n point in direction ((direction) + (180))\nelse\n point in direction ((direction) - (180))\nend\nmove (10) steps\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n\npoint towards (mouse-pointer v)\nif <not <touching (ground v)?>> then\n\nif <[] < []> then\n\nwhen I start as a clone\n\ncreate clone of (_myself_ v)\n\nif <(Level) = [21]> then\n change [color v] effect by (5)\nelse\n stop [this script v]\nend\n\nwhen I start as a clone\n\nmove (10) steps\n\n@charger ink\n\nwhen flag clicked\nhide\n\nwhen I receive [charge shot v]\ncreate clone of (_myself_ v)\n\nwhen I receive [next level v]\nhide\ndelete this clone\n\nwhen I start as a clone\nshow\nset size to ((charge power) * (50)) %\ngo to (arrow2 v)\npoint in direction ([direction v] of [arrow2 v])\nset [charger speed1 v] to ((charge power) * (10))\nrepeat until <touching (_edge_ v)?>\n move (charger speed1) steps\n if <touching (octoling v)?> then\n set [octo hp v] to [0]\n end\n if <touching (bomb octoling v)?> then\n set [octo hp 2 v] to [0]\n end\n if <touching (callie pillar v)?> then\n delete this clone\n end\nend\nhide\ndelete this clone\n\nhide\n\n@Arrow2\n\nif <(ink bomb #) = [0]> then\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\nclear graphic effects\nset [bomb power v] to [0]\nset [bomb done 1 v] to [No]\n\nwhen I receive [start v]\nforever\n if <key (c v) pressed?> then\n clear graphic effects\n set [color v] effect to (50)\n go to [front v] layer\n show\n set [ghost v] effect to (50)\n repeat until <<not <key (c v) pressed?>> or <(HP) < [0.1]>>\n if <(charge power) < [5]> then\n change [charge power v] by (0.2)\n change [ghost v] effect by (-2)\n else\n if <(charge done) = [No]> then\n start sound [bomb done v]\n set [charge done v] to [Yes]\n hide\n wait (1) seconds\n set [charge done v] to [No]\n set [charge power v] to [0]\n end\n change [color v] effect by (5)\n end\n go to (inkling girl v)\n point towards (mouse-pointer v)\n end\n broadcast (charge shot v)\n start sound [ChargeShotQuick v]\n hide\n end\nend\n\n@marina\n\nwhen flag clicked\ngo to [front v] layer\nhide\nset size to (50) %\ngo to x: (-190) y: (30)\n\nwhen I receive [next level v]\nif <(Level) = [24]> then\n go to [front v] layer\n show\n start sound [FestAnnounceCmn_0003 v]\n set [text v] to [Oh. Hi.]\n talk (123)\n start sound [FestResult_JaraJara_0001 v]\n set [text v] to [I'm Marina and I'm here to help you.]\n talk (123)\n broadcast (hyperbomb v)\n start sound [FestAnnounceCmn_0003_01 v]\n set [text v] to [That's a hyperbomb. Hit it with your ink gun to make it explode. Bombs won't even make a dent on them.]\n talk (123)\nelse\n if <(Level) = [25]> then\n go to [front v] layer\n show\n start sound [FestAnnounceCmn_0003 v]\n set [text v] to [Here's another hyperbomb.]\n talk (234)\n broadcast (hyperbomb v)\n else\n if <(Level) = [26]> then\n go to [front v] layer\n show\n start sound [OpeningFestEnd_0001_01 v]\n set [text v] to [Remember: You can't teleport back after you use a teleporter.]\n talk (234)\n broadcast (hyperbomb v)\n else\n if <(Level) = [30]> then\n go to [front v] layer\n show\n start sound [FestAnnounceCmn_0003_01 v]\n set [text v] to [Hey, I'm back!]\n talk (234)\n broadcast (hyperbomb v)\n else\n hide\n end\n end\n end\nend\n\ndefine talk (waitlength)\nset [textletter v] to [0]\nset [lastphrase v] to []\nrepeat ((length of (text)) + (1))\n say (join (lastphrase) (letter (textletter) of (text)))\n set [lastphrase v] to (join (lastphrase) (letter (textletter) of (text)))\n change [textletter v] by (1)\nend\nif <(waitlength) = [123]> then\n wait until <key (space v) pressed?>\n say []\nelse\n if <not <(waitlength) = [234]>> then\n wait (waitlength) seconds\n say []\n end\nend\n\n@hyperbomb\n\nwhen flag clicked\nhide\n\nwhen I receive [hyperbomb v]\ncreate clone of (_myself_ v)\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [hyperbomb y speed v] to [0]\nend\n\nwhen I start as a clone\ngo [backward v] (10) layers\nswitch costume to (costume1 v)\nset [hyperbomb y speed v] to [0]\nset [hyperbomb damage v] to [0]\nshow\nset size to (200) %\nif <(Level) = [24]> then\n go to x: (60) y: (165)\nelse\n if <(Level) = [25]> then\n go to x: (-80) y: (165)\n else\n if <(Level) = [26]> then\n go to x: (150) y: (165)\n else\n if <(Level) = [30]> then\n go to x: (-105) y: (165)\n else\n delete this clone\n end\n end\n end\nend\nstart sound [bomb 1 v]\nrepeat until <touching (ground v)?>\n change [hyperbomb y speed v] by (-1)\n change y by (hyperbomb y speed)\n touch ground\nend\n\nwhen I receive [hyperbomb damage v]\nchange [hyperbomb damage v] by (1)\nif <(hyperbomb damage) = [20]> then\n start sound [GearPlastic00 v]\n broadcast (hyperbomb explode v)\nelse\n start sound (pick random (3) to (6))\nend\n\nwhen I receive [next level v]\nif <<<<(Level) = [24]> or <(Level) = [25]>> or <(Level) = [26]>> or <(Level) = [30]>> then\n set [hyperbomb level? v] to [Yes]\nelse\n set [hyperbomb level? v] to [No]\nend\n\nwhen I receive [hyperbomb explode v]\nswitch costume to (hero-splat-3 v)\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\nclear graphic effects\n\nwhen I receive [next level v]\ndelete this clone\n\n@ground water\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nif <(Level) > [26]> then\n go to [front v] layer\n go to x: (90) y: (-130)\n show\n switch costume to ((Level) - (26))\nelse\n hide\nend\n\nwhen I receive [next level v]\n\nforever\n if <touching (inkling girl v)?> then\n broadcast (hurt v)\n change [hp v] by (-1)\n wait (0.2) seconds\n end\nend\n\n@callie pillar\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nif <(Level) = [41]> then\n go to [back v] layer\n switch costume to (pillar 1 v)\n show\n go to x: (0) y: (0)\nelse\n hide\nend\n\nwhen I receive [boss start v]\n\nwhen I receive [boss attack 1 v]\nglide (1) secs to x: (0) y: (330)\nwait (10) seconds\nglide (1) secs to x: (0) y: (0)\ngo to x: (0) y: (0)\n\nwhen I receive [boss start v]\nif <(HP) < [1]> then\n show\n go to x: (0) y: (0)\n stop [other scripts in sprite v]\nend\n\nwhen I receive [boss attack 2 v]\nglide (1) secs to x: (0) y: (330)\nwait (10) seconds\nglide (1) secs to x: (0) y: (0)\ngo to x: (0) y: (0)\n\nwhen I receive [gun disappear v]\nshow\nrepeat (20)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\n\nwhen I receive [boss attack 3 v]\nglide (1) secs to x: (0) y: (330)\nwait (10) seconds\nglide (1) secs to x: (0) y: (0)\ngo to x: (0) y: (0)\n\n@callie icon\n\nwhen flag clicked\nhide\n\nwhen I receive [z_talk1 v]\nsay []\nset [ghost v] effect to (100)\nset size to (25) %\nshow\ngo to x: (180) y: (130)\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nclear graphic effects\nwait (1) seconds\nset [text v] to [I told you to leave....]\nstart sound [AoriVoice_LK0_01 v]\ntalk (123)\nset [text v] to [Why didn't you listen?]\nstart sound [AoriVoice_LK0_03 v]\ntalk (123)\nbroadcast (z_talk2 v)\n\nwhen I receive [next level v]\nhide\n\ndefine talk (waitlength)\nset [textletter v] to [0]\nset [lastphrase v] to []\nrepeat ((length of (text)) + (1))\n say (join (lastphrase) (letter (textletter) of (text)))\n set [lastphrase v] to (join (lastphrase) (letter (textletter) of (text)))\n change [textletter v] by (1)\nend\nif <(waitlength) = [123]> then\n wait until <key (space v) pressed?>\n say []\nelse\n if <not <(waitlength) = [234]>> then\n wait (waitlength) seconds\n say []\n end\nend\n\nwhen I receive [z_talk3 v]\nset [text v] to [I guess I have no choice except to....]\nstart sound [AoriVoice_LK0_04 v]\ntalk (123)\nset [text v] to [ḔḶḬṀḬṆḀṮḔ ᖻᓍᑘᗩᕲᖴᒪᒚSᖽᐸᒪᕲᒚᑢᘻᒪ]\nstart sound [AORIROBOT v]\ntalk (123)\nset [text v] to [$ДFѲЇJГFКАJДFPЇД$JѲJГКДJѲ$ЇJFГКЄJГFК$JДГКFJѲЇ$ДГFКJ$ГКДJF$ДF$ЄF$ДF$ГДКFJ$ГКCѪГКѪКГ$ДЙѴКГJГК$ДJFѲЇJЄШF$ДF ᗩᒪᖴᖽᐸSᕲᒚᒪᖽᐸᒚᖴᓍᓰᒚᘺᘿᒪᖽᐸᒚᖴᒪᖽᐸSᒚᕲᖴSᕲᖴᓍᓰᒚᘿᘺᖽᐸᒚᒪᒚSᕲᖴ]\nstart sound [AORIROBOT2 v]\ntalk (123)\nbroadcast (z_talk4 v)\n\nwhen I receive [callie hurt v]\nif <(pick random (1) to (5)) = [1]> then\n if <(pick random (1) to (3)) = [1]> then\n set [text v] to [Eep!]\n else\n if <(pick random (1) to (3)) = [2]> then\n set [text v] to [Ow!]\n else\n set [text v] to [Agh!]\n end\n end\n start sound (pick random (24) to (28))\n talk (123)\nend\n\nwhen [3 v] key pressed\nif <(Level) = [41]> then\n say []\nend\n\nwhen I receive [boss start v]\nrepeat until <(Boss HP) < [1]>\n wait (pick random (5) to (7)) seconds\n set [text v] to [Attack!]\n start sound (pick random (4) to (9))\n talk (234)\n if <(pick random (1) to (2)) = [1]> then\n broadcast (boss attack 1 v)\n else\n if <(pick random (1) to (2)) = [2]> then\n broadcast (boss attack 2 v)\n else\n broadcast (boss attack 3 v)\n end\n end\n wait (10) seconds\nend\n\nwhen I receive [next level v]\nstop [other scripts in sprite v]\n\nwhen I receive [boss start v]\nwait until <(HP) < [1]>\nstop [other scripts in sprite v]\n\nwhen I receive [boss start v]\nwait until <(Boss HP) < [1]>\nshow\nset [boss hp v] to [0]\nstop [other scripts in sprite v]\nstart sound [AORIDEATH v]\nset [text v] to [ᎦᏠᏗᏦᏝᏕᎴᏠᎦᏝᏕᏠᏦᏝᎦᏠᏦᏝᏠᏗᏝᏕᏦᎴᎦᏠᎦᎴᏕᏦᏝᏗᏕᏠᎴᏠᎦ]\ntalk (234)\nrepeat (50)\n change [pixelate v] effect by (20)\nend\nrepeat (50)\n change [pixelate v] effect by (20)\n change [ghost v] effect by (5)\nend\nhide\nclear graphic effects\nbroadcast (boss dead v)\n\nwhen I receive [boss start v]\nshow\n\nwhen I receive [boss start v]\nwait until <(Boss HP) < [1]>\nstop [other scripts in sprite v]\n\nwhen I receive [boss start v]\nset volume to (100) %\n\nwhen I receive [boss start v]\nforever\n play sound [Bomb Rush Blush \(DJ Octavio feat v] until done\nend\n\nwhen I receive [boss attack 3 v]\nclear graphic effects\nrepeat (100)\n change [brightness v] effect by (0.5)\nend\nrepeat (5)\n change [brightness v] effect by (-10)\nend\nclear graphic effects\n\nbroadcast (boss attack 3 v)\n\n@weak point\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\n\nwhen I receive [z_talk1 v]\ngo [backward v] (10) layers\ngo to x: (180) y: (130)\nshow\nforever\n glide (1.5) secs to x: (180) y: (-110)\n glide (1.5) secs to x: (180) y: (110)\nend\n\nwhen I receive [boss start v]\nforever\n if <touching (ink v)?> then\n broadcast (callie hurt v)\n change [boss hp v] by (-1)\n end\n if <<touching color (#bf644d)?> and <touching (ink bomb v)?>> then\n broadcast (callie hurt v)\n change [boss hp v] by (-10)\n end\n if <touching (charger ink v)?> then\n broadcast (callie hurt v)\n change [boss hp v] by (-10)\n end\nend\n\nwhen I receive [boss start v]\nshow\nwait until <(Boss HP) < [1]>\nstop [other scripts in sprite v]\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\nclear graphic effects\n\n@callie attack 1\n\nwhen flag clicked\nhide\ndelete this clone\n\nwhen I receive [boss start v]\nset rotation style [don't rotate v]\nhide\ndelete this clone\n\nwhen I receive [next level v]\nhide\ndelete this clone\n\nwhen I receive [boss attack 1 v]\nrepeat (10)\n create clone of (_myself_ v)\n wait (0.5) seconds\nend\n\nwhen I start as a clone\nstart sound [ink v]\nshow\ngo to (callie icon v)\npoint towards (inkling girl v)\nrepeat until <touching (_edge_ v)?>\n move (30) steps\n if <touching (inkling girl v)?> then\n broadcast (hurt v)\n hide\n delete this clone\n end\n if <touching (ground v)?> then\n hide\n delete this clone\n end\n if <touching (callie pillar v)?> then\n hide\n delete this clone\n end\nend\nhide\ndelete this clone\n\nwhen I receive [boss start v]\nforever\n if <(Boss HP) < [1]> then\n stop [other scripts in sprite v]\n end\nend\n\n@callie bomb\n\nrepeat until <touching (ground v)?>\n\nchange [bomb x speed v] by (1)\nforever\n\nplay sound [bomb explode v] until done\n\n\n\nwhen I receive [next level v]\nhide\ndelete this clone\n\nwhen I start as a clone\ngo to [back v] layer\nclear graphic effects\nswitch costume to (costume1 v)\nset [bomb y speed v] to [0]\nset [bomb x speed v] to [20]\ngo to (callie icon v)\nset size to (200) %\nshow\nstart sound [bomb 1 v]\npoint towards (inkling girl v)\nrepeat until <(bomb x speed) < [0.1]>\n move (bomb x speed) steps\n change [bomb x speed v] by (pick random (-1) to (0))\n if <touching (callie pillar v)?> then\n move ((bomb x speed) - ((bomb x speed) * (2))) steps\n end\n if <touching (_edge_ v)?> then\n delete this clone\n end\nend\nplay sound [bomb 2 v] until done\ngo to [front v] layer\nswitch costume to (hero-splat-3 v)\nstart sound [bomb explode v]\nwait (0.1) seconds\nswitch costume to (hero-splat-2 v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\ndefine touch ground\nrepeat until <not <touching (ground v)?>>\n change y by (1)\n set [bomb y speed v] to [0]\nend\n\nwhen I start as a clone\nforever\n if <(costume [number v]) = [1]> then\n change y by (bomb y speed)\n change [bomb y speed v] by (-1)\n touch ground\n end\nend\n\nwhen I receive [boss attack 2 v]\nrepeat (10)\n create clone of (_myself_ v)\n wait (1) seconds\nend\n\nwhen I receive [boss start v]\nforever\n if <(Boss HP) < [1]> then\n stop [other scripts in sprite v]\n end\nend\n\n@callie attack 3\n\nwhen flag clicked\nhide\ndelete this clone\n\nwhen I receive [boss start v]\nset rotation style [don't rotate v]\nhide\ndelete this clone\n\nwhen I receive [next level v]\nhide\ndelete this clone\n\nwhen I receive [boss attack 3 v]\nplay sound [ChargeShotBeep00 v] until done\nwait (0.5) seconds\nplay sound [ChargeAimLoop00 v] until done\nrepeat (5)\n create clone of (_myself_ v)\n wait (1) seconds\nend\n\nwhen I start as a clone\nshow\ngo to (callie icon v)\npoint towards (inkling girl v)\nstart sound [ChargeShotLong v]\nrepeat until <touching (_edge_ v)?>\n move (10) steps\n if <touching (inkling girl v)?> then\n change [hp v] by (-4)\n broadcast (hurt v)\n hide\n delete this clone\n end\n if <touching (ground v)?> then\n hide\n delete this clone\n end\n if <touching (callie pillar v)?> then\n hide\n delete this clone\n end\nend\nhide\ndelete this clone\n\nwhen I receive [boss start v]\nforever\n if <(Boss HP) < [1]> then\n stop [other scripts in sprite v]\n end\nend\n\n@portal\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\n\nwhen I receive [portal v]\ngo to [back v] layer\nset [pixelate v] effect to (500)\nset [ghost v] effect to (100)\nshow\ngo to x: (-200) y: (0)\nstart sound [Teleport2 v]\nrepeat (20)\n change [pixelate v] effect by (-25)\n change [ghost v] effect by (-5)\nend\nclear graphic effects\n\nwhen I receive [gun disappear v]\nrepeat (20)\n change [brightness v] effect by (5)\nend\nhide\nclear graphic effects\n\n@splatformer ending\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\n\nwhen I receive [ending v]\nset size to (200) %\ngo to [back v] layer\ngo to x: (25) y: (0)\nset [brightness v] effect to (100)\nshow\nrepeat (50)\n change [brightness v] effect by (-2)\nend\nclear graphic effects\n\nwhen I receive [ending2 v]\nclear graphic effects\nshow\nstart sound [Teleport2 v]\nrepeat (50)\n change [brightness v] effect by (2)\n change [pixelate v] effect by (2)\nend\nhide\nclear graphic effects\nstop [all v]\n\n@credits\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nhide\n\nwhen I receive [ending v]\nset size to (100) %\nclear graphic effects\nset [brightness v] effect to (100)\nswitch costume to (costume1 v)\ngo to x: (-140) y: (-135)\nshow\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nclear graphic effects\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch costume to (costume2 v)\ngo to x: (-30) y: (-125)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nclear graphic effects\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch costume to (costume3 v)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nclear graphic effects\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch costume to (costume4 v)\ngo to x: (-80) y: (-135)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nclear graphic effects\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch costume to (costume5 v)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\nend\nswitch costume to (costume6 v)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nwait (5) seconds\nrepeat (20)\n change [brightness v] effect by (5)\n change size by (-5)\nend\nhide\nset size to (100) %\nclear graphic effects\n\n
Alright, it's finally done! I might tweak the boss a little bit, but the game is fully playable and has a credits screen as well.\nALL LEVELS ARE BEATABLE! (including level 23)\nMarie will tell you what to do in the game.\nPress space to scroll through Marie/Marina's text.\nPress R to restart a level if you get stuck or something.\nPress W to woomy. (holding the button down will lag the game)\nPress M to mute and unmute the music (not the SFX)\nYou can still charge and throw bombs while in ink. (just so you guys know)\nI've coded little Easter eggs into the game. Tell me in the comments if you find one! You can also check the code if you're lazy.\nDEBUG COMMANDS:\nD - set the level\nDown arrow - skip the introduction\nH - set HP to 10
Scrolling Platformer Tutorial
@Stage\n\n@Stages\n\nwhen I receive [showcase v]\nset size to (100) %\nshow\nshow variable [stagex v]\nset [stagex v] to [0]\nset [id v] to [1]\ncreate clone of (_myself_ v)\nset [id v] to [2]\nforever\n broadcast (Frame v) and wait\n if <key (right arrow v) pressed?> then\n set [stagex v] to (((StageX) + (2)) mod (2800))\n end\n if <key (left arrow v) pressed?> then\n set [stagex v] to (((StageX) - (2)) mod (2800))\n end\nend\n\nwhen I receive [frame v]\nswitch costume to (([floor v] of ((StageX) / (465)) ) + (ID))\ngo to x: ((((([floor v] of ((StageX) / (465)) ) + (ID)) - (1)) * (465)) - (StageX)) y: (0)\n\ndefine None\ngo to x: ((([floor v] of ((stagex) / (480)) ) * (480)) - (stagex)) y: (0)\n\ndefine None\ngo to x: (((([floor v] of ((stagex) / (480)) ) + (1)) * (480)) - (stagex)) y: (0)\n\n@Instruction Slides\n\nwhen flag clicked\nhide variable [stagex v]\ngo to x: (0) y: (0)\nhide\nswitch costume to ((0) - (1))\nset [slides v] to ((costume [number v]) + (1))\nset [slide v] to [1]\ncreate clone of (_myself_ v)\nforever\n if <key (space v) pressed?> then\n set [slide v] to (((Slide) + (1)) mod (Slides))\n create clone of (_myself_ v)\n wait until <not <key (space v) pressed?>>\n if <(Slide) = [23]> then\n broadcast (Showcase v)\n end\n end\nend\n\nwhen I start as a clone\nhide\nswitch costume to (Slide)\nset [slide v] to [4]\ngo to x: (240) y: (0)\nset size to (140) %\nbroadcast (Next Slide v)\nwait until <not <key (space v) pressed?>>\nshow\ngo to [front v] layer\ngo [backward v] (1) layers\nrepeat (4)\n change size by (-10)\n change x by ((Slide) * (-20))\n change [slide v] by (-1)\nend\nclear graphic effects\ngo to x: (0) y: (0)\n\nwhen I start as a clone\nwait until <not <key (space v) pressed?>>\nwait until <key (space v) pressed?>\nwait until <not <key (space v) pressed?>>\ngo [backward v] (1) layers\nrepeat (5)\n change x by ((Slide) * (20))\n change [slide v] by (-1)\nend\ndelete this clone\n\nshow\n\n@Slide Animations\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\nset [slide v] to [1]\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nhide\nwait until <not <key (space v) pressed?>>\nswitch costume to (Slide)\nset [slide v] to [4]\ngo to x: (240) y: (0)\nset size to (140) %\nset [brightness v] effect to (50)\nshow\ngo to [front v] layer\nrepeat (4)\n change size by (-10)\n change [brightness v] effect by (-10)\n change x by ((Slide) * (-20))\n change [slide v] by (-1)\nend\nclear graphic effects\ngo to x: (0) y: (0)\n\nwhen I start as a clone\ngo to x: (0) y: (0)\nif <(Slide) = [3]> then\n repeat (9)\n change x by (-5)\n wait (0.1) seconds\n end\n forever\n repeat (9)\n change x by (5)\n wait (0.1) seconds\n end\n repeat (9)\n change x by (-5)\n wait (0.1) seconds\n end\n end\nend\nif <(Slide) = [6]> then\n forever\n repeat (8)\n change x by (-5)\n wait (0.1) seconds\n end\n wait (0.5) seconds\n repeat (8)\n change x by (5)\n wait (0.1) seconds\n end\n end\nend\nif <(Slide) = [7]> then\n forever\n repeat (8)\n change y by (5)\n wait (0.1) seconds\n end\n repeat (8)\n change y by (-5)\n wait (0.1) seconds\n end\n end\nend\nif <(Slide) = [18]> then\n forever\n repeat (8)\n change x by (5)\n wait (0.1) seconds\n end\n repeat (8)\n change x by (-5)\n wait (0.1) seconds\n end\n end\nend\n\nwhen I start as a clone\nwait until <not <key (space v) pressed?>>\nwait until <key (space v) pressed?>\nwait until <not <key (space v) pressed?>>\ngo [backward v] (1) layers\nrepeat (5)\n change x by ((Slide) * (20))\n change [slide v] by (-1)\nend\ndelete this clone\n\nwhen I receive [next slide v]\nset [slide v] to ([slide v] of [instruction slides v])\ncreate clone of (_myself_ v)\n\n@Thumbnail\n\nwhen flag clicked\nswitch costume to (slide 1 v)\ngo to [front v] layer\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\n\n
~~~A tutorial about how to make scrolling platformers.~~~\n\nIf you want to make a scrolling platformer, but do not know how to, this project is for you! (Even if you know, this project shows some ways to deal with some issues that might arise)\n\n~Press space to advance to the next slide.\n\nAs this is my first tutorial (ever), please leave some (constructive) criticism in the comments. Tell me if you find any spelling errors (xD)\n\n~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n\nL̶e̶t̶ ̶m̶e̶ ̶k̶n̶o̶w̶ ̶i̶f̶ ̶y̶o̶u̶ ̶w̶a̶n̶t̶ ̶a̶ ̶p̶a̶r̶t̶ ̶2̶,̶ ̶a̶s̶ ̶t̶h̶e̶r̶e̶ ̶a̶r̶e̶ ̶m̶a̶n̶y̶ ̶t̶h̶i̶n̶g̶s̶ ̶l̶e̶f̶t̶ ̶t̶o̶ ̶d̶o̶,̶ ̶b̶e̶f̶o̶r̶e̶ ̶w̶e̶ ̶c̶a̶n̶ ̶m̶a̶k̶e̶ ̶t̶h̶e̶ ̶p̶l̶a̶t̶f̶o̶r̶m̶e̶r̶ ̶p̶l̶a̶y̶a̶b̶l̶e̶.̶\nIm not active on scratch anymore (sorry). If anyone wants, they can make the effort to make a part 2.\n\nJust as a warning:\nDON'T check out my other projects. They are terrible (second xD)\n\n~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n\nYou sure you read everything? I mean above this, there is nothing to see below.\n\n\nxD still reading\n\n\nLets have a monolog! said nobody ever.\n\n\nOk, you read this far, comment the amount of xD's you can find in the project and in the description, followed by "Ball".\n\n\nxD
Platformer Collection Ver. 1.1
@Stage\n\nwhen flag clicked\nforever\n if <key (o v) pressed?> then\n ask [Enter continue code] and wait\n broadcast (continue code v)\n end\nend\n\nwhen flag clicked\nswitch backdrop to (level 1 v)\nwait until <([costume # v] of [levels v]) = [50]>\nswitch backdrop to (level 2 v)\nwait until <([costume # v] of [levels v]) = [50]>\nswitch backdrop to (level 3 v)\nwait until <([costume # v] of [levels v]) = [50]>\nswitch backdrop to (level 4 v)\nwait until <([costume # v] of [levels v]) = [50]>\n\n@Player\n\ndefine Side Collsion\nif <(Flight Code) = [1]> then\n if <<key (w v) pressed?> or <key (up arrow v) pressed?>> then\n set [change in y v] to [10]\n else\n end\nend\nif <touching color (#353943)?> then\n change y by (1)\n if <touching color (#353943)?> then\n change y by (1)\n if <touching color (#353943)?> then\n change y by (1)\n if <touching color (#353943)?> then\n change y by (1)\n if <touching color (#353943)?> then\n change y by (1)\n if <touching color (#353943)?> then\n change x by ((Change in x) * (-1))\n change y by (-5)\n if <<key (w v) pressed?> or <key (up arrow v) pressed?>> then\n if <(Change in x) > [0]> then\n set [change in x v] to [-5]\n else\n set [change in x v] to [5]\n end\n set [change in y v] to [10]\n else\n set [change in x v] to [0]\n end\n end\n end\n end\n end\n end\nend\n\ndefine Gravity\nchange [change in y v] by (-1)\nchange y by (change in y)\nif <touching color (#353943)?> then\n set [change in y v] to [0]\n get out of the ground\nend\nchange y by (-1)\nif <touching color (#353943)?> then\n if <<key (w v) pressed?> or <key (up arrow v) pressed?>> then\n set [change in y v] to [15]\n end\nend\nchange y by (1)\n\nwhen flag clicked\nset size to (40) %\nshow\ngo to x: (-216) y: (-74)\nset [change in y v] to [0]\nset [change in x v] to [0]\nforever\n if <(Mini Code) = [1]> then\n set size to (20) %\n end\n if <(Mega Code) = [1]> then\n set size to (100) %\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n switch costume to (costume1 v)\n change [change in x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n switch costume to (costume2 v)\n change [change in x v] by (-1)\n end\n set [change in x v] to ((Change in x) * (0.9))\n change x by (Change in x)\n Side Collsion\n Gravity\n if <touching color (#666600)?> then\n broadcast (Next Level v)\n end\n if <<touching color (#c3500c)?> or <<touching color (#f9660f)?> or <key (r v) pressed?>>> then\n if <(Invincibility Code) = [0]> then\n set [change in y v] to [0]\n set [change in x v] to [0]\n point in direction (90)\n go to x: (-216) y: (-74)\n end\n end\n if <(x position) > [235]> then\n broadcast (Next Level v) and wait\n end\n if <touching color (#99ffbb)?> then\n set [change in y v] to [0]\n change [change in y v] by (20)\n end\n if <(Air) = []> then\n create clone of (_myself_ v)\n end\nend\n\nwhen I receive [next level v]\npoint in direction (90)\nset size to (40) %\nset [change in y v] to [0]\nset [change in x v] to [0]\nwait (0.5) seconds\ngo to x: (-216) y: (-74)\n\nwhen I receive [thumbnail v]\nhide\n\nwhen I start as a clone\nrepeat (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\ndefine get out of the ground\nchange y by (20)\nif <touching color (#353943)?> then\n change y by (-20)\n repeat until <not <touching color (#353943)?>>\n change y by (-1)\n end\nelse\n change y by (-20)\n repeat until <not <touching color (#353943)?>>\n change y by (1)\n end\nend\n\n@Levels\n\nwhen flag clicked\nset [invincibility code v] to [0]\nset [flight code v] to [0]\nset [mini code v] to [0]\nset [mega code v] to [0]\nswitch costume to (costume2 v)\ngo to x: (0) y: (0)\nshow\n\nwhen I receive [thumbnail v]\nhide\n\nwhen I receive [next level v]\nwait (0.5) seconds\nnext costume\n\nwhen I receive [continue code v]\nif <(answer) = [ylzxif]> then\n switch costume to (level 2 start v)\nend\nif <(answer) = [xtyfzs]> then\n switch costume to (level 3 start v)\nend\nif <(answer) = [rjlohx]> then\n switch costume to (level 4 start v)\nend\nif <(answer) = [rxigzn]> then\n switch costume to (level 5 start v)\nend\nif <(answer) = [cjxoud]> then\n switch costume to (level 6 start v)\nend\nif <(answer) = [rageme]> then\n switch costume to (post-end 1 v)\nend\nif <(answer) = [birdie]> then\n set [flight code v] to [1]\nend\nif <(answer) = [nonhit]> then\n set [invincibility code v] to [1]\nend\nif <(answer) = [minime]> then\n set [mini code v] to [1]\nend\nif <(answer) = [biglug]> then\n set [mega code v] to [1]\nend\nif <(answer) = [normal]> then\n set [mini code v] to [0]\n set [mega code v] to [0]\n set [invincibility code v] to [0]\n set [flight code v] to [0]\nend\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [1]> then\n switch backdrop to (level 1 v)\n end\n if <(costume [number v]) = [15]> then\n switch backdrop to (level 2 v)\n end\n if <(costume [number v]) = [30]> then\n switch backdrop to (level 3 v)\n end\n if <(costume [number v]) = [30]> then\n switch backdrop to (level 3 v)\n end\n if <(costume [number v]) = [45]> then\n switch backdrop to (level 4 v)\n end\n if <(costume [number v]) = [59]> then\n switch backdrop to (level 5 v)\n end\n if <(costume [number v]) = [75]> then\n switch backdrop to (level 6 v)\n end\n if <(costume [number v]) = [91]> then\n switch backdrop to (level 7 v)\n end\nend\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [thumbnail v]\nshow\nstop [all v]\n\nbroadcast (Thumbnail v)\n\n@Sprite1\n\nwhen I receive [next level v]\nset [ghost v] effect to (100)\nswitch costume to (costume2 v)\nset size to (999) %\nswitch costume to (costume1 v)\nshow\nrepeat (5)\n change [ghost v] effect by (-20)\nend\ngo to x: (476) y: (0)\nglide (0.5) secs to x: (-476) y: (0)\nrepeat (5)\n change [ghost v] effect by (20)\nend\nhide\nswitch costume to (costume1 v)\nset [ghost v] effect to (0)\nset size to (0) %\nswitch costume to (costume2 v)\n\nwhen flag clicked\nhide\nswitch costume to (costume1 v)\nset [ghost v] effect to (0)\nset size to (0) %\nswitch costume to (costume2 v)\n\n
Left and right arrow keys to move\nUp arrow key to jump\nWall jumping is enabled\nGet to the right of the screen\nPress O to open the continue code screen\n\n\nApparently this is the only way you can experience these games now because they all got replaced with Fat Bounce :p
Scratch (A Platformer) 2.0
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [thumbnail v]\nswitch backdrop to (backdrop2 v)\n\nwhen I receive [end v]\nswitch backdrop to (backdrop3 v)\nstop all sounds\nstop [all v]\n\nwhen flag clicked\nforever\n play sound (pick random (1) to (2)) until done\nend\n\n@Scratch Cat\n\nwhen flag clicked\nshow\ngo to x: (-162) y: (180)\nset [x v] to [0]\nset [y v] to [0]\nswitch costume to (stand_1 v)\nforever\n platform physics (11.5) (-1) (0.7) (2)\nend\n\ndefine None\nswitch costume to (hitbox v)\nchange y by (y)\nif <touching (ground v)?> then\n repeat ([abs v] of (y) )\n if <touching (ground v)?> then\n change y by ((-1) * (([abs v] of (y) ) / (y)))\n end\n end\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(y) > [0]>>> then\n set [y v] to (jump height)\n else\n set [y v] to [0]\n end\nelse\n change [y v] by (gravity)\nend\nif <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (movement speed)\n point in direction (90)\nend\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by ((-1) * (movement speed))\n point in direction (-90)\nend\nchange x by (x)\nif <touching (ground v)?> then\n set [old y v] to (y position)\n repeat ([abs v] of (x) )\n if <touching (ground v)?> then\n change y by (1)\n end\n end\n if <touching (ground v)?> then\n set y to (Old Y)\n repeat ([ceiling v] of ([abs v] of (x) ) )\n if <touching (ground v)?> then\n change x by ((-1) * (([abs v] of (x) ) / (x)))\n end\n end\n set [x v] to [0]\n end\nend\nswitch costume to (stand_1 v)\nset [x v] to ((x) * (friction))\nif <(y) > [2]> then\n switch costume to (jump_1 v)\nend\nif <(y) < [-3]> then\n switch costume to (fall_1 v)\nend\nif <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n switch costume to (Walk)\nend\nif <<(y position) < [-179]> or <touching (lava v)?>> then\n go to x: (-162) y: (180)\nend\n\nwhen flag clicked\nset [walk v] to [4]\nforever\n change [walk v] by (1)\n if <(Walk) > [19]> then\n set [walk v] to [4]\n end\n wait (0.01) seconds\nend\n\nwhen flag clicked\nforever\n if <(x position) > [235]> then\n go to x: (-162) y: (180)\n broadcast (Next Room v)\n end\nend\n\nwhen I receive [thumbnail v]\nhide\nstop [other scripts in sprite v]\n\nwhen flag clicked\nforever\n if <touching color (#009933)?> then\n broadcast (End v)\n hide\n end\nend\n\n@Ground\n\nwhen flag clicked\nshow\nswitch costume to (00 v)\ngo to x: (0) y: (0)\n\nwhen I receive [thumbnail v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [end v]\nhide\n\nwhen I receive [next room v]\nnext costume\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [11]> then\n broadcast (Lava v)\n end\nend\n\n@ThumbNail\n\nwhen flag clicked\nhide\nforever\n if <(username) = [Popfiz910]> then\n if <key (t v) pressed?> then\n show\n broadcast (ThumbNail v)\n end\n end\nend\n\nwhen I receive [end v]\nhide\n\n@Lava\n\nwhen flag clicked\ngo to x: (164) y: (0)\nhide\n\nwhen I receive [lava v]\nshow\n\nwhen I receive [next room v]\nhide\n\n
AD or Arrow Keys To Move\nUp Or W To Jump\n\n\n\n\nSTORY\n_______________________________________________________\nScratch Cat Has Been Used For Scratch As a Sprite Ever Sense Scratch Was Made. But Something Went Wrong And The Scratch Cat Was Sucked Into The Code. And He Is Trying To Escape.\n_______________________________________________________ \n
Samurai ~ A Ninja Platformer
@Stage\n\nwhen I receive [next level v]\nnext backdrop\n\n@player\n\nwhen flag clicked\ngo to x: (-150) y: (0)\nset [yv v] to [0]\nset [yv v] to [0]\nswitch backdrop to (backdrop1 v)\nset [xv v] to [0]\nforever\n switch costume to (costume2 v)\n change [yv v] by (-0.5)\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.7)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.7)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching (platform v)?> then\n change x by (Change)\n end\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n if <touching color (#000008)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching (platform v)?> then\n change x by (Change)\n end\n if <touching color (#000008)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [10]\n end\n end\n change y by (1)\n switch costume to (costume1 v)\n if <touching (portal v)?> then\n broadcast (Next Level v)\n go to x: (-150) y: (0)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n broadcast (Reset Level v)\n go to x: (-150) y: (0)\n end\nend\n\ncreate clone of (_myself_ v)\n\n@Portal\n\nwhen flag clicked\nshow\nset [level v] to [1]\nforever\n if <(level) = [1]> then\n go to x: (200) y: (-94)\n end\n if <(level) = [2]> then\n go to x: (199) y: (110)\n end\n if <(level) = [3]> then\n go to x: (214) y: (158)\n end\n if <(level) = [4]> then\n end\nend\n\nwhen I receive [next level v]\nchange [level v] by (1)\n\nwhen I receive [reset level v]\nforever\n if <(level) = [1]> then\n switch backdrop to (backdrop1 v)\n go to x: (200) y: (-94)\n end\n if <(level) = [2]> then\n switch backdrop to (backdrop2 v)\n go to x: (199) y: (110)\n end\n if <(level) = [3]> then\n switch backdrop to (backdrop3 v)\n go to x: (214) y: (158)\n end\n if <(level) = [4]> then\n switch backdrop to (backdrop4 v)\n go to x: (204) y: (-98)\n end\nend\n\n
ARROW KEYS TO MOVE\ntry to get to the portal to advance in level\nDONT TOUCH THE RED LAVA\n15 levels!\n\nLOVE AND FAVORITE IF YOU LIKED IT! (Dont report me. I said If you like it)\n\n\n\n
99% pen platformer
@Stage\n\nwhen flag clicked\nforever\n play sound [Kalimba.mp3 v] until done\nend\n\n@Main character\n\nwhen flag clicked\nset [y v] to [0]\nset [x v] to [0]\nshow\ngo to x: (-230) y: (0)\nerase all\nhide variable [level v]\nhide variable [x v]\nhide variable [y v]\nforever\n if <touching color (#e1a91a)?> then\n broadcast (3 v)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n set [x v] to ((X) * (0.9))\n change x by (X)\n if <touching color (#0e9a6c)?> then\n change y by (1)\n if <touching color (#0e9a6c)?> then\n change y by (1)\n end\n if <touching color (#0e9a6c)?> then\n change y by (1)\n if <touching color (#0e9a6c)?> then\n change y by (1)\n end\n end\n end\n if <touching color (#0e9a6c)?> then\n change x by ((X) * (-1))\n change y by (-4)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(X) > [0]> then\n set [x v] to [-5]\n else\n set [x v] to [5]\n end\n set [y v] to [10]\n else\n set [y v] to [0]\n end\n end\n change [y v] by (-1)\n change y by (Y)\n if <<<touching color (#0e9a6c)?> or <touching color (#ba7413)?>> or <touching color (#353444)?>> then\n change y by ((Y) * (-1))\n set [y v] to [1]\n end\n change y by (-1)\n if <<<touching color (#0e9a6c)?> or <touching color (#ba7413)?>> or <touching color (#353444)?>> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [y v] to [15]\n end\n end\n change y by (1)\n if <(y position) < [-178]> then\n go to x: (-230) y: (0)\n set [key v] to [0]\n end\n if <<touching color (#f34dff)?> or <touching color (#bb42c3)?>> then\n go to x: (188) y: (97)\n end\n if <touching color (#000000)?> then\n change [level1 v] by (1)\n if <(level1) = [7]> then\n go to x: (-211) y: (-118)\n else\n if <<(level1) = [8]> or <(level1) = [10]>> then\n go to x: (-240) y: (-44)\n else\n go to x: (-230) y: (0)\n end\n end\n end\n if <<touching color (#e81818)?> or <touching color (#e81111)?>> then\n if <(level1) = [7]> then\n set [key v] to [0]\n go to x: (-211) y: (-118)\n else\n if <<(level1) = [8]> or <(level1) = [10]>> then\n go to x: (-240) y: (-44)\n else\n go to x: (-230) y: (0)\n end\n end\n end\n if <touching color (#ee7d16)?> then\n set [y v] to [20]\n end\nend\n\nwhen flag clicked\nset [level1 v] to [0]\nwait until <(level1) = [11]>\nthink [You've finished] for (3) seconds\n\nwhen flag clicked\nforever\n repeat until <not <touching color (#353444)?>>\n change y by (6)\n end\nend\n\nwhen flag clicked\nwait until <(level1) = [10]>\ngo to x: (-240) y: (-66)\n\n@render background\n\nwhen flag clicked\nset [key v] to [0]\nset [level1 v] to [0]\nchange [level1 v] by (1)\ngo to x: (-240) y: (-180)\nset [lifes v] to [3]\nforever\n if <(level1) = [1]> then\n erase all\n level 1\n Render Lava 1\n Render Flag 2\n end\n if <(level1) = [2]> then\n erase all\n level 1\n render hill\n render flag 3\n end\n if <(level1) = [2]> then\n erase all\n level 1\n render hill\n splints\n render flag 3\n end\n if <(level1) = [3]> then\n erase all\n barrier\n level 1\n Render Lava 1\n Render Flag 2\n render lava 2\n render lava 4\n end\n if <<(level1) = [4]> and <(key) = [yes]>> then\n erase all\n level 1\n barrier2\n flag 4\n else\n if <(level1) = [4]> then\n erase all\n set [key v] to [0]\n level 1\n barrier2\n flag 4\n lock1\n key 1\n end\n end\n if <(level1) = [5]> then\n set [key v] to [0]\n erase all\n level 1\n render hill\n spike 3\n spike 2\n b\n line aside\n flag 5\n end\n if <(level1) = [6]> then\n set [key v] to [0]\n erase all\n holeb\n level 1\n level 2\n portal\n portal 2 \n spike 4\n spike 5\n flag 7\n spike 6\n lava\n end\n if <<(level1) = [7]> and <(key) = [yes]>> then\n erase all\n holeb\n render lava 3\n level 1\n level 2 (1)\n hole 4\n flag\n hole 5\n hole 7\n hole 8\n render lava 3\n lava\n else\n if <(level1) = [7]> then\n erase all\n holeb\n level 1\n render lava 3\n level 2 (1)\n hole 4\n flag\n hole 5\n hole 7\n lock 2\n hole 8\n render lava 3\n lava\n key 2\n end\n end\n set [xv v] to [-90]\n if <(level1) = [8]> then\n set [key v] to [0]\n erase all\n level 1\n level 2 (1)\n spike 2\n spikes\n spike 3\n spike 10\n spike 11\n holec\n line of bounce back\n spike 16\n spike 17\n flag 12\n render lava 7\n line aside 3\n end\n if <(level1) = [9]> then\n set [key v] to [0]\n erase all\n level 1\n lava\n flag13\n line of bounce back 2\n render lava 3\n border\n spike 18\n end\n if <(level1) = [10]> then\n erase all\n level 1\n Render Lava 1\n level 2 (1)\n hole 11\n last flag\n elevator red\n render lava 2\n render lava 4\n end\n if <(level1) = [11]> then\n erase all\n level 1\n fun bounce of line\n end\n if <(level1) = [12]> then\n erase all\n level 1\n end\nend\n\nrender lava 3\n\ndefine level 1\npen up\nset pen color to (#0e9a6c)\ngo to x: (-240) y: (-180)\npen down\nset pen size to (100)\ngo to x: (240) y: (-180)\npen up\n\ndefine render hill\npen up\ngo to x: (150) y: (-140)\nset pen size to (150)\nset pen color to (#0e9a6c)\npen down\npen down\nchange y by (200)\nchange x by (-150)\nchange y by (-200)\npen up\n\ndefine Render Flag 2\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (180) y: (-100)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine Render Lava 1\npen up\ngo to x: (-50) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (20) y: (-140)\nchange y by (-20)\nchange x by (-70)\nchange y by (20)\nchange y by (-40)\nchange x by (70)\nchange y by (20)\npen up\ngo to x: (180) y: (-130)\n\ndefine render lava 2\npen up\ngo to x: (130) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (130) y: (-140)\nchange y by (-20)\nchange x by (-70)\nchange y by (20)\nchange y by (-40)\nchange x by (70)\nchange y by (20)\nchange y by (20)\nchange x by (-70)\ngo to x: (130) y: (-140)\npen up\n\ndefine barrier\npen up\ngo to x: (150) y: (-140)\nset pen size to (10)\nset pen color to (#0e9a6c)\npen down\npen down\nchange y by (150)\nchange x by (10)\nchange y by (-150)\npen up\n\ndefine barrier2\npen up\ngo to x: (0) y: (-140)\nset pen size to (10)\nset pen color to (#0e9a6c)\npen down\npen down\nchange y by (150)\nchange x by (10)\nchange y by (-150)\npen up\ngo to x: (0) y: (0)\nset pen size to (10)\nset pen color to (#0e9a6c)\npen down\npen down\nchange y by (10)\nchange x by (150)\nchange y by (-10)\nchange x by (-150)\npen up\n\ndefine lock1\npen up\ngo to x: (150) y: (0)\nset pen size to (10)\nset pen color to (#ba7413)\npen down\npen down\nchange y by (10)\nchange x by (150)\nchange y by (-10)\npen up\n\ndefine flag 4\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (30) y: (-100)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine render flag 3\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (180) y: (150)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\nwhen I receive [3 v]\nset [key v] to [yes]\n\ndefine key 1\npen up\npen up\nset pen color to (#e1a91a)\nset pen size to (10)\npen up\ngo to x: (-30) y: (-100)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\nchange y by (-5)\nchange x by (20)\n\ndefine render lava 4\npen up\ngo to x: (-150) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (-150) y: (-140)\nchange y by (-20)\nchange x by (-70)\nchange y by (20)\nchange y by (-40)\nchange x by (70)\nchange y by (20)\nchange y by (20)\nchange x by (-70)\npen up\ngo to x: (-150) y: (-140)\n\ndefine spike 2\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-100) y: (-130)\npen down\nchange x by (-20)\ngo to x: (-110) y: (-120)\ngo to x: (-100) y: (-130)\n\ndefine level2\npen up\nset pen color to (#e1a91a)\ngo to x: (-240) y: (-180)\npen down\npen down\nset pen size to (100)\ngo to x: (-100) y: (-180)\npen up\n\nchange x by (-20)\ngo to x: (-90) y: (-120)\ngo to x: (-80) y: (-130)\n\ndefine spike 3\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-80) y: (-130)\npen down\nchange x by (-20)\ngo to x: (-90) y: (-120)\ngo to x: (-80) y: (-130)\n\ndefine holeb\npen up\ngo to x: (0) y: (-100)\nset pen color to (#0e9a6c)\nset pen size to (20)\nstamp\npen down\npen up\n\ndefine level 2\npen up\nset pen size to (10)\nset pen color to (#0e9a6c)\ngo to x: (-240) y: (80)\npen down\ngo to x: (240) y: (80)\npen up\n\ndefine portal\npen up\nset pen size to (10)\nset pen color to (#bb42c3)\ngo to x: (180) y: (-20)\npen down\nchange x by (25)\nchange pen shade by (10)\nchange y by (-30)\nchange pen shade by (10)\nchange x by (-25)\nchange pen shade by (10)\nchange y by (30)\n\ndefine portal 2 <>\npen up\nset pen size to (10)\nset pen color to (#dddede)\ngo to x: (180) y: (130)\npen down\nchange x by (25)\nchange pen shade by (10)\nchange y by (-30)\nchange pen shade by (10)\nchange x by (-25)\nchange pen shade by (10)\nchange y by (30)\n\ndefine flag 6\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (-180) y: (130)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine spikes\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-120) y: (-130)\npen down\nchange x by (-20)\ngo to x: (-130) y: (-120)\ngo to x: (-120) y: (-130)\n\ndefine spike 4\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-120) y: (80)\npen down\nchange x by (-20)\ngo to x: (-130) y: (90)\ngo to x: (-120) y: (80)\n\ndefine spike 5\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-140) y: (80)\npen down\nchange x by (-20)\ngo to x: (-150) y: (90)\ngo to x: (-140) y: (80)\n\ndefine spike 6\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-60) y: (80)\npen down\nchange x by (-20)\ngo to x: (-70) y: (90)\ngo to x: (-60) y: (80)\n\ndefine line aside 2\npen up\ngo to x: (0) y: (180)\npen down\nchange y by (-60)\n\ndefine None\npen up\nset pen size to (200)\nset pen color to (#0e9a6c)\ngo to x: (-240) y: (80)\npen down\ngo to x: (240) y: (80)\npen up\n\ndefine flag 5\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (80) y: (-140)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine b\npen up\nset pen color to (#99b2ff)\nset pen size to (50)\ngo to x: (0) y: (130)\npen down\ngo to x: (0) y: (-150)\nchange x by (100)\n\ndefine flag\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (0) y: (150)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine flag 7\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (-180) y: (150)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine hole 5\npen up\nset pen color to (#0e9a6c)\nset pen size to (20)\ngo to x: (180) y: (-100)\npen down\n\ndefine hole 4\npen up\nset pen color to (#99b2ff)\nset pen size to (50)\ngo to x: (0) y: (0)\npen down\ngo to x: (0) y: (180)\n\ndefine hole 7\npen up\nset pen color to (#99b2ff)\nset pen size to (50)\ngo to x: (180) y: (0)\npen down\ngo to x: (180) y: (180)\n\ndefine key 2\npen up\npen up\nset pen color to (#e1a91a)\nset pen size to (10)\npen up\ngo to x: (180) y: (180)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\nchange y by (-5)\nchange x by (20)\n\ndefine lock 2\npen up\ngo to x: (-20) y: (0)\nset pen size to (10)\nset pen color to (#ba7413)\npen down\npen down\nchange y by (10)\nchange x by (40)\nchange y by (-10)\npen up\n\ndefine hole 8\npen up\nset pen color to (#0e9a6c)\nset pen size to (20)\ngo to x: (90) y: (-100)\npen down\n\ndefine spike 10\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-60) y: (-20)\npen down\nchange x by (-20)\ngo to x: (-70) y: (-30)\ngo to x: (-60) y: (-20)\n\ndefine spike 11\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-40) y: (-20)\npen down\nchange x by (-20)\ngo to x: (-50) y: (-30)\ngo to x: (-40) y: (-20)\n\ndefine line of bounce back\npen up\nset pen size to (10)\nset pen color to (#353444)\ngo to x: (-20) y: (yv)\npen down\nchange x by (30)\n\ndefine spike 12\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (0) y: (-20)\npen down\nchange x by (-20)\ngo to x: (-10) y: (-30)\ngo to x: (0) y: (-20)\n\ndefine spike 16\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (80) y: (-20)\npen down\nchange x by (-20)\ngo to x: (70) y: (-30)\ngo to x: (80) y: (-20)\n\nwhen flag clicked\nset [yv v] to [-130]\nforever\n repeat (45)\n change [yv v] by (5)\n end\n repeat (45)\n change [yv v] by (-5)\n end\n wait (1) seconds\nend\n\ndefine holec\npen up\nset pen color to (#99b2ff)\nset pen size to (50)\ngo to x: (0) y: (0)\npen down\ngo to x: (0) y: (120)\nchange x by (160)\nchange y by (-100)\nchange x by (-100)\npen up\n\ndefine flag\n\ndefine flag 12\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (50) y: (20)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine render lava 7\npen up\ngo to x: (-50) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (20) y: (-140)\nchange y by (-20)\nchange x by (-70)\nchange y by (20)\nchange y by (-40)\nchange x by (70)\nchange y by (20)\npen up\ngo to x: (180) y: (-130)\n\ndefine line aside 3\nset pen color to (#e81818)\ngo to x: (180) y: (140)\npen down\nchange y by (-120)\npen up\n\ndefine spike 17\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (120) y: (-20)\npen down\nchange x by (-20)\ngo to x: (110) y: (-30)\ngo to x: (120) y: (-20)\n\ndefine border\npen up\nset pen color to (#0e9a6c)\nset pen size to (20)\ngo to x: (110) y: (-20)\npen down\nchange x by (500)\n\ndefine spike 18\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (100) y: (-28)\npen down\nchange y by (20)\ngo to x: (80) y: (-8)\ngo to x: (100) y: (-28)\n\ndefine flag13\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (180) y: (10)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine line of bounce back 2\npen up\nset pen size to (10)\nset pen color to (#353444)\ngo to x: (-20) y: (zv)\npen down\nchange x by (30)\n\nwhen flag clicked\nset [zv v] to [-130]\nforever\n repeat (15)\n change [zv v] by (5)\n end\n repeat (15)\n change [zv v] by (-5)\n end\n wait (1) seconds\nend\n\ndefine flag\n\ndefine render lava 4\n\ndefine splints\npen up\nset pen color to (#e81818)\nset pen size to (5)\ngo to x: (-100) y: (-130)\npen down\nchange x by (-20)\ngo to x: (-110) y: (-120)\ngo to x: (-110) y: (-120)\ngo to x: (-100) y: (-130)\npen up\n\ndefine portal 3\npen up\nset pen size to (10)\nset pen color to (#ee7d16)\ngo to x: (180) y: (-100)\npen down\nchange x by (25)\nchange pen shade by (10)\nchange y by (-30)\nchange pen shade by (10)\nchange x by (-25)\nchange pen shade by (10)\nchange y by (30)\n\ndefine last flag\npen up\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to x: (180) y: (150)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\n\ndefine hole 11\npen up\nset pen color to (#99b2ff)\nset pen size to (50)\ngo to x: (180) y: (0)\npen down\ngo to x: (180) y: (180)\n\ndefine elevator red\npen up\nset pen size to (10)\nset pen color to (#353444)\nset pen color to (#e81818)\ngo to x: (165) y: (yv)\npen down\nchange x by (30)\n\ndefine fun bounce of line\npen up\ngo to x: (300) y: (-140)\nset pen size to (20)\nset pen color to (#ee7d16)\npen down\ngo to x: (300) y: (-140)\nchange y by (-20)\nchange x by (0)\nchange y by (20)\nchange y by (-40)\nchange x by (-350)\nchange y by (20)\nchange y by (20)\nchange x by (350)\npen up\ngo to x: (-50) y: (-140)\npen down\ngo to x: (300) y: (-160)\nchange x by (-350)\npen up\n\ndefine render lava 3\n\nwhen flag clicked\nset [x position of enemy v] to [-130]\nforever\n repeat (45)\n change [x position of enemy v] by (5)\n end\n repeat (45)\n change [x position of enemy v] by (-5)\n end\nend\n\nerase all\n\nenemy\n\npen up\n\ndefine enemy\n\nrender lava 3\n\ndefine line aside\npen up\nset pen size to (20)\nset pen color to (#e81818)\ngo to x: (30) y: (140)\npen down\ngo to x: (30) y: (-120)\n\ndefine lava 3\npen up\ngo to x: (-100) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (-100) y: (-140)\nchange y by (-20)\nchange x by (-250)\nchange y by (20)\nchange y by (-40)\nchange x by (250)\nchange y by (20)\nchange y by (20)\nchange x by (-250)\npen up\ngo to x: (-100) y: (-140)\n\ndefine lava 5\npen up\ngo to x: (150) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (150) y: (-140)\nchange y by (-20)\nchange x by (0)\nchange y by (20)\nchange y by (-40)\nchange x by (-350)\nchange y by (20)\nchange y by (20)\nchange x by (350)\ngo to x: (150) y: (-160)\nchange x by (-350)\npen up\n\nrender lava 2\n\ndefine lava\npen up\ngo to x: (300) y: (-140)\nset pen size to (20)\nset pen color to (#e81818)\npen down\ngo to x: (300) y: (-140)\nchange y by (-20)\nchange x by (0)\nchange y by (20)\nchange y by (-40)\nchange x by (-350)\nchange y by (20)\nchange y by (20)\nchange x by (350)\npen up\ngo to x: (-50) y: (-140)\npen down\ngo to x: (300) y: (-160)\nchange x by (-350)\npen up\n\nlava\n\nlava 5\n\nlava 5\n\nlava 5\n\ndefine render line\npen up\nset pen size to (10)\nset pen color to (#0e9a6c)\npen down\ngo to x: (180) y: (-1300)\nchange y by (130)\npen up\n\ndefine sideline\npen up\ngo to x: (240) y: (0)\nset pen color to (#ff0000)\npen down\nchange x by (-60)\npen up\n\ndefine key 3\npen up\npen up\nset pen color to (#e1a91a)\nset pen size to (10)\npen up\ngo to x: (220) y: (-100)\npen down\nchange x by (10)\nchange y by (-10)\nchange x by (-10)\nchange y by (10)\nchange y by (-5)\nchange x by (20)\n\ndefine moving lines\npen up\nset pen color to (#ff0000)\nset y to (-130)\npen down\nchange x by (100)\nforever\n set x to (xv)\nend\n\nwait (1) seconds\n\nwhen flag clicked\nset [xv v] to [-130]\nforever\n repeat (45)\n change [xv v] by (5)\n end\n repeat (45)\n change [xv v] by (-5)\n end\nend\n\ngo to x: (xv) y: (-130)\n\nkey 1\n\nkey 2\n\nkey 3\n\n@Sprite3\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nshow variable [level1 v]\nforever\n go to x: (0) y: (0)\nend\n\n
Press the green flag and enjoy\n100% by me\n10 levels\n\n[Obstacles]\n\nArrow keys - to move\nAvoid lava - red\nElevator - grey\nLand - green\nLock - brown (get the key to open it)\nKey - yellow (get it to open locks)\n\n[Finish]\nGet to the black square as fast as you can\n\n\n\n\n\n\n\n
°A little Mystery° A Platformer
@Stage\n\nwhen flag clicked\nset [pixelate v] effect to (200)\n\n@Main\n\nwhen flag clicked\nerase all\nset [game_loop v] to [1]\nset [game_gravity v] to [-1]\nset [game_level v] to [1]\nset [game_levelcount v] to [24]\nbroadcast (ToFront_Ground v) and wait\nbroadcast (ToFront_Traps v) and wait\nbroadcast (ToFront_Player v) and wait\nbroadcast (ToFront_Foreground1 v) and wait\nbroadcast (ToFront_Foreground2 v) and wait\nbroadcast (ToFront_Foreground3 v) and wait\nbroadcast (ToFront_Monsters v) and wait\nbroadcast (ToFront_Text v) and wait\nbroadcast (ToFront_Sign v) and wait\nbroadcast (ToFront_Spider v) and wait\nbroadcast (GameStart v)\n\n@Player\n\ndefine Reset\nset [player_yvel v] to [0]\nset [player_xvel v] to [0]\ngo to x: (-200) y: (60)\npoint in direction (90)\n\ndefine None\nchange y by (yvel)\nif <touching (ground v)?> then\n repeat until <not <touching (ground v)?>>\n if <(yvel) > [0]> then\n change y by (-1)\n else\n change y by (1)\n end\n end\n if <(yvel) > [0]> then\n set [player_yvel v] to ((yvel) * (-0.5))\n set [player_falling v] to [1]\n else\n set [player_yvel v] to [0]\n set [player_falling v] to [0]\n if <(yvel) < [-7]> then\n start sound [land v]\n end\n end\nelse\n set [player_falling v] to [1]\nend\n\ndefine None\nchange x by (xvel)\nset [player_steps v] to [0]\nrepeat until <<(player_steps) = [12]> or <not <touching (ground v)?>>>\n change y by (1)\n change [player_steps v] by (1)\nend\nif <(player_steps) = [12]> then\n change y by (-12)\nend\nif <touching (ground v)?> then\n change x by ((xvel) * (-1))\n if <key (up arrow v) pressed?> then\n start sound [Jump v]\n if <(xvel) > [0]> then\n set [player_xvel v] to [-5]\n else\n set [player_xvel v] to [5]\n end\n set [player_yvel v] to [11]\n else\n set [player_xvel v] to ((xvel) * (-0.75))\n end\nend\n\nwhen I receive [tofront_player v]\ngo to [front v] layer\n\nwhen I receive [gamestart v]\nset [statistics_deaths v] to [0]\nset [statistics_time v] to [0]\nset [statistics_pumpkinssmashed v] to [0]\nset [statistics_spidersscared v] to [0]\nset size to (100) %\nshow\nReset\nbroadcast (DrawLevel v)\nrepeat until <(game_loop) = [0]>\n Physics\nend\n\ndefine Physics\npoint in direction (90)\nchange y by ((player_rotationYAddition) * (-1))\nchange [player_yvel v] by (game_gravity)\nMoveY (player_yVel)\nif <<key (up arrow v) pressed?> and <(player_falling) = [0]>> then\n set [player_yvel v] to [13]\n start sound [Jump v]\nend\nset [player_isxinput v] to [0]\nif <key (right arrow v) pressed?> then\n change [player_xvel v] by (0.625)\n set [player_isxinput v] to [1]\nend\nif <key (left arrow v) pressed?> then\n change [player_xvel v] by (-0.625)\n set [player_isxinput v] to [1]\nend\nif <(player_falling) = [0]> then\n set [player_xvel v] to ((player_xVel) * (0.875))\nelse\n set [player_xvel v] to ((player_xVel) * (0.9))\nend\nMoveX (player_xVel)\nif <(x position) > [235]> then\n change [game_level v] by (1)\n start sound [Stab v]\n if <(game_level) > (game_levelCount)> then\n set [game_loop v] to [0]\n set [game_level v] to ((game_levelCount) + (1))\n set [statistics_time v] to (round (timer))\n set [statistics_pumpkinssmashed v] to (pumpkinCounter_count)\n broadcast (DrawLevel v)\n broadcast (GameEnd v)\n else\n Reset\n broadcast (DrawLevel v)\n end\nend\nBoxRotaion\nif <touching (traps v)?> then\n Reset\n start sound [Scream Short v]\n change [statistics_deaths v] by (1)\nend\nif <(y position) < [-175]> then\n Reset\n start sound [Scream Short v]\n change [statistics_deaths v] by (1)\nend\n\ndefine BoxRotaion\npoint in direction (player_storedDir)\nturn right ((player_xVel) * (6)) degrees\nif <(player_falling) = [0]> then\n set [player_rotationyaddition v] to (((45) - ([abs v] of (((direction) mod (90)) - (45)) )) / (10))\nelse\n set [player_rotationyaddition v] to [0]\nend\nset [player_storeddir v] to (direction)\nchange y by (player_rotationYAddition)\nif <<(player_isXInput) = [0]> and <(player_falling) = [0]>> then\n if <not <(((round ((direction) / (5))) * (5)) mod (90)) = [0]>> then\n if <(((direction) mod (90)) - (45)) > [0]> then\n change [player_xvel v] by (0.15)\n end\n if <(((direction) mod (90)) - (45)) < [0]> then\n change [player_xvel v] by (-0.15)\n end\n end\nend\n\n@Ground\n\nwhen I receive [tofront_ground v]\ngo to [front v] layer\n\nwhen I receive [drawlevel v]\nswitch costume to (game_level)\n\nwhen flag clicked\ngo to x: (0) y: (0)\n\n@Traps\n\nwhen I receive [drawlevel v]\nswitch costume to (game_level)\n\nwhen I receive [tofront_traps v]\ngo to [front v] layer\n\nwhen flag clicked\ngo to x: (0) y: (0)\n\n@Foreground\n\nwhen I receive [tofront_foreground1 v]\ngo to [front v] layer\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\n\n@Foreground 2\n\nwhen I receive [tofront_foreground2 v]\ngo to [front v] layer\n\nwhen flag clicked\ngo to x: (0) y: (0)\n\n@Foreground 3\n\nwhen flag clicked\ngo to x: (0) y: (0)\n\nwhen I receive [tofront_foreground3 v]\ngo to [front v] layer\n\n@Foreground Monster\n\ndefine Close Eyes\nswitch costume to (open v)\nwait (0.05) seconds\nswitch costume to (half open v)\nwait (0.05) seconds\nswitch costume to (nearly closed v)\nwait (0.05) seconds\nswitch costume to (closed v)\n\ndefine Open Eyes\nswitch costume to (closed v)\nwait (0.05) seconds\nswitch costume to (nearly closed v)\nwait (0.05) seconds\nswitch costume to (half open v)\nwait (0.05) seconds\nswitch costume to (open v)\n\ndefine Blink\nswitch costume to (open v)\nwait (0.01) seconds\nswitch costume to (half open v)\nwait (0.01) seconds\nswitch costume to (closed v)\nwait (pick random (0.01) to (0.2)) seconds\nswitch costume to (closed v)\nwait (0.01) seconds\nswitch costume to (half open v)\nwait (0.01) seconds\nswitch costume to (open v)\n\nwhen flag clicked\nshow\ngo to [front v] layer\ngo to x: (204) y: (-171)\nswitch costume to (closed v)\nforever\n Open Eyes\n repeat (pick random (3) to (5))\n wait (pick random (0.1) to (1)) seconds\n Blink\n wait (pick random (0.25) to (1)) seconds\n end\n Close Eyes\n wait (pick random (3) to (13)) seconds\nend\n\nwhen I receive [tofront_monsters v]\ngo to [front v] layer\n\n@Foreground Monster2\n\ndefine Close Eyes\nswitch costume to (open v)\nwait (0.05) seconds\nswitch costume to (half open v)\nwait (0.05) seconds\nswitch costume to (nearly closed v)\nwait (0.05) seconds\nswitch costume to (closed v)\n\ndefine Open Eyes\nswitch costume to (closed v)\nwait (0.05) seconds\nswitch costume to (nearly closed v)\nwait (0.05) seconds\nswitch costume to (half open v)\nwait (0.05) seconds\nswitch costume to (open v)\n\ndefine Blink\nswitch costume to (open v)\nwait (0.01) seconds\nswitch costume to (half open v)\nwait (0.01) seconds\nswitch costume to (closed v)\nwait (pick random (0.01) to (0.2)) seconds\nswitch costume to (closed v)\nwait (0.01) seconds\nswitch costume to (half open v)\nwait (0.01) seconds\nswitch costume to (open v)\n\nwhen flag clicked\nset size to (50) %\ngo to [front v] layer\nswitch costume to (closed v)\nshow\ngo to x: (-220) y: (166)\nwait (pick random (3) to (8)) seconds\nforever\n Open Eyes\n repeat (pick random (3) to (5))\n wait (pick random (0.1) to (1)) seconds\n Blink\n wait (pick random (0.25) to (1)) seconds\n end\n Close Eyes\n wait (pick random (3) to (13)) seconds\nend\n\nwhen I receive [tofront_monsters v]\ngo to [front v] layer\n\n@Instructions\n\ndefine Fade Out\nset [ghost v] effect to (0)\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\ndefine Fade In\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen I receive [tofront_text v]\ngo to [front v] layer\n\nwhen flag clicked\ngo to x: (-12) y: (44)\nset size to (75) %\nhide\nwait until <(game_level) = [1]>\nswitch costume to (intro1 v)\nFade In\nwait until <(game_level) = [2]>\nFade Out\nswitch costume to (intro2 v)\nFade In\nwait until <(game_level) = [3]>\nFade Out\nswitch costume to (intro3 v)\nFade In\nwait until <(game_level) = [4]>\nFade Out\n\n@Sign\n\nwhen I receive [tofront_sign v]\ngo to [front v] layer\n\nwhen I receive [gamestart v]\nstart sound [Gasp v]\nset y to (200)\nshow\nset [velocity v] to [0]\nrepeat (17)\n change [velocity v] by (-1)\n change y by (velocity)\nend\nset [velocity v] to ((velocity) * (-0.25))\nrepeat (8)\n change [velocity v] by (-1)\n change y by (velocity)\nend\nwait (3) seconds\nglide (5) secs to x: (54) y: (158)\nhide\n\nwhen flag clicked\nhide\ngo to x: (54) y: (17)\n\n@Spider\n\nwhen flag clicked\nforever\n switch costume to (normal v)\n set x to (pick random (-240) to (240))\n show\n set y to (175)\n set [velocity v] to [-10]\n set [angry v] to [0]\n repeat until <(velocity) > [-1]>\n set [velocity v] to ((velocity) * (pick random (0.9) to (0.95)))\n change y by (velocity)\n end\n set [endtime v] to ((timer) + (pick random (3) to (5)))\n repeat until <<(timer) > (endTime)> or <(angry) = [1]>>\n if <touching (player v)?> then\n change [statistics_spidersscared v] by (1)\n set [angry v] to [1]\n switch costume to (angry v)\n end\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n switch costume to (angry v)\n wait (0.1) seconds\n switch costume to (normal v)\n end\n end\n set [velocity v] to [0]\n repeat until <(velocity) > [11]>\n change [velocity v] by (0.5)\n change y by (velocity)\n end\n hide\n wait (pick random (10) to (25)) seconds\nend\n\nwhen I receive [tofront_spider v]\ngo to [front v] layer\n\nwhen I receive [gameend v]\nrepeat (50)\n create clone of (_myself_ v)\n wait (pick random (0.05) to (0.1)) seconds\nend\n\nwhen I start as a clone\ngo to x: (0) y: (180)\nwait (pick random (0.1) to (3)) seconds\nswitch costume to (normal v)\nset x to (pick random (-240) to (240))\nshow\nset y to (175)\nset [velocity v] to [-10]\nset [angry v] to [0]\nrepeat until <(velocity) > [-1]>\n set [velocity v] to ((velocity) * (pick random (0.9) to (0.95)))\n change y by (velocity)\nend\nset [endtime v] to ((timer) + (pick random (3) to (5)))\nrepeat until <<(timer) > (endTime)> or <(angry) = [1]>>\n if <touching (player v)?> then\n change [statistics_spidersscared v] by (1)\n set [angry v] to [1]\n switch costume to (angry v)\n end\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n switch costume to (angry v)\n wait (0.1) seconds\n switch costume to (normal v)\n end\nend\nset [velocity v] to [0]\nrepeat until <(velocity) > [11]>\n change [velocity v] by (0.5)\n change y by (velocity)\nend\nhide\ndelete this clone\n\n@LevelItems\n\nwhen flag clicked\nhide\n\n@PumpkinSpawner\n\nwhen I receive [drawlevel v]\nif <(cloneType) = [MAIN]> then\n if <(game_level) = [1]> then\n New Pumpkin at x: (-93) y: (8) dir: (90)\n end\n if <(game_level) = [4]> then\n New Pumpkin at x: (-98) y: (-72) dir: (90)\n New Pumpkin at x: (-81) y: (-75) dir: (110)\n end\n if <(game_level) = [5]> then\n New Pumpkin at x: (-58) y: (-33) dir: (82)\n New Pumpkin at x: (113) y: (58) dir: (93)\n end\n if <(game_level) = [6]> then\n New Pumpkin at x: (-22) y: (-160) dir: (93)\n end\n if <(game_level) = [9]> then\n New Pumpkin at x: (-65) y: (-37) dir: (93)\n New Pumpkin at x: (-43) y: (-37) dir: (76)\n New Pumpkin at x: (-8) y: (-35) dir: (76)\n New Pumpkin at x: (16) y: (-32) dir: (93)\n New Pumpkin at x: (103) y: (5) dir: (93)\n New Pumpkin at x: (121) y: (5) dir: (90)\n New Pumpkin at x: (189) y: (20) dir: (76)\n end\n if <(game_level) = [10]> then\n New Pumpkin at x: (-6) y: (-174) dir: (76)\n end\n if <(game_level) = [11]> then\n New Pumpkin at x: (-97) y: (12) dir: (90)\n New Pumpkin at x: (12) y: (51) dir: (90)\n New Pumpkin at x: (152) y: (66) dir: (76)\n end\n if <(game_level) = [12]> then\n New Pumpkin at x: (-154) y: (-162) dir: (81)\n end\n if <(game_level) = [13]> then\n New Pumpkin at x: (-112) y: (85) dir: (65)\n end\n if <(game_level) = [14]> then\n New Pumpkin at x: (-92) y: (145) dir: (65)\n end\n if <(game_level) = [16]> then\n New Pumpkin at x: (-147) y: (-172) dir: (65)\n end\n if <(game_level) = [19]> then\n New Pumpkin at x: (-30) y: (30) dir: (94)\n New Pumpkin at x: (120) y: (-83) dir: (84)\n end\n if <(game_level) = [21]> then\n New Pumpkin at x: (8) y: (-60) dir: (64)\n New Pumpkin at x: (-159) y: (83) dir: (98)\n end\n if <(game_level) = [23]> then\n New Pumpkin at x: (191) y: (113) dir: (97)\n end\n if <(game_level) = [24]> then\n New Pumpkin at x: (-21) y: (95) dir: (90)\n New Pumpkin at x: (-145) y: (70) dir: (75)\n New Pumpkin at x: (160) y: (47) dir: (94)\n end\nelse\n delete this clone\nend\n\nwhen I start as a clone\nswitch costume to (normal v)\nshow\nwait until <touching (player v)?>\nstart sound [SmashPumpkin v]\nnext costume\nwait (0.05) seconds\nnext costume\nwait (0.05) seconds\nnext costume\nchange [pumpkincounter_count v] by (1)\nset [pumpkincounter_posx v] to ((x position) + (5))\nset [pumpkincounter_posy v] to ((y position) + (10))\nbroadcast (PumpkinSmash v)\n\ndefine None\npoint in direction (dir)\ngo to x: (x) y: (y)\nset [clonetype v] to [CLONE]\ncreate clone of (_myself_ v)\nset [clonetype v] to [MAIN]\n\nwhen flag clicked\nhide\nset [clonetype v] to [MAIN]\n\nhide\n\nshow\n\n@EndScreen\n\nwhen flag clicked\nhide\ngo to x: (0) y: (20)\n\nwhen I receive [gameend v]\nshow\n\n@ThunderSound\n\nwhen flag clicked\nforever\n wait (pick random (8) to (23)) seconds\n set volume to (pick random (10) to (60)) %\n if <(pick random (1) to (2)) = [2]> then\n start sound [Lightning v]\n else\n start sound [Thunder v]\n end\nend\n\n@PumpkinCounter3\n\nwhen flag clicked\nset [pumpkincounter_posx v] to [20]\nset [pumpkincounter_posy v] to [40]\nset [pumpkincounter_count v] to [0]\nhide\n\nwhen I receive [pumpkinsmash v]\ngo to x: (pumpkinCounter_posX) y: (pumpkinCounter_posY)\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [gamestart v]\ngo to x: (pumpkinCounter_posX) y: (pumpkinCounter_posY)\n\n@PumpkinCounter2\n\nwhen I receive [gamestart v]\ngo to x: ((pumpkinCounter_posX) - (30)) y: (pumpkinCounter_posY)\n\nwhen I receive [pumpkinsmash v]\ngo to x: ((pumpkinCounter_posX) - (30)) y: (pumpkinCounter_posY)\nif <(pumpkinCounter_count) > [9]> then\n switch costume to (letter (1) of (pumpkinCounter_count))\nelse\n switch costume to (0 v)\nend\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nswitch costume to (1 v)\nhide\n\n@PumpkinCounter4\n\nwhen I receive [gamestart v]\ngo to x: ((pumpkinCounter_posX) - (15)) y: (pumpkinCounter_posY)\n\nwhen I receive [pumpkinsmash v]\ngo to x: ((pumpkinCounter_posX) - (15)) y: (pumpkinCounter_posY)\nif <(pumpkinCounter_count) > [9]> then\n switch costume to (letter (2) of (pumpkinCounter_count))\nelse\n switch costume to (letter (1) of (pumpkinCounter_count))\nend\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nhide\nswitch costume to (1 v)\n\n@EndCharacterPrinter\n\nwhen flag clicked\nhide\nswitch costume to (0 v)\n\nwhen I receive [gameend v]\ngo to x: (-33) y: (77)\nPrint (statistics_time)\ngo to x: (-42) y: (52)\nPrint (statistics_deaths)\ngo to x: (60) y: (29)\nPrint (join (statistics_pumpkinsSmashed) [/29])\ngo to x: (11) y: (9)\nPrint (statistics_spidersScared)\n\ndefine Print []\nset [index v] to [0]\nrepeat (length of (text))\n change [index v] by (1)\n set [char v] to (letter (index) of (text))\n switch costume to (char)\n stamp\n change x by (12)\nend\n\n@Thumbnail\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nshow\ngo to [front v] layer\n\n
2 Player Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (level 1 v)\n\nwhen I receive [next level v]\nnext backdrop\n\n@Player 1\n\nwhen [space v] key pressed\nask [Do you want to switch player 1's color? Yes/No] and wait\nif <(answer) = [yes]> then\n ask [What color? Red/Orange/Yellow/Green/Blue/Purple] and wait\n if <(answer) = [Red]> then\n switch costume to (red v)\n end\n if <(answer) = [Orange]> then\n switch costume to (orange v)\n end\n if <(answer) = [Yellow]> then\n switch costume to (yellow v)\n end\n if <(answer) = [Green]> then\n switch costume to (green v)\n end\n if <(answer) = [Blue]> then\n switch costume to (blue v)\n end\n if <(answer) = [Purple]> then\n switch costume to (purple v)\n end\nend\n\nwhen flag clicked\nset size to (100) %\nshow\nswitch costume to (blue v)\ngo to x: (-190) y: (-90)\nset [y v] to [0]\nset [x v] to [0]\nset rotation style [left-right v]\nforever\n change [y v] by (-0.5)\n if <key (right arrow v) pressed?> then\n change [x v] by (0.7)\n point in direction (90)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-0.7)\n point in direction (-90)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((x) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <key (up arrow v) pressed?> then\n if <(x) > [0]> then\n set [x v] to [-8]\n else\n set [x v] to [8]\n end\n set [y v] to [10]\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000000)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <key (up arrow v) pressed?> then\n if <not <(costume [number v]) = [7]>> then\n set [y v] to [10]\n else\n set [y v] to [15]\n end\n end\n end\n change y by (1)\n if <touching (goal v)?> then\n broadcast (Next level v)\n end\n if <touching color (#ff9400)?> then\n set [y v] to [20]\n end\n if <touching color (#ffff00)?> then\n change size by (-1)\n end\n if <touching color (#00ff55)?> then\n change size by (1)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n go to x: (-190) y: (-90)\n end\nend\n\nwhen I receive [next level v]\ngo to x: (-190) y: (-90)\nset size to (100) %\n\nwhen [r v] key pressed\ngo to x: (-190) y: (-90)\n\n@Player 2\n\nwhen [q v] key pressed\nask [Do you want to switch player 2's color? Yes/No] and wait\nif <(answer) = [yes]> then\n ask [What color? Red/Orange/Yellow/Green/Blue/Purple] and wait\n if <(answer) = [Red]> then\n switch costume to (red v)\n end\n if <(answer) = [Orange]> then\n switch costume to (orange v)\n end\n if <(answer) = [Yellow]> then\n switch costume to (yellow v)\n end\n if <(answer) = [Green]> then\n switch costume to (green v)\n end\n if <(answer) = [Blue]> then\n switch costume to (blue v)\n end\n if <(answer) = [Purple]> then\n switch costume to (purple v)\n end\nend\n\nwhen flag clicked\nset size to (100) %\nshow\nswitch costume to (green v)\ngo to x: (-220) y: (-90)\nset [y v] to [0]\nset [x v] to [0]\nset rotation style [left-right v]\nforever\n change [y v] by (-0.5)\n if <key (d v) pressed?> then\n change [x v] by (0.7)\n point in direction (90)\n end\n if <key (a v) pressed?> then\n change [x v] by (-0.7)\n point in direction (-90)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((x) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <key (w v) pressed?> then\n if <(x) > [0]> then\n set [x v] to [-8]\n else\n set [x v] to [8]\n end\n set [y v] to [10]\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000000)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <key (w v) pressed?> then\n set [y v] to [10]\n end\n end\n change y by (1)\n if <touching (goal v)?> then\n broadcast (next level v)\n end\n if <touching color (#ff9400)?> then\n set [y v] to [20]\n end\n if <touching color (#ffff00)?> then\n change size by (-1)\n end\n if <touching color (#00ff55)?> then\n change size by (1)\n end\nend\n\nwhen I receive [next level v]\ngo to x: (-220) y: (-90)\nset size to (100) %\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n go to x: (-220) y: (-90)\n end\nend\n\nwhen [r v] key pressed\ngo to x: (-220) y: (-90)\n\n@Goal\n\nwhen backdrop switches to [level 1 v]\ngo to x: (215) y: (-140)\n\nwhen backdrop switches to [level 4 v]\ngo to x: (215) y: (-140)\n\nwhen backdrop switches to [level 3 v]\ngo to x: (-215) y: (110)\n\nwhen backdrop switches to [level 2 v]\ngo to x: (215) y: (-140)\n\nwhen flag clicked\nshow\n\nwhen backdrop switches to [level 10 v]\ngo to x: (180) y: (165)\n\nwhen backdrop switches to [level 9 v]\ngo to x: (180) y: (100)\n\nwhen backdrop switches to [level 5 v]\ngo to x: (-50) y: (0)\npoint in direction (180)\n\nwhen backdrop switches to [level 6 v]\npoint in direction (90)\ngo to x: (215) y: (-140)\n\nwhen backdrop switches to [level 7 v]\ngo to x: (215) y: (-140)\n\nwhen backdrop switches to [finish! v]\nhide\n\n@thumbnail\n\nwhen flag clicked\nhide\n\ngo to [front v] layer\nshow\ngo to x: (0) y: (0)\n\n
10 Follower special is out!!
Disney princess platformer 2.0
@Stage\n\nwhen flag clicked\nswitch backdrop to (os-lightning-over-cinderella-castle-disney-world-20150703 v) and wait\nwait (18) seconds\nnext backdrop\n\nwhen flag clicked\nhide variable [deaths v]\n\nwhen backdrop switches to [backdrop1 v]\nshow variable [deaths v]\n\nhide variable [deaths v]\n\nwhen backdrop switches to [backdrop1 v]\nstop all sounds\nplay sound [jasmen v] until done\n\nwhen backdrop switches to [backdrop2 v]\nstop all sounds\nplay sound [cinderella v] until done\n\nwhen backdrop switches to [backdrop3 v]\nstop all sounds\nplay sound [Snow White v] until done\n\nwhen backdrop switches to [backdrop4 v]\nstop all sounds\nplay sound [rapunzal v] until done\n\nwhen backdrop switches to [backdrop5 v]\nstop all sounds\nplay sound [Ariel v] until done\n\nwhen backdrop switches to [backdrop6 v]\nstop all sounds\nplay sound [briar rose v] until done\n\nwhen backdrop switches to [backdrop7 v]\nstop all sounds\nplay sound [belle v] until done\n\nwhen backdrop switches to [backdrop9 v]\nstop all sounds\nplay sound [mulan v] until done\n\nwhen backdrop switches to [os-lightning-over-cinderella-castle-disney-world-20150703 v]\nstop all sounds\nstart sound [villen v]\n\nwhen backdrop switches to [backdrop10 v]\nstop all sounds\nplay sound [frozen1 v] until done\n\nwhen backdrop switches to [end v]\nstop all sounds\nstop all sounds\nstart sound [end v]\n\nwhen backdrop switches to [end v]\nstop all sounds\nplay sound [end v] until done\n\n@Sprite1\n\nwhen flag clicked\nset [hi v] to [0]\nset [yv v] to [0]\nforever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [hi v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [hi v] by (-1)\n end\n set [hi v] to ((hi) * (0.9))\n change x by (hi)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((hi) * (-1))\n change y by (-5)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(hi) > [0]> then\n set [hi v] to [-5]\n else\n set [hi v] to [5]\n end\n set [yv v] to [10]\n else\n set [hi v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#000000)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [15]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop1 v]\nshow\n\nwhen flag clicked\nforever\n if <touching color (#f4b6ff)?> then\n start sound [Magic Spell v]\n go to x: (-199) y: (148)\n next costume\n next backdrop\n end\nend\n\nwhen flag clicked\nforever\n go to [front v] layer\nend\n\nwhen backdrop switches to [end v]\nhide\n\nwhen flag clicked\nswitch costume to (unknown-1 v)\n\nwhen flag clicked\nforever\n if <touching color (#bb0000)?> then\n broadcast (died v)\n end\nend\n\nwhen flag clicked\ngo to x: (-199) y: (148)\n\nwhen I receive [died v]\nstart sound [Suction Cup v]\ngo to x: (-221) y: (-131)\nchange [deaths v] by (1)\n\nwhen flag clicked\nset [deaths v] to [0]\n\nwhen backdrop switches to [os-lightning-over-cinderella-castle-disney-world-20150703 v]\nbroadcast (done v)\n\nwhen flag clicked\nset [time v] to [0]\n\nwhen backdrop switches to [backdrop1 v]\nrepeat until <touching color (#ffb066)?>\n wait (1) seconds\n change [time v] by (1)\nend\n\nwhen backdrop switches to [end v]\nif <(☁ time record) > (time)> then\n set [☁ time record v] to (time)\nend\n\nwhen backdrop switches to [end v]\nhide variable [time v]\nhide variable [☁ time record v]\nhide variable [☁ death record v]\nhide variable [deaths v]\n\nwhen backdrop switches to [backdrop1 v]\nshow variable [time v]\nshow variable [☁ time record v]\nshow variable [☁ death record v]\nshow variable [deaths v]\n\nwhen backdrop switches to [end v]\nhide variable [☁ time record v]\nhide variable [time v]\nhide variable [deaths v]\nhide variable [☁ death record v]\n\nwhen [2 v] key pressed\nhide variable [deaths v]\nhide variable [time v]\nhide variable [☁ time record v]\nhide variable [☁ death record v]\n\nwhen [1 v] key pressed\nshow variable [deaths v]\nshow variable [time v]\nshow variable [☁ time record v]\nshow variable [☁ death record v]\n\nwhen backdrop switches to [end v]\nif <(☁ death record) > (deaths)> then\n set [☁ death record v] to (deaths)\nend\n\nwhen backdrop switches to [backdrop10 v]\nforever\n if <key (e v) pressed?> then\n switch costume to (costume3 v)\n end\nend\n\nwhen backdrop switches to [backdrop10 v]\nforever\n if <key (a v) pressed?> then\n switch costume to (costume2 v)\n end\nend\n\nwhen backdrop switches to [os-lightning-over-cinderella-castle-disney-world-20150703 v]\nhide variable [☁ time record v]\nhide variable [time v]\nhide variable [☁ death record v]\nhide variable [deaths v]\n\nwhen backdrop switches to [end v]\nhide\n\n@beauty-and-the-beast\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop7 v]\nshow\n\nwhen backdrop switches to [backdrop9 v]\nhide\n\n@Sprite2\n\nwhen this sprite clicked\nask [whats the password] and wait\nif <(username) = [50]> then\n if <(answer) = [lntothewoods1]> then\n switch costume to (costume1 v)\n end\nelse\n if <(answer) = [lntothewoods1]> then\nend\n\nwhen [space v] key pressed\nhide\n\nwhen flag clicked\nif <(username) = [peppergirlpa]> then\n show\nelse\n hide\nend\n\nshow\n\nshow\n\n
use the arrow keys to move and jump go to pink you can beat all of them! press the 1 key to show variables and the 2 key to hide them! ten more likes and seven more favorites and I will add a frozen 2 level! in the frozen level press e to be Elsa and a to be Anna. all levels are possible and personally tested by me.
Crazy Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nforever\n play sound (pick random (1) to (3)) until done\nend\n\nwhen I receive [message1 v]\nnext backdrop\n\n@Player\n\nwhen flag clicked\nshow\ngo to x: (-200) y: (-100)\nset [yv v] to [0]\nset [xv v] to [0]\nset [jump v] to [1]\nforever\n if <touching color (#000000)?> then\n change y by ((yV) * (-1))\n set [yv v] to [0]\n set [jump v] to [1]\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((xV) * (-1))\n change x by (-1)\n change y by (-5)\n set [yv v] to [0]\n set [jump v] to [1]\n if <key (up arrow v) pressed?> then\n if <(xV) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n end\n end\n end\n end\n end\n end\n end\n end\n if <touching (_edge_ v)?> then\n change x by ((xV) * (-1))\n change y by ((yV) * (-1))\n end\n if <not <touching color (#000000)?>> then\n change [yv v] by (-1)\n end\n if <<key (up arrow v) pressed?> and <(jump) = [1]>> then\n set [yv v] to [10]\n change [jump v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n end\n set [xv v] to ((xV) * (0.9))\n change y by (yV)\n change x by (xV)\n if <touching color (#ffcccc)?> then\n broadcast (message1 v)\n go to x: (-200) y: (-100)\n set [yv v] to [0]\n set [xv v] to [0]\n end\n if <touching color (#ff0000)?> then\n go to x: (-200) y: (-100)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (ow\] v)\n end\n if <touching color (#ff9400)?> then\n change y by (2)\n set [yv v] to [15]\n end\nend\n\nwhen [r v] key pressed\ngo to x: (-200) y: (-100)\n\nrepeat (10)\n\n@Sprite1\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop6 v]\nshow\ngo to x: (-73) y: (-128)\npoint in direction (-90)\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\n wait (2) seconds\nend\n\nwhen backdrop switches to [backdrop7 v]\nstop [other scripts in sprite v]\nshow\ngo to x: (-128) y: (-141)\npoint in direction (-90)\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite3\n\nwhen I receive [laser v]\nshow\ncreate clone of (_myself_ v)\nhide\n\nwhen I start as a clone\ngo to (sprite1 v)\nrepeat until <touching (_edge_ v)?>\n change y by (10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\n@Sprite4\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop7 v]\nshow\ngo to x: (-80) y: (-141)\npoint in direction (-90)\nwait (0.2) seconds\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser1 v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite5\n\nwhen I receive [laser1 v]\nshow\ncreate clone of (_myself_ v)\nhide\n\nwhen I start as a clone\ngo to (sprite4 v)\nrepeat until <touching (_edge_ v)?>\n change y by (10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\n@Sprite6\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop7 v]\nshow\ngo to x: (-32) y: (-141)\npoint in direction (-90)\nwait (0.4) seconds\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser2 v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite7\n\nwhen I receive [laser2 v]\nshow\ncreate clone of (_myself_ v)\nhide\n\nwhen I start as a clone\ngo to (sprite6 v)\nrepeat until <touching (_edge_ v)?>\n change y by (10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\n@Sprite8\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop7 v]\nshow\ngo to x: (16) y: (-141)\npoint in direction (-90)\nwait (0.6) seconds\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser3 v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite9\n\nwhen I start as a clone\ngo to (sprite8 v)\nrepeat until <touching (_edge_ v)?>\n change y by (10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [laser3 v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite10\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop7 v]\nshow\ngo to x: (64) y: (-141)\npoint in direction (-90)\nwait (0.8) seconds\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laser4 v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite11\n\nwhen I receive [laser4 v]\nshow\ncreate clone of (_myself_ v)\nhide\n\nwhen I start as a clone\ngo to (sprite10 v)\nrepeat until <touching (_edge_ v)?>\n change y by (10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\n@Sprite12\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop8 v]\nshow\ngo to x: (75) y: (14)\npoint in direction (180)\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop8\(1\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop9 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite13\n\nwhen I start as a clone\ngo to (sprite12 v)\nrepeat until <touching (_edge_ v)?>\n change x by (-10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [laserbackdrop8\(1\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite14\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop8 v]\nshow\ngo to x: (210) y: (-108)\npoint in direction (180)\nstop [other scripts in sprite v]\nwait (0.4) seconds\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop8\(2\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop9 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite15\n\nwhen I start as a clone\ngo to (sprite14 v)\nrepeat until <touching (_edge_ v)?>\n change x by (-10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [laserbackdrop8\(2\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite16\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop8 v]\nshow\ngo to x: (110) y: (-71)\npoint in direction (180)\nwait (0.2) seconds\nstop [other scripts in sprite v]\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop8\(3\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\nend\n\nwhen backdrop switches to [backdrop9 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite17\n\nwhen I start as a clone\ngo to (sprite16 v)\nrepeat until <touching (_edge_ v)?>\n change x by (-10)\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [laserbackdrop8\(3\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite19\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop9 v]\nshow\ngo to x: (0) y: (0)\npoint in direction (180)\nstop [other scripts in sprite v]\nforever\n repeat (13)\n point towards (player v)\n turn left (90) degrees\n next costume\n move (5) steps\n end\n set [num v] to [14]\n broadcast (tracking laser v)\n repeat (13)\n point towards (player v)\n turn left (90) degrees\n change [num v] by (-1)\n switch costume to (num)\n move (5) steps\n end\nend\n\nwhen backdrop switches to [backdrop10 v]\nhide\nstop [other scripts in sprite v]\n\n@Sprite18\n\nwhen I start as a clone\ngo to (sprite19 v)\npoint in direction ([direction v] of [sprite19 v])\nturn right (90) degrees\nrepeat until <touching (_edge_ v)?>\n move (10) steps\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [tracking laser v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite20\n\nwhen flag clicked\nhide\nforever\n go to x: (([sin v] of ((timer) * (50)) ) * (200)) y: (-100)\nend\n\nwhen backdrop switches to [backdrop16 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite21\n\nwhen flag clicked\nhide\nforever\n go to x: (([sin v] of ((timer) * (50)) ) * (200)) y: (0)\nend\n\nwhen backdrop switches to [backdrop16 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite22\n\nwhen flag clicked\nhide\nforever\n go to x: (([sin v] of ((timer) * (50)) ) * (200)) y: (100)\nend\n\nwhen backdrop switches to [backdrop16 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite23\n\nwhen flag clicked\nhide\nforever\n go to x: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1)) y: (-50)\nend\n\nwhen backdrop switches to [backdrop16 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite24\n\nwhen flag clicked\nhide\nforever\n go to x: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1)) y: (50)\nend\n\nwhen backdrop switches to [backdrop16 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite25\n\nwhen flag clicked\nhide\nforever\n go to x: (-100) y: (([sin v] of ((timer) * (50)) ) * (200))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite26\n\nwhen flag clicked\nhide\nforever\n go to x: (0) y: (([sin v] of ((timer) * (50)) ) * (200))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite27\n\nwhen flag clicked\nhide\nforever\n go to x: (100) y: (([sin v] of ((timer) * (50)) ) * (200))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite28\n\nwhen flag clicked\nhide\nforever\n go to x: (-50) y: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite29\n\nwhen flag clicked\nhide\nforever\n go to x: (50) y: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite30\n\nwhen flag clicked\nhide\nforever\n go to x: (150) y: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite31\n\nwhen flag clicked\nhide\nforever\n go to x: (-150) y: ((([sin v] of ((timer) * (50)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite33\n\nwhen flag clicked\nhide\nforever\n go to x: (50) y: ((([sin v] of ((timer) * (100)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite34\n\nwhen flag clicked\nhide\nforever\n go to x: (-50) y: ((([sin v] of ((timer) * (100)) ) * (200)) * (-1))\nend\n\nwhen backdrop switches to [backdrop17 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop18 v]\nhide\n\n@Sprite32\n\nwhen flag clicked\nhide\nforever\n go to x: (-150) y: ((([sin v] of ((timer) * (100)) ) * (150)) * (-1))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite35\n\nwhen flag clicked\nhide\nforever\n go to x: (-50) y: ((([sin v] of ((timer) * (100)) ) * (150)) * (-1))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite36\n\nwhen flag clicked\nhide\nforever\n go to x: (50) y: ((([sin v] of ((timer) * (100)) ) * (150)) * (-1))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite38\n\nwhen flag clicked\nhide\nforever\n go to x: (150) y: ((([sin v] of ((timer) * (100)) ) * (150)) * (-1))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite39\n\nwhen flag clicked\nhide\nforever\n go to x: (-100) y: (([sin v] of ((timer) * (100)) ) * (150))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite40\n\nwhen flag clicked\nhide\nforever\n go to x: (0) y: (([sin v] of ((timer) * (100)) ) * (150))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite41\n\nwhen flag clicked\nhide\nforever\n go to x: (100) y: (([sin v] of ((timer) * (100)) ) * (150))\nend\n\nwhen backdrop switches to [backdrop18 v]\nreset timer\nshow\n\nwhen backdrop switches to [backdrop20 v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite42\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop22 v]\nstop [other scripts in sprite v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\ngo to x: (-150) y: (150)\npoint in direction (90)\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop\(1\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\n wait (2) seconds\nend\n\n@Sprite43\n\nwhen I receive [laserbackdrop\(1\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\nwhen I start as a clone\ngo to (sprite42 v)\nrepeat until <touching (_edge_ v)?>\n change y by (-10)\nend\ndelete this clone\n\nwhen flag clicked\npoint in direction (90)\nhide\n\n@Sprite46\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop22 v]\nstop [other scripts in sprite v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\ngo to x: (-30) y: (140)\nwait (6) seconds\npoint in direction (90)\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop\(3\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\n wait (2) seconds\nend\n\n@Sprite47\n\nwhen I start as a clone\ngo to (sprite46 v)\nrepeat until <touching (_edge_ v)?>\n change y by (-10)\nend\ndelete this clone\n\nwhen flag clicked\npoint in direction (90)\nhide\n\nwhen I receive [laserbackdrop\(3\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite50\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop22 v]\nstop [other scripts in sprite v]\nhide\n\nwhen backdrop switches to [backdrop21 v]\nshow\ngo to x: (90) y: (140)\npoint in direction (90)\nwait (12) seconds\nforever\n repeat (13)\n next costume\n end\n set [num v] to [14]\n broadcast (laserbackdrop\(5\) v)\n repeat (13)\n change [num v] by (-1)\n switch costume to (num)\n end\n wait (2) seconds\nend\n\n@Sprite51\n\nwhen I start as a clone\ngo to (sprite50 v)\nrepeat until <touching (_edge_ v)?>\n change y by (-10)\nend\ndelete this clone\n\nwhen flag clicked\npoint in direction (90)\nhide\n\nwhen I receive [laserbackdrop\(5\) v]\nshow\ncreate clone of (_myself_ v)\nhide\n\n@Sprite44\n\nwhen flag clicked\nhide\nforever\n glide (1) secs to x: (100) y: (100)\n wait (1) seconds\n glide (1) secs to x: (100) y: (-100)\n wait (1) seconds\n glide (1) secs to x: (-100) y: (-100)\n wait (1) seconds\n glide (1) secs to x: (-100) y: (100)\n wait (1) seconds\nend\n\nwhen flag clicked\nforever\n turn right (15) degrees\nend\n\nwhen backdrop switches to [backdrop22 v]\nshow\n\nwhen backdrop switches to [backdrop23 v]\ngo to x: (200) y: (0)\nstop [other scripts in sprite v]\nforever\n point towards (player v)\n move (0.5) steps\nend\n\nwhen I receive [ow\] v]\ngo to x: (200) y: (0)\n\nwhen backdrop switches to [backdrop24 v]\ngo to x: (200) y: (0)\nstop [other scripts in sprite v]\nforever\n point towards (player v)\n move (1) steps\nend\n\nwhen backdrop switches to [backdrop25 v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop25 v]\nshow\npoint in direction (90)\nswitch costume to (costume1 v)\nforever\n repeat (14)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite37\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop25 v]\nshow\npoint in direction (-90)\nswitch costume to (costume1 v)\nwait (0.5) seconds\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite45\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop26 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite48\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop26 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nwait (0.5) seconds\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite49\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop26 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite52\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop26 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nwait (0.5) seconds\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite53\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop26 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite54\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop27 v]\nshow\npoint in direction (0)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (10) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite55\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop27 v]\nshow\npoint in direction (0)\nswitch costume to (costume1 v)\nwait (0.5) seconds\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (10) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite56\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop27 v]\nshow\npoint in direction (0)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (10) seconds\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite57\n\nwhen flag clicked\nhide\nforever\n glide (1) secs to x: (100) y: (100)\n wait (5) seconds\n glide (1) secs to x: (100) y: (-100)\n wait (5) seconds\n glide (1) secs to x: (-100) y: (-100)\n wait (5) seconds\n glide (1) secs to x: (-100) y: (100)\n wait (5) seconds\nend\n\nwhen backdrop switches to [backdrop28 v]\nshow\n\nwhen flag clicked\nforever\n turn right (15) degrees\nend\n\nwhen backdrop switches to [backdrop29 v]\nhide\n\n@Sprite58\n\nwhen flag clicked\nhide variable [boss health v]\nhide\n\nwhen backdrop switches to [backdrop30 v]\nshow variable [boss health v]\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\nshow\nset [boss health v] to [1000]\nrepeat until <(BOSS HEALTH) < [1]>\n glide (1) secs to x: (0) y: (50)\n glide (1) secs to x: (0) y: (0)\nend\n\nwhen backdrop switches to [backdrop31 v]\nhide\n\nwhen backdrop switches to [backdrop30 v]\nrepeat until <(BOSS HEALTH) < [1]>\n if <color (#000000) is touching (#faa51d)?> then\n change [boss health v] by ((pick random (1) to (10)) * (-1))\n end\nend\nswitch costume to (costume2 v)\nhide variable [boss health v]\ngo to x: (0) y: (50)\n\n@Sprite59\n\nwhen flag clicked\nhide variable [boss health v]\nhide\n\nwhen backdrop switches to [backdrop31 v]\nshow variable [boss health v]\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\nshow\nset [boss health v] to [2000]\nrepeat until <(BOSS HEALTH) < [1]>\n glide (1) secs to x: (0) y: (50)\n glide (1) secs to x: (0) y: (25)\nend\n\nwhen backdrop switches to [backdrop32 v]\nhide\n\nwhen backdrop switches to [backdrop31 v]\nrepeat until <(BOSS HEALTH) < [1]>\n if <<color (#000000) is touching (#faa51d)?> and <(costume [number v]) = [1]>> then\n change [boss health v] by ((pick random (1) to (20)) * (-1))\n end\n if <(pick random (1) to (100)) = [10]> then\n switch costume to (costume3 v)\n wait (pick random (1) to (1.5)) seconds\n switch costume to (costume1 v)\n end\nend\nswitch costume to (costume2 v)\nhide variable [boss health v]\ngo to x: (0) y: (50)\n\nwhen backdrop switches to [backdrop31 v]\nrepeat until <(BOSS HEALTH) < [1]>\n change [boss health v] by (pick random (1) to (3))\n wait ((1) - (((2000) - (BOSS HEALTH)) * (0.001))) seconds\nend\n\n@Sprite60\n\nwhen flag clicked\nhide variable [boss health v]\nhide\n\nwhen backdrop switches to [backdrop32 v]\nshow variable [boss health v]\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\nshow\nset [boss health v] to [5000]\nrepeat until <(BOSS HEALTH) < [1]>\n glide (1) secs to x: (0) y: (50)\n glide (1) secs to x: (0) y: (25)\nend\n\nwhen backdrop switches to [backdrop33 v]\nhide\n\nwhen backdrop switches to [backdrop32 v]\nrepeat until <(BOSS HEALTH) < [1]>\n if <<color (#000000) is touching (#faa51d)?> and <(costume [number v]) = [1]>> then\n change [boss health v] by ((pick random (1) to (50)) * (-1))\n end\n if <(pick random (1) to (50)) = [10]> then\n switch costume to (costume3 v)\n wait (pick random (1) to (1.5)) seconds\n switch costume to (costume1 v)\n end\nend\nswitch costume to (costume2 v)\nhide variable [boss health v]\nstop [other scripts in sprite v]\ngo to x: (0) y: (50)\n\nwhen backdrop switches to [backdrop32 v]\nrepeat until <(BOSS HEALTH) < [1]>\n change [boss health v] by (pick random (1) to (5))\n wait ((1) - (((5000) - (BOSS HEALTH)) * (0.001))) seconds\nend\n\n@Sprite61\n\nwhen flag clicked\nset size to (1500) %\nhide\n\nwhen backdrop switches to [backdrop32 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nforever\n repeat (7)\n next costume\n end\n wait (1) seconds\n repeat (7)\n next costume\n end\n wait (1) seconds\nend\n\nwhen backdrop switches to [backdrop33 v]\nhide\n\nwhen backdrop switches to [backdrop32 v]\nshow\npoint in direction (180)\nswitch costume to (costume1 v)\nforever\n set x to (0)\n set y to ([y position v] of [sprite60 v])\n point towards (player v)\nend\n\n
Scratch Cat has learned some new moves! He can scale walls, wall jump, fingers latch climbing, all while avoiding moving and stationary obstacles. Help guide him to the portals to get to the next stage! \n\nUse arrow keys to move.
Black and White (Platformer)
@Stage\n\nwhen I receive [message1 v]\nnext backdrop\nchange [level v] by (1)\n\nwhen flag clicked\nset [level v] to [1]\nswitch backdrop to (backdrop13 v)\n\nwhen I receive [start v]\nswitch backdrop to (backdrop1 v)\n\nstart sound [Theme_regular.mp3 v]\n\nstop all sounds\n\nplay sound [Theme_regular.mp3 v] until done\n\nforever\n if <key (m v) pressed?> then\n set volume to (0) %\n end\n if <key (p v) pressed?> then\n set volume to (100) %\n end\nend\n\nwhen I receive [sound on v]\n\nif <(Mute) = [on]> then\n repeat until <(Mute) = [off]>\n play sound [Theme_regular.mp3 v] until done\n end\nend\n\nset [mute v] to [on]\n\nwhen [e v] key pressed\nshow variable [time v]\n\nwhen [q v] key pressed\nhide variable [time v]\n\nhide variable [time v]\n\nwhen flag clicked\nshow variable [time v]\nset [time v] to [0]\nrepeat until <(level) = [15]>\n change [time v] by (1)\n wait (1) seconds\nend\n\n@Sprite1\n\nwhen [left arrow v] key pressed\nswitch costume to (costume1 v)\n\nwhen I receive [message1 v]\ngo to x: (218) y: (-67)\n\nwhen flag clicked\nforever\n if <<(y position) = [-165]> or <(y position) < [-165]>> then\n go to x: (218) y: (-67)\n end\nend\n\nwhen [right arrow v] key pressed\nswitch costume to (costume2 v)\n\nwhen flag clicked\nshow\nswitch costume to (コスチューム3 v)\ngo to [front v] layer\npoint in direction (-90)\ngo to x: (160) y: (-40)\nrepeat (10)\n set size to (110) %\n change size by (-1)\n change [ghost v] effect by (-10)\nend\nforever\n change [y v] by (-1)\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n point in direction (90)\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (2)\n if <touching color (#ffffff)?> then\n change y by (2)\n if <touching color (#ffffff)?> then\n change y by (-4)\n change x by ((x) * (-1.1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#ffffff)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#ffffff)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n go to x: (160) y: (-40)\n end\n if <key (r v) pressed?> then\n broadcast (reset v)\n end\n if <touching color (#009933)?> then\n broadcast (next v)\n wait until <not <touching color (#009933)?>>\n end\nend\n\nwhen flag clicked\nset [deaths v] to [0]\nforever\n if <touching color (#00ff55)?> then\n go to x: (218) y: (-67)\n wait (0.01) seconds\n broadcast (message1 v)\n end\n if <touching color (#ff0000)?> then\n change [deaths v] by (1)\n wait (0.2) seconds\n end\n if on edge, bounce\nend\n\nwhen [r v] key pressed\ngo to x: (160) y: (-40)\n\n@Sprite2\n\nwhen flag clicked\n\nwhen [d v] key pressed\nswitch costume to (costume1 v)\n\nwhen [a v] key pressed\nswitch costume to (costume2 v)\n\nwhen flag clicked\ngo to x: (-217) y: (-67)\ngo to x: (-217) y: (-67)\n\nwhen flag clicked\ngo to x: (-217) y: (-67)\nforever\n if <(y position) = [-180]> then\n go to x: (-217) y: (-67)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#00ff55)?> then\n go to x: (-217) y: (-67)\n wait (0.01) seconds\n broadcast (message1 v)\n end\n if <touching color (#ff0000)?> then\n change [deaths v] by (1)\n wait (0.2) seconds\n end\nend\n\nwhen I receive [message1 v]\ngo to x: (-217) y: (-67)\n\nwhen flag clicked\nforever\n if <<<(y position) = [-154]> or <(y position) < [-154]>> and <touching (_edge_ v)?>> then\n go to x: (-217) y: (-67)\n else\n if on edge, bounce\n end\nend\n\nwhen flag clicked\nswitch costume to (コスチューム1 v)\nshow\ngo to [front v] layer\ngo to x: (-160) y: (-40)\npoint in direction (90)\nrepeat (10)\n set size to (110) %\n change size by (-1)\n change [ghost v] effect by (-10)\nend\nforever\n change [y v] by (-1)\n if <key (a v) pressed?> then\n point in direction (-90)\n change [x v] by (-1)\n end\n if <key (d v) pressed?> then\n point in direction (90)\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-4)\n change x by ((x) * (-1.1))\n if <key (w v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (w v) pressed?> and <touching color (#000008)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if <touching color (#009933)?> then\n broadcast (next v)\n wait until <not <touching color (#009933)?>>\n end\n if <touching color (#ff0000)?> then\n go to x: (-160) y: (-40)\n end\nend\n\nwhen flag clicked\nforever\n if <(y position) = [-177]> then\n go to x: (-217) y: (-67)\n end\nend\n\nif on edge, bounce\ngo to x: (-175) y: (-64)\n\nwhen [r v] key pressed\ngo to x: (-160) y: (-40)\n\n@Sprite3\n\nif then\nelse\nend\n\ngo to x: (45) y: (93)\n\nwhen flag clicked\nforever\nend\n\nswitch costume to (costume1 v)\n\nwhen flag clicked\nforever\n if <<touching (sprite2 v)?> and <touching (sprite1 v)?>> then\n broadcast (message1 v)\n end\n if <<(level) = [10]> or <<(level) = [11]> or <(level) = [12]>>> then\n show\n else\n hide\n end\n if <(level) = [10]> then\n switch costume to (costume1 v)\n go to x: (48) y: (-78)\n end\n if <(level) = [11]> then\n switch costume to (costume1 v)\n go to x: (50) y: (79)\n end\n if <(level) = [12]> then\n switch costume to (costume2 v)\n end\nend\n\nif then\nelse\n switch costume to (costume1 v)\nend\n\n@costume1\n\nwhen this sprite clicked\nhide\nbroadcast (start v)\n\nif then\nend\n\nwhen flag clicked\nshow\ngo to x: (-4) y: (-7)\nset size to (40) %\nforever\n if <touching (mouse-pointer v)?> then\n set size to (45) %\n else\n set size to (40) %\n end\nend\n\n@Sprite4\n\nset volume to (100) %\n\nset volume to (0) %\n\nforever\nend\n\nbroadcast (sound on v)\n\nbroadcast (sound off v)\n\nwhen flag clicked\nswitch costume to (costume1 v)\n\nset [mute v] to [on]\n\nswitch costume to (costume1 v)\n\nswitch costume to (costume2 v)\n\nwhen flag clicked\n\nwhen this sprite clicked\n\nwhen this sprite clicked\nif <(volume) = [100]> then\n set [mute v] to [Yes]\n set volume to (0) %\n switch costume to (costume2 v)\n stop all sounds\nelse\n set [mute v] to [No]\n switch costume to (costume1 v)\n set volume to (100) %\nend\n\nnext costume\nforever\n if <(costume [number v]) = [1]> then\n set [mute v] to [on]\n end\n if <(costume [number v]) = [1]> then\n set [mute v] to [off]\n end\nend\n\nwhen flag clicked\nset [mute v] to [No]\nswitch costume to (costume1 v)\nforever\n if <(Mute) = [No]> then\n play sound [Theme_regular.mp3 v] until done\n else\n end\nend\n\n@Switch\n\nswitch backdrop to (level 14 v)\n\nshow\n\nclear graphic effects\n\nwhen flag clicked\nswitch costume to (costume1 v)\nforever\n if <touching (sprite1 v)?> then\n switch costume to (costume1 v)\n broadcast (black door open v)\n hide\n end\nend\n\nwhen flag clicked\nhide\ngo to x: (74) y: (-8)\nforever\n if <<(level) = [13]> or <(level) = [14]>> then\n show\n else\n end\n if <(level) = [14]> then\n show\n switch costume to (costume1 v)\n go to x: (-211) y: (110)\n end\n if <(level) = [15]> then\n hide\n end\nend\n\ngo to x: (-80) y: (-28)\n\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwait until \n\n@White Passage\n\nset [ghost v] effect to (100)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen flag clicked\ngo to x: (-80) y: (-28)\nswitch costume to (costume1 v)\nforever\n if <<(level) = [13]> or <(level) = [14]>> then\n show\n else\n hide\n end\n if <(level) = [14]> then\n switch costume to (costume1 v)\n go to x: (13) y: (-28)\n end\nend\n\nhide\n\nwhen I receive [black door open v]\nswitch costume to (costume2 v)\n\ngo to x: (-80) y: (-28)\n\n@Switch2\n\nwhen flag clicked\n\nwhen flag clicked\n\nforever\n if <(level) = [13]> then\n show\n else\n hide\n end\nend\n\nswitch costume to (costume1 v)\nwait until <touching (sprite1 v)?>\nswitch costume to (costume2 v)\nbroadcast (black door open v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@black Passage2\n\nif then\nend\nhide\n\nwhen flag clicked\n\nwhen I receive [white door open v]\n\nset [ghost v] effect to (100)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nswitch costume to (costume1 v)\nforever\n if <(level) = [13]> then\n show\n else\n hide\n end\nend\n\nswitch costume to (costume2 v)\n\n@Sprite6\n\nwhen flag clicked\nforever\n go to x: (0) y: (1)\nend\n\n
PLAY MY NEWEST GAME HERE: https://scratch.mit.edu/projects/292961276/\n1000 VIEWS! \n>>>SORRY FOR GLITCHES/LAG CAUSED BY 3.0<<<\nWASD to move White\nArrows to move Black\nR to restart\nWhite can only touch black\nBlack can only touch white\nthere are 14 levels currently\nclick the mute button in the top right to mute or unmute sound\nQ to hide time and E to show time\n>>> 50 VIEWS!<<< 11/8/18\n>>> 10 LOVES!<<< 11/8/18\n>>> 10 FAVORITES!<<< 11/8/18\n>>> 100 VIEWS!<<< 11/8/18\n>>> 150 VIEWS!<<< 11/8/18\n>>> 200 VIEWS!<<< 11/9/18\n>>> 20 LOVES!<<< 11/9/18\n>>> 20 FAVORITES!<<< 11/9/18\n>>> 250 VIEWS!<<< 11/10/18\n>>> 300 VIEWS!<<<11/12/18\n>>> 30 LOVES!<<<11/13/18\n>>> 400 VIEWS!<<<11/13/18\n>>> 30 FAVORITES!<<<11/13/18\n>>> 500 VIEWS!<<<11/15/18\n>>> 40 LOVES!<<< 11/17/18\n>>> 600 VIEWS!<<<11/18/28\n>>> 40 FAVORITES!<<< 11/19/18\n>>> 700 VIEWS!<<< 11/20/18\n>>> 50 LOVES!<<< 11/26/18\n>>> 800 VIEWS!<<< 11/30/18\n>>> 50 FAVORITES!<<< 12/6/18\n>>> 60 LOVES!<<< 12/6/18\n>>> 900 VIEWS!<<< 12/13/18\n>>> *1000* VIEWS!!!!!!!!!!!!!!!!<<< 12/18/18\n>>> *1000* MORE VIEWS IN ONE DAY!!!!!<<<\nSTOPPED KEEPING TRACK OF V F & L
ROBLOX Platformer
@Stage\n\nwhen flag clicked\nshow variable [music v]\nshow variable [deaths v]\n\nwhen flag clicked\nforever\n if <(Music) = [2]> then\n repeat until <(Music) = [1]>\n stop all sounds\n play sound [Music 2 v] until done\n end\n end\nend\n\nwhen flag clicked\nforever\n if <(Music) = [1]> then\n repeat until <(Music) = [2]>\n stop all sounds\n play sound [Music 1 v] until done\n end\n end\nend\n\n@Platformer\n\nwhen flag clicked\nforever\n if <key (right arrow v) pressed?> then\n move (6) steps\n end\n if <key (left arrow v) pressed?> then\n move (-6) steps\n end\nend\n\nwhen flag clicked\nforever\n if <key (up arrow v) pressed?> then\n change y by (100)\n wait (0.7) seconds\n end\nend\n\nwhen flag clicked\nhide\ngo to [front v] layer\nshow variable [music v]\n\nwhen flag clicked\nforever\n change y by (-6)\n if <touching color (#00cc44)?> then\n change y by (6)\n end\nend\n\n@Terain\n\nwhen flag clicked\nswitch costume to (level1 v)\n\nwhen I receive [switch level v]\nnext costume\n\nwhen I receive [the message v]\nswitch costume to (tycoon v)\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [3]> then\n broadcast (noob gone v)\n end\nend\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [9]> then\n broadcast (level 9 noob v)\n end\nend\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [10]> then\n broadcast (noob gone v)\n end\nend\n\nwhen flag clicked\nhide variable [$ per sec. v]\nhide variable [money v]\nset [$ per sec. v] to [0]\nset [money v] to [10]\n\nwhen I receive [exit v]\nswitch costume to (level6 v)\nhide variable [money v]\nhide variable [$ per sec. v]\nbroadcast (switch level v)\n\nwhen I receive [revive v]\nchange [deaths v] by (1)\n\nwhen flag clicked\nset [deaths v] to [0]\nset [music v] to [1]\nshow variable [deaths v]\nshow variable [music v]\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [2]> then\n broadcast (level 2 noob v)\n end\nend\n\n@Prototype\n\nwhen flag clicked\nhide variable [y v]\nhide variable [velocity v]\nhide variable [x v]\n\nwhen flag clicked\nforever\n if <touching color (#ff9400)?> then\n change [y v] by (14)\n end\nend\n\nwhen flag clicked\nforever\n if <(x position) > [290]> then\n broadcast (Switch level v)\n end\nend\n\nwhen I receive [switch level v]\ngo to x: (-200) y: (100)\n\nwhen I receive [revive v]\ngo to x: (-130) y: (100)\n\nwhen flag clicked\nforever\n if <(y position) < [-212]> then\n broadcast (Revive v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching (noob v)?> then\n broadcast (Revive v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff00bf)?> then\n broadcast (THE Message v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#cc0000)?> then\n broadcast (Revive v)\n end\nend\n\nwhen I receive [the message v]\ngo to x: (-130) y: (100)\nshow variable [money v]\nshow variable [$ per sec. v]\nset [tycoon control v] to [0]\n\nwhen flag clicked\nhide variable [tycoon control v]\n\nwhen flag clicked\nrepeat until <(Tycoon control) = [1]>\n if <<touching color (#00cccc)?> and <<(Money) = [9]> or <(Money) > [9]>>> then\n change [tycoon control v] by (1)\n change [money v] by (-9)\n change [$ per sec. v] by (1)\n broadcast (Tysig1 v)\n end\nend\n\nwhen flag clicked\nrepeat until <(Tycoon control) = [2]>\n if <<touching color (#0033cc)?> and <<(Money) = [20]> or <(Money) > [20]>>> then\n change [tycoon control v] by (1)\n change [money v] by (-20)\n change [$ per sec. v] by (2)\n broadcast (Tysig2 v)\n end\nend\n\nwhen flag clicked\nrepeat until <(Tycoon control) = [3]>\n if <<touching color (#6600cc)?> and <<(Money) = [50]> or <(Money) > [50]>>> then\n change [tycoon control v] by (1)\n change [money v] by (-50)\n change [$ per sec. v] by (2)\n broadcast (Tysig3 v)\n end\nend\n\nwhen flag clicked\nrepeat until <(Tycoon control) = [4]>\n if <<touching color (#cc0099)?> and <<(Money) = [150]> or <(Money) > [150]>>> then\n change [tycoon control v] by (1)\n change [money v] by (-150)\n change [$ per sec. v] by (10)\n broadcast (Tysig4 v)\n end\nend\n\nwhen flag clicked\nforever\n if <($ per sec.) = [3]> then\n repeat until <<(Tycoon control) = [3]> or <(Tycoon control) = [0]>>\n change [money v] by (3)\n wait (1) seconds\n end\n end\nend\n\nwhen flag clicked\nforever\n if <($ per sec.) = [1]> then\n repeat until <<(Tycoon control) = [2]> or <(Tycoon control) = [0]>>\n change [money v] by (1)\n wait (1) seconds\n end\n end\nend\n\nwhen flag clicked\nforever\n if <($ per sec.) = [5]> then\n repeat until <<(Tycoon control) = [4]> or <(Tycoon control) = [0]>>\n change [money v] by (5)\n wait (1) seconds\n end\n end\nend\n\nwhen flag clicked\nforever\n if <($ per sec.) = [15]> then\n repeat until <<(Tycoon control) = [5]> or <(Tycoon control) = [0]>>\n change [money v] by (15)\n wait (1) seconds\n end\n end\nend\n\nwhen flag clicked\nshow\ngo to [front v] layer\ngo to x: (-130) y: (100)\nforever\n change [y v] by (-0.5)\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n set [x v] to ((X) * (0.9))\n change x by (X)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <touching color (#00cc44)?> then\n change y by (1)\n if <key (up arrow v) pressed?> then\n set [y v] to [1]\n if <(X) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((X) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (Y)\n if <touching color (#00cc44)?> then\n change y by ((Y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#00cc44)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if then\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#666600)?> then\n broadcast (EXIT v)\n end\nend\n\n@Noob\n\nwhen I receive [level 2 noob v]\nshow\ngo to x: (-52) y: (98)\n\nwhen flag clicked\ngo to [front v] layer\nhide\n\nwhen I receive [level 9 noob v]\nshow\ngo to x: (135) y: (131)\n\nwhen I receive [noob gone v]\nhide\n\nwhen flag clicked\nforever\n if <touching (prototype v)?> then\n play sound [Oof v] until done\n end\nend\n\n
Use the arrow keys to move.\nAviod the noobs and the lava.\nThe orange things are bounce pads.\nUse the slider labeled "Music" to change the music.\n*There is a secert area, but it dosn't always work.*\nThere are ten levels, all of which are possible.
Big Tower Tiny Square | Platformer
@Stage\n\nwhen flag clicked\nforever\n set [you failed to rescue pineapple and kill big square in v] to (join [0] (join (minutes) (join [:] (join [0] (seconds)))))\n set [time v] to (join [0] (join (minutes) (join [:] (join [0] (seconds)))))\n if <<(seconds) = [10]> or <(seconds) > [10]>> then\n set [you failed to rescue pineapple and kill big square in v] to (join [0] (join (minutes) (join [:] (seconds))))\n set [time v] to (join [0] (join (minutes) (join [:] (seconds))))\n end\n if <<(minutes) = [10]> or <(minutes) > [10]>> then\n set [you failed to rescue pineapple and kill big square in v] to (join (minutes) (join [:] (join [0] (seconds))))\n set [time v] to (join (minutes) (join [:] (join [0] (seconds))))\n end\n if <<<(seconds) = [10]> or <(seconds) > [10]>> and <<(minutes) = [10]> or <(minutes) > [10]>>> then\n set [you failed to rescue pineapple and kill big square in v] to (join (minutes) (join [:] (seconds)))\n set [time v] to (join (minutes) (join [:] (seconds)))\n end\nend\n\nwhen [space v] key pressed\nshow variable [time v]\nshow variable [death v]\nforever\n wait (1) seconds\n change [seconds v] by (1)\n if <(seconds) = [60]> then\n set [seconds v] to [0]\n change [minutes v] by (1)\n end\nend\n\nwhen I receive [congratulations v]\nswitch backdrop to (you win v)\nhide variable [time v]\nshow variable [you failed to rescue pineapple and kill big square in v]\nhide variable [death v]\nshow variable [number of times you died: v]\nchange [amount of people who beat the game: v] by (1)\nshow variable [amount of people who beat the game: v]\nwait (5) seconds\nstop [other scripts in sprite v]\n\nwhen flag clicked\nhide variable [amount of people who beat the game: v]\nhide variable [number of times you died: v]\nhide variable [you failed to rescue pineapple and kill big square in v]\nhide variable [death v]\nset [time v] to [0]\nset [minutes v] to [0]\nset [seconds v] to [0]\nhide variable [time v]\nhide variable [minutes v]\nhide variable [seconds v]\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v) and wait\nset [color v] effect to (0)\nwait (1) seconds\nwait until <key (space v) pressed?>\nswitch backdrop to (lvl 1 v)\nstop [this script v]\n\nwhen I receive [hide3 v]\nwait (1) seconds\nswitch backdrop to (death v)\n\nbroadcast (hide3 v)\n\nswitch backdrop to (lvl 5 v)\n\n@Sprite1\n\nwhen flag clicked\nforever\n play sound [Cool Music.mp3 v] until done\nend\n\n@thumbnail\n\nwhen flag clicked\nshow\nswitch costume to (vef5j5s-0 v)\nrepeat (91)\n next costume\nend\nbroadcast (message1 v)\nswitch backdrop to (intro page v)\nhide\n\nwhen [space v] key pressed\nhide\nstop [other scripts in sprite v]\n\nbroadcast (message1 v)\nswitch backdrop to (intro page v)\nhide\n\nwhen [space v] key pressed\nhide\nstop [other scripts in sprite v]\n\n@Sprite2\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\nwhen I receive [message1 v]\nhide\nwait (1) seconds\nshow\nbroadcast (message2 v)\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nhide\n\n@Sprite3\n\nwhen I receive [message2 v]\nwait (1) seconds\nshow\nbroadcast (message3 v)\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nhide\n\n@Sprite4\n\nwhen I receive [message3 v]\nwait (1) seconds\nshow\nbroadcast (message4 v)\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nhide\n\n@Sprite5\n\nwhen I receive [message4 v]\nwait (1) seconds\nshow\nbroadcast (message5 v)\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nhide\n\n@Sprite11\n\nwhen I receive [message6 v]\nwait (1) seconds\nshow\nset [ghost v] effect to (100)\nforever\n repeat (50)\n wait (0.01) seconds\n change [ghost v] effect by (-2)\n end\n repeat (50)\n wait (0.01) seconds\n change [ghost v] effect by (2)\n end\nend\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\n@Sprite6\n\nwhen I receive [message5 v]\nwait (2) seconds\ngo to x: (-40) y: (-20)\nshow\nbroadcast (message6 v)\n\nwhen backdrop switches to [lvl 1 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen [space v] key pressed\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [lvl 5 v]\nset size to (75) %\ngo to x: (-140) y: (865)\n\nwhen I receive [congratulations v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nhide\n\nwhen I receive [congratulations v]\nshow\nforever\n change [color v] effect by (25)\nend\n\n@Sprite9\n\nwhen flag clicked\nhide\n\nwhen I receive [congratulations v]\nshow\nforever\n change [color v] effect by (25)\nend\n\n@Sprite10\n\nwhen flag clicked\nhide\n\nwhen I receive [congratulations v]\nshow\nforever\n change [color v] effect by (25)\nend\n\n@cube\n\nwhen I receive [play v]\nforever\n change [y v] by (-0.5)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n set [x v] to ((x) * (0.8))\n change x by (x)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (-6)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000000)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <<key (up arrow v) pressed?> or <key (w v) pressed?>>> then\n set [y v] to [5]\n end\n change y by (0.5)\n show\n if <touching color (#ff9400)?> then\n set [y v] to [10]\n end\n if <touching color (#00ff55)?> then\n set [checkx v] to (x position)\n set [checky v] to (y position)\n end\n if <key (r v) pressed?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#00ffff)?> then\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 1 v]\nbroadcast (play v)\nset size to (100) %\nswitch costume to (ball-b v)\nshow\ngo to x: (-220) y: (-10)\nset [checkx v] to [-220]\nset [checky v] to [-10]\nforever\n if <touching color (#ff0000)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f7f7f)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f00ff)?> then\n broadcast (lvl 2 v)\n switch backdrop to (lvl 2 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 2 v]\nswitch backdrop to (lvl 2 v)\ngo to x: (25) y: (-145)\nset [checkx v] to [25]\nset [checky v] to [-145]\nforever\n if <touching color (#ff0000)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f7f7f)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f00ff)?> then\n broadcast (lvl 3 v)\n switch backdrop to (lvl 3 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 3 v]\nset size to (60) %\nswitch backdrop to (lvl 3 v)\ngo to x: (-30) y: (-165)\nset [checkx v] to [-30]\nset [checky v] to [-165]\nforever\n if <touching color (#ff0000)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f7f7f)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#003fff)?> then\n broadcast (hide2 v)\n end\n if <touching color (#7f00ff)?> then\n broadcast (lvl 4 v)\n switch backdrop to (lvl 4 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 4 v]\nswitch backdrop to (lvl 4 v)\ngo to x: (10) y: (-165)\nset [checkx v] to [10]\nset [checky v] to [-165]\nforever\n if <touching color (#ff0000)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f7f7f)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#ffff00)?> then\n go to x: (-125) y: (-50)\n end\n if <touching color (#cccc00)?> then\n go to x: (-180) y: (165)\n end\n if <touching color (#999900)?> then\n go to x: (215) y: (140)\n end\n if <touching color (#003fff)?> then\n broadcast (hide v)\n end\n if <touching color (#7f00ff)?> then\n broadcast (lvl 5 v)\n switch backdrop to (lvl 5 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 5 v]\nswitch backdrop to (lvl 5 v)\ngo to x: (-205) y: (-160)\nset [checkx v] to [-205]\nset [checky v] to [-160]\nforever\n if <touching color (#ff0000)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#7f7f7f)?> then\n go to x: (checkX) y: (checkY)\n end\n if <touching color (#003fff)?> then\n broadcast (hide3 v)\n end\n if <touching color (#0033cc)?> then\n broadcast (hide4 v)\n end\nend\n\nwhen I receive [lvl 5 v]\nforever\n if <touching color (#00ff55)?> then\n broadcast (say v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n repeat until <not <touching color (#00ffff)?>>\n broadcast (play v)\n end\nend\n\nwhen flag clicked\nhide\nwait until <key (space v) pressed?>\nbroadcast (lvl 1 v)\n\nwhen flag clicked\nset [number of times you died: v] to [0]\nset [death v] to [0]\nforever\n if <<touching color (#ff0000)?> or <touching color (#7f7f7f)?>> then\n change [number of times you died: v] by (1)\n change [death v] by (1)\n end\nend\n\nwhen backdrop switches to [you win v]\ngo to x: (145) y: (-108)\n\nwhen I receive [play v]\nforever\n repeat until <not <touching color (#00ffff)?>>\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n set [x v] to ((x) * (0.2))\n change x by (x)\n end\nend\n\n@trail\n\nwhen I start as a clone\nrepeat (4)\n wait (0.05) seconds\n go [backward v] (10000) layers\n change [ghost v] effect by (25)\nend\ndelete this clone\n\nwhen I receive [lvl 1 v]\nshow\nforever\n create clone of (_myself_ v)\n wait (0.01) seconds\n go to (cube v)\n go [backward v] (1000) layers\nend\n\nwhen flag clicked\nhide\n\n@saw1\n\nwhen flag clicked\nhide\n\nwhen [space v] key pressed\nforever\n turn right (15) degrees\nend\n\nwhen I receive [lvl 1 v]\nset size to (100) %\nshow\ngo to x: (90) y: (140)\nforever\n if <(backdrop [name v]) = [lvl 2]> then\n stop [this script v]\n else\n glide (3) secs to x: (90) y: (10)\n glide (3) secs to x: (90) y: (140)\n end\nend\n\nwhen I receive [lvl 2 v]\nset size to (100) %\nshow\ngo to x: (5) y: (85)\nforever\n if <(backdrop [name v]) = [lvl 3]> then\n stop [this script v]\n else\n glide (3) secs to x: (3) y: (40)\n glide (3) secs to x: (5) y: (85)\n end\nend\n\nwhen I receive [lvl 4 v]\nhide\n\nwhen I receive [lvl 3 v]\nshow\ngo to x: (40) y: (60)\nforever\n if <(backdrop [name v]) = [lvl 4]> then\n stop [this script v]\n else\n glide (3) secs to x: (40) y: (-120)\n glide (3) secs to x: (40) y: (60)\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\n\n@saw2\n\nwhen flag clicked\nhide\n\nwhen [space v] key pressed\nforever\n turn right (15) degrees\nend\n\nwhen I receive [lvl 1 v]\nwait (3) seconds\nshow\ngo to x: (140) y: (140)\nforever\n if <(backdrop [name v]) = [lvl 2]> then\n stop [this script v]\n else\n glide (3) secs to x: (140) y: (10)\n glide (3) secs to x: (140) y: (140)\n end\nend\n\nwhen I receive [lvl 2 v]\nwait (3) seconds\nshow\ngo to x: (40) y: (85)\nforever\n if <(backdrop [name v]) = [lvl 3]> then\n stop [this script v]\n else\n glide (3) secs to x: (40) y: (45)\n glide (3) secs to x: (40) y: (85)\n end\nend\n\nwhen I receive [lvl 3 v]\nshow\ngo to x: (15) y: (55)\nforever\n if <(backdrop [name v]) = [lvl 4]> then\n stop [this script v]\n else\n glide (3) secs to x: (70) y: (55)\n glide (3) secs to x: (15) y: (55)\n end\nend\n\nwhen I receive [lvl 4 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\n\n@lvl1 moving platform\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 2 v]\nhide\n\nwhen I receive [lvl 3 v]\nhide\n\nwhen I receive [lvl 1 v]\ngo to x: (20) y: (55)\nshow\nforever\n glide (3) secs to x: (20) y: (150)\n glide (3) secs to x: (20) y: (55)\n if <(backdrop [name v]) = [lvl 2]> then\n stop [this script v]\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\n\nwhen I receive [lvl 4 v]\ngo to x: (-100) y: (-150)\nshow\nforever\n glide (2) secs to x: (-100) y: (-70)\n glide (2) secs to x: (-100) y: (-150)\nend\n\n@saw3\n\nwhen flag clicked\nhide\n\nwhen [space v] key pressed\nforever\n turn right (15) degrees\nend\n\nwhen I receive [lvl 1 v]\nhide\n\nwhen I receive [lvl 2 v]\nshow\ngo to x: (-135) y: (40)\nforever\n if <(backdrop [name v]) = [lvl 3]> then\n stop [this script v]\n else\n end\nend\n\nwhen I receive [lvl 3 v]\nwait (3) seconds\nshow\ngo to x: (20) y: (-110)\nforever\n if <(backdrop [name v]) = [lvl 4]> then\n go to x: (-20) y: (70)\n stop [this script v]\n else\n glide (3) secs to x: (65) y: (-110)\n glide (3) secs to x: (20) y: (-110)\n end\nend\n\nwhen I receive [lvl 4 v]\nshow\ngo to x: (-20) y: (70)\nforever\n if <(backdrop [name v]) = [lvl 5]> then\n stop [this script v]\n else\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\n\n@saw4\n\nwhen flag clicked\nhide\n\nwhen [space v] key pressed\nforever\n turn right (15) degrees\nend\n\nwhen I receive [lvl 1 v]\nhide\n\nwhen I receive [lvl 2 v]\nshow\ngo to x: (-120) y: (40)\nforever\n if <(backdrop [name v]) = [lvl 3]> then\n stop [this script v]\n else\n end\nend\n\nwhen I receive [lvl 3 v]\nshow\ngo to x: (-110) y: (-90)\nforever\n if <(backdrop [name v]) = [lvl 4]> then\n stop [this script v]\n else\n end\nend\n\nwhen I receive [lvl 4 v]\nshow\ngo to x: (-20) y: (55)\nforever\n if <(backdrop [name v]) = [lvl 5]> then\n stop [this script v]\n else\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\n\n@lvl 3 block\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 4 v]\nshow\n\nwhen I receive [hide v]\nhide\n\nwhen I receive [lvl 3 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\n\n@lvl 3 block2\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 4 v]\nshow\n\nwhen I receive [hide v]\nhide\n\nwhen I receive [lvl 3 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\n\n@spike\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 1 v]\nhide\n\nwhen I receive [lvl 4 v]\nshow\npoint in direction (90)\ngo to x: (55) y: (-165)\nforever\n if <(backdrop [name v]) = [lvl 5]> then\n delete this clone\n else\n set [clone v] to [0]\n repeat (10)\n change [clone v] by (1)\n create clone of (_myself_ v)\n end\n end\n if <(backdrop [name v]) = [lvl 5]> then\n stop [this script v]\n end\nend\n\nwhen I start as a clone\nif <(clone) = [1]> then\n point in direction (90)\n go to x: (-25) y: (-140)\nend\nif <(clone) = [2]> then\n point in direction (180)\n go to x: (-45) y: (-110)\nend\nif <(clone) = [3]> then\n point in direction (-90)\n go to x: (-100) y: (-70)\nend\nif <(clone) = [4]> then\n point in direction (90)\n go to x: (-225) y: (135)\nend\nif <(clone) = [5]> then\n point in direction (90)\n go to x: (-190) y: (55)\nend\nif <(clone) = [6]> then\n point in direction (90)\n go to x: (-225) y: (-35)\nend\nif <(clone) = [7]> then\n point in direction (-90)\n go to x: (170) y: (65)\nend\nif <(clone) = [8]> then\n point in direction (-90)\n go to x: (225) y: (20)\nend\nif <(clone) = [9]> then\n point in direction (-90)\n go to x: (170) y: (-5)\nend\nif <(clone) = [10]> then\n point in direction (-90)\n go to x: (225) y: (-50)\nend\n\nwhen I receive [lvl 3 v]\nhide\n\nwhen I receive [lvl 2 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\ndelete this clone\n\nwhen I receive [congratulations v]\nhide\ndelete this clone\n\n@pineapple\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 1 v]\nset size to (20) %\ngo to x: (-170) y: (130)\nshow\nsay [Help Me!!] for (2) seconds\nwait (3) seconds\nhide\n\nwhen I receive [lvl 2 v]\nhide\n\nwhen I receive [hide3 v]\ngo to x: (-185) y: (145)\nglide (1) secs to x: (-185) y: (90)\n\nwhen I receive [lvl 5 v]\nset size to (15) %\ngo to x: (-175) y: (145)\nshow\n\nwhen backdrop switches to [you win v]\ngo to x: (-185) y: (-140)\n\nwhen I receive [congratulations v]\nstop [other scripts in sprite v]\n\n@turret\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nforever\n point towards (cube v)\nend\n\nwhen I receive [lvl 1 v]\nhide\nwait until <key (space v) pressed?>\nshow\ngo to x: (-175) y: (-80)\nforever\n switch costume to (costume1 v)\n wait (3) seconds\n switch costume to (costume2 v)\n repeat (6)\n wait (2) seconds\n broadcast (shoot v)\n start sound [laser2 v]\n end\nend\n\nwhen I receive [lvl 1 v]\nforever\n if <(backdrop [name v]) = [lvl 2]> then\n hide\n stop [other scripts in sprite v]\n end\nend\n\nwhen I receive [lvl 2 v]\nhide\n\nwhen I receive [lvl 3 v]\nforever\n point towards (cube v)\nend\n\nwhen I receive [lvl 3 v]\nshow\ngo to x: (-220) y: (0)\nforever\n switch costume to (costume1 v)\n wait (3) seconds\n switch costume to (costume2 v)\n repeat (6)\n wait (2) seconds\n broadcast (shoot v)\n start sound [laser2 v]\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [lvl 4 v]\nforever\n point towards (cube v)\nend\n\nwhen I receive [lvl 4 v]\nshow\ngo to x: (0) y: (105)\nforever\n switch costume to (costume1 v)\n wait (3) seconds\n switch costume to (costume2 v)\n repeat (6)\n wait (2) seconds\n broadcast (shoot v)\n start sound [laser2 v]\n end\nend\n\nwhen I receive [lvl 4 v]\nforever\n if <(backdrop [name v]) = [lvl 5]> then\n hide\n stop [other scripts in sprite v]\n end\nend\n\n@bullet\n\nwhen I receive [shoot v]\ngo to (turret v)\nshow\npoint towards (cube v)\nrepeat until <touching color (#000000)?>\n move (5) steps\nend\nhide\n\nwhen I receive [lvl 1 v]\nhide\ngo [backward v] (1e+54) layers\ngo to (turret v)\n\nwhen flag clicked\nhide\n\n@lvl4 block\n\nwhen I receive [lvl 3 v]\nshow\n\nwhen I receive [hide2 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 4 v]\nhide\n\nwhen I receive [lvl 5 v]\nhide\n\n@lvl4 vanishing blocks\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 4 v]\nforever\n show\n set [ghost v] effect to (100)\n forever\n repeat (10)\n wait (0.5) seconds\n change [ghost v] effect by (-10)\n end\n wait (5) seconds\n repeat (10)\n wait (0.5) seconds\n change [ghost v] effect by (10)\n end\n end\nend\n\nwhen I receive [lvl 5 v]\nhide\nstop [other scripts in sprite v]\n\n@lvl 5 block2\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 5 v]\nshow\n\nwhen I receive [hide4 v]\nhide\n\n@lvl 5 block1\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 5 v]\nshow\n\nwhen I receive [hide3 v]\nhide\n\n@lvl 5 block2(2)\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl 5 v]\nshow\n\nwhen I receive [hide3 v]\nhide\n\n@boss\n\nwhen I receive [lvl 5 v]\nswitch costume to (costume1 v)\nset size to (40) %\ngo to x: (-95) y: (135)\nshow\n\nwhen flag clicked\nhide\ngo to x: (-95) y: (135)\nswitch costume to (costume1 v)\nset size to (40) %\ngo to x: (-95) y: (135)\n\nwhen I receive [say v]\nsay [You made it! You still can't kill me though! Muahahaha] for (2) seconds\nwait (3) seconds\nsay [What are you doing?] for (1) seconds\nsay [Uh oh] for (1) seconds\nsay [Don't go over there!] for (1) seconds\nsay [Hey!] for (1) seconds\nsay [Watch it!] for (1) seconds\n\nwhen I receive [hide4 v]\nwait (0.2) seconds\ngo to x: (-95) y: (120)\nswitch costume to (costume2 v)\nsay [NOOOOOOOO! I HATE LAVA!] for (2) seconds\nglide (1) secs to x: (-95) y: (80)\nswitch costume to (costume1 v)\nwait (1) seconds\nsay [HEY I'M ALIVE! Not even hurt, actually.] for (4) seconds\nsay [Guess lava doesn't kill me. Good to know.] for (4) seconds\nsay [Well you failed to rescue your pineapple and kill me.] for (4) seconds\nsay [Such a non-conclusive ending must be maddening. Oh well.] for (4) seconds\nbroadcast (congratulations v)\n\nwhen I receive [hide3 v]\nswitch costume to (costume2 v)\ngo to x: (-95) y: (120)\nsay [NOOO! That's the bridge collapse switch, not the wall opening switch!] for (2) seconds\nsay [You killed the Pineapple!] for (2) seconds\nswitch costume to (costume1 v)\ngo to x: (-95) y: (135)\nsay [I can't believe you've done this! ] for (2) seconds\nsay [Why would I put a switch that could kill me RIGHT HERE???] for (2) seconds\nsay [Now no one gets to be friends with the Pineapple.] for (2) seconds\n\nwhen backdrop switches to [you win v]\ngo to x: (-95) y: (-145)\n\nwhen I receive [congratulations v]\nstop [other scripts in sprite v]\n\nset [amount of people who beat the game: v] to [3]\n\n
You are the pink square. Use the arrows keys or WASD to move. Avoid the lava (red), the gun, and the saws and spikes (gray). The bounce pads are orange. The checkpoints are green. Press R to respawn at the last checkpoint. The water (blue) slows you down. Get to the purple part to win!\nGood Luck. You'll need it!\nPlay in fullscreen for the best experience!\nPLEASE LOVE AND FAVORITE!!
platformer
@Stage\n\n@Nano\n\nwhen flag clicked\nshow\nset [level v] to [1]\nset [yv v] to [0]\nset [xv v] to [0]\nforever\n change [yv v] by (-0.5)\n if <key (right arrow v) pressed?> then\n switch costume to (costume2 v)\n change [xv v] by (0.7)\n end\n if <key (left arrow v) pressed?> then\n switch costume to (costume3 v)\n change [xv v] by (-0.7)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <<touching color (#000008)?> and <not <touching (sprite3 v)?>>> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n if <touching (null v)?> then\n change x by (Change)\n end\n change x by (1)\n if <key (up arrow v) pressed?> then\n if <not <touching color (#00ff55)?>> then\n if <(Xv) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n set [yv v] to [10]\n end\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n if <touching color (#000008)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching (null v)?> then\n change x by (Change)\n end\n if <touching color (#000008)?> then\n if <key (up arrow v) pressed?> then\n if <not <touching color (#00ff55)?>> then\n set [yv v] to [10]\n end\n end\n end\n if <touching color (#003fff)?> then\n set [yv v] to [15]\n end\n change y by (1)\nend\n\nwhen flag clicked\nswitch backdrop to (level 1 v)\nset size to (100) %\ngo to x: (-205) y: (-80)\n\nwhen I receive [starting position v]\nsay [oof] for (0.5) seconds\ngo to x: (-206) y: (-97)\nchange [fails v] by (1)\n\nwhen flag clicked\nswitch backdrop to (level 1 v)\n\nwhen backdrop switches to [level 2 v]\ngo to x: (-206) y: (-105)\n\nwhen backdrop switches to [level 4 v]\ngo to x: (-214) y: (-80)\n\nwhen backdrop switches to [level 1 v]\nforever\n if <touching (sprite1 v)?> then\n switch backdrop to (level 2 v)\n end\nend\n\nwhen backdrop switches to [level 2 v]\nforever\n if <touching color (#666666)?> then\n say [oof] for (0.5) seconds\n go to x: (-223) y: (-105)\n change [fails v] by (1)\n end\nend\n\nwhen flag clicked\nshow variable [fails v]\nset [fails v] to [0]\n\nwhen backdrop switches to [level 2 v]\nforever\n if <touching (sprite5 v)?> then\n switch backdrop to (level 3 v)\n end\nend\n\nwhen backdrop switches to [level 3 v]\ngo to x: (-219) y: (-97)\n\nwhen backdrop switches to [level 3 v]\nforever\n if <touching (sprite6 v)?> then\n switch backdrop to (level 4 v)\n end\nend\n\nwhen backdrop switches to [level 4 v]\nforever\n if <touching (sprite4 v)?> then\n switch backdrop to (level 5 v)\n end\nend\n\nwhen backdrop switches to [level 5 v]\ngo to x: (-214) y: (-102)\n\nwhen backdrop switches to [level 4 v]\nforever\n if <touching color (#ff0000)?> then\n say [oof] for (0.5) seconds\n go to x: (-225) y: (-76)\n change [fails v] by (1)\n end\nend\n\nwhen backdrop switches to [level 5 v]\nforever\n if <touching (sprite8 v)?> then\n switch backdrop to (level 6 v)\n end\nend\n\nwhen backdrop switches to [level 6 v]\ngo to x: (-234) y: (-76)\n\nwhen backdrop switches to [level 6 v]\nforever\n if <touching (sprite10 v)?> then\n switch backdrop to (level 7 v)\n end\nend\n\nwhen backdrop switches to [level 7 v]\ngo to x: (-226) y: (-100)\n\nwhen backdrop switches to [level 7 v]\nforever\n if <touching (sprite13 v)?> then\n switch backdrop to (level 8 v)\n end\nend\n\nwhen backdrop switches to [level 8 v]\ngo to x: (-208) y: (-85)\n\nwhen backdrop switches to [level 8 v]\nforever\n if <touching (sprite20 v)?> then\n switch backdrop to (level 9 v)\n end\nend\n\nwhen backdrop switches to [level 9 v]\ngo to x: (-214) y: (-92)\n\nwhen backdrop switches to [level 9 v]\nforever\n if <touching (sprite18 v)?> then\n switch backdrop to (level 10 v)\n end\nend\n\nwhen backdrop switches to [level 10 v]\ngo to x: (-218) y: (-85)\n\nwhen backdrop switches to [backdrop1 v]\nhide variable [fails v]\n\nwhen backdrop switches to [level 10 v]\nforever\n if <touching (sprite21 v)?> then\n switch backdrop to (backdrop1 v)\n end\nend\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\nwhen flag clicked\nshow\nforever\n if <<key (left arrow v) pressed?> and <not <key (up arrow v) pressed?>>> then\n wait (0.1) seconds\n switch costume to (costume1 v)\n wait (0.1) seconds\n switch costume to (costume2 v)\n end\n if <<key (right arrow v) pressed?> and <not <key (up arrow v) pressed?>>> then\n wait (0.1) seconds\n switch costume to (costume3 v)\n wait (0.1) seconds\n switch costume to (costume4 v)\n end\n if <<key (left arrow v) pressed?> and <key (up arrow v) pressed?>> then\n switch costume to (costume5 v)\n end\n if <<key (right arrow v) pressed?> and <key (up arrow v) pressed?>> then\n switch costume to (costume6 v)\n end\n if <<not <<key (right arrow v) pressed?> or <<key (left arrow v) pressed?> or <key (up arrow v) pressed?>>>> and <<(costume [number v]) = [2]> or <(costume [number v]) = [5]>>> then\n switch costume to (costume1 v)\n end\n if <<not <<key (right arrow v) pressed?> or <<key (left arrow v) pressed?> or <key (up arrow v) pressed?>>>> and <<(costume [number v]) = [4]> or <(costume [number v]) = [6]>>> then\n switch costume to (costume3 v)\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 1 v]\nshow\ngo to x: (237) y: (-90)\n\nwhen backdrop switches to [level 2 v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 3 v]\nshow\nforever\n go to x: (17) y: (220)\n glide (1.3) secs to x: (27) y: (-70)\n go to x: (17) y: (220)\nend\n\nwhen backdrop switches to [level 3 v]\nforever\n if <touching (nano v)?> then\n broadcast (starting position v)\n end\nend\n\nwhen backdrop switches to [level 4 v]\nhide\n\nwhen flag clicked\nplay sound [Undertale - Megalovania v] until done\nplay sound [Undertale - Megalovania v] until done\n\n@Sprite3\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 3 v]\nshow\nforever\n go to x: (35) y: (219)\n glide (1.3) secs to x: (166) y: (-74)\n go to x: (35) y: (219)\nend\n\nwhen backdrop switches to [level 3 v]\nforever\n if <touching (nano v)?> then\n broadcast (starting position v)\n end\nend\n\nwhen backdrop switches to [level 4 v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 2 v]\nshow\ngo to x: (237) y: (-90)\n\nwhen backdrop switches to [level 3 v]\nhide\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 3 v]\nshow\ngo to x: (237) y: (-90)\n\nwhen backdrop switches to [level 4 v]\nhide\n\n@Sprite4\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 4 v]\nshow\ngo to x: (237) y: (-90)\n\nwhen backdrop switches to [level 5 v]\nhide\n\n@Sprite7\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 4 v]\nshow\ngo to x: (237) y: (-90)\n\nwhen backdrop switches to [level 5 v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 5 v]\nshow\ngo to x: (231) y: (-98)\n\nwhen backdrop switches to [level 6 v]\nhide\n\n@Sprite9\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 8 v]\nforever\n hide\nend\n\nwhen backdrop switches to [level 7 v]\nrepeat (10000)\n wait (1) seconds\n show\n go to x: (36) y: (259)\n glide (1) secs to x: (33) y: (-40)\n hide\nend\nstop [this script v]\n\n@Sprite10\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 6 v]\nshow\ngo to x: (230) y: (-76)\n\nwhen backdrop switches to [level 7 v]\nhide\n\n@Sprite11\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 7 v]\nforever\n show\n go to x: (-101) y: (215)\n glide (1) secs to x: (-114) y: (-76)\n hide\n wait (1) seconds\nend\n\nwhen backdrop switches to [level 8 v]\nforever\n hide\nend\n\n@Sprite12\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 7 v]\nforever\n show\n go to x: (155) y: (215)\n glide (1) secs to x: (154) y: (-75)\n hide\n wait (1) seconds\nend\n\nwhen backdrop switches to [level 8 v]\nforever\n hide\nend\n\n@Sprite13\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 7 v]\nshow\ngo to x: (227) y: (-93)\n\nwhen backdrop switches to [level 8 v]\nhide\n\n@Sprite14\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nhide\nforever\n hide\n go to x: (71) y: (79)\n wait (1) seconds\n show\n glide (1) secs to x: (75) y: (210)\nend\n\nwhen backdrop switches to [level 10 v]\nforever\n hide\nend\n\n@Sprite15\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\n\nforever\n hide\n go to x: (55) y: (77)\n wait (1) seconds\n show\n glide (1) secs to x: (60) y: (210)\nend\n\nwhen backdrop switches to [level 10 v]\nforever\n hide\nend\n\n@Sprite16\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nhide\nforever\n hide\n go to x: (88) y: (81)\n show\n glide (1) secs to x: (93) y: (207)\nend\n\nwhen backdrop switches to [level 10 v]\nforever\n hide\nend\n\n@Sprite17\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nhide\nforever\n hide\n go to x: (118) y: (88)\n show\n glide (1) secs to x: (122) y: (207)\nend\n\nwhen backdrop switches to [level 10 v]\nforever\n hide\nend\n\n@Sprite20\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 8 v]\nshow\ngo to x: (227) y: (-93)\n\nwhen backdrop switches to [level 9 v]\nhide\n\n@Sprite18\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (227) y: (-93)\n\n@Sprite19\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (227) y: (-93)\n\n@giphy\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop1 v]\nshow\n\n@Sprite21\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\nwhen backdrop switches to [level 10 v]\nshow\ngo to x: (227) y: (-106)\n\n@Sprite22\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 8 v]\nrepeat (10000)\n wait (1) seconds\n show\n go to x: (-86) y: (245)\n glide (1) secs to x: (-89) y: (-42)\n hide\nend\nstop [this script v]\n\nwhen backdrop switches to [level 9 v]\nforever\n hide\nend\n\n
use the arrow keys\nblue is bouncy\ndon't touch gray or red\n\nFull screen recommended
Night Ninja (Platformer)
@Stage\n\nwhen [s v] key pressed\nswitch backdrop to (next backdrop v)\n\nwhen flag clicked\nforever\n play sound [AfterInfinity-Solstice v] until done\nend\n\n@Night Ninja\n\nwhen flag clicked\nforever\n if <(x position) > [234]> then\n switch backdrop to (next backdrop v)\n go to x: (-215) y: (-75)\n end\nend\n\nwhen flag clicked\nhide\nset size to (40) %\nswitch backdrop to (backdrop1 v)\ngo to x: (-199) y: (-93)\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <touching color (#cc0099)?> then\n set [mode v] to [jump]\n set [yv v] to [13]\n end\n if <touching color (#5b9aea)?> then\n if <<key (down arrow v) pressed?> or <key (s v) pressed?>> then\n change [yv v] by (-1)\n else\n change [yv v] by (1)\n end\n end\n if <<key (r v) pressed?> and <key (g v) pressed?>> then\n wait until <not <<key (g v) pressed?> and <key (r v) pressed?>>>\n go to x: (-231) y: (-135)\n set [xv v] to [0]\n set [yv v] to [0]\n broadcast (Restart v)\n end\n if <key (r v) pressed?> then\n if <not <key (g v) pressed?>> then\n wait until <not <key (r v) pressed?>>\n go to x: (-231) y: (-135)\n set [xv v] to [0]\n set [yv v] to [0]\n end\n end\n go to [front v] layer\n if <(back2) = [1]> then\n hide\n stop [this script v]\n end\n if <(x position) > [235]> then\n broadcast (Next v)\n set x to (-222)\n set [xv v] to [0]\n set [yv v] to [0]\n end\n if <<(y position) < [-175]> or <touching color (#ff0000)?>> then\n go to x: (-215) y: (-75)\n set [xv v] to [0]\n set [yv v] to [0]\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (90)\n change [xv v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (-90)\n change [xv v] by (1)\n end\n set [xv v] to ((xv) * (0.85))\n change x by (xv)\n if <touching color (#000008)?> then\n change y by (-2)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-5)\n change x by ((-1) * (xv))\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(xv) = [0]>>> then\n set [mode v] to [walljump]\n set [yv v] to [8]\n set [xv v] to (((xv) / ([abs v] of (xv) )) * (-10))\n else\n set [mode v] to [wallslide]\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (2)\n end\n change y by (-3)\n if <touching color (#000008)?> then\n if <(yv) = [-3]> then\n if <<key (left arrow v) pressed?> or <key (right arrow v) pressed?>> then\n set [mode v] to [run]\n else\n if <([abs v] of (xv) ) > [.1]> then\n set [mode v] to [skid]\n else\n set [mode v] to [stand]\n end\n end\n end\n if <key (up arrow v) pressed?> then\n set [mode v] to [jump]\n set [yv v] to [9]\n end\n end\n if <<<<(mode) = [jump]> or <(mode) = [walljump]>> and <(yv) < [0]>> or <<<(mode) = [run]> or <(mode) = [skid]>> and <(yv) < [-3]>>> then\n set [mode v] to [fall]\n end\n change y by (3)\n if <(yv) > [-15]> then\n change [yv v] by (-0.5)\n end\n change y by (-2)\n if <not <touching color (#000008)?>> then\n change y by (-1)\n if <not <touching color (#000008)?>> then\n change y by (-1)\n if <not <touching color (#000008)?>> then\n change y by (-1)\n if <not <touching color (#000008)?>> then\n change y by (-1)\n if <not <touching color (#000008)?>> then\n change y by (-1)\n if <not <touching color (#000008)?>> then\n change y by (5)\n end\n end\n end\n end\n end\n end\n change y by (2)\n change y by (yv)\n if <touching color (#000008)?> then\n change y by (-2)\n if <touching color (#000008)?> then\n change y by ((-1) * (yv))\n set [yv v] to [-3]\n end\n change y by (2)\n end\nend\n\nwhen backdrop switches to [backdrop7 v]\nset size to (25) %\n\nwhen backdrop switches to [backdrop2 v]\nshow\n\nwhen backdrop switches to [backdrop11 v]\nset size to (40) %\ngo to x: (-215) y: (-93)\n\nwhen backdrop switches to [backdrop8 v]\ngo to x: (-233) y: (103)\nif <key (r v) pressed?> then\n go to x: (-233) y: (103)\nend\n\nwhen [s v] key pressed\ngo to x: (-215) y: (-75)\n\nwhen flag clicked\nforever\n if <touching (warrior7 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior6 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior2 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior5 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior4 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior3 v)?> then\n go to x: (-215) y: (-82)\n end\n if <touching (warrior v)?> then\n go to x: (-215) y: (-82)\n end\nend\n\nwhen backdrop switches to [backdrop17 v]\nset size to (20) %\n\nwhen backdrop switches to [backdrop17 v]\nforever\n if <touching color (#ff0000)?> then\n go to x: (-208) y: (-114)\n end\nend\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\nwhen backdrop switches to [backdrop17 v]\ngo to x: (-224) y: (-103)\nforever\n if <key (r v) pressed?> then\n go to x: (-224) y: (-103)\n end\nend\n\nwhen backdrop switches to [backdrop20 v]\nset size to (40) %\ngo to x: (-222) y: (-96)\n\nwhen flag clicked\nforever\n if <touching (scroll v)?> then\n switch backdrop to (backdrop1 v)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\nrepeat until <not <(backdrop [number v]) = [8]>>\n if <touching color (#ff0000)?> then\n go to x: (-233) y: (101)\n end\nend\n\n@Platform\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop8 v]\ngo to x: (161) y: (82)\nshow\nforever\n glide (4) secs to x: (-176) y: (82)\n wait (0.5) seconds\n glide (4) secs to x: (161) y: (82)\nend\n\nwhen backdrop switches to [backdrop9 v]\nhide\n\n@Menu\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\n\nwhen backdrop switches to [backdrop2 v]\nhide\n\n@Play Game Button\n\nwhen this sprite clicked\nswitch backdrop to (backdrop2 v)\n\nwhen flag clicked\nshow\nforever\n if <touching (mouse-pointer v)?> then\n repeat (10)\n change size by (2)\n end\n wait until <not <touching (mouse-pointer v)?>>\n repeat (10)\n change size by (-2)\n end\n end\nend\n\nwhen backdrop switches to [backdrop2 v]\nhide\n\n@Warrior\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop12 v]\nshow\nforever\n switch costume to (costume1 v)\n go to x: (134) y: (-83)\n wait (1) seconds\n glide (4) secs to x: (-78) y: (-83)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (4) secs to x: (134) y: (-83)\nend\n\nwhen backdrop switches to [backdrop14 v]\nhide\n\n@Warrior2\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop13 v]\nshow\nforever\n switch costume to (costume1 v)\n go to x: (205) y: (85)\n wait (1) seconds\n glide (4) secs to x: (23) y: (85)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (4) secs to x: (205) y: (85)\nend\n\nwhen backdrop switches to [backdrop14 v]\nhide\n\n@Warrior3\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop15 v]\nhide\n\nwhen backdrop switches to [backdrop14 v]\nshow\ngo to x: (208) y: (-20)\nswitch costume to (costume1 v)\nforever\n glide (3) secs to x: (-18) y: (-20)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (3) secs to x: (208) y: (-20)\n switch costume to (costume1 v)\n wait (1) seconds\nend\n\n@Warrior4\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop16 v]\nhide\n\nwhen backdrop switches to [backdrop15 v]\nshow\ngo to x: (155) y: (-80)\nswitch costume to (costume1 v)\nforever\n glide (3) secs to x: (-122) y: (-82)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (3) secs to x: (115) y: (-80)\n switch costume to (costume1 v)\n wait (1) seconds\nend\n\n@Warrior5\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop16 v]\nhide\n\nwhen backdrop switches to [backdrop15 v]\nshow\ngo to x: (-11) y: (110)\nswitch costume to (costume1 v)\nforever\n glide (3) secs to x: (-206) y: (110)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (3) secs to x: (-11) y: (110)\n switch costume to (costume1 v)\n wait (1) seconds\nend\n\n@Warrior6\n\nwhen backdrop switches to [backdrop28 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop27 v]\nshow\ngo to x: (167) y: (-89)\nswitch costume to (costume1 v)\nforever\n glide (3) secs to x: (-128) y: (-89)\n switch costume to (costume2 v)\n wait (1) seconds\n glide (3) secs to x: (167) y: (-89)\n switch costume to (costume1 v)\n wait (1) seconds\nend\n\n@Warrior7\n\nwhen backdrop switches to [backdrop28 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop27 v]\nshow\ngo to x: (-128) y: (-89)\nswitch costume to (costume2 v)\nforever\n glide (3) secs to x: (167) y: (-89)\n switch costume to (costume1 v)\n wait (1) seconds\n glide (3) secs to x: (-128) y: (-89)\n switch costume to (costume2 v)\n wait (1) seconds\nend\n\n@Scroll\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop28 v]\nshow\n\nwhen flag clicked\ngo to x: (140) y: (-37)\nforever\n glide (1) secs to x: (140) y: (-20)\n glide (1) secs to x: (140) y: (-37)\nend\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\n
Night Ninja (Platformer)\n\nSetting:\nYou are a Night Ninja with a mission! Your goal is to get through the enemies outposts, infiltrate their base, and steal the papers that will show your team what the enemies next plans our. Don't fail, Night Ninja!\n\nInstructions:\n--Use arrow keys to move--\n--Click the R key to restart any level--\n--Click the S key to skip any level--\n\nDodge the warriors, slip by traps, and hurtle over barricades!
Square - A Platformer 3
@Stage\n\nwhen flag clicked\nswitch backdrop to (1 v)\n\nwhen I receive [next v]\nnext backdrop\n\nwhen I receive [end v]\nswitch backdrop to (13 v)\n\n@Sprite1\n\nwhen flag clicked\nshow\ngo to x: (-236) y: (-166)\ngo to x: (-202) y: (-124)\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (1)\n if <<touching color (#000008)?> or <touching color (#00ff55)?>> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if <touching color (#00ff55)?> then\n set [y v] to [15]\n end\n if <touching color (#660000)?> then\n go to x: (-204) y: (-133)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n go to x: (-202) y: (-124)\n end\nend\n\nwhen flag clicked\nforever\n if <(x position) > [240]> then\n go to x: (-210) y: (-109)\n broadcast (next v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff9400)?> then\n go to x: (16) y: (-129)\n end\nend\n\nwhen flag clicked\nforever\n play sound [Vexento - Snowflakes v] until done\nend\n\nwhen flag clicked\nforever\n if <touching color (#003fff)?> then\n hide\n broadcast (end v)\n end\nend\n\n@Sprite2\n\nwhen flag clicked\nhide\n\ngo to x: (0) y: (0)\nshow\n\n
Welcome to part 3 of my Square - A Platformer series!!!\n===================================================\nInstructions:\nArrow keys to move.\nDo not touch red.\nGreen is bouncy.\n====================================================
Split Screen | Platformer | 2.0
@Stage\n\nwhen I receive [next level v]\nset [done? v] to [no]\nnext backdrop\n\nwhen I receive [button pressed v]\nif <not <(letter (1) of (backdrop [name v])) = [2]>> then\n next costume\nend\n\nwhen I receive [death v]\nrepeat until <(letter (1) of (backdrop [name v])) = [L]>\n switch backdrop to ((backdrop [number v]) - (1))\nend\n\nwhen I receive [full v]\nswitch backdrop to (blank v)\n\nwhen flag clicked\nset volume to (50) %\nswitch backdrop to (level1 v)\nforever\n play sound [bensound-photoalbum.mp3 v] until done\n wait (0.2) seconds\nend\n\nwhen [m v] key pressed\nif <(volume) = [0]> then\n set volume to (50) %\nelse\n set volume to (0) %\nend\n\n@Intro\n\nwhen I start as a clone\nset [ghost v] effect to (0)\ngo to [front v] layer\nwait (1) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\nwait (2) seconds\nshow\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (1) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nwait (0.5) seconds\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (1) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nset [go v] to [yes]\nwait until <key (space v) pressed?>\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (1) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nwait (1) seconds\ndelete this clone\n\nwhen flag clicked\nset [switch v] to [no]\nset [go v] to [0]\nshow\nswitch costume to (black v)\ncreate clone of (_myself_ v)\nswitch costume to (ssthumbnail v)\nwait (5) seconds\nswitch costume to (logo v)\nwait (1) seconds\nrepeat (10)\n next costume\nend\nwait (1.8) seconds\nswitch costume to (intro v)\nwait until <(go) = [yes]>\nwait until <key (space v) pressed?>\nwait (1) seconds\nhide\nwait (2) seconds\nset [switch v] to [yes]\nswitch costume to (black v)\nreset timer\nbroadcast (start v)\n\n@Player1\n\ndefine Fall down\nchange y by (yVelocity)\nset [canjump v] to [no]\nif <touching (ground v)?> then\n if <(yVelocity) > [0]> then\n repeat until <not <touching (ground v)?>>\n change y by (-1)\n end\n set [yvelocity v] to (join [-] (yVelocity))\n else\n repeat until <not <touching (ground v)?>>\n change y by (1)\n end\n change y by (-1)\n set [yvelocity v] to [0]\n set [canjump v] to [yes]\n end\nend\n\ndefine None\npoint in direction (dirrection)\nmove (5) steps\nset [slopesteepness v] to [0]\nrepeat until <<not <touching (ground v)?>> or <(slopeSteepness) = [8]>>\n change y by (1)\n change [slopesteepness v] by (1)\nend\nif <[8] = (slopeSteepness)> then\n move (-5) steps\n change y by (join [-] (slopeSteepness))\nend\n\nwhen flag clicked\nforever\n if <(whatDoing) = [Walking]> then\n set [costume v] to [3]\n else\n if <(whatDoing) = [Jumping]> then\n set [costume v] to [4]\n end\n end\n if <(whatDoing) = [Standing]> then\n set [costume v] to [2]\n end\nend\n\nwhen I receive [next level v]\ngo to x: (-206) y: (-171)\n\nwhen I receive [death v]\ngo to x: (-206) y: (-171)\n\nwhen I receive [end v]\ngo to x: ([x position v] of [player2 v]) y: (-171)\nswitch costume to (still v)\nstop [other scripts in sprite v]\nwait (3.5) seconds\nhide\n\nwhen I receive [start v]\nset size to (75) %\nwait (0.3) seconds\ngo to x: (-206) y: (-171)\nshow\nwait (0.1) seconds\nset [yvelocity v] to [0]\nforever\n switch costume to (hitbox v)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n Walk | Dirrection (90)\n set [whatdoing v] to [Walking]\n else\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n Walk | Dirrection (-90)\n set [whatdoing v] to [Walking]\n else\n if <touching (ground v)?> then\n set [whatdoing v] to [Standing]\n else\n set [whatdoing v] to [Jumping]\n end\n end\n end\n if <not <touching (ground v)?>> then\n if <(yVelocity) = [0]> then\n set [yvelocity v] to [-2]\n end\n if <not <(yVelocity) = [0]>> then\n change [yvelocity v] by (-1)\n Fall down\n end\n end\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <(canJump) = [yes]>> then\n if <(yVelocity) = [0]> then\n change y by (1)\n set [yvelocity v] to [12]\n end\n if <not <(yVelocity) = [0]>> then\n change [yvelocity v] by (-1)\n Fall down\n end\n end\n if <touching color (#ff0000)?> then\n if <(done?) = [White]> then\n broadcast (next level v)\n else\n set [done? v] to [Black]\n end\n end\n if <touching color (#870101)?> then\n broadcast (button pressed v)\n switch costume to (still v)\n wait (0.01) seconds\n end\n if <touching color (#003fff)?> then\n broadcast (death v)\n end\n switch costume to (costume)\nend\n\nwhen flag clicked\nhide\n\n@Player2\n\ndefine Walk | Dirrection (dirrection)\npoint in direction (dirrection)\nmove (5) steps\nset [slopesteepness v] to [0]\nrepeat until <<not <touching (ground v)?>> or <(slopeSteepness) = [8]>>\n change y by (1)\n change [slopesteepness v] by (1)\nend\nif <[8] = (slopeSteepness)> then\n move (-5) steps\n change y by (join [-] (slopeSteepness))\nend\n\nwhen flag clicked\nforever\n if <(whatDoing) = [Walking]> then\n set [costume v] to [3]\n else\n if <(whatDoing) = [Jumping]> then\n set [costume v] to [4]\n end\n end\n if <(whatDoing) = [Standing]> then\n set [costume v] to [2]\n end\nend\n\ndefine Fall down\nchange y by (yVelocity)\nif <touching (ground v)?> then\n if <touching color (#001966)?> then\n broadcast (button pressed v)\n switch costume to (still v)\n wait (0.01) seconds\n end\n if <(yVelocity) > [0]> then\n repeat until <not <touching (ground v)?>>\n change y by (-1)\n end\n set [yvelocity v] to (join [-] (yVelocity))\n else\n repeat until <not <touching (ground v)?>>\n change y by (1)\n end\n change y by (-1)\n set [yvelocity v] to [0]\n set [timer v] to (timer)\n set [canjump v] to [yes]\n end\nend\n\nwhen I receive [death v]\ngo to x: (-205) y: (10)\n\nwhen I receive [next level v]\ngo to x: (-205) y: (10)\n\ndefine slow fall\nstop [other scripts in sprite v]\n\nwhen flag clicked\nset [end v] to [no]\nhide\n\nwhen [space v] key pressed\nif <(end) = [yes]> then\n set [end v] to [no]\n next costume\n broadcast (end2 v)\nend\n\nwhen I receive [start v]\nswitch costume to (still v)\nwait (0.3) seconds\ngo to x: (-205) y: (10)\nshow\nwait (0.1) seconds\nset [yvelocity v] to [0]\nset size to (75) %\nforever\n switch costume to (hitbox v)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n Walk | Dirrection (90)\n set [whatdoing v] to [Walking]\n else\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n Walk | Dirrection (-90)\n set [whatdoing v] to [Walking]\n else\n if <touching (ground v)?> then\n set [whatdoing v] to [Standing]\n else\n set [whatdoing v] to [Jumping]\n end\n end\n end\n if <not <touching (ground v)?>> then\n if <(yVelocity) = [0]> then\n set [yvelocity v] to [-2]\n end\n if <not <(yVelocity) = [0]>> then\n change [yvelocity v] by (-1)\n Fall down\n end\n end\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <(canJump) = [yes]>> then\n reset timer\n set [timer v] to [1]\n set [canjump v] to [no]\n if <(yVelocity) = [0]> then\n change y by (1)\n set [yvelocity v] to [12]\n end\n if <not <(yVelocity) = [0]>> then\n change [yvelocity v] by (-1)\n Fall down\n end\n end\n if <touching color (#003fff)?> then\n if <(done?) = [Black]> then\n broadcast (next level v)\n else\n set [done? v] to [White]\n end\n end\n if <touching color (#001966)?> then\n broadcast (button pressed v)\n switch costume to (still v)\n wait (0.01) seconds\n end\n if <touching color (#ff0000)?> then\n broadcast (death v)\n end\n if <(y position) < [8]> then\n switch costume to (still v)\n broadcast (end v)\n set [yvelocity v] to [-9]\n repeat until <touching (player1 v)?>\n change y by (yVelocity)\n set [yvelocity v] to ((yVelocity) * (0.943))\n end\n repeat until <(y position) < [-170]>\n change y by (yVelocity)\n end\n wait (1) seconds\n switch costume to (cloud v)\n wait (2.5) seconds\n switch costume to (still2 v)\n set y to (-171)\n wait (2) seconds\n broadcast (full v)\n point in direction (90)\n set size to (1000) %\n go to x: (0) y: (-275)\n wait (2) seconds\n repeat (2)\n next costume\n wait (0.5) seconds\n switch costume to ((costume [number v]) - (1))\n wait (2) seconds\n end\n switch costume to (still4 v)\n wait (1) seconds\n set size to (100) %\n switch costume to (end v)\n go to x: (0) y: (0)\n set [end v] to [yes]\n stop [other scripts in sprite v]\n stop [this script v]\n end\n switch costume to (costume)\nend\n\n@Ground\n\nwhen flag clicked\nshow\nswitch costume to (level1 v)\nforever\n switch costume to (backdrop [number v])\nend\n\nwhen I receive [full v]\nhide\n\nstop [other scripts in sprite v]\n\n@Letters\n\nwhen I start as a clone\nwait until <(done?) = [yes]>\ndelete this clone\n\ndefine None\nset size to (size) %\nshow\nset [ghost v] effect to (0)\nset [letter v] to (words)\nset [counter text v] to [1]\ngo to x: (-150) y: (ypos)\nrepeat (length of (letter))\n switch costume to ( 2 v)\n switch costume to (letter (counter text) of (letter))\n if <(costume [number v]) = [1]> then\n switch costume to (join (letter (counter text) of (letter)) [2])\n end\n create clone of (_myself_ v)\n change [counter text v] by (1)\n change x by ((size) * (1.4))\nend\nhide\n\ndefine None\nset [characterlist v] to [ abcdefghijklmnopqrstuvwxyz-_01234567890]\nset [counter v] to [1]\nset [smallcounter v] to [1]\nset [numbercode v] to []\nrepeat (length of (namex))\n repeat until <(smallCounter) = [0]>\n if <(letter (Counter) of (namex)) = (letter (smallCounter) of (characterList))> then\n if <(smallCounter) < [10]> then\n set [smallcounter v] to (join [0] (smallCounter))\n end\n set [numbercode v] to (join (NumberCode) (smallCounter))\n set [smallcounter v] to [0]\n else\n change [smallcounter v] by (1)\n end\n end\n change [counter v] by (1)\n set [smallcounter v] to [1]\nend\n\ndefine Code to name1\nset [characterlist v] to [ abcdefghijklmnopqrstuvwxyz-_01234567890]\nset [counter v] to [1]\nset [name1 v] to []\nrepeat (length of ((☁ Name1) / (2)))\n set [name1 v] to (join (Name1) (letter (join (letter (Counter) of (☁ Name1)) (letter ((Counter) + (1)) of (☁ Name1))) of (characterList)))\n change [counter v] by (2)\nend\n\nwhen I receive [start v]\nset [time v] to [0]\nforever\n wait (1) seconds\n change [time v] by (1)\nend\n\nwhen I receive [end2 v]\nif <(stop) = [no]> then\n set [stop v] to [yes]\n set [username v] to (username)\n if <(time) < (☁ Highscore1)> then\n set [name3 v] to (Name2)\n set [name2 v] to (Name1)\n set [name1 v] to (username)\n set [☁ highscore3 v] to (☁ Highscore2)\n set [☁ highscore2 v] to (☁ Highscore1)\n set [☁ highscore1 v] to (time)\n Name to code (Name1)\n set [☁ name1 v] to (NumberCode)\n Name to code (Name2)\n set [☁ name2 v] to (NumberCode)\n Name to code (Name3)\n set [☁ name3 v] to (NumberCode)\n else\n if <(time) < (☁ Highscore2)> then\n set [name3 v] to (Name2)\n set [name2 v] to (username)\n set [☁ highscore3 v] to (☁ Highscore2)\n set [☁ highscore2 v] to (time)\n Name to code (Name2)\n set [☁ name2 v] to (NumberCode)\n Name to code (Name3)\n set [☁ name3 v] to (NumberCode)\n else\n if <(time) < (☁ Highscore3)> then\n set [name3 v] to (username)\n set [☁ highscore3 v] to (time)\n Name to code (Name3)\n set [☁ name3 v] to (NumberCode)\n end\n end\n end\n Code to name1\n Code to name2\n Code to name3\n set [done? v] to [yes]\n wait (0.1) seconds\n set [done? v] to [no]\n Write (time) (60) (20)\n Write (join (☁ Highscore1) (join [ by ] (Name1))) (-25) (10)\n Write (join (☁ Highscore2) (join [ by ] (Name2))) (-55) (10)\n Write (join (☁ Highscore3) (join [ by ] (Name3))) (-85) (10)\nend\n\ndefine Code to name2\nset [characterlist v] to [ abcdefghijklmnopqrstuvwxyz-_01234567890]\nset [counter v] to [1]\nset [name2 v] to []\nrepeat (length of ((☁ Name2) / (2)))\n set [name2 v] to (join (Name2) (letter (join (letter (Counter) of (☁ Name2)) (letter ((Counter) + (1)) of (☁ Name2))) of (characterList)))\n change [counter v] by (2)\nend\n\nset [name1 v] to [name]\nset [name2 v] to [name]\nset [name3 v] to [name]\nName to code (Name1)\nset [☁ name1 v] to (NumberCode)\nName to code (Name2)\nset [☁ name2 v] to (NumberCode)\nName to code (Name3)\nset [☁ name3 v] to (NumberCode)\nset [☁ highscore1 v] to [99999]\nset [☁ highscore2 v] to [99999]\nset [☁ highscore3 v] to [99999]\nCode to name1\nCode to name2\nCode to name3\n\ndefine Code to name3\nset [characterlist v] to [ abcdefghijklmnopqrstuvwxyz-_01234567890]\nset [counter v] to [1]\nset [name3 v] to []\nrepeat (length of ((☁ Name3) / (2)))\n set [name3 v] to (join (Name3) (letter (join (letter (Counter) of (☁ Name3)) (letter ((Counter) + (1)) of (☁ Name3))) of (characterList)))\n change [counter v] by (2)\nend\n\nset [time v] to [9999999]\n\nwhen flag clicked\nset [stop v] to [no]\n\nstop [all v]\n\n
Blockhead | Platformer v1.3
@Stage\n\nwhen flag clicked\nforever\n play sound [Geometry Dash - Jumper v] until done\nend\n\n@Barz\n\nwhen flag clicked\nhide\nforever\n go to x: (0) y: (75)\n create clone of (_myself_ v)\n go to x: (0) y: (-75)\n create clone of (_myself_ v)\n wait (1) seconds\nend\n\nwhen I start as a clone\ngo [backward v] (999) layers\nshow\nset [ghost v] effect to (0)\nif <(backdrop [name v]) = [1]> then\n switch costume to (costume1 v)\nelse\n switch costume to (costume2 v)\nend\nif <(y position) < [0]> then\n repeat (50)\n change y by (-0.2)\n change [ghost v] effect by (2)\n end\nelse\n repeat (50)\n change y by (0.2)\n change [ghost v] effect by (2)\n end\nend\ndelete this clone\n\n@Da BOI\n\nwhen flag clicked\nbroadcast (Spawn v)\nforever\n change x by (Xvel)\n change y by (Yvel)\n go to [front v] layer\n switch costume to (costume1 v)\n if <<(y position) > [-70]> or <<(y position) < [-90]> or <touching (iaoe v)?>>> then\n change [yvel v] by (-1)\n if <key (space v) pressed?> then\n if <(Can dash?) = [yes]> then\n if <key (right arrow v) pressed?> then\n set [yvel v] to [0]\n set [xvel v] to [0]\n set [can dash? v] to [no]\n repeat (5)\n change x by (10)\n end\n else\n if <key (left arrow v) pressed?> then\n set [yvel v] to [0]\n set [xvel v] to [0]\n set [can dash? v] to [no]\n repeat (5)\n change x by (-10)\n end\n else\n if <key (up arrow v) pressed?> then\n set [yvel v] to [3]\n set [xvel v] to [0]\n set [can dash? v] to [no]\n repeat (5)\n change y by (10)\n end\n end\n end\n end\n end\n end\n else\n if <<not <touching (iaoe v)?>> and <(y position) > [-90]>> then\n set [can dash? v] to [yes]\n set [yvel v] to [0]\n set y to (-70)\n if <key (up arrow v) pressed?> then\n set [yvel v] to [7]\n end\n end\n end\n if <key (right arrow v) pressed?> then\n if <(Xvel) < [5]> then\n change [xvel v] by (1)\n end\n else\n if <key (left arrow v) pressed?> then\n if <(Xvel) > [-5]> then\n change [xvel v] by (-1)\n end\n else\n if <(Xvel) > [0]> then\n change [xvel v] by (-1)\n else\n if <(Xvel) < [0]> then\n change [xvel v] by (1)\n end\n end\n end\n end\n if <(y position) < [-178]> then\n hide\n wait (0.5) seconds\n broadcast (Spawn v)\n end\n if <(x position) > [235]> then\n hide\n broadcast (Next level v)\n wait (0.5) seconds\n broadcast (Spawn v)\n end\nend\n\nwhen I receive [spawn v]\nSpawn (0) (-220) (-60)\n\ndefine None\nshow\nset [can dash? v] to [no]\nset [xvel v] to [0]\nset [yvel v] to (grav)\ngo to x: (xp) y: (yp)\n\n@IAOE\n\nwhen flag clicked\ngo [backward v] (99) layers\ngo to x: (0) y: (0)\nswitch costume to (1 v)\n\nwhen I receive [next level v]\nnext costume\n\nforever\n go to [front v] layer\n go [backward v] (1) layers\nend\n\nbroadcast (Next level v)\n\nswitch costume to (15 v)\n\n@Print engine2\n\nwhen I start as a clone\nrepeat (4)\n change size by (-10)\n go to [front v] layer\nend\nset [brightness v] effect to (40)\nforever\n repeat (10)\n change size by (2)\n change [brightness v] effect by (-6)\n go to [front v] layer\n end\n repeat (10)\n change size by (-2)\n change [brightness v] effect by (6)\n go to [front v] layer\n end\nend\n\nwhen flag clicked\nPrint: [hello!_welcome_to_my_first_completely__original_platformer!_] X: [-180] Y: [160]\nwait (0.5) seconds\nPrint: [this_is_the_most____original_knockoff_of_celeste_i've_ever___seen] X: [5] Y: [140]\nwait (0.5) seconds\nPrint: [\(advance_to_the_right_of] X: [-200] Y: [-120]\nPrint: [every_level_to_move_on\)] X: [-200] Y: [-140]\n\nwhen I receive [print now v]\nif <([costume # v] of [iaoe v]) = [1]> then\n wait (1) seconds\n Print: [well_done_lil'_boi.] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [you_beat_the_game__and_made_it_back_to_lvl_1.] X: [20] Y: [160]\n wait (0.5) seconds\n Print: [if_you________continue,] X: [70] Y: [140]\n wait (0.5) seconds\n Print: [you_will_go_threw_the_levels___you_had_already_beaten] X: [-100] Y: [120]\n wait (1.5) seconds\n Print: [new_levels_coming_soon!] X: [-115] Y: [-130]\nend\nif <([costume # v] of [iaoe v]) = [2]> then\n wait (6) seconds\n Print: [having_trouble?_] X: [-180] Y: [160]\n wait (1) seconds\n Print: [press_the_space_bar_to_perform_a_midair_dash] X: [-20] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [3]> then\n wait (1) seconds\n Print: [hit_a_pink_gem_to_be_able_to_do_a______second_midair_dash!] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [\(to_reach_it_press_up_arrow_and_space\)] X: [-180] Y: [100]\nend\nif <([costume # v] of [iaoe v]) = [4]> then\n wait (1) seconds\n Print: [hmm..._] X: [-180] Y: [160]\n wait (1) seconds\n Print: [what_does_dat_green_boi_do?] X: [-120] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [5]> then\n wait (1) seconds\n Print: [not_bad_so_far._] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [can_you_use_both_______without_the_ground_to_save_your_skin?] X: [-20] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [6]> then\n wait (1) seconds\n Print: [red_stuff_is_bad_for_your_health] X: [-180] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [7]> then\n wait (1) seconds\n Print: [pink_stuff...] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [_green_stuff...] X: [-50] Y: [160]\n wait (0.5) seconds\n Print: [_and_red___stuff?!?] X: [100] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [8]> then\n wait (1) seconds\n Print: [ooh_neat!_] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [double_bounce_action...] X: [-80] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [9]> then\n wait (1) seconds\n Print: [that's_a_lot_of_red_stuff...] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [watch_your_health!] X: [100] Y: [160]\n wait (1) seconds\n Print: [it's_all_you've_got_m8.] X: [-120] Y: [140]\nend\nif <([costume # v] of [iaoe v]) = [10]> then\n wait (1) seconds\n Print: [i'm_beginning_to_think_the_person_who__made_this_game_wanted_the_player_to_die..] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [0.0] X: [-15] Y: [100]\nend\nif <([costume # v] of [iaoe v]) = [11]> then\n wait (1) seconds\n Print: [was_this_even_designed?] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [looks_like_it__was_made_by_a_two-year-old...] X: [60] Y: [160]\n wait (1) seconds\n Print: [an_evil____two-year-old...] X: [100] Y: [140]\nend\n\ndefine Print: [] X: [] Y: []\nset size to (120) %\npoint in direction (90)\ngo to x: (x pos) y: (y pos)\nshow\nset [letter v] to [0]\nrepeat (length of (text))\n change [letter v] by (1)\n switch costume to (letter (letter) of (text))\n start sound [increase v]\n create clone of (_myself_ v)\n move (10) steps\n if <(x position) > [200]> then\n go to x: (-200) y: ((y position) - (20))\n end\nend\nif <(x position) > [200]> then\n go to x: (-200) y: ((y position) - (20))\nend\nhide\n\nwhen I receive [next level v]\nbroadcast (clear v)\n\nwhen I receive [clear v]\nstop [other scripts in sprite v]\nhide\nbroadcast (print now v)\ndelete this clone\n\ndefine None\nshow\nswitch costume to (next v)\ngo to x: (x) y: (y)\nset [brightness v] effect to (0)\nrepeat until <<touching (mouse-pointer v)?> and <mouse down?>>\n go to [front v] layer\nend\nset [brightness v] effect to (35)\nswitch costume to (next2 v)\nrepeat until <not <mouse down?>>\n go to [front v] layer\nend\nbroadcast (clear v)\nhide\n\nbroadcast (clear v)\n\n@Print engine3\n\nwhen I start as a clone\nrepeat (4)\n change size by (-10)\n go to [front v] layer\nend\nforever\n repeat (10)\n change size by (2)\n go to [front v] layer\n end\n repeat (10)\n change size by (-2)\n go to [front v] layer\n end\nend\n\nwhen I receive [print now v]\nif <([costume # v] of [iaoe v]) = [12]> then\n wait (1) seconds\n Print: [super_job_so_far!] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [since_you've_proven__yourself_to_wield_great_skill,] X: [0] Y: [160]\n wait (0.5) seconds\n Print: [you_will__no_longer_have_a_shadow_to_assist_you.] X: [110] Y: [140]\n wait (0.5) seconds\n Print: [>:\)] X: [-15] Y: [100]\nend\nif <([costume # v] of [iaoe v]) = [13]> then\n wait (1) seconds\n Print: [2_paths?] X: [-180] Y: [160]\n wait (0.5) seconds\n Print: [which_is_less_painful?] X: [-90] Y: [160]\nend\nif <([costume # v] of [iaoe v]) = [14]> then\n wait (1) seconds\n Print: [apples] X: [-25] Y: [120]\nend\nif <([costume # v] of [iaoe v]) = [15]> then\n wait (1) seconds\n Print: [selppa] X: [-25] Y: [120]\nend\nif <([costume # v] of [iaoe v]) = [16]> then\n wait (1) seconds\n Print: [comment_"like_a_troo_boss!"_if_you_made_it_this_far] X: [-180] Y: [160]\nend\n\ndefine Print: [] X: [] Y: []\nset size to (120) %\npoint in direction (90)\ngo to x: (x pos) y: (y pos)\nshow\nset [letter v] to [0]\nrepeat (length of (text))\n change [letter v] by (1)\n switch costume to (letter (letter) of (text))\n start sound [increase v]\n create clone of (_myself_ v)\n move (10) steps\n if <(x position) > [200]> then\n go to x: (-200) y: ((y position) - (20))\n end\nend\nif <(x position) > [200]> then\n go to x: (-200) y: ((y position) - (20))\nend\nhide\n\nwhen I receive [clear v]\nstop [other scripts in sprite v]\nhide\nbroadcast (print now v)\ndelete this clone\n\nbroadcast (clear v)\n\nwhen I receive [next level v]\nbroadcast (clear v)\n\ndefine None\nshow\nswitch costume to (next v)\ngo to x: (x) y: (y)\nset [brightness v] effect to (0)\nrepeat until <<touching (mouse-pointer v)?> and <mouse down?>>\n go to [front v] layer\nend\nset [brightness v] effect to (35)\nswitch costume to (next2 v)\nrepeat until <not <mouse down?>>\n go to [front v] layer\nend\nbroadcast (clear v)\nhide\n\n@Sprite1\n\nwhen flag clicked\nhide\nforever\n create clone of (_myself_ v)\nend\n\ndefine None\nset [ghost v] effect to (40)\nif <(pick random (1) to (2)) = [1]> then\n go to x: (pick random (-240) to (240)) y: (-180)\n repeat (30)\n change [ghost v] effect by (2)\n change y by (speed)\n if <(pick random (1) to (10)) = [1]> then\n change x by (-2)\n else\n if <(pick random (1) to (20)) = [1]> then\n change x by (2)\n end\n end\n end\nelse\n go to x: (pick random (-240) to (240)) y: (180)\n repeat (30)\n change [ghost v] effect by (2)\n change y by ((0) - (speed))\n if <(pick random (1) to (10)) = [1]> then\n change x by (-2)\n else\n if <(pick random (1) to (20)) = [1]> then\n change x by (2)\n end\n end\n end\nend\ndelete this clone\n\nwhen I start as a clone\nshow\nFloat (pick random (2) to (5))\n\n@Red stuff\n\nwhen flag clicked\nforever\n switch costume to ([costume # v] of [iaoe v])\n if <touching (da boi v)?> then\n broadcast (Spawn v)\n end\nend\n\n@Bloo Crystal3\n\nwhen flag clicked\nhide\n\ndefine None\ngo to x: (xloc) y: (yloc)\npoint in direction (90)\nshow\nswitch costume to (costume1 v)\nrepeat until <touching (da boi v)?>\n go to [front v] layer\n change y by (([sin v] of ((timer) * (100)) ) / (3))\nend\nset [can dash? v] to [yes]\nset [yvel v] to [3]\nrepeat (3)\n next costume\n turn right (15) degrees\nend\nhide\n\nwhen I receive [next level v]\nhide\nwait (0.1) seconds\nif <([costume # v] of [iaoe v]) = [3]> then\n forever\n Crystal spawn (0) (-10)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [5]> then\n forever\n Crystal spawn (30) (-20)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [7]> then\n forever\n Crystal spawn (80) (-75)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [10]> then\n forever\n Crystal spawn (0) (-80)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [11]> then\n forever\n Crystal spawn (75) (-80)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [13]> then\n forever\n Crystal spawn (0) (-130)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [14]> then\n forever\n Crystal spawn (0) (-5)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [15]> then\n forever\n Crystal spawn (0) (-5)\n wait (1) seconds\n end\nelse\n hide\nend\n\n@Bloo Crystal2\n\nwhen flag clicked\nhide\n\ndefine None\ngo to x: (xloc) y: (yloc)\npoint in direction (90)\nshow\nswitch costume to (costume1 v)\nrepeat until <touching (da boi v)?>\n go to [front v] layer\n change y by (([sin v] of ((timer) * (100)) ) / (3))\nend\nset [can dash? v] to [yes]\nset [yvel v] to [3]\nrepeat (3)\n next costume\n turn right (15) degrees\nend\nhide\n\nwhen I receive [next level v]\nhide\nwait (0.1) seconds\nif <([costume # v] of [iaoe v]) = [9]> then\n forever\n Crystal spawn (0) (0)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [11]> then\n forever\n Crystal spawn (-145) (15)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [12]> then\n forever\n Crystal spawn (0) (-35)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [12]> then\n forever\n Crystal spawn (107) (-85)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [14]> then\n forever\n Crystal spawn (50) (-15)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [15]> then\n forever\n Crystal spawn (-40) (-15)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [16]> then\n forever\n Crystal spawn (0) (-50)\n wait (1) seconds\n end\nelse\n hide\nend\n\n@Green Crystal\n\nwhen flag clicked\nhide\n\ndefine None\ngo to x: (xloc) y: (yloc)\npoint in direction (90)\nshow\nswitch costume to (costume1 v)\nrepeat until <touching (da boi v)?>\n go to [front v] layer\n change y by (([sin v] of ((timer) * (100)) ) / (3))\nend\nset [yvel v] to [10]\nrepeat (3)\n next costume\n turn right (15) degrees\nend\nhide\n\nwhen I receive [next level v]\nhide\nwait (0.1) seconds\nif <([costume # v] of [iaoe v]) = [4]> then\n forever\n Crystal spawn (0) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [5]> then\n forever\n Crystal spawn (-80) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [7]> then\n forever\n Crystal spawn (0) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [7]> then\n forever\n Crystal spawn (0) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [8]> then\n forever\n Crystal spawn (-60) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [12]> then\n forever\n Crystal spawn (107) (-85)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [13]> then\n forever\n Crystal spawn (-70) (5)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [16]> then\n forever\n Crystal spawn (-75) (-50)\n wait (1) seconds\n end\nelse\n hide\nend\n\n@Green Crystal2\n\nwhen flag clicked\nhide\n\ndefine None\ngo to x: (xloc) y: (yloc)\npoint in direction (90)\nshow\nswitch costume to (costume1 v)\nrepeat until <touching (da boi v)?>\n go to [front v] layer\n change y by (([sin v] of ((timer) * (100)) ) / (3))\nend\nset [yvel v] to [10]\nrepeat (3)\n next costume\n turn right (15) degrees\nend\nhide\n\nwhen I receive [next level v]\nhide\nwait (0.1) seconds\nif <([costume # v] of [iaoe v]) = [8]> then\n forever\n Crystal spawn (100) (-120)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [9]> then\n forever\n Crystal spawn (-60) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [10]> then\n forever\n Crystal spawn (65) (-40)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [11]> then\n forever\n Crystal spawn (-10) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [12]> then\n forever\n Crystal spawn (-80) (-100)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [13]> then\n forever\n Crystal spawn (65) (-105)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [14]> then\n forever\n Crystal spawn (0) (-50)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [15]> then\n forever\n Crystal spawn (10) (-90)\n wait (1) seconds\n end\nelse\n hide\nend\nif <([costume # v] of [iaoe v]) = [16]> then\n forever\n Crystal spawn (75) (-90)\n wait (1) seconds\n end\nelse\n hide\nend\n\n@Shadow\n\nwhen flag clicked\nhide\n\nwhen I receive [shadow on v]\nforever\n go to [front v] layer\n set [ghost v] effect to (40)\n repeat (20)\n change [ghost v] effect by (2)\n end\n repeat (20)\n change [ghost v] effect by (-2)\n end\nend\n\nwhen I receive [next level v]\nstop [other scripts in sprite v]\nhide\nwait (10) seconds\nif <([costume # v] of [iaoe v]) = [2]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 2 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 2 x v]) y: (item (VidCount) of [level 2 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [3]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 3 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 3 x v]) y: (item (VidCount) of [level 3 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [4]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 4 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 4 x v]) y: (item (VidCount) of [level 4 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [5]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 5 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 5 x v]) y: (item (VidCount) of [level 5 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [6]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 6 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 6 x v]) y: (item (VidCount) of [level 6 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [7]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 7 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 7 x v]) y: (item (VidCount) of [level 7 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [8]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 8 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 8 x v]) y: (item (VidCount) of [level 8 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [9]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 9 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 9 x v]) y: (item (VidCount) of [level 9 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [10]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [level 10 x v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [level 10 x v]) y: (item (VidCount) of [level 10 y v])\n end\n end\nend\nif <([costume # v] of [iaoe v]) = [11]> then\n broadcast (shadow on v)\n show\n forever\n set [vidcount v] to [0]\n repeat (length of [video y v])\n change [vidcount v] by (1)\n go to x: (item (VidCount) of [video x v]) y: (item (VidCount) of [video y v])\n end\n end\nend\n\n@Fingernail\n\nwhen flag clicked\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nforever\n go to x: (0) y: (0)\n set [ghost v] effect to (100)\nend\n\ngo to [front v] layer\nshow\n\n
Arrow keys to move, everything else is taught in game. \n\nALL levels are beatable. Believe me, half my time spent "developing" the game, was testing the levels and gameplay. If you are really stuck, comment below. Maybe somebody (or myself) could tip you off? I'm definitely going to make more lvl's in the future\n\nIf you likey what I makey:\nhttps://scratch.mit.edu/projects/250360792/ "Grimsky" \nhttps://scratch.mit.edu/projects/246732289/ "The Final Flame"\nhttps://scratch.mit.edu/projects/237709363/ "△TriPod△"\n\nOne tip I will give you is that because the gems float, timing exactly when you need to hit them is needed on some levels. If you think its impossible, take a breather, but then try to look for patterns in crystal movement and timing. \n\nBig thanks to @-invisible- for curating! According to some *rough* math I did, after I get curated I should be getting around 178 loves and 78 favs in a 24-hour period, let's see how close my prediction gets... Comment below, do you have any guesses? WOAH we blew this outta the water! Tysm!\n\nOne other thing people seem to miss, to do a "double jump" use your air dash while holding the up arrow. (This only works when you aren't holding left or right)
A Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [home v]\nswitch backdrop to (backdrop1 v)\nhide variable [regular time v]\nhide variable [opposite time v]\nhide variable [turned arrow key time v]\n\nwhen I receive [highscore v]\nswitch backdrop to (backdrop18 v)\n\nset [username v] to [0]\n\nwhen I receive [new regular platformer v]\nstop all sounds\n\nwhen I receive [pick level v]\nrepeat (11)\n\nplay sound [Mushroom Theme.mp3 v] until done\nset volume to (500) %\n\n@images\n\nwhen this sprite clicked\nbroadcast (pick level v)\n\nwhen I receive [pick level v]\nhide\n\nwhen flag clicked\nshow\ngo to x: (0) y: (0)\nset size to (70) %\n\nwhen I receive [highscore v]\nhide\n\nwhen I receive [home v]\nshow\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n change size by (10)\n wait (1) seconds\n set size to (70) %\n end\nend\n\nwhen I receive [lolololololol v]\nhide\n\nwhen I receive [new regular platformer v]\nrepeat (4)\n hide\nend\n\n@download (2)\n\nwhen flag clicked\nshow\nset size to (25) %\ngo to x: (189) y: (-135)\n\nwhen I receive [pick level v]\nhide\n\nwhen I receive [highscore v]\nhide\n\nwhen I receive [home v]\nshow\n\nwhen I receive [new regular platformer v]\nrepeat (10)\n switch backdrop to (backdrop10 v)\nend\n\n@images2\n\nwhen flag clicked\nshow\nset size to (60) %\ngo to x: (-156) y: (0)\ngo to [front v] layer\nhide variable [☁ high score for opposite platformer v]\nhide variable [☁ highscore for turned arrow keys platformer v]\nhide variable [☁ highscore for regular platformer v]\n\nwhen this sprite clicked\nbroadcast (highscore v)\nhide\nshow variable [☁ highscore for turned arrow keys platformer v]\nshow variable [☁ high score for opposite platformer v]\nshow variable [☁ highscore for regular platformer v]\n\nwhen I receive [pick level v]\nhide\n\nwhen I receive [home v]\nshow\n\nwhen flag clicked\nif <(round (days since 2000)) > (☁ DaysSince2000)> then\n set [☁ dayssince2000 v] to (round (days since 2000))\n set [☁ highscore for regular platformer v] to [1000]\n set [☁ high score for opposite platformer v] to [1000]\n set [☁ highscore for turned arrow keys platformer v] to [1000]\nend\n\nwhen I receive [home v]\nhide variable [☁ highscore for regular platformer v]\nhide variable [☁ high score for opposite platformer v]\nhide variable [☁ highscore for turned arrow keys platformer v]\n\n@Sprite1\n\nwhen I receive [pick level v]\nshow\ngo to x: (-10) y: (-14)\nset [tp of game v] to [0]\nswitch costume to (costume1 v)\nwait (0.3) seconds\nchange [tp of game v] by (1)\n\nwhen I receive [regular plat. v]\nrepeat (100)\n wait (0.01) seconds\n delete this clone\nend\n\nwhen flag clicked\nhide variable [tp of game v]\nswitch backdrop to (backdrop1 v)\nhide\nset [tp of game v] to [0]\n\nwhen this sprite clicked\nif <(tp of game) = [1]> then\n repeat until <(Regular Time) = [1]>\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [regular time v] to [0]\n set [end regular time v] to [0]\n switch backdrop to (backdrop2 v)\n broadcast (regular plat. v)\n end\n end\nend\nif <(tp of game) = [2]> then\n repeat until <(opposite time) = [1]>\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [opposite time v] to [0]\n set [opposite end time v] to [0]\n switch backdrop to (backdrop10 v)\n broadcast (opposite plat. v)\n end\n end\nend\nif <(tp of game) = [3]> then\n repeat until <(Turned arrow key time) = [1]>\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [end turned time v] to [0]\n set [turned arrow key time v] to [0]\n switch backdrop to (backdrop2 v)\n broadcast (turned arrow plat. v)\n end\n end\nend\nhide\n\nwhen flag clicked\nforever\n hide variable [regular time v]\nend\n\n@Sprite2\n\nwhen flag clicked\nforever\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nrepeat (50)\n change [ghost v] effect by (20)\nend\ndelete this clone\n\nwhen I receive [regular plat. v]\nforever\n if <touching color (#ff0000)?> then\n change [deaths v] by (1)\n start sound [roblox-death-sound-effect.mp3 v]\n go to x: (-176) y: (-67)\n end\n if <touching color (#9a0000)?> then\n change [deaths v] by (1)\n start sound [roblox-death-sound-effect.mp3 v]\n go to x: (-176) y: (-67)\n end\nend\n\nwhen I receive [regular plat. v]\nset [tp of game v] to [0]\nset [regular time v] to [0]\nshow variable [regular time v]\ngo to x: (-176) y: (-67)\nshow\nswitch costume to (costume3 v)\nset size to (50) %\nset size to (100) %\nset [yv v] to [0]\nset [xv v] to [0]\nforever\n if <key (left arrow v) pressed?> then\n switch costume to (costume4 v)\n change [xv v] by (-0.5)\n end\n if <key (right arrow v) pressed?> then\n switch costume to (costume3 v)\n change [xv v] by (0.5)\n end\n change x by (Xv)\n set [xv v] to ((Xv) * (0.9))\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n change y by (0.5)\n if <touching color (#7f7f7f)?> then\n if <key (up arrow v) pressed?> then\n start sound [Mario Jump v]\n if <(Xv) > [0]> then\n start sound [Mario Jump v]\n set [xv v] to [-7]\n else\n start sound [Mario Jump v]\n set [xv v] to [7]\n end\n set [yv v] to [10]\n else\n start sound [Mario Jump v]\n set [xv v] to ((Xv) * (-1.3))\n change x by (Xv)\n set [xv v] to [0]\n change x by ((Xv) / (5))\n end\n change y by (-4)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-0.5)\n change y by (Yv)\n if <touching color (#7f7f7f)?> then\n set [yv v] to ((Yv) * (-0.25))\n change y by (Yv)\n if <touching color (#7f7f7f)?> then\n change y by (Yv)\n if <touching color (#7f7f7f)?> then\n change y by (Yv)\n if <touching color (#7f7f7f)?> then\n change y by (Yv)\n end\n end\n end\n end\n change y by (-1)\n if <<touching color (#7f7f7f)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [7]\n end\n change y by (1)\n if <(x position) > [235]> then\n go to x: (-176) y: (-67)\n switch backdrop to (next backdrop v)\n end\n if <(backdrop [name v]) = [backdrop9]> then\n wait (3) seconds\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\nhide variable [regular time v]\nhide variable [tp of game v]\nhide variable [end regular time v]\nhide variable [opposite time v]\nhide variable [opposite end time v]\nhide variable [deaths v]\nhide variable [turned arrow key time v]\nhide variable [end turned time v]\nhide variable [☁ highscore for regular platformer v]\nset [xv v] to [0]\nset [deaths v] to [0]\n\nwhen I receive [new regular platformer v]\nforever\n if <touching color (#001966)?> then\n change [deaths v] by (1)\n play sound [laser2 v] until done\n go to x: (-208) y: (-17)\n end\nend\n\nwhen I receive [regular plat. v]\nrepeat until <(backdrop [name v]) = [backdrop9]>\n wait (1) seconds\n change [regular time v] by (1e-7)\nend\nwait (2) seconds\nset [end regular time v] to (Regular Time)\nbroadcast (finish for regular plat. v)\nhide variable [regular time v]\n\nwhen I receive [turned arrow plat. v]\nrepeat until <(backdrop [name v]) = [backdrop9]>\n wait (1) seconds\n change [turned arrow key time v] by (1)\nend\nwait (2) seconds\nset [end turned time v] to (Turned arrow key time)\nbroadcast (finish for turned arrow keys v)\nhide variable [regular time v]\n\nwhen I receive [turned arrow plat. v]\nforever\n if <touching color (#ff0000)?> then\n change [deaths v] by (1)\n play sound [roblox-death-sound-effect.mp3 v] until done\n go to x: (-176) y: (-67)\n end\n if <touching color (#d50000)?> then\n change [deaths v] by (1)\n play sound [roblox-death-sound-effect.mp3 v] until done\n go to x: (-176) y: (-67)\n end\nend\n\nwhen I receive [finish for regular plat. v]\nif <(end regular time) < (☁ Highscore for regular platformer)> then\n set [☁ highscore for regular platformer v] to (end regular time)\nend\n\nwhen I receive [finish for opposite plat.l v]\nif <(opposite end time) < (☁ High score for opposite platformer)> then\n set [☁ high score for opposite platformer v] to (opposite end time)\nend\n\nwhen I receive [finish for turned arrow keys v]\nif <(end turned time) < (☁ Highscore for turned arrow keys platformer)> then\n set [☁ highscore for turned arrow keys platformer v] to (end turned time)\nend\n\nwhen I receive [home v]\nhide\n\nwhen I receive [opposite plat. v]\nrepeat until <(backdrop [name v]) = [backdrop17]>\n wait (1) seconds\n change [opposite time v] by (1)\nend\nwait (2) seconds\nset [opposite end time v] to (opposite time)\nbroadcast (finish for opposite plat.l v)\n\nwhen I receive [new regular platformer v]\nwait (1) seconds\nswitch backdrop to (backdrop10 v)\nset [tp of game v] to [0]\nset [regular time v] to [0]\nshow variable [regular time v]\ngo to x: (-209) y: (-18)\nshow\nswitch costume to (costume1 v)\nset size to (50) %\nset size to (100) %\nset [yv v] to [0]\nset [xv v] to [0]\nforever\n if <key (left arrow v) pressed?> then\n switch costume to (costume4 v)\n change [xv v] by (-0.5)\n end\n if <key (right arrow v) pressed?> then\n switch costume to (costume3 v)\n change [xv v] by (0.5)\n end\n change x by (Xv)\n set [xv v] to ((Xv) * (0.9))\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ff55)?> then\n change y by (0.5)\n if <touching color (#00ee4f)?> then\n change y by (0.5)\n if <touching color (#08ee54)?> then\n if <key (up arrow v) pressed?> then\n set volume to (50) %\n start sound [Mario Jump v]\n if <(Xv) > [0]> then\n start sound [Mario Jump v]\n set [xv v] to [-7]\n else\n start sound [Mario Jump v]\n set [xv v] to [7]\n end\n set [yv v] to [10]\n else\n start sound [Mario Jump v]\n set [xv v] to ((Xv) * (-1.3))\n change x by (Xv)\n set [xv v] to [0]\n change x by ((Xv) / (5))\n end\n change y by (-4)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-0.5)\n change y by (Yv)\n if <touching color (#00ff55)?> then\n set [yv v] to ((Yv) * (-0.25))\n change y by (Yv)\n if <touching color (#00ff55)?> then\n change y by (Yv)\n if <touching color (#00ff55)?> then\n change y by (Yv)\n if <touching color (#00ff55)?> then\n change y by (Yv)\n end\n end\n end\n end\n change y by (-1)\n if <<touching color (#00ff55)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [7]\n end\n change y by (1)\n if <(x position) > [235]> then\n go to x: (-176) y: (-67)\n switch backdrop to (next backdrop v)\n end\n if <(backdrop [name v]) = [backdrop9]> then\n wait (3) seconds\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#6600cc)?> then\n broadcast (new regular platformer v)\n end\n if <touching color (#002699)?> then\n broadcast (new regular platformer v)\n end\n if <touching color (#990072)?> then\n broadcast (new regular platformer v)\n end\n if <touching color (#7f00ff)?> then\n broadcast (new regular platformer v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff00bf)?> then\n broadcast (lava v)\n end\n if <touching color (#ccffff)?> then\n broadcast (lava stuff v)\n end\n if <touching color (#666600)?> then\n broadcast (wooooooooo victory v)\n end\n if <touching (sprite11 v)?> then\n broadcast (broadcast boss battle v)\n end\n if <touching color (#6723ff)?> then\n broadcast (hmmmmmmm... v)\n end\n if <touching (sprite8 v)?> then\n go to x: (196) y: (-77)\n end\n if <touching color (#002697)?> then\n broadcast (too much broadcasts v)\n end\n if <touching color (#ff4949)?> then\n broadcast (squidward v)\n end\nend\n\n@Sprite3\n\nwhen I receive [finish for opposite plat.l v]\nbroadcast (home v)\n\nwhen I receive [finish for regular plat. v]\nbroadcast (home v)\n\nwhen I receive [finish for turned arrow keys v]\nbroadcast (home v)\n\nwhen flag clicked\nforever\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n switch backdrop to (backdrop1 v)\n broadcast (home v)\n end\nend\n\nwhen flag clicked\nset [regular time v] to [0]\nset [end regular time v] to [0]\nset [opposite time v] to [0]\nset [opposite end time v] to [0]\nset [turned arrow key time v] to [0]\nset [end turned time v] to [0]\ngo to x: (300) y: (-280)\nhide\n\nwhen flag clicked\n\nwhen I receive [home v]\ngo to x: (296) y: (-236)\nhide\n\nwhen I receive [highscore v]\nshow\ngo to x: (152) y: (-103)\nset size to (90) %\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (36) y: (-31)\nhide\n\nwhen I receive [lava v]\nswitch costume to (costume1 v)\nshow\nforever\n switch costume to (costume2 v)\n wait (0.2) seconds\n switch costume to (costume3 v)\n wait (0.2) seconds\n switch costume to (costume4 v)\n wait (0.2) seconds\n switch costume to (costume5 v)\n wait (0.2) seconds\n switch costume to (costume6 v)\n wait (0.2) seconds\n switch costume to (costume7 v)\n wait (0.2) seconds\n switch costume to (costume8 v)\n wait (0.2) seconds\n switch costume to (costume9 v)\n wait (0.2) seconds\n switch costume to (costume10 v)\n wait (0.2) seconds\n switch costume to (costume11 v)\n wait (0.2) seconds\n switch costume to (costume12 v)\n wait (0.2) seconds\n switch costume to (costume1 v)\nend\n\nwhen I receive [wooooooooo victory v]\nhide\n\nwhen I receive [wooooooooo victory v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nhide\n\nwhen I receive [lava v]\nhide\n\nwhen I receive [lava stuff v]\nshow\n\nwhen I receive [wooooooooo victory v]\nhide\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nwhen I receive [lava v]\nshow\n\nwhen I receive [wooooooooo victory v]\nhide\n\n@Sprite7\n\nwhen flag clicked\nhide\ngo to x: (73) y: (-6)\n\nwhen I receive [broadcast boss battle v]\nswitch costume to (costume1 v)\nshow\nforever\n wait (0.2) seconds\n next costume\n change [costume v] by (1)\n if <(COSTUME) = [34]> then\n wait (0.2) seconds\n switch costume to (costume11 v)\n wait (0.2) seconds\n switch costume to (costume12 v)\n wait (0.2) seconds\n switch costume to (costume13 v)\n wait (0.2) seconds\n switch costume to (costume14 v)\n wait (0.2) seconds\n switch costume to (costume15 v)\n wait (0.2) seconds\n switch costume to (costume16 v)\n wait (0.2) seconds\n switch costume to (costume17 v)\n wait (0.2) seconds\n switch costume to (costume18 v)\n wait (0.2) seconds\n switch costume to (costume19 v)\n end\n if <touching (sprite9 v)?> then\n broadcast (OOOOOOF! v)\n end\nend\n\nwhen I receive [hmmmmmmm... v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen I receive [hmmmmmmm... v]\nshow\nforever\n if <key (space v) pressed?> then\n switch costume to (costume2 v)\n wait (0.5) seconds\n switch costume to (costume3 v)\n wait (0.5) seconds\n switch costume to (costume4 v)\n wait (0.5) seconds\n switch costume to (costume5 v)\n wait (0.5) seconds\n switch costume to (costume6 v)\n wait (0.5) seconds\n end\nend\n\nwhen I receive [woooooo actualy the victory! v]\nhide\n\n@Sprite9\n\nwhen flag clicked\npoint towards (sprite10 v)\nhide\nforever\n go to (sprite8 v)\n if <key (space v) pressed?> then\n show\n wait (2.5) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n move (22) steps\n wait (0) seconds\n end\nend\n\nwhen I receive [woooooo actualy the victory! v]\nhide\n\n@Sprite10\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen I receive [hmmmmmmm... v]\nshow\n\nwhen flag clicked\nforever\n if <touching (sprite9 v)?> then\n switch costume to (costume2 v)\n wait (0.2) seconds\n switch costume to (costume3 v)\n wait (0.2) seconds\n switch costume to (costume4 v)\n wait (0.2) seconds\n switch costume to (costume5 v)\n wait (0.2) seconds\n switch costume to (costume6 v)\n wait (0.2) seconds\n switch costume to (costume7 v)\n wait (0.2) seconds\n switch costume to (costume8 v)\n wait (0.2) seconds\n broadcast (WOOOOOO ACTUALY THE VICTORY! v)\n end\nend\n\n@Sprite11\n\nwhen I receive [broadcast boss battle v]\nhide\n\nwhen flag clicked\ngo to x: (-1) y: (1)\nhide\n\nwhen I receive [too much broadcasts v]\nshow\n\n@Sprite12\n\nwhen I receive [new regular platformer v]\nrepeat (10)\n\nplay sound [Europe - The Final Countdown.mp3 v] until done\n\nstop all sounds\n\n@Sprite13\n\nwhen flag clicked\nhide\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [squidward v]\nshow\nwait (1) seconds\nswitch costume to (costume2 v)\nwait (1) seconds\nswitch costume to (costume3 v)\nwait (0.8) seconds\nswitch costume to (costume4 v)\nwait (0.8) seconds\nswitch costume to (costume5 v)\nwait (0.8) seconds\nswitch costume to (costume6 v)\nwait (0.8) seconds\nswitch costume to (costume7 v)\nwait (0.8) seconds\nswitch costume to (costume8 v)\nwait (0.8) seconds\nswitch costume to (costume9 v)\nwait (0.8) seconds\nswitch costume to (costume10 v)\nwait (0.8) seconds\nswitch costume to (costume11 v)\nwait (0.8) seconds\nswitch costume to (costume12 v)\nwait (5) seconds\nswitch costume to (costume13 v)\nwait (0.8) seconds\nswitch costume to (costume14 v)\nwait (0.8) seconds\nswitch costume to (costume15 v)\nwait (0.8) seconds\nswitch costume to (costume16 v)\nwait (0.8) seconds\nswitch costume to (costume17 v)\nwait (0.8) seconds\nswitch costume to (costume18 v)\nwait (0.8) seconds\nswitch costume to (costume19 v)\nwait (0.8) seconds\nswitch costume to (costume20 v)\nwait (0.8) seconds\nswitch costume to (costume21 v)\nwait (0.8) seconds\nswitch costume to (costume22 v)\nwait (0.8) seconds\nswitch costume to (costume23 v)\nwait (0.8) seconds\nswitch costume to (costume24 v)\nwait (0.8) seconds\nswitch costume to (costume25 v)\n\n
Use arrow keys to move\nPass all levels you are a LEGEND (not really there really easy levels)\n (c:
Super platformer Plus REUPLOAD
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [next level! v]\nnext backdrop\n\nwhen I receive [hero! v]\nforever\n play sound [\(Epic Adventure Music\) - A Hero's Quest -_BY65uBgYFWI_youtube.mp3 v] until done\nend\n\nwhen I receive [short circuit 2! v]\nforever\n play sound [Short Circuit 2 - Holding Out For A Hero \(Fan Edit\) - \(720p,60fps\).mp3 v] until done\nend\n\nwhen I receive [i feel good! v]\nforever\n play sound [James Brown - I Feel Good v] until done\nend\n\nwhen [9 v] key pressed\nforever\n start sound [2 v]\nend\n\nforever\n play sound [James Brown - I Feel Good v] until done\nend\n\n@Sprite1\n\nwhen flag clicked\nset [y v] to [0]\nset [x v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n set [x v] to ((X) * (0.9))\n change x by (X)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (-5)\n change x by ((X) * (-1))\n if <key (up arrow v) pressed?> then\n if <(X) < [0]> then\n set [x v] to [-5]\n else\n set [x v] to [5]\n end\n set [y v] to [10]\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [y v] by (-1)\n change y by (Y)\n if <touching color (#000000)?> then\n change y by ((Y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\ngo to x: (-208) y: (-99)\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n go to x: (-208) y: (-99)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#00ff55)?> then\n go to x: (-208) y: (-99)\n broadcast (next level! v)\n end\nend\n\nwhen [r v] key pressed\ngo to x: (-208) y: (-99)\n\nwhen flag clicked\nforever\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nrepeat (10)\n change size by (-6)\n change [ghost v] effect by (20)\nend\ndelete this clone\n\nwait (0) seconds\n\n@Duszek1\n\nhide\n\nwhen flag clicked\ngo to x: (-1) y: (0)\nshow\ngo to [front v] layer\ngo to [front v] layer\nwait (5) seconds\nforever\n change [ghost v] effect by (2)\nend\n\n@Duszek2\n\nwhen flag clicked\nshow\ngo to x: (-10) y: (40)\n\nwhen I receive [short circuit 2! v]\nhide\n\nwhen I receive [hero! v]\nhide\n\nwhen I receive [i feel good! v]\nhide\n\nwhen I receive [nothing v]\nhide\n\n@Duszek3\n\nwhen flag clicked\nhide\nwait (8) seconds\nshow\ngo to [front v] layer\ngo to x: (-16) y: (19)\n\nwhen this sprite clicked\nbroadcast (short circuit 2! v)\nhide\n\nwhen I receive [hero! v]\nhide\n\nwhen I receive [i feel good! v]\nhide\n\nwhen I receive [nothing v]\nhide\n\n@Duszek4\n\nwhen flag clicked\nhide\ngo to [front v] layer\nwait (8) seconds\nshow\ngo to x: (-4) y: (-19)\n\nwhen this sprite clicked\nbroadcast (hero! v)\nhide\n\nwhen I receive [short circuit 2! v]\nhide\n\nwhen I receive [i feel good! v]\nhide\n\nwhen I receive [nothing v]\nhide\n\n@Duszek5\n\nwhen flag clicked\nhide\nwait (8) seconds\nshow\ngo to x: (-11) y: (-69)\ngo to [front v] layer\n\nwhen this sprite clicked\nbroadcast (i feel good! v)\nhide\n\nwhen I receive [hero! v]\nhide\n\nwhen I receive [short circuit 2! v]\nhide\n\nwhen I receive [nothing v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nhide\nwait (8) seconds\nshow\ngo to [front v] layer\ngo to x: (-20) y: (-110)\n\nwhen this sprite clicked\nbroadcast (nothing v)\nhide\n\nwhen I receive [hero! v]\nhide\n\nwhen I receive [i feel good! v]\nhide\n\nwhen I receive [short circuit 2! v]\nhide\n\nshow\n\n
Welcome in Super Platformer Plus!!!\n\narrow keys - move\n\nr - restart\n\nAll levels are posible!
Wave (Featured)
@Stage\n\nwhen flag clicked\nset [show score showing? v] to [0]\nswitch backdrop to (intro v)\n\nwhen I receive [game end v]\nerase all\nrepeat (50)\n change [ghost v] effect by (1)\nend\nrepeat (50)\n change [ghost v] effect by (-1)\nend\nrepeat (50)\n change [ghost v] effect by (1)\nend\nswitch backdrop to (game end v)\nrepeat (50)\n change [ghost v] effect by (-1)\nend\nset [show_keep v] to ((Show Score) / (30))\nset [show score v] to [0]\nset [show score showing? v] to [1]\nbroadcast (show score v)\nrepeat (30)\n change [show score v] by (Show_keep)\n wait (0) seconds\nend\nset [show score v] to ((round ((Show Score) * (10))) / (10))\nif <(Score) > (High_score)> then\n set [high_score v] to (Score)\n set [isencrying v] to [1]\n broadcast (encry username v)\n wait until <(isEncrying) = [0]>\nend\nbroadcast (load_cloud v)\n\nwhen I receive [intro end v]\nrepeat (50)\n change [ghost v] effect by (1)\nend\nrepeat (50)\n change [ghost v] effect by (-1)\nend\nrepeat (50)\n change [ghost v] effect by (1)\nend\nrepeat (50)\n change [ghost v] effect by (-1)\nend\nbroadcast (start game v)\n\nwhen I receive [start game v]\nswitch backdrop to (intro v)\n\nwhen I receive [wave_2 v]\nswitch backdrop to (intro2 v)\n\nwhen flag clicked\nclear graphic effects\nswitch backdrop to (introing v)\n\nwhen I receive [start v]\nswitch backdrop to (intro v)\n\nwhen flag clicked\nbroadcast (start v)\nset [high_score v] to [0]\nset [highscore_breaknamedata v] to [380270340]\n\nwhen I receive [intro end v]\nset [show score showing? v] to [0]\n\n@Thumbnail\n\nwhen flag clicked\nhide\nforever\n set [checktime v] to ((timer) + (0.01))\n if <key ((join [!] []) v) pressed?> then\n stop [all v]\n end\nend\n\nwhen [timer v] > (CheckTime)\nbroadcast (hide all v)\nshow\ngo to [front v] layer\nset size to (100) %\nswitch costume to (1.4 v)\ngo to x: (0) y: (0)\n\nset [☁ totalview v] to [0]\n\nwhen flag clicked\nif <<(___firstView) = [0]> and <not <(username) = [jenniferandjim]>>> then\n set [___firstview v] to [1]\n change [☁ totalview v] by (1)\nend\n\nset [___firstview v] to [0]\n\n@logo_for_all\n\nwhen flag clicked\ngo to x: (215) y: (-155)\nset [ghost v] effect to (80)\nforever\n if <touching (mouse-pointer v)?> then\n set [ghost v] effect to (60)\n else\n set [ghost v] effect to (80)\n end\nend\n\n@Title\n\nwhen I receive [intro end v]\nstop [other scripts in sprite v]\nset [ghost v] effect to (0)\nrepeat (50)\n change [ghost v] effect by (2)\nend\n\nwhen I receive [start v]\nset [iter v] to [0]\npoint in direction (90)\nshow\nset [ghost v] effect to (200)\nforever\n repeat (5)\n turn right ([sqrt v] of (iter) ) degrees\n change [iter v] by (0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn right ([sqrt v] of (iter) ) degrees\n change [iter v] by (-0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn left ([sqrt v] of (iter) ) degrees\n change [iter v] by (0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn left ([sqrt v] of (iter) ) degrees\n change [iter v] by (-0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn left ([sqrt v] of (iter) ) degrees\n change [iter v] by (0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn left ([sqrt v] of (iter) ) degrees\n change [iter v] by (-0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn right ([sqrt v] of (iter) ) degrees\n change [iter v] by (0.2)\n change [ghost v] effect by (-1)\n end\n repeat (5)\n turn right ([sqrt v] of (iter) ) degrees\n change [iter v] by (-0.2)\n change [ghost v] effect by (-1)\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [hide all v]\nhide\n\n@Wave\n\nwhen I start as a clone\nclear graphic effects\ngo [backward v] ((10) + (waves)) layers\nif <(Introing?) = [1]> then\n forever\n change y by (([sin v] of (sin) ) * (5))\n change [sin v] by (5)\n end\nelse\n forever\n change y by (([sin v] of (sin) ) * (5))\n change [sin v] by (5)\n end\nend\n\nwhen I receive [wave_2 v]\nswitch costume to (rect_wave2 v)\nif <(([floor v] of ((x position) / (50)) ) mod (3)) = [1]> then\n wait (pick random (5.0) to (6.0)) seconds\n delete this clone\nend\nif <(([floor v] of ((x position) / (50)) ) mod (3)) = [2]> then\n wait (pick random (10.0) to (11.0)) seconds\n delete this clone\nend\n\nwhen I receive [game end v]\nset [ghost v] effect to (0)\nrepeat (50)\n change [ghost v] effect by (2)\nend\nstop [other scripts in sprite v]\n\nwhen I receive [intro end v]\nset [ghost v] effect to (0)\nrepeat (50)\n change [ghost v] effect by (2)\nend\nstop [other scripts in sprite v]\n\nwhen I receive [start game v]\ndelete this clone\n\nwhen I receive [start v]\nclear graphic effects\nshow\nswitch costume to (rect_wave v)\nset [introing? v] to [1]\nset [sin v] to [1]\ngo to x: (-240) y: (-50)\nrepeat (96)\n create clone of (_myself_ v)\n move (5) steps\n change y by (([sin v] of (sin) ) * (5))\n change [sin v] by (10)\nend\nset [introing? v] to [0]\nset [sin v] to [1]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nshow\nswitch costume to (rect_wave v)\nset [ending? v] to [0]\nset [waves v] to [0]\nset [sin v] to [1]\ngo to x: (-240) y: (-50)\nrepeat (96)\n erase all\n create clone of (_myself_ v)\n move (5) steps\n change y by (([sin v] of (sin) ) * (5))\n change [sin v] by (10)\nend\nset [sin v] to [1]\nbroadcast (wave_end v)\nhide\n\n@Start\n\nwhen I receive [intro end v]\nstop [other scripts in sprite v]\nset [ghost v] effect to (0)\nrepeat (50)\n change [ghost v] effect by (2)\nend\n\nwhen I receive [game end v]\nwait (8) seconds\nset size to (1000) %\nset [ghost v] effect to (100)\nshow\nrepeat (100)\n go to x: (0) y: (-25)\n change [ghost v] effect by (-1)\n if <touching (mouse-pointer v)?> then\n if <(isEncrying) = [1]> then\n switch costume to (start2 v)\n else\n set size to (1200) %\n end\n else\n switch costume to (start v)\n set size to (1000) %\n end\nend\nforever\n go to x: (0) y: (-25)\n change [ghost v] effect by (-1)\n if <touching (mouse-pointer v)?> then\n if <(isEncrying) = [1]> then\n switch costume to (start2 v)\n else\n set size to (1200) %\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n broadcast (Start Game v)\n stop [this script v]\n end\n end\n else\n switch costume to (start v)\n set size to (1000) %\n end\nend\n\nwhen I receive [start game v]\nhide\n\nwhen I receive [start v]\nset size to (1000) %\nset [ghost v] effect to (200)\nshow\nswitch costume to (start v)\nforever\n go to x: (0) y: (25)\n change [ghost v] effect by (-1)\n if <touching (mouse-pointer v)?> then\n set size to (1200) %\n if <<<touching (mouse-pointer v)?> and <mouse down?>> and <(Introing?) = [0]>> then\n broadcast (Intro End v)\n stop [this script v]\n end\n else\n set size to (1000) %\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [hide all v]\nhide\n\n@Spirite\n\nwhen I receive [wave_end v]\nset [score v] to [0]\nwait until <(Score) > [300]>\nbroadcast (wave_2 v)\n\nset [score v] to [295]\n\nwhen I receive [wave_end v]\ngo to x: (-150) y: (90)\nshow\nset [change in y v] to [0]\nset [change in x v] to [0]\nset [score v] to [0]\nforever\n change [score v] by (0.1)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [change in x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [change in x v] by (-1)\n end\n set [change in x v] to ((Change in x) * (0.9))\n change x by (Change in x)\n if <touching color (#009999)?> then\n change y by (1)\n if <touching color (#009999)?> then\n change y by (1)\n if <touching color (#009999)?> then\n change y by (1)\n if <touching color (#009999)?> then\n change y by (1)\n if <touching color (#009999)?> then\n change y by (1)\n if <touching color (#009999)?> then\n change x by ((Change in x) * (-1))\n change y by (-5)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(Change in x) > [0]> then\n set [change in x v] to [-5]\n else\n set [change in x v] to [5]\n end\n set [change in y v] to [10]\n else\n set [change in x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [change in y v] by (-1)\n change y by (change in y)\n if <touching color (#009999)?> then\n change y by ((-1) * (change in y))\n set [change in y v] to [0]\n end\n change y by (-1)\n if <touching color (#009999)?> then\n change y by (1)\n end\n change y by (-1)\n if <touching color (#009999)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [change in y v] to [15]\n end\n end\n change y by (1)\n if <touching (drop v)?> then\n switch costume to (spirite2 v)\n reset timer\n repeat until <(timer) > [1]>\n change [score v] by (0.1)\n set [change in x v] to ((Change in x) * (0.9))\n change x by (Change in x)\n if <touching color (#009999)?> then\n change y by (-0.1)\n if <touching color (#009999)?> then\n change y by (-0.1)\n if <touching color (#009999)?> then\n change y by (-0.1)\n if <touching color (#009999)?> then\n change y by (-0.1)\n if <touching color (#009999)?> then\n change y by (-0.1)\n if <touching color (#009999)?> then\n change x by ((Change in x) * (-1))\n change y by (-5)\n end\n end\n end\n end\n end\n end\n change [change in y v] by (-1)\n change y by (change in y)\n if <touching color (#009999)?> then\n change y by ((-1) * (change in y))\n set [change in y v] to [0]\n end\n if <touching color (#009999)?> then\n change y by (1)\n end\n if <touching color (#00ffff)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <touching (cloud v)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <(y position) < [-170]> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n change y by (1)\n end\n switch costume to (spirite v)\n else\n switch costume to (spirite v)\n end\n if <touching color (#00ffff)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <touching (cloud v)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <(y position) < [-170]> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n erase all\n change y by (1)\nend\n\nwhen I receive [wave_2 v]\nstop [other scripts in sprite v]\nshow\nforever\n change [score v] by (0.1)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [change in x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [change in x v] by (-1)\n end\n set [change in x v] to ((Change in x) * (0.9))\n change x by (Change in x)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change x by ((Change in x) * (-1))\n change y by (-5)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(Change in x) > [0]> then\n set [change in x v] to [-5]\n else\n set [change in x v] to [5]\n end\n set [change in y v] to [10]\n else\n set [change in x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [change in y v] by (-1)\n change y by (change in y)\n if <touching color (#009933)?> then\n change y by ((-1) * (change in y))\n set [change in y v] to [0]\n end\n change y by (-1)\n if <touching color (#009933)?> then\n change y by (1)\n end\n change y by (-1)\n if <touching color (#009933)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [change in y v] to [15]\n end\n end\n change y by (1)\n if <touching (drop v)?> then\n switch costume to (spirite4 v)\n reset timer\n repeat until <(timer) > [1]>\n change [score v] by (0.1)\n set [change in x v] to ((Change in x) * (0.9))\n change x by (Change in x)\n if <touching color (#009933)?> then\n change y by (-0.1)\n if <touching color (#009933)?> then\n change y by (-0.1)\n if <touching color (#009933)?> then\n change y by (-0.1)\n if <touching color (#009933)?> then\n change y by (-0.1)\n if <touching color (#009933)?> then\n change y by (-0.1)\n if <touching color (#009933)?> then\n change x by ((Change in x) * (-1))\n change y by (-5)\n end\n end\n end\n end\n end\n end\n change [change in y v] by (-1)\n change y by (change in y)\n if <touching color (#009933)?> then\n change y by ((-1) * (change in y))\n set [change in y v] to [0]\n end\n if <touching color (#009933)?> then\n change y by (-1)\n end\n if <touching color (#00cc44)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <touching (cloud v)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <(y position) < [-170]> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n change y by (1)\n end\n switch costume to (spirite3 v)\n else\n switch costume to (spirite3 v)\n end\n if <touching color (#00cc44)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <touching (cloud v)?> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n if <(y position) < [-170]> then\n hide\n broadcast (game end v)\n hide variable [score v]\n set [show score v] to (Score)\n stop [this script v]\n end\n change y by (1)\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [hide all v]\nhide\n\n@drop\n\nwhen I receive [game end v]\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen flag clicked\nset [score v] to [0]\nhide\n\nwhen I receive [wave_2 v]\nswitch costume to (drop2 v)\n\nwhen I start as a clone\nif <(pick random (1) to (3)) = [1]> then\n set [y_vel v] to (pick random (5) to (10))\n show\n set size to (100) %\n go to x: (240) y: (pick random (50) to (150))\n repeat until <touching (wave v)?>\n change y by (y_vel)\n change x by (-5)\n if <touching (_edge_ v)?> then\n hide\n else\n show\n end\n if <(y position) < [-150]> then\n delete this clone\n end\n change [y_vel v] by (-0.5)\n end\n delete this clone\nelse\n if <(pick random (1) to (2)) = [1]> then\n set [y_vel v] to (pick random (5) to (10))\n show\n set size to (100) %\n go to x: (-240) y: (pick random (50) to (150))\n repeat until <touching (wave v)?>\n change y by (y_vel)\n change x by (5)\n if <touching (_edge_ v)?> then\n hide\n else\n show\n end\n if <(y position) < [-150]> then\n delete this clone\n end\n change [y_vel v] by (-0.5)\n end\n delete this clone\n else\n set [y_vel v] to [0]\n show\n set size to (100) %\n go to x: ([x position v] of [spirite v]) y: (240)\n if <touching (_edge_ v)?> then\n repeat until <touching (wave v)?>\n change y by (y_vel)\n if <(y position) < [-150]> then\n delete this clone\n end\n change [y_vel v] by (-0.5)\n end\n else\n repeat until <touching (wave v)?>\n change y by (y_vel)\n if <touching (_edge_ v)?> then\n hide\n else\n show\n end\n if <(y position) < [-150]> then\n delete this clone\n end\n change [y_vel v] by (-0.5)\n end\n end\n delete this clone\n end\nend\n\nwhen I receive [wave_end v]\nswitch costume to (drop v)\nset [score v] to [0]\nwait until <(Score) > [20]>\nforever\n create clone of (_myself_ v)\n if <(Score) < [100]> then\n wait (1) seconds\n else\n if <(Score) < [500]> then\n wait (0.8) seconds\n else\n if <(Score) < [1500]> then\n wait (0.7) seconds\n else\n if <(Score) < [3000]> then\n wait (0.5) seconds\n else\n if <(Score) < [5000]> then\n wait (0.3) seconds\n else\n wait (0.1) seconds\n end\n end\n end\n end\n end\nend\n\nwhen I receive [hide all v]\nhide\n\n@Cloud\n\nwhen flag clicked\nset size to (60) %\nhide\n\nwhen I receive [game end v]\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I receive [wave_end v]\nset [score v] to [0]\nwait until <(Score) > [100]>\ncreate clone of (_myself_ v)\nwait until <(Score) > [1000]>\ncreate clone of (_myself_ v)\nwait until <(Score) > [2500]>\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nshow\nset [randomy v] to (pick random (120) to (140))\ngo to x: (240) y: (randomY)\nforever\n point in direction (-90)\n glide (5) secs to x: (-240) y: (randomY)\n next costume\n point in direction (90)\n glide (5) secs to x: (240) y: (randomY)\n next costume\nend\n\nwhen I receive [hide all v]\nhide\n\n@CloudList\n\nwhen flag clicked\nhide\ndelete (all) of [result v]\nset [symbols v] to [abcdefghijklmnopqrstuvwxyz1234567890/\{}\[\],.<>"';:`~+=-_!@#$%^&*\(\)| ]\n\ndefine Encry []\nset [result v] to []\nset [_iter v] to [0]\nrepeat (length of ())\n change [_iter v] by (1)\n set [_iter2 v] to [0]\n repeat (length of (symbols))\n set [show_encrying v] to (join (_iter) (join [/] (length of ())))\n change [_iter2 v] by (1)\n if <(letter (_iter2) of (symbols)) = (letter (_iter) of ())> then\n set [result v] to (join (result) (join (join (([floor v] of ((_iter2) / (9)) ) + (1)) (((_iter2) mod (9)) + (1))) [0]))\n end\n end\nend\ndelete (all) of [result v]\nadd (result) to [result v]\n\ndefine Decry []\ndelete (all) of [_cl:list v]\nset [result v] to []\nset [_iter v] to [0]\nset [text v] to []\nrepeat (length of ())\n change [_iter v] by (1)\n if <(letter (_iter) of ()) = [0]> then\n add (text) to [_cl:list v]\n set [text v] to []\n else\n set [text v] to (join (text) (letter (_iter) of ()))\n end\nend\nset [_iter v] to [0]\nrepeat (length of [_cl:list v])\n change [_iter v] by (1)\n set [rr v] to (item (_iter) of [_cl:list v])\n set [result v] to (join (result) (letter ((((letter ((length of (rr)) - (1)) of (rr)) - (1)) * (9)) + ((letter (length of (rr)) of (rr)) - (1))) of (symbols)))\nend\ndelete (all) of [result v]\nadd (result) to [result v]\n\nwhen I receive [encry username v]\ndelete (all) of [result v]\nEncry (join [you, ] (username))\nset [highscore_breaknamedata v] to (item (1) of [result v])\nset [isencrying v] to [0]\n\nwhen I receive [load_cloud v]\ndelete (all) of [result v]\nDecry (Highscore_breakNameData)\nset [show_cloudbreaker v] to (join (join (join [Highscore by ] (join (item (1) of [result v]) [ : ])) ((round ((High_score) * (10))) / (10))) [ points])\nbroadcast (Show_Texting v)\n\nwhen I receive [hide all v]\nhide\n\n@Typewriter\n\ndefine print (text) size (size) at (x) (y)\ngo to x: (x) y: (y)\nset size to ((size) * (100)) %\nset [textingiter v] to [1]\nrepeat (length of (text))\n switch costume to ( v)\n switch costume to (letter (TEXTINGITER) of (text))\n if <<not <(letter (TEXTINGITER) of (text)) = [ ]>> and <(costume [number v]) = [1]>> then\n switch costume to (join [_] (letter (TEXTINGITER) of (text)))\n end\n stamp\n change [textingiter v] by (1)\n set [prev_x v] to ((x position) + ((item (costume [number v]) of [length v]) * ((size) / (100))))\n switch costume to (letter ((TEXTINGITER) + (1)) of (text))\n if <((prev_x) + (item (costume [number v]) of [length v])) > [235]> then\n change y by ((0) - (((size) * (1.5)) / (10)))\n set x to (-240)\n else\n set x to (prev_x)\n end\nend\nchange y by ((0) - (((size) * (1.4)) / (10)))\nset x to (-240)\n\ndefine init\nhide\nerase all\ngo to x: (-240) y: (160)\n\nwhen flag clicked\ninit\n\nwhen I receive [wave_2 v]\nset [texting_iter v] to [0]\nset [__gather__ v] to []\nrepeat (length of [Into the forest.])\n change [texting_iter v] by (1)\n set [__gather__ v] to (join (__gather__) (letter (texting_iter) of [Into the forest.]))\n print (__gather__) size [2] at [-90] [150]\n wait (0.1) seconds\nend\nwait (1) seconds\nerase all\n\nwhen I receive [load_cloud v]\nwait (0) seconds\nerase all\nprint [Loading Highscore data...] size [2] at [-200] [150]\n\nwhen I receive [encry username v]\nwait (0) seconds\nerase all\nprint [Writing your Highscore data...] size [2] at [-200] [150]\n\nwhen I receive [show_texting v]\nstop [other scripts in sprite v]\nerase all\nprint (Show_CloudBreaker) size [2] at [-200] [150]\nerase all\nprint (Show_CloudBreaker) size ((<(y position) = [150]> * ((2) - ((2) * ((350) / ((200) + ((x position) + ((((150) - (y position)) / (58)) * (480)))))))) + ((2) * ((350) / ((200) + ((x position) + ((((150) - (y position)) / (58)) * (480))))))) at [-200] [150]\n\nerase all\n\n@counter\n\nwhen flag clicked\nhide\nset [id v] to [1]\ndelete this clone\n\nwhen I start as a clone\nset [id v] to [0]\nif <(Show Score Showing?) = [0]> then\n show\n go to [front v] layer\n set [__counternumeric v] to (__counterMax)\n set [__clonedone v] to [1]\n forever\n set x to ((-235) + ((15) * (__counterNumeric)))\n switch costume to (letter (__counterNumeric) of (round (Score)))\n if <(__counterNumeric) > (__counterMax)> then\n delete this clone\n end\n if <(Show Score Showing?) = [1]> then\n delete this clone\n end\n set y to (150)\n end\nend\n\nwhen I receive [wave_end v]\nif <(id) = [1]> then\n hide\n set [__countermax v] to [0]\n forever\n if <(length of (round (Score))) > (__counterMax)> then\n change [__countermax v] by (1)\n set [__clonedone v] to [0]\n create clone of (_myself_ v)\n wait until <(__cloneDone) = [1]>\n end\n if <(__counterMax) > (length of (round (Score)))> then\n change [__countermax v] by (-1)\n end\n end\nelse\nend\n\nwhen I receive [game end v]\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I start as a clone\nset [id v] to [0]\nif <(Show Score Showing?) = [1]> then\n show\n go to [front v] layer\n set [__counternumeric v] to (__counterMax)\n set [__clonedone v] to [1]\n forever\n set x to ((-10) + ((15) * (__counterNumeric)))\n switch costume to (letter (__counterNumeric) of (round (Show Score)))\n if <(__counterNumeric) > (__counterMax)> then\n delete this clone\n end\n if <(Show Score Showing?) = [0]> then\n delete this clone\n end\n set y to (28)\n end\nend\n\nwhen I receive [show score v]\nif <(id) = [1]> then\n hide\n set [__countermax v] to [0]\n forever\n if <(length of (round (Show Score))) > (__counterMax)> then\n change [__countermax v] by (1)\n set [__clonedone v] to [0]\n create clone of (_myself_ v)\n wait until <(__cloneDone) = [1]>\n end\n if <(__counterMax) > (length of (round (Show Score)))> then\n change [__countermax v] by (-1)\n end\n end\nend\n\nwhen I receive [start game v]\nset [show score showing? v] to [0]\nstop [other scripts in sprite v]\ndelete this clone\n\n
Tiny Circle [A platformer]
@Stage\n\nwhen flag clicked\nforever\n if <<[11] > (Level)> and <[0] < (Level)>> then\n switch backdrop to (Level)\n end\n if <[11] = (Level)> then\n switch backdrop to (backdrop11 v)\n end\n if <[12] = (Level)> then\n switch backdrop to (backdrop10 v)\n end\n if <[13] = (Level)> then\n switch backdrop to (backdrop9 v)\n end\n if <[14] = (Level)> then\n switch backdrop to (backdrop8 v)\n end\n if <[15] = (Level)> then\n switch backdrop to (backdrop7 v)\n end\n if <[16] = (Level)> then\n switch backdrop to (backdrop5 v)\n end\nend\n\nwhen I receive [end game v]\nforever\n\nset [level v] to [10]\n\n@Sprite1\n\nwhen I receive [message1 v]\nset [brightness v] effect to (0)\ngo to x: (-225) y: (-76)\npoint in direction (90)\nset [velocity x v] to [0]\nset [velocity y v] to [0]\nset [rotation? v] to [0]\nif <(Level) = [2]> then\n go to x: (-219) y: (-94)\n say [Dont touch that red stuff!] for (2) seconds\nend\nif <(Level) = [3]> then\n go to x: (-222) y: (-4)\n point in direction (90)\nend\nif <(Level) = [4]> then\n go to x: (-219) y: (155)\n point in direction (90)\nend\nif <(Level) = [5]> then\n go to x: (-225) y: (-154)\n point in direction (90)\nend\nif <(Level) = [6]> then\n go to x: (-227) y: (-147)\n point in direction (90)\nend\nif <(Level) = [7]> then\n go to x: (-226) y: (-58)\n point in direction (90)\nend\nif <(Level) = [8]> then\n go to x: (-218) y: (-48)\n point in direction (90)\nend\nif <(Level) = [9]> then\n point in direction (90)\n go to x: (-223) y: (-159)\nend\nif <(Level) = [10]> then\n point in direction (90)\n go to x: (-223) y: (-159)\nend\nif <(Level) = [11]> then\n point in direction (90)\n go to x: (227) y: (-162)\nend\nif <(Level) = [12]> then\n point in direction (90)\n go to x: (175) y: (-128)\nend\nif <(Level) = [13]> then\n point in direction (90)\n go to x: (222) y: (-2)\nend\nif <(Level) = [14]> then\n point in direction (90)\n go to x: (223) y: (-32)\nend\nif <(Level) = [15]> then\n point in direction (90)\n go to x: (222) y: (-152)\nend\n\ndefine Jump\nrepeat (10)\n if <not <touching color (#666666)?>> then\n change y by (5)\n else\n change y by (-5)\n end\nend\nrepeat (5)\n if <not <touching color (#666666)?>> then\n change y by (3)\n else\n change y by (-3)\n end\nend\nrepeat (3)\n if <not <touching color (#666666)?>> then\n change y by (1)\n else\n change y by (-1)\n end\nend\n\nwhen flag clicked\nshow\nforever\n if <touching color (#ff0000)?> then\n broadcast (message1 v)\n end\nend\n\nwhen flag clicked\nforever\n if <(Jump?) = [True]> then\n set [velocity y v] to [0]\n end\nend\n\nwhen I receive [powers v]\nrepeat (20)\n change [brightness v] effect by (5)\nend\nset [powers? v] to [Red]\nswitch costume to (costume2 v)\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nsay [OMG, Check me out, im red now!] for (2) seconds\nsay [I think I can now Double jump] for (2) seconds\n\nif <not <touching color (#666666)?>> then\nend\n\nwhen flag clicked\nset [powers? v] to [Blue]\nset [jumppower v] to [0]\nswitch costume to (costume1 v)\nforever\n if <(Jump?) = [False]> then\n change [velocity y v] by (-0.5)\n change y by (Velocity Y)\n end\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n if <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>> then\n change y by (1)\n set [velocity y v] to [0]\n set [on ground? v] to [Yes]\n set [jumppower v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n if <(On Ground?) = [Yes]> then\n if <key (up arrow v) pressed?> then\n set [jump? v] to [True]\n if <not <(Powers?) = [Blue]>> then\n if <(JumpPower) = [1]> then\n set [jump? v] to [True]\n set [on ground? v] to [No]\n set [jumppower v] to [2]\n Jump\n set [jump? v] to [False]\n end\n if <(JumpPower) = [0]> then\n change [jumppower v] by (1)\n Jump\n set [jump? v] to [False]\n end\n else\n set [on ground? v] to [No]\n Jump\n set [jump? v] to [False]\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n if <(Powers?) = [Blue]> then\n if <not <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>>> then\n wait (0.02) seconds\n if <not <<touching color (#00cc44)?> or <touching color (#7f7f7f)?>>> then\n set [on ground? v] to [No]\n else\n set [on ground? v] to [Yes]\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#666666)?> then\n wait (1) seconds\n if <touching color (#666666)?> then\n if <not <(x position) > [210]>> then\n if <touching color (#666666)?> then\n change y by (-40)\n end\n else\n if <(x position) > [210]> then\n change x by (-10)\n else\n if <(x position) < [-210]> then\n change x by (10)\n end\n end\n end\n end\n end\nend\n\nwhen flag clicked\nset [level v] to [1]\nbroadcast (message1 v)\nswitch backdrop to (backdrop1 v)\n\nwhen flag clicked\nsay [Hello!] for (2) seconds\nsay [I am tiny circle!] for (2) seconds\nsay [Use the arrow keys to move and jump!] for (2) seconds\nsay [Touch the goal to go to the next level!] for (2) seconds\n\ndefine Ultra Jump\nif <not <touching color (#666666)?>> then\n repeat (15)\n change y by (8)\n end\nend\nif <not <touching color (#666666)?>> then\n repeat (5)\n change y by (4)\n end\nend\nif <not <touching color (#666666)?>> then\n repeat (2)\n change y by (2)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#003fff)?> then\n set [jump? v] to [True]\n set [on ground? v] to [No]\n Ultra Jump\n set [jump? v] to [False]\n end\nend\n\nwhen flag clicked\nset [decelerate x v] to [True]\nset [velocity x v] to [0]\nset [jump? v] to [False]\npoint in direction (90)\nset [velocity y v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n if <(Velocity X) < [6]> then\n if <not <touching color (#666666)?>> then\n change [velocity x v] by (0.3)\n change [rotation? v] by (0.6)\n else\n set [velocity x v] to [0]\n set [rotation? v] to [0]\n end\n end\n if <not <touching color (#666666)?>> then\n change x by (Velocity X)\n end\n turn right (Rotation?) degrees\n if <touching color (#666666)?> then\n change x by ((Velocity X) * (-1))\n set [velocity x v] to [0]\n end\n else\n if <key (left arrow v) pressed?> then\n if <[-6] < (Velocity X)> then\n if <touching color (#666666)?> then\n set [velocity x v] to [0]\n set [rotation? v] to [0]\n else\n change [velocity x v] by (-0.3)\n change [rotation? v] by (-0.6)\n end\n end\n if <not <touching color (#666666)?>> then\n change x by (Velocity X)\n end\n if <touching color (#666666)?> then\n change x by ((Velocity X) * (-1))\n set [velocity x v] to [0]\n end\n turn right (Rotation?) degrees\n else\n if <(Decelerate X) = [True]> then\n set [velocity x v] to ((Velocity X) * (0.9))\n set [rotation? v] to ((Rotation?) * (0.9))\n change x by (Velocity X)\n turn right (Rotation?) degrees\n else\n set [velocity x v] to [0]\n end\n end\n end\nend\n\n@Sprite2\n\nwhen flag clicked\nset [level v] to [1]\n\nwhen I receive [end game v]\nhide\n\nwhen flag clicked\nforever\n if <touching (sprite1 v)?> then\n wait until <touching (sprite1 v)?>\n change [level v] by (1)\n broadcast (message1 v)\n end\nend\n\nwhen flag clicked\nshow\n\nwhen I receive [message1 v]\ngo to x: (110) y: (158)\nif <(Level) = [2]> then\n go to x: (217) y: (-95)\nend\nif <(Level) = [3]> then\n go to x: (-219) y: (128)\nend\nif <(Level) = [4]> then\n go to x: (213) y: (-172)\nend\nif <(Level) = [5]> then\n go to x: (218) y: (-159)\nend\nif <(Level) = [6]> then\n go to x: (217) y: (-6)\nend\nif <(Level) = [7]> then\n go to x: (217) y: (-131)\nend\nif <(Level) = [8]> then\n go to x: (214) y: (-120)\nend\nif <(Level) = [9]> then\n go to x: (202) y: (-129)\nend\nif <(Level) = [10]> then\n go to x: (-223) y: (-53)\nend\nif <(Level) = [11]> then\n go to x: (-218) y: (-124)\nend\nif <(Level) = [12]> then\n go to x: (-223) y: (-37)\nend\nif <(Level) = [13]> then\n go to x: (-219) y: (-1)\nend\nif <(Level) = [14]> then\n go to x: (-207) y: (-154)\nend\nif <(Level) = [15]> then\n go to x: (218) y: (116)\nend\n\n@Sprite3\n\nwhen I receive [message1 v]\nif <(Level) = [10]> then\n switch costume to (costume1 v)\n go to x: (198) y: (-51)\n show\n forever\n if <touching (sprite1 v)?> then\n broadcast (Powers v)\n hide\n stop [this script v]\n end\n end\nend\nif <(Level) = [25]> then\n switch costume to (costume2 v)\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [message1 v]\nif <not <<(Level) = [10]> or <(Level) = [25]>>> then\n hide\nend\n\ngo to x: (221) y: (-43)\n\n@Sprite4\n\ndefine Make words_\ngo to x: (-230) y: (-150)\nbroadcast (show v)\nrepeat (length of (item (Which lines?) of [dialogue v]))\n switch costume to (letter (Next number) of (item (Which lines?) of [dialogue v]))\n create clone of (_myself_ v)\n change [next number v] by (1)\n if <(x position) > [220]> then\n go to x: (-230) y: (-165)\n else\n move (10) steps\n end\nend\nbroadcast (stop showing v)\nset [next number v] to [1]\n\nwhen flag clicked\nset [next number v] to [1]\nset [which lines? v] to [1]\nhide\n\nwhen I start as a clone\nshow\nwait (10) seconds\ndelete this clone\n\nreplace item (1) of [dialogue v] with [anything!]\n\n@Sprite5\n\nwhen flag clicked\nhide\n\nshow\n\n@Sprite6\n\nwhen I receive [level 25 v]\n\n
Press that green circle on a stick thing\n\nI will make more level once I hit 100 stars.\nComplete - 27.3% \n\nhttps://scratch.mit.edu/projects/258627042/ | Cookie Tycoon\nhttps://scratch.mit.edu/projects/210781479/ | Egg CO.\nhttps://scratch.mit.edu/projects/270051462/ | Survive the Button\n\nI'm sorry about the Glitch Where you jump and you get stuck in the ceiling. \n\n
Blob Dungeon (A creative platformer)
@Stage\n\nwhen flag clicked\nforever\n set [brightness v] effect to (-25)\nend\n\n@Ground\n\nwhen flag clicked\nforever\n switch costume to (Level)\n go to x: (0) y: (0)\n set [brightness v] effect to (-5)\nend\n\nwhen flag clicked\npoint in direction (90)\n\nwhen flag clicked\nforever\n play sound [Music v] until done\nend\n\n@Player\n\nwhen flag clicked\nset rotation style [left-right v]\ngo to x: (-180) y: (-120)\nswitch costume to (hitbox v)\nforever\n switch costume to (hitbox v)\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-0.8)\n switch costume to (hitbox v)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (0.8)\n switch costume to (costume1 v)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (1)\n if <touching (ground2 v)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n switch costume to (costume1 v)\n change y by (y)\n if <touching (ground2 v)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching (ground2 v)?> and <key (up arrow v) pressed?>> then\n set [y v] to [8]\n end\n change y by (0.5)\nend\n\n\n\nwhen flag clicked\nset [groundpound v] to [0]\nforever\n if <<touching (enemy 1 v)?> and <(Groundpound) = [1]>> then\n broadcast (Enemy Die v)\n start sound [Pew v]\n change [score v] by (1)\n change [collected v] by (1)\n else\n if <<touching (enemy 1 v)?> and <(Groundpound) = [0]>> then\n start sound [Oops v]\n broadcast (Player Death v)\n go to x: (-165) y: (-120)\n end\n end\nend\n\nwhen I receive [enemy die v]\nset [y v] to [9]\nset [groundpound v] to [0]\n\nwhen I receive [groundpound v]\nset [groundpound v] to [1]\nchange [y v] by (-8)\nwait until <touching (ground v)?>\nset [groundpound v] to [0]\n\nwhen flag clicked\nforever\n if <<touching (coin v)?> or <touching (coin 2 v)?>> then\n change [collected v] by (1)\n change [score v] by (1)\n broadcast (Coin v)\n start sound [Collect v]\n wait (.5) seconds\n end\nend\n\nwhen flag clicked\nset [level v] to [1]\n\nwhen flag clicked\n\nwhen flag clicked\nforever\n if <<touching (flag v)?> and <(Collected) = (Collected Max)>> then\n set [collected v] to [0]\n change [level v] by (1)\n go to x: (-180) y: (-120)\n broadcast (Next Level v)\n broadcast (Clone v)\n play sound [Tada v] until done\n end\nend\n\nwhen flag clicked\nforever\n if <touching (spikes v)?> then\n set [groundpound v] to [0]\n start sound [Oops v]\n go to x: (-180) y: (-120)\n set [x v] to [0]\n end\nend\n\nwhen flag clicked\nset [collected v] to [0]\nforever\n if <(Level) = [1]> then\n set [collected max v] to [3]\n else\n if <(Level) = [2]> then\n set [collected max v] to [2]\n else\n if <(Level) = [3]> then\n set [collected max v] to [3]\n else\n if <(Level) = [4]> then\n set [collected max v] to [4]\n else\n if <(Level) = [5]> then\n set [collected max v] to [5]\n end\n end\n end\n end\n end\nend\n\nwhen I receive [next level v]\n\nwhen flag clicked\nforever\n set [ghost v] effect to (100)\nend\n\nwhen flag clicked\nforever\n if <<key (down arrow v) pressed?> and <not <touching (ground v)?>>> then\n broadcast (Groundpound v)\n else\n set [groundpound v] to [0]\n end\nend\n\nwhen flag clicked\nforever\n if <<touching (enemy 2 v)?> and <(Groundpound) = [1]>> then\n broadcast (Enemy 2 die v)\n start sound [Pew v]\n change [score v] by (1)\n change [collected v] by (1)\n else\n if <<touching (enemy 2 v)?> and <(Groundpound) = [0]>> then\n start sound [Oops v]\n broadcast (Player Death v)\n go to x: (-165) y: (-120)\n end\n end\nend\n\nwhen flag clicked\nforever\n if <touching (ground v)?> then\n set [groundpound v] to [0]\n end\nend\n\nstop [this script v]\n\n\n set [groundpound v] to [0]\nend\n\nwhen I receive [skip v]\ngo to x: (-180) y: (-120)\n\nwait (000.1) seconds\nif <<touching (coin v)?> or <touching (coin 2 v)?>> then\n change [collected v] by (1)\n change [score v] by (1)\n broadcast (Coin v)\n start sound [Collect v]\n wait (.5) seconds\nend\n\nwait (000.1) seconds\n\n@Wall\n\nwhen flag clicked\nforever\n hide\nend\n\ngo to x: (0) y: (0)\nset size to (500) %\ngo to [back v] layer\n\n@Double\n\nwhen flag clicked\n\nhide\n\nshow\nset rotation style [left-right v]\ngo to x: (-190) y: (-110)\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n point in direction (90)\n change [x v] by (-1)\n switch costume to (costume2 v)\n end\n if <key (right arrow v) pressed?> then\n point in direction (-90)\n change [x v] by (1)\n switch costume to (costume1 v)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching (ground v)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching (ground v)?> and <key (up arrow v) pressed?>> then\n set [y v] to [7]\n end\n change y by (0.5)\nend\n\n@Enemy 1\n\nwhen I start as a clone\nforever\n if <(Level) = [6]> then\n delete this clone\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [1]> then\n create clone of (_myself_ v)\n end\n stop [this script v]\nend\n\nwhen I receive [enemy die v]\nforever\n delete this clone\nend\n\nwhen I start as a clone\nshow\nswitch costume to (costume1 v)\nforever\n forever\n switch costume to (costume1 v)\n wait (.5) seconds\n switch costume to (costume2 v)\n wait (.5) seconds\n end\nend\n\nwhen I start as a clone\nforever\n if <(Level) = [1]> then\n go to x: (-130) y: (80)\n show\n point in direction (-90)\n glide (2.5) secs to x: (65) y: (80)\n point in direction (90)\n glide (2.5) secs to x: (-130) y: (80)\n end\nend\n\nwhen flag clicked\nforever\n hide\nend\n\nwhen I receive [show enemy v]\nshow\n\nwhen I start as a clone\nforever\n show\nend\n\nwhen flag clicked\nforever\n if <(Level) = [3]> then\n create clone of (_myself_ v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\n\nwhen flag clicked\nset [enemy x2 v] to [0]\nforever\n if <<not <(Level) = [6]>> and <key (s v) pressed?>> then\n set [collected v] to [0]\n hide\n broadcast (Skiip 4 coins v)\n delete this clone\n end\nend\n\nwhen I receive [skiip 4 coins v]\nforever\n if <(Level) = [2]> then\n hide\n end\nend\n\nwhen I start as a clone\nforever\n if <<touching (player v)?> and <(Groundpound) = [1]>> then\n delete this clone\n end\nend\n\nwhen I start as a clone\nforever\n show\n if <(Level) = [3]> then\n point in direction (-90)\n go to x: (-117) y: (-55)\n glide (2.5) secs to x: (61) y: (-55)\n point in direction (90)\n glide (2.5) secs to x: (-117) y: (-55)\n end\nend\n\nwhen I start as a clone\nforever\n show\n if <(Level) = [4]> then\n go to x: (-71) y: (100)\n glide (1) secs to x: (17) y: (100)\n point in direction (90)\n glide (1) secs to x: (-71) y: (100)\n point in direction (-90)\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [4]> then\n create clone of (_myself_ v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [5]> then\n create clone of (_myself_ v)\n stop [this script v]\n end\nend\n\nwhen I start as a clone\nforever\n show\n if <(Level) = [5]> then\n go to x: (93) y: (106)\n point in direction (90)\n glide (1) secs to x: (10) y: (106)\n point in direction (-90)\n glide (1) secs to x: (93) y: (106)\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [6]> then\n hide\n end\nend\n\n@Ground2\n\nwhen flag clicked\ngo to x: (0) y: (4)\nset [ghost v] effect to (99)\nforever\n switch costume to (Level)\nend\n\n@Coin\n\ndefine Clone At X: (x) Y: (y)\nshow\nset [x v] to (x)\nset [y v] to (y)\ncreate clone of (_myself_ v)\n\nwhen flag clicked\nswitch costume to (coin v)\nforever\n hide\n set [brightness v] effect to (-15)\n set size to (50) %\nend\n\nwhen flag clicked\nforever\n if <(Collected) = (Collected Max)> then\n broadcast (Flag On v)\n end\nend\n\nwhen I start as a clone\nforever\n set x to (X)\n set y to (Y)\nend\n\nset [brightness v] effect to (-15)\nset size to (50) %\n\nwhen I start as a clone\nforever\n next costume\nend\n\nwhen I receive [clone v]\nif <(Level) = [2]> then\n show\n Clone At X: [65] Y: [-50]\n Clone At X: [-47] Y: [-130]\nend\nif <(Level) = [3]> then\n show\n Clone At X: [193] Y: [-126]\n Clone At X: [-24] Y: [118]\nend\nif <(Level) = [4]> then\n show\n Clone At X: [197] Y: [-53]\n Clone At X: [-28] Y: [125]\n Clone At X: [-205] Y: [-50]\nend\nif <(Level) = [5]> then\n go to [front v] layer\n show\n Clone At X: [-207] Y: [48]\n Clone At X: [196] Y: [111]\n Clone At X: [175] Y: [-86]\nend\nif <(Level) = [6]> then\n go to [front v] layer\n show\n Clone At X: [-30] Y: [-130]\n Clone At X: [0] Y: [-130]\n Clone At X: [30] Y: [-130]\nend\n\nwhen flag clicked\nif <(Level) = [1]> then\n Clone At X: [3] Y: [-101]\n Clone At X: [0] Y: [150]\nend\n\nwhen I start as a clone\nforever\n if <<touching (player v)?> or <(Level) = [6]>> then\n delete this clone\n end\nend\n\ndelete this clone\n\nwhen flag clicked\n\nwhen I receive [skiip 4 coins v]\nif <(Level) = [2]> then\n show\n Clone At X: [65] Y: [-50]\n Clone At X: [-47] Y: [-130]\nend\nif <(Level) = [3]> then\n show\n Clone At X: [193] Y: [-126]\n Clone At X: [-24] Y: [118]\nend\nif <(Level) = [4]> then\n show\n Clone At X: [197] Y: [-53]\n Clone At X: [-28] Y: [125]\n Clone At X: [-205] Y: [-50]\nend\nif <(Level) = [5]> then\n go to [front v] layer\n show\n Clone At X: [-207] Y: [48]\n Clone At X: [196] Y: [111]\n Clone At X: [175] Y: [-86]\nend\nif <(Level) = [6]> then\n go to [front v] layer\n show\n Clone At X: [-30] Y: [-130]\n Clone At X: [0] Y: [-130]\n Clone At X: [30] Y: [-130]\nend\n\nwhen I start as a clone\nforever\n if <<not <(Level) = [6]>> and <key (s v) pressed?>> then\n broadcast (Skiip 4 coins v) and wait\n delete this clone\n end\nend\n\n@Score\n\nwhen flag clicked\nswitch costume to (10 v)\nshow\ngo to [front v] layer\ngo to x: (153) y: (153)\nset [score v] to [0]\nforever\n switch costume to (letter (1) of (Score))\nend\n\nwait (0.2) seconds\n\n@Score2\n\nwhen flag clicked\nswitch costume to (none v)\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (165) y: (153)\n\ngo to [front v] layer\n\nwhen flag clicked\nhide\nif <(Score) > [9]> then\n show\n forever\n switch costume to (letter (2) of (Score))\n end\nend\n\n@Deco\n\nwhen flag clicked\nforever\n go to x: (0) y: (0)\n show\n switch costume to (Level)\n set [ghost v] effect to (0)\n go to [back v] layer\nend\n\ngo [backward v] (2) layers\n\n@Flag\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [brightness v] effect to (-25)\nforever\n switch costume to (Level)\nend\n\nwhen flag clicked\nforever\n if <<not <(Level) = [6]>> and <key (s v) pressed?>> then\n change [level v] by (1)\n broadcast (Skip v)\n wait (.3) seconds\n end\nend\n\n@Spikes\n\nwhen flag clicked\nset [brightness v] effect to (-20)\ngo to x: (0) y: (0)\nforever\n switch costume to (Level)\nend\n\n@Score3\n\nwhen flag clicked\nswitch costume to (10 v)\nshow\ngo to [front v] layer\ngo to x: (-170) y: (153)\nforever\n switch costume to (letter (1) of (Collected))\nend\n\nwait (0.2) seconds\n\n@Score4\n\nwhen flag clicked\nswitch costume to (10 v)\nshow\ngo to [front v] layer\ngo to x: (-135) y: (153)\nforever\n switch costume to (letter (1) of (Collected Max))\nend\n\nwait (0.2) seconds\n\n@Sprite2\n\nwhen flag clicked\nset size to (150) %\ngo to x: (-153) y: (162)\n\n@Enemy 2\n\nwhen I start as a clone\nforever\n if <(Level) = [6]> then\n delete this clone\n end\nend\n\nwhen I start as a clone\nforever\n show\n if <(Level) = [5]> then\n go to x: (200) y: (106)\n point in direction (90)\n glide (1) secs to x: (10) y: (106)\n point in direction (-90)\n glide (1) secs to x: (200) y: (106)\n end\nend\n\nwhen I start as a clone\nshow\nswitch costume to (costume1 v)\nswitch costume to (costume3 v)\nforever\n forever\n switch costume to (costume1 v)\n wait (.5) seconds\n switch costume to (costume2 v)\n wait (.5) seconds\n end\nend\n\nwhen flag clicked\nhide\nforever\n\nwhen I start as a clone\nforever\n show\nend\n\nwhen I start as a clone\nforever\n if <<touching (player v)?> and <(Groundpound) = [1]>> then\n delete this clone\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [5]> then\n create clone of (_myself_ v)\n stop [this script v]\n end\nend\n\nchange [collected v] by (1)\n\nwhen I receive [enemy 2 die v]\ndelete this clone\n\n@Player2\n\nwhen flag clicked\nforever\n set x to ([x position v] of [player v])\n set y to (([y position v] of [player v]) - (3))\n if <key (left arrow v) pressed?> then\n point in direction (90)\n end\n if <key (right arrow v) pressed?> then\n point in direction (-90)\n end\nend\n\n@Thumbnail3\n\nwhen flag clicked\nforever\n show\n go to [front v] layer\n set [ghost v] effect to (100)\n go to x: (0) y: (0)\nend\n\n
Welcome to Blob Dungeon! In the making for 6+ months! You are a blob that has found himself in a deadly dungeon! Make your way through while collecting coins and smashing enemies!\n++++++++++++++-Instructions-+++++++++++\n-Arrow keys\n- Jump and click down-arrow to ground-pound\n-Collect coins\n-Ground pound on enemies to collect points\n-Must have the max amount of points to pass level\n-Press "s" to skip
Diamond platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (1 v)\nforever\n if <(LEVEL) = [1]> then\n switch backdrop to (1 v)\n end\n if <(LEVEL) = [2]> then\n switch backdrop to (2 v)\n end\n if <(LEVEL) = [3]> then\n switch backdrop to (4 v)\n end\n if <(LEVEL) = [4]> then\n switch backdrop to (3 v)\n end\nend\n\nwhen I receive [game over v]\nswitch backdrop to (3 v)\n\n@diamond\n\nwhen flag clicked\nswitch costume to (a v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [2]> then\n show\n switch costume to (a v)\n go to x: (-27) y: (10)\n end\n if <not <(LEVEL) = [2]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite1\n\nwhen flag clicked\nhide\nswitch costume to (grey v)\nset [back v] to [0]\n\nwhen flag clicked\nforever\n if <<touching (sprite5 v)?> and <(diomond yes) = [yes]>> then\n change [level v] by (1)\n broadcast (next level v)\n go to x: (-226) y: (-45)\n end\nend\n\nwhen flag clicked\nforever\n if <touching (diamond v)?> then\n switch costume to (a v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching (diamond2 v)?> then\n switch costume to (e v)\n end\nend\n\nwhen I receive [starts v]\nwait (0.8) seconds\nshow\ngo to x: (-226) y: (-45)\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <<<touching (sprite7 v)?> or <<touching (sprite8 v)?> or <touching (sprite9 v)?>>> or <touching (sprite12 v)?>> then\n set volume to (5) %\n start sound [wub beatbox v]\n go to x: (-226) y: (-127)\n wait (0.1) seconds\n end\n go to [front v] layer\n if <(back) = [1]> then\n hide\n stop [this script v]\n end\n if <(x position) > [235]> then\n broadcast (next v)\n set x to (-222)\n set [xv v] to [0]\n set [yv v] to [0]\n end\n if <<(y position) < [-175]> or > then\n go to x: (-197) y: (-44)\n set [xv v] to [0]\n set [yv v] to [0]\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (90)\n change [xv v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (-90)\n change [xv v] by (1)\n end\n set [xv v] to ((xv) * (0.85))\n change x by (xv)\n if <touching color (#666666)?> then\n change y by (-2)\n if <touching color (#666666)?> then\n change y by (1)\n if <touching color (#666666)?> then\n change y by (1)\n if <touching color (#666666)?> then\n change y by (1)\n if <touching color (#666666)?> then\n change y by (1)\n if <touching color (#666666)?> then\n change y by (1)\n if <touching color (#666666)?> then\n change y by (-5)\n change x by ((-1) * (xv))\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(xv) = [0]>>> then\n set [mode v] to [walljump]\n set [yv v] to [8]\n set [xv v] to (((xv) / ([abs v] of (xv) )) * (-10))\n else\n set [mode v] to [wallslide]\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (2)\n end\n change y by (-3)\n if <touching color (#666666)?> then\n if <(yv) = [-3]> then\n if <<key (right arrow v) pressed?> or <key (left arrow v) pressed?>> then\n set [mode v] to [run]\n else\n if <([abs v] of (xv) ) > [.1]> then\n set [mode v] to [skid]\n else\n set [mode v] to [stand]\n end\n end\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [mode v] to [jump]\n set [yv v] to [9]\n end\n end\n if <<(mode) = [jump]> or <<(mode) = [walljump]> and <<(yv) < [0]> or <<(mode) = [run]> or <<(mode) = [skid]> and <(yv) < [-3]>>>>>> then\n set [mode v] to [fall]\n end\n change y by (3)\n if <(yv) > [-15]> then\n change [yv v] by (-0.5)\n end\n change y by (-2)\n if <not <touching color (#666666)?>> then\n change y by (-1)\n if <not <touching color (#666666)?>> then\n change y by (-1)\n if <not <touching color (#666666)?>> then\n change y by (-1)\n if <not <touching color (#666666)?>> then\n change y by (-1)\n if <not <touching color (#666666)?>> then\n change y by (-1)\n if <not <touching color (#666666)?>> then\n change y by (5)\n end\n end\n end\n end\n end\n end\n change y by (2)\n change y by (yv)\n if <touching color (#666666)?> then\n change y by (-2)\n if <touching color (#666666)?> then\n change y by ((-1) * (yv))\n set [yv v] to [-3]\n end\n change y by (2)\n end\nend\n\nwhen flag clicked\nforever\n if <touching (diamond6 v)?> then\n switch costume to (f v)\n end\n if <touching (diamond7 v)?> then\n switch costume to (l v)\n end\n if <touching (diamond2 v)?> then\n switch costume to (e v)\n end\n if <touching (diamond3 v)?> then\n switch costume to (d v)\n end\n if <touching (diamond4 v)?> then\n switch costume to (c v)\n end\n if <touching (diamond5 v)?> then\n switch costume to (b v)\n end\nend\n\nwhen I receive [game over v]\nhide\n\nhide\n\n@Sprite4\n\nwhen I receive [back v]\nshow\ngo to x: (-3000) y: (-33)\nset [ghost v] effect to (0)\nrepeat (25)\n change x by (((0) - (x position)) * (0.2))\nend\nwait until <<touching (mouse-pointer v)?> and <mouse down?>>\nwait until <not <mouse down?>>\nif <touching (mouse-pointer v)?> then\n broadcast (starts v)\n stop [this script v]\nend\n\nwhen flag clicked\nset [start on v] to [yes]\nforever\n if <touching (mouse-pointer v)?> then\n set size to (190) %\n else\n set size to (160) %\n end\nend\n\nwhen I receive [starts v]\nset [start on v] to [off]\nset [play1 v] to [10]\nrepeat until \n change y by (play1)\n change [play1 v] by (-2)\n if <touching (_edge_ v)?> then\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nset [start on v] to [yes]\nbroadcast (back v)\nforever\n set volume to (50) %\n play sound [Beliver v] until done\nend\n\nwhen I receive [back v]\nshow\ngo to x: (50) y: (45)\nset [ghost v] effect to (80)\nrepeat (25)\n change x by (((-5) - (x position)) * (0.05))\n change [ghost v] effect by (-10)\nend\n\nwhen I receive [starts v]\nset [start on v] to [off]\nset [play1 v] to [10]\nrepeat until \n change y by (play1)\nend\nhide\n\nwhen I receive [game over v]\nhide\n\n@Sprite6\n\nwhen I receive [starts v]\nshow\n\nwhen flag clicked\ngo to x: (77) y: (-110)\n\nwhen I receive [game over v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nset [level v] to [1]\nshow\nswitch costume to (1 v)\nforever\n if <(costume [number v]) = [1]> then\n set [level v] to [1]\n go to x: (91) y: (-78)\n end\n if <(costume [number v]) = [2]> then\n set [level v] to [2]\n go to x: (91) y: (-78)\n end\n if <(costume [number v]) = [3]> then\n switch costume to (3 v)\n set [level v] to [3]\n go to x: (91) y: (-78)\n end\n if <(costume [number v]) = [4]> then\n switch costume to (4 v)\n set [level v] to [4]\n go to x: (91) y: (-78)\n end\n if <(costume [number v]) = [5]> then\n go to x: (91) y: (-78)\n switch costume to (5 v)\n set [level v] to [5]\n end\n if <(costume [number v]) = [6]> then\n go to x: (91) y: (-78)\n switch costume to (6 v)\n set [level v] to [6]\n end\n if <(costume [number v]) = [7]> then\n go to x: (91) y: (-78)\n switch costume to (7 v)\n set [level v] to [7]\n end\n if <(costume [number v]) = [8]> then\n go to x: (25) y: (-76)\n switch costume to (8 v)\n set [level v] to [8]\n end\nend\n\nwhen I receive [next level v]\nnext costume\n\nwhen I receive [game over v]\nswitch costume to (1 v)\n\n@Sprite5\n\nwhen I receive [starts v]\nset [level v] to [1]\ngo to x: (146) y: (-131)\nwait (0.8) seconds\nshow\nforever\n next costume\n wait (0.05) seconds\n if <(LEVEL) = [2]> then\n go to x: (144) y: (36)\n end\n if <(LEVEL) = [3]> then\n go to x: (146) y: (-131)\n end\n if <(LEVEL) = [4]> then\n go to x: (144) y: (-131)\n end\n if <(LEVEL) = [5]> then\n go to x: (-38) y: (-127)\n end\n if <(LEVEL) = [6]> then\n go to x: (145) y: (-130)\n end\n if <(LEVEL) = [8]> then\n go to x: (126) y: (-130)\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [game over v]\nhide\n\n@Sprite7\n\nwhen flag clicked\nset [level v] to [1]\nhide\nforever\n if <<(LEVEL) = [3]> or <(LEVEL) = [7]>> then\n show\n go to x: (-56) y: (-88)\n end\n if <not <<(LEVEL) = [3]> or <(LEVEL) = [7]>>> then\n hide\n end\n if <touching (sprite1 v)?> then\n broadcast (life v)\n end\nend\n\nwhen I receive [game over v]\nforever\n hide\nend\n\n@diamond2\n\nwhen flag clicked\nhide\nswitch costume to (b v)\nforever\n if <<(LEVEL) = [1]> and <(start on) = [off]>> then\n show\n switch costume to (f v)\n go to x: (-1) y: (-113)\n end\n if <not <(LEVEL) = [1]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nset [level v] to [1]\nhide\nforever\n if <(LEVEL) = [4]> then\n show\n go to x: (-86) y: (-85)\n end\n if <not <<(LEVEL) = [4]> or <(LEVEL) = [8]>>> then\n hide\n end\n if <touching (sprite1 v)?> then\n broadcast (life v)\n end\n if <(LEVEL) = [8]> then\n show\n go to x: (-60) y: (88)\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@diamond3\n\nwhen flag clicked\nswitch costume to (d v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [4]> then\n show\n switch costume to (b v)\n go to x: (2) y: (-90)\n end\n if <not <(LEVEL) = [4]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite9\n\nwhen flag clicked\nset [level v] to [1]\nhide\nforever\n if <(LEVEL) = [5]> then\n show\n go to x: (15) y: (-58)\n end\n if <not <(LEVEL) = [5]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n broadcast (life v)\n end\nend\n\nhide\n\nshow\n\nwhen I receive [game over v]\nhide\n\n@diamond4\n\nwhen flag clicked\nswitch costume to (d v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [3]> then\n show\n switch costume to (e v)\n go to x: (24) y: (70)\n end\n if <not <(LEVEL) = [3]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nwhen I receive [game over v]\nforever\n hide\nend\n\n@diamond5\n\nwhen flag clicked\nswitch costume to (d v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [5]> then\n show\n switch costume to (d v)\n go to x: (53) y: (32)\n end\n if <not <(LEVEL) = [5]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nshow\n\nwhen I receive [game over v]\nhide\n\n@Sprite10\n\nwhen I receive [rules v]\nshow\nnext costume\n\nwhen flag clicked\nhide\nswitch costume to (costume1 v)\n\nwhen I receive [game over v]\nhide\n\n@Sprite11\n\nwhen flag clicked\nswitch costume to (costume4 v)\nhide\n\nwhen I receive [starts v]\nshow\n\nwhen this sprite clicked\nswitch costume to (costume3 v)\nbroadcast (rules v)\n\nwhen I receive [game over v]\nhide\n\n@Sprite12\n\nwhen flag clicked\nset [level v] to [1]\nhide\nforever\n if <(LEVEL) = [6]> then\n show\n go to x: (139) y: (50)\n end\n if <not <(LEVEL) = [6]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n broadcast (life v)\n end\nend\n\nwhen I receive [game over v]\nhide\n\nshow\n\ngo to [front v] layer\n\n@diamond6\n\nwhen flag clicked\ngo to [front v] layer\nswitch costume to (d v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [6]> then\n show\n switch costume to (c v)\n go to x: (97) y: (1)\n end\n if <not <(LEVEL) = [6]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nshow\n\nwhen I receive [game over v]\nhide\n\n@diamond7\n\nwhen flag clicked\nswitch costume to (d v)\nhide\nforever\n if <(LEVEL) = [1]> then\n hide\n end\n if <(LEVEL) = [7]> then\n show\n switch costume to (c2 v)\n go to x: (23) y: (64)\n end\n if <not <(LEVEL) = [7]>> then\n hide\n end\n if <touching (sprite1 v)?> then\n set [diomond yes v] to [yes]\n wait (0.001) seconds\n forever\n hide\n end\n end\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite13\n\nwhen flag clicked\nhide\ngo to x: (211) y: (131)\n\nwhen I receive [life v]\nnext costume\nif <(costume [number v]) = [5]> then\n wait (1) seconds\n broadcast (game over v)\nend\n\nwhen I receive [starts v]\nswitch costume to (1 v)\nshow\n\n@Sprite14\n\nwhen flag clicked\nhide\n\nwhen I receive [game over v]\nshow\nstop [all v]\n\n@Sprite15\n\nwhen flag clicked\nhide\nset [level v] to [1]\nhide\ngo to x: (-42) y: (112)\n\nwhen I receive [game over v]\nhide\n\nif <(LEVEL) = [8]> then\n show\nend\nif <not <(LEVEL) = [8]>> then\n hide\nend\nif <touching (sprite1 v)?> then\n broadcast (life v)\nend\n\nshow\n\nforever\n point in direction (180)\n change x by (1)\nend\n\n@Sprite16\n\nwhen flag clicked\ngo to [front v] layer\nhide\n\nshow\n\n@Sprite17\n\nwhen this sprite clicked\nstop [all v]\n\n
use left right and up arrow to move and jump\ndon't touch the spikes \ndon't worry about the background its just decoration\ncollect the diamonds to change costume\nclick the scroll to read more rules\nALL LEVELS HAVE BEEN TESTED AND ARE POSSIBLE !!!\nclick the red square to stop
Scrolling Platformer Tutorial
@Stage\n\nwhen I receive [bad v]\nset [brightness v] effect to (100)\nwait (0.1) seconds\nset [brightness v] effect to (0)\n\n@Ground\n\nwhen flag clicked\nset [xv v] to [0]\nset [yv v] to [0]\nswitch costume to (costume2 v)\nset size to (600) %\nswitch costume to (costume1 v)\ngo to x: (-180) y: (471)\nshow\nbroadcast (levelStartSwitch v)\nforever\n set [ghost v] effect to (0)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n if <not <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n set [xv v] to [6]\n change x by ((-1) * (XV))\n end\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n set [xv v] to [-6]\n change x by ((-1) * (XV))\n end\n if <not <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>>> then\n set [xv v] to [0]\n end\n if <touching (player v)?> then\n change y by (-1)\n if <touching (player v)?> then\n change y by (-1)\n if <touching (player v)?> then\n change y by (-1)\n if <touching (player v)?> then\n change y by (-1)\n if <touching (player v)?> then\n change y by (-1)\n if <touching (player v)?> then\n change x by (XV)\n set [xv v] to [0]\n change y by (5)\n end\n end\n end\n end\n end\n end\n change [yv v] by (1)\n change y by (YV)\n change [inair v] by (1)\n if <touching (player v)?> then\n set [inair v] to [0]\n change y by ((YV) * (-1))\n set [yv v] to [0]\n end\n change y by (1)\n if <<touching (player v)?> and <<<key (up arrow v) pressed?> or <key (space v) pressed?>> or <key (w v) pressed?>>> then\n set [yv v] to [-20]\n end\n change y by (-1)\nend\n\nwhen I receive [bad v]\nset [brightness v] effect to (100)\nwait (0.1) seconds\nset [brightness v] effect to (0)\n\nwhen I receive [bad v]\ngo to x: (-180) y: (471)\n\nwhen flag clicked\nforever\n if <(y position) > [670]> then\n go to x: (-180) y: (471)\n end\nend\n\n@Player\n\nwhen flag clicked\ngo to x: (0) y: (0)\n\nwhen I receive [bad v]\nset [brightness v] effect to (100)\nwait (0.1) seconds\nset [brightness v] effect to (0)\n\n@Screen\n\nwhen flag clicked\ngo to x: (0) y: (0)\ngo to [front v] layer\nshow\n\nwhen I receive [bad v]\nset [brightness v] effect to (100)\nwait (0.1) seconds\nset [brightness v] effect to (0)\n\n@Bad\n\nwhen flag clicked\ncreate clone of (_myself_ v)\nhide\n\nwhen I receive [bad v]\nset [brightness v] effect to (100)\nwait (0.1) seconds\nset [brightness v] effect to (0)\n\nwhen I start as a clone\nswitch costume to (costume2 v)\nset size to (600) %\nswitch costume to (costume1 v)\ngo to x: (-180) y: (471)\nshow\nbroadcast (levelStartSwitch v)\nforever\n go to (ground v)\nend\n\nwhen I start as a clone\nforever\n if <touching (player v)?> then\n broadcast (bad v)\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nhide\n\n
T.R.A.P. Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [new_location v]\nnext backdrop\n\n@Спрайт 16\n\nwhen flag clicked\ngo to x: (0) y: (0)\nrepeat (11)\n go to [front v] layer\nend\nset [ghost v] effect to (0)\nshow\nbroadcast (Start_Game v)\nset [y_move v] to [45]\nrepeat until <(y_move) < [1]>\n change y by (y_move)\n change [y_move v] by (-3)\nend\nhide\n\n@Спрайт 17\n\nwhen flag clicked\n\nrepeat (13)\n go to [front v] layer\nend\nwait (0.2) seconds\ngo to x: (0) y: (0)\nset [ghost v] effect to (25)\nshow\nset [y_move v] to [0]\nrepeat (20)\n change y by (y_move)\n change [y_move v] by (2)\nend\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\nrepeat (10)\n go to [front v] layer\nend\nset [ghost v] effect to (20)\nshow\nwait (0.15) seconds\nset [y_move v] to [45]\nrepeat until <(y_move) < [1]>\n change y by (y_move)\n change [y_move v] by (-3)\nend\nhide\n\n@Спрайт 18\n\nwhen flag clicked\n\nrepeat (12)\n go to [front v] layer\nend\nwait (0.4) seconds\ngo to x: (0) y: (0)\nset [ghost v] effect to (50)\nshow\nset [y_move v] to [0]\nrepeat (20)\n change y by (y_move)\n change [y_move v] by (2)\nend\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\nrepeat (9)\n go to [front v] layer\nend\nset [ghost v] effect to (30)\nshow\nwait (0.3) seconds\nset [y_move v] to [45]\nrepeat until <(y_move) < [1]>\n change y by (y_move)\n change [y_move v] by (-3)\nend\nrepeat (3)\n change [ghost v] effect by (25)\nend\nhide\n\n@Sprite1\n\ndefine slope (#) ($)\nif <<<touching color (#484849)?> and <not <touching (level7_tilesground v)?>>> or <<touching (level9_9 v)?> or <<touching (level9_10 v)?> or <<touching (hints v)?> and <<(level) = [9]> or <(level) = [22]>>>>>> then\n if <(#) > [1]> then\n change y by (1)\n slope ((#) - (1)) ($)\n else\n if <<<touching color (#484849)?> and <not <touching (level7_tilesground v)?>>> or <<touching (level9_9 v)?> or <<touching (level9_10 v)?> or <<touching (hints v)?> and <<(level) = [9]> or <(level) = [22]>>>>>> then\n change x by (() - (x))\n set [x v] to [0]\n change y by (() - (($) - (1)))\n end\n end\nend\n\nwhen flag clicked\nhide\nset [skipcode v] to (pick random (0) to (999))\nset [_skipcodechanged v] to [0]\nset [_skipcodeused v] to [0]\nset [breakcode v] to (pick random (0) to (99999))\nset [_breakcodetried v] to [0]\nset [bosscode v] to (pick random (0) to (99999))\n\nif <(level) = [14]> then\n repeat until <(level) = [15]>\n if <touching (mouse-pointer v)?> then\n set [mouse_touch_player v] to [1]\n else\n set [mouse_touch_player v] to [0]\n end\n if <(x position) > [150]> then\n set drag mode [not draggable v]\n go to x: (-240) y: (0)\n else\n set drag mode [draggable v]\n end\n end\n go to x: (-240) y: (0)\n set drag mode [not draggable v]\n set [x v] to [0]\n set [y v] to [0]\nend\n\nwhen I receive [start_game v]\ngo to x: (-100) y: (0)\nrepeat (6)\n go to [front v] layer\nend\nswitch costume to (main v)\nset [ghost v] effect to (0)\nset drag mode [not draggable v]\nshow\nset [x v] to [0]\nset [y v] to [0]\nset [mouse_touch_player v] to [0]\nset [cannottongle v] to [0]\nforever\n set [playerx v] to (x position)\n set [playery v] to (y position)\n if <<<key (r v) pressed?> and <(CannotTongle) = [0]>> or <<<touching color (#ff5b24)?> or <touching (level7_tilesground v)?>> or <<touching color (#f6f3f3)?> and <(x position) > [-230]>>>> then\n broadcast (fading v)\n repeat (10)\n change [ghost v] effect by (10)\n end\n go to x: (-238) y: (0)\n set [x v] to [0]\n set [y v] to [0]\n broadcast (restart_level v)\n set [ghost v] effect to (0)\n wait until <(turning_over) = [0]>\n end\n if <(x position) > [239]> then\n broadcast (levelnext v)\n end\n if <<<(level) = [1]> and <(SpeedrunTick) = [0]>> and <(x position) < [-239]>> then\n set x to (238)\n broadcast (menuLevel v)\n set [cannottongle v] to [1]\n end\n if <(y position) > [176]> then\n set y to (-165)\n broadcast (secretLevel1 v)\n set [cannottongle v] to [1]\n end\n if <(y position) < [-176]> then\n set y to (165)\n broadcast (backFromSecret v)\n set [cannottongle v] to [0]\n end\n change [y v] by (-0.5)\n set [x v] to ((x) * (0.8))\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n change x by (x)\n slope (8) (8)\n change y by (y)\n if then\n change y by (() - (y))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if then\n set [y v] to [7]\n end\n if <touching color (#c91ca1)?> then\n set [y v] to [7]\n broadcast (jumpedPurple v)\n end\n end\n change y by (1)\nend\n\nwhen I receive [start_game v]\nforever\n if <key (([floor v] of ((SkipCode) / (100)) ) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((SkipCode) / (10)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key (((SkipCode) mod (10)) v) pressed?> then\n set [_skipcodeused v] to [1]\n if <<<(level) > [18]> and <(level) < [23]>> and <(_SkipCodeChanged) = [0]>> then\n set [skipcode v] to (pick random (0) to (999))\n set [_skipcodechanged v] to [1]\n if <(level) < [22]> then\n broadcast (SkipCode_changed v)\n end\n else\n broadcast (levelnext v)\n end\n wait until <not <key (any v) pressed?>>\n end\n end\n end\nend\n\nwhen I receive [levelnext v]\nif <(level) = [0]> then\n set x to (-238)\nelse\n go to x: (-238) y: (0)\n set [x v] to [0]\n set [y v] to [0]\nend\nwait (0.01) seconds\nif <(level) = [17]> then\n set [cannottongle v] to [1]\nelse\n set [cannottongle v] to [0]\nend\ngo to [front v] layer\ngo to [front v] layer\n\nwhen I receive [level24_typein v]\nrepeat until <(level) > [24]>\n if <key (([floor v] of ((BossCode) / (10000)) ) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BossCode) / (1000)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BossCode) / (100)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BossCode) / (10)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of (BossCode) ) mod (10)) v) pressed?> then\n if <(_BreakCodeTried) = [0]> then\n broadcast (Level24_Entered v)\n else\n broadcast (BossSmile v)\n stop [this script v]\n end\n end\n end\n end\n end\n end\nend\n\nwhen I receive [start_game v]\nforever\n if <key (([floor v] of ((BreakCode) / (10000)) ) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BreakCode) / (1000)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BreakCode) / (100)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of ((BreakCode) / (10)) ) mod (10)) v) pressed?> then\n wait until <not <key (any v) pressed?>>\n wait until <key (any v) pressed?>\n if <key ((([floor v] of (BreakCode) ) mod (10)) v) pressed?> then\n stop [other scripts in sprite v]\n broadcast (GameBroke v)\n stop [this script v]\n end\n end\n end\n end\n end\nend\n\n@level\n\nwhen flag clicked\ngo to x: (0) y: (0)\npoint in direction (90)\nswitch costume to (start v)\ngo to [back v] layer\nshow\nset [turning_over v] to [0]\n\nwhen I receive [levelnext v]\nchange [level v] by (1)\npoint in direction (90)\nif <(level) = [14]> then\n change [level v] by (1)\nend\nswitch costume to (level)\n\nwhen I receive [turn over v]\nset [turning_over v] to [1]\nstart sound [Oops v]\nrepeat (40)\n turn left (9) degrees\nend\nset [turning_over v] to [0]\n\nwhen flag clicked\nwait until <(level) > [9]>\nstop all sounds\nrepeat until <(level) > [16]>\n set volume to (50) %\n play sound [papayrus-anderteyl-papayrus-anderteyl v] until done\nend\n\nwhen I receive [you_win_song v]\nrepeat until <(level) > [22]>\n play sound [Centuries \(8 Bit Remix Cover Version\) \[Tribute to Fall Out Boy\] - 8 Bit Universe.mp3 v] until done\nend\n\nwhen [m v] key pressed\nbroadcast (Mute v)\n\nwhen [c v] key pressed\nbroadcast (ChangeMusic v)\n\nwhen I receive [start_game v]\nset [level v] to [1]\nswitch costume to (level)\nset [muted v] to [0]\nset [music_number v] to [1]\nset volume to (50) %\nplay sound [TheFatRat - Time Lapse.mp3 v] until done\nrepeat until <(level) > [9]>\n if <(music_number) = [1]> then\n play sound [TheFatRat - Time Lapse.mp3 v] until done\n else\n play sound [mc_hammer_-_u_can_t_touch_this_muzati v] until done\n end\nend\n\nwhen I receive [backfromsecret v]\nswitch costume to (level)\nset volume to (50) %\n\nwhen I receive [secretlevel1 v]\nswitch costume to (secretlevel1 v)\nset volume to (0) %\n\nwhen I receive [menulevel v]\nswitch costume to (menu v)\nchange [level v] by (-1)\n\nwhen flag clicked\nwait until <(level) > [17]>\nstop all sounds\nrepeat until <(level) > [19]>\n play sound [TheFatRat - Time Lapse.mp3 v] until done\nend\n\nwhen flag clicked\nwait until <(level) > [19]>\nstop all sounds\nrepeat until <(level) > [21]>\n play sound [TheFatRat - Time Lapse.mp3 v] until done\nend\n\nwhen flag clicked\nwait until <(level) > [21]>\nwait (3) seconds\nset [cannottongle v] to [1]\nrepeat (20)\n change volume by (-5)\nend\nwait (1) seconds\nstop all sounds\nwait (1) seconds\nset [cannottongle v] to [0]\nif <(Muted) = [0]> then\n set volume to (50) %\nelse\n set volume to (0) %\nend\n\nwhen flag clicked\nwait until <(level) = [17]>\nstop all sounds\nwait (10) seconds\nif <(level) > [17]> then\n stop [this script v]\nend\nbroadcast (Level17_ShowText v)\nset volume to (50) %\nstart sound [horrorsound v]\nwait (7.5) seconds\nif <(level) > [17]> then\n stop [this script v]\nend\nplay sound [electric_noise2 v] until done\nif <(level) > [17]> then\n stop [this script v]\nend\nbroadcast (ShowGirl v)\nstart sound [About Time - Nick Laird Clowes Daniel Marques \[TubeRipper v]\n\nwhen flag clicked\nwait until <(level) > [22]>\nstop all sounds\nif <(Muted) = [0]> then\n set volume to (50) %\nelse\n set volume to (0) %\nend\n\nwhen flag clicked\nwait until <(level) > [9]>\nbroadcast (new_location v)\nwait (0.5) seconds\nwait until <(level) > [17]>\nbroadcast (new_location v)\n\nwhen I receive [start_game v]\nforever\n set [fps_cnt v] to [0]\n set [lasttime v] to (timer)\n repeat until <((timer) - (lastTime)) > [1]>\n change [fps_cnt v] by (1)\n end\n set [fps v] to (FPS_cnt)\nend\n\nwhen flag clicked\nwait until <(level) > [28]>\nbroadcast (new_location v)\n\nwhen flag clicked\nwait until <(level) > [35]>\nbroadcast (new_location v)\n\nwhen I receive [changemusic v]\nif <(CannotTongle) = [0]> then\n set [music_number v] to (((music_number) mod (2)) + (1))\n stop all sounds\nend\n\nwhen I receive [mute v]\nif <(CannotTongle) = [0]> then\n if <(Muted) = [0]> then\n set volume to (0) %\n set [muted v] to [1]\n else\n set volume to (50) %\n set [muted v] to [0]\n end\nend\n\nwhen I receive [bossfight v]\nrepeat until <(level) > [35]>\n play sound [Level ! But Its Actually a Soundtrack REMASTERED \[TubeRipper v] until done\nend\n\n@Спрайт1\n\nwhen flag clicked\nhide\nwait until <(level) = [2]>\ngo to x: (28) y: (-75)\nswitch costume to (костюм1 v)\nrepeat (10)\n go to [back v] layer\nend\nrepeat until <(level) > [2]>\n if <<<(playerX) > ((x position) + (-35))> and <(playerX) < ((x position) + (35))>> and <<(playerY) > ((y position) + (-35))> and <(playerY) < ((y position) + (35))>>> then\n show\n broadcast (inscription v)\n wait (0.5) seconds\n hide\n end\nend\nhide\n\n@Спрайт2\n\nwhen flag clicked\nhide\nwait until <(level) = [3]>\ngo to x: (70) y: (-66)\nswitch costume to (костюм2 v)\nshow\nrepeat until <(level) > [3]>\n if <touching (sprite1 v)?> then\n switch costume to (костюм1 v)\n end\nend\nhide\n\n@Спрайт3\n\nwhen flag clicked\nhide\nwait until <(level) = [4]>\ngo to x: (140) y: (-53)\nswitch costume to (костюм1 v)\nset [ghost v] effect to (50)\nrepeat (10)\n go to [front v] layer\nend\nrepeat until <(level) > [4]>\n if <<(playerX) > [70]> and <(playerY) < [0]>> then\n show\n else\n hide\n end\nend\nhide\n\n@Спрайт4\n\nwhen flag clicked\nhide\nwait until <(level) = [4]>\ngo to x: (207) y: (117)\nswitch costume to (костюм1 v)\nrepeat (10)\n go to [back v] layer\nend\nrepeat until <(level) > [4]>\n if <<(playerX) > [170]> and <(playerY) > [0]>> then\n show\n wait (0.5) seconds\n hide\n end\nend\nhide\n\n@Спрайт5\n\nwhen flag clicked\nhide\nwait until <(level) = [5]>\ngo to x: (0) y: (-2)\ngo to [back v] layer\ngo to [back v] layer\nshow\nrepeat until <(level) > [5]>\n if <(playerX) > [200]> then\n set [ghost v] effect to (50)\n else\n set [ghost v] effect to (0)\n end\nend\nstop [other scripts in sprite v]\nhide\n\ngo to [back v] layer\n\n@Спрайт6\n\nwhen I receive [restart_level v]\nswitch costume to (костюм1 v)\nrepeat (10)\n go to x: (200) y: (-2)\nend\n\nwhen flag clicked\nhide\nwait until <(level) = [6]>\ngo to x: (200) y: (-2)\nswitch costume to (костюм1 v)\ngo to [back v] layer\nshow\nrepeat until <(level) > [6]>\n if <touching (sprite1 v)?> then\n set [triggered v] to [1]\n switch costume to (костюм2 v)\n repeat (2)\n change y by (-20)\n end\n if <<(y position) < [-100]> and <(jumps_cnt) = [2]>> then\n switch costume to (костюм3 v)\n end\n repeat (2)\n change y by (-20)\n end\n change y by (-19)\n wait (0.5) seconds\n end\nend\nhide\n\nwhen I receive [restart_level v]\nif <(level) = [6]> then\n set [triggered v] to [0]\nend\nwait (0.1) seconds\nwait until <(playerY) < [-100]>\nset [jumps_cnt v] to [0]\n\nwhen flag clicked\nwait until <(level) = [6]>\nwait (0.5) seconds\nwait until <(playerY) < [-100]>\nset [jumps_cnt v] to [0]\nrepeat until <(level) > [6]>\n if <(playerY) > [-100]> then\n change [jumps_cnt v] by (1)\n wait until <(playerY) < [-100]>\n end\nend\n\nset [jumps_cnt v] to [0]\n\nwhen I receive [fading v]\nset [jumps_cnt v] to [0]\n\n@Спрайт7\n\nwhen I receive [inscription v]\nswitch costume to (костюм1 v)\ngo to [front v] layer\ngo to [front v] layer\nshow\nwait until <(level) > [2]>\nhide\n\nwait (0.5) seconds\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [inscription_2 v]\nswitch costume to (костюм2 v)\nshow\nwait until <(level) > [7]>\nhide\n\nwhen I receive [inscription_3 v]\nswitch costume to (костюм3 v)\nshow\nwait until <(level) > [8]>\nhide\n\n@Level7_tilesGround\n\nwhen flag clicked\ngo to x: (-116) y: (-102)\nswitch costume to (ground v)\ngo to [front v] layer\nhide\nwait until <(level) = [7]>\nrepeat (3)\n create clone of (_myself_ v)\n change x by (94)\nend\nhide\n\nwhen I start as a clone\nshow\nrepeat until <(level) > [7]>\n if <touching (sprite1 v)?> then\n switch costume to (lava v)\n wait (0.4) seconds\n wait until <not <touching (sprite1 v)?>>\n switch costume to (ground v)\n end\nend\nhide\n\n@Спрайт10\n\nwhen flag clicked\nhide\nwait until <(level) = [8]>\ngo to x: (-70) y: (41)\nswitch costume to (костюм2 v)\nshow\nrepeat until <(level) > [8]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_3 v)\n switch costume to (костюм1 v)\n wait (0.5) seconds\n switch costume to (костюм2 v)\n end\nend\nhide\n\ngo to x: (-22) y: (-50)\n\n@Спрайт11\n\nwhen flag clicked\nhide\nwait until <(level) = [8]>\ngo to x: (-44) y: (-22)\nswitch costume to (костюм2 v)\nrepeat (5)\n go to [back v] layer\nend\nshow\nrepeat until <(level) > [8]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_3 v)\n switch costume to (костюм1 v)\n wait (0.5) seconds\n switch costume to (костюм2 v)\n end\nend\nhide\n\n@Спрайт12\n\nwhen flag clicked\nhide\nwait until <(level) = [8]>\ngo to x: (-70) y: (-87)\nswitch costume to (костюм2 v)\nshow\nrepeat until <(level) > [8]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_3 v)\n switch costume to (костюм1 v)\n wait (0.5) seconds\n switch costume to (костюм2 v)\n end\nend\nhide\n\n@Спрайт13\n\nwhen flag clicked\nhide\nwait until <(level) = [8]>\ngo to x: (139) y: (50)\nswitch costume to (костюм2 v)\ngo to [back v] layer\nshow\nrepeat until <(level) > [8]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_3 v)\n switch costume to (костюм1 v)\n wait (0.5) seconds\n switch costume to (костюм2 v)\n end\nend\nhide\n\n@Спрайт 1\n\nwhen flag clicked\nhide\nwait until <(level) = [10]>\ngo to x: (36) y: (28)\nshow\nrepeat until <(level) > [10]>\n if <touching (sprite1 v)?> then\n repeat (10)\n change x by (-10)\n end\n wait (1) seconds\n repeat (4)\n change x by (25)\n end\n end\nend\nhide\n\nwhen I receive [levelnext v]\nif <(level) = [11]> then\n hide\nend\n\nwhen flag clicked\nwait until <(level) > [10]>\nhide\n\n@Спрайт 2\n\nwhen flag clicked\nhide\nwait until <(level) = [12]>\ngo to x: (-36) y: (30)\nswitch costume to (костюм 1 v)\ngo to [front v] layer\nshow\nrepeat until <(level) > [12]>\n if <touching (sprite1 v)?> then\n switch costume to (костюм 2 v)\n repeat (20)\n turn right (18) degrees\n change x by (10)\n end\n repeat (20)\n change x by (-10)\n end\n switch costume to (костюм 1 v)\n end\nend\nhide\n\nwhen I receive [turn over v]\nhide\nwait (1.3) seconds\nshow\n\nwhen I receive [restart_level v]\n\nif <(level) = [12]> then\n wait (0.5) seconds\n show\nend\n\n@Спрайт 3\n\nwhen flag clicked\nhide\nwait until <(level) = [12]>\ngo to x: (36) y: (28)\ngo to [back v] layer\ngo to [back v] layer\nshow\nrepeat until <(level) > [12]>\n if <touching (sprite1 v)?> then\n hide\n broadcast (turn over v)\n wait (1.5) seconds\n show\n end\nend\nhide\n\nwhen I receive [restart_level v]\nif <(level) = [12]> then\n show\nend\n\n@Sprite15\n\nwhen flag clicked\nwait until <(level) > [13]>\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [13]>\ngo to x: (-100) y: (-60)\npoint in direction (-90)\ngo to [back v] layer\nswitch costume to (costume3 v)\nshow\nrepeat until <(level) > [13]>\n if <touching (sprite1 v)?> then\n start sound [00002a0d v]\n switch costume to (costume1 v)\n show\n wait (1) seconds\n start sound [000029bd v]\n switch costume to (costume2 v)\n wait (0.4) seconds\n switch costume to (costume3 v)\n end\nend\nhide\n\n@Sprite2\n\nwhen flag clicked\nwait until <(level) > [13]>\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [13]>\ngo to x: (60) y: (-136)\npoint in direction (90)\ngo to [back v] layer\nswitch costume to (costume3 v)\nshow\nrepeat until <(level) > [13]>\n if <touching (sprite1 v)?> then\n start sound [00002a0d v]\n switch costume to (costume1 v)\n show\n wait (1) seconds\n start sound [000029bd v]\n switch costume to (costume2 v)\n wait (0.4) seconds\n switch costume to (costume3 v)\n end\nend\nhide\n\n@Sprite3\n\nwhen flag clicked\nhide\nwait until <(level) = [13]>\ngo to x: (220) y: (-40)\npoint in direction (90)\nrepeat (10)\n go to [front v] layer\nend\nswitch costume to (costume3 v)\nshow\nset [_turn v] to [1]\nrepeat until <(level) > [13]>\n if <touching (sprite1 v)?> then\n set [_turn v] to [1]\n start sound [000029bd v]\n switch costume to (costume2 v)\n show\n wait (0.5) seconds\n if <(_turn) = [1]> then\n wait (0.5) seconds\n start sound [Jump v]\n repeat (40)\n move (12) steps\n turn right (9) degrees\n end\n wait (0.4) seconds\n end\n switch costume to (costume3 v)\n wait (0.2) seconds\n end\nend\nhide\n\nwhen I receive [levelnext v]\nif <(level) = [13]> then\n hide\nend\n\nwhen I receive [fading v]\nif <(level) = [13]> then\n set [_turn v] to [0]\nend\n\n@Спрайт 4\n\nwhen flag clicked\nhide\nwait until <(level) = [14]>\nset [ghost v] effect to (100)\ngo to [front v] layer\nset size to (200) %\nrepeat until <(level) = [15]>\n go to x: (pick random (-150) to (150)) y: (-66)\n switch costume to (images v)\n show\n repeat (10)\n change size by (-10)\n change [ghost v] effect by (-10)\n end\n switch costume to (images2 v)\n wait (0.1) seconds\n switch costume to (images v)\n repeat (10)\n change size by (10)\n change [ghost v] effect by (10)\n end\n hide\n wait (1) seconds\nend\n\nwhen I receive [levelnext v]\nwait (0.01) seconds\nif <(level) = [15]> then\n hide\nend\n\n@Спрайт 5\n\nwhen flag clicked\ngo to x: (50) y: (-20)\nswitch costume to (костюм 1 v)\nhide\nwait until <(level) = [14]>\nset size to (100) %\nset [ghost v] effect to (0)\nshow\nrepeat until <(level) = [15]>\n if <touching (sprite1 v)?> then\n set size to (200) %\n set [ghost v] effect to (100)\n switch costume to (1200px-trollface v)\n repeat (10)\n change size by (-10)\n change [ghost v] effect by (-10)\n end\n wait (0.1) seconds\n repeat (10)\n change size by (10)\n change [ghost v] effect by (10)\n end\n switch costume to (костюм 1 v)\n set size to (100) %\n set [ghost v] effect to (0)\n end\nend\n\nwhen I receive [levelnext v]\nwait (0.01) seconds\nif <(level) = [15]> then\n hide\nend\n\n@Спрайт 6\n\nwhen flag clicked\nhide\nwait until <(level) = [14]>\ngo to x: (8) y: (84)\nset [ghost v] effect to (20)\nrepeat until <(level) > [14]>\n if <(mouse_touch_player) = [1]> then\n show\n else\n hide\n end\nend\nhide\n\n@Спрайт14\n\nwhen flag clicked\ngo to x: (-64) y: (-176)\nswitch costume to (костюм2 v)\ngo to [back v] layer\ngo to [back v] layer\nhide\nwait until <(level) = [8]>\nrepeat until <(level) > [8]>\n if <<<(playerX) > [-85]> and <(playerX) < [-35]>> and <(playerY) < [-130]>> then\n set [triggered v] to [1]\n go to [back v] layer\n show\n broadcast (inscription_3 v)\n wait (1) seconds\n broadcast (level8_countdown v)\n repeat until <not <(x position) < [130]>>\n change x by (3)\n end\n wait (1) seconds\n repeat until <not <[-64] < (x position)>>\n change x by (-9)\n if <(level) > [8]> then\n hide\n end\n end\n end\nend\nhide\n\nwhen I receive [level8_countdown v]\nset [_beat v] to [0]\nwait (0.6) seconds\nreset timer\nrepeat until <(timer) > [0.3]>\n if <touching (sprite1 v)?> then\n set [_beat v] to [1]\n end\nend\nif <(_beat) = [1]> then\n broadcast (beat v)\nend\n\nwhen flag clicked\nwait until <(level) > [8]>\nhide\n\n@Спрайт 8\n\nwhen flag clicked\nhide\n\nwhen I receive [beat v]\ngo to x: (104) y: (401)\npoint in direction (90)\ngo to [front v] layer\nshow\nrepeat (9)\n change y by (-50)\nend\nwait (0.9) seconds\nrepeat (9)\n change y by (50)\nend\nhide\n\n@Level16_1\n\nwhen flag clicked\nhide\nwait until <(level) = [16]>\ngo to x: (230) y: (-73)\nrepeat (10)\n go to [back v] layer\nend\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (0)\nshow\nwait until <touching (sprite1 v)?>\nif <(level) = [16]> then\n switch costume to (костюм 2 v)\n broadcast (have_no_levels v)\nend\n\nwhen I receive [have_idea v]\n\nwhen I receive [have_fun v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [16]>\nhide\nwait until <(level) > [21]>\nhide\n\nwhen flag clicked\nwait until <(level) = [21]>\ngo to x: (230) y: (-69)\nset [ghost v] effect to (0)\nswitch costume to (костюм 3 v)\nrepeat (10)\n go to [front v] layer\nend\nshow\nwait until <touching (sprite1 v)?>\nif <(level) = [21]> then\n switch costume to (костюм 2 v)\n broadcast (have_bug v)\nend\n\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\n@Level16_2\n\nwhen flag clicked\nwait until <(level) > [16]>\nhide\n\nwhen I receive [have_no_levels v]\ngo to x: (0) y: (0)\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (100)\nshow\nrepeat (6)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (2.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\nend\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (0.5) seconds\nif <(level) = [16]> then\n change [level v] by (1)\n broadcast (levelnext v)\nend\n\nwhen flag clicked\nhide\n\nset [ghost v] effect to (0)\n\n@Level21_2\n\nwhen I receive [have_bug v]\ngo to x: (0) y: (10)\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (100)\nshow\nrepeat (3)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\nend\nrepeat (5)\n change [ghost v] effect by (-10)\nend\nbroadcast (have_fun v)\nrepeat (5)\n change [ghost v] effect by (-10)\nend\n\nwhen flag clicked\nhide\nwait until <(level) > [21]>\nhide\n\n@Спрайт 11\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\ngo to x: (203) y: (140)\nswitch costume to (normal v)\nhide\nwait until <(level) > [3]>\nset [ghost v] effect to (50)\nset size to (100) %\ngo to [front v] layer\nshow\nset [touched_hint v] to [0]\n\n if <touching (mouse-pointer v)?> then\n if <<(level) > [9]> and <(level) < [18]>> then\n hide\n set [touched_hint v] to [1]\n stop [this script v]\n end\n if <(level) > [22]> then\n stop [other scripts in sprite v]\n broadcast (level22_hide v)\n end\n set [ghost v] effect to (20)\n if <mouse down?> then\n broadcast (touched v)\n broadcast (show_hint v)\n set size to (90) %\n wait (1) seconds\n wait until <(hint_shown) = [0]>\n else\n set size to (100) %\n end\n else\n set [ghost v] effect to (50)\n set size to (100) %\n end\n go to [front v] layer\nend\n\nwhen flag clicked\nwait until <(level) > [16]>\nhide\nwait until <(level) > [17]>\nif <(touched_hint) = [0]> then\n show\nend\nwait until <(level) > [22]>\nwait (5) seconds\nstop [other scripts in sprite v]\nbroadcast (level22_hide v)\n\nwhen I receive [levelnext v]\nwait (0.01) seconds\ngo to [front v] layer\n\nwhen I receive [level22_hide v]\nswitch costume to (corrupted v)\nstop [other scripts in sprite v]\nwait (0.2) seconds\nhide\n\nswitch costume to (normal v)\nshow\n\n@Hints\n\nwhen I receive [backfromsecret v]\nif <(hint_seen) = [1]> then\n show\nend\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\ngo to x: (0) y: (0)\ngo to [front v] layer\nhide\nset [triggered v] to [0]\nset [hint_shown v] to [0]\nset [hint_seen v] to [0]\n\nwhen I receive [show_hint v]\nset [hint_seen v] to [1]\nset [hint_shown v] to [1]\nset [ghost v] effect to (100)\nshow\nif <<(level) > [17]> and <(level) < [20]>> then\n set [cur_level v] to (level)\n repeat until <(level) > (cur_level)>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n set [ghost v] effect to (100)\n end\nelse\n if <<(level) > [19]> and <(level) < [23]>> then\n set [cur_level v] to (level)\n repeat until <(level) > (cur_level)>\n repeat (pick random (1) to (5))\n change [ghost v] effect by (-10)\n end\n set [ghost v] effect to (pick random (0) to (50))\n end\n else\n if <(level) = [9]> then\n repeat (10)\n change [ghost v] effect by (-10)\n end\n next costume\n wait until <(level) > [9]>\n else\n repeat (3)\n repeat (12)\n change [ghost v] effect by (-10)\n end\n repeat (12)\n change [ghost v] effect by (10)\n end\n end\n end\n end\nend\nhide\nset [hint_shown v] to [0]\n\nwhen I receive [levelnext v]\nset [hint_seen v] to [0]\nhide\nset [triggered v] to [0]\ngo to x: (0) y: (0)\nwait (0.01) seconds\nif <(level) < [5]> then\n switch costume to (n4 v)\nelse\n if <(level) < [17]> then\n switch costume to (((((level) - (4)) * (2)) + (triggered)) + (1))\n else\n switch costume to ((level) - (5))\n end\nend\n\nwhen flag clicked\nrepeat until <(level) > [9]>\n wait until <(triggered) = [1]>\n switch costume to (((((level) - (4)) * (2)) + (triggered)) + (1))\n hide\n wait until <(triggered) = [0]>\n switch costume to (((((level) - (4)) * (2)) + (triggered)) + (1))\n hide\nend\n\nwait until <(level) > [17]>\nrepeat until <(level) > [22]>\n switch costume to ((level) - (5))\nend\n\nwhen I receive [level22_hide v]\nhide\n\n@Спрайт 13\n\nwhen flag clicked\ngo to x: (36) y: (28)\nrepeat (10)\n go to [front v] layer\nend\nhide\nwait until <(level) = [20]>\nwait (1) seconds\nshow\nwait until <(level) > [20]>\nhide\n\n@gaster_blaster\n\nwhen flag clicked\nhide\n\nwhen I receive [levelnext v]\nhide\n\nwhen flag clicked\nwait until <(touched_hint) = [1]>\nif <not <(level) > [16]>> then\n go to x: (169) y: (140)\n point in direction (0)\n switch costume to (gaster_blaster v)\n set size to (40) %\n show\n start sound [Gaster Blaster \(Undertale\) - QuickSounds v]\n repeat (3)\n next costume\n wait (0.01) seconds\n end\n wait (0.4) seconds\n repeat (3)\n next costume\n wait (0.01) seconds\n end\n wait (0.5) seconds\n repeat (3)\n next costume\n wait (0.03) seconds\n end\n hide\nend\n\n@Спрайт 14\n\nwhen flag clicked\nhide\nwait until <(level) = [8]>\ngo to x: (0) y: (0)\nswitch costume to (костюм 2 v)\nrepeat (5)\n go to [back v] layer\nend\nshow\nrepeat until <(level) > [8]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_3 v)\n switch costume to (костюм 1 v)\n wait (0.5) seconds\n switch costume to (костюм 2 v)\n end\nend\nhide\n\n@Sprite5\n\ngo to x: (0) y: (0)\ngo to [front v] layer\nshow\n\nwhen flag clicked\nhide\n\n@Спрайт 15\n\nwhen flag clicked\nhide\nwait until <(level) > [3]>\nif <(level) = [4]> then\n wait (0.2) seconds\n go to x: (122) y: (85)\n set [ghost v] effect to (100)\n set size to (50) %\n show\n set [zoom_in v] to [22]\n repeat (20)\n change [ghost v] effect by (() - ((zoom_in) * (1.5)))\n change size by (zoom_in)\n set [zoom_in v] to ((zoom_in) / (1.5))\n end\nend\n\nwhen I receive [touched v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) > [4]>\nhide\n\n@Sprite6\n\nwhen flag clicked\nhide\nwait until <(level) = [5]>\nwait (8.1) seconds\nif <(level) = [5]> then\n go to x: (-105) y: (240)\n show\n repeat (9)\n change y by (-11)\n end\n set [y_move v] to [-11]\n repeat until <(y_move) > [0]>\n change y by (y_move)\n change [y_move v] by (1)\n end\n wait until <(level) > [5]>\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [5]>\nhide\n\nset x to (-105)\n\n@Sprite7\n\nwhen flag clicked\nhide\ngo to x: (25) y: (240)\nwait until <(level) = [5]>\nwait (8.2) seconds\nif <(level) = [5]> then\n show\n repeat (9)\n change y by (-11)\n end\n set [y_move v] to [-11]\n repeat until <(y_move) > [0]>\n change y by (y_move)\n change [y_move v] by (1)\n end\n wait until <(level) > [5]>\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [5]>\nhide\n\nset x to (25)\n\nwhen I receive [changemusic v]\nwait (1) seconds\nif <(music_number) = [2]> then\n repeat until <<(level) > [5]> or <(music_number) = [1]>>\n repeat (3)\n repeat (6)\n change x by (3)\n change y by (-3)\n end\n repeat (6)\n change x by (-3)\n change y by (3)\n end\n if <not <(music_number) = [2]>> then\n stop [this script v]\n end\n repeat (6)\n change x by (-3)\n change y by (-3)\n end\n repeat (6)\n change x by (3)\n change y by (3)\n end\n if <not <(music_number) = [2]>> then\n stop [this script v]\n end\n end\n repeat (6)\n change x by (3)\n change y by (-3)\n end\n repeat (6)\n change x by (-3)\n change y by (3)\n end\n wait (0.6) seconds\n end\nend\n\n@Sprite8\n\nwhen flag clicked\nhide\nwait until <(level) = [12]>\nset [shown v] to [0]\nset [y_move v] to [0]\nrepeat until <(level) > [12]>\n set [last_xlevel v] to (playerX)\n set [last_ylevel v] to (playerY)\n wait (0.7) seconds\n if <<<(last_xLevel) = (playerX)> and <(last_yLevel) = (playerY)>> and <<(turning_over) = [0]> and <(level) = [12]>>> then\n set [shown v] to [1]\n go to x: (130) y: (240)\n show\n repeat (8)\n change y by (-11)\n end\n set [y_move v] to [-11]\n repeat until <(y_move) > [0]>\n change y by (y_move)\n change [y_move v] by (1)\n end\n wait until <(level) > [12]>\n end\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [12]>\nhide\n\nwhen I receive [turn over v]\nhide\nwait (1.3) seconds\nif <(shown) = [1]> then\n show\nend\n\n@Sprite4\n\nwhen flag clicked\nhide\nwait until <(level) = [5]>\nwait (8) seconds\nif <(level) = [5]> then\n go to x: (0) y: (240)\n show\n repeat (6)\n change y by (-11)\n end\n set [y_move v] to [-11]\n repeat until <(y_move) > [0]>\n change y by (y_move)\n change [y_move v] by (1)\n end\n wait until <(level) > [5]>\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [5]>\nhide\n\n@Спрайт 19\n\nwhen flag clicked\nhide\nwait until <(level) = [12]>\ngo to x: (0) y: (-212)\ngo to [front v] layer\nshow\nrepeat until <(level) > [12]>\n wait until <<(playerY) < [80]> and <<(playerX) > [-15]> and <(playerX) < [30]>>>\n repeat (5)\n change y by (42)\n end\n wait until <not <<(playerY) < [80]> and <<(playerX) > [-15]> and <(playerX) < [30]>>>>\n repeat (5)\n change y by (-42)\n end\nend\nhide\n\nwhen I receive [turn over v]\nhide\nwait (1.3) seconds\nshow\n\nwhen flag clicked\nwait until <(level) > [12]>\nhide\n\n@Level9_1\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (-87) y: (55)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\n@Level9_2\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (-140) y: (-90)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_3\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (-58) y: (-110)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_4\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (20) y: (-90)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_5\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (74) y: (-58)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_6\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (191) y: (10)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_7\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (202) y: (45)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_8\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\ngo to x: (231) y: (117)\nswitch costume to (костюм2 v)\nshow\nwait until <touching (sprite1 v)?>\nswitch costume to (костюм1 v)\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Level9_9\n\nwhen I receive [backfromsecret v]\ngo to [back v] layer\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\nwhen I receive [level9_9_show v]\ngo to x: (60) y: (89)\ngo to [back v] layer\nshow\n\n@Level9_10\n\nwhen I receive [backfromsecret v]\nshow\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nwait until <(level) = [9]>\nset [x_move v] to [0]\nrepeat until <(level) > [9]>\n set [last_xlevel v] to (playerX)\n set [last_ylevel v] to (playerY)\n wait (0.7) seconds\n if <<<(last_xLevel) = (playerX)> and <(last_yLevel) = (playerY)>> and <(level) = [9]>> then\n go to x: (-252) y: (110)\n show\n set [x_move v] to [10]\n repeat until <(x_move) < [0]>\n change x by (x_move)\n change [x_move v] by (-1)\n end\n wait until <(level) > [9]>\n end\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@Menu1\n\nwhen flag clicked\nhide\n\nwhen I receive [menulevel v]\ngo to x: (0) y: (-35)\nshow\nreset timer\nforever\n change y by (([sin v] of (((timer) * (500)) + (90)) ) * (2))\nend\n\nwhen I receive [levelnext v]\nhide\n\n@Menu2\n\nwhen flag clicked\nhide\n\nwhen I receive [menulevel v]\ngo to x: (0) y: (0)\nswitch costume to (костюм 1 v)\nshow\nforever\n if <(SpeedrunTick) = [1]> then\n switch costume to (костюм 2 v)\n repeat until <(SpeedrunTick) = [0]>\n repeat (7)\n change y by (-4)\n end\n repeat (7)\n change y by (4)\n end\n end\n else\n if <(TouchedSpeedrunTick) = [1]> then\n switch costume to (костюм 3 v)\n wait (0.15) seconds\n switch costume to (костюм 2 v)\n wait (0.15) seconds\n end\n end\nend\n\nwhen I receive [levelnext v]\nhide\n\nwhen I receive [menulevel v]\nforever\n if <<(TouchedSpeedrunTick) = [0]> and <(SpeedrunTick) = [0]>> then\n switch costume to (костюм 1 v)\n end\nend\n\n@Спрайт 20\n\nwhen flag clicked\nhide\nset [speedruntick v] to [0]\n\nwhen I receive [levelnext v]\nhide\n\nwhen I receive [menulevel v]\ngo to x: (0) y: (-80)\nswitch costume to (костюм 1 v)\nshow\nforever\n if <touching (sprite1 v)?> then\n set [touchedspeedruntick v] to [1]\n if <<key (down arrow v) pressed?> or <key (s v) pressed?>> then\n if <(SpeedrunTick) = [0]> then\n switch costume to (костюм 2 v)\n set [speedruntick v] to [1]\n else\n switch costume to (костюм 1 v)\n set [speedruntick v] to [0]\n end\n wait until <not <<key (down arrow v) pressed?> or <key (s v) pressed?>>>\n end\n else\n set [touchedspeedruntick v] to [0]\n end\nend\n\n@Спрайт 22\n\nwhen flag clicked\nhide\n\nwhen I receive [levelnext v]\nhide\n\nwhen I receive [menulevel v]\ngo to x: (113) y: (40)\nset [ghost v] effect to (100)\nshow\nwait (0.2) seconds\nforever\n if <(SpeedrunTick) = [1]> then\n repeat (10)\n change [ghost v] effect by (-10)\n set x to ((([sin v] of ((timer) * (500)) ) * (5)) + (113))\n end\n repeat until <(SpeedrunTick) = [0]>\n set x to ((([sin v] of ((timer) * (500)) ) * (5)) + (113))\n end\n repeat (10)\n change [ghost v] effect by (10)\n set x to ((([sin v] of ((timer) * (500)) ) * (5)) + (113))\n end\n set x to (113)\n end\nend\n\n@Спрайт 21\n\nwhen flag clicked\nhide\n\nwhen I receive [levelnext v]\nhide\n\nwhen I receive [menulevel v]\ngo to x: (113) y: (100)\nset [ghost v] effect to (100)\nshow\nwait (0.2) seconds\nforever\n if <(SpeedrunTick) = [1]> then\n repeat until <(SpeedrunTick) = [0]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n repeat (10)\n change [ghost v] effect by (10)\n end\n end\n end\nend\n\n@Level9_9_help\n\nwhen I receive [backfromsecret v]\nif <(Hidden) = [1]> then\n go to [front v] layer\n show\nend\n\nwhen I receive [secretlevel1 v]\nhide\n\nwhen flag clicked\nhide\nset [hidden v] to [1]\nwait until <(level) = [9]>\ngo to x: (60) y: (89)\ngo to [front v] layer\nshow\nwait until <touching (sprite1 v)?>\nset [hidden v] to [0]\nbroadcast (level9_9_show v)\nhide\n\nwhen flag clicked\nwait until <(level) > [9]>\nhide\n\n@SecretLevel1_1\n\nwhen I receive [secretlevel1 v]\nerase all\ngo to x: (-150) y: (100)\nswitch costume to (([floor v] of ((SkipCode) / (100)) ) + (1))\nshow\nstamp\nchange x by (20)\nswitch costume to ((([floor v] of ((SkipCode) / (10)) ) mod (10)) + (1))\nstamp\nchange x by (20)\nswitch costume to (((SkipCode) mod (10)) + (1))\nstamp\nhide\n\nwhen flag clicked\nhide\nerase all\n\nwhen I receive [backfromsecret v]\nhide\nerase all\n\nwhen I receive [levelnext v]\nhide\nerase all\n\n@Level22_1\n\nwhen flag clicked\nhide\nwait until <(level) > [22]>\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nwait until <(level) = [22]>\ngo to x: (0) y: (10)\nswitch costume to (костюм 5 v)\nset [ghost v] effect to (100)\nshow\nwait (8) seconds\nrepeat (3)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\nend\nif <(_SkipCodeUsed) = [0]> then\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n broadcast (You_Win_Song v)\n repeat (10)\n change [ghost v] effect by (-10)\n end\nelse\n switch costume to (skipcodestart v)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3) seconds\n next costume\n wait (3) seconds\n next costume\n wait (1) seconds\n repeat (5)\n next costume\n wait (0.1) seconds\n end\n next costume\n wait (2) seconds\n if <(touched_hint) = [1]> then\n switch costume to (nohints v)\n wait (3.5) seconds\n switch costume to (anyway v)\n else\n next costume\n wait (1.5) seconds\n next costume\n wait (1.5) seconds\n next costume\n wait (1.5) seconds\n hide\n wait (6) seconds\n broadcast (level22_hide v)\n wait (1) seconds\n switch costume to (fixed v)\n set [ghost v] effect to (100)\n show\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3) seconds\n next costume\n end\n wait (2) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n switch costume to (youwin v)\n broadcast (You_Win_Song v)\n repeat (10)\n change [ghost v] effect by (-10)\n end\nend\n\n@Level17_1\n\nwhen flag clicked\nhide\nset [startx v] to [-120]\nset [starty v] to [10]\nwait until <(level) > [17]>\nhide\nwait until <(level) > [34]>\ngo to x: (startX) y: (startY)\nswitch costume to (static1 v)\nset size to (150) %\nset [ghost v] effect to (80)\nshow\nrepeat until <(level) > [35]>\n switch costume to (static1 v)\n go to x: ((startX) + (pick random (-10) to (10))) y: ((startY) + (pick random (-10) to (10)))\n wait (0.1) seconds\n next costume\n go to x: ((startX) + (pick random (-10) to (10))) y: ((startY) + (pick random (-10) to (10)))\n wait (0.1) seconds\nend\nhide\n\nwhen I receive [showgirl v]\ngo to x: (startX) y: (startY)\nswitch costume to (horror v)\nset size to (150) %\nset [ghost v] effect to (95)\nshow\n\nwhen I receive [gamebroke v]\nstop [other scripts in sprite v]\nstop [this script v]\n\n@Level17_2\n\nwhen flag clicked\nhide\nwait until <(level) > [17]>\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [level17_showtext v]\nhide\nwait (6.5) seconds\ngo to x: (0) y: (0)\nswitch costume to (костюм 1 v)\nshow\nwait (1.7) seconds\nswitch costume to (костюм 2 v)\n\nwhen I receive [showgirl v]\nhide\n\n@Level17_3\n\nwhen flag clicked\nerase all\nhide\nwait until <(level) > [17]>\nstop [other scripts in sprite v]\nerase all\nhide\n\nwhen I receive [showgirl v]\nerase all\nhide\ngo to x: (50) y: (20)\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (100)\ngo to [front v] layer\nshow\nwait (4) seconds\nrepeat (4)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n stamp\n wait (2) seconds\n set [ghost v] effect to (100)\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (3.5) seconds\n erase all\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (0.5) seconds\n next costume\nend\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nbroadcast (Level17_TypeIn v)\n\n@Level17_4\n\nwhen I receive [level17_typein v]\ngo to x: (25) y: (-25)\nset [ghost v] effect to (100)\nswitch costume to (([floor v] of ((BreakCode) / (10000)) ) + (1))\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nstamp\nwait until <(pressed1) = [1]>\nset [ghost v] effect to (100)\nchange x by (40)\nswitch costume to ((([floor v] of ((BreakCode) / (1000)) ) mod (10)) + (1))\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nstamp\nwait until <(pressed2) = [1]>\nset [ghost v] effect to (100)\nchange x by (40)\nswitch costume to ((([floor v] of ((BreakCode) / (100)) ) mod (10)) + (1))\nrepeat (5)\n change [ghost v] effect by (-10)\nend\nset [_breakcodetried v] to [1]\nbroadcast (levelnext v)\n\nwhen flag clicked\nhide\nerase all\nwait until <(level) > [17]>\nstop [other scripts in sprite v]\nhide\nwait until <(level) = [35]>\nrepeat until <(level) > [35]>\n Level35_BreakCode\n wait (0.05) seconds\nend\nerase all\nhide\nstop [other scripts in sprite v]\nstop [this script v]\n\nwhen I receive [showgirl v]\nhide\n\nwhen I receive [level17_typein v]\nset [pressed1 v] to [0]\nset [pressed2 v] to [0]\nwait until <key (([floor v] of ((BreakCode) / (10000)) ) v) pressed?>\nset [pressed1 v] to [1]\nwait until <not <key (any v) pressed?>>\nwait until <key ((([floor v] of ((BreakCode) / (1000)) ) mod (10)) v) pressed?>\nset [pressed2 v] to [1]\n\ndefine Level35_BreakCode\nerase all\ngo to x: (35) y: (0)\nset [ghost v] effect to (0)\nchange x by (pick random (-5) to (5))\nchange y by (pick random (-5) to (5))\nswitch costume to (([floor v] of ((BreakCode) / (10000)) ) + (1))\nif <not <(pick random (1) to (10)) = [1]>> then\n stamp\nend\nchange x by (40)\nchange x by (pick random (-5) to (5))\nchange y by (pick random (-5) to (5))\nswitch costume to ((([floor v] of ((BreakCode) / (1000)) ) mod (10)) + (1))\nif <not <(pick random (1) to (10)) = [1]>> then\n stamp\nend\nchange x by (40)\nchange x by (pick random (-5) to (5))\nchange y by (pick random (-5) to (5))\nswitch costume to ((([floor v] of ((BreakCode) / (100)) ) mod (10)) + (1))\nif <not <(pick random (1) to (10)) = [1]>> then\n stamp\nend\nchange x by (40)\nchange x by (pick random (-5) to (5))\nchange y by (pick random (-5) to (5))\nswitch costume to ((([floor v] of ((BreakCode) / (10)) ) mod (10)) + (1))\nif <not <(pick random (1) to (10)) = [1]>> then\n stamp\nend\nchange x by (40)\nchange x by (pick random (-5) to (5))\nchange y by (pick random (-5) to (5))\nswitch costume to (((BreakCode) mod (10)) + (1))\nif <not <(pick random (1) to (10)) = [1]>> then\n stamp\nend\nhide\n\nwhen I receive [gamebroke v]\nstop [other scripts in sprite v]\nstop [this script v]\n\n@ceil\n\nwhen flag clicked\ngo to x: (0) y: (0)\nswitch costume to (normal v)\nshow\nforever\n if <(level) = [9]> then\n switch costume to (lvl9 v)\n else\n if <(level) = [12]> then\n switch costume to (lvl12 v)\n else\n if <(level) = [28]> then\n switch costume to (lvl28 v)\n else\n switch costume to (normal v)\n end\n end\n end\nend\n\n@SkipCode_changed\n\nwhen flag clicked\nhide\n\nwhen I receive [skipcode_changed v]\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen I receive [levelnext v]\nhide\n\n@Level24_Wall\n\nwhen flag clicked\nhide\nwait until <(level) > [23]>\ngo to x: (388) y: (0)\npoint in direction (90)\ngo to [back v] layer\ngo to [back v] layer\nshow\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [level24_boo v]\nrepeat (20)\n change x by (-18)\nend\nif <(_SkipCodeUsed) = [0]> then\n broadcast (Level24_dialogStart v)\nelse\n broadcast (Level24_dialogContinue v)\nend\n\nwhen I receive [level24_morespace v]\nrepeat (20)\n change x by (11)\nend\nrepeat (20)\n turn right (4.5) degrees\nend\n\n@Level24_wall\n\nwhen I receive [level24_wallslidein v]\ngo to x: (200) y: (0)\ngo to [back v] layer\nshow\nset [wall_speed v] to [11]\nrepeat until <(wall_speed) < [1]>\n change x by (() - (wall_speed))\n set [wall_speed v] to ((wall_speed) / (1.13))\nend\n\nwhen flag clicked\nhide\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\n\n@Level24_text\n\nwhen flag clicked\nhide\nset [die_count v] to [0]\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\n\nwhen flag clicked\nwait until <(level) > [23]>\nif <(_SkipCodeUsed) = [0]> then\n hide\n wait (6) seconds\n broadcast (Level24_BOO v)\nelse\n if <(_BreakCodeTried) = [0]> then\n erase all\n hide\n wait until <(level) = [24]>\n erase all\n hide\n wait (2) seconds\n delete all of [dialogtimes v]\n add [4] to [dialogtimes v]\n add [3] to [dialogtimes v]\n add [4] to [dialogtimes v]\n go to x: (0) y: (130)\n switch costume to (neutral v)\n set [ghost v] effect to (100)\n show\n repeat (2)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n end\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [dialogtimes v]) seconds\n delete all of [dialogtimes v]\n add [1.5] to [dialogtimes v]\n add [3.5] to [dialogtimes v]\n add [1] to [dialogtimes v]\n add [0.3] to [dialogtimes v]\n add [1] to [dialogtimes v]\n add [1] to [dialogtimes v]\n add [4] to [dialogtimes v]\n add [4] to [dialogtimes v]\n repeat until <(length of [dialogtimes v]) = [0]>\n next costume\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n end\n hide\n erase all\n wait (5) seconds\n delete all of [dialogtimes v]\n add [2] to [dialogtimes v]\n add [3] to [dialogtimes v]\n add [3.5] to [dialogtimes v]\n add [2] to [dialogtimes v]\n go to x: (0) y: (130)\n switch costume to (neutral12_favour v)\n set [ghost v] effect to (100)\n show\n repeat (3)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n stamp\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n set [ghost v] effect to (100)\n next costume\n end\n erase all\n switch costume to (neutral14 v)\n set [ghost v] effect to (0)\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n broadcast (Level24_TypeIn v)\n else\n hide\n wait (2) seconds\n go to x: (0) y: (130)\n set [ghost v] effect to (0)\n switch costume to (enemy v)\n show\n repeat (2)\n wait (2) seconds\n next costume\n end\n repeat (9)\n wait (0.75) seconds\n next costume\n end\n wait (3) seconds\n broadcast (Level24_TypeIn v)\n end\nend\n\nwhen I receive [bosssmile v]\nhide\n\nwhen I receive [bosstext v]\ngo to x: (0) y: (130)\nswitch costume to (bosstext v)\nshow\nrepeat (5)\n wait (0.5) seconds\n next costume\nend\nbroadcast (BossShow v)\nwait (0.5) seconds\nbroadcast (BossFight v)\nwait (0.5) seconds\nhide\n\nwhen I receive [level24_dialogstart v]\nwait (1) seconds\ndelete all of [dialogtimes v]\nadd [3] to [dialogtimes v]\nadd [3] to [dialogtimes v]\nadd [4] to [dialogtimes v]\nadd [3.5] to [dialogtimes v]\ngo to x: (0) y: (130)\nswitch costume to (friend v)\nset [ghost v] effect to (0)\nshow\nwait (item (1) of [dialogtimes v]) seconds\ndelete (1) of [dialogtimes v]\nrepeat until <(length of [dialogtimes v]) = [0]>\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\nend\nwait (1) seconds\nbroadcast (BossShow v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nbroadcast (BossFight v)\nwait (4) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nswitch costume to (friend_hint v)\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen I receive [level24_dialogstart v]\nwait until <(BossStage) = [2]>\nstop [other scripts in sprite v]\nwait (2) seconds\ngo to x: (0) y: (130)\nswitch costume to (friend_morespace v)\nset [ghost v] effect to (0)\nshow\nwait (0.5) seconds\nbroadcast (Level24_MoreSpace v)\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nswitch costume to (friend_hint2 v)\nwait (0.5) seconds\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait until <key (r v) pressed?>\nwait (1) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nswitch costume to (friend_enjoy v)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nset [die_count v] to [0]\nwait until <(Die_Count) > [4]>\nswitch costume to (friend_noescape1 v)\ndelete all of [dialogtimes v]\nadd [4] to [dialogtimes v]\nadd [2.5] to [dialogtimes v]\nrepeat until <(length of [dialogtimes v]) = [0]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\nend\nwait until <(Die_Count) > [7]>\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (0.5) seconds\nbroadcast (Level24_WallSlideIn v)\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1.5) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nwait until <(Die_Count) > [9]>\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (4) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nwait until <(Die_Count) > [11]>\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\nset [ghost v] effect to (0)\n\nwhen I receive [restart_level v]\nif <(costume [number v]) > [9]> then\n change [die_count v] by (1)\nend\n\nwhen I receive [level24_entered v]\ngo to x: (0) y: (130)\nset [level24_entered v] to [1]\ndelete all of [dialogtimes v]\nadd [1.5] to [dialogtimes v]\nadd [2.5] to [dialogtimes v]\nadd [1.5] to [dialogtimes v]\nadd [1.5] to [dialogtimes v]\nadd [1] to [dialogtimes v]\nswitch costume to (neutral_entered v)\nset [ghost v] effect to (100)\nshow\nerase all\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nrepeat until <(length of [dialogtimes v]) = [2]>\n stamp\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n set [ghost v] effect to (100)\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\nend\nstamp\nwait (item (1) of [dialogtimes v]) seconds\ndelete (1) of [dialogtimes v]\nerase all\nnext costume\nwait (item (1) of [dialogtimes v]) seconds\ndelete (1) of [dialogtimes v]\nhide\nwait (5) seconds\nbroadcast (Level24_BOO v)\n\nwhen I receive [level24_typein v]\nset [level24_timeup v] to [0]\nif <(_BreakCodeTried) = [0]> then\n\nwhen I receive [level24_dialogcontinue v]\ngo to x: (0) y: (130)\ndelete all of [dialogtimes v]\nadd [2] to [dialogtimes v]\nadd [3] to [dialogtimes v]\nadd [3] to [dialogtimes v]\nadd [2.5] to [dialogtimes v]\nswitch costume to (neutral_entered6 v)\nset [ghost v] effect to (0)\nshow\nerase all\nwait (item (1) of [dialogtimes v]) seconds\ndelete (1) of [dialogtimes v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nrepeat until <(length of [dialogtimes v]) = [1]>\n wait (item (1) of [dialogtimes v]) seconds\n delete (1) of [dialogtimes v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (1) seconds\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\nend\nstamp\nwait (item (1) of [dialogtimes v]) seconds\ndelete (1) of [dialogtimes v]\nset [ghost v] effect to (100)\ngo to x: (0) y: (-135)\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\n@Level24_bossCode\n\nwhen I receive [level24_typein v]\nerase all\nif <(_BreakCodeTried) = [0]> then\n go to x: (-75) y: (80)\nelse\n go to x: (-75) y: (40)\nend\nswitch costume to (([floor v] of ((BossCode) / (10000)) ) + (1))\nshow\nstamp\nchange x by (40)\nswitch costume to ((([floor v] of ((BossCode) / (1000)) ) mod (10)) + (1))\nstamp\nchange x by (40)\nswitch costume to ((([floor v] of ((BossCode) / (100)) ) mod (10)) + (1))\nstamp\nchange x by (40)\nswitch costume to ((([floor v] of ((BossCode) / (10)) ) mod (10)) + (1))\nstamp\nchange x by (40)\nswitch costume to (((BossCode) mod (10)) + (1))\nstamp\nhide\n\nwhen flag clicked\nhide\nerase all\n\nwhen I receive [levelnext v]\nhide\nerase all\n\nwhen I receive [bosstext v]\nhide\nerase all\n\n@Level24_Smile\n\nwhen I receive [bosssmile v]\nerase all\nset [time_gap v] to [2]\ngo to x: (0) y: (130)\nstamp\nrepeat (3)\n wait (time_gap) seconds\n change x by (10)\n stamp\n set [time_gap v] to ((time_gap) / (3))\nend\nrepeat (10)\n wait (time_gap) seconds\n change x by (10)\n stamp\n set [time_gap v] to [0.0000001]\nend\nerase all\nbroadcast (BossText v)\n\nwhen flag clicked\nhide\nerase all\n\nwhen I receive [levelnext v]\nhide\nerase all\n\n@Level24_Enemy\n\nwhen I receive [restart_level v]\nif <(_BreakCodeTried) = [1]> then\n erase all\n pen up\nend\n\nwhen I receive [bossshow v]\ngo to x: (-190) y: (0)\nswitch costume to (stage 1 v)\ngo to [front v] layer\nshow\nerase all\nset pen color to (#484849)\nset pen size to (5)\npen up\nset [speedchange v] to [5]\nset [maxspeedx v] to [5]\nset [maxspeedy v] to [5]\nset [speedx v] to [0]\nset [speedy v] to [0]\n\nwhen I receive [bossfight v]\nforever\n if <(x position) < (playerX)> then\n change [speedx v] by ((speedChange) / (30))\n end\n if <(x position) > (playerX)> then\n change [speedx v] by ((() - (speedChange)) / (30))\n end\n if <(y position) < (playerY)> then\n change [speedy v] by ((speedChange) / (30))\n end\n if <(y position) > (playerY)> then\n change [speedy v] by ((() - (speedChange)) / (30))\n end\n if <(speedX) > (MaxSpeedX)> then\n set [speedx v] to (MaxSpeedX)\n end\n if <(speedX) < (() - (MaxSpeedX))> then\n set [speedx v] to (() - (MaxSpeedX))\n end\n if <(speedY) > (MaxSpeedY)> then\n set [speedy v] to (MaxSpeedY)\n end\n if <(speedY) < (() - (MaxSpeedY))> then\n set [speedy v] to (() - (MaxSpeedY))\n end\n if <<((x position) + (speedX)) < [-230]> or <((x position) + (speedX)) > [211]>> then\n set [speedx v] to [0]\n end\n if <<((y position) + (speedY)) < [-87]> or <((y position) + (speedY)) > [170]>> then\n set [speedy v] to [0]\n end\n go to x: ((x position) + (speedX)) y: ((y position) + (speedY))\n if <(BossStage) = [1]> then\n switch costume to (stage 1 v)\n pen up\n else\n switch costume to (stage 2 v)\n pen down\n end\n if <touching (sprite1 v)?> then\n set [touchboss v] to [1]\n else\n set [touchboss v] to [0]\n end\nend\n\nwhen flag clicked\nhide\nerase all\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\nerase all\n\n@Level24_pressR\n\nwhen flag clicked\nhide\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [bossfight v]\nhide\nwait until <(BossStage) = [2]>\nif <(_SkipCodeUsed) = [1]> then\n switch costume to (костюм 1 v)\n show\n wait until <key (r v) pressed?>\n switch costume to (костюм 2 v)\n wait (1.5) seconds\n hide\nend\n\n@Level24_Enemy_Trace\n\nwhen flag clicked\nhide\nset [bossstage v] to [1]\n\nwhen I receive [jumpedpurple v]\nwait (0.1) seconds\nif <(level) > [24]> then\n hide\n stop [this script v]\nend\nset [bossstage v] to [2]\ngo to (level24_enemy v)\nswitch costume to (stage 2 v)\nset [ghost v] effect to (20)\nset size to (170) %\ngo to [front v] layer\nshow\nrepeat (8)\n go to (level24_enemy v)\n change size by (20)\n change [ghost v] effect by (10)\nend\nhide\nwait (4.5) seconds\nif <(level) > [24]> then\n hide\n stop [this script v]\nend\ngo to (level24_enemy v)\nswitch costume to (stage 1 v)\nset [ghost v] effect to (100)\nset size to (260) %\ngo to [front v] layer\nshow\nrepeat (8)\n go to (level24_enemy v)\n change size by (-20)\n change [ghost v] effect by (-10)\nend\nhide\nset [bossstage v] to [1]\n\nwhen I receive [levelnext v]\nif <(level) > [24]> then\n stop [other scripts in sprite v]\n hide\nend\n\nwhen I receive [restart_level v]\nstop [other scripts in sprite v]\nhide\nset [bossstage v] to [1]\n\n@GameBroke_Background\n\nwhen flag clicked\nhide\n\nwhen I receive [gamebroke v]\ngo to x: (0) y: (0)\ngo to [front v] layer\nshow\nwait (0.001) seconds\ngo to [front v] layer\n\n@Level36_text3\n\nwhen flag clicked\nhide\nwait until <(level) = [38]>\nhide\nwait (2.5) seconds\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nwait (0.5) seconds\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\n@level5_question\n\nwhen flag clicked\nhide\nwait until <(level) = [5]>\ngo to x: (210) y: (60)\nshow\nrepeat until <(level) > [5]>\n ask [How much will be 0 / 0 ?] and wait\n if <<(answer) = [m]> or <(answer) = [M]>> then\n broadcast (Mute v)\n else\n if <<(answer) = [c]> or <(answer) = [C]>> then\n broadcast (ChangeMusic v)\n else\n if <(level) = [5]> then\n set volume to (50) %\n start sound [wrong-answer-sound-fx v]\n wait (1) seconds\n end\n end\n end\nend\n\nwhen flag clicked\nhide\nwait until <(level) > [5]>\nstop [other scripts in sprite v]\nhide\n\ngo to x: (210) y: (60)\nask [How much will be 0 / 0 ?] and wait\n\n@GameBroken_Text\n\nwhen flag clicked\nhide\n\nwhen I receive [gamebroke v]\nwait (2) seconds\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\ngo to [front v] layer\nshow\nif <(level) < [36]> then\n delete all of [girltimes v]\n add [2] to [girltimes v]\n add [2.5] to [girltimes v]\n add [2.5] to [girltimes v]\n add [2.5] to [girltimes v]\n add [3] to [girltimes v]\n add [3] to [girltimes v]\n switch costume to (girl1 v)\n repeat until <(length of [girltimes v]) = [0]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [girltimes v]) seconds\n delete (1) of [girltimes v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (0.5) seconds\n next costume\n end\nelse\n delete all of [narratortimes v]\n add [2] to [narratortimes v]\n add [6] to [narratortimes v]\n add [4.5] to [narratortimes v]\n switch costume to (narrator1 v)\n repeat until <(length of [narratortimes v]) = [0]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (item (1) of [narratortimes v]) seconds\n delete (1) of [narratortimes v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n end\nend\n\nset [ghost v] effect to (0)\n\n@Level36_text\n\nwhen flag clicked\nhide\nwait until <(level) = [36]>\nhide\nwait (2) seconds\ngo to x: (90) y: (115)\nswitch costume to (костюм 1 v)\nshow\nwait (1.5) seconds\nnext costume\nwait (1.5) seconds\nnext costume\n\nwhen I receive [levelnext v]\nhide\n\n@Level24_Hint\n\nwhen flag clicked\n\nwait until <(level) > [23]>\ngo to x: (-35) y: (10)\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (50)\nset size to (90) %\nrepeat until <(level) > [24]>\n wait (0.1) seconds\n next costume\nend\n\nwhen flag clicked\n\nforever\n if <<(BossStage) = [1]> and <(touchBoss) = [1]>> then\n show\n else\n hide\n end\nend\n\nwhen flag clicked\nhide\nwait until <(level) > [24]>\nstop [other scripts in sprite v]\nhide\n\n@Level36_text2\n\nwhen flag clicked\nhide\nerase all\nwait until <(level) = [37]>\nhide\nerase all\nwait (1.5) seconds\nerase all\ngo to x: (-32) y: (47)\nswitch costume to (костюм 1 v)\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nstamp\nset [ghost v] effect to (100)\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2.5) seconds\nerase all\nrepeat (10)\n change [ghost v] effect by (10)\nend\nwait (0.5) seconds\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nstamp\nset [ghost v] effect to (100)\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1.5) seconds\nrepeat (3)\n stamp\n set [ghost v] effect to (100)\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (1) seconds\nend\nstamp\nset [ghost v] effect to (100)\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2.5) seconds\nerase all\nrepeat (10)\n change [ghost v] effect by (10)\nend\nwait (0.5) seconds\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen flag clicked\nwait until <(level) > [37]>\nstop [other scripts in sprite v]\nhide\nerase all\n\n@Level7_tilesLava\n\nwhen flag clicked\ngo to x: (-116) y: (-102)\nchange y by (-6)\nchange x by (50)\nswitch costume to (lava v)\ngo to [front v] layer\nhide\nwait until <(level) = [7]>\nrepeat (2)\n create clone of (_myself_ v)\n change x by (94)\nend\nswitch costume to (lava v)\nshow\nrepeat until <(level) > [7]>\n if <touching (sprite1 v)?> then\n broadcast (inscription_2 v)\n stop [this script v]\n end\nend\nhide\n\nwhen I start as a clone\nshow\nrepeat until <(level) > [7]>\n if <touching (sprite1 v)?> then\n switch costume to (ground v)\n wait until <not <touching (sprite1 v)?>>\n switch costume to (lava v)\n end\nend\nhide\n\nwhen flag clicked\nwait until <(level) > [7]>\nstop [other scripts in sprite v]\nhide\n\n
PLEASE, DOUBLE CLICK FLAG\nR - RESPAWN M - MUTE\nWelcome to T R A P! It's not an ordinary platformer, it's platformer with unexpected traps you must avoid.\n\nAll intsructions are in the game.\nLet me know in the comments if you complete the whole game (i personally think it's really hard).\nGood Luck!
Ball Platformer
@Stage\n\nwhen flag clicked\nforever\n play sound [\[Dubstep_-_Pegboard_Nerds_-_Self_Destruct_\[Monster v] until done\nend\n\n@theGround\n\nwhen I receive [nextlevel v]\nnext costume\n\nwhen I receive [message1 v]\nswitch costume to (costume15 v)\n\nwhen [space v] key pressed\nchange [level v] by (1)\nnext costume\n\nwhen flag clicked\nswitch costume to (costume1 v)\n\n@theGuy\n\nwhen flag clicked\nset [level v] to [1]\nhide variable [level v]\nforever\n if <touching color (#ff0000)?> then\n go to x: (-209) y: (-54)\n set [yv v] to [0]\n wait until <not <touching color (#e81818)?>>\n end\n if <<touching color (#ffff00)?> or <touching color (#000000)?>> then\n go to x: (-209) y: (-54)\n change [level v] by (1)\n broadcast (nextlevel v)\n wait until <not <<touching color (#ffff00)?> or <touching color (#000000)?>>>\n end\n if <touching color (#ff9400)?> then\n set [yv v] to [20]\n end\n if <touching color (#2daae4)?> then\n set [yv v] to [40]\n end\n if <touching color (#cc99ff)?> then\n if <(level) = [11]> then\n go to x: (-212) y: (19)\n end\n if <(level) = [10]> then\n go to x: (-193) y: (117)\n end\n if <(level) = [13]> then\n go to x: (219) y: (18)\n end\n end\n wait until <not <touching color (#cc99ff)?>>\nend\n\nwhen flag clicked\nforever\n if <touching color (#15e462)?> then\n change y by ((YV) * (1))\n set [yv v] to [0]\n end\n change y by (1)\n if <<touching color (#15e462)?> and <<<key (up arrow v) pressed?> or <key (space v) pressed?>> or <key (w v) pressed?>>> then\n set [yv v] to [-15]\n end\n change y by (-1)\nend\n\nwhen flag clicked\nshow\nset size to (50) %\nwait (1) seconds\ngo to [front v] layer\n\nwhen flag clicked\ngo to x: (-209) y: (-54)\nforever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((XV) * (0.9))\n change x by (XV)\n if <touching color (#00ff55)?> then\n change y by (1)\n if <touching color (#00ff55)?> then\n change y by (1)\n if <touching color (#00ff55)?> then\n change y by (1)\n if <touching color (#00ff55)?> then\n change y by (1)\n if <touching color (#00ff55)?> then\n change y by (1)\n if <touching color (#00ff55)?> then\n change x by ((XV) * (-1))\n change y by (-5)\n if <<<key (up arrow v) pressed?> or <key (space v) pressed?>> or <key (w v) pressed?>> then\n if <(XV) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (YV)\n if <touching color (#00ff55)?> then\n change y by ((YV) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <<touching color (#00ff55)?> and <<<key (up arrow v) pressed?> or <key (space v) pressed?>> or <key (w v) pressed?>>> then\n set [yv v] to [15]\n end\n change y by (1)\nend\n\nwhen flag clicked\nforever\n if <touching color (#e4e43e)?> then\n broadcast (message1 v)\n end\nend\n\nwhen [space v] key pressed\ngo to x: (-209) y: (-54)\n\n@thumbnail\n\nwhen flag clicked\nhide\n\nwhen I receive [message1 v]\nwait (3.5) seconds\nshow\ngo to [front v] layer\ngo to x: (0) y: (0)\nstop [all v]\n\n
Use the arrow keys or ASDW to move. Go to the flag. Different colors mean different things.
The Hot Steel ball - a platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (screen v)\nset volume to (20) %\nwait until <key (q v) pressed?>\nforever\n play sound [Vexento - Occupy v] until done\nend\n\nwhen I receive [next level v]\nnext backdrop\n\nwhen flag clicked\nwait until <key (q v) pressed?>\nwait until <not <key (q v) pressed?>>\nforever\n if <key (q v) pressed?> then\n if <(volume) = [20]> then\n set volume to (0) %\n else\n set volume to (20) %\n end\n wait until <not <key (q v) pressed?>>\n end\nend\n\n@Player\n\nwhen flag clicked\nhide\nset [x v] to [0]\nset [y v] to [0]\nset [last v] to [0]\nset [on wall v] to [0]\nset [editing v] to [0]\nset [respawn v] to [0]\nset [tell time v] to [0]\n\nwhen flag clicked\nforever\n if <<(WASD) = [2]> and <(editing) = [1]>> then\n go to x: (-185) y: (0)\n wait until <(editing) = [0]>\n set [x v] to [0]\n set [y v] to [0]\n set [last v] to [0]\n set [on wall v] to [0]\n end\n change x by (X)\n change y by (Y)\nend\n\nwhen flag clicked\nforever\n if <(Y) < [-15]> then\n set [y v] to [-15]\n end\nend\n\nwhen flag clicked\nforever\n if <(X) < [0]> then\n set [last v] to [-1]\n end\n if <(X) > [0]> then\n set [last v] to [1]\n end\nend\n\nwhen I receive [begin v]\ngo to x: (-185) y: (0)\nshow\nforever\n if <<(WASD) = [2]> and <(editing) = [1]>> then\n wait until <(editing) = [0]>\n end\n if <<<(WASD) > [0]> and <<<<key (a v) pressed?> or <key (left arrow v) pressed?>> and <<key (d v) pressed?> or <key (right arrow v) pressed?>>> or <not <<<key (d v) pressed?> or <key (right arrow v) pressed?>> or <<key (a v) pressed?> or <key (left arrow v) pressed?>>>>>> or <<(WASD) = [0]> and <<(Loudness) = [0]> or <(Loudness) > [24]>>>> then\n if <(X) = [0]> then\n else\n if <(X) < [0]> then\n change [x v] by (1)\n else\n change [x v] by (-1)\n end\n end\n else\n if <<<(WASD) > [0]> and <<key (a v) pressed?> or <key (left arrow v) pressed?>>> or <<(WASD) = [0]> and <<(Loudness) > [7]> and <(Loudness) < [25]>>>> then\n if <(X) < [-6]> then\n else\n if <(On wall) = [0]> then\n change [x v] by (-1)\n else\n Wall jump (-5)\n end\n end\n end\n if <<<(WASD) > [0]> and <<key (d v) pressed?> or <key (right arrow v) pressed?>>> or <<(WASD) = [0]> and <<(Loudness) > [0]> and <(Loudness) < [8]>>>> then\n if <(X) > [6]> then\n else\n if <(On wall) = [0]> then\n change [x v] by (1)\n else\n Wall jump (5)\n end\n end\n end\n end\n if <not <touching color (#000000)?>> then\n change [y v] by (-1)\n set [on wall v] to [0]\n end\n if <touching color (#000000)?> then\n set [on air from jump v] to [0]\n change [y v] by ((Y) * (-1))\n if <<<<(WASD) > [0]> and <<key (w v) pressed?> or <key (up arrow v) pressed?>>> or <<(WASD) = [0]> and <<(Loudness) > [4]> and <(Loudness) < [13]>>>> and <(on air from jump) = [0]>> then\n set [on air from jump v] to [1]\n set [y v] to [10]\n end\n end\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (-10)\n broadcast (wall v)\n set [on wall v] to [1]\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n if <<touching color (#ff0000)?> or <key (r v) pressed?>> then\n set [respawn v] to [1]\n set [x v] to [0]\n set [y v] to [0]\n go to x: (-185) y: (0)\n wait (0.01) seconds\n set [respawn v] to [0]\n end\nend\n\nwhen I receive [begin v]\nforever\n if <<(WASD) = [2]> and <(editing) = [1]>> then\n wait until <(editing) = [0]>\n end\nend\n\ndefine None\nif <(On wall) = [1]> then\n if <(last) > [0]> then\n set [x v] to (x)\n end\n if <(last) < [0]> then\n set [x v] to (x)\n end\nend\n\nwhen I receive [wall v]\nif <(last) > [0]> then\n Touching wall (-1) Back (23)\nend\n\nwhen I receive [wall v]\nif <(last) < [0]> then\n Touching wall (1) Back (-23)\nend\n\ndefine None\nif <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (go1back)\n if <touching color (#000000)?> then\n change x by (back)\n if <touching color (#000000)?> then\n Touching ceiling\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\ndefine Touching ceiling\nset [y v] to [-1]\nset [x v] to [0]\nif <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n if <touching color (#000000)?> then\n change y by (-1)\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\nwhen I receive [begin v]\nforever\n if <<touching color (#ff00bf)?> or <<(WASD) = [0]> and <key (space v) pressed?>>> then\n if <(WASD) = [2]> then\n set [editing v] to [1]\n set [tell time v] to [1]\n wait (9.999999999999999e-26) seconds\n set [tell time v] to [0]\n else\n set [x v] to [0]\n set [y v] to [0]\n go to x: (-185) y: (0)\n broadcast (Next level v)\n if <<(WASD) = [0]> and <key (space v) pressed?>> then\n wait until <not <key (space v) pressed?>>\n end\n end\n end\nend\n\n@Buttons\n\nwhen I start as a clone\nif <(costume [number v]) = [2]> then\n go to x: (150) y: (-135)\n set size to (220) %\n switch costume to (voice control v)\n show\n wait (0.1) seconds\n repeat (10)\n change [ghost v] effect by (-10)\n end\n Painetaanko (0) koko (6)\n if <(WASD) = [0]> then\n next backdrop\n show variable [loudness v]\n broadcast (Begin v)\n end\n delete this clone\nend\n\nwhen flag clicked\npen up\nerase all\nhide\nclear graphic effects\nset [wasd v] to [-1]\nset [loudness v] to [0]\nhide variable [loudness v]\nhide variable [☁ world's best \(sec\) v]\ngo to x: (30) y: (-135)\nset size to (500) %\nset [ghost v] effect to (100)\nswitch costume to (wasd v)\ncreate clone of (_myself_ v)\nswitch costume to (voice control v)\ncreate clone of (_myself_ v)\nswitch costume to (level creator v)\ncreate clone of (_myself_ v)\n\nwhen flag clicked\nforever\n set [loudness v] to ((loudness) / (3))\nend\n\nwhen I start as a clone\nif <(costume [number v]) = [3]> then\n go to x: (-150) y: (130)\n show\n wait (0.1) seconds\n repeat (10)\n change [ghost v] effect by (-10)\n end\n Painetaanko (2) koko (5)\n if <(WASD) = [2]> then\n switch backdrop to (level creator v)\n broadcast (Begin v)\n broadcast (Draw v)\n end\n hide\nend\nif <<(WASD) = [0]> or <(WASD) = [1]>> then\n delete this clone\nend\nset [ghost v] effect to (100)\nshow\nforever\n if <(tell time) = [1]> then\n say (join (join [Your time was ] (timer)) [ seconds]) for (3.5) seconds\n end\nend\n\ndefine None\nrepeat until <(WASD) > [-1]>\n if <touching (mouse-pointer v)?> then\n repeat (10)\n change size by (koko)\n if <mouse down?> then\n set [wasd v] to (controls)\n end\n end\n repeat until <<not <touching (mouse-pointer v)?>> or <(WASD) > [-1]>>\n if <mouse down?> then\n set [wasd v] to (controls)\n end\n end\n if <(WASD) = [-1]> then\n repeat (10)\n change size by ((koko) * (-1))\n end\n end\n end\nend\n\nwhen I start as a clone\nif <(costume [number v]) = [1]> then\n show\n wait (0.1) seconds\n repeat (10)\n change [ghost v] effect by (-10)\n end\n Painetaanko (1) koko (10)\n if <(WASD) = [1]> then\n next backdrop\n broadcast (Begin v)\n end\n if <(WASD) = [0]> then\n delete this clone\n end\n hide\n set [ghost v] effect to (100)\n set x to (0)\n reset timer\n wait until <(backdrop [name v]) = [The end]>\n show\n if <<<(timer) < (☁ World's best \(sec\))> and <(WASD) = [1]>> and <not <(username) = [Hamuniii]>>> then\n set [☁ world's best \(sec\) v] to (timer)\n repeat (10)\n set [☁ world's best \(sec\) v] to (☁ World's best \(sec\))\n end\n end\n if <(WASD) = [1]> then\n show variable [☁ world's best \(sec\) v]\n say (join (join [Your time was ] (timer)) [ seconds]) for (7) seconds\n say [Maybe try to get a better time?] for (5) seconds\n hide\n end\n if <(WASD) = [0]> then\n show variable [☁ world's best \(sec\) v]\n say (join (join [Your time was ] (timer)) [ seconds]) for (7) seconds\n say [You can't get a world record if you are playing in voice conrol mode.] for (5) seconds\n hide\n end\nend\n\n@Draw\n\nwhen I receive [draw v]\nset [editing v] to [1]\nforever\n wait until <key (space v) pressed?>\n set [editing v] to [0]\n wait until <not <key (space v) pressed?>>\n wait until <<key (space v) pressed?> or <(editing) = [1]>>\n set [editing v] to [1]\n wait until <not <key (space v) pressed?>>\nend\n\nwhen [z v] key pressed\nif <<(WASD) = [2]> and <(editing) = [1]>> then\n set pen color to (#000000)\n go to (mouse-pointer v)\n say [Obstacle] for (1) seconds\nend\n\nwhen [b v] key pressed\nif <<(WASD) = [2]> and <(editing) = [1]>> then\n erase all\n go to (mouse-pointer v)\n say [Cleared] for (1) seconds\nend\n\nwhen [v v] key pressed\nif <<(WASD) = [2]> and <(editing) = [1]>> then\n set pen color to (#ffffff)\n go to (mouse-pointer v)\n say [Erase] for (1) seconds\nend\n\nwhen [x v] key pressed\nif <<(WASD) = [2]> and <(editing) = [1]>> then\n set pen color to (#ff0000)\n go to (mouse-pointer v)\n say [Danger zone] for (1) seconds\nend\n\nwhen [c v] key pressed\nif <<(WASD) = [2]> and <(editing) = [1]>> then\n set pen color to (#ff00bf)\n go to (mouse-pointer v)\n say [Finish] for (1) seconds\nend\n\nwhen I receive [draw v]\nwait until <not <mouse down?>>\nset pen color to (#000000)\nset pen size to (30)\nforever\n if <<mouse down?> and <(editing) = [1]>> then\n go to (mouse-pointer v)\n pen down\n repeat until <not <mouse down?>>\n go to (mouse-pointer v)\n end\n else\n pen up\n end\nend\n\nwhen I receive [draw v]\nforever\n repeat until <(editing) = [1]>\n reset timer\n wait until <<key (r v) pressed?> or <<(respawn) = [1]> or <(editing) = [1]>>>\n end\n wait until <(editing) = [0]>\nend\n\n
Jelly Dash (Platformer)
@Stage\n\nwhen flag clicked\nforever\n play sound [01 -Jumper- \(ID_ 168734\).mp3 v] until done\nend\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (-210) y: (-80)\ngo to [front v] layer\ngo [backward v] (1) layers\nset size to (220) %\nforever\n if <touching color (#ff0000)?> then\n go to x: (-210) y: (-90)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1.3)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1.3)\n end\n set [xv v] to ((xv) * (0.85))\n change x by (xv)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (1)\n if <touching color (#ff00bf)?> then\n change y by (-5)\n change x by ((-1) * (xv))\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(xv) = [0]>>> then\n set [mode v] to [walljump]\n set [yv v] to [8]\n set [xv v] to (((xv) / ([abs v] of (xv) )) * (-10))\n else\n set [mode v] to [wallslide]\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (2)\n end\n change y by (-3)\n if <touching color (#ff00bf)?> then\n if <(yv) = [-3]> then\n if <<key (a v) pressed?> or <<key (d v) pressed?> or <<key (left arrow v) pressed?> or <key (right arrow v) pressed?>>>> then\n set [mode v] to [run]\n else\n if <([abs v] of (xv) ) > [.1]> then\n set [mode v] to [skid]\n else\n set [mode v] to [stand]\n end\n end\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [mode v] to [jump]\n set [yv v] to [9]\n end\n end\n if <<<<(mode) = [jump]> or <(mode) = [walljump]>> and <(yv) < [0]>> or <<<(mode) = [run]> or <(mode) = [skid]>> and <(yv) < [-3]>>> then\n set [mode v] to [fall]\n end\n change y by (3)\n if <(yv) > [-15]> then\n change [yv v] by (-0.5)\n end\n change y by (-2)\n if <not <touching color (#ff00bf)?>> then\n change y by (-1)\n if <not <touching color (#ff00bf)?>> then\n change y by (-1)\n if <not <touching color (#ff00bf)?>> then\n change y by (-1)\n if <not <touching color (#ff00bf)?>> then\n change y by (-1)\n if <not <touching color (#ff00bf)?>> then\n change y by (-1)\n if <not <touching color (#ff00bf)?>> then\n change y by (5)\n end\n end\n end\n end\n end\n end\n change y by (2)\n change y by (yv)\n if <touching color (#ff00bf)?> then\n change y by (-2)\n if <touching color (#ff00bf)?> then\n change y by ((-1) * (yv))\n set [yv v] to [-3]\n end\n change y by (2)\n end\nend\n\nwhen flag clicked\nforever\n if <[230] < (x position)> then\n broadcast (next level v) and wait\n go to x: (-210) y: (-90)\n end\nend\n\n@Sprite2\n\nwhen flag clicked\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [next level v]\nnext costume\n\n@Sprite3\n\nwhen flag clicked\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\n\n
Arrow Keys To Move, Lava Will Kill You, Levels Are All Possible\n\nLast Level Hint: Look closely at all the lava.
Color Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (levels v)\nforever\n if <touching color (#ccffff)?> then\n next backdrop\n end\nend\n\nwhen [space v] key pressed\nswitch backdrop to (level 1 v)\n\n@Sprite1\n\nwhen flag clicked\nhide\nforever\n if <touching color (#ffe9cc)?> then\n set [y v] to [15]\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ffffcc)?> then\n go to x: (-159) y: (-99)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ccffff)?> then\n switch backdrop to (next backdrop v)\n go to x: (-164) y: (-99)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#cc99ff)?> then\n set [y v] to [-30]\n end\nend\n\nwhen [space v] key pressed\nset [ghost v] effect to (0)\npoint in direction (90)\nswitch backdrop to (backdrop3 v)\nswitch costume to (costume1 v)\ngo to x: (-159) y: (-99)\ngo to [front v] layer\ngo [backward v] (1) layers\nshow\nforever\n change [y v] by (-0.5)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ccffdd)?> then\n change y by (1)\n if <touching color (#ccffdd)?> then\n change y by (1)\n if <touching color (#ccffdd)?> then\n change y by (1)\n if <touching color (#ccffdd)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n change x by ((x) * (-1))\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n if <key (left arrow v) pressed?> then\n switch costume to (costume2 v)\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n switch costume to (costume1 v)\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#ccffdd)?> then\n change y by (1)\n if <touching color (#ccffdd)?> then\n change y by (1)\n end\n end\n change y by (y)\n if <touching color (#ccffdd)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#ccffdd)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\nend\n\n@Sprite2\n\n@Sprite3\n\nwhen backdrop switches to [level 3 v]\nshow\nforever\n glide (1) secs to x: (78) y: (-38)\n glide (1) secs to x: (77) y: (38)\nend\n\nwhen backdrop switches to [level 4 v]\nhide\n\nwhen flag clicked\nhide\n\n@Sprite4\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 6 v]\nshow\nforever\n glide (1) secs to x: (-33) y: (28)\n glide (1) secs to x: (129) y: (28)\nend\n\nwhen backdrop switches to [level 7 v]\nhide\n\n@Sprite9\n\nwhen flag clicked\nhide\n\n
Press Space to Start!!\n\n- Arrow Keys to Move\n- Goal\n * Touch light blue heart\n- Yellow: Restart\n- Purple: Accelerated Downward\n- Orange: Accelerated Upward\n- Mint: Platform\n
Platformer-Mobile Friendly!
@Stage\n\n@Sprite2\n\nwhen I start as a clone\nset [clone? v] to [1]\nset [ghost v] effect to (60)\nrepeat (6)\n wait (.0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001) seconds\n change size by (-1)\nend\ndelete this clone\n\nwhen flag clicked\nshow\nset size to (100) %\nswitch costume to (costume1 v)\nset [deaths v] to [0]\ngo to x: (-220) y: (-160)\nforever\n if <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<(x position) < (mouse x)> and <mouse down?>>> then\n change [xv v] by (1)\n end\n if <<<key (left arrow v) pressed?> or <key (a v) pressed?>> or <<(mouse x) < (x position)> and <mouse down?>>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <<(y position) < ((mouse y) + (-30))> and <mouse down?>>> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#000000)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <<(y position) < ((mouse y) + (-30))> and <mouse down?>>> then\n set [yv v] to [15]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\nforever\n if <touching color (#003fff)?> then\n set [yv v] to [0]\n change [yv v] by (20)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#00ff55)?> then\n switch costume to (costume2 v)\n end\n if <touching color (#ff9400)?> then\n switch costume to (costume1 v)\n end\nend\n\nwhen flag clicked\nforever\n if <<key (down arrow v) pressed?> or <key (s v) pressed?>> then\n set [yv v] to [-10]\n end\nend\n\nwhen backdrop switches to [backdrop15 v]\nswitch costume to (costume1 v)\n\nwhen backdrop switches to [backdrop18 v]\nhide\nwait (4) seconds\nstop [all v]\n\nwhen flag clicked\nforever\n play sound [elec piano F major v] until done\n play sound [elec piano C major v] until done\n play sound [elec piano A minor v] until done\n play sound [elec piano G major v] until done\n play sound [recording1 v] until done\nend\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nforever\n if <touching color (#ff0000)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n go to x: (-230) y: (-161)\n change [deaths v] by (1)\n change [☁ total deaths worldwide v] by (1)\n repeat (25)\n change [ghost v] effect by (-4)\n end\n end\n if <<touching color (#ffff00)?> or <key (s v) pressed?>> then\n set [xv v] to [0]\n set [yv v] to [0]\n broadcast (message1 v)\n repeat (4)\n change [ghost v] effect by (25)\n end\n hide\n wait (2) seconds\n switch backdrop to (next backdrop v)\n go to x: (-230) y: (-161)\n show\n repeat (25)\n change [ghost v] effect by (-4)\n end\n end\nend\n\nwhen flag clicked\nforever\n wait (0.0000000000000000000000000000000000000000000000000000000000000001) seconds\n create clone of (_myself_ v)\nend\n\n@Sprite1\n\nwhen flag clicked\nhide\ngo to x: (-158) y: (9)\nshow\nglide (1) secs to x: (-17) y: (10)\n\nwhen flag clicked\nwait (5) seconds\nhide\n\n@Sprite3\n\nwhen flag clicked\ngo to x: (177) y: (-11)\nhide\nwait (1) seconds\nshow\nglide (1) secs to x: (39) y: (-10)\n\nwhen flag clicked\nwait (6) seconds\nhide\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (249) y: (-33)\nhide\nwait (2) seconds\nshow\nglide (1) secs to x: (97) y: (-32)\n\nwhen flag clicked\nwait (7) seconds\nhide\n\n@Sprite5\n\nwhen flag clicked\ngo to x: (-142) y: (-56)\nhide\nwait (3) seconds\nshow\nglide (1) secs to x: (7) y: (-51)\n\nwhen flag clicked\nwait (8) seconds\nhide\n\n@Sprite6\n\nwhen flag clicked\ngo to x: (189) y: (-85)\nhide\nwait (4) seconds\nshow\nglide (1) secs to x: (-8) y: (-79)\n\nwhen flag clicked\nwait (9) seconds\nhide\n\n@Sprite7\n\nwhen flag clicked\nshow\ngo to x: (0) y: (0)\nwait (10) seconds\nhide\n\n@Sprite8\n\nwhen flag clicked\ngo to x: (0) y: (360)\nhide\n\nwhen I receive [message1 v]\nwait (1) seconds\ngo to x: (0) y: (360)\nshow\nglide (1) secs to x: (0) y: (0)\nwait (1) seconds\nglide (1) secs to x: (0) y: (360)\nhide\n\n@Thumbnail\n\nwhen flag clicked\nforever\n go to [front v] layer\n show\n go to x: (0) y: (0)\n set [ghost v] effect to (100)\nend\n\n
Use the arrow keys or wad to move! If on mobile touch where you want to go! Press s to skip a level! At the beginning, after you triple-click the green flag, wait a few seconds, it takes awhile to load. Full screen recommended! If you like it, please propose this to be featured here! https://scratch.mit.edu/studios/4228481/ If you do, thank you so much!\nMajor update! Made it a ton easier!!!!\nJust added a Total Deaths Worldwide Variable!!!
Marshmello Platformer (COLLAB)
@Stage\n\nwhen flag clicked\nforever\n if <(LEVEL \(VERY IMPORTANT\)) = [22]> then\n switch backdrop to (backdrop7 v)\n else\n switch backdrop to (backdrop2 v)\n end\nend\n\nforever\n repeat (12)\n next backdrop\n wait (0.01) seconds\n end\n repeat (12)\n switch backdrop to ((backdrop [number v]) - (1))\n wait (0.01) seconds\n end\nend\n\n@Marshmellow\n\nwhen flag clicked\n\nset [y v] to [0]\nset [x v] to []\nset [x v] to [-10]\n\nset [y v] to [0]\n\nset [y v] to [16]\n\nchange y by (1)\nset [x v] to [10]\nchange y by (10)\n\nwait until \n\nwait (0.1) seconds\n\nwhen flag clicked\nset [score v] to [0]\nhide variable [score v]\nhide variable [☁ hlghscore v]\nforever\n change [score v] by (1)\n wait (1) seconds\n if <(LEVEL \(VERY IMPORTANT\)) = [22]> then\n show variable [☁ hlghscore v]\n show variable [score v]\n if <(score) < (☁ HlGHSCORE)> then\n set [☁ hlghscore v] to (score)\n end\n stop [this script v]\n end\nend\n\nwhen I start as a clone\nclear graphic effects\nrepeat (10)\n change [color v] effect by (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\nwhen flag clicked\nforever\n wait (1) seconds\n create clone of (_myself_ v)\nend\n\n@ground\n\nwhen flag clicked\ngo to x: (0) y: (0)\ngo to [front v] layer\nforever\n set size to (100) %\n switch costume to (LEVEL \(VERY IMPORTANT\))\nend\n\nset [level2 v] to [0]\n\n@exit\n\nwhen flag clicked\nforever\n if <(LEVEL \(VERY IMPORTANT\)) > [21]> then\n else\n play sound (pick random (1) to (6)) until done\n end\nend\n\nset [level v] to [0]\n\nwhen flag clicked\nset size to (60) %\nforever\n change size by (15)\n wait (0.07) seconds\n change size by (-15)\n wait (0.07) seconds\nend\n\nchange [brightness v] effect by (-50)\nwait (0.07) seconds\n\nchange [brightness v] effect by (50)\n\ngo to x: (-176) y: (88)\n\nwhen flag clicked\nforever\n go to x: (item (LEVEL \(VERY IMPORTANT\)) of [exit x v]) y: (item (LEVEL \(VERY IMPORTANT\)) of [exit y v])\nend\n\nwhen flag clicked\ngo to [front v] layer\nforever\n turn right (15) degrees\n change [color v] effect by (5)\nend\n\nwhen flag clicked\nforever\n if <(LEVEL \(VERY IMPORTANT\)) > [21]> then\n hide\n stop all sounds\n play sound [Marshmello - TOGETHER \(1\).mp3 v] until done\n else\n show\n end\nend\n\n@dead detector\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n set [ghost v] effect to (100)\nend\n\n@Sprite1\n\nwhen flag clicked\nforever\n show\n set [ghost v] effect to (100)\n go to [front v] layer\n go to x: (0) y: (0)\nend\n\n@Marshmellow Lives\n\nset [y v] to [0]\n\nset [y v] to [0]\n\nif then\nend\n\nhide\n\n@moving platformer #1\n\nwhen flag clicked\nhide\nwait until <(LEVEL \(VERY IMPORTANT\)) = [18]>\ngo to x: (-185) y: (-20)\nshow\nswitch costume to (LEVEL \(VERY IMPORTANT\))\nrepeat until <not <(LEVEL \(VERY IMPORTANT\)) = [18]>>\n show\n go to x: (-185) y: (-20)\n repeat (60)\n change x by (4)\n if <not <(LEVEL \(VERY IMPORTANT\)) = [18]>> then\n hide\n stop [this script v]\n end\n end\n repeat (60)\n change x by (-4)\n if <not <(LEVEL \(VERY IMPORTANT\)) = [18]>> then\n hide\n stop [this script v]\n end\n end\nend\nhide\nif <not <(LEVEL \(VERY IMPORTANT\)) = [18]>> then\n hide\n stop [this script v]\nend\n\nwhen flag clicked\nhide\nwait until <(LEVEL \(VERY IMPORTANT\)) = [17]>\nswitch costume to (LEVEL \(VERY IMPORTANT\))\nrepeat until <not <(LEVEL \(VERY IMPORTANT\)) = [17]>>\n show\n go to x: (-95) y: (-36)\n repeat (50)\n change y by (4)\n if <not <(LEVEL \(VERY IMPORTANT\)) = [17]>> then\n stop [this script v]\n end\n end\n repeat (50)\n change y by (-4)\n if <not <(LEVEL \(VERY IMPORTANT\)) = [17]>> then\n stop [this script v]\n end\n end\nend\nhide\nif <not <(LEVEL \(VERY IMPORTANT\)) = [17]>> then\n stop [this script v]\nend\n\n@Sprite2\n\n@Mar old (NOT WORKING)\n\nwhen flag clicked\nbroadcast (del v)\n\ndefine omega\nset volume to (1000) %\nset size to (13) %\nif <not <touching (ground v)?>> then\n change [xv v] by ((<key (left arrow v) pressed?> * (-3)) + (<key (right arrow v) pressed?> * (3)))\nend\nset [xv v] to ((Xv) * (0.7))\nchange x by (Xv)\ndetect slope: (8) (15) (13)\nchange [yv v] by (-1)\nchange y by (Yv)\nif <key (left arrow v) pressed?> then\n switch costume to (mar-1 v)\nend\nif <key (right arrow v) pressed?> then\n switch costume to (mar1 v)\nend\nif <touching (ground v)?> then\n out2 <(Yv) > [0]>\nend\nchange y by (-1)\nif <<touching (ground v)?> and <<key (up arrow v) pressed?> or <key (space v) pressed?>>> then\n start sound [Jump v]\n set [yv v] to [15]\nend\nif <touching color (#ffff99)?> then\n set [yv v] to [24]\nend\nchange y by (1)\nif <<touching (exit v)?> or <<<touching (spikes v)?> or <touching color (#ff9999)?>> or <touching (dead detector v)?>>> then\n if <touching (exit v)?> then\n start sound [quick dash v]\n change [level v] by (1)\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\n end\n if <<<touching (spikes v)?> or <touching color (#ff9999)?>> or <touching (dead detector v)?>> then\n start sound [quick dash v]\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\n end\nend\n\nwhen I receive [del v]\ndelete this clone\n\ndefine out <>\nset [i v] to [0]\nif <boolean1> then\n repeat until <<not <touching (ground v)?>> or <(i) > [8]>>\n change [i v] by (1)\n change x by (-1)\n end\nelse\n if <[0] > (Xv)> then\n repeat until <<not <touching (ground v)?>> or <(i) > [8]>>\n change [i v] by (1)\n change x by (1)\n end\n end\nend\n\ndefine out2 <>\nset [i v] to [0]\nif <boolean1> then\n repeat until <<not <touching (ground v)?>> or <(i) > [24]>>\n change [i v] by (1)\n change y by (-1)\n end\n set [yv v] to [-1]\nelse\n repeat until <<not <touching (ground v)?>> or <(i) > [24]>>\n change [i v] by (1)\n change y by (1)\n end\n set [yv v] to [0]\nend\n\ndefine None\nset [i v] to [0]\nrepeat until <<(i) > (maxslope)> or <not <touching (ground v)?>>>\n change [i v] by (1)\n change y by (1)\nend\nset [i2 v] to (i)\nif <touching (ground v)?> then\n out <(Xv) > [0]>\n change y by ((0) - (i2))\n if <<key (up arrow v) pressed?> or <key (space v) pressed?>> then\n switch costume to (mar0 v)\n start sound [Jump v]\n if <(Xv) > [0]> then\n set [xv v] to ((0) - (walljump))\n else\n set [xv v] to (walljump)\n end\n set [yv v] to (jumpheight)\n else\n set [xv v] to [0]\n end\nend\n\nswitch costume to ( v)\n\nwhen flag clicked\nforever\n set [level2 v] to (level)\nend\n\nset [level v] to [12]\n\nset [level v] to [12]\n\nbroadcast (message1 v) and wait\n\nset [level v] to [12]\n\nwait until <not <touching color (#f09697)?>>\n\nforever\nend\n\nbroadcast (message1 v)\n\ndefine die\nif then\nelse\nend\n\nif then\nend\n\nif then\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\nelse\nend\n\nchange [level v] by (1)\nif then\n change y by (1)\n start sound [quick dash v]\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\nend\n\nchange [level v] by (1)\n\nforever\n omega\n die\nend\n\nset [yv v] to [0]\nset [xv v] to [0]\nset [level v] to [1]\nswitch costume to (mar0 v)\nset size to (50) %\npoint in direction (90)\nshow\nset [ghost v] effect to (0)\ngo to x: (-211) y: (0)\nhide\n\n@spikes\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n set size to (100) %\n switch costume to (LEVEL \(VERY IMPORTANT\))\n go to [front v] layer\n go [backward v] (1) layers\nend\n\n@Mar2\n\nwhen I receive [del v]\ndelete this clone\n\ndefine out2 <>\nset [i v] to [0]\nif <boolean1> then\n repeat until <<not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>> or <(i) > [24]>>\n change [i v] by (1)\n change y by (-1)\n end\n set [yv v] to [-1]\nelse\n repeat until <<not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>> or <(i) > [24]>>\n change [i v] by (1)\n change y by (1)\n end\n set [yv v] to [0]\nend\n\nswitch costume to (join [mar] (<key (right arrow v) pressed?> + (<key (left arrow v) pressed?> * (-1))))\n\nforever\nend\n\ndefine die\nif then\nelse\nend\n\nif then\nend\n\nif then\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\nelse\nend\n\nchange [level v] by (1)\n\nif then\nend\n\ndefine out <>\nset [i v] to [0]\nif <boolean1> then\n repeat until <<not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>> or <(i) > [8]>>\n change [i v] by (1)\n change x by (-1)\n end\nelse\n if <[0] > (Xv)> then\n repeat until <<not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>> or <(i) > [8]>>\n change [i v] by (1)\n change x by (1)\n end\n end\nend\n\nset [level v] to [12]\n\nchange [level v] by (1)\nif then\n change y by (1)\n start sound [quick dash v]\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\nend\n\nwhen flag clicked\nforever\n set [level \(very important\) v] to (level)\nend\n\nset [level \(very important\) v] to [14]\n\nwait until <not <touching color (#f09697)?>>\n\ndefine None\nset [i v] to [0]\nrepeat until <<(i) > (maxslope)> or <not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>>>\n change [i v] by (1)\n change y by (1)\nend\nset [i2 v] to (i)\nif <<touching (ground v)?> or <touching (moving platformer #1 v)?>> then\n out <(Xv) > [0]>\n change y by ((0) - (i2))\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n switch costume to (mar0 v)\n start sound [Jump v]\n if <(Xv) > [0]> then\n set [xv v] to ((0) - (walljump))\n else\n set [xv v] to (walljump)\n end\n set [yv v] to (jumpheight)\n else\n set [xv v] to [0]\n end\nend\n\ndefine omega\nset volume to (1000) %\nset size to (13) %\nif <not <<touching (ground v)?> or <touching (moving platformer #1 v)?>>> then\n change [xv v] by ((<<key (left arrow v) pressed?> or <key (a v) pressed?>> * (-5)) + (<<key (d v) pressed?> or <key (right arrow v) pressed?>> * (5)))\nend\nset [xv v] to ((Xv) * (0.7))\nchange x by (Xv)\ndetect slope: (8) (15) (13)\nchange [yv v] by (-1)\nchange y by (Yv)\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n switch costume to (mar-1 v)\nend\nif <<key (d v) pressed?> or <key (right arrow v) pressed?>> then\n switch costume to (mar1 v)\nend\nif <<touching (ground v)?> or <touching (moving platformer #1 v)?>> then\n out2 <(Yv) > [0]>\nend\nchange y by (-1)\nif <<<touching (ground v)?> or <touching (moving platformer #1 v)?>> and <<key (up arrow v) pressed?> or <key (space v) pressed?>>> then\n start sound [Jump v]\n set [yv v] to [15]\nend\nif <touching color (#ffff99)?> then\n set [yv v] to [23]\nend\nchange y by (1)\nif <touching (exit v)?> then\n if <(Level) > [21]> then\n start sound [quick dash v]\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\n else\n start sound [quick dash v]\n change [level v] by (1)\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\n end\nend\nif <<<touching (spikes v)?> or <touching color (#ff9999)?>> or <touching (dead detector v)?>> then\n hide\n go to x: (-220) y: (0)\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n broadcast (message1 v) and wait\n show\nend\n\nwhen flag clicked\ngo to [front v] layer\nset [level v] to [1]\nset [level \(very important\) v] to [1]\nbroadcast (del v)\nset [yv v] to [0]\nset [xv v] to [0]\nswitch costume to (mar0 v)\nset size to (50) %\npoint in direction (90)\nshow\nset [ghost v] effect to (0)\ngo to x: (-211) y: (0)\nforever\n omega\n die\nend\n\nwhen flag clicked\nforever\n wait (0.01) seconds\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nclear graphic effects\nrepeat (10)\n change [color v] effect by (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\nwhen I start as a clone\nif <key (right arrow v) pressed?> then\n switch costume to (mar11 v)\nend\nif <key (left arrow v) pressed?> then\n switch costume to (mar-1-1 v)\nend\nif <not <key (any v) pressed?>> then\n switch costume to (mar01 v)\nend\n\nforever\nend\n\n@celebration\n\nwhen flag clicked\nhide\nwait until <(LEVEL \(VERY IMPORTANT\)) = [22]>\nshow\nforever\n next costume\n wait (0.01) seconds\n go [backward v] (1) layers\nend\n\nnext costume\n\nwhen flag clicked\nhide\nwait until <(LEVEL \(VERY IMPORTANT\)) = [22]>\nshow\npoint in direction (90)\nforever\n turn right (5) degrees\nend\n\nset size to (75) %\n\n@Sprite3\n\nwhen flag clicked\nhide\nforever\n go [backward v] (1) layers\nend\n\nwhen flag clicked\n\nforever\n wait (pick random (0.01) to (0.02)) seconds\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nswitch costume to (pick random (1) to (2))\nclear graphic effects\ngo to x: (pick random (-218) to (218)) y: (pick random (160) to (-100))\nset [color v] effect to (pick random (1) to (200))\nset size to (pick random (50) to (125)) %\npoint in direction (90)\nrepeat (10)\n change [ghost v] effect by (3)\n change size by (4)\nend\nrepeat (5)\n change [ghost v] effect by (4)\n change size by (6)\nend\ndelete this clone\n\nwait (0.01) seconds\nwait (0.01) seconds\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (60)\n\n
A Christmas Platformer
@Stage\n\nwhen flag clicked\nset [time v] to [0]\nswitch backdrop to (hi v)\n\nwhen I receive [next level v]\nif <(backdrop [number v]) < [13]> then\n wait (1) seconds\n next backdrop\nend\n\nwhen I receive [start v]\nswitch backdrop to (backdrop1 v)\n\nwhen flag clicked\nforever\n if <(backdrop [number v]) = [13]> then\n show variable [time v]\n show variable [☁ world_record v]\n else\n hide variable [time v]\n hide variable [☁ world_record v]\n end\nend\n\nwhen I receive [start v]\nrepeat until <(backdrop [number v]) = [13]>\n change [time v] by (0.1)\n wait (0.1) seconds\nend\nstop [this script v]\n\nwhen flag clicked\nif <(username) = [HELIFIRE]> then\n stop [this script v]\nelse\n wait until <(backdrop [number v]) = [13]>\n if <(Time) < (☁ World_record)> then\n set [☁ world_record v] to (Time)\n end\nend\n\nwhen I receive [next level v]\nchange [level v] by (1)\n\nwhen flag clicked\nset [level v] to [1]\nhide variable [level v]\n\nwhen I receive [start v]\nshow variable [level v]\n\nwhen I receive [start v]\nshow variable [_time v]\nforever\n repeat until <(backdrop [number v]) = [13]>\n change [_time v] by (0.1)\n wait (0.1) seconds\n end\n if <(backdrop [number v]) = [13]> then\n hide variable [_time v]\n end\nend\n\nwhen flag clicked\nhide variable [_time v]\nset [_time v] to [0]\n\nwhen flag clicked\nhide variable [deaths v]\nset [deaths v] to [0]\n\nwhen I receive [start v]\nshow variable [deaths v]\nif <(backdrop [number v]) = [13]> then\n hide variable [deaths v]\nend\nif <(backdrop [number v]) = [13]> then\n hide variable [level v]\nend\n\nwhen I receive [restart v]\nchange [deaths v] by (1)\n\nwhen [r v] key pressed\nbroadcast (restart v)\n\nwhen flag clicked\nforever\n if <(backdrop [number v]) = [13]> then\n hide variable [level v]\n end\n if <(backdrop [number v]) = [13]> then\n hide variable [deaths v]\n end\nend\n\nwhen flag clicked\nforever\n if <(backdrop [number v]) = [13]> then\n wait (5) seconds\n broadcast (end v)\n stop all sounds\n end\n if <(backdrop [name v]) = [outro]> then\n hide variable [time v]\n hide variable [☁ world_record v]\n end\nend\n\nwhen I receive [end v]\nswitch backdrop to (outro v)\n\n@Sprite1\n\nwhen I receive [restart v]\ngo to x: (-228) y: (-100)\n\nwhen I receive [next level v]\nwait (1) seconds\nshow\ngo to x: (-228) y: (-100)\n\nwhen I receive [start v]\nswitch costume to (costume1 v)\nshow\ngo to x: (-210) y: (-100)\nforever\n if <touching (sprite2 v)?> then\n hide\n broadcast (next level v)\n end\n if <touching color (#ff0000)?> then\n broadcast (bouncey v)\n end\n if <touching color (#000000)?> then\n broadcast (restart v)\n end\n change [y v] by (-0.5)\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-0.5)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (0.5)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (-6)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [y v] to [7]\n if <(x) > [0]> then\n set [x v] to [-7]\n else\n set [x v] to [7]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if < and <<key (up arrow v) pressed?> or <key (w v) pressed?>>> then\n set [y v] to [7]\n end\n change y by (0.5)\n if <touching color (#ff0000)?> then\n set [y v] to [10]\n end\nend\n\nwhen I receive [bouncey v]\nchange y by (50)\n\nwhen [m v] key pressed\nforever\n stop all sounds\nend\n\nwhen flag clicked\nwait until <(backdrop [number v]) = [15]>\nif <touching (sprite2 v)?> then\n broadcast (start v)\nend\n\nwhen I receive [restart v]\nchange [☁ death v] by (1)\n\nwhen flag clicked\nhide\n\nwhen I receive [start v]\nforever\n play sound (pick random (1) to (6)) until done\n wait (1) seconds\n if <(backdrop [name v]) = [outro]> then\n stop [this script v]\n end\nend\n\nwhen I receive [end v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nhide\nwait (3) seconds\nshow\ngo to x: (220) y: (-120)\nswitch costume to (74018-200 v)\n\nwhen I receive [next level v]\nswitch costume to (74018-2 v)\ngo to x: (220) y: (-120)\nglide (1) secs to x: (260) y: (-120)\ngo to x: (220) y: (-120)\nswitch costume to (74018-200 v)\n\n@THUMBNAIL\n\nwhen flag clicked\nshow\nwait (3) seconds\nhide\nbroadcast (Start v)\n\n@Sprite3\n\nwhen I receive [start v]\nswitch costume to (costume1 v)\nhide\nforever\n create clone of (_myself_ v)\n wait (0.1) seconds\nend\n\nwhen I start as a clone\ngo to [front v] layer\nshow\ngo to x: (pick random (-240) to (240)) y: (180)\nglide (pick random (1.5) to (5)) secs to x: (((x position) + (x position)) - (x position)) y: (-180)\nforever\n if <touching (_edge_ v)?> then\n delete this clone\n end\nend\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\nhide\n\n@Sprite4\n\nwhen I receive [end v]\ngo to x: (0) y: (0)\nshow\nforever\n play sound (pick random (1) to (3)) until done\n wait (1) seconds\nend\n\nwhen I receive [end v]\nset size to (100) %\nswitch costume to (costume3 v)\nforever\n next costume\n wait (1) seconds\nend\n\nwhen flag clicked\nhide\n\n@Flying objects\n\nwhen I receive [end v]\nshow\ngo to [front v] layer\nwait (1) seconds\nhide\ngo to x: (0) y: (-195)\nforever\n create clone of (_myself_ v)\n wait (0.5) seconds\nend\n\nwhen I start as a clone\nset [turn v] to (pick random (-3) to (5))\ngo to x: (pick random (-235) to (235)) y: (-195)\nset size to (pick random (75) to (115)) %\nswitch costume to (pick random (1) to (6))\nshow\n\nwhen I start as a clone\nset [yvelocity v] to [0]\nif <(yvelocity) = [0]> then\n set [yvelocity v] to [25]\nend\nrepeat (50)\n change y by (yvelocity)\n change [yvelocity v] by (-1)\n turn right (turn) degrees\nend\ndelete this clone\n\nwhen flag clicked\nhide\n\n@Sprite5\n\nwhen I receive [end v]\nshow\ngo to [front v] layer\nshow\nforever\n set size to (50) %\n forever\n next costume\n wait (0.7) seconds\n end\nend\n\nwhen flag clicked\nhide\n\n
More Levels Have Been Added there are currently 13 Levels Now
Cave Escape - Platformer
@Stage\n\nwhen flag clicked\nforever\n switch backdrop to (Level)\nend\n\nwhen flag clicked\nclear graphic effects\nforever\n if <(backdrop [number v]) = [9]> then\n repeat (10)\n change [brightness v] effect by (5)\n end\n repeat (10)\n change [brightness v] effect by (-5)\n end\n else\n clear graphic effects\n end\nend\n\nwhen I receive [escaped v]\nstop [other scripts in stage v]\nswitch backdrop to (backdrop1 v)\n\n@Blob\n\nwhen flag clicked\nset [level v] to [1]\nset [yv v] to [0]\nset [xv v] to [0]\nset [startx v] to [-202]\nset [starty v] to [-55]\ngo to x: (StartX) y: (StartY)\nshow\nswitch costume to (right v)\nset size to (110) %\nforever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n switch costume to (right v)\n change [xv v] by (0.7)\n else\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n switch costume to (left v)\n change [xv v] by (-0.7)\n end\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#330066)?> then\n change y by (1)\n if <touching color (#330066)?> then\n change y by (1)\n if <touching color (#330066)?> then\n change y by (1)\n if <touching color (#330066)?> then\n change y by (1)\n end\n if <touching color (#330066)?> then\n change x by ((Xv) * (-1))\n change y by (-4)\n set [xv v] to [0]\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#330066)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <touching color (#330066)?>> then\n set [yv v] to [10]\n end\n change y by (1)\n if <<(x position) > [239]> and <not <(Level) = [8]>>> then\n change [level v] by (1)\n wait (0.001) seconds\n go to x: (StartX) y: (StartY)\n end\n if <<<<<<<touching (spikes v)?> or <touching (spikes2 v)?>> or <key (r v) pressed?>> or <touching (fan v)?>> or <touching (fan2 v)?>> or <touching (fan3 v)?>> or <touching (fan4 v)?>> then\n set [ghost v] effect to (0)\n set [xv v] to [0]\n repeat (10)\n change size by ((25) - ((size) / (-5)))\n change [ghost v] effect by (25)\n end\n go to x: (StartX) y: (StartY)\n set [ghost v] effect to (0)\n set size to (110) %\n end\nend\n\nwhen flag clicked\nforever\n if <(Level) = [1]> then\n set [startx v] to [-202]\n set [starty v] to [-55]\n else\n if <(Level) = [2]> then\n set [startx v] to [-202]\n set [starty v] to [-55]\n else\n if <(Level) = [3]> then\n set [startx v] to [-188]\n set [starty v] to [-161]\n else\n if <(Level) = [4]> then\n set [startx v] to [-188]\n set [starty v] to [-161]\n else\n if <(Level) = [5]> then\n set [startx v] to [-227]\n set [starty v] to [44]\n else\n if <(Level) = [8]> then\n set [startx v] to [-199]\n set [starty v] to [-65]\n else\n end\n end\n end\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n start sound [OMFG - Hello \[NCS 2.0 Release\].mp3 v]\n wait (230) seconds\nend\n\nwhen flag clicked\nforever\n wait until <touching (boss missiles v)?>\n set [boss fight timer v] to [0]\nend\n\nwhen flag clicked\nforever\n if <(Level) = [8]> then\n repeat until <touching (boss missiles v)?>\n change [boss fight timer v] by (1)\n wait (1) seconds\n end\n end\nend\n\nwhen flag clicked\nforever\n if <(Boss Fight Timer) > [59]> then\n switch backdrop to (backdrop1 v)\n wait (0.2) seconds\n broadcast (Escaped v)\n hide\n end\nend\n\nwhen flag clicked\nwait until <(Level) = [8]>\ngo to x: (-199) y: (-65)\n\n@Dust\n\nwhen flag clicked\nforever\n Dust\nend\n\ndefine Dust\nhide\ngo to (blob v)\nchange y by (-5)\nif <<<key (right arrow v) pressed?> or <key (d v) pressed?>> and <(Xv) > [2]>> then\n move (-1) steps\n set [ghost v] effect to (0)\n show\n switch costume to (pick random (3) to (4))\n repeat (10)\n move (-1) steps\n change y by (1.5)\n change [ghost v] effect by (15)\n end\n hide\n wait (0.1) seconds\nelse\n if <<<key (left arrow v) pressed?> or <key (a v) pressed?>> and <(Xv) < [-2]>> then\n move (1) steps\n set [ghost v] effect to (0)\n show\n switch costume to (pick random (1) to (2))\n repeat (10)\n move (2) steps\n change y by (1.5)\n change [ghost v] effect by (15)\n end\n hide\n wait (0.1) seconds\n else\n end\nend\n\n@Spikes\n\nwhen flag clicked\npoint in direction (90)\nhide\nwait until <(Level) = [2]>\ncreate clone of (_myself_ v)\nswitch costume to (slanted v)\nshow\nforever\n if <(Level) = [2]> then\n go to x: (-29) y: (-36)\n end\n if <(Level) = [3]> then\n switch costume to (costume2 v)\n go to x: (15) y: (-36)\n end\n if <(Level) = [4]> then\n switch costume to (costume2 v)\n go to x: (-117) y: (-38)\n end\n if <(Level) = [5]> then\n show\n go to x: (-47) y: (-37)\n end\n if <(Level) = [6]> then\n switch costume to (costume2 v)\n show\n go to x: (5) y: (137)\n end\n if <(Level) = [7]> then\n go to x: (-50) y: (-36)\n switch costume to (costume2 v)\n show\n end\n if <(Level) = [8]> then\n go to x: (-50) y: (-36)\n switch costume to (costume2 v)\n hide\n end\nend\n\nwhen I start as a clone\nforever\n repeat (3)\n change [brightness v] effect by (25)\n end\n wait (1) seconds\n repeat (3)\n change [brightness v] effect by (-25)\n end\nend\n\nwhen I start as a clone\nforever\n if <(Level) = [3]> then\n switch costume to (costume2 v)\n go to x: (-29) y: (-36)\n end\n if <(Level) = [4]> then\n show\n go to x: (-19) y: (-37)\n end\n if <(Level) = [5]> then\n show\n go to x: (-203) y: (-36)\n end\n if <(Level) = [6]> then\n show\n go to x: (44) y: (137)\n end\n if <(Level) = [7]> then\n show\n go to x: (-8) y: (-36)\n end\n if <(Level) = [8]> then\n hide\n end\nend\n\nwhen I start as a clone\nshow\nif <(Level) = [2]> then\n switch costume to (slanted v)\n go to x: (34) y: (-22)\n turn left (10) degrees\nend\nif <(Level) = [3]> then\n switch costume to (costume2 v)\n go to x: (-29) y: (-36)\nend\nif <(Level) = [4]> then\n switch costume to (costume2 v)\n go to x: (-19) y: (-37)\nend\nif <(Level) = [5]> then\n switch costume to (costume2 v)\n go to x: (-47) y: (-37)\nend\n\nwhen I start as a clone\nforever\n if <(Level) = [3]> then\n turn right (10) degrees\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n repeat (3)\n change [brightness v] effect by (25)\n end\n wait (1) seconds\n repeat (3)\n change [brightness v] effect by (-25)\n end\nend\n\n@Spikes2\n\nwhen I start as a clone\nhide\nif <(Level) = [2]> then\n show\n switch costume to (slanted v)\n go to x: (34) y: (-22)\n turn left (10) degrees\nend\nif <(Level) = [3]> then\n show\n switch costume to (costume2 v)\n turn right (10) degrees\n go to x: (-29) y: (-36)\nend\nforever\n if <(Level) = [4]> then\n show\n go to x: (118) y: (-36)\n end\n if <(Level) = [5]> then\n show\n point in direction (-90)\n go to x: (-48) y: (-16)\n end\n if <(Level) = [6]> then\n hide\n end\n if <(Level) = [7]> then\n show\n point in direction (90)\n go to x: (90) y: (-37)\n end\n if <(Level) = [8]> then\n hide\n end\nend\n\nwhen flag clicked\npoint in direction (90)\nhide\ncreate clone of (_myself_ v)\nforever\n if <(Level) = [3]> then\n show\n switch costume to (costume2 v)\n go to x: (120) y: (-36)\n end\n if <(Level) = [5]> then\n hide\n end\n if <(Level) = [7]> then\n show\n go to x: (170) y: (-37)\n end\n if <(Level) = [8]> then\n hide\n go to x: (170) y: (-37)\n end\nend\n\nwhen flag clicked\nforever\n repeat (3)\n change [brightness v] effect by (25)\n end\n wait (1) seconds\n repeat (3)\n change [brightness v] effect by (-25)\n end\nend\n\nwhen I start as a clone\nforever\n repeat (3)\n change [brightness v] effect by (25)\n end\n wait (1) seconds\n repeat (3)\n change [brightness v] effect by (-25)\n end\nend\n\n@Water Drop\n\nwhen flag clicked\ngo [backward v] (100) layers\nhide\nset [clone id v] to [0]\nforever\n create clone of (_myself_ v)\n wait (0.5) seconds\nend\n\nwhen I start as a clone\ngo [backward v] (100) layers\nif <(Clone ID) = [1]> then\n show\n go to x: (15) y: (6)\n Water Fall\nend\nif <(Clone ID) = [2]> then\n show\n go to x: (124) y: (41)\n Water Fall\nend\nif <(Clone ID) = [3]> then\n show\n go to x: (217) y: (69)\n Water Fall\nend\nif <(Clone ID) = [4]> then\n show\n go to x: (-126) y: (17)\n Water Fall\nend\nif <(Clone ID) = [5]> then\n show\n go to x: (-196) y: (45)\n Water Fall\nend\n\ndefine Water Fall\nrepeat until <touching color (#330066)?>\n change y by (-5)\n change [ghost v] effect by (2)\nend\ndelete this clone\n\nwhen flag clicked\nforever\n change [clone id v] by (1)\n if <(Clone ID) = [6]> then\n set [clone id v] to [0]\n end\nend\n\n@Fire Particle\n\nwhen flag clicked\ngo to x: (5) y: (-97)\nhide\nrepeat until <(Level) = [2]>\n create clone of (_myself_ v)\nend\nhide\nwait until <(Level) = [3]>\ngo to x: (-53) y: (-42)\nrepeat until <(Level) = [4]>\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nrepeat (20)\n change x by (pick random (-4) to (4))\n change y by (pick random (1) to (4))\n change [ghost v] effect by (5)\nend\ndelete this clone\n\n@Fire Particle2\n\nwhen flag clicked\ngo to x: (77) y: (-97)\nhide\nrepeat until <(Level) = [2]>\n create clone of (_myself_ v)\nend\nhide\nwait until <(Level) = [3]>\ngo to x: (15) y: (-24)\nrepeat until <(Level) = [4]>\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nrepeat (20)\n change x by (pick random (-4) to (4))\n change y by (pick random (1) to (4))\n change [ghost v] effect by (5)\nend\ndelete this clone\n\n@Fan\n\nwhen flag clicked\nhide\nwait until <(Level) = [5]>\ngo to x: (84) y: (-59)\nshow\nrepeat until <(Level) = [6]>\n change [brightness v] effect by (10)\n turn right (15) degrees\n change [brightness v] effect by (-10)\nend\ngo to x: (155) y: (28)\nrepeat until <(Level) = [7]>\n turn right (15) degrees\nend\nhide\n\nwhen flag clicked\nforever\n change [brightness v] effect by (20)\n wait (0.1) seconds\n change [brightness v] effect by (-20)\nend\n\n@Fan2\n\nwhen flag clicked\nhide\nwait until <(Level) = [5]>\ngo to x: (153) y: (-61)\nshow\nrepeat until <(Level) = [6]>\n change [brightness v] effect by (10)\n turn right (15) degrees\n change [brightness v] effect by (-10)\nend\nhide\n\n@wind\n\nwhen flag clicked\nhide\nforever\n if <not <(Level) = [8]>> then\n create clone of (_myself_ v)\n wait (pick random (0.1) to (0.3)) seconds\n end\nend\n\nwhen I start as a clone\ngo to x: (240) y: (pick random (-180) to (180))\nshow\nglide (3) secs to x: (-240) y: (pick random (-180) to (180))\ndelete this clone\n\n@Sprite1\n\nwhen flag clicked\nforever\n hide\nend\n\n@Blob2\n\nwhen flag clicked\nforever\n hide\nend\n\n@Fan3\n\nwhen flag clicked\nhide\nwait until <(Level) = [5]>\ngo to x: (-139) y: (-155)\nshow\nrepeat until <(Level) = [6]>\n change [brightness v] effect by (10)\n turn right (15) degrees\n change [brightness v] effect by (-10)\nend\nhide\n\n@Fan4\n\nwhen flag clicked\nhide\nwait until <(Level) = [5]>\ngo to x: (-91) y: (-155)\nshow\nrepeat until <(Level) = [6]>\n change [brightness v] effect by (10)\n turn right (15) degrees\n change [brightness v] effect by (-10)\nend\nhide\n\n@Boss Missiles\n\nwhen flag clicked\nhide\nwait until <(Level) = [8]>\nforever\n create clone of (_myself_ v)\n wait (pick random (0.3) to (0.4)) seconds\nend\n\nwhen I start as a clone\nforever\n turn right (15) degrees\nend\n\nwhen I start as a clone\nset size to (pick random (90) to (110)) %\nset [brightness v] effect to (pick random (10) to (50))\nset [color v] effect to (pick random (10) to (100))\ngo to x: (pick random (-220) to (220)) y: (180)\nshow\nglide (1) secs to x: (pick random (-220) to (220)) y: (-180)\ndelete this clone\n\n@Tens\n\nwhen flag clicked\nhide\nwait until <(Level) = [8]>\nshow\ngo to x: (-15) y: (74)\nforever\n if <<(Boss Fight Timer) > [10]> or <(Boss Fight Timer) = [10]>> then\n switch costume to ((((Boss Fight Timer) - ((Boss Fight Timer) mod (10))) / (10)) + (2))\n else\n switch costume to (0-pixel v)\n end\nend\n\nwhen I receive [escaped v]\nhide\n\n@Ones\n\nwhen flag clicked\nset [boss fight timer v] to [0]\nhide\nwait until <(Level) = [8]>\nshow\ngo to x: (15) y: (76)\nforever\n if <<(Boss Fight Timer) > [10]> or <(Boss Fight Timer) = [10]>> then\n switch costume to (((Boss Fight Timer) mod (10)) + (2))\n else\n switch costume to ((Boss Fight Timer) + (2))\n end\nend\n\nwhen I receive [escaped v]\nhide\n\n
\n
Ball platformer game
@Stage\n\nwhen I receive [next level v]\nnext backdrop\n\nwhen flag clicked\nswitch backdrop to ( start screen v)\n\nwhen flag clicked\nswitch backdrop to (scratch profile \(1\) v)\nwait (4) seconds\nswitch backdrop to ( start screen v) and wait\n\nwhen I receive [start v]\nforever\n start sound [dance head nod v]\n wait (5.64) seconds\nend\n\n@ ball\n\nwhen flag clicked\nshow\nset [yvelocity v] to [0]\ngo to x: (-214) y: (-157)\nforever\n change y by (yvelocity)\n if <<key (space v) pressed?> and <(yvelocity) < [0]>> then\n if <touching color (#ccffff)?> then\n set [yvelocity v] to [12]\n change y by (12)\n end\n end\n if <touching color (#ccffff)?> then\n if <(yvelocity) < [0]> then\n set [yvelocity v] to [0]\n end\n if <(yvelocity) > [0]> then\n change y by ((0) - (yvelocity))\n set [yvelocity v] to [-5]\n end\n end\n repeat until <not <touching color (#ccffff)?>>\n change y by (1)\n end\n change [yvelocity v] by (-0.5)\nend\n\nwhen flag clicked\nset [level v] to [0]\nset [lives v] to [4]\nset [xvelocity v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n set [xvelocity v] to [15]\n end\n if <key (left arrow v) pressed?> then\n set [xvelocity v] to [-15]\n end\n set [xvelocity v] to ((xvelocity) / (2))\n change x by (xvelocity)\n if <touching color (#ccffff)?> then\n change x by ((0) - (xvelocity))\n set [xvelocity v] to [0]\n end\n if <touching color (#cccc00)?> then\n go to x: (-214) y: (-197)\n change [level v] by (1)\n broadcast (next level v)\n end\n if <touching color (#ff0000)?> then\n go to x: (-214) y: (-197)\n change [lives v] by (-1)\n end\n if <touching color (#00ff55)?> then\n start sound [boing v]\n set [yvelocity v] to [15]\n change y by (15)\n end\n if <touching color (#0033cc)?> then\n go to x: (50) y: (120)\n end\n if <(Lives) < [1]> then\n switch backdrop to ( game over screen v)\n broadcast (game over v)\n set [level v] to [0]\n stop [all v]\n end\nend\n\nwhen flag clicked\n\nwhen flag clicked\nhide variable [level v]\nhide variable [lives v]\nwait (6) seconds\nshow variable [level v]\nshow variable [lives v]\n\nwhen I receive [game over v]\nhide\n\nwhen flag clicked\nScan user\n\ndefine Scan user\n\nwhen I receive [start v]\nhide\n\nwhen I receive [end v]\nshow\n\nwhen I receive [end v]\nshow variable [level v]\nshow variable [lives v]\n\nwhen I receive [start v]\nhide variable [level v]\nhide variable [lives v]\n\n@Sprite2\n\nwhen flag clicked\nforever\n if <(Level) = [3]> then\n show\n turn right (4) degrees\n else\n hide\n end\n wait (0.05) seconds\nend\n\nwhen I receive [game over v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nforever\n glide (2) secs to x: (85) y: (100)\n glide (2) secs to x: (85) y: (-62)\nend\n\nwhen flag clicked\nforever\n if <(Level) = [4]> then\n show\n else\n hide\n end\n wait (0.05) seconds\nend\n\nwhen I receive [game over v]\nhide\n\n@scratch profile (1)2\n\nwhen flag clicked\nbroadcast (start v)\nset [ghost v] effect to (0)\nset size to (100) %\ngo to x: (0) y: (0)\nset [sv v] to [20]\nset [sv v] to (((sv) * (0.7)) + (((105) - (size)) * (0.2)))\nchange size by (sv)\nshow\nrepeat (20)\n set [sv v] to (((sv) * (0.7)) + (((100) - (size)) * (0.2)))\n change size by (sv)\nend\nset [sv v] to [20]\nset [sv v] to (((sv) * (0.7)) + (((105) - (size)) * (0.2)))\nchange size by (sv)\nrepeat (20)\n set [sv v] to (((sv) * (0.7)) + (((100) - (size)) * (0.2)))\n change size by (sv)\n change size by (-10)\nend\nset [sv v] to [20]\nset [sv v] to (((sv) * (0.7)) + (((105) - (size)) * (0.2)))\nchange size by (sv)\nrepeat (20)\n set [sv v] to (((sv) * (0.7)) + (((100) - (size)) * (0.2)))\n change size by (sv)\n change size by (-50)\nend\nrepeat (20)\n set [sv v] to (((sv) * (0.7)) + (((100) - (size)) * (0.2)))\n change size by (sv)\n change [ghost v] effect by (5)\nend\nhide\nstop all sounds\nbroadcast (end v)\n\n@Sprite1\n\nwhen flag clicked\nshow\ngo to x: (0) y: (0)\n\nwhen I receive [start v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\n@ thumbnail\n\nwhen flag clicked\nshow\nhide\n\n
Space,left and right keys for controls\n-------------------------------------------------------------------------\nDon't forget to Love, Favorite and Follow me! - @ldsmithy See ya!\n-------------------------------------------------------------------------\nI will try and reply to everyone's comments if their nice\n-------------------------------------------------------------------------\nDon't forget to comment your suggestions!\n-------------------------------------------------------------------------\nGOAL: To be featured! - Please that's all I want (:\n
CUBIC - A Scrolling Platformer
@Stage\n\nwhen [m v] key pressed\nset [_mouse test v] to (join ((mouse x) + (SCROLL X)) (join [_] ((mouse y) + (SCROLL Y))))\n\nwhen I receive [play v]\nstop all sounds\nforever\n play sound [astronomia v] until done\nend\n\nwhen I receive [start v]\nrepeat until <(_PLAY) = [1]>\n play sound [pixel party v] until done\nend\n\nwhen I receive [start v]\nforever\n set vol ((70) * (V MUS))\nend\n\ndefine set vol (v)\nif <not <(v) = (volume)>> then\n set volume to (v) %\nend\n\nwhen I receive [start v]\nforever\n if <(item (2) of [options v]) = [0]> then\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n if <(item (2) of [options v]) = [0]> then\n switch backdrop to (join [background] (CHAPTER))\n end\n else\n switch backdrop to (join [background] [0])\n end\n else\n switch backdrop to (dark v)\n end\nend\n\n@blank\n\n@start\n\ndefine delete (key)\nset [i v] to [1]\nrepeat until <(i) > (length of [key press v])>\n if <(item (i) of [key press v]) = (key)> then\n delete (i) of [key press v]\n end\n change [i v] by (1)\nend\n\ndefine detect pressed\nif <<key (w v) pressed?> and <not <[key press v] contains (join [up] [1])?>>> then\n add (join [up] [1]) to [key press v]\nend\nif <<not <key (w v) pressed?>> and <[key press v] contains (join [up] [1])?>> then\n delete (join [up] [1])\nend\nif <<key (s v) pressed?> and <not <[key press v] contains (join [down] [1])?>>> then\n add (join [down] [1]) to [key press v]\nend\nif <<not <key (s v) pressed?>> and <[key press v] contains (join [down] [1])?>> then\n delete (join [down] [1])\nend\nif <<key (a v) pressed?> and <not <[key press v] contains (join [left] [1])?>>> then\n add (join [left] [1]) to [key press v]\nend\nif <<not <key (a v) pressed?>> and <[key press v] contains (join [left] [1])?>> then\n delete (join [left] [1])\nend\nif <<key (d v) pressed?> and <not <[key press v] contains (join [right] [1])?>>> then\n add (join [right] [1]) to [key press v]\nend\nif <<not <key (d v) pressed?>> and <[key press v] contains (join [right] [1])?>> then\n delete (join [right] [1])\nend\nif <<key (up arrow v) pressed?> and <not <[key press v] contains (join [up] [2])?>>> then\n add (join [up] [2]) to [key press v]\nend\nif <<not <key (up arrow v) pressed?>> and <[key press v] contains (join [up] [2])?>> then\n delete (join [up] [2])\nend\nif <<key (down arrow v) pressed?> and <not <[key press v] contains (join [down] [2])?>>> then\n add (join [down] [2]) to [key press v]\nend\nif <<not <key (down arrow v) pressed?>> and <[key press v] contains (join [down] [2])?>> then\n delete (join [down] [2])\nend\nif <<key (left arrow v) pressed?> and <not <[key press v] contains (join [left] [2])?>>> then\n add (join [left] [2]) to [key press v]\nend\nif <<not <key (left arrow v) pressed?>> and <[key press v] contains (join [left] [2])?>> then\n delete (join [left] [2])\nend\nif <<key (right arrow v) pressed?> and <not <[key press v] contains (join [right] [2])?>>> then\n add (join [right] [2]) to [key press v]\nend\nif <<not <key (right arrow v) pressed?>> and <[key press v] contains (join [right] [2])?>> then\n delete (join [right] [2])\nend\n\ndefine update time (amount)\nchange [time last v] by (amount)\nset [time v] to ((round ((time last) * (100))) / (100))\nif <(letter ((length of (TIME)) - (1)) of (TIME)) = [.]> then\n set [time v] to (join (TIME) [0])\nelse\n if <not <(letter ((length of (TIME)) - (2)) of (TIME)) = [.]>> then\n set [time v] to (join (TIME) [.00])\n end\nend\n\nwhen flag clicked\nbroadcast (flag v)\nset [0] [0] [90] [cover] [100] [99999] [100]\nforever\n go [forward v] (99999) layers\nend\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [flag v]\nsetup [1]\nbroadcast (setup v) and wait\nbroadcast (intro v)\nwait until <(INTRO) < [0]>\nbroadcast (buttons v)\nbroadcast (start v)\n\ndefine menu pos (x) (y)\nreplace item (X #) of [menu pos v] with (x)\nreplace item (Y #) of [menu pos v] with (y)\n\ndefine reset time\nset [time v] to [0]\nset [time last v] to [0]\nupdate time [0]\n\nwhen I receive [start v]\nforever\n menu pos [0] ((-20) + (([sin v] of (((timer) + (1)) * (70)) ) * (12)))\n mouse pos (mouse x) (mouse y)\nend\n\nwhen I receive [flag v]\nforever\n if <mouse down?> then\n set [mouse v] to [1]\n wait (0) seconds\n set [mouse v] to [0]\n wait until <not <mouse down?>>\n end\nend\n\ndefine thumbnail (id)\nhide variable [time v]\nset [v mus v] to [1]\nset [v fx v] to [1]\nset [0] [0] [90] (join [thumbnail] (id)) [100] [99999] [0]\nstop [all v]\n\nthumbnail [2]\n\ndefine check wr\nif <(CHAPTER) = [1]> then\n if <(TIME) < (☁ WR1)> then\n set [☁ wr1 v] to (TIME)\n end\nend\nif <(CHAPTER) = [2]> then\n if <(TIME) < (☁ WR2)> then\n set [☁ wr2 v] to (TIME)\n end\nend\n\ndefine mouse pos (x) (y)\nreplace item (X #) of [mouse pos v] with (x)\nreplace item (Y #) of [mouse pos v] with (y)\n\ndefine setup (type)\nif <(type) = [1]> then\n hide variable [time v]\n set [_play v] to [0]\n set [win v] to [0]\n set [chapter v] to [1]\n set [chpt max v] to [3]\n set [creator v] to [PetrThePro]\n set [checkpoint v] to [1]\n set [x # v] to [1]\n set [y # v] to [2]\n delete all of [menu pos v]\n repeat (2)\n add [] to [menu pos v]\n end\n delete all of [mouse pos v]\n repeat (2)\n add [] to [mouse pos v]\n end\n delete all of [options v]\n delete all of [options # v]\n add [1] to [options v]\n add [grid] to [options # v]\n add [0] to [options v]\n add [dark] to [options # v]\n add [0] to [options v]\n add [hitbox] to [options # v]\n add [0] to [options v]\n add [speed run] to [options # v]\n add [0] to [options v]\n add [key stroke] to [options # v]\nend\nif <(type) = [2]> then\n hide variable [time v]\n set [_play v] to [0]\n set [win v] to [0]\n set [chapter v] to ((CHAPTER) + (1))\n set [checkpoint v] to [1]\nend\n\nwhen I receive [start v]\nreset time\nwait until <(_PLAY) = [1]>\nshow variable [time v]\nbroadcast (play v)\nrepeat until <(WIN) = [1]>\n if <(item (4) of [options v]) = [1]> then\n reset time\n wait (3) seconds\n end\n reset timer\n repeat until <<(DIE) = [1]> or <(WIN) = [1]>>\n update time ((1) / (30))\n detect pressed\n end\n if <(WIN) = [0]> then\n wait until <(DIE) = [0]>\n end\nend\nif <not <(username) = (CREATOR)>> then\n check wr\nend\nwait (1) seconds\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nshow\nset [0] [-360] [90] [slide] [100] [99] [0]\nrepeat until <(y position) = [0]>\n change y by (((0) - (y position)) / (3))\nend\nwait (2) seconds\nreset time\nsetup [2]\nbroadcast (start v)\ndelete this clone\n\n@player\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\ndefine setup\nif <(CHAPTER) = [1]> then\n set [x v] to (item (CHECKPOINT) of [checkpoints1 v])\n set [y v] to (item ((CHECKPOINT) + (1)) of [checkpoints1 v])\n set [scroll x v] to (item (CHECKPOINT) of [checkpoints1 v])\n set [scroll y v] to (item ((CHECKPOINT) + (1)) of [checkpoints1 v])\nend\nif <(CHAPTER) = [2]> then\n set [x v] to (item (CHECKPOINT) of [checkpoints2 v])\n set [y v] to (item ((CHECKPOINT) + (1)) of [checkpoints2 v])\n set [scroll x v] to (item (CHECKPOINT) of [checkpoints2 v])\n set [scroll y v] to (item ((CHECKPOINT) + (1)) of [checkpoints2 v])\nend\nif <(CHAPTER) = [3]> then\n set [x v] to (item (CHECKPOINT) of [checkpoints3 v])\n set [y v] to (item ((CHECKPOINT) + (1)) of [checkpoints3 v])\n set [scroll x v] to (item (CHECKPOINT) of [checkpoints3 v])\n set [scroll y v] to (item ((CHECKPOINT) + (1)) of [checkpoints3 v])\nend\nset [sx v] to [0]\nset [sy v] to [0]\nset [in air v] to [0]\nset [die v] to [0]\nset [coin last v] to (COINS)\nshow\n\ndefine tick (chapter)\nif <(chapter) = [1]> then\n set vol ((100) * (V FX))\n switch costume to (hitbox v)\n if <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> then\n if <not <touching (water v)?>> then\n if <not <touching (bounce v)?>> then\n change [sx v] by (-1.2)\n end\n else\n change [sx v] by (-0.4)\n end\n end\n if <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> then\n if <not <touching (water v)?>> then\n if <not <touching (bounce v)?>> then\n change [sx v] by (1.2)\n end\n else\n change [sx v] by (0.4)\n end\n end\n if <not <touching (water v)?>> then\n set [sx v] to ((sx) * (0.85))\n else\n set [sx v] to ((sx) * (0.95))\n end\n if <([abs v] of (sx) ) > [0.9]> then\n player x (sx) [0]\n end\n if <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> then\n if <not <touching (water v)?>> then\n if <(in air) < [5]> then\n set [sy v] to [14]\n end\n else\n change [sy v] by (1.3)\n end\n end\n if <not <touching (water v)?>> then\n if <(sy) > [-20]> then\n change [sy v] by (-2)\n end\n else\n if <(sy) < [2]> then\n change [sy v] by (1)\n end\n if <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> then\n change [sy v] by (-1.5)\n end\n end\n player y (sy)\n pos\n change [scroll x v] by (round (((x) - (SCROLL X)) / (8)))\n if <(SCROLL X) < [-250]> then\n set [scroll x v] to [-250]\n end\n if <(SCROLL X) > [4200]> then\n set [scroll x v] to [4200]\n end\n change [scroll y v] by (round (((y) - (SCROLL Y)) / (4)))\n if <(SCROLL Y) < [0]> then\n set [scroll y v] to [0]\n end\n pos\n if <touching (bounce v)?> then\n start sound [bounce v]\n set [sy v] to [38]\n end\n if <not <(COINS) = (coin last)>> then\n start sound [coin v]\n end\n set [coin last v] to (COINS)\n if <not <(CHECKPOINT) = (point last)>> then\n start sound [checkpoint v]\n end\n set [point last v] to (CHECKPOINT)\n if <(item (item # of [hitbox] in [options # v]) of [options v]) = [0]> then\n set costume\n switch costume to (join [player ] (costume))\n else\n switch costume to (outline v)\n end\nend\nif <(chapter) = [2]> then\n set vol ((100) * (V FX))\n switch costume to (hitbox v)\n if <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> then\n change [sx v] by (-0.5)\n end\n if <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> then\n change [sx v] by (0.5)\n end\n set [sx v] to ((sx) * (0.95))\n if <([abs v] of (sx) ) > [0.9]> then\n player x (sx) [1]\n end\n if <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> then\n if <(in air) < [8]> then\n set [sy v] to [14]\n end\n end\n if <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> then\n change [sy v] by (-4)\n else\n change [sx v] by (-0.1)\n end\n if <(sy) > [-20]> then\n change [sy v] by (-1)\n end\n player y (sy)\n pos\n change [scroll x v] by (round (((x) - (SCROLL X)) / (10)))\n if <(SCROLL X) < [-700]> then\n set [scroll x v] to [-700]\n end\n change [scroll y v] by (round (((y) - (SCROLL Y)) / (3)))\n if <(SCROLL Y) < [0]> then\n set [scroll y v] to [0]\n end\n pos\n if <touching (bounce v)?> then\n start sound [bounce v]\n set [sy v] to [30]\n end\n if <not <(COINS) = (coin last)>> then\n start sound [coin v]\n end\n set [coin last v] to (COINS)\n if <(item (item # of [hitbox] in [options # v]) of [options v]) = [0]> then\n set costume\n switch costume to (join [player ] (costume))\n else\n switch costume to (outline v)\n end\nend\nif <(chapter) = [3]> then\n set vol ((100) * (V FX))\n switch costume to (hitbox v)\n if <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> then\n change [sx v] by (-9)\n end\n if <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> then\n change [sx v] by (9)\n end\n set [sx v] to ((sx) * (0.4))\n if <([abs v] of (sx) ) > [0.9]> then\n player x (sx) [0]\n end\n if <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> then\n if <(in air) < [2]> then\n set [sy v] to [19]\n end\n end\n if <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> then\n change [sy v] by (-3)\n end\n if <(sy) > [-20]> then\n change [sy v] by (-2)\n end\n player y (sy)\n pos\n change [scroll x v] by (round (((x) - (SCROLL X)) / (3)))\n if <(SCROLL X) < [-50]> then\n set [scroll x v] to [-50]\n end\n change [scroll y v] by (round (((y) - (SCROLL Y)) / (4)))\n if <(SCROLL Y) < [0]> then\n set [scroll y v] to [0]\n end\n pos\n if <touching (bounce v)?> then\n start sound [bounce v]\n set [sy v] to [30]\n end\n if <not <(COINS) = (coin last)>> then\n start sound [coin v]\n end\n set [coin last v] to (COINS)\n if <(item (item # of [hitbox] in [options # v]) of [options v]) = [0]> then\n set costume\n switch costume to (join [player ] (costume))\n else\n switch costume to (outline v)\n end\nend\n\ndefine player y (sy)\nchange [y v] by (sy)\nchange [in air v] by (1)\npos\nif <not <<touching (bounce v)?> or <touching (spike v)?>>> then\n repeat until <not <touching (platformes v)?>>\n if <(sy) > [0]> then\n change [y v] by (-1)\n else\n change [y v] by (1)\n set [in air v] to [0]\n end\n pos\n set [sy v] to [0]\n end\nend\n\ndefine pos\ngo to x: ((x) - (SCROLL X)) y: ((y) - (SCROLL Y))\n\ndefine player x (sx) (wall jump)\nchange [x v] by (sx)\npos\nif <touching (platformes v)?> then\n repeat (10)\n change [y v] by (1)\n pos\n if <not <touching (platformes v)?>> then\n stop [this script v]\n end\n end\n change [y v] by (-10)\n if <(wall jump) = [1]> then\n if <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> then\n if <(sx) > [0]> then\n set [sx v] to [-5]\n else\n set [sx v] to [5]\n end\n set [in air v] to [0]\n else\n set [sx v] to [0]\n end\n end\n repeat until <not <touching (platformes v)?>>\n if <(sx) > [0]> then\n change [x v] by (-1)\n else\n change [x v] by (1)\n end\n pos\n end\nend\n\nwhen I receive [setup v]\nset [point last v] to [1]\nset [0] [0] [90] (join [player ] [m]) [55] [999] [0]\nhide\n\nwhen I receive [play v]\nrepeat until <(WIN) = [1]>\n broadcast (game reset v) and wait\n broadcast (game setup v) and wait\n setup\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n tick (CHAPTER)\n broadcast (tick v)\n if <(item (item # of [hitbox] in [options # v]) of [options v]) = [0]> then\n switch costume to (join [player ] [m])\n end\n wait (3) seconds\n end\n repeat until <<(DIE) = [1]> or <(WIN) = [1]>>\n tick (CHAPTER)\n broadcast (tick v)\n end\n if <(WIN) = [0]> then\n wait until <(DIE) = [0]>\n end\nend\nbroadcast (game reset v)\nhide\n\ndefine die\nset [brightness v] effect to (0)\nrepeat (3)\n set [brightness v] effect to (20)\n start sound [die v]\n wait (0.1) seconds\n set [brightness v] effect to (0)\n wait (0.1) seconds\nend\nhide\nwait (0.5) seconds\n\nwhen I receive [play v]\nforever\n death\nend\n\ndefine death\nif <<<<touching (spike v)?> or <touching (enemy v)?>> or <touching (lava v)?>> or <(y) < [-170]>> then\n set [die v] to [1]\n die\n set [die v] to [0]\n set [y v] to [0]\n set [x v] to [0]\nend\n\ndefine set costume\nif <<<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> and <<not <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>>> and <not <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>>>>> then\n set [costume v] to [n]\nend\nif <<<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> and <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>>> then\n set [costume v] to [ne]\nend\nif <<<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> and <not <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>>>> then\n set [costume v] to [e]\nend\nif <<<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> and <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>>> then\n set [costume v] to [se]\nend\nif <<<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> and <<not <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>>> and <not <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>>>>> then\n set [costume v] to [s]\nend\nif <<<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> and <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>>> then\n set [costume v] to [sw]\nend\nif <<<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> and <not <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>>>> then\n set [costume v] to [w]\nend\nif <<<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> and <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>>> then\n set [costume v] to [nw]\nend\nif <<<not <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>>> and <not <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>>>> and <<not <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>>> and <not <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>>>>> then\n set [costume v] to [m]\nend\n\ndefine set vol (v)\nif <not <(v) = (volume)>> then\n set volume to (v) %\nend\n\n@buttons1\n\ndefine box collide (x1) (y1) (x2) (y2) (w) (h)\nif <([abs v] of ((x1) - (x2)) ) < ((w) + (1))> then\n if <([abs v] of ((y1) - (y2)) ) < ((h) + (1))> then\n set [collide v] to [1]\n else\n set [collide v] to [0]\n end\nelse\n set [collide v] to [0]\nend\n\nwhen I receive [setup v]\nhide\n\ndefine clone (id)\nset [clone v] to (id)\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nif <(clone) = [title]> then\n set ((0) + (item (X #) of [menu pos v])) ((120) + (item (Y #) of [menu pos v])) [90] (join [title] [2]) [90] [0] [0]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((120) + (item (Y #) of [menu pos v]))\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((0) + (item (X #) of [menu pos v])) ((120) + (item (Y #) of [menu pos v])) [80] [40]\n if <(collide) = [1]> then\n if <<(MOUSE) = [1]> or <(SPACE) = [1]>> then\n change [combo v] by (1)\n end\n end\n if <(COMBO) > [1]> then\n change [combo v] by ((-1) / ((10) - ((5) * ((COMBO) / (100)))))\n end\n else\n hide\n end\n end\nend\nif <(clone) = [combo]> then\n set ((0) + (item (X #) of [menu pos v])) ((165) + (item (Y #) of [menu pos v])) [90] (join [bar] [banana]) [100] [0] [100]\n set [brightness v] effect to (100)\n set [combo v] to [0]\n set [delta v] to [0]\n set [ghost v] to [0]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((165) + (item (Y #) of [menu pos v]))\n show\n if <(COMBO) > [1]> then\n set [delta v] to ((COMBO) / (100))\n switch costume to (join [bar] ([ceiling v] of ((delta) * (10)) ))\n change [ghost v] by (((0) - (ghost)) * (0.4))\n else\n change [ghost v] by (((100) - (ghost)) * (0.4))\n end\n set [ghost v] effect to (ghost)\n else\n hide\n end\n end\nend\nif <(clone) = [play]> then\n set ((0) + (item (X #) of [menu pos v])) ((-90) + (item (Y #) of [menu pos v])) [90] [play] [90] [0] [30]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((-90) + (item (Y #) of [menu pos v]))\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((0) + (item (X #) of [menu pos v])) ((-90) + (item (Y #) of [menu pos v])) [65] [30]\n if <<(CHAPTER) < ((CHPT MAX) + (1))> and <not <<(CHAPTER) = [3]> and <not <(COINS) > ((2) - (1))>>>>> then\n if <(collide) = [1]> then\n change [touch v] by (1)\n if <(MOUSE) = [1]> then\n set [_play v] to [1]\n end\n end\n point in direction ((90) + (((([sin v] of ((timer) * (100)) ) * (4)) * <(touch) < [1]>) + ((([sin v] of ((timer) * (100)) ) * (2)) * <(touch) > [1]>)))\n set [ghost v] effect to ((30) - ((([sin v] of ((timer) * (50)) ) * (10)) + ((touch) * (8))))\n set [size vel v] to ((size vel) + (((((90) + (<(touch) > [1]> * (15))) - (size)) * (0.4)) + (<not <(CHAPTER) = (last)>> * (10))))\n set [last v] to (CHAPTER)\n set size to ((size) + ((size vel) + ((([sin v] of ((timer) * (200)) ) * (4)) * <(touch) < [1]>))) %\n set [size vel v] to ((size vel) * (0.8))\n set [touch v] to ((touch) * (0.7))\n else\n point in direction (90)\n set size to ((size) + (((70) - (size)) / (3))) %\n set [ghost v] effect to (60)\n end\n switch costume to (join [play] ((item (item # of [dark] in [options # v]) of [options v]) + (1)))\n else\n hide\n end\n end\nend\nif <(clone) = [map]> then\n set ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] (join [chapter] (CHAPTER)) [80] [0] [15]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [80] [50]\n if <(collide) = [1]> then\n set size to ((size) + (((95) - (size)) / (4))) %\n else\n set size to ((size) + (((80) - (size)) / (6))) %\n end\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n switch costume to (join [chapter] (CHAPTER))\n else\n switch costume to (join [chapter] [0])\n end\n else\n hide\n end\n end\nend\nif <(clone) = [lock]> then\n set ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] (join [locked] (CHAPTER)) [80] [0] [20]\n forever\n if <(_PLAY) = [0]> then\n if <<(CHAPTER) = [3]> and <not <(COINS) > ((2) - (1))>>> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [80] [50]\n if <(collide) = [1]> then\n set size to ((size) + (((95) - (size)) / (4))) %\n else\n set size to ((size) + (((80) - (size)) / (6))) %\n end\n switch costume to (join [locked] (CHAPTER))\n else\n hide\n end\n else\n hide\n end\n end\nend\nif <(clone) = [text]> then\n set ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] (join [text] (CHAPTER)) [80] [0] [60]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [80] [50]\n if <(collide) = [1]> then\n set size to ((size) + (((95) - (size)) / (4))) %\n else\n set size to ((size) + (((80) - (size)) / (6))) %\n end\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n switch costume to (join [text] (CHAPTER))\n else\n switch costume to (join [text] [0])\n end\n set [ghost v] effect to ((size) - (10))\n else\n hide\n end\n end\nend\nif <(clone) = (join [arrow] [1])> then\n set ((-115) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] (join [arrow] (join (join [1] [-]) ((item (2) of [options v]) + (1)))) [110] [0] [30]\n forever\n if <(_PLAY) = [0]> then\n go to x: (((-115) + (toggle)) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n show\n if <not <(CHAPTER) = [1]>> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((-115) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [20] [20]\n if <(collide) = [1]> then\n set [brightness v] effect to (3)\n if <(MOUSE) = [1]> then\n change [chapter v] by (-1)\n change [toggle v] by (-10)\n end\n else\n set [brightness v] effect to (0)\n end\n set [ghost v] effect to (20)\n else\n set [ghost v] effect to (60)\n end\n set [toggle v] to ((toggle) * (0.7))\n else\n hide\n end\n switch costume to (join [arrow] (join (join [1] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [arrow] [2])> then\n set ((115) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] (join [arrow] (join (join [2] [-]) ((item (2) of [options v]) + (1)))) [110] [0] [30]\n forever\n if <(_PLAY) = [0]> then\n go to x: (((115) + (toggle)) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n show\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) ((115) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [20] [20]\n if <(collide) = [1]> then\n set [brightness v] effect to (3)\n if <(MOUSE) = [1]> then\n change [chapter v] by (1)\n change [toggle v] by (10)\n end\n else\n set [brightness v] effect to (0)\n end\n set [ghost v] effect to (20)\n else\n set [ghost v] effect to (60)\n end\n set [toggle v] to ((toggle) * (0.7))\n else\n hide\n end\n switch costume to (join [arrow] (join (join [2] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = [music]> then\n set [198] [168] [90] (join [music] [1]) [30] [99] [20]\n if <(V MUS) = [1]> then\n set [switch v] to [0]\n else\n set [switch v] to [1]\n end\n forever\n go to x: (198) y: (168)\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) [198] [168] [10] [10]\n if <(collide) = [1]> then\n set [brightness v] effect to (5)\n if <(MOUSE) = [1]> then\n if <(switch) = [1]> then\n set [switch v] to [0]\n set [v mus v] to [1]\n else\n set [switch v] to [1]\n set [v mus v] to [0]\n end\n end\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [music] (((V MUS) * (-1)) + (2)))\n end\nend\nif <(clone) = [fx]> then\n set [224] [168] [90] (join [fx] [1]) [35] [99] [20]\n if <(V FX) = [1]> then\n set [switch v] to [0]\n else\n set [switch v] to [1]\n end\n forever\n go to x: (224) y: (168)\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) [224] [168] [15] [9]\n if <(collide) = [1]> then\n set [brightness v] effect to (5)\n if <(MOUSE) = [1]> then\n if <(switch) = [1]> then\n set [switch v] to [0]\n set [v fx v] to [1]\n else\n set [switch v] to [1]\n set [v fx v] to [0]\n end\n end\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [fx] (((V FX) * (-1)) + (2)))\n end\nend\nif <(clone) = [cover]> then\n set [0] [0] [90] [cover] [100] [9] [50]\n show\nend\nif <(clone) = (join [info] [1])> then\n set [-210] [-150] [90] (join [icon] [1]) [10] [0] [20]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) [-210] [-150] [20] [20]\n if <(collide) = [1]> then\n set [show info v] to [1]\n set [ghost v] effect to (10)\n set size to ((size) + (((80) - (size)) / (3))) %\n else\n set [show info v] to [0]\n set [ghost v] effect to (20)\n set size to ((size) + (((90) - (size)) / (5))) %\n end\n else\n set [ghost v] effect to (40)\n end\n if <<(CHAPTER) < ((CHPT MAX) + (1))> and <not <(CHAPTER) = (last)>>> then\n change [touch v] by (15)\n end\n set [last v] to (CHAPTER)\n set [touch v] to ((touch) * (0.4))\n change size by (touch)\n else\n hide\n end\n end\nend\nif <(clone) = (join [info] [2])> then\n set [-175] [-70] [90] (join [info] (CHAPTER)) [95] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW INFO) = [1]> then\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n switch costume to (join [info] (CHAPTER))\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [wr] [1])> then\n set [-160] [-150] [90] (join [icon] [2]) [10] [0] [20]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(CHAPTER) < ((CHPT MAX) + (1))> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) [-160] [-150] [20] [20]\n if <(collide) = [1]> then\n set [show wr v] to [1]\n set [ghost v] effect to (10)\n set size to ((size) + (((80) - (size)) / (3))) %\n else\n set [show wr v] to [0]\n set [ghost v] effect to (20)\n set size to ((size) + (((90) - (size)) / (5))) %\n end\n else\n set [ghost v] effect to (40)\n end\n if <<(CHAPTER) < ((CHPT MAX) + (1))> and <not <(CHAPTER) = (last)>>> then\n change [touch v] by (15)\n end\n set [last v] to (CHAPTER)\n set [touch v] to ((touch) * (0.4))\n change size by (touch)\n else\n hide\n end\n end\nend\nif <(clone) = (join [wr] [2])> then\n set [-175] [-95] [90] (join [wr] (length of (☁ WR1))) [95] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW WR) = [1]> then\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n if <(CHAPTER) = [1]> then\n set [record v] to (☁ WR1)\n end\n if <(CHAPTER) = [2]> then\n set [record v] to (☁ WR2)\n end\n switch costume to (join [wr] (length of (record)))\n set [wr ghost v] to ((100) - ((touch) * (2)))\n set [ghost v] effect to (WR GHOST)\n else\n hide\n end\n end\nend\nif <(clone) = [glow]> then\n set ((0) + (item (X #) of [menu pos v])) ((10) + (item (Y #) of [menu pos v])) [90] [glow] [100] [-99] [90]\n set [tick v] to [0]\n forever\n if <(_PLAY) = [0]> then\n go to x: ((0) + (item (X #) of [menu pos v])) y: ((10) + (item (Y #) of [menu pos v]))\n point in direction (((tick) + ([abs v] of (([sin v] of ((tick) * (8)) ) * (2)) )) mod (360))\n set size to ((400) + (([sin v] of ((tick) * (8)) ) * (25))) %\n show\n change [tick v] by (1)\n else\n hide\n end\n end\nend\n\ndefine clones\nclone [title]\nclone [combo]\nclone [play]\nclone [map]\nclone [lock]\nclone (join [arrow] [1])\nclone (join [arrow] [2])\nclone [text]\nclone [music]\nclone [fx]\nclone [cover]\nclone (join [info] [1])\nclone (join [info] [2])\nclone (join [wr] [1])\nclone (join [wr] [2])\nclone [glow]\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [buttons v]\nclones\n\nwhen I receive [start v]\nrepeat until <(_PLAY) = [1]>\n if <key (space v) pressed?> then\n set [space v] to [1]\n wait (0) seconds\n set [space v] to [0]\n wait until <not <key (space v) pressed?>>\n end\nend\n\n@buttons2\n\ndefine box collide (x1) (y1) (x2) (y2) (w) (h)\nif <([abs v] of ((x1) - (x2)) ) < ((w) + (1))> then\n if <([abs v] of ((y1) - (y2)) ) < ((h) + (1))> then\n set [collide v] to [1]\n else\n set [collide v] to [0]\n end\nelse\n set [collide v] to [0]\nend\n\nwhen I receive [setup v]\nsetup\n\ndefine setup\nhide\n\ndefine clone (id)\nset [clone v] to (id)\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nif <(clone) = (join [options] [1])> then\n set [210] [-150] [90] (join [symbol] [3]) [10] [0] [20]\n set [show opt v] to [0]\n forever\n if <(_PLAY) = [0]> then\n show\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) [210] [-150] [20] [20]\n if <(collide) = [1]> then\n set [ghost v] effect to (10)\n set size to ((size) + (((80) - (size)) / (3))) %\n if <(MOUSE) = [1]> then\n if <(SHOW OPT) = [1]> then\n set [show opt v] to [0]\n else\n set [show opt v] to [1]\n end\n set size to ((size) + (((70) - (size)) / (2))) %\n end\n else\n set [ghost v] effect to (20)\n set size to ((size) + (((90) - (size)) / (5))) %\n end\n else\n hide\n end\n end\nend\nif <(clone) = (join [options] [2])> then\n set [175] [-70] [90] [options] [95] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [checkbox] [1])> then\n set [box x v] to [220]\n set [box y first v] to [-35]\n set [box y add v] to [17.5]\n set (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((1) - (1)))) [90] (join [checkbox] ((item (item # of [grid] in [options # v]) of [options v]) + (1))) [50] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((1) - (1)))) [8] [8]\n if <(collide) = [1]> then\n if <(MOUSE) = [1]> then\n if <(item (item # of [grid] in [options # v]) of [options v]) = [1]> then\n replace item (item # of [grid] in [options # v]) of [options v] with [0]\n else\n replace item (item # of [grid] in [options # v]) of [options v] with [1]\n end\n end\n set [brightness v] effect to (10)\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [checkbox] ((item (item # of [grid] in [options # v]) of [options v]) + (1)))\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [checkbox] [2])> then\n set (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((2) - (1)))) [90] (join [checkbox] ((item (item # of [dark] in [options # v]) of [options v]) + (1))) [50] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((2) - (1)))) [8] [8]\n if <(collide) = [1]> then\n if <(MOUSE) = [1]> then\n if <(item (item # of [dark] in [options # v]) of [options v]) = [1]> then\n replace item (item # of [dark] in [options # v]) of [options v] with [0]\n else\n replace item (item # of [dark] in [options # v]) of [options v] with [1]\n end\n end\n set [brightness v] effect to (10)\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [checkbox] ((item (item # of [dark] in [options # v]) of [options v]) + (1)))\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [checkbox] [3])> then\n set (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((3) - (1)))) [90] (join [checkbox] ((item (item # of [hitbox] in [options # v]) of [options v]) + (1))) [50] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((3) - (1)))) [8] [8]\n if <(collide) = [1]> then\n if <(MOUSE) = [1]> then\n if <(item (item # of [hitbox] in [options # v]) of [options v]) = [1]> then\n replace item (item # of [hitbox] in [options # v]) of [options v] with [0]\n else\n replace item (item # of [hitbox] in [options # v]) of [options v] with [1]\n end\n end\n set [brightness v] effect to (10)\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [checkbox] ((item (item # of [hitbox] in [options # v]) of [options v]) + (1)))\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [checkbox] [4])> then\n set [220] ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((4) - (1)))) [90] (join [checkbox] ((item (item # of [speed run] in [options # v]) of [options v]) + (1))) [50] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((4) - (1)))) [8] [8]\n if <(collide) = [1]> then\n if <(MOUSE) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n replace item (item # of [speed run] in [options # v]) of [options v] with [0]\n else\n replace item (item # of [speed run] in [options # v]) of [options v] with [1]\n end\n end\n set [brightness v] effect to (10)\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [checkbox] ((item (item # of [speed run] in [options # v]) of [options v]) + (1)))\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [checkbox] [5])> then\n set [220] ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((5) - (1)))) [90] (join [checkbox] ((item (item # of [key stroke] in [options # v]) of [options v]) + (1))) [50] [0] [100]\n forever\n if <(_PLAY) = [0]> then\n show\n if <(SHOW OPT) = [1]> then\n box collide (item (X #) of [mouse pos v]) (item (Y #) of [mouse pos v]) (BOX X) ((BOX Y FIRST) + (((BOX Y ADD) * (-1)) * ((5) - (1)))) [8] [8]\n if <(collide) = [1]> then\n if <(MOUSE) = [1]> then\n if <(item (item # of [key stroke] in [options # v]) of [options v]) = [1]> then\n replace item (item # of [key stroke] in [options # v]) of [options v] with [0]\n else\n replace item (item # of [key stroke] in [options # v]) of [options v] with [1]\n end\n end\n set [brightness v] effect to (10)\n else\n set [brightness v] effect to (0)\n end\n switch costume to (join [checkbox] ((item (item # of [key stroke] in [options # v]) of [options v]) + (1)))\n if <(touch) < [30]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-5)\n end\n end\n set [ghost v] effect to ((100) - ((touch) * (2)))\n else\n hide\n end\n end\nend\nif <(clone) = (join [number] [1])> then\n set [0] [50] [90] (join [number] (join (join [1] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n wait (2) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [1] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [number] [2])> then\n set [0] [50] [90] (join [number] (join (join [2] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n wait (1) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [2] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [number] [3])> then\n set [0] [50] [90] (join [number] (join (join [3] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [3] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [number] [1])> then\n set [0] [50] [90] (join [number] (join (join [1] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n wait (2) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [1] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [number] [2])> then\n set [0] [50] [90] (join [number] (join (join [2] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n wait (1) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [2] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [number] [3])> then\n set [0] [50] [90] (join [number] (join (join [3] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1)))) [300] [0] [100]\n set [set play v] to [1]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [speed run] in [options # v]) of [options v]) = [1]> then\n if <<(DIE) = [1]> or <(set play) = [1]>> then\n if <(DIE) = [1]> then\n wait (1.5) seconds\n end\n wait (0.1) seconds\n show\n set [ghost v] effect to (0)\n start sound [count down v]\n wait (0.5) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n if <(DIE) = [1]> then\n wait until <not <(DIE) = [1]>>\n end\n end\n set [set play v] to [0]\n end\n else\n hide\n end\n switch costume to (join [number] (join (join [3] [-]) ((item (item # of [dark] in [options # v]) of [options v]) + (1))))\n end\nend\nif <(clone) = (join [key] [1])> then\n set [-175] [-115] [0] [key] [100] [99] [40]\n forever\n if <(_PLAY) = [1]> then\n show\n if <(item (item # of [key stroke] in [options # v]) of [options v]) = [1]> then\n if <<[key press v] contains (join [up] [1])?> or <[key press v] contains (join [up] [2])?>> then\n change [size vel v] by (-3)\n if <(touch) < [10]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-1)\n end\n end\n change [size vel v] by (((100) - (size)) * (0.3))\n change size by (size vel)\n set [size vel v] to ((size vel) * (0.7))\n set [brightness v] effect to (touch)\n else\n hide\n end\n else\n hide\n end\n end\nend\nif <(clone) = (join [key] [2])> then\n set [-175] [-155] [-180] [key] [100] [99] [40]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [key stroke] in [options # v]) of [options v]) = [1]> then\n show\n if <<[key press v] contains (join [down] [1])?> or <[key press v] contains (join [down] [2])?>> then\n change [size vel v] by (-3)\n if <(touch) < [10]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-1)\n end\n end\n change [size vel v] by (((100) - (size)) * (0.3))\n change size by (size vel)\n set [size vel v] to ((size vel) * (0.7))\n set [brightness v] effect to (touch)\n else\n hide\n end\n else\n hide\n end\n end\nend\nif <(clone) = (join [key] [3])> then\n set [-215] [-155] [-90] [key] [100] [99] [40]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [key stroke] in [options # v]) of [options v]) = [1]> then\n show\n if <<[key press v] contains (join [left] [1])?> or <[key press v] contains (join [left] [2])?>> then\n change [size vel v] by (-3)\n if <(touch) < [10]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-1)\n end\n end\n change [size vel v] by (((100) - (size)) * (0.3))\n change size by (size vel)\n set [size vel v] to ((size vel) * (0.7))\n set [brightness v] effect to (touch)\n else\n hide\n end\n else\n hide\n end\n end\nend\nif <(clone) = (join [key] [4])> then\n set [-135] [-155] [90] [key] [100] [99] [40]\n forever\n if <(_PLAY) = [1]> then\n if <(item (item # of [key stroke] in [options # v]) of [options v]) = [1]> then\n show\n if <<[key press v] contains (join [right] [1])?> or <[key press v] contains (join [right] [2])?>> then\n change [size vel v] by (-3)\n if <(touch) < [10]> then\n change [touch v] by (5)\n end\n else\n if <(touch) > [0]> then\n change [touch v] by (-1)\n end\n end\n change [size vel v] by (((100) - (size)) * (0.3))\n change size by (size vel)\n set [size vel v] to ((size vel) * (0.7))\n set [brightness v] effect to (touch)\n else\n hide\n end\n else\n hide\n end\n end\nend\nif <(clone) = [dark]> then\n set [0] [0] [90] [dark] [100] [99] [60]\n forever\n if <(item (item # of [dark] in [options # v]) of [options v]) = [1]> then\n show\n else\n hide\n end\n end\nend\n\ndefine clones\nclone (join [options] [1])\nclone (join [options] [2])\nclone (join [checkbox] [1])\nclone (join [checkbox] [2])\nclone (join [checkbox] [3])\nclone (join [checkbox] [4])\nclone (join [checkbox] [5])\nclone (join [number] [1])\nclone (join [number] [2])\nclone (join [number] [3])\nclone (join [key] [1])\nclone (join [key] [2])\nclone (join [key] [3])\nclone (join [key] [4])\nclone [dark]\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [buttons v]\nclones\n\n@wr\n\nwhen I receive [setup v]\nhide\n\nwhen I start as a clone\nrepeat until <(_PLAY) = [1]>\n if <(SHOW WR) = [1]> then\n print [-225] [-105] [100] [13] (digit) (record)\n if <(CHAPTER) = [1]> then\n set [record v] to (☁ WR1)\n end\n if <(CHAPTER) = [2]> then\n set [record v] to (☁ WR2)\n end\n if <(CHAPTER) = [3]> then\n set [record v] to (☁ WR3)\n end\n set [ghost v] effect to (WR GHOST)\n else\n hide\n end\nend\ndelete this clone\n\ndefine clones\nset [digit v] to [1]\nrepeat (10)\n create clone of (_myself_ v)\n change [digit v] by (1)\nend\n\ndefine print (x) (y) (size) (space) (var1) (var2)\nset size to (size) %\ngo to x: (((var1) * (space)) + (x)) y: (y)\nif <(length of (var2)) < (var1)> then\n hide\nelse\n switch costume to (letter (var1) of (var2))\n show\nend\n\nwhen I receive [start v]\nclones\n\n@platformes\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [0] [0] [1]\n clone [340] [0] [2]\n clone [600] [0] [3]\n clone [600] [400] [4]\n clone [-400] [0] [5]\n clone [1150] [0] [6]\n clone [1650] [0] [7]\n clone [2200] [0] [8]\n clone [2650] [0] [9]\n clone [3300] [0] [10]\n clone [3800] [0] [11]\n clone [4200] [0] [12]\nend\nif <(CHAPTER) = [2]> then\n clone [0] [0] [1]\n clone [600] [0] [2]\n clone [-650] [0] [3]\n clone [1100] [0] [4]\n clone [1600] [0] [5]\n clone [2000] [0] [6]\n clone [2500] [0] [7]\n clone [3100] [0] [8]\nend\nif <(CHAPTER) = [3]> then\n clone [0] [0] [1]\n clone [400] [0] [2]\n clone [600] [0] [3]\nend\nset [x v] to [-99999]\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\ndefine clone (x) (y) (id)\nset [x v] to (x)\nset [y v] to (y)\nswitch costume to (join (join [platform] (join (CHAPTER) [-])) (id))\ncreate clone of (_myself_ v)\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [setup v]\nhide\n\n@text\n\ndefine clone (x) (y) (id)\nset [x v] to (x)\nset [y v] to (y)\nswitch costume to (join (join [text] (join (CHAPTER) [-])) (id))\nset size to (80) %\ngo to [back v] layer\nset [ghost v] effect to (40)\ncreate clone of (_myself_ v)\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [50] [100] [1]\n clone [700] [120] [2]\n clone [650] [580] [3]\n clone [1070] [100] [4]\n clone [1425] [70] [5]\n clone [1750] [60] [6]\n clone [1930] [80] [7]\n clone [2860] [100] [8]\n clone [3950] [80] [9]\nend\nif <(CHAPTER) = [2]> then\n clone [100] [80] [1]\n clone [400] [90] [2]\n clone [-200] [120] [3]\n clone [-500] [60] [4]\n clone [900] [170] [5]\n clone [2300] [90] [7]\nend\nif <(CHAPTER) = [3]> then\n clone [-100] [80] [1]\n clone [200] [130] [2]\nend\nset [x v] to [-99999]\n\nwhen I receive [game reset v]\ndelete this clone\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\nwhen I receive [setup v]\nhide\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\n@spike\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\ndefine pos (x) (y)\nif <(id) = (join [spike] [1])> then\n set [move v] to [0]\n turn right (3) degrees\n switch costume to (spike v)\n set size to (100) %\nend\nif <(id) = (join [spike] [2])> then\n set [move v] to [0]\n turn right (5) degrees\n switch costume to (spike v)\n set size to (50) %\nend\nif <(id) = (join [spike] [3])> then\n set [move v] to (([cos v] of ((timer) * (30)) ) * (60))\n turn right (3) degrees\n switch costume to (spike v)\n set size to (100) %\nend\ngo to x: ((x) + (move)) y: (y)\ngo to [back v] layer\nif <<((x) + (move)) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [-100] [80] [2]\n clone [700] [-25] [1]\n clone [1538] [127] [2]\n clone [2230] [-88] [3]\n clone [2950] [-50] [3]\n clone [3770] [-40] [1]\nend\nif <(CHAPTER) = [2]> then\n clone [-85] [-15] [2]\n clone [700] [135] [1]\n clone [1000] [-110] [2]\n clone [1150] [-110] [2]\nend\nif <(CHAPTER) = [3]> then\nend\nset [x v] to [-99999]\n\ndefine clone (x) (y) (id)\nset [x v] to (x)\nset [y v] to (y)\nset [id v] to (join [spike] (id))\ncreate clone of (_myself_ v)\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [setup v]\nhide\n\n@coin\n\nwhen I receive [setup v]\nset [coins v] to [0]\nhide\n\ndefine clone (x) (y) (id)\nset [x v] to (x)\nset [y v] to (y)\nswitch costume to (join [coin] (id))\nset [ghost v] effect to (20)\ncreate clone of (_myself_ v)\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) (((y) + (([sin v] of ((timer) * (50)) ) * (15))) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nset size to (80) %\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\nif <touching (player v)?> then\n if <(costume [name v]) = (join [coin] [1])> then\n change [coins v] by (1)\n end\n switch costume to (join [coin] [2])\nend\n\nwhen I receive [play v]\nif <(CHAPTER) = [1]> then\n clone [725] [500] [1]\n clone [-430] [110] [1]\nend\nif <(CHAPTER) = [2]> then\n clone [-820] [5] [1]\nend\nif <(CHAPTER) = [3]> then\nend\nset [x v] to [-99999]\n\n@enemy\n\nwhen I receive [setup v]\nhide\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [1050] [-23] [0]\n clone [1260] [-5] [4]\nend\nif <(CHAPTER) = [2]> then\n clone [3150] [15] [0]\nend\nif <(CHAPTER) = [3]> then\nset [x v] to [-99999]\n\ndefine clone (x) (y) (add)\nset [x v] to (x)\nset [y v] to (y)\nset [add v] to (add)\nset size to (55) %\ncreate clone of (_myself_ v)\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [tick v]\npos (((x) + (([cos v] of (((timer) + (add)) * (70)) ) * (50))) - (SCROLL X)) ((y) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\n@bounce\n\nwhen I receive [start v]\nhide\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [438] [-129]\n clone [515] [165]\n clone [1485] [6]\nend\nif <(CHAPTER) = [2]> then\n clone [1560] [-28]\n clone [2130] [-93]\nend\nif <(CHAPTER) = [3]> then\nend\nset [x v] to [-99999]\n\ndefine clone (x) (y)\nset [x v] to (x)\nset [y v] to (y)\ncreate clone of (_myself_ v)\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\ntouch\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\ndefine touch\nif <touching (player v)?> then\n switch costume to (bounce2 v)\nelse\n switch costume to (bounce1 v)\nend\n\n@water\n\nwhen I receive [setup v]\nhide\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [0] [-280] [0]\n clone [0] [-280] [0.5]\n clone [0] [-280] [1]\n clone [-300] [-270] [0]\n clone [-300] [-270] [0.5]\n clone [-300] [-270] [1]\n clone [3000] [-200] [0]\n clone [3000] [-200] [0.5]\n clone [3000] [-200] [1]\n clone [4000] [-270] [0]\n clone [4000] [-270] [0.5]\n clone [4000] [-270] [1]\nend\nif <(CHAPTER) = [2]> then\nif <(CHAPTER) = [3]> then\nset [x v] to [-99999]\n\ndefine clone (x) (y) (add)\nset [x v] to (x)\nset [y v] to (y)\nset [add v] to (add)\ncreate clone of (_myself_ v)\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) (((y) + (([sin v] of (((timer) + (add)) * (200)) ) * (20))) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nset size to (100) %\ngo [backward v] (99) layers\nset [ghost v] effect to (70)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\n@lava\n\nwhen I receive [setup v]\nhide\n\nwhen I receive [game reset v]\ndelete this clone\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\nif <(CHAPTER) = [2]> then\nend\nif <(CHAPTER) = [3]> then\n clone [300] [-300] [0]\n clone [300] [-300] [0.5]\n clone [300] [-300] [1]\n clone [300] [-300] [1.5]\nend\nset [x v] to [-99999]\n\ndefine clone (x) (y) (add)\nset [x v] to (x)\nset [y v] to (y)\nset [add v] to (add)\ncreate clone of (_myself_ v)\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) (((y) + (([sin v] of (((timer) + (add)) * (80)) ) * (25))) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nset size to (100) %\ngo [backward v] (99) layers\nset [ghost v] effect to (80)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\n\n@checkpoint\n\nwhen I receive [setup v]\ndelete all of [checkpoints1 v]\nlist [0] [0] [1]\nlist [1750] [-15] [1]\ndelete all of [checkpoints2 v]\nlist [40] [0] [2]\nlist [2055] [50] [2]\ndelete all of [checkpoints3 v]\nlist [-30] [70] [3]\nswitch costume to (join [flag] [1])\nhide\n\ndefine list (x) (y) (chapter)\nif <(chapter) = [1]> then\n add (x) to [checkpoints1 v]\n add (y) to [checkpoints1 v]\nend\nif <(chapter) = [2]> then\n add (x) to [checkpoints2 v]\n add (y) to [checkpoints2 v]\nend\nif <(chapter) = [3]> then\n add (x) to [checkpoints3 v]\n add (y) to [checkpoints3 v]\nend\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nset size to (70) %\ngo to [back v] layer\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\nif <<<touching (player v)?> and <(CHECKPOINT) = [1]>> and <(item (4) of [options v]) = [0]>> then\n change [checkpoint v] by (2)\n switch costume to (join [flag] [2])\nend\n\ndefine clone (x) (y)\nset [x v] to (x)\nset [y v] to (y)\ncreate clone of (_myself_ v)\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n clone [1750] [-30]\nend\nif <(CHAPTER) = [2]> then\n clone [2055] [45]\nend\nif <(CHAPTER) = [3]> then\nend\nset [x v] to [-99999]\n\nwhen I receive [game reset v]\ndelete this clone\n\n@finish\n\nwhen I receive [setup v]\nswitch costume to (join [flag] [1])\nhide\n\nwhen I receive [tick v]\npos ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\ndefine pos (x) (y)\ngo to x: (x) y: (y)\nset size to (120) %\ngo to [back v] layer\nif <<(x) = (x position)> and <(y) = (y position)>> then\n show\nelse\n hide\nend\nif <<touching (player v)?> and <(WIN) = [0]>> then\n set [win v] to [1]\n switch costume to (join [flag] [2])\nend\n\nwhen I receive [game setup v]\nif <(CHAPTER) = [1]> then\n set [x v] to [4200]\n set [y v] to [90]\nend\nif <(CHAPTER) = [2]> then\nif <(CHAPTER) = [3]> then\n\nwhen I receive [game reset v]\nhide\n\n@particles\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [setup v]\nhide\n\nwhen I receive [start v]\nset [clone v] to [1]\nrepeat until <(_PLAY) = [1]>\n create clone of (_myself_ v)\n wait (pick random (0) to (0.2)) seconds\nend\n\nwhen I start as a clone\nif <(clone) = [1]> then\n set [speed v] to (pick random (0.5) to (10))\n show\n set [-235] (pick random (-170) to (170)) [90] (join [dot] ((CHAPTER) * <(CHAPTER) < ((CHPT MAX) + (1))>)) (pick random (50) to (100)) [-99] (pick random (80) to (90))\n repeat until <<(x position) > [235]> or <(_PLAY) = [1]>>\n change x by (speed)\n end\n delete this clone\nelse\n set [speed v] to (pick random (10) to (15))\n show\n set [235] (pick random (-170) to (170)) [90] (join [dot] [2]) (pick random (80) to (100)) [-99] (pick random (90) to (95))\n set [y v] to (y position)\n repeat until <<(x position) < [-235]> or <(WIN) = [1]>>\n change x by ((speed) * (-1))\n set y to ((y) - (SCROLL Y))\n end\n delete this clone\nend\n\nwhen I receive [play v]\nif <(CHAPTER) = [2]> then\n set [clone v] to [2]\n repeat until <(WIN) = [1]>\n create clone of (_myself_ v)\n wait (pick random (0.5) to (1)) seconds\n end\nend\n\n@background\n\nwhen I receive [setup v]\nerase all\nset [-240] [0] [90] (join [grid] ((item (2) of [options v]) + (1))) [100] [999] [96]\nhide\n\ndefine grid (xl) (yl) (change)\ngo to x: (xl) y: (yl)\nrepeat (((yl) / (10)) + (1))\n repeat (((xl) / (10)) + (1))\n stamp\n change x by ((change) * (-1))\n end\n set x to (xl)\n change y by ((change) * (-1))\nend\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [start v]\nshow\nforever\n if <(item (1) of [options v]) = [1]> then\n erase all\n switch costume to (join [grid] ((item (2) of [options v]) + (1)))\n grid [240] [180] [20.01]\n end\nend\n\n@intro\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [intro v]\nforever\n if <(INTRO) > [-1]> then\n if <(clone) = [1]> then\n if <(INTRO) = ((5) * (30))> then\n start sound [dont leave me v]\n set size to (100) %\n end\n change [intro v] by (-1)\n show\n else\n if <(INTRO) < [105]> then\n if <(INTRO) < [7]> then\n change [intro size v] by ((((10) - (size)) * (0.3)) + (round ((INTRO) * (0.1))))\n point in direction (((90) - (0.5)) + ((pick random (((INTRO) / (17)) * (-1)) to ((INTRO) / (17))) * (0.4)))\n set [ghost v] effect to (round (((1) - ((size) / (100))) * (100)))\n else\n change [intro size v] by ((((55) - (size)) * (0.5)) + (round ((INTRO) * (0.15))))\n point in direction (((90) - (2)) + ((pick random (((INTRO) / (10)) * (-1)) to ((INTRO) / (10))) * (0.5)))\n set [ghost v] effect to (0)\n end\n set x to (pick random (((INTRO) / (10)) * (-1)) to ((INTRO) / (10)))\n set y to (pick random (((INTRO) / (10)) * (-1)) to ((INTRO) / (10)))\n change size by ((INTRO SIZE) + (pick random (-5) to (5)))\n set [intro size v] to ((INTRO SIZE) * (0.6))\n if <(INTRO) = [104]> then\n change size by (25)\n end\n if <(INTRO) = [65]> then\n change size by (30)\n end\n if <(INTRO) = [19]> then\n change size by (10)\n end\n if <(INTRO) = [12]> then\n change [intro size v] by ((INTRO) / ((1) / (4)))\n end\n show\n else\n hide\n end\n end\n set volume to ((round (((INTRO) / (4)) + (45))) * (V MUS)) %\n else\n hide\n end\nend\n\nwhen I start as a clone\nset [clone v] to [2]\nset [0] [0] ((90) - (0.5)) [logo] [100] [99] [0]\nhide\n\nwhen I receive [setup v]\nstop all sounds\nset volume to (0) %\nset [intro v] to ((5) * (30))\nset [clone v] to [1]\nset [0] [0] [90] [background] [100] [99] [0]\ncreate clone of (_myself_ v)\n\nwhen I receive [intro v]\nrepeat until <(INTRO) < [0]>\n if <key (space v) pressed?> then\n stop all sounds\n set [intro v] to [0]\n end\nend\n\n@love + fav\n\nwhen I receive [setup v]\nset [-190] [180] [90] [pop up] [50] [99] [20]\nset [tick v] to [0]\nhide\n\nwhen I receive [start v]\nwait (0.5) seconds\nshow\nforever\n set y to ((320) - ([abs v] of (([sin v] of (((tick) / (60)) * (40)) ) * (200)) ))\n set size to (([abs v] of (([sin v] of (((tick) / (60)) * (40)) ) * (200)) ) - (130)) %\n set [ghost v] effect to (round (((y position) * (2)) - (230)))\n change [tick v] by (1)\nend\n\ndefine set (x) (y) (dir) (costume) (size) (layer) (ghost)\ngo to x: (x) y: (y)\npoint in direction (dir)\nswitch costume to (costume)\nset size to (size) %\ngo [forward v] (layer) layers\nset [ghost v] effect to (ghost)\n\nwhen I receive [play v]\nhide\n\n
Ninja Platformer
@Stage\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n switch backdrop to (background1 v)\n else\n switch backdrop to (background2 v)\n end\nend\n\nwhen I receive [start v]\nforever\n if <key (n v) pressed?> then\n if <(night) = [0]> then\n set [night v] to [1]\n wait (0.5) seconds\n else\n set [night v] to [0]\n wait (0.5) seconds\n end\n end\nend\n\nwhen I receive [start v]\nforever\n if <key (p v) pressed?> then\n change [time v] by (1)\n wait (0.2) seconds\n end\nend\n\nwhen flag clicked\nforever\n if <(music) = [1]> then\n play sound [Anamanaguchi - A v] until done\n set [music v] to [2]\n end\n if <(music) = [2]> then\n play sound [Anamanaguchi - H v] until done\n set [music v] to [3]\n end\n if <(music) = [3]> then\n play sound [tylerk_-_thats_e v] until done\n set [music v] to [4]\n end\n if <(music) = [4]> then\n play sound [Anamanaguchi - A1 v] until done\n set [music v] to [1]\n end\nend\n\nwhen I receive [start v]\nset [time v] to [2]\nset [yvel v] to [0]\nset [score v] to [0]\nset [changed v] to [1]\n\nwhen flag clicked\nbroadcast (Start v)\n\nwhen flag clicked\nforever\n if <(Score) > (Hi-Score)> then\n set [hi-score v] to (Score)\n end\nend\n\nwhen flag clicked\nset [local hi-score v] to [0]\nset [night v] to [0]\nset [score v] to [0]\nset [hi-score v] to [0]\nset [music v] to (pick random (1) to (4))\n\nwhen I receive [start v]\nforever\n if <key (m v) pressed?> then\n if <(volume) = [0]> then\n change volume by (100)\n wait (0.5) seconds\n else\n change volume by (-100)\n wait (0.5) seconds\n end\n end\nend\n\nwhen flag clicked\nforever\n if <(Score) > (Local Hi-Score)> then\n set [local hi-score v] to (Score)\n end\nend\n\n@Ninja\n\nwhen I receive [start v]\nforever\n if <<touching (platform1 v)?> and <(y position) < (p1ypos)>> then\n set [yvel v] to [-5]\n end\nend\n\nwhen I receive [start v]\nforever\n if <<touching (platform2 v)?> and <(y position) < (p2ypos)>> then\n set [yvel v] to [-5]\n end\nend\n\nwhen I receive [start v]\nforever\n if <<<touching (platform1 v)?> and <(y position) > (p1ypos)>> or <<<touching (platform2 v)?> and <(y position) > (p2ypos)>> or <<touching (platform3 v)?> and <(y position) > (p3ypos)>>>> then\n set [yvel v] to [9]\n else\n change [yvel v] by (-1)\n end\nend\n\nwhen I receive [start v]\nforever\n if <<touching (platform1 v)?> and <(y position) > (p1ypos)>> then\n set [jump v] to [0]\n end\nend\n\nwhen I receive [start v]\nforever\n if <(y position) < [-170]> then\n if <(Hi-Score) > (☁ Hi-Score)> then\n set [☁ hi-score v] to (Hi-Score)\n end\n broadcast (Start v)\n end\nend\n\nwhen I receive [start v]\nforever\n if <<<key (space v) pressed?> or <key (w v) pressed?>> or <key (up arrow v) pressed?>> then\n if <<(jump) < [2]> and <key (space v) pressed?>> then\n set [yvel v] to [12]\n change [jump v] by (1)\n wait until <not <key (space v) pressed?>>\n end\n if <<(jump) < [2]> and <key (w v) pressed?>> then\n set [yvel v] to [12]\n change [jump v] by (1)\n wait until <not <key (w v) pressed?>>\n end\n if <<(jump) < [2]> and <key (up arrow v) pressed?>> then\n set [yvel v] to [12]\n change [jump v] by (1)\n wait until <not <key (up arrow v) pressed?>>\n end\n end\nend\n\nwhen I receive [start v]\nforever\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change x by (-10)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change x by (10)\n end\nend\n\nwhen I receive [start v]\nforever\n set [ypos v] to (y position)\nend\n\nwhen I receive [start v]\nforever\n change y by (yvel)\nend\n\nwhen I receive [start v]\ngo to [front v] layer\ngo to x: (0) y: (60)\n\nwhen I receive [start v]\nforever\n turn right (10) degrees\nend\n\nwhen I receive [start v]\nforever\n if <<<touching (platform1 v)?> and <(y position) > (p1ypos)>> or <<<touching (platform2 v)?> and <(y position) > (p2ypos)>> or <<touching (platform3 v)?> and <(y position) > (p3ypos)>>>> then\n change [score v] by (10)\n wait until <not <<<touching (platform1 v)?> and <(y position) > (p1ypos)>> or <<<touching (platform2 v)?> and <(y position) > (p2ypos)>> or <<touching (platform3 v)?> and <(y position) > (p3ypos)>>>>>\n end\nend\n\nwhen I receive [start v]\nforever\n if <<touching (platform3 v)?> and <(y position) > (p3ypos)>> then\n set [jump v] to [0]\n end\nend\n\nwhen I receive [start v]\nforever\n if <<touching (platform3 v)?> and <(y position) < (p3ypos)>> then\n set [yvel v] to [-5]\n end\nend\n\nwhen I receive [start v]\nforever\n if <(y position) > [175]> then\n set [yvel v] to [-5]\n end\nend\n\nwhen I receive [start v]\nforever\n if <(yvel) < [-15]> then\n set [yvel v] to [-15]\n end\nend\n\nwhen I receive [start v]\nforever\n if <<touching (platform2 v)?> and <(y position) > (p2ypos)>> then\n set [jump v] to [0]\n end\nend\n\nwhen I receive [start v]\nforever\n if <(night) = [0]> then\n switch costume to (costume1 v)\n else\n switch costume to (costume2 v)\n end\nend\n\nwhen this sprite clicked\nsay [Thank you for playing! Have fun and feel free to leave feedback!] for (5) seconds\n\n@Silver\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen flag clicked\ngo to [front v] layer\nforever\n turn right (-15) degrees\nend\n\nwhen I receive [start v]\nhide\ngo to x: (-500) y: (-500)\nwait (10) seconds\nforever\n wait (pick random (5) to (10)) seconds\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to (150))\n show\n wait until <touching (ninja v)?>\n go to x: (-500) y: (-500)\n change [score v] by (100)\n start sound [collectcoin v]\n hide\nend\n\n@Gold\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen flag clicked\ngo to [front v] layer\nforever\n turn right (-15) degrees\nend\n\nwhen I receive [start v]\nhide\ngo to x: (-500) y: (-500)\nwait (20) seconds\nforever\n if <not <touching (ninja v)?>> then\n wait (pick random (10) to (15)) seconds\n go to x: (240) y: (pick random (-160) to (160))\n show\n glide (3) secs to x: (-240) y: (y position)\n hide\n end\nend\n\nwhen I receive [start v]\nforever\n if <touching (ninja v)?> then\n go to x: (-500) y: (-500)\n change [score v] by (300)\n start sound [collectcoin v]\n hide\n end\nend\n\n@Red\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen flag clicked\ngo to [front v] layer\nforever\n turn right (-15) degrees\nend\n\nwhen I receive [start v]\nhide\ngo to x: (-500) y: (-500)\nwait (30) seconds\nforever\n if <not <touching (ninja v)?>> then\n wait (pick random (15) to (20)) seconds\n go to x: (pick random (-200) to (200)) y: (175)\n show\n glide (2) secs to x: (x position) y: (-181)\n hide\n end\nend\n\nwhen I receive [start v]\nforever\n if <touching (ninja v)?> then\n broadcast (Start v)\n end\nend\n\n@Platform1\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen I receive [start v]\nforever\n set [p1ypos v] to (y position)\nend\n\nwhen I receive [start v]\nforever\n if <(y position) > [120]> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\n if <<touching (platform3 v)?> or <touching (platform2 v)?>> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\nend\n\nwhen I receive [start v]\ngo to x: (-80) y: (-50)\n\nwhen I receive [start v]\nforever\n wait until <(Changed) = [1]>\n wait ((7) / (time)) seconds\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (25)))\n change [time v] by (0.2)\n set [changed v] to [2]\nend\n\n@Platform2\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen I receive [start v]\nforever\n set [p2ypos v] to (y position)\nend\n\nwhen I receive [start v]\ngo to x: (80) y: (-50)\n\nwhen I receive [start v]\nforever\n wait until <(Changed) = [2]>\n wait ((7) / (time)) seconds\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n change [time v] by (0.2)\n set [changed v] to [3]\nend\n\nwhen I receive [start v]\nforever\n if <(y position) > [120]> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\n if <<touching (platform1 v)?> or <touching (platform3 v)?>> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\nend\n\n@Platform3\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n set [brightness v] effect to (0)\n else\n set [brightness v] effect to (-25)\n end\nend\n\nwhen I receive [start v]\nforever\n set [p3ypos v] to (y position)\nend\n\nwhen I receive [start v]\ngo to x: (0) y: (40)\n\nwhen I receive [start v]\nforever\n wait until <(Changed) = [3]>\n wait ((7) / (time)) seconds\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n change [time v] by (0.2)\n set [changed v] to [1]\nend\n\nwhen I receive [start v]\nforever\n if <(y position) > [120]> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\n if <<touching (platform1 v)?> or <touching (platform2 v)?>> then\n go to x: (pick random (-200) to (200)) y: (pick random (-150) to ((ypos) + (80)))\n end\nend\n\n@Cloud1\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n switch costume to (costume1 v)\n else\n switch costume to (costume2 v)\n end\nend\n\nwhen flag clicked\nshow\ngo [backward v] (100) layers\ngo to x: (pick random (-170) to (170)) y: (pick random (15) to (170))\nforever\n change x by (-1)\n wait (0.2) seconds\nend\n\nwhen flag clicked\nforever\n if <(x position) < [-235]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (pick random (3) to (5)) seconds\n go to x: (240) y: (pick random (15) to (140))\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\nend\n\n@Cloud2\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n switch costume to (costume1 v)\n else\n switch costume to (costume2 v)\n end\nend\n\nwhen flag clicked\nshow\ngo [backward v] (100) layers\ngo to x: (pick random (-170) to (170)) y: (pick random (15) to (170))\nforever\n change x by (-1)\n wait (0.3) seconds\nend\n\nwhen flag clicked\nforever\n if <(x position) < [-235]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (pick random (3) to (5)) seconds\n go to x: (240) y: (pick random (15) to (140))\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\nend\n\n@Cloud3\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n switch costume to (costume1 v)\n else\n switch costume to (costume2 v)\n end\nend\n\nwhen flag clicked\nforever\n if <(x position) < [-235]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (pick random (3) to (5)) seconds\n go to x: (240) y: (pick random (15) to (140))\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\nend\n\nwhen flag clicked\ngo [backward v] (100) layers\nshow\ngo to x: (pick random (-170) to (170)) y: (pick random (15) to (170))\nforever\n change x by (-1)\n wait (0.5) seconds\nend\n\n@Moon\n\nwhen flag clicked\nforever\n repeat until <(y position) > [165]>\n change y by (1)\n wait (15) seconds\n end\n repeat until <(y position) < [86]>\n change y by (-1)\n wait (15) seconds\n end\nend\n\nwhen flag clicked\nforever\n if <<touching (cloud1 v)?> or <<touching (cloud2 v)?> or <touching (cloud3 v)?>>> then\n go [backward v] (1) layers\n end\nend\n\nwhen flag clicked\nforever\n if <(night) = [0]> then\n hide\n else\n show\n end\nend\n\nwhen flag clicked\nforever\n if <(x position) > [235]> then\n hide\n wait (pick random (0) to (0)) seconds\n go to x: (-240) y: (85)\n show\n end\nend\n\nwhen flag clicked\ngo to x: (-240) y: (85)\nforever\n change x by (1)\n wait (5) seconds\nend\n\nwhen this sprite clicked\nsay [I hope you enjoy my game! Thank you for playing!] for (5) seconds\n\n
CONTROLS:\n\nW, Space, or Up Arrow - Jump\n\nA or Left Arrow - Move Left\n\nD or Right Arrow - Move Right\n\nM - Toggle Sound\n\nN - Night/Day Mode\n\nP - Increase the Speed the Platforms Move\n\nINSTRUCTIONS:\n\n~Objective is to stay on the platforms as long as you can.\n\n~Get points by bouncing or collecting gold and silver pieces.\n\n~Red pieces will kill you.\n\n~Touching blue kills you.\n\n~Platforms move randomly.\n\n~You can double jump.
Being Red - A platformer/scroller
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop2 v)\nset [level v] to [1]\n\nwhen I receive [start_game v]\nforever\n play sound [Here Comes a Thought - Steven Universe Karaoke \[Official Instrumental\] \(320 kbps\).mp3 v] until done\nend\n\n@Thumbnail\n\nwhen flag clicked\nset [level v] to [1]\nforever\n go to x: (0) y: (0)\n go to [front v] layer\n set [ghost v] effect to (100)\nend\n\nwhen flag clicked\nforever\n if <(level) = [11]> then\n stop [all v]\n end\nend\n\nset [space v] to [0]\nchange [space v] by (1)\n\n@Game Intro\n\nwhen flag clicked\nset [intro_id v] to [0]\nhide\nbroadcast (intro v)\n\nwhen I receive [intro v]\nrepeat (2)\n create clone of (_myself_ v)\n change [intro_id v] by (1)\nend\n\nwhen I start as a clone\nif <(Intro_ID) = [1]> then\n show\n go to x: (0) y: (0)\n go to [front v] layer\n go [backward v] (999) layers\n forever\n if <(space) = [1]> then\n switch costume to (1 v)\n end\n if <(space) = [2]> then\n switch costume to (3 v)\n wait until <key (space v) pressed?>\n broadcast (start_game v)\n wait until <not <key (space v) pressed?>>\n stop [this script v]\n end\n end\nelse\n if <(Intro_ID) = [2]> then\n show\n set [ghost v] effect to (100)\n go to [front v] layer\n go to x: (0) y: (0)\n switch costume to (2 v)\n wait (3.6) seconds\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (2) seconds\n repeat (10)\n change [ghost v] effect by (10)\n end\n wait (2) seconds\n broadcast (start_game v)\n else\n end\nend\n\nwhen I receive [start_game v]\nstop [other scripts in sprite v]\nhide\n\n@Player\n\nwhen flag clicked\nset [scroll v] to [1]\ngo to x: (-175) y: (-122)\npoint in direction (90)\nset [y-velocity v] to [0]\nset [x-velocity v] to [0]\nhide\n\ndefine None\nset rotation style [left-right v]\nif <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x-velocity v] by (running speed)\n point in direction (90)\nend\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x-velocity v] by ((running speed) * (-1))\n point in direction (-90)\nend\nset [x-velocity v] to ((X-Velocity) * (friction))\nchange x by (X-Velocity)\nif <touching (platform v)?> then\n set [slope v] to [0]\n repeat until <<(Slope) = [8]> or <not <touching (platform v)?>>>\n change [slope v] by (1)\n change y by (1)\n end\n if <touching (platform v)?> then\n change y by ((Slope) * (-1))\n repeat ([ceiling v] of ([abs v] of (X-Velocity) ) )\n if <touching (platform v)?> then\n repeat (10)\n change x by ((([abs v] of (X-Velocity) ) / (X-Velocity)) * (-1))\n end\n end\n end\n set [x-velocity v] to [0]\n end\nend\nchange y by (Y-Velocity)\nif <touching (platform v)?> then\n repeat ([ceiling v] of ([abs v] of (Y-Velocity) ) )\n if <touching (platform v)?> then\n change y by ((([abs v] of (Y-Velocity) ) / (Y-Velocity)) * (-1))\n end\n end\n if <<(([abs v] of (Y-Velocity) ) / (Y-Velocity)) = [-1]> and <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <key (space v) pressed?>>> then\n set [y-velocity v] to (jump/height)\n else\n set [y-velocity v] to [0]\n end\nelse\n change [y-velocity v] by (-1)\nend\nswitch costume to (idle v)\nif <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n switch costume to (Walk)\nend\nif <(Y-Velocity) > [2]> then\n switch costume to (jump v)\nend\nif <(Y-Velocity) < [-3]> then\n switch costume to (fall v)\nend\nif <(scroll) = [2]> then\n set [x-velocity v] to ((X-Velocity) * (friction))\n switch costume to (idle v)\n if <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n switch costume to (Walk)\n end\n if <(Y-Velocity) > [2]> then\n switch costume to (jump v)\n end\n if <(Y-Velocity) < [-3]> then\n switch costume to (fall v)\n end\n set rotation style [left-right v]\n change [scroll x v] by ((x position) * (-1))\n change [scroll y v] by ((y position) * (-1))\n go to x: (0) y: (0)\nend\n\nwhen flag clicked\nset [walk v] to [5]\nforever\n change [walk v] by (1)\n if <(Walk) > [8]> then\n set [walk v] to [5]\n end\n wait (0.1) seconds\nend\n\nwhen I receive [start_game v]\nwait (2.5) seconds\nswitch backdrop to (backdrop1 v)\nshow\nset [scroll v] to [1]\nforever\n Platform (11.5) (-1) (0.7) (3)\nend\n\nwhen flag clicked\nforever\n if <touching (door v)?> then\n go to x: (-175) y: (-109)\n point in direction (90)\n change [level v] by (1)\n broadcast (scroll set v)\n set [y-velocity v] to [0]\n set [x-velocity v] to [0]\n end\n if <touching (spikes v)?> then\n if <(scroll) = [1]> then\n go to x: (-175) y: (-109)\n point in direction (90)\n set [y-velocity v] to [0]\n set [x-velocity v] to [0]\n end\n if <(scroll) = [2]> then\n go to x: (0) y: (0)\n point in direction (90)\n set [y-velocity v] to [0]\n set [x-velocity v] to [0]\n set [scroll x v] to [0]\n set [scroll y v] to [0]\n end\n end\nend\n\nwhen I receive [scroll set v]\nif <(level) = [8]> then\n go to x: (-175) y: (-109)\nend\n\n@Platform\n\nwhen flag clicked\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [level v] to [1]\nset [scroll v] to [1]\nhide\n\nwhen I receive [start_game v]\nhide\nset [space v] to [2]\nwait (2.5) seconds\nshow\nforever\n if <(scroll) = [2]> then\n go to x: (scroll x) y: (scroll y)\n switch costume to (level)\n else\n go to x: (0) y: (0)\n switch costume to (level)\n end\nend\n\nwhen I receive [scroll set v]\nset [scroll y v] to [0]\nset [scroll x v] to [0]\nif <(level) > [4]> then\n set [scroll v] to [1]\nend\nif <(level) = [5]> then\n set [scroll v] to [2]\nend\nif <(level) = [6]> then\n set [scroll v] to [2]\nend\nif <(level) = [7]> then\n set [scroll v] to [2]\nend\nif <(level) = [8]> then\n set [scroll v] to [1]\nend\nif <(level) = [10]> then\n set [scroll v] to [2]\nend\n\n@Spikes\n\nwhen flag clicked\nset [level v] to [1]\nforever\n go to x: (0) y: (0)\n switch costume to (level)\nend\n\nwhen flag clicked\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [level v] to [1]\nset [scroll v] to [1]\n\nwhen I receive [start_game v]\nhide\nset [space v] to [2]\nwait (2.5) seconds\nshow\nforever\n if <(scroll) = [2]> then\n go to x: (scroll x) y: (scroll y)\n switch costume to (level)\n else\n go to x: (0) y: (0)\n switch costume to (level)\n end\nend\n\n@Door\n\nwhen flag clicked\nhide\nset [level v] to [1]\nforever\n go to x: (0) y: (0)\n switch costume to (level)\nend\n\nwhen I receive [start_game v]\nhide\nset [space v] to [2]\nwait (2.5) seconds\nshow\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [level v] to [1]\nset [scroll v] to [1]\nforever\n if <(scroll) = [2]> then\n go to x: (scroll x) y: (scroll y)\n switch costume to (level)\n else\n go to x: (0) y: (0)\n switch costume to (level)\n end\nend\n\n@Text\n\nwhen flag clicked\nset [level v] to [1]\nforever\n go [backward v] (88) layers\n go to x: (0) y: (0)\n switch costume to (level)\nend\n\nwhen I receive [start_game v]\nhide\nset [space v] to [2]\nwait (2.5) seconds\nshow\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [level v] to [1]\nset [scroll v] to [1]\nforever\n if <(scroll) = [2]> then\n go to x: (scroll x) y: (scroll y)\n switch costume to (level)\n else\n go to x: (0) y: (0)\n switch costume to (level)\n end\nend\n\n@Scroller Screen\n\nwhen flag clicked\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [level v] to [1]\nset [scroll v] to [1]\nforever\n go to x: (0) y: (0)\n if <(scroll) = [2]> then\n show\n else\n hide\n end\nend\n\n
W,A,D and Left, Right, Up to Move, Jump\n\nSpace to Jump To.\nGet to the door.
100% Pen Platformer [Engine]
@Stage\n\n@pen\n\nwhen flag clicked\nCreate Level\nset [xv v] to [0]\nset [yv v] to [0]\nset [x position v] to [0]\nset [y position v] to [0]\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nforever\n Draw\n Update\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change [x position v] by (Xv)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [x position v] by ((Xv) * (-1))\n change [y position v] by (-5)\n \n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n Update\n change [yv v] by (-1)\n change [y position v] by (Yv)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by ((Yv) * (-1))\n set [yv v] to [0]\n end\n Update\n change [y position v] by (-1)\n Update\n if <[touching v] contains [1]?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [15]\n end\n end\n Update\n if <[touching v] contains [2]?> then\n set [yv v] to [20]\n end\n Update\n if <<[touching v] contains [3]?> or <(Scroll Y) > [500]>> then\n set [xv v] to [0]\n set [yv v] to [0]\n set [x position v] to [0]\n set [y position v] to [0]\n set [scroll x v] to [0]\n set [scroll y v] to [0]\n end\n Update\n change [y position v] by (1)\n Scrolling\nend\n\ndefine Go To (x) (y)\ngo to x: ((x) + (Scroll X)) y: ((y) + (Scroll Y))\n\ndefine Scrolling\nchange [scroll x v] by (() - (round ((x position) / (10))))\nchange [x position v] by (() - (round ((x position) / (10))))\nchange [scroll y v] by (() - (round ((y position) / (10))))\nchange [y position v] by (() - (round ((y position) / (10))))\n\nwhen flag clicked\nforever\n Update\nend\n\ndefine Update\ndelete (all) of [touching v]\nset [i v] to [0]\nrepeat (length of [level xs v])\n change [i v] by (1)\n if <<<(x position) < (((item (i) of [level xs v]) + (Scroll X)) + (item (i) of [level widths v]))> and <((x position) + (20)) > ((item (i) of [level xs v]) + (Scroll X))>> and <<(y position) < (((item (i) of [level ys v]) + (Scroll Y)) + (item (i) of [level heights v]))> and <((y position) + (20)) > ((item (i) of [level ys v]) + (Scroll Y))>>> then\n if <not <[touching v] contains (item (i) of [level types v])?>> then\n add (item (i) of [level types v]) to [touching v]\n end\n end\nend\n\ndefine Create Level\ndelete (all) of [level xs v]\ndelete (all) of [level ys v]\ndelete (all) of [level widths v]\ndelete (all) of [level heights v]\ndelete (all) of [level types v]\nAdd Rectangle (-150) (-50) (300) (25) (1)\nAdd Rectangle (150) (-50) (50) (25) (2)\nAdd Rectangle (200) (-50) (25) (150) (1)\nAdd Rectangle (225) (75) (50) (25) (1)\nAdd Rectangle (275) (50) (50) (25) (1)\nAdd Rectangle (325) (25) (50) (25) (1)\nAdd Rectangle (375) (0) (75) (25) (1)\nAdd Rectangle (450) (0) (50) (20) (3)\nAdd Rectangle (500) (0) (50) (25) (1)\nAdd Rectangle (550) (0) (50) (20) (3)\nAdd Rectangle (600) (0) (125) (25) (1)\nAdd Rectangle (725) (0) (25) (75) (3)\nAdd Rectangle (725) (150) (25) (25) (3)\nAdd Rectangle (750) (0) (50) (25) (2)\nAdd Rectangle (675) (150) (50) (25) (2)\nAdd Rectangle (800) (0) (25) (275) (1)\nAdd Rectangle (825) (250) (100) (25) (1)\n\ndefine Draw\npen up\nerase all\nset pen size to (5)\nset [i v] to [0]\nrepeat (length of [level xs v])\n change [i v] by (1)\n if <<<((Scroll Y) + (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))) > [-180]> and <((Scroll Y) + ((item (i) of [level ys v]) + (5))) < [240]>> and <<((Scroll X) + (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5))) > [-240]> and <((Scroll X) + ((item (i) of [level xs v]) + (5))) < [240]>>> then\n Go To ((item (i) of [level xs v]) + (5)) ((item (i) of [level ys v]) + (5))\n set pen color to (#000000)\n if <(item (i) of [level types v]) = [2]> then\n set pen color to (#2ca5e2)\n end\n if <(item (i) of [level types v]) = [1]> then\n set pen color to (#ffffff)\n end\n if <(item (i) of [level types v]) = [3]> then\n set pen color to (#ff0000)\n end\n pen down\n Go To (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5)) ((item (i) of [level ys v]) + (5))\n Go To (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5)) (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))\n Go To ((item (i) of [level xs v]) + (5)) (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))\n Go To ((item (i) of [level xs v]) + (5)) ((item (i) of [level ys v]) + (5))\n pen up\n end\nend\nset pen color to (#ee7d16)\ngo to x: (x position) y: (y position)\npen down\ngo to x: (x position) y: ((y position) + (20))\ngo to x: ((x position) + (20)) y: ((y position) + (20))\ngo to x: ((x position) + (20)) y: (y position)\ngo to x: (x position) y: (y position)\npen up\n\ndefine Add Rectangle (x) (y) (width) (height) (tyoe)\nadd (x) to [level xs v]\nadd (y) to [level ys v]\nadd (width) to [level widths v]\nadd (height) to [level heights v]\nadd (tyoe) to [level types v]\n\n
AntiGravity: A Platformer
@Stage\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset size to (100) %\nhide\ngo to [front v] layer\n\nshow\n\nset [ghost v] effect to (100)\n\nwhen flag clicked\nforever\n go to [front v] layer\nend\n\nmove (10) steps\ngo to x: (0) y: (0)\n\n@Sprite1\n\nwhen I receive [play v]\npoint in direction (90)\nclear graphic effects\ngo to x: (-200) y: (-110)\nswitch backdrop to (backdrop2 v)\nshow\ngo to [front v] layer\nswitch costume to (costume1 v)\nset size to (60) %\n\nwhen flag clicked\nset [level v] to [0]\n\nforever\nend\n\nwhen I receive [play v]\nset [gravity v] to [1]\nset [timer v] to [0]\nforever\n if <(Gravity) = [1]> then\n if <(timer) < [1]> then\n if <key (space v) pressed?> then\n switch costume to (costume2 v)\n broadcast (switched v)\n set [gravity v] to [2]\n set [timer v] to [18]\n repeat until <(timer) < [1]>\n wait (0.067999) seconds\n change [timer v] by (-1)\n end\n end\n end\n end\n if <(Gravity) = [2]> then\n if <(timer) < [1]> then\n if <key (space v) pressed?> then\n switch costume to (costume1 v)\n broadcast (switched v)\n set [gravity v] to [1]\n set [timer v] to [18]\n repeat until <(timer) < [1]>\n wait (0.067999) seconds\n change [timer v] by (-1)\n end\n end\n end\n end\nend\n\nwhen I receive [play v]\n\nwhen I receive [play v]\nforever\n if <(Gravity) = [1]> then\n change [yv v] by (-0.5)\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n set [xv v] to ((xv) * (0.8))\n change x by (xv)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (-6)\n change x by ((xv) * (-1))\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (yv)\n if <touching (levels v)?> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-2)\n if <<touching (levels v)?> and <<key (up arrow v) pressed?> or <key (w v) pressed?>>> then\n set [yv v] to [8]\n end\n change y by (2)\n end\nend\n\nwhen I receive [play v]\nset [level v] to [1]\nforever\n if <key (r v) pressed?> then\n go to x: (-220) y: (-110)\n end\n if <touching color (#ff0000)?> then\n broadcast (died v)\n set [yv v] to [0]\n set [ghost v] effect to (0)\n repeat (4)\n change [ghost v] effect by (25)\n end\n set [ghost v] effect to (0)\n go to x: (-220) y: (-110)\n set [gravity v] to [1]\n switch costume to (costume1 v)\n end\n if <(x position) > [235]> then\n change [level v] by (1)\n broadcast (next level v)\n go to x: (-220) y: (-110)\n set [gravity v] to [1]\n switch costume to (costume1 v)\n set [yv v] to [0]\n end\nend\n\nwhen I receive [play v]\nforever\n if <(Gravity) = [2]> then\n change [yv v] by (0.5)\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n set [xv v] to ((xv) * (0.8))\n change x by (xv)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (-1)\n if <touching (levels v)?> then\n change y by (6)\n change x by ((xv) * (-1))\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (yv)\n if <touching (levels v)?> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\n end\n change y by (2)\n if <<touching (levels v)?> and <<key (up arrow v) pressed?> or <key (w v) pressed?>>> then\n set [yv v] to [-8]\n end\n change y by (-2)\n end\nend\n\nwhen flag clicked\nhide\n\nwait until <not <key (space v) pressed?>>\nwait until <not <key (space v) pressed?>>\n\nwait (1.8) seconds\n\nwhen I receive [switched v]\n\nif <(yv) < [0]> then\nend\nif <[0] < (yv)> then\nend\n\nif <(Gravity) = [2]> then\n set [yv v] to [-5]\nend\nif <(Gravity) = [1]> then\n set [yv v] to [5]\nend\n\nwhen I receive [play v]\nforever\n if <(level) = [11]> then\n broadcast (you win v) and wait\n end\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\n\nwhen I receive [play v]\nhide\n\n@Sprite3\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (0) y: (-80)\nshow\nswitch costume to (costume1 v)\nset size to (100) %\n\nwhen flag clicked\nhide variable [level v]\nforever\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n wait until <not <mouse down?>>\n broadcast (play v)\n wait (0) seconds\n stop [other scripts in sprite v]\n stop [this script v]\n end\nend\n\nwhen I receive [play v]\nhide\n\nwhen flag clicked\nforever\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n switch costume to (costume2 v)\n set size to (90) %\n wait until <not <mouse down?>>\n switch costume to (costume1 v)\n set size to (100) %\n end\nend\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n repeat (5)\n change size by (3)\n end\n wait until <not <touching (mouse-pointer v)?>>\n repeat (5)\n change size by (-3)\n end\n end\nend\n\nchange x by (10)\n\n@Levels\n\nwhen flag clicked\nhide\n\nwhen I receive [play v]\nshow\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\ngo to [front v] layer\n\nwhen I receive [next level v]\nnext costume\nwait (1) seconds\n\nwhen I receive [you win v]\nswitch costume to (costume11 v)\n\n@Level Counter\n\nwhen flag clicked\ngo to x: (-203) y: (140)\nswitch costume to (costume1 v)\nset size to (75) %\nhide\ngo to [front v] layer\n\nwhen I receive [play v]\nshow\ngo to [front v] layer\nwait (0.1) seconds\ngo to [front v] layer\n\nwhen I receive [next level v]\nnext costume\ngo to [front v] layer\n\nwhen I receive [you win v]\nswitch costume to (costume11 v)\n\n@lava\n\nwhen flag clicked\nhide\n\nwhen I receive [play v]\nforever\n if <<(level) = [2]> or <<(level) = [3]> or <<(level) = [4]> or <<(level) = [5]> or <<(level) = [6]> or <<(level) = [7]> or <<(level) = [8]> or <<(level) = [9]> or <(level) = [10]>>>>>>>>> then\n show\n else\n hide\n end\nend\n\nwhen I receive [play v]\nforever\n if <(level) = [2]> then\n switch costume to (costume2 v)\n set size to (150) %\n go to x: (-128) y: (68.5)\n end\n if <(level) = [3]> then\n switch costume to (costume1 v)\n set size to (65) %\n go to x: (30) y: (60)\n end\n if <(level) = [4]> then\n switch costume to (costume3 v)\n set size to (110) %\n go to x: (0) y: (0)\n end\n if <(level) = [5]> then\n switch costume to (costume4 v)\n set size to (120) %\n go to x: (0) y: (0)\n end\n if <(level) = [6]> then\n switch costume to (costume5 v)\n set size to (100) %\n go to x: (0) y: (20)\n end\n if <(level) = [7]> then\n switch costume to (costume6 v)\n set size to (100) %\n go to x: (0) y: (0)\n end\n if <(level) = [8]> then\n switch costume to (costume7 v)\n set size to (100) %\n go to x: (0) y: (0)\n end\n if <(level) = [9]> then\n switch costume to (costume8 v)\n set size to (100) %\n go to x: (0) y: (0)\n end\n if <(level) = [10]> then\n switch costume to (costume9 v)\n set size to (100) %\n go to x: (0) y: (0)\n switch costume to (costume9 v)\n end\nend\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (34) y: (-179)\n\nwhen flag clicked\nhide\n\nwhen I receive [next level v]\nnext costume\nwait (1) seconds\ngo to [front v] layer\n\nwhen I receive [play v]\nshow\nswitch costume to (costume1 v)\nwait (0) seconds\ngo to [front v] layer\n\nwhen I receive [next level v]\nif <(costume [number v]) = [5]> then\n hide\nend\n\n@Sprite5\n\nwhen flag clicked\nset size to (150) %\nhide\nforever\n go to x: (200) y: (100)\n go to [front v] layer\nend\n\nforever\nend\n\nif <key (space v) pressed?> then\nend\n\nwhen I receive [play v]\nshow\nforever\n if then\n end\nend\n\nwhen I receive [died v]\nswitch costume to (costume16 v)\n\nwhen I receive [switched v]\nswitch costume to (costume1 v)\nrepeat until <(costume [number v]) = [16]>\n next costume\n wait (0.099) seconds\nend\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nwhen I receive [you win v]\nshow\nwait (0) seconds\ngo to [front v] layer\ngo to x: (0) y: (0)\n\n@Sprite7\n\nwhen I receive [play v]\nset [music v] to [1]\ngo to x: (43) y: (90)\ngo to [front v] layer\nforever\n play sound [Ahrix - Nova.mp3 v] until done\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [play v]\nwait (0.2) seconds\ngo to [front v] layer\n\nshow\n\n@Sprite8\n\nwhen flag clicked\nhide\n\n
AntiGravity: A Platformer\n \nWarning: This Game Is Extremely Hard. All Levels Aredw Possible.\nPress WASD/Arrow Keys to move. Press Space to switch gravity. There's a cooldown timer, you can only switch gravity when it's 0.\nHave fun Playing, and don't forget to love, fav, and follow me!\nCheck this game out: https://scratch.mit.edu/projects/269756701/\nThere are 10 levels.\n\n
Get trolled(platformer)
@Stage\n\nwhen flag clicked\nswitch backdrop to (outdoors v)\n\nwhen I receive [next level v]\nnext backdrop\n\n@Player\n\nset [gravity v] to [-5]\nset [x velocity v] to [0]\nset [y velocity v] to [0]\nforever\n if <not <touching (ground v)?>> then\n change y by (Gravity)\n end\n if <key (left arrow v) pressed?> then\n set rotation style [left-right v]\n point in direction (-90)\n move (5) steps\n end\n if <key (right arrow v) pressed?> then\n set rotation style [left-right v]\n point in direction (90)\n move (5) steps\n end\n if <touching (ground v)?> then\n set [y velocity v] to [0]\n if <key (up arrow v) pressed?> then\n set [y velocity v] to [20]\n end\n end\n change y by (Y velocity)\n change [y velocity v] by (-1)\nend\n\nwhen flag clicked\nforever\n switch costume to (costume1 v)\n wait (0.1) seconds\n switch costume to (costume3 v)\n wait (0.1) seconds\n switch costume to (costume2 v)\n wait (0.1) seconds\n switch costume to (costume4 v)\n wait (0.1) seconds\n switch costume to (costume5 v)\n wait (0.1) seconds\n switch costume to (costume6 v)\n wait (0.1) seconds\n switch costume to (costume1 v)\n wait (2) seconds\nend\n\nwhen I receive [start v]\nshow\n\nwhen I receive [next level v]\ngo to x: (-179) y: (-79)\n\nwhen backdrop switches to [white space v]\ngo to x: (-170) y: (19)\n\ndefine Touch Block <up?>\nchange [falling? v] by (1)\nrepeat until <not >\n if <up?> then\n change y by (-1)\n else\n change y by (1)\n set [falling? v] to [0]\n end\n set [speed y v] to [0]\nend\n\ndefine Walk (direction) (speed)\npoint in direction (direction)\nchange x by (speed)\nset [slope v] to [0]\nrepeat until <<(slope) = [8]> or <not >>\n change y by (1)\n change [slope v] by (1)\nend\nif <(slope) = [8]> then\n change x by ((0) - (speed))\n change y by ((0) - (slope))\nend\n\nwhen flag clicked\nforever\n\nwhen flag clicked\nset rotation style [left-right v]\ngo to x: (-179) y: (-79)\nshow\nset [speed y v] to [0]\nset [falling? v] to [10]\nforever\n change [speed y v] by (-1)\n change y by (speed y)\n Touch Block <(speed y) > [0]>\n if <<key (a v) pressed?> or <key (left arrow v) pressed?>> then\n Walk (-90) (-10)\n end\n if <<key (d v) pressed?> or <key (right arrow v) pressed?>> then\n Walk (90) (10)\n end\n if <<<key (w v) pressed?> or <key (up arrow v) pressed?>> and <(falling?) < [3]>> then\n set [speed y v] to [15]\n end\n if <touching color (#66004c)?> then\n set [speed y v] to [22]\n end\n if <(y position) < [-180]> then\n go to x: (-179) y: (-79)\n set [speed y v] to [0]\n end\n if <touching (goal v)?> then\n broadcast (next level v)\n end\n if <<(backdrop [name v]) = [white space ]> and <(y position) < [-180]>> then\n go to x: (-155) y: (-134)\n set [speed y v] to [0]\n end\n if <<touching color (#ff0000)?> or <touching (sprite2 v)?>> then\n go to x: (-179) y: (-79)\n end\nend\n\nwhen backdrop switches to [white space v]\ngo to x: (-159) y: (-123)\n\n@goal\n\nwhen flag clicked\ngo to x: (251) y: (-58)\nshow\n\nwhen I receive [start v]\n\nwhen backdrop switches to [white space v]\nswitch costume to (costume2 v)\ngo to x: (230) y: (-152)\n\nwhen backdrop switches to [outdoors v]\ngo to x: (251) y: (-58)\nswitch costume to (costume1 v)\n\nwhen backdrop switches to [x yellow v]\nswitch costume to (costume3 v)\ngo to x: (-227) y: (-137)\n\nwhen backdrop switches to [classic v]\nswitch costume to (costume2 v)\ngo to x: (254) y: (39)\n\n@Sprite1\n\nwhen flag clicked\nshow\nwait (1.5) seconds\nhide\n\n
WAD or arrow keys to move\nfigure what colors do what :)\nEasier in full-screen\nI would make it go to next level if you go to the edge to the right, but it would mess up a lot of the levels\nThanks for the views and stuff XD\n
A Trolled Platformer
@Stage\n\nwhen flag clicked\nforever\n play sound [Happy Troll.mp3 v] until done\nend\n\n@You\n\nwhen flag clicked\ngo to x: (-187) y: (-94)\ngo to x: (-220) y: (-100)\nset size to (20) %\nshow\nhide variable [y v]\nhide variable [x v]\nset [y v] to [0]\nset [x v] to [0]\nforever\n change [y v] by (-1)\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <<touching color (#000000)?> or > then\n change y by (1)\n end\n if <<touching color (#000000)?> or > then\n change y by (1)\n end\n if <<touching color (#000000)?> or < or >> then\n change y by (1)\n end\n if <<touching color (#000000)?> or > then\n change y by (1)\n end\n if <touching (falling block v)?> then\n change y by (-4)\n end\n if <<touching color (#000000)?> or < or <touching color (#663b00)?>>> then\n change y by (-4)\n change x by ((x) * (-1))\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-5]\n else\n set [x v] to [5]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <<touching color (#000000)?> or > then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <touching color (#000000)?>> then\n set [y v] to [15]\n end\n change y by (1)\nend\n\nwhen flag clicked\nshow\nforever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (90)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (-90)\n end\nend\n\nwhen I receive [start game v]\ngo to x: (-207) y: (-121)\n\nwhen I receive [lvl2 v]\ngo to x: (-207) y: (-121)\n\nwhen flag clicked\nforever\n set [x pos v] to (x position)\nend\n\nwhen flag clicked\nforever\n if <touching (death pit v)?> then\n broadcast (Game over v)\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [start game v]\nshow\n\nwhen I receive [lvl3 v]\ngo to x: (-207) y: (-121)\n\nwhen I receive [lvl4 v]\ngo to x: (-207) y: (-100)\nstart sound [falling.mp3 v]\n\nwhen I receive [lvl5 v]\ngo to x: (-220) y: (148)\n\nwhen I receive [lvl6 v]\ngo to x: (-220) y: (-100)\n\nwhen I receive [lvl7 v]\ngo to x: (-145) y: (-123)\n\nwhen I receive [lvl8 v]\nwait (0.1) seconds\ngo to x: (-220) y: (-123)\n\nwhen I receive [lvl9 v]\ngo to x: (-240) y: (-123)\n\nwhen I receive [lvl10 v]\ngo to x: (-240) y: (-123)\n\nwhen I receive [win! v]\nhide\n\n@Floor\n\nwhen flag clicked\ngo to x: (0) y: (-168)\nshow\nswitch costume to (floor v)\n\nwhen I receive [lvl2 v]\ngo to x: (0) y: (-186)\nswitch costume to (lvl2 v)\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [start game v]\nshow\n\nwhen I receive [lvl3 v]\nswitch costume to (floor v)\ngo to x: (0) y: (-168)\n\nwhen I receive [lvl4 v]\nswitch costume to (lvl4 v)\ngo to x: (0) y: (-168)\n\nwhen I receive [lvl5 v]\nswitch costume to (lvl5 v)\ngo to x: (0) y: (-50)\nwait (1) seconds\nforever\n if <not <touching (you v)?>> then\n switch costume to (lvl5 \(2\) v)\n start sound [troll-laugh.mp3 v]\n broadcast (Flag Move LVL5 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl6 v]\nswitch costume to (floor v)\ngo to x: (0) y: (-168)\n\nwhen I receive [win! v]\nhide\n\n@Title\n\nwhen flag clicked\nshow\ngo to x: (0) y: (999)\nglide (5) secs to x: (0) y: (90)\n\nwhen I receive [start game v]\nhide\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [win! v]\nhide\n\n@Flag\n\nwhen flag clicked\ngo to x: (204) y: (-119)\nshow\nforever\n if <touching (you v)?> then\n broadcast (Start Game v)\n stop [this script v]\n end\nend\n\nwhen I receive [start game v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL2 v)\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl2 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL3 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl3 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL4 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl4 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL5 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl5 v]\ngo to x: (204) y: (-53)\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL6 v)\n stop [this script v]\n end\nend\n\nwhen I receive [flag move lvl5 v]\ngo to x: (204) y: (132)\n\nwhen I receive [lvl6 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL7 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl7 v]\nstop [other scripts in sprite v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL8 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl8 v]\nstop [other scripts in sprite v]\ngo to x: (204) y: (-119)\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL9 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl9 v]\nstop [other scripts in sprite v]\ngo to x: (204) y: (-119)\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (LVL10 v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\nset size to (100) %\nswitch costume to (costume1 v)\n\nwhen I receive [lvl10 v]\nstop [other scripts in sprite v]\ngo to x: (204) y: (-119)\nset size to (20) %\nswitch costume to (trophy-pixelated-game-award-winner-vector-19568644 v)\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (Win! v)\n stop [this script v]\n end\nend\n\nwhen I receive [win! v]\nhide\n\n@Troll\n\nwhen flag clicked\nhide\npoint in direction (-90)\ngo to x: (198) y: (-125)\n\nwhen I receive [start game v]\ngo to x: (198) y: (-125)\nshow\nglide (0.6) secs to x: (-205) y: (-125)\nhide\n\nwhen I receive [start game v]\nswitch costume to (meme-s-excited-troll-face-meme-decal v)\nwait (0.1) seconds\ngo to [front v] layer\nstart sound [SCREAM_4.mp3 v]\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl2 v]\nstop [other scripts in sprite v]\n\nwhen I receive [lvl3 v]\nswitch costume to (1duf5k v)\ngo to [front v] layer\ngo to x: (202) y: (-118)\nset [ghost v] effect to (99)\nwait (1) seconds\nshow\nforever\n if <[140] < (X Pos)> then\n set [ghost v] effect to (0)\n start sound [Annoying+Yell.mp3 v]\n wait (1.09) seconds\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [lvl3 v]\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl3 v]\nwait (1) seconds\nforever\n if <[140] < (X Pos)> then\n repeat (10)\n change x by (-1)\n wait (0) seconds\n change x by (1)\n wait (0) seconds\n end\n stop [this script v]\n end\nend\n\nwhen I receive [troll lvl 6 v]\nswitch costume to (meme-s-excited-troll-face-meme-decal v)\nwait (0.1) seconds\ngo to [front v] layer\nstart sound [SCREAM_4.mp3 v]\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl7 v]\nhide\n\nwhen I receive [lvl7 v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [troll lvl 7 v]\nstart sound [SCREAM_4.mp3 v]\nswitch costume to (meme-s-excited-troll-face-meme-decal v)\ngo to x: (198) y: (-125)\nshow\nglide (0.6) secs to x: (-240) y: (-125)\nhide\n\nwhen I receive [lvl10 v]\nwait (1) seconds\nforever\n if <[140] < (X Pos)> then\n repeat (10)\n change x by (-1)\n wait (0) seconds\n change x by (1)\n wait (0) seconds\n end\n stop [this script v]\n end\nend\n\nwhen I receive [lvl10 v]\nswitch costume to (1duf5k v)\ngo to [front v] layer\ngo to x: (202) y: (-118)\nset [ghost v] effect to (99)\nwait (1) seconds\nshow\nforever\n if <[140] < (X Pos)> then\n set [ghost v] effect to (0)\n start sound [Annoying+Yell.mp3 v]\n wait (1.09) seconds\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [win! v]\nhide\n\n@Win or lose?\n\nwhen flag clicked\nhide\n\nwhen I receive [game over v]\ngo to x: (-12) y: (26)\nshow\nswitch costume to (images v)\nforever\n change x by (10)\n wait (0) seconds\n change x by (-10)\n wait (0) seconds\nend\n\nwhen I receive [win! v]\nshow\nswitch costume to (maxresdefault v)\nforever\n show\n set size to (0) %\n go to x: (0) y: (30)\n point in direction (90)\n set [turn v] to [0]\n forever\n change size by (((100) - (size)) / (4))\n change [turn v] by (4)\n point in direction ((90) + (([sin v] of (turn) ) * (3)))\n change y by (([sin v] of (turn) ) / (4))\n end\nend\n\n@Level \n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nshow\ngo to x: (0) y: (156)\nswitch costume to (costume1 v)\n\nwhen I receive [lvl2 v]\nswitch costume to (costume2 v)\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl3 v]\nswitch costume to (costume3 v)\n\nwhen I receive [lvl4 v]\nswitch costume to (costume4 v)\n\nwhen I receive [lvl5 v]\nswitch costume to (costume5 v)\n\nwhen I receive [lvl6 v]\nswitch costume to (costume6 v)\n\nwhen I receive [lvl7 v]\nswitch costume to (costume7 v)\ngo to [front v] layer\n\nwhen I receive [lvl8 v]\nswitch costume to (costume8 v)\ngo to [front v] layer\n\nwhen I receive [lvl9 v]\nswitch costume to (costume9 v)\ngo to [front v] layer\n\nwhen I receive [lvl10 v]\nswitch costume to (costume10 v)\ngo to [front v] layer\n\nwhen I receive [win! v]\nhide\n\n@Troll Block\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl2 v]\nshow\ngo to x: (-125) y: (-47)\nset [ghost v] effect to (99)\ngo [backward v] (999) layers\nforever\n if <touching (you v)?> then\n set [ghost v] effect to (0)\n start sound [troll-laugh.mp3 v]\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl3 v]\nhide\n\nwhen I receive [lvl6 v]\nshow\nset [ghost v] effect to (99)\ngo [backward v] (999) layers\nforever\n if <touching (you v)?> then\n set [ghost v] effect to (0)\n start sound [Hello Baby Girl-SoundBible.com-879828213.mp3 v]\n go to x: (-231) y: (-18)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl7 v]\nhide\n\nwhen I receive [win! v]\nhide\n\n@Death Pit\n\nwhen flag clicked\ngo to x: (0) y: (-174)\nset [ghost v] effect to (99)\nshow\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [start game v]\nshow\n\nwhen I receive [win! v]\nhide\n\n@Troll2\n\nwhen flag clicked\nhide\n\nwhen I receive [game over v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [lvl3 v]\nforever\n create clone of (_myself_ v)\n wait (pick random (0.5) to (2)) seconds\nend\n\nwhen I start as a clone\ngo to x: (pick random (-60) to (200)) y: (999)\nshow\npoint in direction (-90)\nforever\n change y by (-5)\n if <(y position) < [-130]> then\n delete this clone\n end\nend\n\nwhen I start as a clone\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl4 v]\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I receive [win! v]\nhide\n\n@Troll3\n\nwhen flag clicked\nhide\nset size to (100) %\n\nwhen I receive [game over v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [lvl4 v]\ngo to x: (271) y: (-46)\nset [fall v] to [0]\nwait (1) seconds\nforever\n if <[85] < (X Pos)> then\n show\n start sound [690.mp3 v]\n repeat until <(y position) < [-195]>\n change x by (-5)\n change [fall v] by (-0.4)\n change y by (Fall)\n end\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [lvl4 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl5 v]\nstop [other scripts in sprite v]\n\nwhen I receive [troll2 lvl 7 v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [troll2 lvl 7 v]\nshow\nstart sound [690.mp3 v]\ngo to x: (114) y: (197)\nforever\n change y by (-15)\n if <touching (floor v)?> then\n hide\n stop [other scripts in sprite v]\n stop [this script v]\n end\nend\n\nwhen I receive [button pressed v]\ngo to x: (-128) y: (999)\nset size to (300) %\nset [fall v] to [0]\nwait (1) seconds\nshow\nstart sound [690.mp3 v]\nrepeat until <(y position) < [-195]>\n change [fall v] by (-0.4)\n change y by (Fall)\nend\nhide\nstop [this script v]\n\nwhen I receive [button pressed v]\nwait (1) seconds\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl10 v]\ngo to x: (-128) y: (999)\nset size to (300) %\nset [fall v] to [0]\nshow\nstart sound [690.mp3 v]\nrepeat until <(y position) < [-195]>\n change [fall v] by (-0.4)\n change y by (Fall)\nend\nhide\nstop [this script v]\n\nwhen I receive [lvl10 v]\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n stop [this script v]\n end\nend\n\nwhen I receive [win! v]\nhide\n\nwhen I receive [lvl5 v]\nhide\n\n@Stage\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl6 v]\nshow\nswitch costume to (lvl6 v)\ngo to x: (-29) y: (86)\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl7 v]\nshow\nswitch costume to (lvl7 v)\ngo to x: (1) y: (33)\n\nwhen I receive [lvl8 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [win! v]\nhide\n\n@Falling Block\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl6 v]\nshow\ngo to x: (11) y: (85)\nforever\n if <touching (you v)?> then\n go [backward v] (999999) layers\n start sound [Bye Bye -SoundBible.com-1483442951.mp3 v]\n glide (2) secs to x: (11) y: (-170)\n broadcast (Troll LVL 6 v)\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl8 v]\nshow\ngo to x: (5) y: (-168)\ngo [backward v] (99999) layers\nforever\n if <touching (you v)?> then\n go [backward v] (999999) layers\n start sound [Bye Bye -SoundBible.com-1483442951.mp3 v]\n broadcast (LVL9 BYE BYE v)\n glide (0) secs to x: (5) y: (-999)\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [lvl9 bye bye v]\nstart sound [Bye Bye -SoundBible.com-1483442951.mp3 v]\n\nwhen I receive [lvl9 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [win! v]\nhide\n\n@Giant Troll\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl7 v]\nshow\ngo to x: (-415) y: (16)\nforever\n play sound [Annoying+Yell.mp3 v] until done\nend\n\nwhen I receive [lvl7 v]\ngo [backward v] (9999999) layers\ngo to x: (-415) y: (16)\nwait (0.1) seconds\nglide (15) secs to x: (38) y: (16)\nstop [other scripts in sprite v]\n\nwhen I receive [lvl7 v]\nforever\n if <touching (you v)?> then\n broadcast (Game over v)\n hide\n stop [other scripts in sprite v]\n end\nend\n\nwhen I receive [lvl8 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [win! v]\nhide\n\n@Trigger Line LVL 7\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl7 v]\nshow\nset [ghost v] effect to (99)\nforever\n if <touching (you v)?> then\n broadcast (Troll LVL 7 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl8 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [win! v]\nhide\n\n@Trigger Line 2 LVL 7\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl7 v]\nshow\nset [ghost v] effect to (99)\nforever\n if <touching (you v)?> then\n broadcast (Troll2 LVL 7 v)\n stop [this script v]\n end\nend\n\nwhen I receive [lvl8 v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [win! v]\nhide\n\n@Button\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl9 v]\nshow\nset size to (500) %\nswitch costume to (off v)\nforever\n if <touching (you v)?> then\n broadcast (Button Pressed v)\n switch costume to (on v)\n start sound [troll-laugh.mp3 v]\n stop [this script v]\n end\nend\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl10 v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [win! v]\nhide\n\n@LVL9 Wall\n\nwhen flag clicked\nhide\n\nwhen I receive [button pressed v]\nshow\ngo to x: (8) y: (-1)\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [win! v]\nhide\n\n@Press This Button\n\nwhen flag clicked\nhide\n\nwhen I receive [lvl9 v]\nshow\nswitch costume to (costume1 v)\n\nwhen I receive [button pressed v]\nswitch costume to (costume2 v)\n\nwhen I receive [lvl10 v]\nhide\n\nwhen I receive [game over v]\nhide\n\nwhen I receive [lvl10 v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [win! v]\nhide\n\n@Sprite1\n\nwhen flag clicked\nshow\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\n\n
It's a platformer... trolled!!! \nCan you get to the end? Probs not...\n=========================================\nTry my work in progress (NOT ACTIVE): https://scratch.mit.edu/projects/435019172/\n=========================================\nTry InsaneScratches inspired edition of A Trolled Platformer: \nhttps://scratch.mit.edu/projects/355756893/
Christmas! A Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (level 1 v)\n\nwhen I receive [trick! v]\nswitch backdrop to (backdrop1 v)\nstop [all v]\n\n@You\n\nwhen flag clicked\nforever\n create clone of (_myself_ v)\n wait (0.02) seconds\nend\n\nwhen I start as a clone\nrepeat (16)\n change size by (-5)\n change [ghost v] effect by (6.25)\nend\ndelete this clone\n\nwhen I receive [game start v]\n\nwhen backdrop switches to [level 3 v]\ngo to x: (-168) y: (-124)\n\nwhen backdrop switches to [level 5 v]\ngo to x: (-194) y: (-124)\n\nwhen backdrop switches to [level 6 v]\ngo to x: (-175) y: (-125)\n\nwhen backdrop switches to [level 7 v]\ngo to x: (-171) y: (-125)\n\nwhen backdrop switches to [level 12 v]\ngo to x: (-185) y: (1)\n\nwhen backdrop switches to [level 13 v]\ngo to x: (0) y: (-125)\n\nwhen backdrop switches to [level 4 v]\ngo to x: (-187) y: (-124)\n\nwhen backdrop switches to [level 13 v]\ngo to x: (-144) y: (82)\n\nwhen backdrop switches to [level 15 v]\ngo to x: (-207) y: (133)\n\nwhen I receive [game start! v]\ngo to x: (-194) y: (-87)\nset [level v] to [1]\nset [deaths v] to [0]\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#ffffff)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#ffffff)?> then\n if <key (up arrow v) pressed?> then\n set volume to (40) %\n set [yv v] to [15]\n end\n end\n change y by (1)\n if <(x position) > [235]> then\n switch backdrop to (next backdrop v)\n end\n if <<<touching color (#009933)?> or <touching (sprite25 v)?>> or <touching (sprite26 v)?>> then\n change [deaths v] by (1)\n go to x: (-194) y: (-125)\n end\n if <(y position) < [-171]> then\n hide\n change [deaths v] by (1)\n go to x: (-187) y: (-125)\n wait (0.09) seconds\n show\n end\n if <touching color (#6600cc)?> then\n change [yv v] by (32)\n change y by (Yv)\n end\nend\n\nwhen backdrop switches to [level 17 v]\ngo to x: (-189) y: (-113)\n\nwhen flag clicked\nset [deaths v] to [0]\nhide\n\nwhen backdrop switches to [level 2 v]\ngo to x: (-187) y: (-125)\n\nwhen backdrop switches to [level 8 v]\ngo to x: (-169) y: (-124)\n\nwhen backdrop switches to [level 9 v]\ngo to x: (-187) y: (-124)\n\nwhen backdrop switches to [level 11 v]\ngo to x: (-189) y: (42)\n\nwhen backdrop switches to [level 10 v]\ngo to x: (-192) y: (-125)\n\nwhen backdrop switches to [level 14 v]\ngo to x: (-180) y: (-90)\n\nwhen I receive [game start v]\nforever\n if <key (s v) pressed?> then\n wait (0.5) seconds\n switch backdrop to (next backdrop v)\n end\n if <(backdrop [number v]) = [17]> then\n stop [this script v]\n end\nend\n\nwhen flag clicked\nwait (10) seconds\nplay sound [Glee - Jingle Bell Rock \(Lyrics\) \(1\).mp3 v] until done\n\nwhen backdrop switches to [level 16 v]\ngo to x: (-194) y: (-125)\n\nwhen flag clicked\nforever\n if <(backdrop [number v]) = [17]> then\n if <touching (mouse-pointer v)?> then\n if <mouse down?> then\n wait (1) seconds\n broadcast (Trick! v)\n end\n end\n end\nend\n\nwhen I receive [trick! v]\nhide\n\n@Ground\n\nwhen flag clicked\nhide\nswitch costume to (ground9 v)\n\nwhen I receive [game start! v]\nswitch costume to (ground v)\nshow\ngo to x: (0) y: (-4)\n\nwhen backdrop switches to [level 2 v]\nswitch costume to (ground2 v)\n\nwhen backdrop switches to [level 3 v]\nswitch costume to (ground3 v)\n\nwhen backdrop switches to [level 4 v]\nswitch costume to (ground4 v)\n\nwhen backdrop switches to [level 5 v]\nswitch costume to (ground5 v)\n\nwhen backdrop switches to [level 6 v]\nswitch costume to (ground6 v)\n\nwhen backdrop switches to [level 1 v]\nswitch costume to (ground v)\n\nwhen backdrop switches to [level 7 v]\nswitch costume to (ground7 v)\n\nwhen backdrop switches to [level 8 v]\nswitch costume to (ground8 v)\n\nwhen backdrop switches to [level 9 v]\nswitch costume to (ground9 v)\n\nwhen backdrop switches to [level 11 v]\nswitch costume to (ground11 v)\n\nwhen backdrop switches to [level 13 v]\ngo to x: (1) y: (0)\nswitch costume to (ground13 v)\ngo [backward v] (1) layers\n\nwhen backdrop switches to [level 14 v]\nswitch costume to (ground14 v)\n\nwhen backdrop switches to [level 15 v]\nswitch costume to (ground15 v)\n\nwhen backdrop switches to [level 12 v]\nswitch costume to (ground12 v)\ngo to x: (-1) y: (-5)\n\nwhen backdrop switches to [level 10 v]\nswitch costume to (ground10 v)\n\nwhen backdrop switches to [level 10 v]\ngo to x: (-2) y: (-5)\n\nwhen backdrop switches to [level 17 v]\nswitch costume to (ground16 v)\n\nwhen backdrop switches to [level 16 v]\nswitch costume to (ground16 v)\n\nwhen I receive [trick! v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nhide\n\nwhen I receive [intro 2 v]\nwait () seconds\ngo to x: (66) y: (-40)\nshow\nwait (2.5) seconds\nbroadcast (game start! v)\nhide\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 3 v]\nshow\ngo to x: (117) y: (-45)\n\nwhen backdrop switches to [level 4 v]\nshow\ngo to x: (118) y: (-55)\n\nwhen backdrop switches to [level 5 v]\nhide\n\nwhen backdrop switches to [level 6 v]\nshow\ngo to x: (69) y: (-46)\n\nwhen backdrop switches to [level 7 v]\ngo to x: (69) y: (-46)\n\nwhen backdrop switches to [level 8 v]\nhide\n\nwhen backdrop switches to [level 15 v]\nhide\n\n@Sprite4\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 5 v]\nswitch costume to (costume1 v)\nshow\ngo to x: (166) y: (-83)\n\nwhen backdrop switches to [level 6 v]\nhide\n\nwhen backdrop switches to [level 7 v]\nswitch costume to (costume2 v)\nshow\ngo to x: (245) y: (-80)\n\nwhen backdrop switches to [level 8 v]\nhide\n\nwhen backdrop switches to [level 12 v]\nhide\n\nwhen I receive [trick! v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 6 v]\nshow\ngo to x: (193) y: (-45)\n\nwhen backdrop switches to [level 7 v]\ngo to x: (65) y: (96)\n\nwhen backdrop switches to [level 8 v]\nhide\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 6 v]\nshow\ngo to x: (309) y: (-45)\n\nwhen backdrop switches to [level 7 v]\nhide\n\nwhen backdrop switches to [level 8 v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 7 v]\nshow\ngo to x: (191) y: (90)\n\nwhen backdrop switches to [level 8 v]\nhide\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite9\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 8 v]\nshow\ngo to x: (-28) y: (21)\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (-169) y: (22)\n\nwhen backdrop switches to [level 10 v]\nhide\n\n@Sprite10\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 8 v]\nshow\ngo to x: (24) y: (-141)\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 15 v]\nshow\ngo to x: (2) y: (-130)\n\nwhen backdrop switches to [level 9 v]\ngo to x: (47) y: (-139)\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite11\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (-9) y: (21)\n\nwhen backdrop switches to [level 10 v]\nhide\n\n@Sprite12\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (115) y: (21)\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 15 v]\nshow\ngo to x: (-55) y: (32)\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite13\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (-41) y: (-20)\ncreate clone of (_myself_ v)\ngo to x: (-5) y: (36)\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 11 v]\nshow\ngo to x: (190) y: (-39)\ncreate clone of (_myself_ v)\ngo to x: (280) y: (-86)\n\nwhen backdrop switches to [level 12 v]\nhide\n\n@Sprite14\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 9 v]\nshow\ngo to x: (191) y: (-141)\n\nwhen backdrop switches to [level 10 v]\nhide\n\nwhen backdrop switches to [level 15 v]\nshow\ngo to x: (290) y: (-133)\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite15\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 10 v]\nshow\ngo to x: (118) y: (14)\nwait (2.5) seconds\nhide\n\n@Sprite16\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 11 v]\nshow\ngo to x: (15) y: (-54)\n\nwhen backdrop switches to [level 12 v]\nhide\n\n@Sprite20\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 12 v]\nshow\ngo to x: (46) y: (104)\n\nwhen backdrop switches to [level 13 v]\nhide\n\n@Sprite18\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 14 v]\nshow\ngo to x: (44) y: (-2)\n\nwhen backdrop switches to [level 15 v]\nhide\n\n@Sprite19\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 15 v]\ngo to x: (101) y: (-6)\nset size to (70) %\nshow\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite17\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 15 v]\nshow\ngo to x: (266) y: (70)\n\nwhen backdrop switches to [level 16 v]\nhide\n\n@Sprite21\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 17 v]\nshow\ngo to x: (100) y: (-102)\n\nwhen I receive [trick! v]\nhide\n\n@Sprite22\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 17 v]\nshow\ngo to x: (-1) y: (0)\n\nwhen I receive [trick! v]\nhide\n\n@Sprite23\n\nwhen flag clicked\ngo to x: (-240) y: (180)\nhide\nrepeat (60)\n create clone of (_myself_ v)\n change x by (8)\nend\n\nwhen I start as a clone\nforever\n hide\n go [backward v] (1000) layers\n go to x: (x position) y: (180)\n wait (pick random (0) to (7.5)) seconds\n show\n glide (pick random (4) to (10)) secs to x: (x position) y: (-180)\nend\n\n@Sprite2\n\nwhen flag clicked\nhide\nwait (2) seconds\nshow\nstart sound [recording2 v]\nwait (8) seconds\nbroadcast (game start v)\n\nwhen flag clicked\nwait (2) seconds\nforever\n change [color v] effect by (25)\n turn right (8) degrees\nend\n\nwhen I receive [game start v]\nbroadcast (intro 2 v)\nhide\nwait (0.1) seconds\nstop [other scripts in sprite v]\n\n@Sprite7\n\n@Sprite24\n\nwhen flag clicked\nset [ghost v] effect to (0)\nshow\ngo to [front v] layer\nwait (2) seconds\nrepeat (25)\n change [ghost v] effect by (4)\nend\nhide\n\n@Sprite25\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 10 v]\nshow\ngo to x: (19) y: (-112)\n\nwhen backdrop switches to [level 11 v]\nhide\n\n@Sprite26\n\nwhen backdrop switches to [level 10 v]\nshow\ngo to x: (84) y: (-46)\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [level 11 v]\nhide\n\n@Sprite27\n\ndefine Start\nrepeat (100)\n go to (random position v)\n set size to (pick random (20) to (50)) %\n set [ghost v] effect to (pick random (90) to (95))\n point in direction (pick random (-70) to (-100))\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\ngo to [back v] layer\ngo to [back v] layer\nrepeat until <(x position) < [-220]>\n move (5) steps\nend\ndelete this clone\n\nwhen I receive [game start! v]\nshow\nStart\nforever\n if <(backdrop [number v]) < [10]> then\n hide\n point in direction (pick random (-70) to (-100))\n go to x: (300) y: (pick random (-180) to (180))\n set size to (pick random (20) to (50)) %\n set [ghost v] effect to (pick random (55) to (75))\n create clone of (_myself_ v)\n else\n hide\n point in direction (pick random (-70) to (-100))\n go to x: (300) y: (pick random (-180) to (180))\n set size to (pick random (20) to (50)) %\n set [ghost v] effect to (pick random (0) to (15))\n create clone of (_myself_ v)\n end\n if <(backdrop [number v]) = [17]> then\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\n\n@Sprite28\n\nwhen flag clicked\nhide\n\nwhen I receive [trick! v]\nshow\ngo to x: (36) y: (28)\n\n
Arrow keys to move and jump\nGreen kills you\nPurple is bouncy\nGet to the end of the screen to advance! \nS to skip\nAll Levels Are Possible!\n
scrolling platformer maker
@Stage\n\nwhen flag clicked\nforever\n if <(y) > ((1200) + (((hoe groot spel bord?) - (1)) * (1200)))> then\n set [brightness v] effect to ((((y) * (-1)) + ((1200) + (((hoe groot spel bord?) - (1)) * (1200)))) / (10))\n else\n set [brightness v] effect to (0)\n end\nend\n\n@game\n\ndefine voor bereiding\nshow list [copy this v]\ndelete all of [tekens v]\nset [nummer1 v] to [0]\nrepeat (length of [ 1234567890abcdefghijklmnopqrstuvwxyz@])\n change [nummer1 v] by (1)\n add (letter (nummer1) of [ 1234567890abcdefghijklmnopqrstuvwxyz@]) to [tekens v]\nend\ndelete all of [acount gegevens v]\nadd [] to [acount gegevens v]\nset [nummer1 v] to [0]\nrepeat ((length of (☁ alles)) / (2))\n change [nummer1 v] by (2)\n if <(item (join (letter ((nummer1) - (1)) of (☁ alles)) (letter (nummer1) of (☁ alles))) of [tekens v]) = [@]> then\n add [] to [acount gegevens v]\n else\n replace item (length of [acount gegevens v]) of [acount gegevens v] with (join (item (length of [acount gegevens v]) of [acount gegevens v]) (item (join (letter ((nummer1) - (1)) of (☁ alles)) (letter (nummer1) of (☁ alles))) of [tekens v]))\n end\nend\nset [nummer1 v] to [0]\nrepeat (length of [acount gegevens v])\n change [nummer1 v] by (1)\n replace item (nummer1) of [acount gegevens v] with (translate (item (nummer1) of [acount gegevens v]) to ((language::translate) v)::translate)\nend\ndelete all of [gebruikers namen v]\nadd [] to [gebruikers namen v]\nset [nummer1 v] to [0]\nrepeat ((length of (☁ alles 2)) / (2))\n change [nummer1 v] by (2)\n if <(item (join (letter ((nummer1) - (1)) of (☁ alles 2)) (letter (nummer1) of (☁ alles 2))) of [tekens v]) = [@]> then\n add [] to [gebruikers namen v]\n else\n replace item (length of [gebruikers namen v]) of [gebruikers namen v] with (join (item (length of [gebruikers namen v]) of [gebruikers namen v]) (item (join (letter ((nummer1) - (1)) of (☁ alles 2)) (letter (nummer1) of (☁ alles 2))) of [tekens v]))\n end\nend\nset [nummer1 v] to [0]\nrepeat (length of [gebruikers namen v])\n change [nummer1 v] by (1)\n replace item (nummer1) of [gebruikers namen v] with (translate (item (nummer1) of [gebruikers namen v]) to ((language::translate) v)::translate)\nend\n\ndefine opslaan\nset [andwoord list v] to []\nset [nummer1 v] to [0]\nrepeat ((length of [gebruikers namen v]) - (1))\n change [nummer1 v] by (1)\n set [andwoord list v] to (join (andwoord list) (join (translate (item (nummer1) of [gebruikers namen v]) to (nl v)::translate) [@]))\nend\nchange [nummer1 v] by (1)\nset [andwoord list v] to (join (andwoord list) (translate (item (nummer1) of [gebruikers namen v]) to (nl v)::translate))\nset [nummer1 v] to [0]\nset [☁ alles 2 v] to []\nrepeat (length of (andwoord list))\n change [nummer1 v] by (1)\n if <(length of (item # of (letter (nummer1) of (andwoord list)) in [tekens v])) = [1]> then\n set [☁ alles 2 v] to (join (☁ alles 2) (join [0] (item # of (letter (nummer1) of (andwoord list)) in [tekens v])))\n else\n set [☁ alles 2 v] to (join (☁ alles 2) (item # of (letter (nummer1) of (andwoord list)) in [tekens v]))\n end\nend\nset [gevraagd list v] to []\nset [nummer1 v] to [0]\nrepeat ((length of [acount gegevens v]) - (1))\n change [nummer1 v] by (1)\n set [gevraagd list v] to (join (gevraagd list) (join (translate (item (nummer1) of [acount gegevens v]) to (nl v)::translate) [@]))\nend\nchange [nummer1 v] by (1)\nset [gevraagd list v] to (join (gevraagd list) (translate (item (nummer1) of [acount gegevens v]) to (nl v)::translate))\nset [nummer1 v] to [0]\nset [☁ alles v] to []\nrepeat (length of (gevraagd list))\n change [nummer1 v] by (1)\n if <(length of (item # of (letter (nummer1) of (gevraagd list)) in [tekens v])) = [1]> then\n set [☁ alles v] to (join (☁ alles) (join [0] (item # of (letter (nummer1) of (gevraagd list)) in [tekens v])))\n else\n set [☁ alles v] to (join (☁ alles) (item # of (letter (nummer1) of (gevraagd list)) in [tekens v]))\n end\nend\n\ndefine bewegings besturing <text>\ngo to x: (x4) y: (y4)\nchange x by (((x4) * (diepte)) - (x4))\nchange y by (((y4) * (diepte)) - (y4))\nif <<(item (((round (((y) + (((y4) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((x4) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v]) = [5]> and <[2 v] contains [6]?>> then\n set [nummer v] to [0]\n repeat ((225) * (hoe groot spel bord?))\n change [nummer v] by (1)\n if <(item (nummer) of [2 v]) = [6]> then\n replace item (nummer) of [1 v] with [0]\n replace item (nummer) of [2 v] with [1]\n end\n if <(item (nummer) of [2 v]) = [5]> then\n replace item (nummer) of [1 v] with [0]\n replace item (nummer) of [2 v] with [2]\n end\n end\nend\nif <key (right arrow v) pressed?> then\n change [x2 v] by (1)\nend\nif <key (left arrow v) pressed?> then\n change [x2 v] by (-1)\nend\nset [x2 v] to ((x2) * (0.9))\nchange x by (x2)\nchange x by (-1)\nchange y by (-10)\nif <touching color (#ffff00)?> then\n change y by (5)\n change x by (1)\n if <not <touching color (#ffff00)?>> then\n set [y2 v] to [23]\n end\n change y by (-5)\n change x by (-1)\nend\nchange x by (2)\nchange y by (10)\nset size to ((110) * (diepte)) %\nif <touching color (#ffff00)?> then\n change y by (5)\n change x by (-1)\n if <not <touching color (#ffff00)?>> then\n set [y2 v] to [23]\n end\n change y by (-5)\n change x by (1)\nend\nset size to ((100) * (diepte)) %\nchange x by (-1)\nif <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by (1)\n if <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by (1)\n if <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by (1)\n if <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by (1)\n if <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by (1)\n if <<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change x by ((x2) * (-2))\n set [x2 v] to [0]\n change y by (-5)\n end\n end\n end\n end\n end\nend\nif <(y2) > [-20]> then\n change [y2 v] by (-1)\nend\nchange y by (y2)\nif <<<<touching color (#000000)?> or <touching color (#ffff00)?>> or <touching color (#ffff00)?>> or <touching color (#4e4e4e)?>> then\n change y by ((y2) * (-1))\n set [y2 v] to [0]\nend\nchange y by (-5)\nif <<<touching color (#000000)?> or <touching color (#4e4e4e)?>> and <key (up arrow v) pressed?>> then\n set [y2 v] to [18]\nend\nchange y by (5)\nif <<touching color (#ff0000)?> or <(y) > ((1560) + (((hoe groot spel bord?) - (1)) * (1200)))>> then\n set pen size to (1)\n set pen color to (#ff0000)\n pen up\n go to x: (-240) y: (180)\n pen down\n repeat (240)\n change x by (480)\n change y by (-1.5)\n change x by (-480)\n change y by (-1.5)\n end\n set pen size to (10)\n set [y v] to (([floor v] of ((3) / (15)) ) * (80))\n set [x v] to (((((((3) / (15)) * (80)) - (([floor v] of ((3) / (15)) ) * (80))) * (15)) + (-1280)) * (-1))\n set [x2 v] to [0]\n set [y2 v] to [0]\n set [x4 v] to [0]\n set [y4 v] to [0]\n hide\n set pen color to (#ffff00)\n set pen size to (50)\n pen up\n go to x: (0) y: (20)\n pen down\n go to x: (20) y: (-40)\n go to x: (-20) y: (-40)\n go to x: (0) y: (20)\n set pen size to (20)\n set pen color to (#ff0000)\n pen up\n go to x: (0) y: (60)\n pen down\n go to x: (60) y: (-60)\n go to x: (-60) y: (-60)\n go to x: (0) y: (60)\n set pen color to (#000000)\n set pen size to (26)\n pen up\n go to x: (0) y: (-40)\n pen down\n pen up\n go to x: (0) y: (10)\n pen down\n go to x: (0) y: (-10)\n wait (1) seconds\n erase all\n reload sleutels en grijzen blokken\nend\nif <touching color (#00ff55)?> then\n set pen size to (1)\n set pen color to (#00ff4f)\n pen up\n go to x: (-240) y: (180)\n pen down\n repeat (240)\n change x by (480)\n change y by (-2)\n change x by (-480)\n change y by (-2)\n end\n pen up\n hide\n wait (1) seconds\n if <[10] = (level)> then\n go to x: (0) y: (0)\n set [mode v] to [0]\n else\n 2\n stop [this script v]\n end\nend\npen up\nif <key (s v) pressed?> then\n if <[10] = (level)> then\n go to x: (0) y: (0)\n set [mode v] to [0]\n else\n wait until <not <key (s v) pressed?>>\n hide\n 2\n stop [this script v]\n end\nend\nchange x by ((((x4) * (diepte)) - (x4)) * (-1))\nchange y by ((((y4) * (diepte)) - (y4)) * (-1))\nset [x4 v] to (x position)\nset [y4 v] to (y position)\nchange [x v] by (((x4) * (-0.04)) / (diepte))\nchange [y v] by (((y4) * (-0.04)) / (diepte))\nchange [x4 v] by (((x4) * (-0.04)) / (diepte))\nchange [y4 v] by (((y4) * (-0.04)) / (diepte))\n\ndefine player generaator\nchange [diepte word? v] by (((([abs v] of (x2) ) + ([abs v] of (y2) )) - ((([abs v] of (x2) ) * ([abs v] of (y2) )) / (12))) * (-0.004))\nset [diepte word? v] to ((((diepte word?) - (1)) * (0.9)) + (1))\nif <(diepte word?) < [0.2]> then\n set [diepte word? v] to [0.201]\nend\nset [diepte v] to (((diepte word?) + ((diepte) * (9))) / (10))\ngo to x: ((x4) * (diepte)) y: ((y4) * (diepte))\nset size to ((100) * (diepte)) %\nset pen size to ((20) * (diepte))\nset pen color to (#000000)\ngo to x: ((x4) * (diepte)) y: ((y4) * (diepte))\npen down\npen up\nif <<(([sin v] of ((timer) * (100)) ) * (5)) < [0]> and <<<((round (timer)) / (6)) = (round ((timer) / (6)))> or <((round ((timer) - (1))) / (6)) = (round (((timer) - (1)) / (6)))>> or <((round ((timer) - (-1))) / (6)) = (round (((timer) - (-1)) / (6)))>>> then\n set pen size to (((([sin v] of ((timer) * (100)) ) * (6)) + (6)) * (diepte))\n set pen color to (#ffffff)\n go to x: ((((x4) + (4)) + ((x2) / (3))) * (diepte)) y: ((diepte) * (((y4) + (2)) + ((y2) / (3))))\n pen down\n pen up\n go to x: ((((x4) + (-4)) + ((x2) / (3))) * (diepte)) y: ((diepte) * (((y4) + (2)) + ((y2) / (3))))\n pen down\n pen up\n go to x: (0) y: (0)\n set pen size to (10)\nelse\n set pen color to (#ffffff)\n set pen size to (((5) + ((x2) / (20))) * (diepte))\n go to x: ((((x4) + (4)) + ((x2) / (3))) * (diepte)) y: ((diepte) * (((y4) + (2)) + ((y2) / (3))))\n pen down\n pen up\n set pen size to (((5) - ((x2) / (20))) * (diepte))\n go to x: ((((x4) + (-4)) + ((x2) / (3))) * (diepte)) y: ((diepte) * (((y4) + (2)) + ((y2) / (3))))\n pen down\n pen up\n go to x: (0) y: (0)\n set pen size to (10)\nend\n\ndefine 2d blok generator\ngo to x: ((x) * (diepte)) y: ((y) * (diepte))\nset size to ((diepte) * (1030)) %\nstamp\n\ndefine 3d blok generator\npen up\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (40)) * (diepte))\npen down\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: (((x) + ((40) * (-1))) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((-40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: ((((x) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte)) y: ((((y) * ((1) + ((3d diepte) / (200)))) + ((40) * ((1) + ((3d diepte) / (200))))) * (diepte))\npen up\n\ndefine blokken generaator\nset pen size to ((diepte) * (10))\nset [nummer v] to [0]\nrepeat ((15) * (hoe groot spel bord?))\n change [x v] by (-1200)\n repeat (15)\n change [nummer v] by (1)\n if <<(item (nummer) of [1 v]) = [1]> or <<(item (nummer) of [2 v]) = [7]> and <(mode) = [0]>>> then\n if <(item (nummer) of [2 v]) = [1]> then\n set pen color to (#ff0000)\n switch costume to (rood blok v)\n else\n if <(item (nummer) of [2 v]) = [2]> then\n set pen color to (#00ff55)\n switch costume to (groen blok v)\n else\n if <(item (nummer) of [2 v]) = [3]> then\n set pen color to (#ffff00)\n switch costume to (geel blok v)\n else\n if <(item (nummer) of [2 v]) = [4]> then\n set pen color to (#000000)\n switch costume to (zwart blok v)\n else\n if <<(item (nummer) of [2 v]) = [5]> or <(item (nummer) of [2 v]) = [6]>> then\n set pen color to (#4e4e4e)\n switch costume to (grijs blok v)\n else\n if <<(item (nummer) of [2 v]) = [7]> and <(level) = [10]>> then\n set pen color to (#002eff)\n switch costume to (blauw blok v)\n else\n set pen (transparency v) to (100)\n switch costume to (wit blok v)\n end\n end\n end\n end\n end\n end\n if <not <<<(x) > ((270) / (diepte))> or <(x) < ((-270) / (diepte))>> or <<(y) > ((210) / (diepte))> or <(y) < ((-210) / (diepte))>>>> then\n if <(item (nummer) of [2 v]) = [5]> then\n sleutelblok maken\n else\n if <(3d diepte) = [0]> then\n 2d blok generator\n else\n 3d blok generator\n end\n end\n end\n end\n change [x v] by (80)\n end\n change [y v] by (-80)\nend\nchange [y v] by ((1200) * (hoe groot spel bord?))\n\ndefine 3d diepte\ngetal [-200] [140] [3d depth] [100] x---y---geta---grote\nif <<<<(mouse x) < [-150]> and <(mouse x) > [-240]>> and <<(mouse y) < [170]> and <(mouse y) > [150]>>> and <mouse down?>> then\n if <<(mouse x) < [-170]> and <(mouse x) > [-220]>> then\n set [3d diepte v] to (((mouse x) * (2)) + (440))\n else\n if <(mouse x) < [-170]> then\n set [3d diepte v] to [0]\n else\n set [3d diepte v] to [100]\n end\n end\nend\nset pen size to (3)\ngo to x: (-223) y: (160)\nset pen color to (#353535)\npen down\ngo to x: (-167) y: (160)\npen up\ngo to x: ((-220) + ((3d diepte) / (2))) y: (155)\npen down\ngo to x: ((-220) + ((3d diepte) / (2))) y: (165)\nset pen size to (10)\npen up\n\ndefine kaart\nset pen size to (4)\ngo to x: (180) y: (160)\nif <(level) = [10]> then\n if <(round ((y) / (80))) < (((hoe groot spel bord?) - (1)) * (22))> then\n set [nummer v] to ((((hoe groot spel bord?) - (1)) * (225)) + ((([floor v] of (((y) + (36)) / (80)) ) - (((hoe groot spel bord?) - (1)) * (22))) * (15)))\n else\n set [nummer v] to (((hoe groot spel bord?) - (1)) * (225))\n end\nelse\n set [nummer v] to [0]\nend\nrepeat (15)\n set x to (180)\n repeat (15)\n change [nummer v] by (1)\n if <<<(level) = [10]> and <<(nummer) = ((107) + (((round ((((x) * (-1)) + (1280)) / (80))) + (-2)) + ((((hoe groot spel bord?) - (1)) * (225)) + ((([floor v] of (((y) + (40)) / (80)) ) - (((hoe groot spel bord?) - (1)) * (22))) * (15)))))> and <(round ((y) / (80))) < (((hoe groot spel bord?) - (1)) * (22))>>> or <<(nummer) = (((round ((y) / (80))) * (15)) + (round ((((x) * (-1)) + (1280)) / (80))))> and <not <<(level) = [10]> and <(round ((y) / (80))) < (((hoe groot spel bord?) - (1)) * (22))>>>>> then\n set pen color to (#000aff)\n else\n if <(item (nummer) of [1 v]) = [1]> then\n if <(item (nummer) of [2 v]) = [1]> then\n set pen color to (#cc0000)\n else\n if <(item (nummer) of [2 v]) = [2]> then\n set pen color to (#00ce42)\n else\n if <(item (nummer) of [2 v]) = [3]> then\n set pen color to (#cccc00)\n else\n if <(item (nummer) of [2 v]) = [5]> then\n set pen color to (#4e4e4e)\n else\n set pen color to (#000000)\n end\n end\n end\n end\n else\n set pen color to (#ffffff)\n set pen (transparency v) to (30)\n end\n end\n pen down\n go to x: (x position) y: (y position)\n pen up\n change x by (3)\n end\n change y by (-4)\nend\nset pen size to (10)\n\ndefine sleutelblok maken\ngo to x: (((x) + (-35)) * (diepte)) y: (((y) + (7.5)) * (diepte))\npen down\ngo to x: (((x) + (-20)) * (diepte)) y: (((y) + (7.5)) * (diepte))\ngo to x: (((x) + (-20)) * (diepte)) y: (((y) + (-7.5)) * (diepte))\ngo to x: (((x) + (-35)) * (diepte)) y: (((y) + (-7.5)) * (diepte))\ngo to x: (((x) + (-35)) * (diepte)) y: (((y) + (7.5)) * (diepte))\npen up\ngo to x: (((x) + (-20)) * (diepte)) y: (((y) + (0)) * (diepte))\npen down\ngo to x: (((x) + (20)) * (diepte)) y: (((y) + (0)) * (diepte))\ngo to x: (((x) + (20)) * (diepte)) y: (((y) + (-10)) * (diepte))\npen up\ngo to x: (((x) + (5)) * (diepte)) y: (((y) + (0)) * (diepte))\npen down\ngo to x: (((x) + (5)) * (diepte)) y: (((y) + (-10)) * (diepte))\npen up\n\ndefine bewegings besturing 2\nif <(mode) = [0]> then\n set [diepte v] to [0.5]\n go to x: (0) y: (0)\n if <key (up arrow v) pressed?> then\n change [y2 v] by (3)\n end\n if <key (right arrow v) pressed?> then\n change [x2 v] by (3)\n end\n if <key (left arrow v) pressed?> then\n change [x2 v] by (-3)\n end\n if <key (down arrow v) pressed?> then\n change [y2 v] by (-3)\n end\n set [x2 v] to ((x2) * (0.8))\n set [y2 v] to ((y2) * (0.8))\n change y by (y2)\n change x by (x2)\n change [x v] by ((x position) * (-1))\n change [y v] by ((y position) * (-1))\n if <(x) < [41]> then\n set [x v] to [41]\n end\n if <(x) > [1239]> then\n set [x v] to [1239]\n end\n if <(y) < [-39]> then\n set [y v] to [-39]\n end\n if <(y) > ((1160) + (((hoe groot spel bord?) - (1)) * (1200)))> then\n set [y v] to (((1160) + (((hoe groot spel bord?) - (1)) * (1200))) - (1))\n end\n if <<<mouse down?> and <<(round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80))) < ((hoe groot spel bord?) * (16))> and <(round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80))) > [0]>>> and <not <(mouse y) < [-120]>>> then\n if <(soort) = [7]> then\n repeat until <not <[2 v] contains [7]?>>\n replace item (item # of [7] in [2 v]) of [2 v] with [0]\n replace item (item # of [7] in [2 v]) of [1 v] with [0]\n end\n replace item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v] with [7]\n replace item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [1 v] with [0]\n set [3 v] to (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80))))\n else\n if <not <(item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v]) = [7]>> then\n replace item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [1 v] with (soort2)\n replace item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v] with (soort)\n replace item (((round (((y) + (((mouse y) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((mouse x) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [beweging v] with [0]\n end\n end\n end\n if <(mode) = [0]> then\n pen up\n set pen size to (120)\n set pen color to (#ffffff)\n go to x: (240) y: (-180)\n pen down\n go to x: (-240) y: (-180)\n set pen size to (0)\n save\n reload\n end\n set pen (transparency v) to (0)\n set pen size to (5)\n set [nummer v] to [-260]\n set pen color to (#000000)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-240]> and <(mouse x) < [-195]>>> then\n getal [-106] [-100] [this is a block that the] [100] x---y---geta---grote\n getal [-133] [-120] [player can stand on] [100] x---y---geta---grote\n change pen (brightness v) by (20)\n if <mouse down?> then\n set [soort v] to [4]\n set [soort2 v] to [1]\n end\n end\n blokken selecteren generatoor\n set pen color to (#ff0000)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-195]> and <(mouse x) < [-150]>>> then\n getal [-94] [-100] [if the player touches this] [100] x---y---geta---grote\n getal [-90] [-120] [block he dies and respawns] [100] x---y---geta---grote\n change pen (brightness v) by (-50)\n if <mouse down?> then\n set [soort v] to [1]\n set [soort2 v] to [1]\n end\n end\n blokken selecteren generatoor\n set pen color to (#fffe00)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-150]> and <(mouse x) < [-105]>>> then\n getal [-40] [-100] [when the player touches this block] [100] x---y---geta---grote\n getal [-23] [-120] [she automatically jumps 3 blocks high] [100] x---y---geta---grote\n change pen (brightness v) by (-50)\n if <mouse down?> then\n set [soort v] to [3]\n set [soort2 v] to [1]\n end\n end\n blokken selecteren generatoor\n set pen color to (#4e4e4e)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-105]> and <(mouse x) < [-60]>>> then\n getal [-44] [-100] [the player can stand on this block] [100] x---y---geta---grote\n getal [-35] [-120] [ it disappears when the key is taken] [100] x---y---geta---grote\n change pen (brightness v) by (20)\n if <mouse down?> then\n set [soort v] to [6]\n set [soort2 v] to [1]\n end\n end\n blokken selecteren generatoor\n set pen color to (#4e4e4e)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-60]> and <(mouse x) < [-15]>>> then\n getal [-35] [-100] [if the player touches all] [100] x---y---geta---grote\n getal [-35] [-120] [gray blocks disappear] [100] x---y---geta---grote\n change pen (brightness v) by (20)\n if <mouse down?> then\n set [soort v] to [5]\n set [soort2 v] to [1]\n end\n end\n sleutel selecteren generator\n set pen color to (#00ff54)\n if <<(mouse y) < [-140]> and <<(mouse x) > [-15]> and <(mouse x) < [30]>>> then\n getal [10] [-100] [if the player touches] [100] x---y---geta---grote\n getal [10] [-120] [this block he wins] [100] x---y---geta---grote\n change pen (brightness v) by (-50)\n if <mouse down?> then\n set [soort v] to [2]\n set [soort2 v] to [1]\n end\n end\n blokken selecteren generatoor\n set pen color to (#002eff)\n if <<(mouse y) < [-140]> and <<(mouse x) > [30]> and <(mouse x) < [75]>>> then\n getal [55] [-100] [the player] [100] x---y---geta---grote\n getal [55] [-120] [starts here] [100] x---y---geta---grote\n change pen (brightness v) by (-50)\n if <mouse down?> then\n set [soort v] to [7]\n set [soort2 v] to [0]\n end\n end\n blokken selecteren generatoor\n if <key (0 v) pressed?> then\n set [soort v] to [0]\n set [soort2 v] to [0]\n end\nelse\n bewegings besturing <(item (((round (((y) + (((y4) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((x4) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v]) = [4]>\nend\n\ndefine edit\nif <key (b v) pressed?> then\n set [mode v] to [1]\nend\nif <key (space v) pressed?> then\n reload sleutels en grijzen blokken\n wait until <not <key (space v) pressed?>>\n if <(mode) = [1]> then\n set [mode v] to [0]\n else\n set [mode v] to [1]\n end\nend\n\ndefine edit mode?\nif <key (b v) pressed?> then\n reload sleutels en grijzen blokken\n set [y v] to (([floor v] of (((3) - (1)) / (15)) ) * (80))\n set [x v] to ((((((((3) - (1)) / (15)) * (80)) - (([floor v] of (((3) - (1)) / (15)) ) * (80))) * (15)) - (1200)) * (-1))\n set [y2 v] to [0]\n set [x2 v] to [0]\n set [y4 v] to [0]\n set [x4 v] to [0]\nend\n\ndefine getal (x positie) (y positie) (getal) (grote) x---y---geta---grote\nset [nummer 1 v] to [0]\nset size to (grote) %\nset [x3 v] to (((((length of (getal)) * (-6)) + (17.5)) + (x positie)) * ((grote) / (100)))\nset [y3 v] to ((y positie) * ((grote) / (100)))\nrepeat (length of (getal))\n change [nummer 1 v] by (1)\n switch costume to (join (letter (nummer 1) of (getal)) [2])\n if <not <<<(X3) > [233]> or <(X3) < [-233]>> or <<(Y3) > [179]> or <(Y3) < [-179]>>>> then\n go to x: (X3) y: (Y3)\n stamp\n end\n change [x3 v] by ((11) * ((grote) / (100)))\n if <<<(letter ((nummer 1) + (1)) of (getal)) = [i]> or <(letter ((nummer 1) + (1)) of (getal)) = [j]>> or <(letter ((nummer 1) + (1)) of (getal)) = [l]>> then\n change [x3 v] by ((-2) * ((grote) / (100)))\n end\n if <<<(letter (nummer 1) of (getal)) = [i]> or <(letter (nummer 1) of (getal)) = [j]>> or <(letter (nummer 1) of (getal)) = [l]>> then\n change [x3 v] by ((-1) * ((grote) / (100)))\n end\n if <<(letter ((nummer 1) + (1)) of (getal)) = [m]> or <(letter ((nummer 1) + (1)) of (getal)) = [w]>> then\n change [x3 v] by ((3) * ((grote) / (100)))\n end\n if <<(letter (nummer 1) of (getal)) = [m]> or <(letter (nummer 1) of (getal)) = [w]>> then\n change [x3 v] by ((5) * ((grote) / (100)))\n end\n if <(letter (nummer 1) of (getal)) = [ ]> then\n change [x3 v] by ((-6) * ((grote) / (100)))\n end\n if <<(letter ((nummer 1) + (1)) of (getal)) = [r]> or <<(letter ((nummer 1) + (1)) of (getal)) = [t]> or <<(letter ((nummer 1) + (1)) of (getal)) = [c]> or <<(letter ((nummer 1) + (1)) of (getal)) = [f]> or <(letter ((nummer 1) + (1)) of (getal)) = [s]>>>>> then\n change [x3 v] by ((-0.5) * ((grote) / (100)))\n end\n if <<(letter (nummer 1) of (getal)) = [r]> or <<(letter (nummer 1) of (getal)) = [t]> or <<(letter (nummer 1) of (getal)) = [c]> or <<(letter (nummer 1) of (getal)) = [f]> or <(letter (nummer 1) of (getal)) = [s]>>>>> then\n change [x3 v] by ((-1) * ((grote) / (100)))\n end\n if <<(letter (nummer 1) of (getal)) = [n]> or <<(letter (nummer 1) of (getal)) = [h]> or <<(letter (nummer 1) of (getal)) = [p]> or <(letter (nummer 1) of (getal)) = [u]>>>> then\n change [x3 v] by ((2) * ((grote) / (100)))\n end\n if <(letter (nummer 1) of (getal)) = [l]> then\n change [x3 v] by ((-2) * ((grote) / (100)))\n end\nend\nswitch costume to (game6 v)\nset size to ((diepte) * (100)) %\n\ndefine instructie generatoor\nif <<(level) = [2]> and < (2) contains [6]?>> then\n getal ((x) + (-560)) ((y) + (-580)) [grab the key to make the] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-560)) ((y) + (-600)) [gray blocks disappear] ((diepte) * (100)) x---y---geta---grote\nend\nif <(level) = [2]> then\n getal ((x) + (-922)) ((y) + (-1000)) [dont touch lava] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-640)) ((y) + (-980)) [jump extra high ] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-640)) ((y) + (-1000)) [on this block] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-240)) ((y) + (-700)) [hit the green] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-240)) ((y) + (-720)) [block to win] ((diepte) * (100)) x---y---geta---grote\n turn right (([sin v] of ((timer) * (100)) ) * (15)) degrees\n getal ((x) + (-1120)) ((y) + (-1000)) [@] ((diepte) * (100)) x---y---geta---grote\n turn right ((([sin v] of ((timer) * (100)) ) * (15)) * (-1)) degrees\nend\nif <(level) = [3]> then\n getal ((x) + (-740)) ((y) + (-700)) [press s to skip a level] ((diepte) * (100)) x---y---geta---grote\n getal ((x) + (-140)) ((y) + (-950)) [this is the next level] ((diepte) * (100)) x---y---geta---grote\nend\nif <<(level) = [10]> and <(mode) = [0]>> then\n getal [0] [170] [press b to play your level] [100] x---y---geta---grote\n getal [24] [150] [press space to test your level] [100] x---y---geta---grote\n getal [-48] [130] [press 0 for eraser] [100] x---y---geta---grote\n getal [29] [110] [click to place or erase a block] [100] x---y---geta---grote\nend\nif <<(mode) = [1]> and <(level) = [10]>> then\n getal [0] [170] [press space for edit mode] [100] x---y---geta---grote\n getal [-42] [150] [press b to respawn] [100] x---y---geta---grote\nend\npoint in direction (90)\n\ndefine reload sleutels en grijzen blokken\nset [nummer v] to [0]\nrepeat ((225) * (hoe groot spel bord?))\n change [nummer v] by (1)\n if <<(item (nummer) of [2 v]) = [1]> and <(item (nummer) of [1 v]) = [0]>> then\n replace item (nummer) of [1 v] with [1]\n replace item (nummer) of [2 v] with [6]\n end\n if <<(item (nummer) of [2 v]) = [2]> and <(item (nummer) of [1 v]) = [0]>> then\n replace item (nummer) of [1 v] with [1]\n replace item (nummer) of [2 v] with [5]\n end\nend\n\ndefine w (code?)\nif <(length of (code?)) > [0]> then\n delete all of [1 v]\n delete all of [2 v]\n set [nummer v] to [0]\n repeat ((length of (code?)) / (2))\n change [nummer v] by (1)\n add (letter (nummer) of (code?)) to [2 v]\n if <(letter (nummer) of (code?)) = [7]> then\n set [3 v] to (length of [2 v])\n set [y v] to (([floor v] of ((3) / (15)) ) * (80))\n set [x v] to (((((((3) / (15)) * (80)) - (([floor v] of ((3) / (15)) ) * (80))) * (15)) + (-1280)) * (-1))\n end\n end\n repeat ((length of (code?)) / (2))\n change [nummer v] by (1)\n add (letter (nummer) of (code?)) to [1 v]\n end\nend\n\ndefine level? (level?) code? (code?)\nif <((level) - (1)) = (level?)> then\n w (code?)\nend\n\ndefine levels\nlevel? [1] code? [000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000005044444000000004040004000000000060204000000000444444000000000400000070000000400000444114434400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001011111000000001010001000000000010101000000000111111000000000100000000000000100000111111111100000]\nlevel? [2] code? [000000000000000000000000000000000000000006660000000000006260000000000006660000000000440000000000000040000000000044000000000000004000000000000000000000000004300000100000004441000000000050004000000000030004333370000000004444444000000000000000000000000000000000000000001110000000000001110000000000001110000000000110000000000000010000000000011000000000000001000000000000000000000000001100000100000001111000000000010001000000000010001111100000000001111111]\nlevel? [3] code? [444444444444444400000000400024440444040404044400000400400004404640404040404440004404000044400454000404044440404040404004400404040404044440000400404004404044040004404400040004400004404000400040404400404004074004444444444444444111111111111111100000000100011110111010101011100000100100001101110101010101110001101000011100111000101011110101010101001100101010101011110000100101001101011010001101100010001100001101000100010101100101001001001111111111111111]\nlevel? [4] code? [000000000000666000000000000626050000000400646040040000000010010010040000010011000110040000000000100010000070000000000400040000000000100010000400040000010400100011000000100110001000000110000000000000000000000000000000000000000000000000000111000000000000111010000000100111010010000000010010010010000010011000110010000000000100010000000000000000100010000000000100010000100010000010100100011000000100110001000000110000000000000000000000000000000000000000]\nlevel? [5] code? [000000000000000040000000000000000000000000020040000400040040000000000000000040000000000000000000000000000040000000000000000000000000000040404040404000010101010101000000000000000040000000000000000700000000000000333333333333333000000000000000010000000000000000000000000010010000100010010000000000000000010000000000000000000000000000010000000000000000000000000000010101010101000010101010101000000000000000010000000000000000000000000000000111111111111111]\nlevel? [6] code? [444444444444444400100440044244410001000404044400400040004044410004001040004404014040040404400000000400014440404040004004440010040400044400644001040444406624404000004400615404040404440610010001004470610000404404444444344414414111111111111111100100110011111110001000101011100100010001011110001001010001101011010010101100000000100011110101010001001110010010100011100111001010111101111101000001100111101010101110110010001001100110000101101111111111111111]\nlevel? [7] code? [444444440444444411111140400114400000000000014404000040400004401000010111404401004000101004400101041000004400101010000034410030010414144400014000141414400400100000004403000130000004400030013000074404004000333344444144342444444111111110111111111111110100111100000000000011101000010100001101000010111101101001000101001100101011000001100101010000011110010010111111100011000111111100100100000001101000110000001100010011000001101001000111111111111111111111]\nlevel? [8] code? [414141414141414102010000000101404040404040404100000101010001404040404040404101010100010001404040404040404101000001000101404040404040404100010101010101404040404040404100000100000101404040404040404101010001010701414141414141414111111111111111101010000000101101010101010101100000101010001101010101010101101010100010001101010101010101101000001000101101010101010101100010101010101101010101010101100000100000101101010101010101101010001010001111111111111111]\nlevel? [9] code? [000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000007000000000000044400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000]\n\nwhen flag clicked\nvoor bereiding\nif <not <[gebruikers namen v] contains (username)?>> then\n add (username) to [gebruikers namen v]\n add [] to [acount gegevens v]\n opslaan\nend\nbegin\nforever\n erase all\n blokken generaator\n kaart\n 3d diepte\n instructie generatoor\n if <(level) = [10]> then\n bewegings besturing 2\n edit\n else\n bewegings besturing <(item (((round (((y) + (((y4) / (diepte)) * (-1))) / (80))) * (15)) + (round (((((x) + (((x4) / (diepte)) * (-1))) * (-1)) + (1280)) / (80)))) of [2 v]) = [4]>\n end\n player generaator\n edit mode?\n set [☁ data v] to (level)\nend\n\ndefine 2\nset [x2 v] to [0]\nset [y2 v] to [0]\nchange [level v] by (1)\nlevels\nset [diepte v] to [0.25]\nset [x4 v] to [0]\nset [y4 v] to [0]\n\nset [x2 v] to [0]\nset [y2 v] to [0]\nif <<(level) = [1]> or <(level) = [9]>> then\n change [level v] by (1)\nend\nif <(level) = (levels ontgrendelt?)> then\n change [levels ontgrendelt? v] by (1)\nend\nlevels selecteren generatoor\nlevels\nset [diepte v] to [0.25]\nset [x4 v] to [0]\nset [y4 v] to [0]\n\ndefine 3\nrepeat (360)\n move ((180) * ((([sin v] of (((timer) - (-1)) * (20)) ) * ((([sin v] of ((timer) * (20)) ) * (0.5)) + (0.7))) + (1.7))) steps\n move ((-180) * ((([sin v] of (((timer) - (-1)) * (20)) ) * (((([sin v] of ((timer) * (20)) ) * (0.5)) + (0.7)) + (([sin v] of ((timer) * (12.5)) ) / (10)))) + (1.7))) steps\n if <[] = [1]> then\n set pen color to (#000000)\n set pen (brightness v) to (([sin v] of ((timer) * (50)) ) * (100))\n turn right (round (((timer) / (10)) + (1))) degrees\n else\n change pen (color v) by (0.277777)\n turn right (1) degrees\n end\nend\n\ndefine begin\nset [diepte v] to [0]\ndelete all of [vertaalde woorden v]\nadd (translate [play] to ((language::translate) v)::translate) to [vertaalde woorden v]\nadd (translate [level maker] to ((language::translate) v)::translate) to [vertaalde woorden v]\nrepeat until <(diepte) = [1]>\n erase all\n herhaal ding voor begin\nend\nwait until <not <mouse down?>>\nset [diepte v] to [0]\nif <(level) = [1]> then\n set [levels ontgrendelt? v] to [1]\n levels selecteren generatoor\nend\npoint in direction (90)\nset [3d diepte v] to [0]\nset [mode v] to [0]\nhide\n2\n\ndefine herhaal ding voor begin\npen down\nset pen color to (#ffffff)\ngo to x: (240) y: (-180)\nset pen size to (100000)\ngo to x: (-240) y: (180)\npen up\ngo to x: ((((length of (item (1) of [vertaalde woorden v])) * (-6)) + (17.5)) * (2)) y: (((-30) + (([sin v] of ((timer) * (200)) ) * (3))) * (2))\npen down\nset pen size to (40)\nif <<<<(mouse y) > [-90]> and <(mouse y) < [-30]>> and <(mouse x) > (((((length of (item (1) of [vertaalde woorden v])) * (-6)) + (17.5)) * (2)) - (40))>> and <(mouse x) < (((((length of (translate [play] to ((language::translate) v)::translate)) * (-6)) + (17.5)) * (-2)) + (40))>> then\n set pen color to (#1c9b00)\n if <mouse down?> then\n set [diepte v] to [1]\n set [level v] to [1]\n end\nelse\n set pen color to (#32ff00)\nend\ngetal [0] ((-30) + (([sin v] of ((timer) * (200)) ) * (3))) (item (1) of [vertaalde woorden v]) [200] x---y---geta---grote\npen up\nswitch costume to (s2 v)\ngetal [0] ((-30) + (([sin v] of ((timer) * (200)) ) * (3))) (item (1) of [vertaalde woorden v]) [200] x---y---geta---grote\npen up\ngo to x: ((((length of (item (2) of [vertaalde woorden v])) * (-6)) + (17.5)) * (2)) y: (((30) + (([sin v] of ((timer) * (200)) ) * (3))) * (2))\npen down\nset pen size to (40)\nif <<<<(mouse y) > [30]> and <(mouse y) < [90]>> and <(mouse x) > (((((length of (item (2) of [vertaalde woorden v])) * (-6)) + (17.5)) * (2)) - (40))>> and <(mouse x) < (((((length of (translate [play] to ((language::translate) v)::translate)) * (-6)) + (17.5)) * (-2)) + (1000))>> then\n set pen color to (#9b0000)\n if <mouse down?> then\n set [diepte v] to [1]\n set [level v] to [9]\n end\nelse\n set pen color to (#ff0000)\nend\ngetal [0] ((30) + (([sin v] of ((timer) * (200)) ) * (3))) (item (2) of [vertaalde woorden v]) [200] x---y---geta---grote\npen up\nswitch costume to (s2 v)\ngetal [0] ((30) + (([sin v] of ((timer) * (200)) ) * (3))) (item (2) of [vertaalde woorden v]) [200] x---y---geta---grote\n\ndefine reload\npen up\ngo to x: (180) y: (-140)\npen down\nset pen size to (20)\nif <<<<(mouse y) > [-150]> and <(mouse y) < [-130]>> and <(mouse x) > (((((length of [reload]) * (-6)) + (17.5)) * (2)) - (-185))>> and <(mouse x) < (((((length of (translate [play] to ((language::translate) v)::translate)) * (-6)) + (17.5)) * (-2)) + (210))>> then\n set pen color to (#9b0000)\n if <mouse down?> then\n pen down\n set pen color to (#ffffff)\n go to x: (240) y: (-180)\n set pen size to (100000)\n go to x: (-240) y: (180)\n pen up\n ask [code?] and wait\n w (answer)\n erase all\n end\nelse\n set pen color to (#ff0000)\nend\ngetal [200] [-140] [reload] [100] x---y---geta---grote\npen up\nswitch costume to (s2 v)\ngetal [200] [-140] [reload] [100] x---y---geta---grote\n\ndefine save\npen up\ngo to x: (190) y: (-165)\npen down\nset pen size to (20)\nif <<<<(mouse y) > [-175]> and <(mouse y) < [-155]>> and <(mouse x) > (((((length of [save]) * (-6)) + (17.5)) * (2)) - (-185))>> and <(mouse x) < (((((length of (translate [play] to ((language::translate) v)::translate)) * (-6)) + (17.5)) * (-2)) + (210))>> then\n set pen color to (#1c9b00)\n if <mouse down?> then\n hide list [copy this v]\n delete all of [copy this v]\n add (join (2) (1)) to [copy this v]\n set size to (100) %\n go to x: (0) y: (0)\n switch costume to (close2 v)\n stamp\n wait until <not <mouse down?>>\n wait until <mouse down?>\n wait until <not <mouse down?>>\n show list [copy this v]\n erase all\n end\nelse\n set pen color to (#32ff00)\nend\ngetal [200] [-165] [save] [100] x---y---geta---grote\npen up\nswitch costume to (s2 v)\ngetal [200] [-165] [save] [100] x---y---geta---grote\n\ndefine blokken selecteren generatoor\nchange [nummer v] by (45)\ngo to x: ((nummer) + (-20)) y: ((-160) + (20))\npen down\ngo to x: ((nummer) + (20)) y: ((-160) + (20))\ngo to x: ((nummer) + (20)) y: ((-160) + (-20))\ngo to x: ((nummer) + (-20)) y: ((-160) + (-20))\ngo to x: ((nummer) + (-20)) y: ((-160) + (20))\ngo to x: ((nummer) + (20)) y: ((-160) + (-20))\npen up\n\ndefine sleutel selecteren generator\nchange [nummer v] by (45)\ngo to x: ((nummer) + ((0.5) * (-35))) y: ((-160) + ((7.5) * (0.5)))\npen down\ngo to x: ((nummer) + ((-20) * (0.5))) y: ((-160) + ((7.5) * (0.5)))\ngo to x: ((nummer) + ((0.5) * (-20))) y: ((-160) + ((-7.5) * (0.5)))\ngo to x: ((nummer) + ((0.5) * (-35))) y: ((-160) + ((-7.5) * (0.5)))\ngo to x: ((nummer) + ((0.5) * (-35))) y: ((-160) + ((7.5) * (0.5)))\npen up\ngo to x: ((nummer) + ((-20) * (0.5))) y: ((-160) + (0))\npen down\ngo to x: ((nummer) + ((20) * (0.5))) y: ((-160) + (0))\ngo to x: ((nummer) + ((20) * (0.5))) y: ((-160) + ((-10) * (0.5)))\npen up\ngo to x: ((nummer) + ((5) * (0.5))) y: ((-160) + (0))\npen down\ngo to x: ((nummer) + ((5) * (0.5))) y: ((-160) + ((-10) * (0.5)))\npen up\n\ndefine levels selecteren generatoor\nrepeat until <(diepte) = [1]>\n erase all\n go to x: (-240) y: (-180)\n set pen color to (#ffffff)\n set pen size to (1000000)\n pen down\n go to x: (240) y: (180)\n pen up\n level [1] [-120] x [100] y\n level [2] [0] x [100] y\n level [3] [120] x [100] y\n level [4] [-120] x [0] y\n level [5] [0] x [0] y\n level [6] [120] x [0] y\n level [7] [-120] x [-100] y\n level [8] [0] x [-100] y\nend\n\ndefine level (level?) (x) x (y) y\nset pen color to (#0dcc00)\ngo to x: ((x) + (7)) y: ((y) + (-7))\nset pen size to (40)\nchange x by (-20)\nchange y by (-15)\npen down\nchange x by (40)\nchange y by (30)\nchange x by (-40)\nchange y by (-30)\npen up\nchange pen (brightness v) by (20)\nif <<<<(mouse x) > ((x) - (50))> and <(mouse x) < ((x) + (50))>> and <<(mouse y) > ((y) - (50))> and <(mouse y) < ((y) + (50))>>> and <not <(level?) > (levels ontgrendelt?)>>> then\n go to x: ((x) + (5)) y: ((y) + (-5))\n if <mouse down?> then\n set [diepte v] to [1]\n set [level v] to (level?)\n end\nelse\n go to x: (x) y: (y)\nend\nset pen size to (40)\nchange x by (-20)\nchange y by (-15)\npen down\nchange x by (40)\nchange y by (30)\nchange x by (-40)\nchange y by (-30)\npen up\nif <(level?) > (levels ontgrendelt?)> then\n switch costume to (lock v)\n go to x: ((x) - (-5)) y: ((y) - (5))\n set size to (100) %\n stamp\nelse\n getal (((x) / (3)) - (10)) ((y) / (3)) (level?) [300] x---y---geta---grote\nend\n\nwhen flag clicked\n\nforever\n set size to (1000) %\nend\n\npen up\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (40)) * (diepte))\npen down\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (-40)) * (diepte))\ngo to x: (((x) + (-40)) * (diepte)) y: (((y) + (40)) * (diepte))\ngo to x: (((x) + (40)) * (diepte)) y: (((y) + (-40)) * (diepte))\npen up\n\nwhen flag clicked\nforever\n if <(item ((107) + (((round ((((x) * (-1)) + (1280)) / (80))) + (-2)) + ((((hoe groot spel bord?) - (1)) * (225)) + ((([floor v] of (((y) + (40)) / (80)) ) - (((hoe groot spel bord?) - (1)) * (22))) * (15))))) of [2 v]) = [4]> then\n set [☁ data v] to [1]\n else\n set [☁ data v] to [0]\n end\nend\n\nwhen I start as a clone\nlevels selecteren generatoor\ndelete this clone\n\nset [diepte v] to [0]\nif <((level) + (-2)) = (levels ontgrendelt?)> then\n change [levels ontgrendelt? v] by (1)\nend\ncreate clone of (_myself_ v)\nwait until <(diepte) = [1]>\n\nset [diepte v] to [0.5]\n\ndefine schud het scherm (heftig heid)\nchange [y4 v] by ((extra y) * (-1))\nchange [x4 v] by ((extra x) * (-1))\nchange [y v] by ((extra y) * (-1))\nchange [x v] by ((extra x) * (-1))\nchange [extra y v] by (pick random (heftig heid) to ((heftig heid) * (-1)))\nchange [extra x v] by (pick random (heftig heid) to ((heftig heid) * (-1)))\nset [extra y v] to ((extra y) * (0.8))\nset [extra x v] to ((extra x) * (0.8))\nchange [y4 v] by (extra y)\nchange [x4 v] by (extra x)\nchange [y v] by (extra y)\nchange [x v] by (extra x)\n\nset [3 v] to [0]\nrepeat (100)\n change [3 v] by (-0.2)\n set [3 v] to ((3) * (0.8))\nend\n\n@intro\n\nwhen flag clicked\nshow\nset [ghost v] effect to (100)\n\n
⏫ \n CONTROLS ⏪⏬⏩\n-------------------------------------------------------------------------\n press S to skip a level\n
Winter ( A Platformer )
@Stage\n\nwhen flag clicked\nswitch backdrop to (lvl 1 v)\n\nwhen flag clicked\nforever\n set volume to (50) %\n play sound [Winter.Sound.Effect.mp3 v] until done\nend\n\n@Snow\n\nwhen flag clicked\nhide\nforever\n wait (0.1) seconds\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nforever\n change y by (-10)\nend\n\nwhen I start as a clone\ngo to [front v] layer\nshow\ngo to x: (pick random (-237) to (237)) y: (179)\nforever\n repeat until <touching color (#01efe0)?>\n repeat (3)\n change x by (2)\n end\n wait (0.1) seconds\n repeat (6)\n change x by (-2)\n end\n wait (0.1) seconds\n repeat (3)\n change x by (2)\n end\n end\n wait until <<touching color (#01efe0)?> or <<touching color (#ff0000)?> or <(y position) = [-176]>>>\n forever\n delete this clone\n end\nend\n\n@Player\n\nwhen flag clicked\nwait until <(backdrop [name v]) = [Lvl 1]>\nif <(backdrop [name v]) = [Lvl 1]> then\n go to x: (-202) y: (-97)\nend\n\nwhen flag clicked\nforever\n if <(Freeze!) = [0]> then\n switch costume to (costume1 v)\n else\n if <(Freeze!) = [1]> then\n switch costume to (costume2 v)\n else\n if <(Freeze!) = [2]> then\n switch costume to (costume4 v)\n end\n end\n end\nend\n\nwhen flag clicked\nswitch costume to (costume1 v)\nset [freeze! v] to [0]\nset [x v] to [0]\nset [y v] to [0]\nforever\n if <<(Freeze!) = [0]> or <(Freeze!) = [2]>> then\n change [y v] by (-1)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if then\n change y by (1)\n end\n if then\n change y by (1)\n end\n if then\n change y by (1)\n end\n if then\n change y by (1)\n end\n if then\n change y by (-4)\n change x by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <touching color (#01efe0)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#01efe0)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if then\n start sound [Click_Button_3.mp3 v]\n set [ghost v] effect to (60)\n wait (0.1) seconds\n set [ghost v] effect to (0)\n go to x: (-227) y: (41)\n end\n if <(x position) > [211]> then\n if <not <(backdrop [name v]) = [End]>> then\n go to x: (-211) y: (41)\n next backdrop\n end\n if <(backdrop [name v]) = [Lvl 5]> then\n go to x: (-197) y: (-77)\n else\n if <(backdrop [name v]) = [Lvl 6]> then\n go to x: (-203) y: (38)\n else\n if <(backdrop [name v]) = [Lvl 7]> then\n go to x: (-203) y: (-10)\n else\n if <(backdrop [name v]) = [Lvl 9]> then\n go to x: (-207) y: (-61)\n else\n if <(backdrop [name v]) = [Lvl 9]> then\n go to x: (-207) y: (-61)\n else\n if <(backdrop [name v]) = [Lvl 1]> then\n go to x: (-195) y: (-89)\n else\n if <(backdrop [name v]) = [Lvl 10]> then\n change [freeze! v] by (1)\n go to x: (-209) y: (-108)\n end\n end\n end\n end\n end\n end\n end\n end\n else\n if <(Freeze!) = [3]> then\n change [y v] by (0)\n else\n if <(Freeze!) = [1]> then\n change [x v] by (0)\n end\n end\n end\nend\n\n@Mr. Reverse\n\nwhen flag clicked\ngo to x: (164) y: (-112)\nhide\n\nwhen flag clicked\nwait until <(Freeze!) = [1]>\nshow\nif <(Freeze!) = [1]> then\n show\n set size to (100) %\n wait (0.8) seconds\n switch costume to (hood v)\n wait (0.8) seconds\n start sound [Mario_Jump.mp3 v]\n glide (0.3) secs to x: (164) y: (-96)\n set size to (140) %\n wait (0.1) seconds\n set size to (150) %\n wait (0.1) seconds\n glide (0.3) secs to x: (164) y: (-212)\n hide\n change [freeze! v] by (-1)\nend\n\nset [freeze! v] to [1]\n\n@Ice Crown\n\nwhen flag clicked\ngo to x: (100) y: (-50)\nrepeat until <(backdrop [name v]) = [End]>\n hide\nend\n\nwhen flag clicked\nrepeat (1)\n set [freeze! v] to [0]\nend\n\nwhen backdrop switches to [end v]\nwait until <(backdrop [name v]) = [End]>\nshow\nrepeat until <touching (player v)?>\n if <(backdrop [name v]) = [End]> then\n repeat (3)\n change y by (2)\n end\n repeat (6)\n change y by (-2)\n end\n repeat (3)\n change y by (2)\n end\n end\nend\nwait until <touching (player v)?>\nif <touching (player v)?> then\n start sound [Click_Button_2.mp3 v]\n set [ghost v] effect to (60)\n wait (0.1) seconds\n set [ghost v] effect to (0)\n hide\n set [freeze! v] to [2]\n broadcast (Continue? v)\nend\n\n@:o\n\nwhen flag clicked\nset [stage v] to [0]\nforever\n go to x: (130) y: (-117)\n if <not <(backdrop [name v]) = [Lvl 5]>> then\n repeat until <(backdrop [name v]) = [Lvl 5]>\n hide\n end\n else\n end\nend\n\nwhen flag clicked\nforever\n if <(Stage) = [1]> then\n switch costume to (costume2 v)\n else\n if <(Stage) = [2]> then\n switch costume to (costume3 v)\n else\n if <(Stage) = [3]> then\n switch costume to (costume4 v)\n wait (0.8) seconds\n set [ghost v] effect to (60)\n wait (0.1) seconds\n set [ghost v] effect to (0)\n hide\n change [silence! v] by (1)\n end\n end\n end\nend\n\nwhen flag clicked\nwait until <(backdrop [name v]) = [Lvl 5]>\nif <(backdrop [name v]) = [Lvl 5]> then\n show\n switch costume to (costume1 v)\nend\n\nwhen flag clicked\nswitch costume to (costume1 v)\n\nwhen this sprite clicked\nplay sound [Crystal.Crack.mp3 v] until done\nchange [stage v] by (1)\n\n@Remember this?\n\nwhen this sprite clicked\nstart sound [Collect.mp3 v]\nset [ghost v] effect to (60)\nwait (0.1) seconds\nset [ghost v] effect to (0)\nhide\nchange [silence! v] by (1)\nbroadcast (lol! v)\n\nwhen flag clicked\nset [silence! v] to [0]\nforever\n if <(Silence!) = [1]> then\n show\n go to x: (141) y: (-131)\n else\n if <(Silence!) = [0]> then\n hide\n end\n end\nend\n\nwhen flag clicked\nforever\n set size to (90) %\n wait (1) seconds\n set size to (100) %\n wait (1) seconds\nend\n\n@Hooray\n\nwhen flag clicked\ngo to x: (-284) y: (-45)\nhide\n\nwhen I receive [lol! v]\nstart sound [Click_Button_2.mp3 v]\nshow\nglide (1) secs to x: (-202) y: (-45)\nwait (1.5) seconds\nglide (1) secs to x: (-284) y: (-45)\nhide\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\ngo to [front v] layer\nshow\n\n@- Sign -\n\nwhen flag clicked\ngo to x: (178) y: (-201)\nhide\n\nwhen I receive [continue? v]\nshow\ngo to [front v] layer\nglide (1) secs to x: (178) y: (-155)\n\n
--- STORY ---\nPrince Winterling was playing in the snow but suddenly a strong wind blows his crown. So he began to search and travel then the adventure awaits.\n\n- If the game is glitching try double click the ( Green flag )\n- Use the arrow keys for movement.\n- There is a *Shhhh * ....... ( secret ).
santa platformer
@Stage\n\n@download (2)\n\nwhen flag clicked\nset [x v] to [0]\nset [y v] to [0]\nshow\nforever\n change [y v] by (-1)\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (1)\n end\n if <touching color (#000008)?> then\n change y by (-4)\n change x by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#000008)?>> then\n set [y v] to [17]\n end\n change y by (1)\n if <touching color (#003fff)?> then\n set [y v] to [25]\n end\n if <touching color (#ff0000)?> then\n go to x: (-214) y: (-114)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\nend\n\nwhen flag clicked\nswitch costume to (download \(2\) v)\nswitch backdrop to (backdrop1 v)\ngo to x: (-201) y: (-119)\nset [stage v] to [1]\nforever\n if <<(x position) > [237]> and <not <<(stage) = [20]> or <(stage) = [21]>>>> then\n go to x: (-214) y: (-114)\n change [stage v] by (1)\n switch backdrop to (next backdrop v)\n end\n if <(stage) = [8]> then\n if <touching color (#ff9999)?> then\n switch costume to (cool santa v)\n end\n if <touching color (#6600cc)?> then\n switch costume to (download \(2\) v)\n end\n end\n if <(stage) = [15]> then\n if <touching color (#ff9999)?> then\n switch costume to (cool santa v)\n end\n if <touching color (#6600cc)?> then\n switch costume to (download \(2\) v)\n end\n if <touching color (#ffd499)?> then\n switch costume to (santa_claus_png38508 v)\n end\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nset [mesage v] to [0]\nhide\nforever\n if <(stage) = [7]> then\n go to x: (163) y: (-36)\n show\n if <touching (download \(2\) v)?> then\n broadcast (unhide 1 v)\n change [mesage v] by (1)\n forever\n hide\n end\n end\n end\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (17) y: (-150)\nhide\nforever\n if <<(stage) = [7]> and <(mesage) = [0]>> then\n show\n end\nend\n\nwhen I receive [unhide 1 v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nset [score v] to [0]\nhide\ngo to (random position v)\nset y to (180)\nforever\n if <(stage) = [20]> then\n show\n change y by (-5.5)\n if <touching (download \(2\) v)?> then\n change [score v] by (1)\n go to (random position v)\n set y to (180)\n end\n if <touching color (#000000)?> then\n switch backdrop to (cool santa v)\n set [stage v] to [8]\n hide\n end\n if <(score) = [10]> then\n switch backdrop to (win v)\n end\n end\nend\n\n@Sprite4\n\nwhen flag clicked\nhide\n\n
use arrow keys to move\nUp arrow to jump\nthere is wall jumping\nred kills you\nblue shoots you up\n
Inverses: A multitask platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nset [ghost v] effect to (100)\nrepeat (5)\n change [ghost v] effect by (-20)\nend\nbroadcast (Start Game v)\n\nswitch backdrop to (intro v)\nset [gamemode v] to [Intro]\nwait until <(GameMode) = [Main Menu]>\n\nwhen I receive [reset v]\nset [ghost v] effect to (100)\nrepeat (5)\n change [ghost v] effect by (-20)\nend\n\nwhen [r v] key pressed\nbroadcast (Reset v)\n\nwhen [p v] key pressed\nif <(Level) = [13]> then\n if <(Username list showing?) = [no]> then\n hide list [hall of fame v]\n set [username list showing? v] to [yes]\n else\n show list [hall of fame v]\n set [username list showing? v] to [no]\n end\nend\n\nwhen flag clicked\nshow list [hall of fame v]\nset [username list showing? v] to [no]\n\n@Thumbnail\n\nhide\n\nwhen I receive [tick v]\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\nshow\ngo to [front v] layer\n\n@Black Character\n\nwhen flag clicked\nhide\ngo to [front v] layer\nswitch costume to (normal v)\nset size to (20) %\n\nwhen I receive [start game v]\nshow\nbroadcast (Reset v)\n\nwhen I receive [start game v]\nforever\n if <(Hint State) = [0]> then\n if <key (right arrow v) pressed?> then\n point in direction (-90)\n change [xv - black v] by (1)\n end\n if <key (left arrow v) pressed?> then\n point in direction (90)\n change [xv - black v] by (-1)\n end\n set [xv - black v] to ((Xv - black) * (0.9))\n change x by (Xv - black)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change y by (1)\n if then\n change x by ((Xv - black) * (-1))\n set [yv - black v] to [0]\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv - black) > [0]> then\n set [xv - black v] to [-5]\n else\n set [xv - black v] to [5]\n end\n set [yv - black v] to [10]\n else\n set [xv - black v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv - black v] by (-1)\n change y by (Yv - black)\n if <<touching color (#b2b2b2)?> or <touching color (#000000)?>> then\n change y by ((Yv - black) * (-1))\n set [yv - black v] to [0]\n end\n change y by (-1)\n if <<touching color (#b2b2b2)?> or <touching color (#000000)?>> then\n if <key (up arrow v) pressed?> then\n set [yv - black v] to [12]\n end\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n broadcast (Reset v)\n end\n end\n if <touching color (#c841ff)?> then\n set [yv - black v] to [-20]\n end\n if <touching color (#ffec24)?> then\n set [yv - black v] to [20]\n end\nend\n\nwhen I receive [start game v]\nset [level v] to [1]\n\nwhen [space v] key pressed\n\nbroadcast (Start Game v)\n\nwhen I receive [reset v]\ngo to x: (-137) y: (-130)\nset rotation style [left-right v]\npoint in direction (-90)\nset [yv - black v] to [0]\nset [xv - black v] to [0]\n\n@White Character\n\nwhen flag clicked\nhide\nset size to (20) %\n\nwhen I receive [start game v]\nforever\n if <(Hint State) = [0]> then\n if <key (d v) pressed?> then\n point in direction (-90)\n change [xv - white v] by (1)\n end\n if <key (a v) pressed?> then\n point in direction (90)\n change [xv - white v] by (-1)\n end\n set [xv - white v] to ((Xv - white) * (0.9))\n change x by (Xv - white)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by (1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by (1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by (1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by (1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by (1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change x by ((Xv - white) * (-1))\n set [yv - white v] to [0]\n change y by (-5)\n if <key (w v) pressed?> then\n if <(Xv - white) > [0]> then\n set [xv - white v] to [-5]\n else\n set [xv - white v] to [5]\n end\n set [yv - white v] to [10]\n else\n set [xv - white v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv - white v] by (-1)\n change y by (Yv - white)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n change y by ((Yv - white) * (-1))\n set [yv - white v] to [0]\n end\n change y by (-1)\n if <<touching color (#b2b2b2)?> or <touching color (#ffffff)?>> then\n if <key (w v) pressed?> then\n set [yv - white v] to [12]\n end\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n broadcast (Reset v)\n end\n if <touching color (#c841ff)?> then\n set [yv - white v] to [-20]\n end\n if <touching color (#ffec24)?> then\n set [yv - white v] to [20]\n end\n end\nend\n\nwhen I receive [start game v]\ngo to [front v] layer\nshow\n\nwhen I receive [reset v]\ngo to x: (-180) y: (-130)\nset rotation style [left-right v]\npoint in direction (-90)\nset [xv - white v] to [0]\nset [yv - white v] to [0]\n\n@Ground\n\nturn right (7) degrees\npoint in direction (90)\n\nchange size by (200)\n\nwhen I receive [next level v]\nif <(Level) = [6]> then\n switch costume to (7 v)\nelse\n if <(Level) = [8]> then\n switch costume to (9 v)\n else\n if <(Level) = [12]> then\n switch costume to (end v)\n else\n if <(Level) = [13]> then\n switch costume to (end v)\n else\n next costume\n end\n end\n end\nend\nchange [level v] by (1)\n\nset [switch state v] to [0]\nwait (0) seconds\n\nwhen I receive [start game v]\nswitch costume to (1 v)\nset [level v] to [1]\n\nwhen I receive [tick v]\nif <(Level) = [6]> then\n if <(Switch State) = [1]> then\n switch costume to (6a v)\n else\n switch costume to (6b v)\n end\nend\nif <(Level) = [8]> then\n if <(Switch State) = [1]> then\n switch costume to (8a v)\n else\n switch costume to (8b v)\n end\nend\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset size to (100) %\n\n@FPS Counter\n\nwhen I receive [tick v]\nchange [frames v] by (1)\n\nwhen I receive [start game v]\nset [sine factor v] to [0]\nforever\n broadcast (tick v)\nend\n\nwhen I receive [start game v]\nreset timer\nforever\n set [frames v] to [0]\n set [start time v] to (timer)\n wait until <(timer) > ((start time) + (1))>\n set [fps v] to (frames)\nend\n\nwhen flag clicked\nforever\n change [sine factor v] by (3)\nend\n\nwhen flag clicked\nset [last lvl legit? v] to [True]\n\nwhen flag clicked\nwait (5) seconds\nwait until <(Level) = [13]>\nif <(Last Lvl Legit?) = [True]> then\n broadcast (Beat Last Level Legit v)\nend\n\n@Keys\n\nset size to (200) %\ngo to [back v] layer\n\nwhen I receive [reset v]\nset [white key state v] to [1]\nset [black key state v] to [1]\nbroadcast (Spawn Keys v)\n\nwhen I receive [spawn keys v]\nswitch costume to (white key v)\ncreate clone of (_myself_ v)\nswitch costume to (black key v)\ncreate clone of (_myself_ v)\n\nwhen flag clicked\nhide\n\nwhen I start as a clone\ngo to [front v] layer\nshow\nif <(costume [number v]) = [1]> then\n set x to (item (Level) of [xloc white key v])\n set y to (item (Level) of [yloc white key v])\n wait until <touching (white character v)?>\n hide\n broadcast (Key Collected v)\n set [white key state v] to [0]\n delete this clone\nelse\n set x to (item (Level) of [xloc black key v])\n set y to (item (Level) of [yloc black key v])\n wait until <touching (black character v)?>\n hide\n broadcast (Key Collected v)\n set [black key state v] to [0]\n delete this clone\nend\n\ndelete (11) of [yloc white key v]\ndelete (11) of [xloc white key v]\n\nadd [-5] to [xloc white key v]\nadd [75] to [yloc white key v]\n\nadd [80] to [xloc black key v]\nadd [80] to [yloc black key v]\n\nwhen I receive [reset v]\ndelete this clone\n\ndelete (10) of [yloc black key v]\ndelete (10) of [xloc black key v]\n\nwhen I start as a clone\nforever\n if <(Level) = [13]> then\n delete this clone\n end\nend\n\n@Portal particles\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nforever\n if <<(Black Key State) = [0]> and <(White Key State) = [0]>> then\n create clone of (_myself_ v)\n end\nend\n\nwhen I receive [reset v]\ndelete this clone\n\nwhen I start as a clone\nshow\ngo to [front v] layer\nclear graphic effects\ngo to (portal v)\npoint in direction (pick random (1) to (360))\nrepeat (20)\n move (2) steps\n turn right (5) degrees\n change [ghost v] effect by (2)\nend\ndelete this clone\n\nadd [220] to [xloc portal v]\n\ndelete (12) of [xloc portal v]\n\n@WASD\n\nwhen I receive [start game v]\nshow\nset size to (70) %\ngo to [back v] layer\nrepeat until <not <(Level) = [1]>>\n go to (white character v)\n change y by ((35) + ((3) * ([sin v] of (Sine Factor) )))\nend\nhide\ngo to x: (1000) y: (1000)\n\nchange [sine factor v] by (1)\n\ndelete this clone\n\nwhen I start as a clone\n\nwhen I receive [tick v]\n\nwait (0) seconds\n\n@Arrows\n\nwhen I receive [tick v]\n\nwait (0) seconds\n\nwhen I receive [start game v]\nshow\nset size to (70) %\ngo to [back v] layer\nrepeat until <not <(Level) = [1]>>\n go to (black character v)\n change y by ((35) + ((3) * ([sin v] of (Sine Factor) )))\nend\nhide\ngo to x: (1000) y: (1000)\n\n@Portal\n\nwhen flag clicked\nset size to (12) %\ngo to x: (0) y: (0)\nforever\n go to [back v] layer\n set x to (item (Level) of [xloc portal v])\n set y to ((-120) + ((-5) * ([sin v] of (Sine Factor) )))\n set [brightness v] effect to (pick random (0) to (5))\n wait (0.1) seconds\nend\n\nwhen I receive [tick v]\nif <(costume [number v]) = [1]> then\n if <<touching (white character v)?> or <touching (black character v)?>> then\n broadcast (Next Level v)\n broadcast (Reset v) and wait\n end\nend\n\nwhen I receive [tick v]\nif <<(Black Key State) = [0]> and <(White Key State) = [0]>> then\n switch costume to (unlocked v)\nelse\n if <<(Black Key State) = [0]> and <(White Key State) = [1]>> then\n switch costume to (white locked v)\n else\n if <<(Black Key State) = [1]> and <(White Key State) = [0]>> then\n switch costume to (black locked v)\n else\n if <<(Black Key State) = [1]> and <(White Key State) = [1]>> then\n switch costume to (white locked + black locked v)\n end\n end\n end\nend\n\nwhen [n v] key pressed\nif <(Level) = [12]> then\n set [last lvl legit? v] to [False]\nend\nif <(Level) < [13]> then\n broadcast (Next Level v)\n broadcast (Reset v)\nend\n\nwhen I receive [tick v]\nif <(Level) = [13]> then\n hide\nelse\n show\nend\n\n@MUSIC\n\nwhen flag clicked\nset volume to (100) %\nforever\n play sound [Vexento - Particles v] until done\nend\n\nwhen [m v] key pressed\nif <(volume) = [100]> then\n set volume to (0) %\nelse\n set volume to (100) %\nend\n\n@Switch\n\nwhen I receive [tick v]\nif <(Switch State) = [1]> then\n switch costume to (left v)\nelse\n switch costume to (right v)\nend\n\nwhen flag clicked\nset size to (20) %\nforever\n if <<<touching (black character v)?> or <touching (white character v)?>> and <key (space v) pressed?>> then\n if <(Switchable?) = [1]> then\n if <(Switch State) = [1]> then\n set [switch state v] to [0]\n else\n set [switch state v] to [1]\n end\n set [switchable? v] to [0]\n end\n else\n set [switchable? v] to [1]\n end\nend\n\nwhen I receive [reset v]\nset [switch state v] to [1]\n\nwhen I receive [tick v]\nif <(Level) = [6]> then\n show\n go to x: (-200) y: (0)\nelse\n if <(Level) = [8]> then\n show\n go to x: (150) y: (-153)\n else\n \n end\nend\n\nset size to (20) %\n\n@Hints\n\nwhen I receive [start game v]\ngo to x: (0) y: (0)\nset [hint state v] to [0]\nset [ghost v] effect to (30)\ngo to [front v] layer\nhide\n\nforever\n\nwhen I receive [tick v]\ngo to [front v] layer\nswitch costume to (Level)\nif <(Hint State) = [1]> then\n show\nelse\n hide\nend\n\nwhen [h v] key pressed\nif <(Hint State) = [1]> then\n set [hint state v] to [0]\nelse\n set [hint state v] to [1]\nend\n\n@Saves Reader\n\nwhen I receive [load data v]\nset [chars v] to [abcdefghijklmnopqrstuvwxyz!@#$%^&*\(\)~`";:?/.>,<|\}\]{\[+=_-1234567890 ]\nif <not <[hall of fame v] contains (username)?>> then\n Encode Username\nend\ndelete (all) of [hall of fame v]\nDecode Usernames\n\ndefine Convert [] to Numbers\nset [append to me! v] to []\nset [i1 v] to [1]\nrepeat (length of (letters))\n set [i2 v] to [1]\n repeat until <(letter (i2) of (Chars)) = (letter (i1) of (letters))>\n change [i2 v] by (1)\n end\n if <(length of (i2)) = [1]> then\n set [i2 v] to (join [0] (i2))\n end\n set [append to me! v] to (join (Append to me!) (i2))\n change [i1 v] by (1)\nend\n\ndefine Search For User ID\nset [user location in save list v] to []\nset [i0 v] to [1]\nrepeat until <not <(User Location in Save List) = []>>\n if <(username) = (item (i0) of [hall of fame v])> then\n set [user location in save list v] to (i0)\n end\nend\n\ndefine Encode Username\nConvert (username) to Numbers\nset [☁ users \(encoded\) v] to (join (☁ Users \(Encoded\)) (join (Append to me!) [00]))\n\ndefine Decode Usernames\nset [i1 v] to [0]\nset [i0 v] to [1]\nrepeat until <(i0) = [0]>\n set [append to me! v] to []\n set [scanner v] to []\n repeat until <<(Scanner) = [00]> or <(i1) > (length of (☁ Users \(Encoded\)))>>\n set [scanner v] to []\n repeat (2)\n change [i1 v] by (1)\n set [scanner v] to (join (Scanner) (letter (i1) of (☁ Users \(Encoded\))))\n end\n if <(Scanner) = [00]> then\n else\n set [append to me! v] to (join (Append to me!) (letter (Scanner) of (Chars)))\n end\n end\n if <(Append to me!) = []> then\n set [i0 v] to [0]\n else\n add (Append to me!) to [hall of fame v]\n end\nend\n\ndelete (all) of [hall of fame v]\nset [☁ users \(encoded\) v] to []\n\nSearch For User ID\n\nwhen I receive [beat last level legit v]\ndelete (all) of [hall of fame v]\nDecode Usernames\nbroadcast (Load Data v)\n\n
Welcome to Inverses! Inverses is a platformer where you have to control 2 characters to unlock the portal and advance to the next level. Collect both keys to unlock the portal and avoid the dangers along the way.\n\nGood luck!\n
Pen Platformer (99% pen)
@Stage\n\nwhen flag clicked\nforever\n play sound [Beepbox1 v] until done\nend\n\n@Player\n\nwhen flag clicked\nset [highscore this month v] to [71]\nforever\n if <key (r v) pressed?> then\n go to x: (-235) y: (-120)\n end\nend\n\nwhen flag clicked\ngo to x: (-203) y: (-24)\nset [level v] to [1]\nshow\nforever\n go to [front v] layer\n set [y v] to [0]\n set [x v] to [0]\n forever\n change [y v] by (-1)\n set [x v] to ((x) * (0.9))\n if <(flying) = [off]> then\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n switch costume to (left v)\n change [x v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n switch costume to (right1 v)\n change [x v] by (1)\n end\n change x by (x)\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (-4)\n change x by ((x) * (-1))\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [y v] to [10]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-4]\n else\n set [x v] to [4]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <touching color (#000000)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <touching color (#000000)?>> then\n set [y v] to [15]\n end\n change y by (1)\n end\n end\nend\n\nwhen flag clicked\nforever\n if <[235] < (x position)> then\n change [level v] by (1)\n broadcast (next level v)\n go to x: (-235) y: (-120)\n end\nend\n\nif <(level) < [8]> then\nif <(level) = [8]> then\n go to x: (-207) y: (20)\nend\nif <(level) > [8]> then\n go to x: (-207) y: (-120)\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff0000)?> then\n if <(flying) = [off]> then\n go to x: (-235) y: (-120)\n broadcast (red v)\n end\n end\nend\n\nif <(level) < [8]> then\nif <(level) = [8]> then\n go to x: (-207) y: (20)\nend\nif <(level) > [8]> then\n go to x: (-207) y: (-120)\nend\n\nwhen I receive [end v]\nhide\n\nif <(level) < [7]> then\n go to x: (-203) y: (-120)\nend\nif <(level) = [7]> then\n go to x: (-203) y: (20)\nend\nif <(level) > [7]> then\n go to x: (-203) y: (-120)\nend\n\nwhen I receive [skip v]\nbroadcast (next level v)\ngo to x: (-235) y: (-120)\n\nwhen flag clicked\npoint in direction (90)\nforever\n if <touching color (#2ee400)?> then\n set [y v] to [20]\n end\nend\n\nwhen flag clicked\nswitch costume to (player v)\nforever\n if <key (1 v) pressed?> then\n switch costume to (player v)\n end\n if <key (2 v) pressed?> then\n switch costume to (cat v)\n end\n if <key (3 v) pressed?> then\n switch costume to (centaur v)\n end\n if <key (4 v) pressed?> then\n switch costume to (red ball v)\n end\nend\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [4]> then\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n turn right (7) degrees\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n turn left (7) degrees\n end\n end\nend\n\nwhen flag clicked\n\ndefine spawn immunity\nbroken\n\nset [spawn immunity v] to [1]\nwait (1) seconds\nset [spawn immunity v] to [2]\n\nspawn immunity\n\nspawn immunity\n\nspawn immunity\n\nspawn immunity\n\ndefine broken\n\nwhen I receive [win v]\nif <<(time taken \(First 20 lvls\)) < (☁ Highscore \(first 20 lvls\))> and <(Skipped a level?) = [no]>> then\n set [☁ highscore \(first 20 lvls\) v] to (time taken \(First 20 lvls\))\nend\n\nwhen flag clicked\nset [time taken \(first 20 lvls\) v] to [0]\nset [time taken \(all lvls\) v] to [0]\nrepeat until <(Level) = [20]>\n change [time taken \(first 20 lvls\) v] by (1)\n wait (1) seconds\nend\n\nwhen flag clicked\npoint in direction (90)\nforever\n if <touching color (#0043ff)?> then\n set [y v] to [10]\n set [x v] to [20]\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ffac00)?> then\n repeat until <<not <touching color (#ffac00)?>> or <<key (a v) pressed?> or <key (d v) pressed?>>>\n set [x v] to [4]\n end\n end\nend\n\nwhen flag clicked\nforever\n if <<(flying) = [on]> or <(speed) = [on]>> then\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change x by (-15)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change x by (15)\n end\n end\n if <(flying) = [on]> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n change y by (15)\n end\n if <key (down arrow v) pressed?> then\n change y by (-15)\n end\n end\nend\n\nwhen flag clicked\nset [flying v] to [off]\nforever\n if <<<key (f v) pressed?> and <<[super admin v] contains (username)?> and <(flying) = [off]>>> and <(hacks) = [on]>> then\n repeat until <not <key (f v) pressed?>>\n set [flying v] to [on1]\n end\n set [flying v] to [on]\n end\nend\n\nwhen flag clicked\nset [flying v] to [off]\nforever\n if <<key (f v) pressed?> and <<[super admin v] contains (username)?> and <(flying) = [on]>>> then\n repeat until <not <key (f v) pressed?>>\n set [flying v] to [off1]\n end\n set [flying v] to [off]\n end\nend\n\nwhen flag clicked\nset [speed v] to [off]\nforever\n if <<<key (g v) pressed?> and <<[super admin v] contains (username)?> and <(speed) = [off]>>> and <(hacks) = [on]>> then\n repeat until <not <key (g v) pressed?>>\n set [speed v] to [on1]\n end\n set [speed v] to [on]\n end\nend\n\nwhen flag clicked\nset [speed v] to [off]\nforever\n if <<key (g v) pressed?> and <<[super admin v] contains (username)?> and <(speed) = [on]>>> then\n repeat until <not <key (g v) pressed?>>\n set [speed v] to [off1]\n end\n set [speed v] to [off]\n end\nend\n\nwhen flag clicked\nrepeat until <(Level) = [27]>\n change [time taken \(all lvls\) v] by (1)\n wait (1) seconds\nend\n\nwhen I receive [win v]\nif <<(time taken \(all lvls\)) < (☁ Highscore)> and <(Skipped a level?) = [no]>> then\n set [☁ highscore v] to (time taken \(all lvls\))\nend\n\nif then\nend\n\nwhen I receive [activate hacks v]\nforever\n add (username) to [blacklist v]\nend\n\n@Win screen\n\nwhen flag clicked\nhide\n\nwhen I receive [win v]\nshow\ngo to x: (0) y: (0)\ngo [forward v] (10000000000) layers\n\n@Thumbnail\n\nwhen flag clicked\nhide variable [level v]\nforever\n go to x: (0) y: (0)\n set [ghost v] effect to (100)\n go to [front v] layer\nend\n\n@Ground\n\nwhen flag clicked\nset [ghost v] effect to (100)\nset [level v] to [1]\nset pen size to (15)\nerase all\npen up\ngo to x: (0) y: (0)\nDraw ground from (-240) (-155) to (240) (-155) size (45)\n\nwhen I receive [next level v]\nchange [level v] by (1)\nforever\n if <(Level) = [2]> then\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw lava from (-120) (-140) to (120) (-140) size (15)\n Draw lava from (118) (-140) to (122) (-140) size (15)\n Draw ground from (0) (-40) to (20) (-40) size (15)\n end\n if <(Level) = [3]> then\n erase all\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (70) (-140) to (70) (100) size (15)\n Draw ground from (70) (-60) to (50) (-60) size (15)\n Draw ground from (-45) (20) to (-55) (20) size (15)\n Draw ground from (-55) (20) to (-55) (180) size (15)\n Draw lava from (75) (90) to (75) (-130) size (7)\n Draw lava from (60) (-130) to (60) (-70) size (7)\n end\n if <(Level) = [4]> then\n erase all\n Draw ground from (-240) (-50) to (-230) (-50) size (15)\n Draw ground from (-60) (0) to (0) (0) size (15)\n Draw lava from (-75) (-5) to (-160) (-45) size (10)\n Draw lava from (210) (-155) to (210) (30) size (10)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw lava from (210) (55) to (210) (95) size (10)\n Draw ground from (170) (55) to (240) (55) size (15)\n end\n if <(Level) = [5]> then\n erase all\n Draw lava from (-240) (-50) to (-140) (-50) size (10)\n Draw lava from (-85) (-130) to (240) (-130) size (10)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (-85) (-155) to (-85) (0) size (15)\n Draw ground from (-85) (0) to (-190) (0) size (15)\n Draw ground from (-85) (-60) to (-100) (-60) size (15)\n Draw ground from (-140) (-40) to (-240) (-40) size (15)\n Draw ground from (90) (40) to (180) (40) size (15)\n end\n if <(Level) = [6]> then\n erase all\n Draw lava from (-185) (-55) to (-185) (-135) size (15)\n Draw ground from (240) (-170) to (240) (135) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (-175) (-135) to (-175) (90) size (15)\n Draw ground from (-175) (-45) to (-195) (-45) size (15)\n Draw ground from (-240) (0) to (-220) (0) size (15)\n Draw lava from (-125) (95) to (-1) (95) size (15)\n Draw ground from (-175) (90) to (0) (90) size (15)\n Draw lava from (10) (10) to (25) (10) size (10)\n Draw lava from (90) (10) to (70) (10) size (10)\n Draw ground from (0) (90) to (0) (0) size (15)\n Draw ground from (0) (0) to (100) (0) size (15)\n Draw ground from (100) (0) to (100) (90) size (15)\n Draw ground from (100) (90) to (240) (135) size (15)\n end\n if <(Level) = [7]> then\n erase all\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (-240) (0) to (-180) (0) size (15)\n Draw ground from (0) (0) to (5) (0) size (15)\n Draw ground from (175) (0) to (180) (0) size (15)\n Draw lava from (-240) (-135) to (240) (-135) size (15)\n Draw bounce from [-240] [-135] to [0] [-135] size [15]\n end\n if <(Level) = [8]> then\n erase all\n Draw lava from (230) (-155) to (230) (100) size (15)\n Draw lava from (-180) (-135) to (180) (-135) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n go to (-130) (-75) and make a square (15) Pen size (4)\n go to (0) (0) and make a square (15) Pen size (4)\n Draw ground from (240) (-155) to (240) (130) size (15)\n go to (-130) (65) and make a square (15) Pen size (4)\n go to (0) (125) and make a square (15) Pen size (4)\n go to (120) (130) and make a square (15) Pen size (4)\n end\n if <(Level) = [9]> then\n erase all\n Draw lava from (100) (-130) to (125) (-130) size (10)\n Draw lava from (-130) (-135) to (-130) (-70) size (15)\n Draw lava from (-35) (-135) to (-35) (-70) size (15)\n Draw lava from (55) (-135) to (55) (-70) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (135) (-155) to (135) (10) size (15)\n Draw ground from (135) (-35) to (115) (-42) size (15)\n Draw ground from (135) (10) to (165) (10) size (15)\n Draw ground from (165) (10) to (165) (60) size (15)\n Draw ground from (165) (60) to (240) (60) size (15)\n Draw lava from (-240) (143) to (240) (143) size (10)\n Draw ground from (-240) (150) to (240) (150) size (15)\n end\n if <(Level) = [10]> then\n Draw lava from (100) (-130) to (125) (-130) size (10)\n Draw lava from (-130) (-135) to (-130) (-70) size (15)\n Draw lava from (-35) (-135) to (-35) (-70) size (15)\n Draw lava from (55) (-135) to (55) (-70) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (135) (-155) to (135) (10) size (15)\n Draw ground from (135) (-35) to (115) (-42) size (15)\n Draw ground from (135) (10) to (165) (10) size (15)\n Draw ground from (165) (10) to (165) (60) size (15)\n Draw ground from (165) (60) to (240) (60) size (15)\n Draw lava from (-240) (143) to (240) (143) size (10)\n Draw ground from (-240) (150) to (240) (150) size (15)\n erase all\n Draw lava from (85) (92) to (170) (92) size (10)\n Draw lava from (-80) (4) to (-120) (4) size (15)\n Draw lava from (-44) (0) to (-44) (-100) size (10)\n Draw lava from (65) (-50) to (65) (-135) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n go to (-100) (-50) and make a square (100) Pen size (15)\n Draw ground from (70) (-135) to (70) (80) size (15)\n Draw ground from (70) (-50) to (50) (-50) size (15)\n Draw ground from (-240) (0) to (-150) (0) size (15)\n go to (-200) (65) and make a square (10) Pen size (15)\n Draw ground from (20) (85) to (240) (85) size (15)\n end\n if <(Level) = [11]> then\n erase all\n set [part v] to [2]\n if <(switch) = [1]> then\n erase all\n Draw ground from (-240) (-155) to (0) (-155) size (45)\n Draw lava from (240) (-155) to (0) (-155) size (45)\n else\n erase all\n Draw ground from (240) (-155) to (0) (-155) size (45)\n Draw lava from (-240) (-155) to (0) (-155) size (45)\n end\n if <key (e v) pressed?> then\n if <(switch) = [1]> then\n set [switch v] to [2]\n wait (0.1) seconds\n else\n if <(switch) = [2]> then\n set [switch v] to [1]\n wait (0.1) seconds\n end\n end\n end\n end\n if <(Level) = [12]> then\n erase all\n set [part v] to [2]\n if <(switch) = [1]> then\n erase all\n Draw ground from (-240) (-155) to (0) (-155) size (45)\n Draw lava from (240) (-155) to (0) (-155) size (45)\n go to (70) (-50) and make a square (10) pen size (15) but make it HOT LAVAAA!!!\n Draw lava from (240) (-155) to (240) (0) size (15)\n else\n erase all\n Draw ground from (240) (-155) to (0) (-155) size (45)\n Draw lava from (-240) (-155) to (0) (-155) size (45)\n go to (70) (-50) and make a square (10) Pen size (15)\n Draw lava from (240) (-155) to (240) (0) size (15)\n end\n if <key (e v) pressed?> then\n if <(switch) = [1]> then\n set [switch v] to [2]\n wait (0.1) seconds\n else\n if <(switch) = [2]> then\n set [switch v] to [1]\n wait (0.1) seconds\n end\n end\n end\n end\n if <(Level) = [13]> then\n erase all\n set [part v] to [2]\n if <(switch) = [1]> then\n erase all\n Draw lava from (-240) (-135) to (-200) (-135) size (15)\n Draw lava from (240) (-135) to (200) (-135) size (15)\n Draw bounce from [-100] [-135] to [100] [-135] size [15]\n Draw ground from (240) (-155) to (-240) (-155) size (15)\n else\n erase all\n Draw bounce from [-240] [-135] to [-200] [-135] size [15]\n Draw lava from (-100) (-135) to (100) (-135) size (15)\n Draw bounce from [200] [-135] to [240] [-135] size [15]\n Draw ground from (240) (-155) to (-240) (-155) size (15)\n end\n if <key (e v) pressed?> then\n if <(switch) = [1]> then\n set [switch v] to [2]\n wait (0.5) seconds\n else\n if <(switch) = [2]> then\n set [switch v] to [1]\n wait (0.5) seconds\n end\n end\n end\n end\n if <(Level) = [14]> then\n erase all\n Draw ground from (240) (-155) to (-240) (-155) size (15)\n Draw lava from (-200) (-150) to (250) (-150) size (15)\n go to (-150) (-70) and make a square (15) Pen size (15)\n go to (0) (-70) and make a square (15) Pen size (15)\n go to (150) (-70) and make a square (15) Pen size (15)\n end\n if <(Level) = [15]> then\n erase all\n Draw lava from (200) (-135) to (-200) (-135) size (15)\n go to (-200) (-135) and make a square (15) Pen size (15)\n go to (150) (0) and make a square (15) Pen size (15)\n go to (0) (100) and make a square (15) Pen size (15)\n go to (-150) (0) and make a square (15) Pen size (15)\n go to (200) (-135) and make a square (15) Pen size (15)\n Draw ground from (-240) (-135) to (-200) (-135) size (15)\n Draw ground from (240) (-135) to (200) (-135) size (15)\n Draw ground from (240) (-180) to (-240) (-180) size (80)\n end\n if <(Level) = [16]> then\n erase all\n Draw lava from (-175) (-155) to (-175) (-75) size (15)\n Draw lava from (-100) (-155) to (-100) (-75) size (15)\n Draw lava from (-25) (-155) to (-25) (-75) size (15)\n Draw lava from (50) (-155) to (50) (-75) size (15)\n Draw lava from (125) (-155) to (125) (-75) size (15)\n Draw lava from (200) (-155) to (200) (-75) size (15)\n Draw ground from (240) (-155) to (-240) (-155) size (45)\n end\n if <(Level) = [17]> then\n erase all\n Draw ground from (240) (-155) to (-240) (-155) size (45)\n go to (-150) (0) and make a square (25) Pen size (30)\n Draw ground from (-150) (0) to (-150) (-140) size (55)\n go to (0) (50) and make a square (15) Pen size (15)\n Draw ground from (240) (50) to (200) (50) size (15)\n Draw ground from (230) (50) to (230) (-155) size (15)\n end\n if <(Level) = [18]> then\n erase all\n Draw lava from (-170) (-140) to (-170) (-120) size (15)\n Draw ground from (240) (-155) to (-240) (-155) size (45)\n Draw lava from (-90) (-70) to (-90) (-60) size (15)\n Draw lava from (0) (0) to (0) (20) size (15)\n Draw ground from (-180) (-155) to (0) (0) size (15)\n Draw ground from (0) (0) to (240) (0) size (15)\n end\n if <(Level) = [19]> then\n erase all\n Draw lava from (200) (0) to (200) (120) size (45)\n Draw lava from (40) (65) to (90) (65) size (15)\n Draw lava from (-30) (120) to (-30) (180) size (15)\n Draw lava from (0) (-130) to (50) (-130) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw lava from (-130) (0) to (-85) (0) size (15)\n Draw ground from (-200) (-155) to (-130) (0) size (15)\n Draw ground from (-80) (0) to (0) (0) size (15)\n Draw ground from (0) (0) to (0) (-155) size (15)\n Draw ground from (50) (0) to (50) (-155) size (15)\n Draw ground from (50) (0) to (240) (0) size (15)\n Draw ground from (240) (0) to (240) (120) size (15)\n Draw ground from (240) (120) to (40) (120) size (15)\n Draw ground from (90) (70) to (40) (70) size (15)\n Draw ground from (40) (70) to (-35) (120) size (15)\n Draw ground from (-35) (120) to (-35) (180) size (15)\n end\n if <(Level) = [20]> then\n erase all\n Draw ground from (0) (-80) to (0) (190) size (15)\n Draw lava from (0) (-135) to (75) (-135) size (15)\n Draw blue from [0] [-155] to [0] [-80] [15]\n Draw ground from (75) (-155) to (75) (0) size (15)\n Draw ground from (75) (0) to (240) (0) size (15)\n Draw ground from (200) (0) to (200) (145) size (15)\n Draw blue from [5] [80] to [5] [140] [15]\n Draw lava from (190) (0) to (190) (120) size (15)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n end\n if <(Level) = [21]> then\n erase all\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n draw orange from [-240] [-130] to [240] [-130] size [15]\n end\n if <(Level) = [22]> then\n erase all\n Draw lava from (-195) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw ground from (-200) (-155) to (-200) (-100) size (15)\n draw orange from [-200] [-90] to [-160] [-90] size [15]\n Draw ground from (-200) (-100) to (-160) (-100) size (15)\n draw orange from [-130] [-35] to [-90] [-35] size [15]\n Draw ground from (-130) (-40) to (-90) (-40) size (15)\n draw orange from [40] [20] to [0] [20] size [15]\n Draw ground from (40) (15) to (0) (15) size (15)\n Draw lava from (200) (65) to (200) (130) size (15)\n draw orange from [100] [70] to [200] [70] size [15]\n Draw ground from (100) (65) to (200) (65) size (15)\n end\n if <(Level) = [23]> then\n erase all\n Draw lava from (-175) (-140) to (240) (-140) size (20)\n draw orange from [-200] [-90] to [-200] [-90] size [20]\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n Draw lava from (-178) (-155) to (-198) (-89) size (15)\n Draw ground from (-180) (-155) to (-200) (-90) size (15)\n Draw ground from (-30) (0) to (30) (0) size (15)\n end\n if <(Level) = [24]> then\n erase all\n pen up\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n pen up\n forever\n go to (mouse-pointer v)\n if <key (e v) pressed?> then\n pen down\n end\n if <key (q v) pressed?> then\n pen up\n end\n if <key (b v) pressed?> then\n erase all\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n pen up\n end\n end\n end\n if <(Level) = [25]> then\n erase all\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n forever\n pen up\n if <key (e v) pressed?> then\n Draw square at mouse pointer\n wait (0.5) seconds\n end\n if <key (b v) pressed?> then\n erase all\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n pen up\n end\n end\n end\n if <(Level) = [26]> then\n erase all\n Draw lava from (240) (150) to (240) (-180) size (20)\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n forever\n pen up\n if <key (e v) pressed?> then\n Draw square at mouse pointer\n wait (0.5) seconds\n end\n if <key (b v) pressed?> then\n erase all\n Draw lava from (240) (150) to (240) (-180) size (20)\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n pen up\n end\n end\n end\n if <(Level) = [27]> then\n erase all\n Draw lava from (240) (150) to (240) (-180) size (20)\n Draw lava from (-180) (-150) to (240) (-150) size (45)\n Draw ground from (-240) (-155) to (240) (-155) size (45)\n pen up\n bouncy bouncy o such a good time\n end\n if <(Level) = [28]> then\n erase all\n broadcast (win v)\n end\nend\n\nbroadcast (win v)\n\ndefine Draw ground from (x) (y) to (x\(f\)) (y\(f\)) size (size)\npen up\ngo to x: (x) y: (y)\nset pen size to (size)\npen down\nset pen color to (#000000)\ngo to x: (x\(f\)) y: (y\(f\))\npen down\n\ndefine Draw lava from (x) (y) to (x\(f\)) (y\(f\)) size (size)\npen up\nset pen size to (size)\ngo to x: (x) y: (y)\npen down\nset pen color to (#ff0000)\ngo to x: (x\(f\)) y: (y\(f\))\npen down\n\nwhen flag clicked\nset [skipped a level? v] to [no]\nforever\n if <[admin v] contains (username)?> then\n if <key (s v) pressed?> then\n set [skipped a level? v] to [yes]\n broadcast (skip v)\n wait (0.5) seconds\n end\n end\nend\n\ndefine go to (x) (y) and make a square (size of square) Pen size (pen size)\nset pen color to (#000000)\nset pen size to (pen size)\npen up\ngo to x: (x) y: (y)\nchange x by ((size of square) / (2))\npen down\nchange y by ((size of square) / (2))\nchange x by ((size of square) - ((size of square) * (2)))\nchange y by ((size of square) - ((size of square) * (2)))\nchange x by (size of square)\nchange y by ((size of square) / (2))\n\nwhen flag clicked\nforever\n show variable [level v]\n play sound [Vexento-Pollen.mp3 v] until done\nend\n\nwhen flag clicked\nset [part v] to [1]\n\nwhen flag clicked\nset [switch v] to [1]\n\ndefine go to (x) (y) and make a square (size of square) pen size (pen size) but make it HOT LAVAAA!!!\nset pen color to (#ff0000)\nset pen size to (pen size)\npen up\ngo to x: (x) y: (y)\nchange x by ((size of square) / (2))\npen down\nchange y by ((size of square) / (2))\nchange x by ((size of square) - ((size of square) * (2)))\nchange y by ((size of square) - ((size of square) * (2)))\nchange x by (size of square)\nchange y by ((size of square) / (2))\n\nset [level v] to [1]\n\nif <(Level) = [13]> then\n erase all\n broadcast (win v)\nend\n\ndefine Draw bounce from (x) (y) to (x\(f\)) (y\(f\)) size (size)\npen up\nset pen size to (size)\ngo to x: (x) y: (y)\npen down\nset pen color to (#2ee400)\ngo to x: (x\(f\)) y: (y\(f\))\npen down\n\nset [switch v] to [1]\n\nset [switch v] to [1]\n\nwhen flag clicked\ndelete all of [blacklist v]\ndelete all of [admin v]\nadd [XxNinjasDiaperxX] to [admin v]\nadd [CatCodez] to [admin v]\nadd [rishi_p06] to [admin v]\nadd [mooney-seyfang] to [admin v]\nadd [RAFSTAR1] to [admin v]\nadd [kittyandadragongirl] to [admin v]\nadd [SHA086] to [admin v]\nadd [silentbutdeadly100] to [admin v]\nadd [anakinskywalker100] to [admin v]\nadd [Dbuild] to [admin v]\nadd [HarryZebra123] to [admin v]\nadd [XxNinjasDiaperxX] to [super admin v]\nadd [Hobbit_192] to [admin v]\nadd [E-Quest2] to [admin v]\n\nwhen flag clicked\nforever\n if <[blacklist v] contains (username)?> then\n wait (0.01) seconds\n broadcast (banned v)\n stop [all v]\n end\nend\n\nwhen flag clicked\nforever\n if <<key (space v) pressed?> and <(username) = [XxNinjasDiaperxX]>> then\n repeat (19)\n set [skipped a level? v] to [yes]\n broadcast (next level v)\n end\n end\nend\n\nset [☁ highscore \(first 20 lvls\) v] to [102]\n\ndefine Draw blue from (x1) (y1) to (x2) (y2) (size)\npen up\nset pen size to (size)\ngo to x: (x1) y: (y1)\npen down\nset pen color to (#0042ff)\ngo to x: (x2) y: (y2)\npen down\n\ndefine draw orange from (x1) (y1) to (x2) (y2) size (size)\npen up\nset pen size to (size)\ngo to x: (x1) y: (y1)\npen down\nset pen color to (#ffac00)\ngo to x: (x2) y: (y2)\npen down\n\nwhen flag clicked\nset [skipped a level? v] to [no]\nforever\n if <[admin v] contains (username)?> then\n if <key (b v) pressed?> then\n set [skipped a level? v] to [yes]\n broadcast (back a level v)\n wait (0.5) seconds\n end\n end\nend\n\nwhen I receive [back a level v]\n\nchange [level v] by (-1)\n\nset pen color to (#000000)\nset pen size to (15)\n\ndefine Draw square at mouse pointer\nset pen color to (#000000)\nset pen size to (10)\npen up\ngo to (mouse-pointer v)\nchange x by ((25) / (2))\npen down\nchange y by ((25) / (2))\nchange x by ((25) - ((25) * (2)))\nchange y by ((25) - ((25) * (2)))\nchange x by (25)\nchange y by ((25) / (2))\n\ndefine bouncy bouncy o such a good time\nset pen color to (#2ee400)\nset pen size to (10)\npen up\ngo to (mouse-pointer v)\nchange x by ((25) / (2))\npen down\nchange y by ((25) / (2))\nchange x by ((25) - ((25) * (2)))\nchange y by ((25) - ((25) * (2)))\nchange x by (25)\nchange y by ((25) / (2))\n\n@Instructions\n\nwhen flag clicked\nshow\nforever\n hide\n if <(Level) = [1]> then\n show\n switch costume to (costume1 v)\n go to x: (-6) y: (-99)\n end\n if <(Level) = [2]> then\n show\n switch costume to (costume2 v)\n go to x: (-6) y: (-99)\n end\n if <(Level) = [3]> then\n show\n switch costume to (costume3 v)\n go to x: (-50) y: (-100)\n end\n if <(Level) = [7]> then\n show\n switch costume to (costume4 v)\n go to x: (0) y: (100)\n end\n if <(Level) = [11]> then\n show\n switch costume to (costume5 v)\n go to x: (0) y: (0)\n end\n if <(Level) = [15]> then\n show\n switch costume to (costume6 v)\n go to x: (0) y: (0)\n end\n if <(Level) = [20]> then\n show\n switch costume to (costume7 v)\n go to x: (-100) y: (0)\n end\n if <(Level) = [21]> then\n show\n switch costume to (costume8 v)\n go to x: (0) y: (0)\n end\n if <(Level) = [24]> then\n show\n switch costume to (costume9 v)\n go to x: (0) y: (120)\n end\n if <(Level) = [25]> then\n show\n switch costume to (costume10 v)\n go to x: (0) y: (120)\n end\nend\n\nswitch costume to (costume1 v)\nswitch costume to (costume1 v)\nswitch costume to (costume1 v)\nswitch costume to (costume1 v)\nswitch costume to (costume1 v)\n\n@Area 51\n\nwhen flag clicked\nset [hacks v] to [off]\nforever\n if <<key (h v) pressed?> and <<key (a v) pressed?> and <<key (c v) pressed?> and <<key (k v) pressed?> and <[super admin v] contains (username)?>>>>> then\n set [hacks v] to [on]\n set [skipped a level? v] to [yes]\n end\nend\n\nwhen flag clicked\nset [hacks v] to [off]\nforever\n if <<key (e v) pressed?> and <<key (n v) pressed?> and <<key (d v) pressed?> and <[super admin v] contains (username)?>>>> then\n set [hacks v] to [off]\n end\nend\n\nset [☁ highscore \(first 20 lvls\) v] to [0]\n\nwhen flag clicked\nset [hacks v] to [off]\nforever\n if <key (h v) pressed?> then\n hide variable [☁ highscore v]\n hide variable [☁ highscore \(first 20 lvls\) v]\n hide variable [time taken \(all lvls\) v]\n hide variable [time taken \(first 20 lvls\) v]\n hide variable [level v]\n end\nend\n\nwhen flag clicked\nshow variable [☁ highscore v]\nshow variable [time taken \(all lvls\) v]\nshow variable [time taken \(first 20 lvls\) v]\nshow variable [☁ highscore \(first 20 lvls\) v]\nshow variable [level v]\nset [hacks v] to [off]\nforever\n if <key (n v) pressed?> then\n show variable [☁ highscore v]\n show variable [time taken \(all lvls\) v]\n show variable [time taken \(first 20 lvls\) v]\n show variable [☁ highscore \(first 20 lvls\) v]\n show variable [level v]\n end\nend\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [banned v]\nshow\ngo to [front v] layer\n\n@hacks\n\nwhen flag clicked\nforever\n if <key (0 v) pressed?> then\n broadcast (activate hacks v)\n end\nend\n\n
Arrow keys or WAD to move. Wall jumping is possible. For part 2 if you press 'e' then it switches the lava and the ground to the opposite of what they are, eg. if there was lava and you pressed 'e' then the lava would turn black. S to skip a level if you are an admin. Press the number keys to switch costume. H to hide the variables and n to show them again. If it doesnt work i might have banned you XD .\n
Glitched - A 100% Pen Platformer Challenge
@Stage\n\nwhen flag clicked\nforever\n play sound [Theme B v] until done\nend\n\nwhen flag clicked\nset [pitch v] effect to (0)\nforever\n set [pitch v] effect to ((Glitch) * (10))\nend\n\n@pen\n\nwhen flag clicked\nCreate Level\nset [xv v] to [0]\nset [yv v] to [0]\nset [x position v] to [0]\nset [y position v] to [0]\nset [scroll x v] to [0]\nset [scroll y v] to [0]\nset [glitch v] to [1]\nforever\n Draw\n Update\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change [x position v] by (Xv)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by (1)\n Update\n if <[touching v] contains [1]?> then\n change [x position v] by ((Xv) * (-1))\n change [y position v] by (-5)\n if then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n Update\n change [yv v] by (-1)\n change [y position v] by (Yv)\n Update\n if <[touching v] contains [1]?> then\n change [y position v] by ((Yv) * (-1))\n set [yv v] to [0]\n end\n Update\n change [y position v] by (-1)\n Update\n if <[touching v] contains [1]?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [15]\n end\n end\n Update\n if <[touching v] contains [2]?> then\n set [yv v] to [20]\n end\n Update\n if <<[touching v] contains [3]?> or <(Scroll Y) > [500]>> then\n set [xv v] to [0]\n set [yv v] to [0]\n set [x position v] to [0]\n set [y position v] to [0]\n set [scroll x v] to [0]\n set [scroll y v] to [0]\n stop all sounds\n end\n Update\n change [y position v] by (1)\n Scrolling\nend\n\ndefine None\ngo to x: (((x) + (Scroll X)) + (pick random (() - (Glitch)) to (Glitch))) y: (((y) + (Scroll Y)) + (pick random (() - (Glitch)) to (Glitch)))\n\ndefine Create Level\nset [offset v] to [0]\ndelete (all) of [level xs v]\ndelete (all) of [level ys v]\ndelete (all) of [level widths v]\ndelete (all) of [level heights v]\ndelete (all) of [level types v]\nrepeat (2)\n Add Rectangle (-150) (-50) (300) (25) (1)\n Add Rectangle (150) (-50) (50) (25) (2)\n Add Rectangle (200) (-50) (25) (150) (1)\n Add Rectangle (225) (75) (50) (25) (1)\n Add Rectangle (275) (50) (50) (25) (1)\n Add Rectangle (325) (25) (50) (25) (1)\n Add Rectangle (375) (0) (75) (25) (1)\n Add Rectangle (450) (0) (50) (20) (3)\n Add Rectangle (500) (0) (50) (25) (1)\n Add Rectangle (550) (0) (50) (20) (3)\n Add Rectangle (600) (0) (125) (25) (1)\n Add Rectangle (725) (0) (25) (75) (3)\n Add Rectangle (750) (0) (50) (25) (1)\n Add Rectangle (800) (0) (25) (75) (3)\n Add Rectangle (825) (0) (50) (25) (1)\n Add Rectangle (950) (0) (50) (25) (2)\n Add Rectangle (1000) (0) (100) (100) (3)\n Add Rectangle (1100) (0) (100) (25) (1)\n Add Rectangle (1200) (0) (25) (75) (3)\n Add Rectangle (1275) (50) (25) (150) (3)\n Add Rectangle (1225) (0) (125) (25) (1)\n Add Rectangle (1300) (175) (400) (25) (3)\n Add Rectangle (1350) (0) (100) (25) (2)\n Add Rectangle (1450) (0) (50) (25) (1)\n Add Rectangle (1500) (0) (150) (25) (2)\n Add Rectangle (1650) (0) (150) (25) (1)\n Add Rectangle (1800) (0) (25) (100) (3)\n Add Rectangle (1825) (0) (50) (25) (1)\n Add Rectangle (1875) (0) (25) (100) (3)\n Add Rectangle (1900) (0) (50) (25) (1)\n Add Rectangle (1950) (0) (25) (100) (3)\n Add Rectangle (1975) (0) (25) (25) (1)\n Add Rectangle (2000) (0) (25) (100) (3)\n Add Rectangle (2025) (0) (75) (25) (1)\n Add Rectangle (2100) (0) (50) (25) (2)\n Add Rectangle (2150) (0) (200) (50) (3)\n Add Rectangle (2350) (0) (60) (25) (1)\n Add Rectangle (2410) (0) (25) (100) (3)\n Add Rectangle (2435) (0) (40) (25) (1)\n Add Rectangle (2475) (0) (25) (100) (3)\n Add Rectangle (2500) (0) (150) (25) (1)\n change [offset v] by (2800)\nend\n\ndefine Draw\npen up\nerase all\nset pen size to (5)\nset [i v] to [0]\nrepeat (length of [level xs v])\n change [i v] by (1)\n if <<<((Scroll Y) + (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))) > [-180]> and <((Scroll Y) + ((item (i) of [level ys v]) + (5))) < [240]>> and <<((Scroll X) + (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5))) > [-240]> and <((Scroll X) + ((item (i) of [level xs v]) + (5))) < [240]>>> then\n Go To ((item (i) of [level xs v]) + (5)) ((item (i) of [level ys v]) + (5))\n set [initial x v] to (x position)\n set [initial y v] to (y position)\n set pen color to (#000000)\n if <(item (i) of [level types v]) = [2]> then\n set pen color to (#2ca5e2)\n end\n if <(item (i) of [level types v]) = [1]> then\n set pen color to (#ffffff)\n end\n if <(item (i) of [level types v]) = [3]> then\n set pen color to (#5cb712)\n end\n pen down\n Go To (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5)) ((item (i) of [level ys v]) + (5))\n Go To (((item (i) of [level xs v]) + (item (i) of [level widths v])) - (5)) (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))\n Go To ((item (i) of [level xs v]) + (5)) (((item (i) of [level ys v]) + (item (i) of [level heights v])) - (5))\n go to x: (Initial X) y: (Initial Y)\n pen up\n end\nend\nset pen color to (#ee7d16)\ngo to x: ((x position) + (pick random (() - (Glitch)) to (Glitch))) y: ((y position) + (pick random (() - (Glitch)) to (Glitch)))\nset [initial x v] to (x position)\nset [initial y v] to (y position)\npen down\ngo to x: ((x position) + (pick random (() - (Glitch)) to (Glitch))) y: (((y position) + (20)) + (pick random (() - (Glitch)) to (Glitch)))\ngo to x: (((x position) + (20)) + (pick random (() - (Glitch)) to (Glitch))) y: (((y position) + (20)) + (pick random (() - (Glitch)) to (Glitch)))\ngo to x: (((x position) + (20)) + (pick random (() - (Glitch)) to (Glitch))) y: ((y position) + (pick random (() - (Glitch)) to (Glitch)))\ngo to x: (Initial X) y: (Initial Y)\npen up\n\ndefine Update\nset [glitch v] to ((Scroll X) * (() - ((1) / (500))))\ndelete (all) of [touching v]\nset [i v] to [0]\nrepeat (length of [level xs v])\n change [i v] by (1)\n if <<<(x position) < (((item (i) of [level xs v]) + (Scroll X)) + (item (i) of [level widths v]))> and <((x position) + (20)) > ((item (i) of [level xs v]) + (Scroll X))>> and <<(y position) < (((item (i) of [level ys v]) + (Scroll Y)) + (item (i) of [level heights v]))> and <((y position) + (20)) > ((item (i) of [level ys v]) + (Scroll Y))>>> then\n if <not <[touching v] contains (item (i) of [level types v])?>> then\n add (item (i) of [level types v]) to [touching v]\n end\n end\nend\n\ndefine Scrolling\nset [offset v] to (pick random (() - (Glitch)) to (Glitch))\nchange [scroll x v] by (() - (round ((x position) / (10))))\nchange [x position v] by (() - (round ((x position) / (10))))\nset [offset v] to (pick random (() - (Glitch)) to (Glitch))\nchange [scroll y v] by (() - (round ((y position) / (10))))\nchange [y position v] by (() - (round ((y position) / (10))))\n\ndefine None\nadd ((x) + (offset)) to [level xs v]\nadd (y) to [level ys v]\nadd (width) to [level widths v]\nadd (height) to [level heights v]\nadd (tyoe) to [level types v]\n\nwhen I receive [message1 v]\nstop [other scripts in sprite v]\npen up\nerase all\nset pen color to (#e6e8e8)\nset pen size to (20)\ngo to x: (-240) y: (180)\npen down\nrepeat (13)\n set y to (180)\n repeat (18)\n change y by (-20)\n end\n change x by (20)\n set y to (-180)\n repeat (18)\n change y by (20)\n end\n change x by (20)\nend\n\nwhen flag clicked\nforever\n Update\n if <(Scroll X) < [-5400]> then\n broadcast (message1 v)\n end\nend\n\n
Radioactive {Part I}
@Stage\n\nwhen flag clicked\nforever\nend\n\n@Sprite8\n\nwhen flag clicked\nshow\ngo to x: (-220) y: (-130)\nset [ghost v] effect to (0)\nset size to (40) %\nforever\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1.2)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1.2)\n end\n set [xv v] to ((xv) * (0.85))\n change x by (xv)\n if <touching color (#0d0d0d)?> then\n change y by (-3)\n if <touching color (#0d0d0d)?> then\n change y by (1)\n if <touching color (#0d0d0d)?> then\n change y by (1)\n if <touching color (#0d0d0d)?> then\n change y by (1)\n if <touching color (#0d0d0d)?> then\n change y by (1)\n if <touching color (#0d0d0d)?> then\n change y by (1)\n if <touching color (#0d0d0d)?> then\n change y by (-5)\n change x by ((-1) * (xv))\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(xv) = [0]>>> then\n set [mode v] to [walljump]\n set [yv v] to [8]\n set [xv v] to (((xv) / ([abs v] of (xv) )) * (-10))\n else\n set [mode v] to [wallslide]\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (2)\n end\n change y by (-3)\n if <touching color (#0d0d0d)?> then\n if <(yv) = [-3]> then\n if <<key (a v) pressed?> or <<key (d v) pressed?> or <<key (left arrow v) pressed?> or <key (right arrow v) pressed?>>>> then\n set [mode v] to [run]\n else\n if <([abs v] of (xv) ) > [.1]> then\n set [mode v] to [skid]\n else\n set [mode v] to [stand]\n end\n end\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [mode v] to [jump]\n set [yv v] to [9]\n end\n end\n if <<<<(mode) = [jump]> or <(mode) = [walljump]>> and <(yv) < [0]>> or <<<(mode) = [run]> or <(mode) = [skid]>> and <(yv) < [-3]>>> then\n set [mode v] to [fall]\n end\n change y by (3)\n if <(yv) > [-15]> then\n change [yv v] by (-0.5)\n end\n change y by (-2)\n if <not <touching color (#0d0d0d)?>> then\n change y by (-1)\n if <not <touching color (#0d0d0d)?>> then\n change y by (-1)\n if <not <touching color (#0d0d0d)?>> then\n change y by (-1)\n if <not <touching color (#0d0d0d)?>> then\n change y by (-1)\n if <not <touching color (#0d0d0d)?>> then\n change y by (-1)\n if <not <touching color (#0d0d0d)?>> then\n change y by (5)\n end\n end\n end\n end\n end\n end\n change y by (2)\n change y by (yv)\n if <touching color (#0d0d0d)?> then\n change y by (-2)\n if <touching color (#0d0d0d)?> then\n change y by ((-1) * (yv))\n set [yv v] to [-3]\n end\n change y by (2)\n end\nend\n\nif <touching color (#00ff55)?> then\n set [yv v] to [13]\nend\n\nwhen flag clicked\nforever\n if <[235] < (x position)> then\n repeat (2)\n change [ghost v] effect by (-50)\n end\n go to x: (-220) y: (-130)\n broadcast (Next v) and wait\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\n if <touching color (#00ff55)?> then\n repeat (2)\n change [ghost v] effect by (-50)\n end\n go to x: (-220) y: (-130)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\nend\n\nwhen I receive [end animation v]\nhide\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (3) layers\n\n@Sprite2\n\nwhen flag clicked\nforever\n if <key (s v) pressed?> then\n broadcast (next v) and wait\n wait until <not <key (s v) pressed?>>\n end\nend\n\nwhen I receive [next v]\nif <(costume [number v]) = [9]> then\n broadcast (end animation v) and wait\nelse\n next costume\nend\n\nwhen flag clicked\nshow\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [end animation v]\nhide\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (8) layers\n\n@Sprite5\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (13)\n\nwhen flag clicked\nshow\ngo to [front v] layer\ngo [backward v] (5) layers\n\nwhen I receive [end v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nshow\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [next v]\nnext costume\n\nwhen I receive [end animation v]\nhide\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (2) layers\n\n@Sprite4\n\nwhen flag clicked\nshow\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [next v]\nnext costume\n\nwhen I receive [end v]\nhide\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (4) layers\n\n@Sprite6\n\nwhen flag clicked\ngo to [front v] layer\nswitch costume to (thumbnail v)\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\n\n@Sprite7\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen I receive [end animation v]\nshow\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (3) layers\n\nwhen I receive [end v]\nhide\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (-50)\nset size to (300) %\nhide\n\nif <touching color (#00ff55)?> then\n set [yv v] to [13]\nend\n\nwhen I receive [end animation v]\nswitch costume to (costume1 v)\nshow\nrepeat (3)\n change [ghost v] effect by (25)\nend\nswitch costume to (costume2 v)\nrepeat (3)\n change [ghost v] effect by (-25)\nend\nwait (0.9) seconds\nrepeat (3)\n change [ghost v] effect by (25)\nend\nswitch costume to (costume3 v)\nrepeat (3)\n change [ghost v] effect by (-25)\nend\nwait (1.4) seconds\nrepeat (3)\n change [ghost v] effect by (25)\nend\nswitch costume to (costume4 v)\nrepeat (3)\n change [ghost v] effect by (-25)\nend\nwait (3) seconds\nbroadcast (End v) and wait\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (3) layers\n\nwhen I receive [end v]\nhide\n\n@Sprite9\n\nwhen flag clicked\n\nwhen I receive [end v]\nset size to (100) %\ngo to x: (0) y: (0)\nset [ghost v] effect to (0)\ngo to [front v] layer\ngo [backward v] (20) layers\npoint in direction (90)\nshow\nwait (3) seconds\nrepeat (40)\n turn right (9) degrees\n change size by (-2.5)\n change [ghost v] effect by (0.5)\nend\nhide\nstop [all v]\n\nwhen flag clicked\nhide\n\n@Sprite10\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen I receive [end v]\nshow\n\nwhen flag clicked\n\n
This is a platformer...\nArrow Keys/WAD controls.\nAvoid Radioactive Material.\nAll levels are possible.\n--------------------------------------------------------------\nON EXPLORE PAGE??? NO WAY!!! TOP LOVED??? NO WAY!!!\n
Just Your Ordinary Platformer...
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\n@Sprite3\n\nwhen I receive [message1 v]\nnext costume\n\nwhen I receive [start v]\nset [times died v] to [0]\nhide variable [times died v]\nshow\nswitch costume to (costume1 v)\nhide\ngo to x: (0) y: (0)\nshow\nforever\n play sound [Itro - Panda \[NCS Release\].mp3 v] until done\nend\n\nchange [levels completed v] by (1)\n\nbroadcast (start v)\n\nwhen I receive [message1 v]\n\nforever\n if <(levels completed) = [15]> then\n show variable [times died v]\n end\nend\n\n@Sprite1\n\nwhen I receive [message1 v]\ngo to x: (-175) y: (-95)\n\nwhen I receive [start v]\nset [xv v] to [0]\nset [yv v] to [0]\ngo to x: (-175) y: (-95)\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change y by (1)\n if <touching color (#009933)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#009933)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#009933)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [13]\n end\n end\n change y by (1)\n if <touching (_edge_ v)?> then\n broadcast (message1 v)\n change [levels completed v] by (1)\n end\nend\n\nwhen flag clicked\n\nwait (0.02) seconds\n\nwhen I receive [start v]\nshow\nset [times died v] to [0]\nset [levels completed v] to [0]\nset [amount of lost lives v] to [0]\nstop all sounds\n\nwhen flag clicked\nbroadcast (start v)\n\nwhen I receive [start v]\nforever\n if <touching color (#000000)?> then\n go to x: (-175) y: (-95)\n end\nend\n\nif then\n go to x: (-175) y: (-95)\nend\n\nbroadcast (message1 v)\n\n
Swing [Game + Level Editor] V1.3
@Stage\n\nwhen flag clicked\nset [gameended v] to [false]\nset [playing v] to [false]\nswitch backdrop to (backdrop1 v)\ndelete (all) of [landpositiony v]\ndelete (all) of [landpositionx v]\ndelete (all) of [obstaclepositionx v]\ndelete (all) of [obstaclepositiony v]\ndelete (all) of [slimepositionx v]\ndelete (all) of [slimepositiony v]\nset [gridscale v] to [35]\nset [stage v] to [0]\nforever\n wait (1) seconds\n change [timer v] by (1)\nend\n\nwhen I receive [nextstage v]\nswitch backdrop to (backdrop3 v)\nchange [stage v] by (1)\ndelete (all) of [landpositiony v]\ndelete (all) of [landpositionx v]\ndelete (all) of [obstaclepositionx v]\ndelete (all) of [obstaclepositiony v]\nset [spawnx v] to [null]\nset [spawny v] to [null]\nif <(Stage) = [1]> then\n add [20] to [landpositionx v]\n add [-100] to [landpositiony v]\n set [portalx v] to [-100]\n set [portaly v] to [-80]\n set [grappleability v] to [false]\nend\nif <(Stage) = [2]> then\n add [160] to [landpositionx v]\n add [-120] to [landpositiony v]\n set [portalx v] to [-160]\n set [portaly v] to [-120]\n set [grappleability v] to [true]\nend\nif <(Stage) = [3]> then\n add [125] to [landpositionx v]\n add [-120] to [landpositiony v]\n add [0] to [obstaclepositionx v]\n add [-100] to [obstaclepositiony v]\n set [portalx v] to [-125]\n set [portaly v] to [-120]\n set [grappleability v] to [true]\nend\nif <(Stage) = [4]> then\n add [125] to [landpositionx v]\n add [0] to [landpositiony v]\n add [0] to [obstaclepositionx v]\n add [0] to [obstaclepositiony v]\n set [portalx v] to [-125]\n set [portaly v] to [-120]\n set [grappleability v] to [true]\nend\nif <(Stage) = [5]> then\n add [-150] to [landpositionx v]\n add [80] to [landpositiony v]\n add [-50] to [obstaclepositionx v]\n add [80] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [50] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [20] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [-10] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [-40] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [-70] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [-100] to [obstaclepositiony v]\n add [-50] to [obstaclepositionx v]\n add [-130] to [obstaclepositiony v]\n set [portalx v] to [100]\n set [portaly v] to [-120]\n set [grappleability v] to [true]\nend\nif <(Stage) = [6]> then\n add [0] to [landpositionx v]\n add [75] to [landpositiony v]\n add [0] to [landpositionx v]\n add [0] to [landpositiony v]\n add [-30] to [landpositionx v]\n add [0] to [landpositiony v]\n add [30] to [landpositionx v]\n add [0] to [landpositiony v]\n add [-60] to [landpositionx v]\n add [0] to [landpositiony v]\n add [60] to [landpositionx v]\n add [0] to [landpositiony v]\n add [-90] to [landpositionx v]\n add [0] to [landpositiony v]\n add [90] to [landpositionx v]\n add [0] to [landpositiony v]\n add [-120] to [landpositionx v]\n add [0] to [landpositiony v]\n add [120] to [landpositionx v]\n add [0] to [landpositiony v]\n set [portalx v] to [0]\n set [portaly v] to [-75]\n set [grappleability v] to [true]\nend\nif <(Stage) = [7]> then\n generateLevel [0, 105, 0, 35, 0, -35, | 0, 70, 0, 0, | | 0, 140, | 0, -70, | > >]\nend\nif <(Stage) = [8]> then\n generateLevel [-105, 70, | | 0, -35, | -105, 105, | 105, 70, | > >]\nend\nif <(Stage) = [9]> then\n generateLevel [-105, 35, | 0, 70, 0, 105, | -35, -70, 0, -70, 0, -35, 105, 35, | -105, 70, | 140, 35, | > >]\nend\nif <(Stage) = [10]> then\n generateLevel [0, 70, | -35, 105, -35, 140, | -70, -35, | 0, 105, | -175, 35, | < >]\nend\nif <(Stage) = [11]> then\n generateLevel [-105, 70, | 0, 105, 0, 70, | 105, -35, | -105, 105, | 210, 35, | < >]\nend\nif <(Stage) = [12]> then\n generateLevel [-70, 70, 35, -70, | -35, 35, 0, 0, 35, -35, | | -70, 105, | 35, -105, | > >]\nend\nif <(Stage) = [13]> then\n generateLevel [-105, 35, | 0, 70, 0, 105, 70, 0, | 0, -35, 140, -140, | -105, 70, | 210, 35, | > >]\nend\nif <(Stage) = [14]> then\n generateLevel [-105, 35, 70, -35, 105, -70, | 0, 70, 70, 0, 105, 0, | 0, -35, 140, -140, | -105, 70, | 105, -35, | < >]\nend\nif <(Stage) = [15]> then\n generateLevel [-70, 70, 35, 0, | 35, 35, 70, 0, | | -70, 105, | 70, -35, | > >]\nend\nif <(Stage) = [16]> then\n generateLevel [-105, 0, 70, 70, 70, 105, | 35, -35, 0, -35, -35, -35, -70, -35, -140, 35, -140, 70, 70, 35, 70, 0, -140, 105, -140, 140, -105, 175, | | -105, 35, | -140, -35, | < >]\nend\nif <(Stage) = [17]> then\n generateLevel [-105, 70, | -140, 105, -105, 140, -35, 105, -35, 70, -35, 35, -70, 0, -105, 0, -175, 35, -175, 70, -175, 0, -70, 140, | -140, -140, | -105, 105, | 35, -70, | < >]\nend\nif <(Stage) = [18]> then\n generateLevel [| | | 0, -140, | 0, 105, | > <]\nend\nif <(Stage) = [19]> then\n generateLevel [-70, -70, | | 0, 105, | -70, -35, | 105, 70, | > <]\nend\nif <(Stage) = [20]> then\n generateLevel [-70, -35, | -35, 140, 35, 140, 70, 70, 140, 70, | 0, 140, 105, 70, | -70, 0, | 140, 105, | > <]\nend\nif <(Stage) = [21]> then\n generateLevel [| | | -70, -105, | 105, 0, | < <]\nend\nif <(Stage) = [22]> then\n generateLevel [-105, -70, | 35, -35, | -35, 70, | -105, -35, | 105, -35, | < <]\nend\nif <(Stage) = [23]> then\n switch backdrop to (backdrop4 v)\n set [gameended v] to [true]\n set [grappled v] to [false]\n broadcast (endGame v)\n erase all\nend\nif <<(spawnX) = [null]> and <(spawnY) = [null]>> then\n set [spawnx v] to (item (1) of [landpositionx v])\n set [spawny v] to ((item (1) of [landpositiony v]) + ((gridScale) * (1)))\nend\nif <(gameEnded) = [false]> then\n broadcast (initiateLevel v)\n wait (0.1) seconds\n set [grappled v] to [false]\nend\n\nwhen I receive [stoptest v]\nset [playing v] to [false]\n\nwhen I receive [initiatelevel v]\nset [playing v] to [true]\n\nwhen I receive [askforsave v]\nask [Input save code] and wait\ngenerateLevel (answer)\n\nadd (save) to [debug v]\n\nif <(playType) = [regular]> then\n if <(loadType) = [land]> then\n add (item (1) of [debug v]) to [landpositionx v]\n add (item (2) of [debug v]) to [landpositiony v]\n end\n if <(loadType) = [obstacle]> then\n add (item (1) of [debug v]) to [obstaclepositionx v]\n add (item (2) of [debug v]) to [obstaclepositiony v]\n end\n if <(loadType) = [portal]> then\n set [portalx v] to (item (1) of [debug v])\n set [portaly v] to (item (2) of [debug v])\n end\n if <(loadType) = [spawner]> then\n set [spawnx v] to (item (1) of [debug v])\n set [spawny v] to (item (2) of [debug v])\n end\nelse\nend\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [o v] to [1]\n repeat until <<(letter (o) of (save)) = [<]> or <(letter (o) of (save)) = [>]>>\n if <not <(letter (o) of (save)) = [ ]>> then\n if <not <(letter (o) of (save)) = [,]>> then\n if <(letter (o) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (o) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [o v] by (1)\n end\n if <(letter (o) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [o v] by (2)\n if <(letter (o) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\nend\n\nwhen I receive [leveleditor v]\nswitch backdrop to (backdrop2 v)\n\nif <(Stage) = [9]> then\n generateLevel [-105, -35, 0, 0, 105, 35, 0, 70, | 35, 0, 140, 35, -35, 70, | -105, 0, | -105, 105, | >]\nend\n\nwhen I receive [startgame v]\nset [playing v] to [true]\n\nstop [all v]\n\n@Sprite1\n\nwhen flag clicked\nset [grappleability v] to [false]\nset rotation style [all around v]\npoint in direction (90)\nset size to (100) %\nstartVariables\nshow\nwait (0.1) seconds\npen up\nstartAnimation\n\ndefine doGrapple\nset [grappled v] to [true]\nset [grapplex v] to (mouse x)\nset [grappley v] to (mouse y)\nset [grapplelength v] to (distance to [mouse-pointer v])\nif <(y position) < (grappleY)> then\n set [xvelocity v] to ((xVelocity) * (-1))\nend\nbroadcast (grapple v)\n\nwhen I start as a clone\nrepeat (5)\n\ndefine move\nif <(reverseGravity) = [true]> then\n set [yvelocity v] to ((yVelocity) * (-1))\nend\nif <(grappled) = [true]> then\n set rotation style [all around v]\n point towards (grapplemarker v)\n turn left (90) degrees\n move ((xVelocity) * (1)) steps\nelse\n change x by (xVelocity)\n change y by (yVelocity)\n if <<touching color (#00cc44)?> or <touching color (#995900)?>> then\n change y by ([abs v] of (yVelocity) )\n set [yvelocity v] to [0]\n set [touchedgreen v] to [true]\n end\n if <touching color (#995900)?> then\n change y by (-1)\n change y by ((yVelocity) * (-1))\n change x by ((xVelocity) * (-1))\n set [xvelocity v] to [0]\n set [yvelocity v] to [0]\n end\n set rotation style [left-right v]\n if <(xVelocity) > [0]> then\n point in direction (90)\n else\n point in direction (-90)\n end\nend\nif <(reverseGravity) = [true]> then\n set [yvelocity v] to ((yVelocity) * (-1))\nend\nif <<touching (_edge_ v)?> or <touching color (#cc0000)?>> then\n broadcast (initiatelevel v)\nend\n\nwhen I receive [stoptest v]\nhide\nset [xvelocity v] to [0]\nset [yvelocity v] to [0]\nset [grappled v] to [false]\n\nwhen I receive [loading v]\nhide\nset [xvelocity v] to [0]\nset [yvelocity v] to [0]\nset [playing v] to [false]\nset [grappled v] to [false]\n\ndefine stageEndCheck\nif <<touching color (#d135ff)?> or <touching color (#7320ff)?>> then\n if <(playType) = [regular]> then\n broadcast (loading v)\n hide\n broadcast (nextstage v)\n erase all\n else\n if <(playType) = [levelEditor]> then\n broadcast (stoptest v)\n else\n switch backdrop to (backdrop1 v)\n set [playing v] to [false]\n broadcast (communitylevels v)\n startAnimation\n end\n end\nend\n\ndefine grappleCheck\nif <mouse down?> then\n if <(grappled) = [false]> then\n doGrapple\n set [grappletimer v] to (timer)\n end\nelse\n if <(grappled) = [true]> then\n set [grappled v] to [false]\n set [xvelocity v] to ((xVelocity) * (-1))\n set [yvelocity v] to [1]\n end\nend\n\ndefine updateVelocity\nif <(grappled) = [false]> then\n if <<key (w v) pressed?> or <key (up arrow v) pressed?>> then\n if <(touchedGreen) = [true]> then\n if <not <touching color (#814901)?>> then\n change y by (0)\n change [yvelocity v] by (8)\n set [touchedgreen v] to [false]\n end\n end\n end\n if <<key (d v) pressed?> or <key (right arrow v) pressed?>> then\n if <([abs v] of (xVelocity) ) < (maxXVelocity)> then\n change [xvelocity v] by (1)\n end\n end\n if <<key (a v) pressed?> or <key (left arrow v) pressed?>> then\n if <([abs v] of (xVelocity) ) < (maxXVelocity)> then\n change [xvelocity v] by (-1)\n end\n end\n if <not <key (any v) pressed?>> then\n if <(xVelocity) > [0]> then\n change [xvelocity v] by (-0.25)\n end\n if <(xVelocity) < [0]> then\n change [xvelocity v] by (0.25)\n end\n end\n if <touching color (#99ffbb)?> then\n if <(reverseGravity) = [true]> then\n change y by (yVelocity)\n set [yvelocity v] to ((yVelocity) * (-1))\n else\n set [yvelocity v] to ([abs v] of (yVelocity) )\n end\n end\n if <touching color (#b8ffc5)?> then\n if <(xVelocity) > [0]> then\n set [xvelocity v] to (([abs v] of (xVelocity) ) * (-1))\n else\n set [xvelocity v] to ([abs v] of (xVelocity) )\n end\n end\n if <touching color (#814901)?> then\n change y by (([abs v] of (yVelocity) ) * (-1))\n set [yvelocity v] to [-.25]\n end\n if <touching color (#92f3b0)?> then\n if <(reverseGravity) = [false]> then\n change y by (-1)\n set [yvelocity v] to (([abs v] of (yVelocity) ) * (-1))\n else\n change y by (1)\n set [yvelocity v] to ([abs v] of (yVelocity) )\n end\n end\n if <not <touching color (#99ffbb)?>> then\n change [yvelocity v] by (-0.5)\n end\nelse\n if <(reverseGravity) = [false]> then\n if <(x position) > (([x position v] of [grapplemarker v]) - (0))> then\n change [xvelocity v] by (([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (350))\n else\n change [xvelocity v] by ((([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (350)) * (-1))\n end\n else\n if <(x position) > (([x position v] of [grapplemarker v]) - (0))> then\n change [xvelocity v] by ((([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (350)) * (-1))\n else\n change [xvelocity v] by (([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (350))\n end\n end\n if then\n set [xvelocity v] to [0]\n set [yvelocity v] to [0]\n set [grappled v] to [false]\n end\n if <touching color (#b8ffc5)?> then\n move ((xVelocity) * (-1)) steps\n set [xvelocity v] to ((xVelocity) * (-1))\n end\nend\n\nwhen I receive [initiatelevel v]\nset [xvelocity v] to [0]\nset [yvelocity v] to [0]\nset [grappled v] to [false]\nset [playing v] to [true]\ngo to x: (spawnX) y: (spawnY)\nwait (0.1) seconds\nshow\nrepeat until <(playing) = [false]>\n updateVelocity\n if <(grappleAbility) = [true]> then\n grappleCheck\n end\n stageEndCheck\n move\nend\n\ndelete this clone\n\ndefine startVariables\nset [reversegravity v] to [false]\nset [xvelocity v] to [0]\nset [yvelocity v] to [0]\nset [maxxvelocity v] to [3]\nset [grapplecooldown v] to [0]\nset [grappletimer v] to [2]\nset [grapplelength v] to [0]\nset [grappled v] to [false]\ndelete (all) of [debug v]\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\ndefine startAnimation\nset rotation style [all around v]\ngo to x: (40) y: (-40)\nset [grapplex v] to [0]\nset [grappley v] to [0]\nset [grappled v] to [0]\nbroadcast (grapple v)\nset [animxv v] to [0]\nrepeat until <(playing) = [true]>\n point towards (grapplemarker v)\n turn left (90) degrees\n move ((animXV) * (1)) steps\n if <(x position) > (([x position v] of [grapplemarker v]) - (0))> then\n change [animxv v] by (([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (500))\n else\n change [animxv v] by ((([abs v] of ((y position) - ([y position v] of [grapplemarker v])) ) / (500)) * (-1))\n end\nend\n\nwhen I receive [leveleditor v]\nhide\nstartVariables\n\nchange x by ((xVelocity) * (-1))\nset [xvelocity v] to [0]\n\nif <touching color (#b8ffc5)?> then\n change x by ((xVelocity) * (-1))\nend\n\n@Sprite2\n\nwhen flag clicked\nset size to (500) %\nshow\nhide\n\nwhen I receive [initiatelevel v]\nif <(Stage) < [6]> then\n if <(playType) = [regular]> then\n wait (0.01) seconds\n set [i v] to [1]\n repeat (length of [landpositionx v])\n go to x: (item (i) of [landpositionx v]) y: (item (i) of [landpositiony v])\n create clone of (_myself_ v)\n change [i v] by (1)\n end\n end\nend\n\nwhen I start as a clone\nshow\n\nwhen I receive [initiatelevel v]\ndelete this clone\n\nwhen I receive [stoptest v]\ndelete this clone\n\n@grapple\n\nwhen flag clicked\nset pen size to (2)\nhide\npen up\nerase all\nset pen color to (#666666)\n\nforever\nend\n\nwhen I receive [grapple v]\ngo to (sprite1 v)\npen down\nrepeat until <(grappled) = [false]>\n erase all\n go to (sprite1 v)\n pen down\n go to (grapplemarker v)\n pen up\nend\nerase all\n\ngo to x: (10) y: (([y position v] of [sprite1 v]) + (-5))\n\nwhen I receive [leveleditor v]\nhide\n\n@grappleMarker\n\nwhen flag clicked\nset size to (200) %\nhide\nshow\n\nwhen I receive [grapple v]\nshow\ngo to x: (grappleX) y: (grappleY)\nwait until <(grappled) = [false]>\nhide\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\n@Portal\n\nwhen flag clicked\nhide\nset size to (500) %\n\nwhen I receive [startgame v]\nbroadcast (nextStage v)\n\nwhen I receive [stoptest v]\nhide\n\nwhen I receive [initiatelevel v]\nif <(playType) = [regular]> then\n wait (0.1) seconds\n show\n go to x: (portalX) y: (portalY)\nend\n\nforever\n if <touching (sprite1 v)?> then\n if <(playType) = [regular]> then\n broadcast (nextStage v)\n hide\n else\n broadcast (stopTest v)\n end\n end\nend\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\n@Sprite4\n\nwhen flag clicked\nset size to (500) %\nhide\n\nwhen I start as a clone\nshow\n\nwhen I receive [initiatelevel v]\ndelete this clone\n\nshow\n\nwhen I receive [initiatelevel v]\nif <(Stage) < [6]> then\n if <(playType) = [regular]> then\n wait (0.01) seconds\n set [i v] to [1]\n repeat (length of [obstaclepositionx v])\n go to x: (item (i) of [obstaclepositionx v]) y: (item (i) of [obstaclepositiony v])\n create clone of (_myself_ v)\n change [i v] by (1)\n end\n end\nend\n\n@Sprite3\n\nwhen flag clicked\ngo to [front v] layer\nwait (0.1) seconds\ngo to x: (0) y: (10)\nset size to (200) %\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (300) %\n else\n set size to (200) %\n end\nend\n\nwhen I receive [leveleditor v]\nhide\n\nwhen this sprite clicked\nhide\nset [playtype v] to [regular]\nbroadcast (startGame v)\n\nwhen I receive [communitylevels v]\nhide\n\n@Sprite6\n\nwhen I receive [leveleditor v]\nif <(clone) = [true]> then\n show\nend\n\nwhen I start as a clone\nset [clone v] to [true]\n\nwhen this sprite clicked\nif <(role) = [spawner]> then\n if <(placeAnotherSpawner) = [true]> then\n set [placeanotherspawner v] to [false]\n set [buildtype v] to (role)\n broadcast (startBuild v)\n set [placestyle v] to [regular]\n create clone of (buildtemplate v)\n end\nelse\n if <(role) = [portal]> then\n if <(placeAnotherPortal) = [true]> then\n set [placeanotherportal v] to [false]\n set [buildtype v] to (role)\n broadcast (startBuild v)\n set [placestyle v] to [regular]\n create clone of (buildtemplate v)\n end\n else\n set [buildtype v] to (role)\n broadcast (startBuild v)\n set [placestyle v] to [regular]\n create clone of (buildtemplate v)\n end\nend\n\nwhen I receive [startbuild v]\nhide\n\nwhen I receive [donebuilding v]\nif <(clone) = [true]> then\n show\nend\n\nwhen flag clicked\nhide\ngo to x: (200) y: (130)\nset size to (500) %\nset [spacing v] to [-40]\nset [clone v] to [false]\nset [role v] to [land]\ncreate clone of (_myself_ v)\nchange y by (spacing)\nset [role v] to [obstacle]\ncreate clone of (_myself_ v)\nchange y by (spacing)\nset [role v] to [portal]\ncreate clone of (_myself_ v)\nchange y by (spacing)\nset [role v] to [spawner]\ncreate clone of (_myself_ v)\nchange y by (spacing)\nset [role v] to [slime]\ncreate clone of (_myself_ v)\nchange y by (spacing)\nset [role v] to [eraser]\ncreate clone of (_myself_ v)\nset [role v] to [null]\n\nwhen I start as a clone\nset [placeanotherportal v] to [true]\nset [placeanotherspawner v] to [true]\nset [clone v] to [true]\nswitch costume to (role)\nif <(role) = [spawner]> then\n set [help v] to [Player Spawn]\nend\nif <(role) = [portal]> then\n set [help v] to [Portal]\nend\nif <(role) = [land]> then\n set [help v] to [Dirt Block]\nend\nif <(role) = [obstacle]> then\n set [help v] to [Obstacle]\nend\nif <(role) = [eraser]> then\n set [help v] to [Erase]\nend\nif <(role) = [slime]> then\n set [help v] to [Slime Block]\nend\nrepeat until <not <(Stage) = [0]>>\n if <(distance to [mouse-pointer v]) < [30]> then\n say (help) for (0.1) seconds\n end\nend\n\nwhen I receive [initiatelevel v]\nif <(clone) = [true]> then\n hide\nend\n\nwhen I receive [stoptest v]\nif <(clone) = [true]> then\n show\nend\n\n@buildTemplate\n\nwhen flag clicked\nhide\nset size to (500) %\nset [clone v] to [false]\n\nwhen I receive [initiatelevel v]\nhide\n\nwhen I start as a clone\nif <(placeStyle) = [regular]> then\n set [clone v] to [true]\n set [role v] to (buildType)\n wait (0.1) seconds\n switch costume to (role)\n show\n repeat (10)\n set x to ((round ((mouse x) / (gridScale))) * (gridScale))\n set y to ((round ((mouse y) / (gridScale))) * (gridScale))\n end\n repeat until <mouse down?>\n set x to ((round ((mouse x) / (gridScale))) * (gridScale))\n set y to ((round ((mouse y) / (gridScale))) * (gridScale))\n end\n buildChecks\n broadcast (doneBuilding v)\nelse\n hide\n set [clone v] to [true]\n set [role v] to (buildType)\n switch costume to (role)\n align\n buildChecks\n hide\nend\n\ndefine buildChecks\nif <(role) = [spawner]> then\n set [spawnx v] to (x position)\n set [spawny v] to (y position)\nend\nif <(role) = [portal]> then\n set [portalx v] to (x position)\n set [portaly v] to (y position)\nend\nif <(role) = [land]> then\n add (x position) to [landpositionx v]\n add (y position) to [landpositiony v]\nend\nif <(role) = [obstacle]> then\n add (x position) to [obstaclepositionx v]\n add (y position) to [obstaclepositiony v]\nend\nif <(role) = [slime]> then\n add (x position) to [slimepositionx v]\n add (y position) to [slimepositiony v]\nend\nif <(role) = [eraser]> then\n switch costume to (replace v)\n stamp\n switch costume to (item v)\n broadcast (removeTile v)\n broadcast (doneBuilding v)\n delete this clone\nend\n\nwhen I receive [removetile v]\nalign\nset [i v] to [0]\nif <<(x position) = ((round ((mouse x) / (gridScale))) * (gridScale))> and <(y position) = ((round ((mouse y) / (gridScale))) * (gridScale))>> then\n if <(role) = [spawner]> then\n set [spawnx v] to [null]\n set [spawny v] to [null]\n set [placeanotherspawner v] to [true]\n delete this clone\n end\n if <(role) = [portal]> then\n set [portalx v] to [null]\n set [portaly v] to [null]\n set [placeanotherportal v] to [true]\n delete this clone\n end\n if <(role) = [land]> then\n repeat until <<(item (i) of [landpositionx v]) = (x position)> and <(item (i) of [landpositiony v]) = (y position)>>\n change [i v] by (1)\n end\n delete (i) of [landpositionx v]\n delete (i) of [landpositiony v]\n delete this clone\n end\n if <(role) = [obstacle]> then\n repeat until <<(item (i) of [obstaclepositionx v]) = (x position)> and <(item (i) of [obstaclepositiony v]) = (y position)>>\n change [i v] by (1)\n end\n delete (i) of [obstaclepositionx v]\n delete (i) of [obstaclepositiony v]\n end\n delete this clone\nelse\nend\n\nwhen I receive [createblock v]\nif <(clone) = [false]> then\n go to x: (item (1) of [debug v]) y: (item (2) of [debug v])\n delete (all) of [debug v]\n set [placestyle v] to [preSelected]\n create clone of (_myself_ v)\nend\n\nwhen I receive [clearstage v]\ndelete this clone\n\nwhen I receive [initiatelevel v]\nif <<(clone) = [true]> and <not <(role) = [spawner]>>> then\n show\nend\n\nwhen I receive [renderlevel v]\nif <(clone) = [true]> then\n show\nend\n\nwhen I receive [nextstage v]\ndelete this clone\n\ndefine align\nset x to ((round ((x position) / (gridScale))) * (gridScale))\nset y to ((round ((y position) / (gridScale))) * (gridScale))\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\nwhen I receive [stoptest v]\nif <(clone) = [true]> then\n align\n show\nend\n\nwhen I receive [communitylevels v]\ndelete this clone\n\n@level editor test\n\nwhen flag clicked\nhide\nset [playtype v] to [regular]\ngo to x: (-214) y: (-130)\nset size to (300) %\nswitch costume to (play v)\n\nif then\nend\n\nwhen this sprite clicked\nif <(costume [number v]) = [1]> then\n playChecks\nelse\n broadcast (stopTest v)\n next costume\nend\n\nwhen I receive [stoptest v]\nswitch costume to (play v)\n\nwhen I receive [startgame v]\nhide\n\ndefine playChecks\nif <not <(spawnX) = [null]>> then\n if <not <(portalX) = [null]>> then\n set [stage v] to [null]\n broadcast (initiateLevel v)\n next costume\n end\nend\n\nwhen I receive [leveleditor v]\nshow\n\n@Sprite8\n\nwhen I receive [leveleditor v]\nshow\n\nwhen I receive [startgame v]\nhide\n\nwhen I receive [initiatelevel v]\nhide\n\nwhen I receive [stoptest v]\nshow\n\nwhen flag clicked\ndelete (all) of [savecodefinal v]\nshow list [savecodefinal v]\nset [savecode v] to [null]\nset size to (400) %\ngo to x: (-120) y: (-130)\nhide\n\nwhen this sprite clicked\ndelete (all) of [savecodefinal v]\nif <not <(spawnX) = [null]>> then\n if <not <(portalX) = [null]>> then\n delete (all) of [savecode v]\n set [i v] to [1]\n repeat (length of [landpositionx v])\n add (join (item (i) of [landpositionx v]) [,]) to [savecode v]\n add (join (item (i) of [landpositiony v]) [,]) to [savecode v]\n change [i v] by (1)\n end\n add [|] to [savecode v]\n set [i v] to [1]\n repeat (length of [obstaclepositionx v])\n add (join (item (i) of [obstaclepositionx v]) [,]) to [savecode v]\n add (join (item (i) of [obstaclepositiony v]) [,]) to [savecode v]\n change [i v] by (1)\n end\n add [|] to [savecode v]\n set [i v] to [1]\n repeat (length of [slimepositionx v])\n add (join (item (i) of [slimepositionx v]) [,]) to [savecode v]\n add (join (item (i) of [slimepositiony v]) [,]) to [savecode v]\n change [i v] by (1)\n end\n add [|] to [savecode v]\n add (join (spawnX) [,]) to [savecode v]\n add (join (spawnY) [,]) to [savecode v]\n add [|] to [savecode v]\n add (join (portalX) [,]) to [savecode v]\n add (join (portalY) [,]) to [savecode v]\n add [|] to [savecode v]\n if <(grappleAbility) = [true]> then\n add [<] to [savecode v]\n else\n add [>] to [savecode v]\n end\n if <(reverseGravity) = [true]> then\n add [<] to [savecode v]\n else\n add [>] to [savecode v]\n end\n add (saveCode) to [savecodefinal v]\n hide list [savecodefinal v]\n wait until <key (space v) pressed?>\n show list [savecodefinal v]\n end\nend\n\n@Sprite9\n\nwhen I receive [leveleditor v]\nshow\n\nwhen I receive [startgame v]\nhide\n\nwhen I receive [initiatelevel v]\nhide\n\nwhen I receive [stoptest v]\nshow\n\nwhen flag clicked\ndelete (all) of [debug v]\ndelete (all) of [numberfactory v]\nset size to (400) %\ngo to x: (-60) y: (-130)\nhide\n\nbroadcast (askForSave v)\n\nif <(letter (o) of (save)) = [<]> then\n set [grappleability v] to [true]\nelse\n set [grappleability v] to [false]\nend\n\nwhen this sprite clicked\nask [Input save code] and wait\nif <not <(answer) = []>> then\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (answer)) = [<]> or <(letter (x) of (answer)) = [>]>>\n if <not <(letter (x) of (answer)) = [ ]>> then\n if <not <(letter (x) of (answer)) = [,]>> then\n if <(letter (x) of (answer)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (answer)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (answer)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (answer)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n broadcast (renderLevel v)\nend\n\n@Sprite10\n\nwhen I receive [initiatelevel v]\nswitch costume to (reverseGravity)\nshow\n\nwhen flag clicked\ngo to x: (-206) y: (100)\nset size to (400) %\nhide\n\nwhen I receive [leveleditor v]\nswitch costume to (reverseGravity)\nshow\n\nwhen this sprite clicked\nif <not <(playType) = [regular]>> then\n next costume\n if <(costume [number v]) = [1]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\nend\n\nwhen I receive [createblock v]\nshow\nwait (0.5) seconds\nswitch costume to (reverseGravity)\n\nwhen I receive [renderlevel v]\nwait (1) seconds\nswitch costume to (reverseGravity)\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\nwhen I receive [communitylevels v]\nhide\ndelete this clone\n\n@Sprite11\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen I receive [loading v]\ngo to [front v] layer\nshow\n\nwhen I receive [initiatelevel v]\nhide\n\nwhen I receive [endgame v]\nhide\n\n@Sprite12\n\nwhen I receive [initiatelevel v]\nswitch costume to (grappleAbility)\nshow\n\nwhen flag clicked\ngo to x: (-206) y: (140)\nset size to (500) %\nhide\n\nwhen I receive [leveleditor v]\nswitch costume to (grappleAbility)\nshow\n\nwhen this sprite clicked\nif <not <(playType) = [regular]>> then\n next costume\n if <(costume [number v]) = [1]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\nend\n\nif <(playType) = [levelEditor]> then\n next costume\nend\n\nwhen I receive [createblock v]\nshow\nwait (0.5) seconds\nswitch costume to (grappleAbility)\n\nwhen I receive [endgame v]\nhide\ndelete this clone\n\nwhen I receive [communitylevels v]\nhide\ndelete this clone\n\n@Sprite13\n\nwhen flag clicked\nshow\nwait (0.1) seconds\ngo to x: (0) y: (113)\nset size to (100) %\nrepeat until <(playing) = [true]>\n point in direction ((([direction v] of [sprite1 v]) * (-0.2)) + (70))\nend\nhide\n\nwhen I receive [leveleditor v]\nset [playing v] to [true]\nwait (1) seconds\nset [playing v] to [false]\n\nwhen I receive [communitylevels v]\nhide\n\n@Sprite14\n\nwhen flag clicked\nhide\n\nwhen I receive [endgame v]\nshow\nset [ghost v] effect to (100)\nforever\n set x to ((mouse x) / (10))\n set y to ((mouse y) / (10))\n change [ghost v] effect by (-1)\nend\n\n@Sprite15\n\nwhen flag clicked\ngo [backward v] (5) layers\nhide\nset [ghost v] effect to (0)\n\nwhen I receive [endgame v]\nrepeat (3)\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\ngo to x: (pick random (-240) to (240)) y: (pick random (-180) to (180))\nset [speed v] to (pick random (0.5) to (1))\nswitch costume to (pick random (1) to (3))\nset size to (pick random (50) to (110)) %\nforever\n repeat until <(x position) > [239]>\n change x by (speed)\n erase all\n end\n go to x: (pick random (-210) to (-200)) y: (pick random (-160) to (160))\n set [speed v] to (pick random (0.5) to (1))\n switch costume to (pick random (1) to (3))\n set size to (pick random (50) to (150)) %\nend\n\n@Sprite7\n\nwhen this sprite clicked\nhide\nbroadcast (communityLevels v)\nset [playtype v] to [levelEditor]\nset [spawnx v] to [null]\nset [portalx v] to [null]\n\nwhen flag clicked\ngo to [front v] layer\nset [playtype v] to [regular]\nwait (0.1) seconds\ngo to x: (-110) y: (10)\nset size to (200) %\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (300) %\n else\n set size to (200) %\n end\nend\n\nwhen I receive [leveleditor v]\nhide\n\nwhen I receive [startgame v]\nhide\n\n@Sprite5\n\nwhen this sprite clicked\nhide\nbroadcast (levelEditor v)\nset [playtype v] to [levelEditor]\nset [spawnx v] to [null]\nset [portalx v] to [null]\n\nwhen I receive [startgame v]\nhide\n\nwhen flag clicked\ngo to [front v] layer\nset [playtype v] to [regular]\nwait (0.1) seconds\ngo to x: (110) y: (10)\nset size to (200) %\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (300) %\n else\n set size to (200) %\n end\nend\n\nwhen I receive [communitylevels v]\nhide\n\n@Sprite16\n\nwhen flag clicked\ngo to x: (0) y: (-130)\nhide\n\nwhen I receive [communitylevels v]\nshow\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite17\n\nwhen flag clicked\nset [buttonoffset v] to [30]\ngo to x: (buttonOffset) y: (150)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-210, -70, -175, -70, -140, -70, -105, 35, -105, 70, -105, 105, -105, 140, | -105, -70, -105, -70, -70, -70, -35, -70, 0, -70, 35, -70, 70, 70, 105, 35, 140, 0, | 70, -70, | -210, -35, | 140, -105, | < >]\n\ndefine generateLevel (save)\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearstage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createblock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiatelevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite18\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (120)\nhide\n\nwhen this sprite clicked\ngenerateLevel [140, 35, 105, 105, | -105, 35, 70, -70, | -35, -35, | -140, 70, | 175, 0, | < >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite19\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (90)\nhide\n\nwhen this sprite clicked\ngenerateLevel [175, -105, 140, -105, 35, 105, 0, 105, -35, 105, 70, -35, 70, 35, -70, -70, -140, 0, -210, 70, -210, 105, -105, -70, -175, 105, 70, 175, 35, 175, -175, 175, | 35, -105, 35, -70, 35, -35, 35, 0, 35, 35, -105, -35, -175, 35, | 105, -105, 35, 70, | 175, -70, | -240, 175, | < >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite20\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (60)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-105, 0, | -70, 0, -35, 140, -35, 35, 0, -35, 0, 105, -35, -35, -70, 140, | 35, 0, 35, 35, 35, 70, | -105, 35, | -35, 0, | < >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite21\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (30)\nhide\n\nwhen this sprite clicked\ngenerateLevel [| 70, 105, 70, 140, 70, 175, 140, 175, 140, 140, 140, 105, 70, 70, 70, 35, 140, 70, 140, 35, | 105, -105, -175, -70, -70, 0, 70, 70, 35, 70, -175, -70, | -175, -105, | 105, 140, | > <]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite22\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (0)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-210, 140, -175, 140, -140, 140, -70, 105, -70, -70, -105, -70, -105, 140, 140, 0, 105, 0, -70, 70, 70, 0, 35, 0, 0, 0, | 70, 70, 35, 70, 0, 70, -70, 70, -140, -70, -140, 70, -175, -70, -210, -70, -140, 105, -140, 35, -105, 105, -70, -35, -70, -70, -35, 70, -70, 70, -105, 70, -35, -35, 0, -35, 35, -35, 70, -35, 105, -35, 140, -35, 175, -35, | 35, -35, -105, -70, | -210, 175, | -210, -35, | < >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite23\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (-30)\nhide\n\nwhen this sprite clicked\ngenerateLevel [105, -70, -70, -70, -35, -105, 0, -105, 35, -70, 70, -105, 105, -105, 175, -140, 210, -140, 35, -105, -140, -70, -70, -105, -175, -70, -105, -105, | -175, -35, -140, -35, -105, 0, -105, 35, -140, 70, -175, 70, -210, 35, -210, 0, -175, 35, -175, 0, -140, 35, -140, 0, 175, -70, 210, -70, | 35, -35, 105, -70, -35, -70, 0, -70, 35, 0, | -70, -35, | 210, -105, | > >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite24\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (-60)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-70, -105, -35, -105, -70, -70, -105, -35, -105, 140, 105, -105, -35, -35, 0, -105, | 0, 105, 35, 70, 70, 35, 105, 0, 105, 0, 210, 70, 140, 70, | 175, -105, 140, -105, 210, -35, 105, 0, -175, 35, | -35, -70, | 175, 140, | < <]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite25\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (-90)\nhide\n\nwhen this sprite clicked\ngenerateLevel [70, 35, 35, 70, 175, 140, 245, 105, -105, -105, -35, -105, 35, -105, 140, -105, 210, -35, 175, -70, 105, 0, 175, 35, | 35, 35, 35, 0, 175, 140, 245, 140, 175, 175, 210, 175, 245, 175, 175, 35, | 105, -35, 0, -35, 210, 70, 70, 70, | -105, -70, | 210, 140, | < >]\n\ndefine generateLevel []\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearStage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createBlock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiateLevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite26\n\nwhen flag clicked\ngo to x: (buttonOffset) y: (-120)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-140, -70, -105, -70, -70, -70, -35, -70, 0, -70, -70, 105, 35, -70, -105, 105, -140, 105, -140, 70, -140, 35, -140, 0, -140, -35, 70, 0, 105, 0, 175, 0, 105, 140, 70, 140, 35, 140, 0, 140, -35, 140, 175, 35, 175, 70, 175, 105, 140, 140, 175, 140, 70, 35, 70, -35, 35, 35, | 0, -35, 35, -35, | -35, -35, | -105, -35, | 70, -70, | < >]\n\ndefine generateLevel (save)\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearstage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createblock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiatelevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite27\n\nwhen flag clicked\ngo to x: ((buttonOffset) - (175)) y: (150)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-35, 140, 0, 175, -70, 105, -105, 70, -105, -70, 35, -70, 70, -35, 140, 35, -35, 140, 0, 175, -70, 105, -105, 70, -105, -70, 35, -70, 70, -35, 140, 35, 70, 35, 70, 35, 0, 35, | -35, 70, 0, 0, -70, 0, -35, 35, -35, 70, 0, 0, -70, 0, -35, 35, -70, -175, 0, -175, 70, 140, 105, 140, 105, -35, -140, -70, 0, 140, -210, 0, 105, 70, 70, 105, 35, 140, | 70, 35, 140, 35, 175, -35, 175, 35, 105, 0, -175, -35, -35, -105, -35, -140, -35, 0, 70, 35, 140, 35, 175, -35, 175, 35, 105, 0, -175, -35, -35, -105, -35, -140, -35, 0, -35, -140, | -35, 175, | -35, 105, | > >]\n\ndefine generateLevel (save)\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearstage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createblock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiatelevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite28\n\nwhen flag clicked\ngo to x: ((buttonOffset) - (175)) y: (120)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-35, 70, 70, -35, | 0, 70, 0, 105, 0, 140, 0, 175, 35, -35, 0, -35, -35, -35, -70, -35, -105, -35, -140, -35, -210, -35, -175, -35, -240, -35, 175, 35, 175, -35, 175, 0, | 140, -35, 70, -35, 105, -35, | -35, 105, | -140, -105, | < >]\n\ndefine generateLevel (save)\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearstage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createblock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiatelevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n@Sprite29\n\nwhen flag clicked\ngo to x: ((buttonOffset) - (175)) y: (90)\nhide\n\nwhen this sprite clicked\ngenerateLevel [-140, 105, | 70, -105, 105, -70, 105, -105, 105, -35, | -105, 105, 35, -105, | -140, 140, | 140, -105, | > >]\n\ndefine generateLevel (save)\nif <not <(save) = []>> then\n broadcast (loading v)\n broadcast (clearstage v)\n set [loadtype v] to [land]\n set [x v] to [1]\n repeat until <<(letter (x) of (save)) = [<]> or <(letter (x) of (save)) = [>]>>\n if <not <(letter (x) of (save)) = [ ]>> then\n if <not <(letter (x) of (save)) = [,]>> then\n if <(letter (x) of (save)) = [|]> then\n if <(loadType) = [spawner]> then\n set [loadtype v] to [portal]\n end\n if <(loadType) = [slime]> then\n set [loadtype v] to [spawner]\n end\n if <(loadType) = [obstacle]> then\n set [loadtype v] to [slime]\n end\n if <(loadType) = [land]> then\n set [loadtype v] to [obstacle]\n end\n else\n add (letter (x) of (save)) to [numberfactory v]\n end\n else\n add (numberFactory) to [debug v]\n delete (all) of [numberfactory v]\n if <(length of [debug v]) = [2]> then\n set [buildtype v] to (loadType)\n broadcast (createblock v)\n end\n end\n end\n change [x v] by (1)\n end\n if <(letter (x) of (save)) = [<]> then\n set [grappleability v] to [true]\n else\n set [grappleability v] to [false]\n end\n change [x v] by (2)\n if <(letter (x) of (save)) = [<]> then\n set [reversegravity v] to [true]\n else\n set [reversegravity v] to [false]\n end\n switch backdrop to (backdrop3 v)\n set [playtype v] to [communityLevel]\n broadcast (initiatelevel v)\nend\n\nwhen I receive [communitylevels v]\nshow\nrepeat until <(playing) = [true]>\n if <touching (mouse-pointer v)?> then\n set size to (150) %\n else\n set size to (100) %\n end\nend\n\nwhen I receive [initiatelevel v]\nhide\n\n
Welcome to Swing!\n\nInstructions:\n-A/Left Arrow and D/Right Arrow will move you left and right\n-Hold your mouse down to initiate a grapple\n-Lift your mouse up to release the grapple\n\nSymbols in the top left:\n-Tells you whether grappling is enabled or disabled on this stage\n-Direction of gravity\n\nBlocks:\n-Land: no effect, but you can wall ride on its sides\n-Obstacle (Red block): sends you back to the start of the level\n-Slime block: bounces you back up (or down if the gravity is reversed) at the velocity that you hit it at\n\nLevel Editor:\n-The buttons on the right will let you place blocks in your level\n-The buttons on the top left will let you change grapple ability and gravity direction\n-The play symbol on the bottom left lets you test the level (You cannot test a level without a portal and/or a spawner)\n-The save button will give you a code. Highlight the text and copy it with CTRL + C (Press space to close this menu)\n-The import button will ask for a save code when you click it. Paste one that you have previously made, or paste one from the comments\n\nThanks for checking out my project.
snow platformer
@Stage\n\nwhen flag clicked\nbroadcast (start v)\n\n@menu\n\nif <mouse down?> then\nend\n\nwhen I receive [hide v]\nhide\n\nwhen I receive [start v]\nshow\ngo to x: (0) y: (0)\n\n@player\n\nwhen flag clicked\n\nwhen flag clicked\n\nwhen flag clicked\n\nif <touching color (#ff0000)?> then\nif <(x position) > [222]> then\n switch backdrop to (next backdrop v)\n go to x: (-210) y: (20)\nend\n\nwhen flag clicked\n\nwhen flag clicked\n\nnext costume\n\nwhen flag clicked\nforever\n if <key (space v) pressed?> then\nend\n\ndefine platform\npoint in direction (90)\nif <<key (right arrow v) pressed?> or <<mouse down?> and <(mouse x) > [10]>>> then\n change [xv v] by (2)\nend\nif <<key (left arrow v) pressed?> or <<mouse down?> and <(mouse x) < [-10]>>> then\n change [xv v] by (-2)\nend\nset [xv v] to ((xv) * (0.8))\nchange x by (xv)\nif <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change y by (1)\n if <touching color (#ffffff)?> then\n change x by ((xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(xv) > [0]> then\n set [xv v] to [-15]\n else\n set [xv v] to [15]\n end\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\nend\nchange [yv v] by (-1)\nchange y by (yv)\nif <touching color (#ffffff)?> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\nend\nchange y by (-1)\nif <touching color (#ffffff)?> then\n if <<key (up arrow v) pressed?> or <<mouse down?> and <(mouse y) > (y position)>>> then\n set [yv v] to [15]\n end\nend\nchange y by (1)\nif <touching color (#00cc44)?> then\n switch backdrop to (backdrop1 v)\n go to x: (-210) y: (40)\nend\nif <touching color (#ff0000)?> then\n go to x: (-210) y: (40)\nend\nif <(x position) > [222]> then\n switch backdrop to (next backdrop v)\n go to x: (-210) y: (20)\n change [level v] by (1)\nend\nif <touching color (#ffff00)?> then\n set [yv v] to [17]\nend\nif <key (r v) pressed?> then\n go to x: (-210) y: (40)\nend\nif <key (r v) pressed?> then\n go to x: (-210) y: (40)\nend\nif <touching (exit v)?> then\n switch backdrop to (backdrop9 v)\n go to x: (-210) y: (20)\nend\n\nset [yv v] to [14]\n\nchange x by (10)\n\nwhen I receive [hide v]\ngo to x: (-215) y: (240)\nset size to (450) %\nshow\ngo to [front v] layer\n\nchange [level v] by (1)\n\nshow\n\nwhen I receive [start v]\nhide\nswitch backdrop to (backdrop1 v)\nchange x by (1)\n\nwhen I receive [start v]\nforever\n if <key (down arrow v) pressed?> then\n switch costume to (costume2 v)\n end\n if <not <key (down arrow v) pressed?>> then\n switch costume to (costume1 v)\n end\nend\n\nwhen I receive [start v]\nhide\nset [something v] to [true]\nswitch costume to (costume2 v)\nforever\n if <(something) = [true]> then\n platform\n end\nend\n\nwhen I receive [start v]\nset size to (300) %\nset [xv v] to [0]\nset [yv v] to [0]\nset [level v] to [1]\n\nwhen I receive [start v]\nforever\n play sound [Drip Drop v] until done\nend\n\n@exit\n\nwhen flag clicked\ngo to x: (-212) y: (-162)\nhide\nforever\n if <(backdrop [number v]) = [9]> then\n show\n else\n hide\n end\nend\n\n@play \n\nwhen flag clicked\n\ndefine start\nstart sound [Water Drop v]\nbroadcast (hide v) and wait\nhide\n\nset y to ()\n\nset x to (0)\n\nwhen I receive [start v]\nshow\nset y to (-100)\nforever\n set size to ((50) + ((5) * ([cos v] of (((timer) - (3)) * (100)) ))) %\n point in direction ((90) + ((5) * ([cos v] of (((timer) - (3)) * (100)) )))\n if <touching (mouse-pointer v)?> then\n set size to (55) %\n point in direction (90)\n end\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n start\n end\nend\n\n@Thumbnail\n\nwhen flag clicked\nhide\n\ngo to x: (0) y: (0)\nshow\ngo to [front v] layer\n\n@Sprite2\n\nwhen flag clicked\nset [off v] to [false]\nhide\ngo to x: (-195) y: (200)\n\nwhen I receive [love favourite and follow v]\nset [off v] to [true]\n\nwhen flag clicked\nforever\n if <(off) = [true]> then\n go to [front v] layer\n set [ghost v] effect to (-10000000000)\n show\n switch costume to <(costume [number v]) = (pick random (1) to (3))>\n glide (1) secs to x: (-195) y: (142)\n wait (2) seconds\n set [off v] to [false]\n else\n set [ghost effect stop v] to [false]\n set [ghost v] effect to (-100000000000)\n wait (0.2) seconds\n broadcast (ghost effect v)\n glide (2.5) secs to x: (-195) y: (240)\n broadcast (ghost effect stop v)\n hide\n end\nend\n\nwhen I receive [ghost effect v]\nrepeat until <(ghost effect stop) = [true]>\n change [ghost v] effect by (10)\nend\n\nif <<(y position) = [230]> or <touching color (#000000)?>> then\n\nwhen I receive [ghost effect stop v]\nset [ghost effect stop v] to [true]\n\nwhen flag clicked\nforever\n wait (5) seconds\n broadcast (love favourite and follow v) and wait\n wait (30) seconds\n broadcast (love favourite and follow v) and wait\nend\n\n
If you like this check this out: https://scratch.mit.edu/projects/456410700/\ncheck it out even if you don't like this.\n\nuse arrow keys\ndown arrow to get smaller\nbased on my platformer engine version 2.0\nI got 1000 views!!!!! thank you so much for 1000 views!!!!!!!!!!!!!!!!!\ncheck out my new project promos\nhttps://scratch.mit.edu/projects/431402649\nhttps://scratch.mit.edu/projects/436180725
_=Purple Platformer=_
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen flag clicked\nforever\n if <(backdrop [number v]) = [7]> then\n broadcast (oh no! v)\n end\nend\n\nwhen I receive [yes v]\nbroadcast (message1 v)\n\nwhen I receive [message1 v]\n\nwhen I receive [message1 v]\nnext backdrop\n\nif <(backdrop [number v]) = [8]> then\n broadcast (to be continued v)\nend\n\nif <not <(backdrop [number v]) = [9]>> then\n\nwhen flag clicked\nforever\n play sound [Alan Walker - Faded.mp3 v] until done\nend\n\n@Sprite1\n\ndefine Move (direction) (speed)\nswitch costume to (direction)\nchange x by (speed)\nset [slope v] to [0]\nrepeat until <<(slope) = [8]> or <not <touching color (#b2b2b2)?>>>\n change y by (1)\n change [slope v] by (1)\nend\nif <(slope) = [8]> then\n change x by ((0) - (speed))\n change y by ((0) - (slope))\nend\n\ndefine Touch ground\nchange [fallin' v] by (1)\nrepeat until <not <touching color (#b2b2b2)?>>\n change y by (1)\n set [fallin' v] to [0]\n set [gravity v] to [0]\nend\n\ndefine Touch Ground <up?>\nchange [fallin' v] by (1)\nrepeat until <not <touching color (#b2b2b2)?>>\n if <up?> then\n change y by (-1)\n else\n change y by (1)\n set [fallin' v] to [0]\n end\n set [gravity v] to [0]\nend\n\nwhen flag clicked\nset [walljump v] to [0]\nforever\n if <key (up arrow v) pressed?> then\n if <(costume [number v]) = [2]> then\n if <key (left arrow v) pressed?> then\n if <<(slope) = [8]> and <(gravity) > [-100]>> then\n repeat (3)\n change [walljump v] by (6)\n change x by (walljump)\n end\n change y by (5)\n set [gravity v] to [0]\n change [gravity v] by (6)\n set [walljump v] to [0]\n end\n end\n else\n if <(costume [number v]) = [1]> then\n if <key (right arrow v) pressed?> then\n if <<(slope) = [8]> and <(gravity) > [-100]>> then\n repeat (3)\n change [walljump v] by (-6)\n change x by (walljump)\n end\n change y by (5)\n set [gravity v] to [0]\n change [gravity v] by (6)\n set [walljump v] to [0]\n end\n end\n end\n end\n end\nend\n\nwhen flag clicked\nset rotation style [left-right v]\ngo to x: (-215) y: (-25)\nshow\nset [gravity v] to [0]\nset [fallin' v] to [10]\nforever\n change [gravity v] by (-1)\n change y by (gravity)\n Touch Ground <(gravity) > [0]>\n if <key (left arrow v) pressed?> then\n Move (2) (-5.5)\n end\n if <key (right arrow v) pressed?> then\n Move (1) (5.5)\n end\n if <<key (up arrow v) pressed?> and <[3] > (fallin')>> then\n set [gravity v] to [9]\n end\nend\n\nwhen flag clicked\nset [ghost v] effect to (100)\nforever\n if <touching color (#ff0000)?> then\n go to x: (-215) y: (-25)\n broadcast (yuh v)\n end\nend\n\nwhen flag clicked\nforever\n if <(x position) > [220]> then\n broadcast (message1 v)\n go to x: (-215) y: (-25)\n end\nend\n\nwhen I receive [yes v]\ngo to x: (-215) y: (-25)\n\nwhen flag clicked\nforever\n if <touching (sprite8 v)?> then\n broadcast (key v)\n end\nend\n\nhide\n\n@Sprite2\n\nwhen flag clicked\nswitch costume to (costume1 v)\nshow\nset size to (100) %\nforever\n go to (sprite1 v)\nend\n\nwhen flag clicked\nforever\n wait (0.001) seconds\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nset size to (100) %\nset [ghost v] effect to (0)\nrepeat (10)\n change [ghost v] effect by (9)\n change size by (-5)\nend\ndelete this clone\n\nwhen I receive [oh no! v]\nset [ghost v] effect to (100)\nshow\nset size to (100) %\nforever\n go to (sprite1 v)\nend\n\nwhen I receive [yes v]\nshow\nset size to (100) %\nset [ghost v] effect to (0)\n\nwhen I receive [key v]\nswitch costume to (costume2 v)\n\nwhen flag clicked\nforever\n set [costume v] to (costume [number v])\nend\n\n@Sprite3\n\nwhen flag clicked\nhide\n\nwhen I receive [oh no! v]\ngo to x: (120) y: (-17)\nshow\n\nwhen this sprite clicked\nbroadcast (no v)\nhide\n\nwhen I receive [yes v]\nhide\n\nwhen I receive [no v]\nhide\n\n@Sprite4\n\nwhen I receive [oh no! v]\ngo to x: (-120) y: (-17)\nshow\n\nwhen this sprite clicked\nwait (0.1) seconds\nbroadcast (yes v)\n\nwhen I receive [no v]\nhide\n\nwhen flag clicked\nhide\nforever\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n hide\n end\nend\n\nwhen I receive [yes v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nset [ghost v] effect to (100)\nforever\n go to x: (0) y: (0)\nend\n\nwhen I receive [saved v]\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\n@Sprite6\n\nwhen flag clicked\nforever\n set [ghost v] effect to (100)\n go to x: (0) y: (0)\nend\n\nshow\n\n@Sprite7\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [no v]\nshow\n\n@Sprite8\n\nwhen flag clicked\ngo to x: (-11) y: (-127)\nhide\nwait until <(backdrop [number v]) = [10]>\nbroadcast (now v)\nshow\nforever\n if <touching (sprite1 v)?> then\n hide\n end\nend\n\nwhen I receive [key v]\n\n@Sprite9\n\nwhen flag clicked\ngo to x: (190) y: (-107)\nhide\ngo [backward v] (1111111101101010000) layers\n\nwhen I receive [now v]\nshow\nforever\n if <<(costume) = [2]> and <touching (sprite1 v)?>> then\n hide\n broadcast (saved v)\n end\nend\n\n
Arrow keys to move and jump\nPlease leave a love and fave\ndouble click flag to prevent lag (glitches might occur on slower computers if you dont!!!)\nThe end was kinda rushed and you can tell\nREAD THE TEXT FOR THE STORY!!\n(the really cheesy one btw)\n___________________________________________\nWhats up guys. I haven't made any new content in a few years, but it would be cool if you are seeing this to visit my most recent project here: https://scratch.mit.edu/projects/283681639/
~ Scratch 3.0 Platformer ~
@Stage\n\nwhen flag clicked\nforever\n play sound [Tune01 v] until done\nend\n\n@Confetti\n\nwhen I start as a clone\nset size to (pick random (25) to (50)) %\ngo [backward v] (100) layers\nswitch costume to (pick random (1) to (4))\ngo to x: (pick random (-235) to (195)) y: (180)\nshow\nrepeat until <(y position) < [-175]>\n turn right (pick random (5) to (15)) degrees\n change y by (-10)\nend\ndelete this clone\n\nwhen flag clicked\nhide variable [falling? v]\nFalling Blocks\n\ndefine Falling Blocks\nset [falling? v] to [1]\ngo [backward v] (500) layers\nrepeat until <key (f v) pressed?>\n create clone of (_myself_ v)\n wait (0.1) seconds\nend\nset [falling? v] to [0]\nstop [this script v]\n\nwhen [n v] key pressed\nif <not <(Falling?) = [1]>> then\n Falling Blocks\nend\n\n@Thumbnail!\n\nwhen flag clicked\ngo [backward v] (-5) layers\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to x: (0) y: (0)\nclear graphic effects\nrepeat (10)\n change [ghost v] effect by (25)\nend\nset [ghost v] effect to (100)\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\nshow\nswitch costume to (costume1 v)\n\n@Edge\n\nwhen flag clicked\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\n\nwhen I receive [next level v]\nnext costume\n\n@Story\n\nwhen flag clicked\nswitch costume to (1 v)\ngo to [front v] layer\ngo to [front v] layer\ngo to [front v] layer\ngo [backward v] (1) layers\nshow\ngo to x: (0) y: (0)\nwait until <key (space v) pressed?>\nhide\nbroadcast (Start v)\n\nwhen I receive [gobo desert v]\nswitch costume to (2 v)\nshow\nwait until <key (space v) pressed?>\nhide\n\nwhen I receive [gobo desert v]\nwait (1) seconds\nbroadcast (Lvl 6 v)\nstop [this script v]\n\nwhen I receive [script canyon v]\nswitch costume to (3 v)\nshow\nwait until <key (space v) pressed?>\nhide\n\nwhen I receive [script canyon v]\nwait (1) seconds\nbroadcast (Lvl 11 v)\nstop [this script v]\n\nwhen I receive [neigh dilemma v]\nwait (1) seconds\nbroadcast (Lvl 16 v)\nstop [this script v]\n\nwhen I receive [neigh dilemma v]\nswitch costume to (4 v)\nshow\nwait until <key (any v) pressed?>\nif <<key (1 v) pressed?> or <<key (3 v) pressed?> or <<key (5 v) pressed?> or <<key (7 v) pressed?> or <key (9 v) pressed?>>>>> then\n broadcast (Continue; Neigh v)\nelse\n if <<key (2 v) pressed?> or <<key (4 v) pressed?> or <<key (6 v) pressed?> or <<key (8 v) pressed?> or <key (0 v) pressed?>>>>> then\n broadcast (Continue; Gobo's Friends v)\n end\nend\nhide\n\nwhen I receive [thanks for playing! v]\nshow\nswitch costume to (5 v)\n\n@Platform\n\nwhen flag clicked\ngo to x: (0) y: (0)\nswitch costume to (backdrop1 v)\n\nwhen I receive [lvl 6 v]\nswitch costume to (backdrop6 v)\n\nwhen I receive [next level v]\nif <(costume [number v]) = [5]> then\n broadcast (Gobo Desert v)\nelse\n if <(costume [number v]) = [10]> then\n broadcast (Script Canyon v)\n else\n if <(costume [number v]) = [15]> then\n broadcast (Neigh Dilemma v)\n else\n if <(costume [number v]) = [20]> then\n broadcast (Thanks for Playing! v)\n else\n next costume\n end\n end\n end\nend\n\nwhen I receive [lvl 11 v]\nswitch costume to (backdrop11 v)\n\nwhen I receive [lvl 16 v]\nswitch costume to (backdrop16 v)\n\n@Character\n\nwhen I receive [start v]\nset rotation style [left-right v]\ngo to x: (-200) y: (-85)\nswitch costume to (neigh pony v)\nset size to (50) %\nshow\nset [x v] to [0]\nset [y v] to [0]\nforever\n change [y v] by (-1)\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n point in direction (90)\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#ffae28)?> then\n change y by (1)\n end\n if <touching color (#ffae28)?> then\n change y by (1)\n end\n if <touching color (#ffae28)?> then\n change y by (1)\n end\n if <touching color (#ffae28)?> then\n change y by (1)\n end\n if <touching color (#ffae28)?> then\n change y by (-4)\n change x by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <touching color (#ffae28)?> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#ffae28)?>> then\n set [y v] to [15]\n end\n change y by (1)\n if <touching color (#43b8ff)?> then\n if <([costume # v] of [platform v]) = [13]> then\n go to x: (-200) y: (115)\n else\n go to x: (-200) y: (-85)\n end\n end\n if <touching (edge v)?> then\n broadcast (Next Level v)\n go to x: (-200) y: (-85)\n end\n if <touching color (#336423)?> then\n set [y v] to [25]\n end\nend\n\nwhen I receive [lvl 6 v]\nwait until <key (space v) pressed?>\nwait until <key (space v) pressed?>\ngo to x: (-200) y: (-85)\npoint in direction (90)\n\nwhen I receive [lvl 11 v]\nswitch costume to (carry v)\nwait until <key (space v) pressed?>\ngo to x: (-200) y: (-85)\npoint in direction (90)\nwait until <([costume # v] of [platform v]) = [13]>\ngo to x: (-200) y: (115)\n\nwhen I receive [continue; gobo's friends v]\nswitch costume to (carry v)\n\nwhen I receive [continue; neigh v]\nswitch costume to (neigh pony v)\n\nwhen I receive [lvl 16 v]\nwait until <key (any v) pressed?>\ngo to x: (-200) y: (-85)\npoint in direction (90)\n\nwhen I receive [continue; gobo's friends v]\nswitch costume to (carry v)\n\n@Moving Platform\n\nwhen flag clicked\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nhide\nwait until <([costume # v] of [platform v]) = [15]>\nshow\nrepeat until <([costume # v] of [platform v]) = [16]>\n turn right (1) degrees\nend\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [16]>\ngo to x: (60) y: (20)\npoint in direction (90)\nswitch costume to (costume2 v)\nrepeat until <([costume # v] of [platform v]) = [17]>\n Fade\nend\n\ndefine Fade\nswitch costume to (costume2 v)\nwait (0.1) seconds\nswitch costume to (costume3 v)\nwait (0.1) seconds\nswitch costume to (costume4 v)\nwait (0.1) seconds\nswitch costume to (costume5 v)\nwait (0.1) seconds\nswitch costume to (costume6 v)\nwait (0.1) seconds\nswitch costume to (costume5 v)\nwait (0.1) seconds\nswitch costume to (costume4 v)\nwait (0.1) seconds\nswitch costume to (costume3 v)\nwait (0.1) seconds\nswitch costume to (costume2 v)\nwait (2) seconds\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [18]>\nhide\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [19]>\ngo to x: (0) y: (0)\nshow\nswitch costume to (costume2 v)\nrepeat until <([costume # v] of [platform v]) = [20]>\n Fade\nend\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [19]>\nshow\nrepeat until <([costume # v] of [platform v]) = [20]>\n repeat (48)\n change x by (-10)\n end\n repeat (48)\n change x by (10)\n end\nend\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [20]>\nhide\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [17]>\nhide\n\n@Falling Dots\n\nwhen I start as a clone\nset size to (pick random (50) to (100)) %\ngo to [front v] layer\ngo to [front v] layer\nswitch costume to (costume1 v)\ngo to x: (pick random (-235) to (195)) y: (180)\nshow\nrepeat until <(y position) < [-175]>\n change y by (-10)\nend\ndelete this clone\n\nwhen flag clicked\ngo to [front v] layer\ngo to [front v] layer\nwait until <([costume # v] of [platform v]) = [20]>\nforever\n create clone of (_myself_ v)\n wait (0.25) seconds\nend\n\nwhen flag clicked\nwait until <([costume # v] of [story v]) = [5]>\nstop [other scripts in sprite v]\nstop [this script v]\n\n@Scratch Cat\n\nwhen flag clicked\nhide\nset size to (125) %\n\nwhen I receive [thanks for playing! v]\ngo to [front v] layer\nshow\ngo to x: (0) y: (-110)\nforever\n switch costume to (cat1-a v)\n wait (0) seconds\n switch costume to (cat1-a2 v)\n wait (0) seconds\n switch costume to (cat1-a3 v)\n wait (0) seconds\n switch costume to (cat1-a4 v)\n wait (0) seconds\n switch costume to (cat1-a3 v)\n wait (0) seconds\n switch costume to (cat1-a2 v)\n wait (0) seconds\n switch costume to (cat1-a v)\n wait (0) seconds\nend\n\n@Moving Platform2\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [17]>\ngo to x: (180) y: (0)\ngo [backward v] (1) layers\ngo [backward v] (1) layers\nswitch costume to (costume7 v)\nshow\nrepeat until <([costume # v] of [platform v]) = [18]>\n repeat (48)\n change x by (-10)\n end\n repeat (48)\n change x by (10)\n end\nend\n\nwhen flag clicked\nwait until <([costume # v] of [platform v]) = [18]>\nhide\n\nwhen flag clicked\nhide\n\n
~ Welcome to Scratch 3.0 Platformer! ~\n\nUse the arrow keys to move.\nSome of the levels may be difficult, but none of them are impossible! \nPress f to turn the falling blocks off, and n to turn them back on.\n\nThis game is heavily based off of one of my older projects, Scratch Day Platformer (link: https://scratch.mit.edu/projects/220952936/)\nI really enjoyed making this sequel and I hope you enjoy it too!\n
Scrolling Platformer
@Stage\n\n@Platforms\n\nwhen flag clicked\nshow\nswitch costume to (level 1 1 v)\nforever\n go to x: ((scrollx) * (-1)) y: ((scrolly) * (-1))\nend\n\nwhen I receive [next v]\nnext costume\n\n@Exit\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (10) layers\nforever\n go to x: (((scrollx) * (-1)) + (100)) y: (0)\nend\n\nwhen flag clicked\nswitch costume to (exit v)\nforever\n set [exit? v] to [0]\n if <touching (player v)?> then\n broadcast (2 v)\n set [exit? v] to [1]\n switch costume to (exit v)\n repeat (7)\n next costume\n wait (0.02) seconds\n end\n broadcast (message1 v)\n wait (1) seconds\n repeat (7)\n switch costume to ((costume [number v]) - (1))\n wait (0.02) seconds\n end\n switch costume to (exit v)\n end\nend\n\n@Player\n\nwhen flag clicked\nshow\ngo to x: (-100) y: (0)\nset [scrollx v] to [0]\nset [x v] to [0]\nset [y v] to [0]\nforever\n if <(exit?) = [0]> then\n change [y v] by (-1)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change [scrollx v] by (x)\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by (1)\n end\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by (1)\n end\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by (1)\n end\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by (1)\n end\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by (-4)\n change [scrollx v] by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [15]\n if <([abs v] of (x) ) = (x)> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n change y by (y)\n if <<touching (platforms v)?> and <not <touching color (#ff0000)?>>> then\n change y by ((y) - ((y) * (2)))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <<touching (platforms v)?> and <not <touching color (#ff0000)?>>>> then\n set [y v] to [15]\n end\n change y by (1)\n else\n set [x v] to [0]\n set [y v] to [0]\n end\nend\n\nwhen I receive [next v]\nset [scrollx v] to [0]\n\nwhen flag clicked\nforever\n if <<<(round (y position)) = [-179]> or <touching color (#ff0000)?>> or <key (r v) pressed?>> then\n go to x: (-100) y: (0)\n set [scrollx v] to [0]\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nset [ghost v] effect to (100)\nforever\n go to x: (0) y: (0)\n go to [front v] layer\nend\n\nwhen I receive [2 v]\nrepeat (40)\n change [ghost v] effect by (-2.5)\nend\nbroadcast (next v)\nrepeat (40)\n change [ghost v] effect by (2.5)\nend\n\n
-=-Teleport-=- (Platformer!)
@Stage\n\nwhen flag clicked\nhide variable [level v]\nhide variable [xv v]\nhide variable [yv v]\n\n@Sprite1\n\nwhen flag clicked\nswitch costume to (costume1 v)\nset size to (250) %\nset [yv v] to [0]\nset [xv v] to [0]\n\nwhen flag clicked\ngo to x: (-218) y: (0)\nforever\n change [yv v] by (-0.5)\n if <key (right arrow v) pressed?> then\n set [xv v] to [5]\n point in direction (90)\n end\n if <key (left arrow v) pressed?> then\n set [xv v] to [-5]\n point in direction (-90)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n if <touching color (#000000)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [10.8]\n end\n end\n change y by (1)\nend\n\nwhen I receive [next level - v]\ngo to x: (-218) y: (0)\n\nwhen flag clicked\nforever\n if <touching color (#ffcccc)?> then\n go to x: (-218) y: (-120)\n end\nend\n\nwhen I receive [fast people v]\nhide variable [timer: v]\nshow\n\nwhen [space v] key pressed\nnext costume\n\n@Sprite2\n\nwhen flag clicked\nswitch costume to (costume1 v)\n\nwhen I receive [next level - v]\nnext costume\n\nwhen flag clicked\nshow\ngo [backward v] (20) layers\ngo to x: (0) y: (-2)\nset size to (100) %\n\nwhen I receive [goodj v]\nhide\n\n@Sprite3\n\nwhen flag clicked\nset [level v] to [0]\nshow\nset size to (300) %\npoint in direction (90)\ngo to x: (212) y: (155)\nforever\n wait (0.001) seconds\n turn right (20) degrees\nend\n\nwhen flag clicked\nforever\n if <touching (sprite1 v)?> then\n broadcast (Next Level - v)\n wait (0.4) seconds\n change [level v] by (1)\n if <(level) = [10]> then\n wait (1) seconds\n broadcast (GoodJ v)\n end\n end\nend\n\nwhen I receive [goodj v]\nhide\n\n@Sprite4\n\nwhen flag clicked\nset [helper v] to [0]\nset size to (71.4) %\nshow\ngo to x: (-198) y: (149)\nshow variable [time v]\nset [time v] to [0]\nrepeat until <(Helper) = [3]>\n wait (0.9) seconds\n change [time v] by (1)\nend\n\nwhen I receive [goodj v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nhide\nhide variable [time4 v]\nhide variable [level v]\nhide variable [time1 v]\nhide variable [time2 v]\nhide variable [time3 v]\nhide variable [time4 v]\nhide variable [☁ un1 v]\nhide variable [☁ un2 v]\nhide variable [☁ un3 v]\nhide variable [time x v]\nhide variable [timer: v]\n\nwhen I receive [fast people v]\nshow\nset [time x v] to (Time)\nshow variable [time x v]\nset [un v] to (username)\nshow variable [un v]\n\n@Sprite6\n\nwhen I receive [goodj v]\nshow\ngo to x: (0) y: (0)\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nforever\n play sound [Murad - Run \(Inspired By Alan Walker\) NCN Release.mp3 v] until done\nend\n\n@Sprite7\n\nwhen I receive [goodj v]\nshow\ngo to x: (0) y: (300)\nglide (2.3) secs to x: (0) y: (0)\nhide variable [time v]\nset [helper v] to [3]\nrepeat (1)\n repeat (20)\n wait (0.1) seconds\n change y by (1)\n end\n wait (0.1) seconds\n repeat (50)\n wait (0.1) seconds\n change y by (-1)\n end\nend\nhide\nbroadcast (Fast people v)\n\nwhen flag clicked\nset [time v] to [0]\nset [random reset v] to (pick random (1) to (65))\nforever\n if <(Random RESET) = [47]> then\n set [un1 v] to [0]\n set [un2 v] to [0]\n set [un3 v] to [0]\n set [time1 v] to [0]\n set [time2 v] to [0]\n set [time3 v] to [0]\n set [time4 v] to [0]\n end\nend\n\nwhen flag clicked\nforever\n if <(Time1) = [0]> then\n set [time1 v] to [135]\n end\n if <(Time2) = [0]> then\n set [time2 v] to [150]\n end\n if <(Time3) = [0]> then\n set [time3 v] to [189]\n end\nend\n\n@Sprite8\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nhide variable [un1 v]\nhide variable [un2 v]\nhide variable [un3 v]\nhide variable [un v]\nforever\n if <(username) = [Jlam09]> then\n show\n go to [front v] layer\n go to x: (0) y: (0)\n end\nend\n\n
Blocky Platformer 3
@Stage\n\nwhen flag clicked\nset [location v] to [0]\nset [level v] to [1]\nset [selected block v] to [g]\nhide variable [selected block v]\nhide variable [level v]\nhide variable [location v]\nhide variable [local fastest time v]\n\n show variable [local fastest time v]\nend\nshow list [custom levels v]\nswitch backdrop to (awesome-llama menu1 v)\nreset save\nbroadcast (! initalise v)\nforever\n broadcast (tick v)\n wait (0) seconds\nend\n\nwhen I receive [load level v]\nswitch backdrop to (load screen v)\nwait (1) seconds\nswitch backdrop to (awesome-llama menu1 v)\n\nwhen [l v] key pressed\nif <(Location) = [2]> then\n ask [Load Save Code \(Cancel by typing nothing\)] and wait\n if <not <(length of (answer)) = [192]>> then\nend\n\ndelete (all) of [current save v]\n\ndefine reset save\ndelete (all) of [custom levels v]\nshow list [current save v]\ndelete (all) of [current save v]\nrepeat (16)\n add [g] to [current save v]\n repeat (11)\n add [a] to [current save v]\n end\nend\n\nwhen [b v] key pressed\nif <(Location) = [2]> then\n ask [Select Block ID] and wait\n set [selected block v] to (answer)\nend\n\nwhen [s v] key pressed\nwait until <not <key (s v) pressed?>>\nif <(Location) = [2]> then\n if <not <(item (last) of [custom levels v]) = (Current Save)>> then\n add (Current Save) to [custom levels v]\n end\n hide list [custom levels v]\n wait until <key (s v) pressed?>\nend\nshow list [custom levels v]\n\nwhen I receive [tick v]\nif <not <(backdrop [name v]) = [Load Screen]>> then\n if <(Location) = [0]> then\n switch backdrop to (awesome-llama menu1 v)\n else\n switch backdrop to (sky v)\n end\nend\n\nadd [thing] to [current save v]\n\ndefine load save\nset [load v] to [0]\ndelete (all) of [current save v]\nrepeat (192)\n change [load v] by (1)\n add (letter (load) of (answer)) to [current save v]\nend\n\nwhen I receive [! initalise v]\nforever\n broadcast (5 sec tick v)\n wait (5) seconds\nend\n\nwhen I receive [play v]\nset volume to (60) %\nwait (2) seconds\nforever\n play sound [732229.mp3 v] until done\nend\n\nwhen I receive [load custom v]\nask [Input level save:] and wait\nif <(length of (answer)) = [192]> then\n delete all of [custom levels v]\n add (answer) to [custom levels v]\n set [location v] to [3]\n broadcast (play v)\nend\n\nwhen I receive [play v]\nwait (1) seconds\nwait until <(Level) = [21]>\nset volume to (60) %\n\n@thumbnail\n\nwhen flag clicked\nhide\n\nswitch costume to (menu title v)\ngo to x: (0) y: (0)\nshow\n\n@Menu\n\nwhen I receive [! initalise v]\nclear graphic effects\nswitch costume to (play button v)\nset size to (100) %\ngo to x: (0) y: (0)\nshow\ngo to [front v] layer\ncreate clone of (_myself_ v)\nswitch costume to (level editor v)\ncreate clone of (_myself_ v)\nswitch costume to (load levels v)\ncreate clone of (_myself_ v)\nswitch costume to (menu title v)\n\nwhen I start as a clone\nset size to (400) %\nif <(costume [number v]) = [2]> then\n go to x: (-180) y: (0)\nelse\n if <(costume [number v]) = [3]> then\n go to x: (-180) y: (-50)\n else\n go to x: (-180) y: (-100)\n end\nend\n\nwhen this sprite clicked\nif <not <(costume [number v]) = [1]>> then\n set [brightness v] effect to (20)\n hide variable [local fastest time v]\n broadcast (hide v)\n if <(costume [number v]) = [2]> then\n reset timer\n set [location v] to [1]\n broadcast (play v)\n else\n if <(costume [number v]) = [3]> then\n reset timer\n set [location v] to [2]\n broadcast (load level v)\n else\n if <(costume [number v]) = [4]> then\n broadcast (load custom v)\n else\n set [location v] to [0]\n end\n end\n end\n wait (0) seconds\n set [brightness v] effect to (0)\nend\n\nwhen I receive [tick v]\nif <<(Location) = [0]> and <[awesome-llama Menu1] = (backdrop [name v])>> then\n show\nelse\n hide\nend\n\nwhen I receive [hide v]\nhide\n\nwhen I receive [play v]\nwait (1) seconds\nbroadcast (reset v)\n\nwhen I receive [load custom v]\n\nwait (1) seconds\nwait until <not <(Level) = [1]>>\nset [location v] to [0]\n\n@Player\n\nchange y by (-2)\nchange y by (2)\n\nwhen I receive [tick v]\nif <<(Location) = [1]> or <(Location) = [3]>> then\n show\nelse\n hide\nend\nif <(backdrop [name v]) = [Load Screen]> then\n set [ghost v] effect to (100)\nelse\n set [ghost v] effect to (0)\nend\n\nset size to (220) %\n\ndefine find air\nset [ghost v] effect to (100)\nshow\nset y to (-130)\nrepeat (12)\n if <not <touching (tile renderer v)?>> then\n stop [this script v]\n end\n change y by (30)\nend\nhide\n\nwhen [r v] key pressed\nbroadcast (reset v) and wait\nfind air\nclear graphic effects\n\nwhen I receive [reset v]\nhide\nwait (0.1) seconds\nswitch costume to (null v)\ngo to x: (-225) y: (-34)\npoint in direction (90)\nset [xv v] to [0]\nset [yv v] to [0]\nswitch costume to (jelly v)\nhide\nfind air\nhide\nclear graphic effects\n\nwhen I receive [! initalise v]\nset volume to (20) %\nswitch costume to (jelly v)\ngo to x: (-225) y: (-34)\nset [fails v] to [0]\nset [xv v] to [0]\nset [yv v] to [0]\nhide\nforever\n if <<(Location) = [1]> or <(Location) = [3]>> then\n set size to (220) %\n if <[239] < (x position)> then\n hide\n if <(Location) = [3]> then\n set [location v] to [0]\n broadcast (load menu v)\n else\n broadcast (advance level v) and wait\n go to x: (0) y: (200)\n broadcast (reset v) and wait\n show\n end\n end\n if <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <(letter (3) of (keys)) = [1]>> then\n change [xv v] by (1)\n point in direction (90)\n end\n if <<<key (left arrow v) pressed?> or <key (a v) pressed?>> or <(letter (1) of (keys)) = [1]>> then\n change [xv v] by (-1)\n point in direction (-90)\n end\n set [xv v] to ((Xv) * (0.9))\n if <touching color (#4a91f7)?> then\n set [xv v] to ((Xv) * (0.8))\n else\n if <touching color (#3bf621)?> then\n set [xv v] to ((Xv) * (0.8))\n end\n end\n if <(Xv) < [-6]> then\n set [xv v] to [-6]\n else\n if <[6] < (Xv)> then\n set [xv v] to [6]\n end\n end\n change x by (Xv)\n set size to (280) %\n if <<(y position) < [-165]> or <<touching color (#f36b01)?> or <touching color (#ffa002)?>>> then\n broadcast (lava v)\n set size to (220) %\n start sound [burn v]\n broadcast (death effect v)\n broadcast (reset v) and wait\n end\n set size to (220) %\n if <touching (tile renderer v)?> then\n change y by (1)\n if <touching (tile renderer v)?> then\n change y by (1)\n if <touching (tile renderer v)?> then\n change y by (1)\n if <touching (tile renderer v)?> then\n change y by (1)\n if <touching (tile renderer v)?> then\n change y by (1)\n if <touching (tile renderer v)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <(letter (2) of (keys)) = [1]>> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [12]\n start sound (pick random (1) to (6))\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching (tile renderer v)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching (tile renderer v)?> then\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <(letter (2) of (keys)) = [1]>> then\n if <touching color (#3bf621)?> then\n set [yv v] to [16.2]\n start sound (pick random (1) to (6))\n else\n if <touching color (#4a91f7)?> then\n change [yv v] by (10)\n start sound [splash v]\n else\n set [yv v] to [12.5]\n start sound (pick random (1) to (6))\n end\n end\n end\n end\n change y by (1)\n end\n set size to (230) %\nend\n\nset [level v] to [5]\nbroadcast (load level v)\n\nbroadcast (reset v)\n\nwhen I receive [shift clones v]\nchange x by (-40)\n\ngo to [front v] layer\n\nset [color v] effect to (0)\n\n@Tile Renderer\n\nwhen I receive [switch costume v]\nif <[0] < (id)> then\n if <(Location) = [2]> then\n if <[a] = (letter (id) of (Current Save))> then\n switch costume to (0 v)\n else\n switch costume to (letter (id) of (Current Save))\n end\n else\n if <(Location) = [3]> then\n if <[a] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (a v)\n else\n switch costume to (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))\n end\n if <<(costume [number v]) > [16]> and <not <(costume [number v]) = [20]>>> then\n switch costume to (a v)\n end\n else\n if <[a] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (a v)\n else\n switch costume to (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))\n end\n if <<(costume [number v]) > [16]> and <not <(costume [number v]) = [20]>>> then\n switch costume to (a v)\n end\n end\n end\nend\n\nwhen I receive [tick v]\nif <(costume [number v]) = [2]> then\n set [ghost v] effect to (75)\nelse\n set [ghost v] effect to (0)\nend\nif <(costume [number v]) = [14]> then\n if <touching (player v)?> then\n set [brightness v] effect to (-20)\n else\n set [brightness v] effect to (0)\n end\nend\n\nwhen I receive [! initalise v]\nset [id v] to [-1]\nset [vertical layer offset v] to [0]\nset size to (380) %\ngo to x: (-225) y: (-165)\nswitch costume to (x v)\nhide\n\nwhen I receive [advance level v]\nif <(id) < [1]> then\n change [level v] by (1)\n broadcast (load level v)\nend\n\nwhen I receive [load level v]\nif <(id) < [1]> then\n if <(Level) = [21]> then\n \n show variable [local fastest time v]\n end\n if <(round (timer)) < (local fastest time)> then\n set [local fastest time v] to (round (timer))\n end\n end\n set size to (380) %\n hide\n go to x: (-225) y: (-165)\n broadcast (delete clones v)\n wait (0) seconds\n load level\n broadcast (load bg v)\nend\n\nwhen I receive [play v]\nif <(id) < [1]> then\n set [level v] to [1]\n broadcast (load level v)\nend\n\ndelete (all) of [levels v]\nadd [se***sebddgaes***esbdgaae*****bdg#aas**aa*ddg#aas*aaaaaaaaaabgaaaaaaaaaabgaaaaaaaaaasbg#aaaaaaaaddgaaaaaaaaaddg#aaaaaaaaddgaaaaaaaaadddgaaaaaaaadddddgaaaaaabddddgaaaaaassbddddg#aaasessbddgaaaa] to [levels v]\nadd [esbddddg#aaaesbdgaaaaaaasbdgaaaaaaaasbdg#aaaaaaas*dgaaaaaaaashhlaaaaaaaahhmlaaaaaaaahhhhaaaaaaaahs*haaaaaaaa*eshaaaaaaaaessbaaaaaaaassbdgaaaaaaasbddg#aaaaaaesbdg#aaaaaasssbgaaaaaaaeebdgaaaaaaa] to [levels v]\nadd [*sbdgaaaaaaa*hsbgaaaaaaahhhsssesbg#as*mmh*hsbgaaehmmmmlaaaaa*hmmmmlaaaaahhmmmmlaaaaah*hmmmlaaaaas*hhmhhaaaaashh*hmlaaaaah*se*hlaaaaasehh*hhaaaaasss*hhaaaaaasesheaaaaaaasssbg#aaaaaaesbdgaaaaaaa] to [levels v]\nadd [esbdgaaaaaaaeesbgaaaaaaasesewaaaaaaaeesewaaaaaaaeseswaaaaaaaeesswaaaaaaasesswaaaaaaaeesewaaaaaaasseswaaaaaaasesswaaaaaaaeeessaaaaaaaseseeaaaaaaaeseseeaaaaaasesessbg#aaassesesbgaaaaseseebddg#aa] to [levels v]\nadd [ssbdddddgaaabdddg#aaaaaadgaaaaaaaaaadg#aaaaaaaaadgaaaaaaaaaadgaaaaaaaaaadgaaaaaaaaaadgaaaaaaaaaadgaaaaaaaaaaddgjaaaaaaaabdgaaaagaaaabdg#aaaaaaaabdgaaaaaaaaabdg#aaaaaaaassbg#aagaaaasssssbdgaaaa] to [levels v]\nadd [esbddddgaaaassselapaaaaasesmlapaaaaassmmlapaaaaasesmlapaaaaaessss*g#aaaassss**dgaaaasemlaaaaaaaassmlaaaaaaaaemmlaaaaaaaassesbg#aaaaaesmlaaaaaaaasmmlaaaaaaaassbgaaaaaaaaemmlaaaaaaaaemmlaaaaaaaa] to [levels v]\nadd [esesaaaaaaaasebg#aaaaaaasssbgaaaaaaaebddgaaaaaaassbdgaaaaaaasbddg#aaaaaabddgaaaaaaaadddgaaaaaaaadddwaaaaaaaadddwaaaaaaaadddwaa*gaaaadddg***aaaaabddg*****aaabddg**g**gaasbddg***bg#asssssssbdgaa] to [levels v]\nadd [ssessbddgaaaessesbdg#aaasesssbdg#aaasesbg#aaaaaassbgaaaaaaaasbg#aaaaaaaabdgaaaaaaaaaeswaaaaaaaaasswaa**bdgaasee****sbg#ased***esbdgasswa**sebdgaedwa**ssbddgsdwaa***sbddsee******bddses*****esbd] to [levels v]\nadd [hss*****sesb*heh***essbdmmm***sssebdmmmh***hsssbmmmshh***sebmmmehh*****bmmmh*hh*hh*bmhmm**hhhh*smmmm**h****emmmm*****hhhmmmh*****h*smmmhs***sesb*mmmeh**hsbdhmsmmh**hbdgms*hhh**ebgas*hhhs*h*sbd] to [levels v]\nadd [mmmmh***hsesmmmhe****hesmmm*h***h*sbmmhh***s*sbgmmsh**sssbgamss**hsebdgamme**sssbdg#mhs***esbg#ammla**sssbga*mhaa*sesbgamhseaaesbdgahmsseaaabg#ahhsbgaaaaaaahssebgaaaaaa*hssbg#aaaaaheesbgaaaaaa] to [levels v]\nadd [bddgaaaaaaaabddg#aaaaaaasbdgaaaaaaaasebdgaaaaaaasbddg#aaaaaasbdgaaaaaaaaesbg*gaaaaaases**gaaaaaass**bdgaaaaaess**bg#aaaas*ss*g#aaaaas****gaaaaaas***bdg#aaaae****bdgaaaas**s****aaaasesessebdgaa] to [levels v]\nadd [hesssesbdgaahseessbddg#aseshesbdgaaahhehhlaaaaaahhmhmlaaaaaamhmmmlaaaaaasmmmelaaaaaahmmsssbaaaaammseslaaaaaammmmmlaaaaaamhsmmlaaaaaahmmsmlaaaaaaehmmslaaaaaahmhmhs**bgaahhehmssb#aaaeheselaaaaaa] to [levels v]\nadd [eessshaaaaaah**ehhaaaaaasesh*hhhhaaahh*hehh*hhaahhehmlaaaaaam*mmmlaaaaaa**mmmla-aaaahmmmmlaaaaaa*emmmbaaaaaameemmlaaaaaammmmmlaaaaaahmmmmlaaaaaa*hemml-aaaaahmmmml-aaaaahh*emlaaaaaaehemmlaaaaaa] to [levels v]\nadd [hhaaaaaaaaaahbaaaahbaaaasbaahshhhaaahhaeshemlaaaslaemmmmlaaase*semmmlaaaee*semmmlaaasb**semmlaaaelaasmmmlaaaelaasemmlaaaela*semmlaaass***semlaaaesb**semlaaaesb**ssmlaaaees**emmlaaaese*emmmlaaa] to [levels v]\nadd [shsaaaselaaahlaaaaemlaaaesaaasmmlaaas*aahhmmlaaae**sshmmlaaalaashmmmlaaalaaeshmshhaahaass*sheb#ae*sb****sehhs*eh**sa-asss*b**ssa-aaahab**sssbaaasasahsb#aaaaha-asbaaaaaaeeeshaaaaaaasshbaaaaaaaa] to [levels v]\nadd [sssbaaaaaaaassb-aaaaaaaasba-aaaaaaaasla-aaaaaaaasla-aaaaaaaacla-aaaaaaaactttjaaaaaaaclaaaaaaaaaaclaaaaaaaaaaclaaaaaaaaaaclaaaaaaaaaaclaaaaaaaaaaclaaaaaaaaaaclaaaaaaaaaactttaaaaaaaaclataaaaaaaa] to [levels v]\nadd [ccctaattttaaccctja-aataattttttttataasssbaaatataasssbaaapaaaasssbaaapaaaattttaaapaaaahlapaaapaaaahlapaaapaaaahlapaaapaaaatt-t-t-tttaamlaaaaaaaaaamlaaaaaaaaaamlaaaaaaaaaamlapaaaaaaaamlapaaaaaaaa] to [levels v]\nadd [ssssatttttttlaapatttttttlaaaapapaaaattttapaaaaaas**tapaaaaaas**tapaaapaatt-tapaaapaalaaaapaaaaaalaaaapaaaaaalpaaaaaaaaaalpaaaaaaapaalaaapaaaapaalaaapaaattaalaaapaaapaaalaaapaaapaaaccccccccc-cc] to [levels v]\nadd [ttttaaaaaaaalaapaaaaaaaalaapaaaaaaaalaapaaaaaaaalaapaaaaaaaalaapaaaaaaaabddtaaaaaaaasbgaaaaaaaaaesbgaaaaaaaassbgaaaaaaaasebg#aaaaaaaesbgaaaaaaaasbdgaaaaaaaasbg#aaaaaaaabdgaaaaaaaaaebgaaaaaaaaa] to [levels v]\nadd [ddgaaaaaaaaaddgaaaaaaaaabddg#aaaaaaasbddgaaaaaaaessbgaaaaaaasebddgaaaaaaeesbdg#aaaaasssb**aaaaaaese**bgaaaaases**bdgaaaaess**sbddg#ase***sebgaaaee***sbdg#aase***esbgaaasseessbddgaaessssesbdgaa] to [levels v]\nadd [sesessebdgaassesebddgaaasseaaaaaaaaabg#aaaaaaaaabgjaaaaaaaaadgaaaaaaaaaadg#aaaaaaaaabg#aaaaaaaaadgjaaaaaaaaadgaaaaaaaaaadgaaaaaaaaaadg#aaaaaaaaadgjaaaaaaaaadgaaaaaaabgadg#aaaabddg#ssssssssbgaa] to [levels v]\nadd [gaaaaaaaaaaabaaaaaaatttasaaaaaaaataaecaaaaaatttah*aaaaaaaaaag#aa-aaatttagaaa-aaaaaaagjaa-aaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaapaaaaaaaaasssbaaaaaaaasmmlaaaaaaaasssiaaaaaaatssswaaaaaaasssssssssssss] to [levels v]\n\nset [level v] to [18]\nbroadcast (load level v)\n\nwhen I start as a clone\nbroadcast (switch costume v)\nshow\n\nwhen I receive [delete clones v]\ndelete this clone\n\ndefine load level\nset [id v] to [0]\nrepeat (16)\n repeat (12)\n change [id v] by (1)\n create clone of (_myself_ v)\n change y by (30)\n end\n set y to (-165)\n change x by (30)\nend\nset [id v] to [-2]\n\nset [vertical layer offset v] to [0]\nrepeat (16)\n change [vertical layer offset v] by (1)\n broadcast (shift clones v)\nend\nset [vertical layer offset v] to [0]\n\nwhen I receive [shift clones v]\nif <[0] < (id)> then\n change [id v] by (12)\n broadcast (switch costume v)\n if <(id) < [1]> then\n delete this clone\n end\nend\n\nwhen I receive [5 sec tick v]\nif <<(costume [number v]) = [20]> and <<(Location) = [1]> or <(Location) = [3]>>> then\n hide\n wait (3) seconds\n show\nend\n\nwhen this sprite clicked\nif <<[0] < (id)> and <(Location) = [2]>> then\n if <(Selected Block) = [2]> then\n set [selected block v] to [3]\n end\n replace item (id) of [current save v] with (Selected Block)\n switch costume to (letter (id) of (Current Save))\n if <(costume [number v]) = [3]> then\n switch costume to (0 v)\n end\nend\n\nadd [gaapaaaaaaaagaaaaaaaaaaagaaiaaaataaagaaiaaaaaaaagaaiaaaaaaaagaawaaaaaaaagaattaaataaagaapaaaaaaaagaapaaaaaaaagaammlaaaaaagaaaaaaaaaaagaaaataaaaaagaaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaasssssssbdgaa] to [levels v]\nadd [xasaaaaaaaaaaaaaaaaaaaaaassssiwaaaaaaaaaaiwaaaaaaaaaaiiaaaaaaaaaamlaaaaaaaaaamlaaaaaaaaaaslaaaaaaaaaasbgaaaatttttsbgaaaaacccappaaaaaacccappaaaaaacccappaaaaaacccappaaaaaacccappaaaaaacccappaaaax] to [levels v]\n\nif <touching (mouse-pointer v)?> then\n say (costume [number v])\nelse\n say []\nend\n\nadd [ccccccccctcclaapatttttttlaaaapapaaaattttapaaaaaas**tapaaaaaas**tapaaapaatt-tapaaapaalaaaapaaaaaalaaaapaaaaaalpaaaaaaaaaalpaaaaaaapaalaaapaaaapaalaaapaaattaalaaapaaapaaalaaapaaapaaaccccccccc-cc] to [levels v]\n\nadd [gaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaag#aaaaaaaaaag#aaaaaaaaaag#aaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaagaaaaaaaaaaa] to [levels v]\n\nwhen I receive [load menu v]\ndelete this clone\n\n@BG Tiles\n\nwhen I receive [switch costume v]\n\nif <[0] < (id)> then\n if <(Location) = [2]> then\n if <[a] = (letter (id) of (Current Save))> then\n switch costume to (0 v)\n else\n switch costume to (letter (id) of (Current Save))\n end\n end\nend\n\nif <(Location) = [2]> then\n switch costume to (0 v)\nend\n\nif <(costume [number v]) = [2]> then\n set [ghost v] effect to (95)\nelse\n set [ghost v] effect to (0)\nend\n\nwhen I receive [! initalise v]\nset [id v] to [-1]\nset size to (380) %\ngo to x: (-225) y: (-165)\nhide\n\nwhen I receive [load bg v]\nif <<(id) < [1]> and <<(Location) = [1]> or <(Location) = [3]>>> then\n set size to (380) %\n hide\n load level\nend\n\ndefine load level\ngo to x: (-225) y: (-165)\nset [id v] to [0]\nrepeat (16)\n repeat (12)\n change [id v] by (1)\n if <(Location) = [3]> then\n if <[#] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (# v)\n create clone of (_myself_ v)\n else\n if <[*] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (* v)\n create clone of (_myself_ v)\n else\n if <[w] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (w v)\n create clone of (_myself_ v)\n else\n if <[-] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (- v)\n create clone of (_myself_ v)\n else\n if <[%] = (letter (id) of (join (item (Level) of [custom levels v]) (item ((Level) + (1)) of [custom levels v])))> then\n switch costume to (% v)\n create clone of (_myself_ v)\n end\n end\n end\n end\n end\n else\n if <[#] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (# v)\n create clone of (_myself_ v)\n else\n if <[*] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (* v)\n create clone of (_myself_ v)\n else\n if <[w] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (w v)\n create clone of (_myself_ v)\n else\n if <[-] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (- v)\n create clone of (_myself_ v)\n else\n if <[%] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (% v)\n create clone of (_myself_ v)\n end\n end\n end\n end\n end\n end\n change y by (30)\n end\n set y to (-165)\n change x by (30)\nend\nset [id v] to [-2]\n\nwhen I receive [delete clones v]\ndelete this clone\n\nwhen I start as a clone\nclear graphic effects\nshow\nif <(costume [number v]) = [7]> then\n set [ghost v] effect to (50)\nend\n\nwhen I receive [shift clones v]\n\nif <[0] < (id)> then\n change [id v] by (12)\n broadcast (switch costume v)\n if <(id) < [1]> then\n delete this clone\n end\nend\n\nif <(Location) = [3]> then\n if <[a] = (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))> then\n switch costume to (a v)\n else\n switch costume to (letter (id) of (join (item (Level) of [levels v]) (item ((Level) + (1)) of [levels v])))\n end\nend\n\nwhen I start as a clone\n\nbroadcast (load level v)\n\nwhen I receive [load menu v]\ndelete this clone\n\n@Help\n\nwhen I receive [! initalise v]\nswitch costume to (note1 v)\nset [ghost v] effect to (30)\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [play v]\nif <(Location) = [1]> then\n switch costume to (note1 v)\n show\nelse\n hide\nend\n\nwhen I receive [advance level v]\nif <(Location) = [1]> then\n switch costume to (Level)\n show\nelse\n hide\nend\n\nwhen I receive [switch costume v]\nif <(Location) = [1]> then\n switch costume to (Level)\n show\nelse\n hide\nend\n\nwait until <(Level) = [21]>\n\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [load menu v]\nhide\n\n@Effects\n\nwhen I receive [! initalise v]\nhide\n\nwhen I receive [death effect v]\nchange [fails v] by (1)\nset size to (100) %\nset [ghost v] effect to (100)\nset [fisheye v] effect to (-10)\ngo to (player v)\nshow\nrepeat (4)\n change [ghost v] effect by (-10)\n change size by (2)\n change [fisheye v] effect by (2)\n wait (0) seconds\nend\nwait (0.5) seconds\nrepeat (10)\n change [ghost v] effect by (8)\n wait (0) seconds\nend\nhide\n\nwhen I receive [death effect v]\nturn right (pick random (1) to (360)) degrees\nrepeat (50)\n change y by (1)\n change size by (3)\n wait (0) seconds\n change [fisheye v] effect by (4)\nend\n\nrepeat (10)\n\n@Coin\n\nwhen I receive [! initalise v]\nhide variable [coins v]\nset [coins v] to [0]\ngo to x: (0) y: (0)\nhide\nset size to (200) %\n\nwhen I receive [load bg v]\nhide variable [coins v]\nshow\nif <(Level) = [6]> then\n go to x: (-70) y: (-15)\nelse\n if <(Level) = [7]> then\n go to x: (195) y: (-15)\n else\n if <(Level) = [8]> then\n go to x: (77) y: (163)\n else\n if <(Level) = [10]> then\n go to x: (19) y: (164)\n else\n if <(Level) = [11]> then\n go to x: (76) y: (-136)\n else\n if <(Level) = [12]> then\n go to x: (167) y: (18)\n else\n if <(Level) = [17]> then\n go to x: (-100) y: (-42)\n else\n if <(Level) = [18]> then\n go to x: (-102) y: (-131)\n else\n if <(Level) = [20]> then\n go to x: (137) y: (-77)\n else\n hide\n if <(Level) = [21]> then\n show variable [coins v]\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\n\nwhen I receive [tick v]\nif <touching (player v)?> then\n hide\n change [coins v] by (1)\n go to x: (-999) y: (-999)\n show variable [coins v]\nend\n\ngo to x: (0) y: (0)\n\nwhen I receive [5 sec tick v]\nwait (0.5) seconds\nrepeat (10)\n change [brightness v] effect by (2)\nend\nrepeat (10)\n change [brightness v] effect by (-2)\nend\nwait (0.5) seconds\nrepeat (10)\n change [brightness v] effect by (1)\nend\nrepeat (10)\n change [brightness v] effect by (-1)\nend\nwait (0.5) seconds\nrepeat (10)\n change [brightness v] effect by (1)\nend\nrepeat (10)\n change [brightness v] effect by (-1)\nend\n\n@Mobile Buttons\n\nwhen I receive [! initalise v]\nset [mobile mode v] to [0]\nhide\nswitch costume to (dot2 v)\ngo to x: ((240) - (80)) y: ((-180) + (80))\ncreate clone of (_myself_ v)\nswitch costume to (dot v)\ncreate clone of (_myself_ v)\nswitch costume to (toggle1 v)\ngo to x: (-150) y: (-165)\nshow\n\nwhen I receive [! initalise v]\ndelete this clone\n\nwhen I start as a clone\nset [ghost v] effect to (20)\nhide\n\nwhen I receive [load level v]\nif <<<<(costume [number v]) = [1]> or <(costume [number v]) = [2]>> and <(Location) = [0]>> or <<<(costume [number v]) = [3]> or <(costume [number v]) = [4]>> and <<(Mobile Mode) = [1]> and <<(Location) = [1]> or <(Location) = [3]>>>>> then\n show\nelse\n hide\nend\n\nwhen this sprite clicked\nif <(costume [number v]) = [2]> then\n switch costume to (toggle1 v)\n set [mobile mode v] to [0]\nelse\n if <(costume [number v]) = [1]> then\n switch costume to (toggle2 v)\n set [mobile mode v] to [1]\n end\nend\n\nif <(costume [number v]) = [3]> then\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [keys v] to (join (letter (1) of (keys)) (join [1] (letter (3) of (keys))))\n else\n set [keys v] to (join (letter (1) of (keys)) (join [0] (letter (3) of (keys))))\n end\nelse\n if <(costume [number v]) = [4]> then\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [keys v] to (join [1] (join (letter (2) of (keys)) (letter (3) of (keys))))\n else\n set [keys v] to (join [0] (join (letter (2) of (keys)) (letter (3) of (keys))))\n end\n else\n if <(costume [number v]) = [5]> then\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [keys v] to (join (join (letter (1) of (keys)) (letter (2) of (keys))) [1])\n else\n set [keys v] to (join (join (letter (1) of (keys)) (letter (2) of (keys))) [0])\n end\n end\n end\nend\n\nwhen this sprite clicked\nif <(costume [number v]) = [3]> then\n go to x: (160) y: (-100)\n repeat until <not <mouse down?>>\n go to x: (160) y: (-100)\n set [touch distance v] to (distance to [mouse-pointer v])\n if <(Touch Distance) < [60]> then\n point towards (mouse-pointer v)\n go to (mouse-pointer v)\n else\n point towards (mouse-pointer v)\n move (60) steps\n end\n if <(y position) < [-101]> then\n set y to (-100)\n end\n movement\n end\n go to x: (160) y: (-100)\n set [keys v] to [000]\nend\n\ndefine movement\nset [keys v] to [000]\nif <(Touch Distance) > [10]> then\n if <<(direction) > [-100]> and <(direction) < [-20]>> then\n set [keys v] to (join [1] (join (letter (2) of (keys)) (letter (3) of (keys))))\n end\n if <<[100] > (direction)> and <[20] < (direction)>> then\n set [keys v] to (join (letter (1) of (keys)) (join (letter (2) of (keys)) [1]))\n end\n if <<[40] > (direction)> and <[-40] < (direction)>> then\n set [keys v] to (join (letter (1) of (keys)) (join [1] (letter (3) of (keys))))\n end\nend\n\n
Christmas | Scrolling Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [start platformer v]\nswitch backdrop to (backdrop2 v)\n\n@STS\n\nwhen flag clicked\nset [level v] to [1]\nset [select v] to [False]\nset [project? v] to [False]\nset [player # v] to [1]\nset [music # v] to [1]\nset [music? v] to [False]\nset [parallax? v] to [False]\nset [play? v] to [False]\nset [score? v] to [False]\nset [ending scene v] to [False]\nset volume to (100) %\nSTS\n\nwhen I receive [load music v]\nstop all sounds\nforever\n if <not <(volume) = [0]>> then\n if <(Music #) = [1]> then\n play sound [Aurora Zone v] until done\n else\n if <(Music #) = [2]> then\n play sound [All I Want For Christmas Is You v] until done\n else\n if <(Music #) = [3]> then\n play sound [Vexento - Winter v] until done\n else\n play sound [Frozen - Do You Want to Build a Snowman \[Orchestra\] v] until done\n end\n end\n end\n end\nend\n\nwhen I receive [revolume v]\nrepeat (10)\n change volume by (10)\nend\n\nwhen I receive [zero volume v]\nrepeat (10)\n change volume by (-10)\nend\n\ndefine STS\nhide\nif <<(current [month v]) = [1]> and <(current [date v]) < [4]>> then\n switch costume to (happy new year v)\nelse\n switch costume to (i challenge challenges as they are there. v)\nend\nclear graphic effects\nset size to (75) %\npoint in direction (90)\ngo to x: (0) y: (0)\nshow\nstart sound [Aurora v]\nwait (1.2) seconds\nrepeat (30)\n change size by (Size)\n change [size v] by (0.2)\nend\nset [size v] to [5]\nrepeat (50)\n change size by (Size)\n change [size v] by (-0.2)\nend\nhide\nswitch costume to (sts christmas v)\npoint in direction (90)\ngo to x: (0) y: (0)\nset [velocity v] to [0]\nset size to (10) %\nshow\nset [size v] to [5]\nstart sound [Dweep v]\nrepeat (50)\n change size by (Size)\n change [size v] by (-0.2)\nend\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n change [brightness v] effect by (10)\nend\nset [project? v] to [True]\nbroadcast (christmas v) and wait\n\n@Player\n\nwhen flag clicked\nset [ghost v] effect to (100)\nhide\n\nwhen I receive [christmas v]\nset size to (75) %\nset [christmas | scrolling plaftormer v] to [0]\npoint in direction (90)\nshow\nswitch costume to (Player #)\ngo to x: (165) y: (-150)\nset [christmas | scrolling plaftormer v] to [0]\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nforever\n change [christmas | scrolling plaftormer v] by (5)\n change size by (([sin v] of (Christmas | Scrolling Plaftormer) ) / (3))\n change y by (([sin v] of (Christmas | Scrolling Plaftormer) ) / (3))\n turn right (([sin v] of ((100) - (Christmas | Scrolling Plaftormer)) ) / (6)) degrees\n if <(Instructions?) = [True]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n set size to (100) %\n point in direction (90)\n go to x: (165) y: (-150)\n wait until <(Instructions?) = [False]>\n set [ghost v] effect to (0)\n end\n if <(Play?) = [True]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n stop [this script v]\n end\nend\n\nwhen I receive [next costume v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nswitch costume to (Player #)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\n\nwhen I receive [start platformer v]\nshow\nset [ghost v] effect to (0)\nset [x v] to [0]\nset [y v] to [0]\nset [xv v] to [0]\nset [yv v] to [0]\nset [length v] to [0]\nset [height v] to [0]\nset [death v] to [False]\nset [drop? v] to [False]\nforever\n Movement\nend\n\ndefine None\nchange [x v] by (xv)\nMove\n\ndefine None\nchange [y v] by (yv)\nif <(y position) < [-180]> then\n set [yv v] to [0]\nend\nMove\n\ndefine Move\ngo to x: ((X) - (Length)) y: ((Y) - (Height))\nif <(X) > [2250]> then\n set [x v] to [2250]\nend\nif <[-210] > (X)> then\n set [x v] to [-210]\nend\n\ndefine Reset\ndelete (all) of [height list v]\ndelete (all) of [length list v]\ndelete (all) of [x list v]\nadd [-70] to [height list v]\nadd [880] to [length list v]\nadd [1100] to [x list v]\n\ndefine None\nset [slope v] to (no.)\nrepeat until <<not <touching (platforms 1 v)?>> or <(Slope) < [1]>>\n change [slope v] by (-1)\n Change Y by (1)\nend\nif <(Slope) < [1]> then\n Change X by ((XV) * (-1))\n Change Y by ((0) - (no.))\n if <key (up arrow v) pressed?> then\n if <(XV) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [15]\n else\n set [xv v] to [0]\n end\nend\n\ndefine Movement\nset rotation style [left-right v]\nset [exv v] to (XV)\nset [eyv v] to (YV)\nif <key (right arrow v) pressed?> then\n point in direction (90)\n change [xv v] by (1)\nend\nif <key (left arrow v) pressed?> then\n point in direction (-90)\n change [xv v] by (-1)\nend\nset [xv v] to ((XV) * (0.9))\nChange X by (XV)\nSlope (10)\nchange [yv v] by (-1)\nChange Y by (YV)\nif <touching (platforms 1 v)?> then\n set [drop? v] to [False]\n Change Y by ((YV) * (-1))\n set [yv v] to [0]\nend\nChange Y by (-1)\nif <touching (platforms 1 v)?> then\n if <key (up arrow v) pressed?> then\n start sound [Jump v]\n set [yv v] to [15]\n end\nend\nif <touching (bounce v)?> then\n set [yv v] to [30]\nend\nChange Y by (1)\nchange [length v] by (((X) - (Length)) / (5))\nchange [height v] by (((Y) - (Height)) / (5))\nif <(Drop?) = [False]> then\n if <not <touching (platforms 1 v)?>> then\n if <key (down arrow v) pressed?> then\n wait until <not <key (down arrow v) pressed?>>\n start sound [Drop v]\n set [yv v] to [-15]\n set [drop? v] to [True]\n end\n end\nend\nif <key (r v) pressed?> then\n wait until <not <key (r v) pressed?>>\n broadcast (Death v)\n repeat until <<([abs v] of (X) ) < [1]> and <([abs v] of (Y) ) < [1]>>\n set [x v] to ((X) * (0.8))\n set [y v] to ((Y) * (0.8))\n end\n set [xv v] to [0]\n set [yv v] to [0]\n set [touch # v] to [0]\n start sound [Death v]\n broadcast (Game On v)\nend\nif <touching (enemy 1 v)?> then\n if <(Drop?) = [True]> then\n broadcast (Enemy 1 Die v)\n else\n broadcast (Death v)\n repeat until <<([abs v] of (X) ) < [1]> and <([abs v] of (Y) ) < [1]>>\n set [x v] to ((X) * (0.8))\n set [y v] to ((Y) * (0.8))\n end\n set [xv v] to [0]\n set [yv v] to [0]\n set [touch # v] to [0]\n start sound [Death v]\n broadcast (Game On v)\n end\nelse\nend\nif <touching (enemy 2 v)?> then\n if <(Drop?) = [True]> then\n broadcast (Enemy 2 Die v)\n else\n broadcast (Death v)\n repeat until <<([abs v] of (X) ) < [1]> and <([abs v] of (Y) ) < [1]>>\n set [x v] to ((X) * (0.8))\n set [y v] to ((Y) * (0.8))\n end\n set [xv v] to [0]\n set [yv v] to [0]\n set [touch # v] to [0]\n start sound [Death v]\n broadcast (Game On v)\n end\nelse\nend\nif <<<<<[-75] > (Height)> and <(y position) < [-180]>> or <touching (obstacle v)?>> or <touching (snowrock v)?>> or <touching (explosion v)?>> then\n broadcast (Death v)\n repeat until <<([abs v] of (X) ) < [1]> and <([abs v] of (Y) ) < [1]>>\n set [x v] to ((X) * (0.8))\n set [y v] to ((Y) * (0.8))\n end\n set [xv v] to [0]\n set [yv v] to [0]\n set [touch # v] to [0]\n start sound [Death v]\n broadcast (Game On v)\nend\nif <<<(World) = [1]> or <(World) = [2]>> or <(World) = [3]>> then\n if <(Touch #) > [5]> then\n set [touch # v] to [0]\n change [level v] by (1)\n if <(World) = [1]> then\n if <(Level) > [5]> then\n set [select v] to [True]\n end\n else\n if <(World) = [2]> then\n if <(Level) > [10]> then\n set [x v] to [1030]\n set [y v] to [540]\n set [ending scene v] to [True]\n broadcast (Ending Scene v)\n end\n else\n if <(World) = [3]> then\n if <(Level) > [11]> then\n set [select v] to [True]\n end\n else\n end\n broadcast (Select v)\n end\n broadcast (Select v)\n end\n broadcast (Select v)\n end\nelse\nend\nif <(Length) > [2030]> then\n set [length v] to [2030]\nend\nif <[0] > (Length)> then\n set [length v] to [0]\nend\nif <[-75] > (Height)> then\n set [height v] to [-75]\nend\nif <<key (s v) pressed?> and <key (k v) pressed?>> then\n wait until <not <<key (s v) pressed?> and <key (k v) pressed?>>>\n set [touch # v] to [6]\nend\nbroadcast (Plaforms v)\n\n@Background Effect\n\nwhen I start as a clone\nshow\ngo [backward v] (100) layers\nswitch costume to (costume1 v)\nset size to (100) %\nswitch costume to (lines v)\nset [ghost v] effect to (75)\nforever\n go to x: (0) y: (0)\n repeat (160)\n change x by (0.5)\n end\nend\n\nwhen flag clicked\nhide\nset volume to (30) %\nclear graphic effects\nset size to (100) %\nset [christmas | scrolling plaformer v] to [0]\npoint in direction (90)\ncreate clone of (_myself_ v)\nwait until <(Project?) = [True]>\nshow\nswitch costume to (christmas | scrolling platformer v)\ngo to x: (0) y: (0)\nset [christmas | scrolling plaformer v] to [0]\nforever\n change [christmas | scrolling plaformer v] by (5)\n change size by (([sin v] of (Christmas | Scrolling Plaformer) ) / (3))\n change y by (([sin v] of (Christmas | Scrolling Plaformer) ) / (3))\n turn right (([sin v] of ((100) - (Christmas | Scrolling Plaformer)) ) / (6)) degrees\n if <<(Instructions?) = [True]> or <(Play?) = [True]>> then\n repeat (7)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n set size to (100) %\n point in direction (90)\n go to x: (0) y: (0)\n else\n set [ghost v] effect to (0)\n end\nend\n\nwhen flag clicked\nwait until <(Project?) = [True]>\nforever\n if <(Play?) = [False]> then\n if <touching (mouse-pointer v)?> then\n start sound [boing v]\n set size to (30) %\n repeat until <(size) > [100]>\n change size by (10)\n end\n wait until <not <touching (mouse-pointer v)?>>\n end\n end\nend\n\n@Effect\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\nforever\n if <not <(Ending Scene) = [True]>> then\n turn right (70) degrees\n go to x: (pick random (-240) to (240)) y: (pick random (-180) to (180))\n create clone of (_myself_ v)\n end\nend\n\nwhen I start as a clone\ngo to [front v] layer\nshow\nset size to (pick random (15) to (30)) %\nrepeat (pick random (10) to (15))\n change [ghost v] effect by (-10)\n move (2) steps\n if <(Ending Scene) = [True]> then\n delete this clone\n end\nend\nrepeat (pick random (10) to (15))\n change [ghost v] effect by (10)\n move (2) steps\n if <(Ending Scene) = [True]> then\n delete this clone\n end\nend\nhide\ndelete this clone\n\n@Play Button\n\nwhen I receive [christmas v]\nset size to (100) %\nset [christmas | scrolling plaformer v] to [0]\nset [play? v] to [False]\nset [instructions? v] to [False]\nswitch costume to (costume1 v)\ngo to x: (-120) y: (-90)\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nforever\n change [christmas | scrolling plaformer v] by (5)\n change y by (([sin v] of (Christmas | Scrolling Plaformer) ) / (3))\n if <touching (mouse-pointer v)?> then\n change size by ([sin v] of (Christmas | Scrolling Plaformer) )\n if <mouse down?> then\n wait until <not <mouse down?>>\n set [play? v] to [True]\n broadcast (Start v)\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\n else\n set size to (100) %\n end\n if <(Instructions?) = [True]> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\n@Instructions Button\n\nwhen I receive [christmas v]\nhide\nset [ghost v] effect to (100)\nset size to (100) %\nswitch costume to (costume2 v)\ngo to x: (120) y: (-90)\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nset [christmas | scrolling plaformer v] to [0]\nforever\n change [christmas | scrolling plaformer v] by (5)\n change y by (([sin v] of (Christmas | Scrolling Plaformer) ) / (3))\n if <touching (mouse-pointer v)?> then\n change size by ([sin v] of (Christmas | Scrolling Plaformer) )\n if <mouse down?> then\n wait until <not <mouse down?>>\n set [instructions? v] to [True]\n broadcast (Instructions v)\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\n else\n set size to (100) %\n end\n if <(Play?) = [True]> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\n@Music Button\n\nwhen I receive [christmas v]\nhide\nset [ghost v] effect to (100)\nset size to (100) %\nswitch costume to (costume3 v)\ngo to x: (210) y: (150)\nset [music? v] to [True]\nset size to (75) %\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nforever\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (25)\n if <mouse down?> then\n wait until <not <mouse down?>>\n if <(costume [number v]) = [1]> then\n switch costume to (costume4 v)\n broadcast (Zero Volume v)\n else\n switch costume to (costume3 v)\n broadcast (Revolume v)\n end\n end\n else\n set [brightness v] effect to (0)\n end\n if <(Story?) = [True]> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n hide\n wait until <(Story?) = [False]>\n show\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\n end\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\nwhen I receive [ending scene v]\nswitch costume to (costume4 v)\nbroadcast (Zero Volume v)\nwait until <not <(Ending Scene) = [True]>>\nswitch costume to (costume3 v)\nbroadcast (Revolume v)\n\n@Music Title Button\n\nwhen I receive [christmas v]\nhide\nset [ghost v] effect to (100)\nset size to (100) %\nswitch costume to (costume5 v)\ngo to x: (-210) y: (150)\nbroadcast (Load Music v)\nset size to (75) %\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nforever\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (25)\n if <mouse down?> then\n wait until <not <mouse down?>>\n change [music # v] by (1)\n if <(Music #) > [4]> then\n set [music # v] to [1]\n end\n broadcast (Load Music v)\n end\n else\n set [brightness v] effect to (0)\n end\n if <(Story?) = [True]> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n hide\n wait until <(Story?) = [False]>\n show\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\n end\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\n@Player Right Button\n\nwhen I receive [christmas v]\nhide\nset [ghost v] effect to (100)\nset size to (100) %\nswitch costume to (costume6 v)\ngo to x: (210) y: (-150)\nset size to (75) %\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nforever\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (25)\n if <mouse down?> then\n wait until <not <mouse down?>>\n change [player # v] by (1)\n if <(Player #) > [3]> then\n set [player # v] to [1]\n end\n broadcast (Next Costume v) and wait\n end\n else\n set [brightness v] effect to (0)\n end\n if <<(Instructions?) = [True]> or <(Play?) = [True]>> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\n@Player Left Button\n\nwhen I receive [christmas v]\nhide\nset [ghost v] effect to (100)\nset size to (100) %\nswitch costume to (costume6 v)\ngo to x: (120) y: (-150)\nset size to (75) %\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nforever\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (25)\n if <mouse down?> then\n wait until <not <mouse down?>>\n change [player # v] by (-1)\n if <(Player #) < [1]> then\n set [player # v] to [3]\n end\n broadcast (Next Costume v) and wait\n end\n else\n set [brightness v] effect to (0)\n end\n if <<(Instructions?) = [True]> or <(Play?) = [True]>> then\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\n\n@Music Title\n\nwhen flag clicked\nset [ghost v] effect to (100)\nhide\n\nwhen I receive [load music v]\ngo to x: (0) y: (70)\nswitch costume to (Music #)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\n change y by (-1)\nend\nrepeat (3)\n wait (1) seconds\n if <<not <(costume [number v]) = (Music #)>> or <(Play?) = [True]>> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n stop [this script v]\n end\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\nstop [this script v]\n\n@Instructions\n\nwhen I receive [instructions v]\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (-10)\nend\nset [instructions v] to [0]\nforever\n change [instructions v] by (5)\n change y by ([sin v] of (Instructions) )\n if <mouse down?> then\n wait until <not <mouse down?>>\n repeat (10)\n wait (0.01) seconds\n change [ghost v] effect by (10)\n end\n hide\n set [instructions? v] to [False]\n broadcast (Christmas v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\nset [ghost v] effect to (100)\nhide\n\n@Story\n\nwhen flag clicked\nset [story? v] to [False]\nset [ghost v] effect to (100)\nhide\n\nwhen I receive [start v]\nset [story? v] to [True]\nswitch costume to (costume1 v)\nshow\nrepeat (4)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait until <<key (any v) pressed?> or <mouse down?>>\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\nend\nset [story? v] to [False]\nset [select v] to [True]\nset [parallax? v] to [True]\n\n@Platforms 1\n\nwhen flag clicked\nhide\n\nwhen I receive [start platformer v]\nset [touch # v] to [0]\nif <(World) = [1]> then\n if <(Level) = [1]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 1 v)\n show\n else\n if <(Level) = [2]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 2 v)\n show\n else\n if <(Level) = [3]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 3 v)\n show\n else\n if <(Level) = [4]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 4 v)\n show\n else\n if <(Level) = [5]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 5 v)\n show\n else\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 6 v)\n show\n else\n if <(Level) = [7]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 7 v)\n show\n else\n if <(Level) = [8]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 8 v)\n show\n else\n if <(Level) = [9]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 9 v)\n show\n else\n if <(Level) = [10]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 10 v)\n show\n else\n end\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (level 11 v)\n show\n else\n end\n else\n end\n end\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\ndefine Platforms\nif <not <(Ending Scene) = [True]>> then\n go to x: ((1000) - (Length)) y: ((0) - (Height))\nend\n\n@Parallax\n\nwhen flag clicked\nset [parallax clone v] to [0]\nhide\nset [ghost v] effect to (100)\n\ndefine Parallax\ngo to x: (0) y: (-90)\nset size to (300) %\nswitch costume to ( v)\nswitch costume to (costume1 v)\nset [parallax clone v] to [0]\ncreate clone of (_myself_ v)\nswitch costume to ( v)\nswitch costume to (costume2 v)\ncreate clone of (_myself_ v)\nswitch costume to ( v)\nswitch costume to (costume3 v)\ncreate clone of (_myself_ v)\n\nwhen I receive [christmas v]\nset [length v] to [0]\nset [height v] to [0]\nchange [parallax clone v] by (1)\nParallax\n\nwhen I start as a clone\nif <not <(costume [number v]) = [1]>> then\n if <(costume [number v]) = [2]> then\n repeat (5)\n change [ghost v] effect by (-10)\n end\n forever\n if <(Parallax Clone) > [0]> then\n delete this clone\n end\n if <(Parallax?) = [True]> then\n if <not <(Ending Scene) = [True]>> then\n show\n go to x: ((30) - ((Length) / (20))) y: ((0) - ((Height) / (40)))\n end\n else\n hide\n end\n end\n else\n if <(costume [number v]) = [3]> then\n repeat (6)\n change [ghost v] effect by (-10)\n end\n forever\n if <(Parallax Clone) > [0]> then\n delete this clone\n end\n if <(Parallax?) = [True]> then\n if <not <(Ending Scene) = [True]>> then\n show\n go to x: ((30) - ((Length) / (15))) y: ((0) - ((Height) / (30)))\n end\n else\n hide\n end\n end\n else\n repeat (7)\n change [ghost v] effect by (-10)\n end\n forever\n if <(Parallax Clone) > [0]> then\n delete this clone\n end\n if <(Parallax?) = [True]> then\n if <not <(Ending Scene) = [True]>> then\n show\n go to x: ((30) - ((Length) / (10))) y: ((0) - ((Height) / (20)))\n end\n else\n hide\n end\n end\n end\n end\nend\n\nwhen I receive [instructions v]\nset [parallax clone v] to [1]\nhide\nset [ghost v] effect to (100)\n\n@Save\n\n@Load\n\n@Achievements\n\n@Levels\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\nswitch costume to (level 1 v)\ncreate clone of (_myself_ v)\nswitch costume to (level 2 v)\ncreate clone of (_myself_ v)\nswitch costume to (level 3 v)\ncreate clone of (_myself_ v)\nswitch costume to (costume1 v)\nforever\n hide\n go to x: (-20) y: (120)\n wait until <(Select) = [True]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n show\n wait until <(Select) = [False]>\n repeat (10)\n change [ghost v] effect by (10)\n end\nend\n\nwhen I start as a clone\nif <(costume [number v]) = [2]> then\n set [ghost v] effect to (100)\n forever\n hide\n go to x: (-10) y: (50)\n set [christmas | scrolling platformer v] to [0]\n wait until <(Select) = [True]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n show\n repeat until <(Select) = [False]>\n change [christmas | scrolling platformer v] by (5)\n change y by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (mouse-pointer v)?> then\n set size to (120) %\n set [brightness v] effect to (30)\n if <mouse down?> then\n wait until <not <mouse down?>>\n set [world v] to [1]\n set [select v] to [False]\n set [level v] to [1]\n set [score? v] to [True]\n broadcast (Select v)\n end\n else\n set size to (100) %\n set [brightness v] effect to (0)\n end\n end\n repeat (10)\n change [ghost v] effect by (10)\n end\n end\nend\n\nwhen I start as a clone\nif <(costume [number v]) = [3]> then\n set [ghost v] effect to (100)\n forever\n hide\n go to x: (-10) y: (-20)\n set [christmas | scrolling platformer v] to [0]\n wait until <(Select) = [True]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n show\n repeat until <(Select) = [False]>\n change [christmas | scrolling platformer v] by (5)\n change y by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (mouse-pointer v)?> then\n set size to (120) %\n set [brightness v] effect to (30)\n if <mouse down?> then\n wait until <not <mouse down?>>\n set [world v] to [2]\n set [select v] to [False]\n set [level v] to [6]\n set [score? v] to [True]\n broadcast (Select v)\n end\n else\n set size to (100) %\n set [brightness v] effect to (0)\n end\n end\n repeat (10)\n change [ghost v] effect by (10)\n end\n end\nend\n\nwhen I start as a clone\nif <(costume [number v]) = [4]> then\n set [ghost v] effect to (100)\n forever\n hide\n go to x: (-10) y: (-90)\n set [christmas | scrolling platformer v] to [0]\n wait until <(Select) = [True]>\n repeat (10)\n change [ghost v] effect by (-10)\n end\n show\n repeat until <(Select) = [False]>\n change [christmas | scrolling platformer v] by (5)\n change y by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (mouse-pointer v)?> then\n set size to (120) %\n set [brightness v] effect to (30)\n if <mouse down?> then\n wait until <not <mouse down?>>\n set [world v] to [3]\n set [select v] to [False]\n set [level v] to [11]\n set [score? v] to [True]\n broadcast (Select v)\n end\n else\n set size to (100) %\n set [brightness v] effect to (0)\n end\n end\n repeat (10)\n change [ghost v] effect by (10)\n end\n end\nend\n\nwhen I receive [select v]\nbroadcast (Start Platformer v)\nbroadcast (Game On v) and wait\n\n@Christmas | Scrolling Platformer\n\nwhen flag clicked\nset [ghost v] effect to (100)\n\n@Enemy 1\n\nwhen flag clicked\nhide\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n else\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - enemy 1 v])\n set [y v] to (item (2) of [world 1 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - enemy 1 v])\n set [y v] to (item (4) of [world 1 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - enemy 1 v])\n set [y v] to (item (6) of [world 1 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n set [touch? v] to [True]\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - enemy 1 v])\n set [y v] to (item (2) of [world 2 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - enemy 1 v])\n set [y v] to (item (4) of [world 2 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - enemy 1 v])\n set [y v] to (item (6) of [world 2 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n set [touch? v] to [True]\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 3 - enemy 1 v])\n set [y v] to (item (2) of [world 3 - enemy 1 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n set [touch? v] to [True]\n end\n else\n set [touch? v] to [True]\n end\n end\nend\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Platforms\nset rotation style [left-right v]\nif <(Touch?) = [False]> then\n next costume\n if <(Change) = [-1]> then\n point in direction (-90)\n change [x v] by (-1)\n change [clone v] by (-1)\n if <(Clone) < [-40]> then\n set [change v] to [1]\n end\n else\n point in direction (90)\n change [x v] by (1)\n change [clone v] by (1)\n if <(Clone) > [40]> then\n set [change v] to [-1]\n end\n end\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\n if <(Touch?) = [True]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n set [touch? v] to [True]\n stop [this script v]\n end\nelse\n hide\n stop [this script v]\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [enemy 1 die v]\nstart sound [boing v]\nset [touch? v] to [True]\n\n@Enemy 2\n\nwhen flag clicked\nhide\n\ndefine Setting\nif <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - enemy 2 v])\n set [y v] to (item (2) of [world 2 - enemy 2 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - enemy 2 v])\n set [y v] to (item (4) of [world 2 - enemy 2 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\nend\nif <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 3 - enemy 2 v])\n set [y v] to (item (2) of [world 3 - enemy 2 v])\n set [change v] to [-1]\n set [clone v] to [0]\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\nend\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Platforms\nset rotation style [left-right v]\nif <(Touch?) = [False]> then\n next costume\n if <(Change) = [-1]> then\n point in direction (-90)\n change [x v] by (-1)\n change [clone v] by (-1)\n if <(Clone) < [-40]> then\n set [change v] to [1]\n end\n else\n point in direction (90)\n change [x v] by (1)\n change [clone v] by (1)\n if <(Clone) > [40]> then\n set [change v] to [-1]\n end\n end\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\n if <(Touch?) = [True]> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n set [touch? v] to [True]\n stop [this script v]\n end\nelse\n hide\n stop [this script v]\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [enemy 2 die v]\nstart sound [boing v]\nset [touch? v] to [True]\n\n@Transition from griffpatch\n\nwhen I receive [game on v]\ngo to x: (0) y: (0)\ngo to [front v] layer\nswitch costume to (mini v)\nset size to (1116) %\nswitch costume to (mask #5 v)\nshow\nrepeat (4)\n switch costume to (mini v)\n set size to ((size) / (1.2)) %\n switch costume to (mask #5 v)\nend\nrepeat (3)\n switch costume to (mini v)\n set size to ((size) / (1.2)) %\n switch costume to (mask #4 v)\nend\nrepeat (2)\n switch costume to (mini v)\n set size to ((size) / (1.2)) %\n switch costume to (mask #3 v)\nend\nrepeat (2)\n switch costume to (mini v)\n set size to ((size) / (1.2)) %\n switch costume to (mask #2 v)\nend\nswitch costume to (mini v)\nset size to (250) %\nrepeat (5)\n switch costume to (mini v)\n set size to ((size) / (1.2)) %\n switch costume to (mask #1 v)\nend\nswitch costume to (black v)\nset size to (100) %\nwait (0.5) seconds\ngo to x: (0) y: (0)\ngo to [front v] layer\nswitch costume to (black v)\nset size to (100) %\nshow\nrepeat (5)\n switch costume to (mini v)\n set size to ((size) * (1.2)) %\n switch costume to (mask #1 v)\nend\nset size to ((size) * (0.5)) %\nrepeat (2)\n switch costume to (mini v)\n set size to ((size) * (1.2)) %\n switch costume to (mask #2 v)\nend\nrepeat (2)\n switch costume to (mini v)\n set size to ((size) * (1.2)) %\n switch costume to (mask #3 v)\nend\nrepeat (3)\n switch costume to (mini v)\n set size to ((size) * (1.2)) %\n switch costume to (mask #4 v)\nend\nrepeat (5)\n switch costume to (mini v)\n set size to ((size) * (1.2)) %\n switch costume to (mask #5 v)\nend\nhide\n\nwhen flag clicked\nhide\n\n@Background Platformer\n\nwhen flag clicked\nhide\n\nwhen I receive [start platformer v]\nif <(World) = [1]> then\n if <(Level) = [1]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume1 v)\n show\n else\n if <(Level) = [2]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume2 v)\n show\n else\n if <(Level) = [3]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume3 v)\n show\n else\n if <(Level) = [4]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume4 v)\n show\n else\n if <(Level) = [5]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume5 v)\n show\n else\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume6 v)\n show\n else\n if <(Level) = [7]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume7 v)\n show\n else\n if <(Level) = [8]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume8 v)\n show\n else\n if <(Level) = [9]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume9 v)\n show\n else\n if <(Level) = [10]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume10 v)\n show\n else\n end\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume11 v)\n show\n else\n end\n else\n end\n end\nend\n\ndefine Platforms\nif <not <(Ending Scene) = [True]>> then\n go to x: ((1000) - (Length)) y: ((0) - (Height))\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\n@Aurora Element 1\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - level 1 v])\n set [y v] to (item (2) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - level 2 v])\n set [y v] to (item (2) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - level 3 v])\n set [y v] to (item (2) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - level 4 v])\n set [y v] to (item (2) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - level 5 v])\n set [y v] to (item (2) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n else\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - level 7 v])\n set [y v] to (item (2) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - level 8 v])\n set [y v] to (item (2) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - level 9 v])\n set [y v] to (item (2) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - level 10 v])\n set [y v] to (item (2) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 3 - level 11 v])\n set [y v] to (item (2) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - level 6 v])\n set [y v] to (item (2) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n end\nend\n\nwhen flag clicked\nhide\n\n@Aurora Element 2\n\nwhen flag clicked\nhide\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [plaforms v]\nPlatforms\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - level 1 v])\n set [y v] to (item (4) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - level 3 v])\n set [y v] to (item (4) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - level 4 v])\n set [y v] to (item (4) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - level 7 v])\n set [y v] to (item (4) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - level 8 v])\n set [y v] to (item (4) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - level 9 v])\n set [y v] to (item (4) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - level 10 v])\n set [y v] to (item (4) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 3 - level 11 v])\n set [y v] to (item (4) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\nend\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [1]> then\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - level 2 v])\n set [y v] to (item (4) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 1 - level 5 v])\n set [y v] to (item (4) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (3) of [world 2 - level 6 v])\n set [y v] to (item (4) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n end\n else\n end\nend\n\n@Aurora Element 3\n\nwhen flag clicked\nhide\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [plaforms v]\nPlatforms\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [1]> then\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - level 2 v])\n set [y v] to (item (6) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - level 5 v])\n set [y v] to (item (6) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - level 9 v])\n set [y v] to (item (6) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n end\n else\n end\nend\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - level 1 v])\n set [y v] to (item (6) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [2]> then\n set [touch? v] to [True]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - level 3 v])\n set [y v] to (item (6) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 1 - level 4 v])\n set [y v] to (item (6) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n else\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - level 7 v])\n set [y v] to (item (6) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - level 8 v])\n set [y v] to (item (6) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - level 10 v])\n set [y v] to (item (6) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 3 - level 11 v])\n set [y v] to (item (6) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\nend\n\nwhen I receive [enemy 2 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (5) of [world 2 - level 6 v])\n set [y v] to (item (6) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n end\nend\n\n@Aurora Element 4\n\nwhen flag clicked\nhide\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [plaforms v]\nPlatforms\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 1 - level 1 v])\n set [y v] to (item (8) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 1 - level 2 v])\n set [y v] to (item (8) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 1 - level 3 v])\n set [y v] to (item (8) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 1 - level 4 v])\n set [y v] to (item (8) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 1 - level 5 v])\n set [y v] to (item (8) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n else\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 2 - level 7 v])\n set [y v] to (item (8) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 2 - level 8 v])\n set [y v] to (item (8) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 2 - level 10 v])\n set [y v] to (item (8) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 3 - level 11 v])\n set [y v] to (item (8) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\nend\n\nwhen I receive [enemy 2 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 2 - level 6 v])\n set [y v] to (item (8) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n end\nend\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (7) of [world 2 - level 9 v])\n set [y v] to (item (8) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n end\nend\n\n@Aurora Element 5\n\nwhen flag clicked\nhide\n\nwhen I receive [plaforms v]\nPlatforms\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 1 - level 1 v])\n set [y v] to (item (10) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 1 - level 2 v])\n set [y v] to (item (10) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 1 - level 3 v])\n set [y v] to (item (10) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 1 - level 5 v])\n set [y v] to (item (10) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 2 - level 6 v])\n set [y v] to (item (10) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 2 - level 7 v])\n set [y v] to (item (10) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 2 - level 8 v])\n set [y v] to (item (10) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\nend\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [1]> then\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 1 - level 4 v])\n set [y v] to (item (10) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n end\nend\nif <(World) = [2]> then\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 2 - level 10 v])\n set [y v] to (item (10) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n end\nend\nif <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 3 - level 11 v])\n set [y v] to (item (10) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n end\nend\n\nwhen I receive [enemy 2 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (9) of [world 2 - level 9 v])\n set [y v] to (item (10) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n end\nend\n\n@Aurora Element 6\n\nwhen flag clicked\nhide\n\nwhen I receive [plaforms v]\nPlatforms\n\ndefine Platforms\nif <(Touch?) = [False]> then\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n change [christmas | scrolling platformer v] by (5)\n change [y v] by (([sin v] of (Christmas | Scrolling Platformer) ) / (3))\n if <touching (player v)?> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n start sound [Level Completed v]\n hide\n set [touch? v] to [True]\n broadcast (Touch # v)\n stop [this script v]\n end\n else\n repeat (10)\n change [ghost v] effect by (10)\n end\n hide\n end\n else\n hide\n end\nelse\n hide\nend\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [touch # v]\nchange [touch # v] by (1)\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [1]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 1 - level 1 v])\n set [y v] to (item (12) of [world 1 - level 1 v])\n set [touch? v] to [False]\n else\n if <(Level) = [2]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 1 - level 2 v])\n set [y v] to (item (12) of [world 1 - level 2 v])\n set [touch? v] to [False]\n else\n if <(Level) = [3]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 1 - level 3 v])\n set [y v] to (item (12) of [world 1 - level 3 v])\n set [touch? v] to [False]\n else\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 1 - level 5 v])\n set [y v] to (item (12) of [world 1 - level 5 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 2 - level 6 v])\n set [y v] to (item (12) of [world 2 - level 6 v])\n set [touch? v] to [False]\n else\n if <(Level) = [7]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 2 - level 7 v])\n set [y v] to (item (12) of [world 2 - level 7 v])\n set [touch? v] to [False]\n else\n if <(Level) = [8]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 2 - level 8 v])\n set [y v] to (item (12) of [world 2 - level 8 v])\n set [touch? v] to [False]\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\n end\n end\n else\n set [christmas | scrolling platformer v] to [0]\n set [touch? v] to [True]\n end\nend\n\nwhen I receive [enemy 1 die v]\nset [ghost v] effect to (0)\nif <(World) = [1]> then\n if <(Level) = [4]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 1 - level 4 v])\n set [y v] to (item (12) of [world 1 - level 4 v])\n set [touch? v] to [False]\n else\n end\nend\nif <(World) = [2]> then\n if <(Level) = [10]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 2 - level 10 v])\n set [y v] to (item (12) of [world 2 - level 10 v])\n set [touch? v] to [False]\n else\n end\nend\n\nwhen I receive [enemy 2 die v]\nset [ghost v] effect to (0)\nif <(World) = [2]> then\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 2 - level 9 v])\n set [y v] to (item (12) of [world 2 - level 9 v])\n set [touch? v] to [False]\n else\n end\nend\nif <(World) = [3]> then\n if <(Level) = [11]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (11) of [world 3 - level 11 v])\n set [y v] to (item (12) of [world 3 - level 11 v])\n set [touch? v] to [False]\n else\n end\nend\n\n@Score System\n\nwhen flag clicked\nhide\ngo to x: (210) y: (100)\nset size to (150) %\nforever\n if <(Score?) = [True]> then\n show\n switch costume to (letter (1) of (Touch #))\n else\n hide\n end\nend\n\n@Obstacle\n\nwhen I receive [start platformer v]\nif <(World) = [1]> then\n if <(Level) = [1]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume1 v)\n show\n else\n if <(Level) = [2]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume2 v)\n show\n else\n if <(Level) = [3]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume3 v)\n show\n else\n if <(Level) = [4]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume4 v)\n show\n else\n if <(Level) = [5]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume5 v)\n show\n else\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume6 v)\n show\n else\n if <(Level) = [7]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume7 v)\n show\n else\n if <(Level) = [8]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume8 v)\n show\n else\n if <(Level) = [9]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume9 v)\n show\n else\n if <(Level) = [10]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume10 v)\n show\n else\n end\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume11 v)\n show\n else\n end\n else\n end\n end\nend\n\nwhen flag clicked\nhide\n\ndefine Platforms\nif <not <(Ending Scene) = [True]>> then\n go to x: ((1000) - (Length)) y: ((0) - (Height))\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\n@Bounce\n\nwhen flag clicked\nhide\n\nwhen I receive [start platformer v]\nif <(World) = [1]> then\n if <(Level) = [1]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume1 v)\n show\n else\n if <(Level) = [2]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume2 v)\n show\n else\n if <(Level) = [3]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume3 v)\n show\n else\n if <(Level) = [4]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume4 v)\n show\n else\n if <(Level) = [5]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume5 v)\n show\n else\n end\n end\n end\n end\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [6]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume6 v)\n show\n else\n if <(Level) = [7]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume7 v)\n show\n else\n if <(Level) = [8]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume8 v)\n show\n else\n if <(Level) = [9]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume9 v)\n show\n else\n if <(Level) = [10]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume10 v)\n show\n else\n end\n end\n end\n end\n end\n else\n if <(World) = [3]> then\n if <(Level) = [11]> then\n go to x: (0) y: (0)\n switch costume to ( v)\n set size to (500) %\n switch costume to (costume11 v)\n show\n else\n end\n else\n end\n end\nend\n\ndefine Platforms\nif <not <(Ending Scene) = [True]>> then\n go to x: ((1000) - (Length)) y: ((0) - (Height))\nend\n\nwhen I receive [plaforms v]\nPlatforms\n\n@Snowrock\n\nwhen flag clicked\nhide\nset [snowrock? v] to [False]\nforever\n if <(World) = [1]> then\n if <(Level) = [5]> then\n set [x v] to (item (1) of [world 1 - snowrock v])\n set [y v] to (item (2) of [world 1 - snowrock v])\n else\n set [snowrock? v] to [False]\n end\n else\n if <(World) = [2]> then\n if <(Level) = [9]> then\n set [x v] to (item (1) of [world 2 - snowrock v])\n set [y v] to (item (2) of [world 2 - snowrock v])\n else\n set [snowrock? v] to [False]\n end\n else\n set [snowrock? v] to [False]\n end\n end\n if <(Snowrock?) = [True]> then\n if <(Snowrock?) = [True]> then\n if <(pick random (1) to (2)) = [1]> then\n point in direction (40)\n set [xv v] to (pick random (-8) to (-12))\n set [yv v] to (pick random (8) to (12))\n else\n point in direction (-40)\n set [xv v] to (pick random (8) to (12))\n set [yv v] to (pick random (8) to (12))\n end\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n switch costume to (pick random (1) to (2))\n repeat until <<(Test) = [True]> or <(Y) < [-180]>>\n if <(Snowrock?) = [True]> then\n change [x v] by (XV)\n change [y v] by ((YV) * (-1))\n if <<([abs v] of ((X) - (Length)) ) < [250]> and <([abs v] of ((Y) - (Height)) ) < [190]>> then\n if <(Touch?) = [False]> then\n show\n go to x: ((X) - (Length)) y: ((Y) - (Height))\n else\n hide\n end\n else\n hide\n end\n else\n hide\n end\n end\n broadcast (Explosion v) and wait\n hide\n else\n hide\n end\n else\n hide\n end\nend\n\nwhen I receive [death v]\nset [ghost v] effect to (0)\nSetting\n\nwhen I receive [start platformer v]\nset [ghost v] effect to (0)\nSetting\n\ndefine Setting\nif <(World) = [1]> then\n if <(Level) = [5]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 1 - snowrock v])\n set [y v] to (item (2) of [world 1 - snowrock v])\n set [snowrock? v] to [True]\n else\n end\nelse\n if <(World) = [2]> then\n if <(Level) = [9]> then\n set [christmas | scrolling platformer v] to [0]\n set [x v] to (item (1) of [world 2 - snowrock v])\n set [y v] to (item (2) of [world 2 - snowrock v])\n set [snowrock? v] to [True]\n else\n set [snowrock? v] to [False]\n end\n else\n set [snowrock? v] to [False]\n end\nend\n\nwhen flag clicked\nforever\n if <touching (platforms 1 v)?> then\n set [test v] to [True]\n else\n set [test v] to [False]\n end\nend\n\n@Explosion\n\nwhen I receive [explosion v]\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nset [x v] to ([x position v] of [snowrock v])\nset [y v] to ([y position v] of [snowrock v])\nset [brightness v] effect to (0)\nswitch costume to (costume2 v)\nif <<(X) < [240]> and <(Y) < [180]>> then\n show\n go to x: (X) y: (Y)\n start sound [Explosion Sound v]\n repeat (8)\n if <<(X) < [250]> and <(Y) < [190]>> then\n change [x v] by ((EXV) * (-1))\n change [y v] by ((EYV) * (-1))\n go to x: (X) y: (Y)\n wait (0.01) seconds\n next costume\n else\n hide\n delete this clone\n end\n end\n delete this clone\nelse\n hide\n delete this clone\nend\n\nwhen flag clicked\nhide\n\n@Ending Scene\n\nwhen flag clicked\nhide\n\nwhen I receive [ending scene v]\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\nshow\nrepeat (5)\n change [ghost v] effect by (-10)\nend\nbroadcast (Snow Effect v) and wait\nrepeat (5)\n change [ghost v] effect by (10)\nend\nhide\n\n@Snow Effect\n\nwhen I start as a clone\nif <(size) > [50]> then\n go to [front v] layer\nend\nshow\nrepeat until <touching (_edge_ v)?>\n change y by (() - ((size) / (50)))\nend\ndelete this clone\n\nwhen I receive [snow effect v]\nset [ghost v] effect to (65)\nset y to (165)\nrepeat (20)\n create clone of (_myself_ v)\n set x to (pick random (240) to (-240))\n set size to (pick random (1) to (100)) %\n wait (0.2) seconds\nend\nbroadcast (Word v) and wait\n\nwhen flag clicked\nhide\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen I receive [word v]\nstart sound [All Level Completed v]\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (5) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\nset [ending scene v] to [False]\nset [select v] to [True]\n\n
Autumn Whispers ~ a platformer ~
@Stage\n\nwhen flag clicked\nforever\n play sound [Heaven's Prayer v] until done\nend\n\n@Vix\n\nwhen flag clicked\nset rotation style [left-right v]\nforever\n go to (hitbox v)\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n end\n if <key (right arrow v) pressed?> then\n point in direction (90)\n end\nend\n\nwhen flag clicked\ngo to x: (-189) y: (-118)\nshow\nset [action v] to [STANDING]\n\nwhen flag clicked\nforever\n if <touching color (#56111e)?> then\n if <<not <key (up arrow v) pressed?>> and <<key (right arrow v) pressed?> or <key (left arrow v) pressed?>>> then\n set [action v] to [WALKING]\n else\n set [action v] to [STANDING]\n end\n else\n if <not <touching color (#56111e)?>> then\n set [action v] to [FLYING]\n end\n end\nend\n\nwhen I receive [start v]\ngo to [front v] layer\nforever\n if <(Action) = [FLYING]> then\n wait (0.12) seconds\n next costume\n if <not <<[9] > (costume [number v])> and <[3] < (costume [number v])>>> then\n switch costume to (flying1 v)\n end\n end\n if <(Action) = [STANDING]> then\n wait (0.4) seconds\n next costume\n if <not <<(costume [number v]) = [1]> or <(costume [number v]) = [2]>>> then\n switch costume to (standing1 v)\n end\n end\n if <(Action) = [WALKING]> then\n wait (0.2) seconds\n next costume\n if <not <<[14] > (costume [number v])> and <[9] < (costume [number v])>>> then\n switch costume to (walking1 v)\n end\n end\nend\n\nwhen [r v] key pressed\ngo to x: (-193) y: (20)\n\n@land\n\nwhen flag clicked\nswitch costume to (costume1 v)\ngo to x: (0) y: (0)\nshow\nset [level v] to [1]\n\nwhen I receive [nextlevel v]\nnext costume\nwait (1) seconds\n\n@Hitbox\n\ngo to x: (-189) y: (-118)\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (-189) y: (-118)\nshow\n\nwhen flag clicked\nforever\n if <<touching color (#a2d0ff)?> or <touching color (#cbebff)?>> then\n wait (0.01) seconds\n go to x: (-215) y: (-107)\n end\nend\n\ndefine None\npoint in direction (direction)\nchange x by (speed)\nset [slope v] to [0]\nrepeat until <<(slope) = [8]> or <not <touching color (#56111e)?>>>\n change y by (1)\n change [slope v] by (1)\n if <(slope) = [8]> then\n change x by ((speed) * (-1))\n set [xv v] to ((xv) * (0.1))\n change y by (-8)\n end\nend\n\nwhen flag clicked\ngo to x: (-215) y: (-107)\nset [ghost v] effect to (100)\nshow\nset rotation style [left-right v]\nset [yv v] to [0]\nforever\n change [yv v] by (-1)\n set [xv v] to ((xv) * (0.6))\n change y by (yv)\n TG <[0] < (yv)> <(yv) < [0]>\n if <<<key (up arrow v) pressed?> and <(falling) = [0]>> and <(yv) < [10]>> then\n change [yv v] by (3)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (2)\n Walk (90) (xv)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-2)\n Walk (-90) (xv)\n end\nend\n\nwhen I receive [nextlevel v]\ngo to x: (-215) y: (-107)\nMagic Block\n\nwhen [g v] key pressed\ngo to (flower v)\n\ndefine Magic Block\nrepeat until <not <touching color (#56111e)?>>\n change y by (1)\nend\n\ndefine TG <> <>\nrepeat until <not <touching color (#56111e)?>>\n if <up?> then\n change y by (-1)\n else\n if <down> then\n change y by (1)\n set [falling v] to [0]\n end\n end\n set [yv v] to [0]\nend\n\nwhen flag clicked\nforever\n if <(y position) < [-170]> then\n change y by (100)\n Magic Block\n end\nend\n\n@flower\n\nwhen flag clicked\nforever\n if <touching (vix v)?> then\n broadcast (Nextlevel v)\n end\n wait (0.05) seconds\nend\n\nwhen I receive [nextlevel v]\nchange [level v] by (1)\nif <(Level) = [1]> then\n go to x: (214) y: (-81)\nend\nif <(Level) = [2]> then\n go to x: (72) y: (-114)\nend\nif <(Level) = [3]> then\n go to x: (196) y: (-95)\nend\nif <(Level) = [4]> then\n go to x: (196) y: (-95)\nend\nif <(Level) = [5]> then\n go to x: (125) y: (155)\nend\nif <(Level) = [6]> then\n go to x: (130) y: (161)\nend\nif <(Level) = [7]> then\n go to x: (208) y: (-13)\nend\nif <(Level) = [8]> then\n go to x: (188) y: (33)\nend\nif <(Level) = [9]> then\n go to x: (176) y: (81)\nend\nif <(Level) = [10]> then\n go to x: (224) y: (97)\nend\nif <(Level) = [11]> then\n go to x: (199) y: (-8)\nend\nif <(Level) = [12]> then\n go to x: (183) y: (-21)\nend\nif <(Level) = [13]> then\n go to x: (201) y: (-106)\nend\nif <(Level) = [14]> then\n go to x: (210) y: (72)\nend\nif <(Level) = [17]> then\n hide\n broadcast (fin v)\nend\n\nwhen flag clicked\ngo to x: (214) y: (-81)\nshow\nforever\n wait (0.05) seconds\n turn right (5) degrees\nend\n\nwhen I receive [start v]\ngo to [front v] layer\n\nhide\n\n@Indigo\n\nwhen flag clicked\nhide\n\nwhen I receive [nextlevel v]\nwait (0.2) seconds\nif <(Level) = [15]> then\n switch costume to (costume2 v)\n go to x: (55) y: (75)\n repeat until <(Level) = [16]>\n glide (1) secs to x: (47) y: (-112)\n glide (3) secs to x: (64) y: (88)\n end\nend\n\nwhen I receive [nextlevel v]\nwait (0.2) seconds\nif <(Level) = [14]> then\n go to x: (34) y: (-6)\n switch costume to (costume1 v)\n go to [front v] layer\n show\n repeat until <(Level) = [15]>\n glide (1) secs to x: (26) y: (-87)\n glide (2) secs to x: (147) y: (-81)\n glide (3) secs to x: (153) y: (52)\n glide (4) secs to x: (55) y: (75)\n end\nend\n\nwhen I receive [nextlevel v]\nwait (0.2) seconds\n\nwhen I receive [nextlevel v]\nwait (0.2) seconds\nif <(Level) = [17]> then\n hide\nend\n\nif <(Level) = [16]> then\n go to x: (23) y: (-59)\n switch costume to (costume3 v)\n repeat until <(Level) = [17]>\n glide (1) secs to x: (27) y: (-89)\n glide (1) secs to x: (221) y: (-60)\n glide (1) secs to x: (207) y: (85)\n glide (1) secs to x: (42) y: (86)\n end\nend\n\nwhen I receive [nextlevel v]\nwait (0.2) seconds\nif <(Level) = [16]> then\n go to x: (23) y: (-59)\n switch costume to (costume3 v)\n repeat until <(Level) = [17]>\n glide (1) secs to x: (20) y: (-50)\n glide (1.3) secs to x: (200) y: (-100)\n glide (1) secs to x: (200) y: (56)\n glide (1) secs to x: (20) y: (86)\n glide (1) secs to x: (100) y: (-50)\n glide (1) secs to x: (200) y: (-100)\n end\nend\n\nshow\ngo to [front v] layer\n\n@1Keila\n\nwhen flag clicked\ngo to [front v] layer\nset [ghost v] effect to (0)\ngo to x: (0) y: (0)\nshow\nwait (2) seconds\nbroadcast (start v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nshow\nset [ghost v] effect to (0)\ngo to [front v] layer\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [fin v]\nshow\n\n
Winter Omens ~ https://scratch.mit.edu/projects/319250587/\n\n\nPlay as Vix the flying fox to collect all the flowers\n~Use the arrow keys to move\n~Avoid water and dragons\n~Fly with the up arrow\n\nIf you are having difficulty on a level type H-F-F-G to skip\nAll levels are possible\nThey have been run through and tested lots and lots of times.
ExoWare: Platformer part I
@Stage\n\nwhen I receive [play game v]\nswitch backdrop to (backdrop2 v)\nplay sound [734427_Pyrolysis.mp3 v] until done\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nplay sound [686782_Badland.mp3 v] until done\n\nwhen backdrop switches to [backdrop14 v]\nstop all sounds\n\nwhen I receive [next level v]\nwait (1) seconds\nnext backdrop\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\nset [ghost v] effect to (100)\nswitch costume to (costume1 v)\nrepeat (6)\n repeat (50)\n change [ghost v] effect by (-2)\n end\n wait (1.2) seconds\n repeat (50)\n change [ghost v] effect by (2)\n end\n next costume\nend\nhide\nbroadcast (message1 v)\n\nwhen backdrop switches to [backdrop14 v]\nwait (2.5) seconds\nshow\nset [ghost v] effect to (100)\nswitch costume to (costume7 v)\nrepeat (2)\n repeat (50)\n change [ghost v] effect by (-2)\n end\n wait (2) seconds\n repeat (50)\n change [ghost v] effect by (2)\n end\n next costume\nend\nhide\nstop [all v]\n\n@Sprite2\n\nwhen I receive [message1 v]\ngo to x: (-480) y: (0)\nshow\nrepeat (18)\n change x by (10)\nend\nrepeat (7)\n change x by (5)\nend\nrepeat (3)\n change x by (4)\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [play game v]\nhide\n\n@Sprite3\n\nwhen I receive [message1 v]\ngo to x: (480) y: (0)\nshow\nrepeat (18)\n change x by (-10)\nend\nrepeat (7)\n change x by (-5)\nend\nrepeat (3)\n change x by (-4)\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [play game v]\nhide\n\n@Sprite4\n\nwhen I receive [message1 v]\ngo to x: (0) y: (180)\nwait (1.8) seconds\nshow\nrepeat (10)\n change y by (-8)\nend\nrepeat (5)\n change y by (-4)\nend\nrepeat (3)\n change y by (-2)\nend\nbroadcast (2 v)\n\nwhen flag clicked\nhide\n\nwhen I receive [play game v]\nhide\n\n@Sprite5\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n set size to (110) %\n wait until <not <touching (mouse-pointer v)?>>\n set size to (100) %\n end\nend\n\nwhen this sprite clicked\nstop all sounds\nstart sound [quitSound_01.mp3 v]\nwait (0.5) seconds\nbroadcast (begin v)\n\nwhen flag clicked\ngo to x: (0) y: (-78)\nhide\n\nwhen I receive [2 v]\nshow\nset [ghost v] effect to (100)\nrepeat (20)\n change [ghost v] effect by (-5)\nend\n\nwhen I receive [play game v]\nhide\n\n@Sprite6\n\nwhen I receive [begin v]\nshow\nset [ghost v] effect to (100)\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (0.5) seconds\nbroadcast (play game v)\nhide\n\nwhen I receive [next level v]\nshow\nset [ghost v] effect to (100)\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (0.2) seconds\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nhide\nbroadcast (glub v)\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\n@Sprite7\n\nwhen flag clicked\nhide\nforever\n if <touching color (#ff0000)?> then\n broadcast (oof v)\n start sound [med-rifle v]\n go to x: (-210) y: (-100)\n set [y vel v] to [0]\n end\n if <touching color (#cc7700)?> then\n broadcast (next level v)\n start sound [Laser Sound Effect-2 v]\n hide\n end\n if <key (down arrow v) pressed?> then\n change [y vel v] by (-3)\n end\nend\n\nwhen flag clicked\nset volume to (100) %\nset size to (50) %\nswitch costume to (costume1 v)\ngo to x: (-210) y: (-100)\nset [x vel v] to [0]\nset [y vel v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n switch costume to (costume2 v)\n change [x vel v] by (1)\n end\n if <key (left arrow v) pressed?> then\n switch costume to (costume3 v)\n change [x vel v] by (-1)\n end\n set [x vel v] to ((x vel) * (0.9))\n change x by (x vel)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((x vel) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(x vel) = [0]> then\n set [x vel v] to [-5]\n else\n set [x vel v] to [5]\n end\n set [y vel v] to [10]\n else\n set [x vel v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [y vel v] by (-1)\n change y by (y vel)\n if <touching color (#000000)?> then\n change y by ((y vel) * (-1))\n set [y vel v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <key (up arrow v) pressed?> then\n set [y vel v] to [13]\n start sound [Whoosh sound effects \(from the tutorial\) v]\n end\n end\n if <touching color (#00ffff)?> then\n if <key (up arrow v) pressed?> then\n set [y vel v] to [8]\n else\n set [y vel v] to [-1.5]\n end\n end\n if <touching color (#ff9400)?> then\n start sound [quick dash v]\n set [y vel v] to [24]\n end\n if <touching color (#ff00bf)?> then\n if <key (up arrow v) pressed?> then\n set [y vel v] to [13]\n start sound [quick dash v]\n end\n end\n change y by (1)\nend\n\nwhen I receive [play game v]\ngo to x: (-210) y: (-100)\nshow\n\nwhen flag clicked\nforever\n if <touching color (#00ffff)?> then\n play sound [bubbles v] until done\n end\nend\n\nwhen I receive [glub v]\ngo to x: (-210) y: (-100)\nshow\n\nwhen I receive [play game v]\nrepeat until <(backdrop [name v]) = [backdrop14]>\n create clone of (_myself_ v)\n wait (0.06) seconds\nend\n\nwhen I start as a clone\ngo [backward v] (99) layers\nset size to (50) %\nset [ghost v] effect to (25)\nshow\nrepeat (15)\n change [ghost v] effect by (5)\n change size by (-3)\nend\ndelete this clone\n\nwhen backdrop switches to [backdrop14 v]\nforever\n hide\nend\n\n
note: this is completely possible.\nanother note: I didn't mean to copy the storyline of terminator. it was a complete coincidence\nthis is part I of my new platformer series! be sure to love, favorite and follow for part II!\n\nNOTE: ground slam is glitched, so don’t spam me in the comments about it. I already know, and I’m trying to fix it.
R.O.B.O.T (Platformer)
@Stage\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nshow\ngo to [front v] layer\n\nwhen I receive [next lvl v]\nerase all\n\n@Sprite6\n\nwhen I receive [gamestart v]\nset [ghost v] effect to (100)\nswitch costume to (stand v)\nset rotation style [left-right v]\ngo to x: (-200) y: (-85)\nshow\nset [x vel v] to [0]\nset [y vel v] to [0]\nforever\n change [y vel v] by (-1)\n if <key (left arrow v) pressed?> then\n if <(Wave?) = [1]> then\n change [x vel v] by (-0.3)\n else\n change [x vel v] by (-1)\n end\n end\n if <key (right arrow v) pressed?> then\n if <(Wave?) = [1]> then\n change [x vel v] by (0.3)\n else\n change [x vel v] by (1)\n end\n end\n set [x vel v] to ((X vel) * (0.9))\n change x by (X vel)\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (1)\n end\n if <touching color (#000000)?> then\n change y by (-4)\n change x by ((X vel) * (-1))\n if <key (up arrow v) pressed?> then\n set [y vel v] to [10]\n if <([abs v] of (X vel) ) = (X vel)> then\n set [x vel v] to [-10]\n else\n set [x vel v] to [10]\n end\n else\n set [x vel v] to [0]\n end\n end\n change y by (Y vel)\n if <touching color (#000000)?> then\n change y by ((Y vel) - ((Y vel) * (2)))\n set [y vel v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#000000)?>> then\n set [y vel v] to [10]\n end\n change y by (1)\n if <touching color (#8731c2)?> then\n broadcast (portal v)\n end\n if <<touching (sprite12 v)?> and <([costume # v] of [sprite12 v]) = [7]>> then\n set [y vel v] to [20]\n set [tground v] to [0]\n end\n if <<touching (sprite9 v)?> and <([costume # v] of [sprite9 v]) = [4]>> then\n set [wave? v] to [1]\n broadcast (Slow v)\n end\nend\n\nif <touching (edge v)?> then\n broadcast (next lvl v)\n go to x: (-200) y: (-85)\nend\n\ngo to x: (-200) y: (200)\nset [y vel v] to [0]\n\nset [tground v] to [1]\n\ndefine Shoot ( (1/2) )\nif <(1/2) = [1]> then\n switch costume to (shoot2 v)\n wait (0) seconds\n switch costume to (shoot3 v)\n wait (0.1) seconds\n switch costume to (shoot2 v)\nelse\n switch costume to (shoot11 v)\nend\nwait (0) seconds\nswitch costume to (shoot12 v)\nwait (0.1) seconds\nswitch costume to (shoot11 v)\n\nwhen I receive [respawn v]\nset [y vel v] to [0]\ngo to x: (-171) y: (90)\n\nwhen flag clicked\nforever\n if <[237] < (x position)> then\n if <not <<([costume # v] of [ground v]) = [16]> or <([costume # v] of [ground v]) = [22]>>> then\n go to x: (-171) y: (90)\n broadcast (next lvl v)\n end\n end\n go to [front v] layer\n show\n set [ghost v] effect to (100)\nend\n\nwhen I receive [game start v]\n\nif <key (a v) pressed?> then\n set [x vel v] to [0]\n set [y vel v] to [0]\nend\n\nwhen backdrop switches to [backdrop1 v]\n\nwhen I receive [fight1 v]\ngo to x: (-171) y: (90)\n\nif <key (up arrow v) pressed?> then\n set [y vel v] to [10]\nend\n\nwhen flag clicked\nforever\n if <not <touching color (#000000)?>> then\nend\n\nwhen flag clicked\nforever\n if <not <touching color (#000000)?>> then\n set [tground v] to [0]\n end\nend\n\ngo to x: (-171) y: (-90)\n\nwhen flag clicked\nforever\n if <key (r v) pressed?> then\n if <touching color (#5b5b5b)?> then\n if <<touching (sprite3 v)?> and <not <color (#e5e5e5) is touching (#000000)?>>> then\n change x by (-5)\n set [x vel v] to [0]\n end\n change y by (10)\n set [y vel v] to [0]\n end\n end\nend\n\nwhen I receive [cancel sink v]\nif <<touching (sprite12 v)?> or <touching (sprite16 v)?>> then\n reset timer\n repeat until <(letter (3) of (timer)) = [3]>\n set [y vel v] to [0.6]\n end\nend\n\nwhen I receive [boss1 v]\nwait (4.2) seconds\nset [y vel v] to [0]\nset [x vel v] to [0]\ngo to x: (-196) y: (-71)\n\nwhen flag clicked\nforever\n if <<touching (sprite9 v)?> or <<touching (sprite3 v)?> or <touching (sprite16 v)?>>> then\n change [phealth v] by (1)\n wait (0.5) seconds\n end\nend\n\nwhen I receive [back v]\nhide\n\nwhen I receive [b1 defeat v]\nwait (2) seconds\nset [y vel v] to [0]\nset [x vel v] to [0]\ngo to x: (-196) y: (100)\n\nwhen [a v] key pressed\nwait (1) seconds\ngo to x: (-171) y: (90)\n\nwhen I receive [slow v]\nwait (4) seconds\nset [wave? v] to [0]\n\nbroadcast (portal v)\n\n@Player\n\ndefine Run ( (1/2) )\nif <(TGround) = [1]> then\n if <(1/2) = [1]> then\n switch costume to (run v)\n wait (0.1) seconds\n repeat (2)\n next costume\n wait (0.1) seconds\n end\n else\n switch costume to (run v)\n wait (0.1) seconds\n repeat (2)\n next costume\n wait (0.1) seconds\n end\n end\nend\n\nwhen flag clicked\nset [y vel v] to [0]\ngo to [front v] layer\nforever\n go to (sprite6 v)\nend\n\nwhen flag clicked\nshow\n\nwhen I receive [gamestart v]\nforever\n go to [front v] layer\nend\n\nwhen I receive [respawn v]\nshow\n\nwhen I receive [portal v]\nhide\n\nwhen I receive [gamestart v]\n\ngo to [front v] layer\n\nbroadcast (respawn v)\n\nif <(costume [number v]) = [12]> then\n Shoot ( (4) )\nend\n\nturn left (360) degrees\n\ndefine Shoot ( (1/2) )\nif <(1/2) = [1]> then\n switch costume to (shoot v)\n wait (0) seconds\n switch costume to (shoot2 v)\n wait (0.1) seconds\n switch costume to (shoot v)\nend\nif <(1/2) = [2]> then\n switch costume to (shoot v)\n wait (0) seconds\n switch costume to (shoot2 v)\n wait (0.1) seconds\n switch costume to (shoot v)\nend\n\ndefine Jump\nswitch costume to (jump v)\nwait (0.1) seconds\nswitch costume to (jump2 v)\nwait (0.3) seconds\nrepeat until <(TGround) = [1]>\n switch costume to (fall v)\nend\n\nif <(costume [number v]) = [12]> then\n Shoot ( (3) )\nend\n\nif <[] = [0]> then\n switch costume to (fall v)\nend\n\nwhen flag clicked\nforever\n\nwhen I receive [game start v]\nwait (0) seconds\nforever\n if <key (right arrow v) pressed?> then\n Run ( (1) )\n end\n if <key (left arrow v) pressed?> then\n Run ( (2) )\n end\n if <key (up arrow v) pressed?> then\n if <(TGround) = [1]> then\n Jump\n end\n end\n if <(TGround) = [1]> then\n if <key (space v) pressed?> then\n Shoot ( (1) )\n end\n end\n if <<(TGround) = [1]> and <not <key (any v) pressed?>>> then\n switch costume to (stand v)\n end\n if <(TGround) = [0]> then\n switch costume to (fall v)\n end\nend\n\nwhen flag clicked\nforever\n if <color (#e5e5e5) is touching (#000000)?> then\n set [tground v] to [1]\n else\n set [tground v] to [0]\n end\nend\n\nwhen I receive [boss1 v]\n\ngo [backward v] (1) layers\n\nwhen I receive [boss1 v]\nhide\nwait (3) seconds\nshow\n\nwhen I receive [back v]\nhide\nswitch costume to (dead v)\ngo [backward v] (1) layers\n\nwhen I receive [gamestart v]\nshow\n\nwhen I receive [b1 defeat v]\nhide\nwait (1.5) seconds\nshow\n\nshow\n\nwhen I receive [game start v]\nwait (0) seconds\nforever\n if <key (right arrow v) pressed?> then\n set rotation style [left-right v]\n point in direction (90)\n end\n if <key (left arrow v) pressed?> then\n set rotation style [left-right v]\n point in direction (-90)\n end\nend\n\nwhen I receive [game finished v]\nhide\nset [eshoot? v] to [0]\n\n@Sprite8\n\nwhen I receive [portal v]\nswitch costume to (costume2 v)\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nrepeat (10)\n change [ghost v] effect by (10)\n broadcast (respawn v)\nend\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [boss1 v]\nswitch costume to (costume2 v)\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (10)\n broadcast (Fight1 v)\nend\nhide\nbroadcast (next lvl v)\n\nwhen flag clicked\nset [phealth v] to [1]\nhide\nwait until <(PHealth) = [41]>\nbroadcast (Back v)\nswitch costume to (costume1 v)\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\n go to [front v] layer\nend\nstop [all v]\n\nwhen I receive [back v]\nhide\n\nwhen I receive [b1 defeat v]\nswitch costume to (costume2 v)\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nbroadcast (Fight1 v)\n\n@Ground\n\nwhen I receive [gamestart v]\nswitch costume to (costume1 v)\n\nwhen I receive [respawn v]\nswitch costume to (costume2 v)\n\nwhen flag clicked\nswitch costume to (costume1 v)\nforever\n go to x: (0) y: (0)\nend\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n go [backward v] (1) layers\nend\n\nwhen I receive [next lvl v]\nnext costume\n\nwhen I receive [b1 defeat v]\n\nwhen I receive [b1 defeat v]\nwait (1) seconds\nrepeat (10)\n switch costume to (costume17 v)\n wait (0.1) seconds\n switch costume to (costume17 v)\nend\n\nwait (0.4) seconds\nnext costume\n\nwhen flag clicked\nwait until <(costume [number v]) = [22]>\nbroadcast (Boss2 v)\n\n@Sprite3\n\ndefine Load Animation\nforever\n if <(Eshoot?) = [1]> then\n if <(E) = [1]> then\n show\n switch costume to (r1s v)\n wait (1) seconds\n switch costume to (r1 v)\n wait (1) seconds\n switch costume to (r1s v)\n broadcast (eshoot v)\n end\n if <(E) = [2]> then\n show\n switch costume to (r3 v)\n wait (2) seconds\n broadcast (eshoot v)\n switch costume to (r3s v)\n wait (2) seconds\n switch costume to (r3 v)\n end\n if <(E) = [3]> then\n show\n broadcast (eshoot v) and wait\n end\n if <(E) = [4]> then\n show\n switch costume to (r5s v)\n wait (1) seconds\n switch costume to (r5 v)\n wait (1) seconds\n switch costume to (r5s v)\n broadcast (eshoot v)\n end\n if <(E) = [5]> then\n show\n switch costume to (r6 v)\n wait (2) seconds\n broadcast (eshoot v)\n switch costume to (r6s v)\n wait (2) seconds\n switch costume to (r6 v)\n end\n if <(E) = [6]> then\n show\n switch costume to (r7 v)\n wait (2) seconds\n switch costume to (r7s v)\n set [rsheild v] to [1]\n wait (4) seconds\n switch costume to (r7 v)\n broadcast (eshoot v)\n end\n else\n hide\n end\nend\n\nbroadcast (eshoot v)\n\nif <(E) = [4]> then\nwait (2) seconds\n\nhide\n\nwhen flag clicked\nwait (0.1) seconds\nLvl ([costume # v] of [ground v])\n\nshow\ngo to [front v] layer\n\nwhen flag clicked\nLoad Animation\nLoad\nforever\n go to [front v] layer\nend\n\nwhen I receive [next lvl v]\nwait (0.2) seconds\nLvl ([costume # v] of [ground v])\n\nwhen I start as a clone\nif <<(costume [number v]) = [3]> or <(costume [number v]) = [4]>> then\n forever\n set rotation style [left-right v]\n repeat until <touching color (#000000)?>\n point in direction (-90)\n change x by (3)\n end\n point in direction (90)\n change x by (-10)\n repeat until <touching color (#000000)?>\n point in direction (90)\n change x by (-3)\n end\n point in direction (-90)\n change x by (10)\n end\nend\n\ndefine Lvl (#)\nif <(#) = [1]> then\n Robot Type [0] How Many [] x [] y []\nend\nif <(#) = [2]> then\n Robot Type [0] How Many [] x [] y []\nend\nif <(#) = [3]> then\n Robot Type [1] How Many [1] x [150] y [-66]\nend\nif <(#) = [4]> then\n Robot Type [1] How Many [1] x [168] y [32]\nend\nif <(#) = [5]> then\n Robot Type [2] How Many [2] x [-84] y [-87]\n Robot Type [2] How Many [2] x [84] y [-87]\nend\nif <(#) = [6]> then\n Robot Type [2] How Many [2] x [-84] y [-87]\n Robot Type [2] How Many [2] x [84] y [-87]\nend\nif <(#) = [7]> then\n Robot Type [3] How Many [1] x [156] y [36]\nend\nif <(#) = [8]> then\n Robot Type [2] How Many [3] x [-84] y [-87]\n Robot Type [2] How Many [3] x [84] y [-87]\n Robot Type [3] How Many [3] x [156] y [36]\nend\nif <(#) = [9]> then\n Robot Type [4] How Many [1] x [-35] y [123]\nend\nif <(#) = [10]> then\n Robot Type [2] How Many [3] x [-96] y [-46]\n Robot Type [2] How Many [3] x [109] y [-46]\n Robot Type [4] How Many [3] x [-35] y [123]\nend\nif <(#) = [11]> then\n Robot Type [0] How Many [0] x [0] y [0]\nend\nif <(#) = [12]> then\n Robot Type [1] How Many [1] x [179] y [35]\nend\nif <(#) = [13]> then\n Robot Type [3] How Many [1] x [179] y [35]\nend\nif <(#) = [14]> then\n Robot Type [0] How Many [0] x [0] y [0]\nend\nif <(#) = [15]> then\n Robot Type [0] How Many [1] x [0] y [0]\nend\nif <(#) = [16]> then\n Robot Type [0] How Many [1] x [0] y [0]\nend\nif <(#) = [17]> then\nif <(#) = [18]> then\n Robot Type [2] How Many [2] x [25] y [-59]\n Robot Type [2] How Many [2] x [-25] y [-59]\nend\nif <(#) = [19]> then\n Robot Type [6] How Many [1] x [150] y [35]\nend\nif <(#) = [20]> then\n Robot Type [7] How Many [1] x [150] y [35]\nend\n\nshow\n\nwhen flag clicked\n\nwhen I start as a clone\nif <<(costume [number v]) = [3]> or <(costume [number v]) = [4]>> then\n forever\n switch costume to (r2 v)\n wait (0.1) seconds\n switch costume to (r2s v)\n wait (0.1) seconds\n if <<touching (sprite12 v)?> and <([costume # v] of [sprite12 v]) = [3]>> then\n repeat (2)\n switch costume to (r2s2 v)\n wait (0.1) seconds\n switch costume to (r2s3 v)\n wait (0.1) seconds\n end\n repeat (10)\n change [ghost v] effect by (10)\n end\n change [#robots v] by (-1)\n delete this clone\n end\n end\nend\nif <(costume [number v]) = [10]> then\n set rotation style [left-right v]\n point in direction (90)\n repeat until <(#Robots) = [0]>\n switch costume to (r5 v)\n wait (0.1) seconds\n switch costume to (r5s v)\n wait (0.1) seconds\n switch costume to (r5s1 v)\n wait (1) seconds\n end\nend\n\ndefine Health (#)\nset [health v] to (#)\nclear graphic effects\nrepeat until <[1] > (Health)>\n if <<touching (sprite5 v)?> and <(RSheild) = [0]>> then\n clear graphic effects\n set [brightness v] effect to (0)\n repeat (5)\n change [brightness v] effect by (2)\n end\n change [health v] by (-1)\n repeat (5)\n change [brightness v] effect by (-2)\n end\n end\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\nset [brightness v] effect to (0)\nhide\nset [eshoot? v] to [0]\nchange [#robots v] by (-1)\n\ngo to x: (86) y: (88)\n\nswitch costume to (r3s v)\nwait (2) seconds\nswitch costume to (r3 v)\n\ndefine Drone\nrepeat until <(Eshoot?) = [0]>\n switch costume to (r4 v)\n repeat until <<touching (_edge_ v)?> or <touching color (#666666)?>>\n go to [front v] layer\n change x by (10)\n end\n change x by (-25)\n repeat until <<touching (_edge_ v)?> or <touching color (#666666)?>>\n go to [front v] layer\n change x by (-10)\n end\n change x by (25)\nend\n\nhide\n\nbroadcast (eshoot v)\n\nwhen I receive [shoot cycle v]\nrepeat until <(Eshoot?) = [0]>\n wait (1.5) seconds\n broadcast (eshoot v)\nend\n\nwhen flag clicked\nforever\n if <(costume [number v]) = [9]> then\n if <<([costume # v] of [sprite12 v]) = [3]> and <touching (sprite12 v)?>> then\n repeat (10)\n change [ghost v] effect by (10)\n set [eshoot? v] to [0]\n end\n change [#robots v] by (-1)\n end\n end\nend\n\nforever\n switch costume to (r5 v)\nend\n\nwhen flag clicked\nforever\n\nwhen I receive [boss1 v]\ngo [backward v] (1) layers\n\ndefine Load\n\nforever\n\nif <[] = [1]> then\n if <(E) = [1]> then\n if <(E) = [2]> then\n wait (2) seconds\n wait (2) seconds\n end\n if <(E) = [3]> then\n show\n broadcast (eshoot v) and wait\n end\n if <(E) = [4]> then\nelse\n hide\nend\n\nshow\n\nwait (1) seconds\n\nwhen flag clicked\nLoad\n\nwhen [a v] key pressed\n\nwhen I receive [b1 defeat v]\nwait (1) seconds\nLvl ([costume # v] of [ground v])\n\ndefine Robot Type (r) How Many (#) x (x) y (y)\nif <(r) = [0]> then\n hide\n set [eshoot? v] to [0]\n set [#robots v] to (#)\n set [e v] to [0]\nend\nif <(r) = [1]> then\n switch costume to (r1 v)\n set size to (100) %\n show\n go to [front v] layer\n go to x: (x) y: (y)\n set [eshoot? v] to [1]\n set [#robots v] to (#)\n set [e v] to [1]\n Health [5]\nend\nif <(r) = [2]> then\n set [e v] to [0]\n set [eshoot? v] to [0]\n set [#robots v] to (#)\n set size to (100) %\n show\n clear graphic effects\n switch costume to (r2 v)\n go to x: (x) y: (y)\n create clone of (_myself_ v)\n hide\nend\nif <(r) = [3]> then\n set [e v] to [2]\n set [#robots v] to (#)\n set [eshoot? v] to [1]\n go to x: (x) y: (y)\n set size to (100) %\n show\n switch costume to (r3 v)\n Health [5]\nend\nif <(r) = [4]> then\n set [#robots v] to (#)\n set [eshoot? v] to [1]\n set [e v] to [3]\n clear graphic effects\n switch costume to (r4 v)\n set size to (200) %\n go to x: (x) y: (y)\n broadcast (Shoot Cycle v)\n Drone\nend\nif <(r) = [5]> then\n set [eshoot? v] to [1]\n set [#robots v] to (#)\n set [e v] to [4]\n set size to (100) %\n switch costume to (r5s v)\n show\n go to [front v] layer\n go to x: (x) y: (y)\n Health [10]\nend\nif <(r) = [6]> then\n set [eshoot? v] to [1]\n set [#robots v] to (#)\n set [e v] to [5]\n set size to (100) %\n switch costume to (r6 v)\n show\n go to [front v] layer\n go to x: (x) y: (y)\n Health [10]\nend\nif <(r) = [7]> then\n set [eshoot? v] to [1]\n set [#robots v] to (#)\n set [e v] to [6]\n set size to (100) %\n switch costume to (r7 v)\n show\n go to [front v] layer\n go to x: (x) y: (y)\n Health [10]\nend\n\nwhen I receive [next lvl v]\nset [rsheild v] to [0]\n\nwhen I receive [b1 defeat v]\nwait (4) seconds\nRobot Type [5] How Many [1] x [150] y [35]\n\n@Sprite5\n\nwhen flag clicked\n\nwhen I receive [gamestart v]\nwait (1) seconds\nforever\n if <<key (space v) pressed?> and <(TGround) = [1]>> then\n Shoot\n end\nend\n\ndefine Shoot\nshow\ngo to (player v)\nif <([direction v] of [player v]) = [90]> then\n repeat until < or <touching (_edge_ v)?>>\n point in direction (90)\n switch costume to (costume2 v)\n show\n change x by (30)\n go to [front v] layer\n end\n if <touching (sprite3 v)?> then\n switch costume to (costume3 v)\n create clone of (_myself_ v)\n end\n go to (player v)\n hide\nelse\n repeat until < or <touching (_edge_ v)?>>\n point in direction (90)\n switch costume to (costume2 v)\n show\n change x by (-30)\n go to [front v] layer\n end\n if <touching (sprite3 v)?> then\n switch costume to (costume3 v)\n create clone of (_myself_ v)\n point in direction (pick random (0) to (360))\n end\n go to (player v)\n hide\nend\n\nhide\n\ngo to [front v] layer\n\nwhen I receive [boss1 v]\ngo [backward v] (1) layers\n\nwhen I start as a clone\npoint in direction (pick random (0) to (360))\nwait (0.2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\ndelete this clone\n\n@Sprite9\n\nwhen I receive [eshoot v]\ngo to (sprite3 v)\nif <(Eshoot?) = [1 ]> then\n if <(E) = [1]> then\n set size to (100) %\n go to (sprite3 v)\n switch costume to (shoot v)\n show\n repeat until <<<touching (_edge_ v)?> or <touching (sprite6 v)?>> or <touching (sprite11 v)?>>\n go to [front v] layer\n change x by (-20)\n end\n wait (0.1) seconds\n hide\n end\n if <(E) = [2]> then\n set [del lazer v] to [0]\n clear graphic effects\n set size to (100) %\n go to x: ([x position v] of [sprite3 v]) y: (([y position v] of [sprite3 v]) + (4))\n show\n switch costume to (shoot2 v)\n show\n create clone of (_myself_ v)\n show\n repeat until <<touching (_edge_ v)?> or <touching (sprite11 v)?>>\n change x by (-35)\n show\n create clone of (_myself_ v)\n end\n wait (2) seconds\n set [del lazer v] to [1]\n hide\n wait (4) seconds\n end\n if <(E) = [3]> then\n go to (sprite3 v)\n show\n set size to (100) %\n switch costume to (shoot3 v)\n show\n repeat until <touching color (#000000)?>\n change y by (-9)\n end\n end\n if <(E) = [4]> then\n clear graphic effects\n set size to (100) %\n go to (sprite3 v)\n show\n switch costume to (shoot4 v)\n show\n repeat until <<touching (_edge_ v)?> or <touching (sprite11 v)?>>\n change x by (-9)\n change size by (10)\n change [ghost v] effect by (2)\n end\n wait (0.1) seconds\n hide\n end\n if <(E) = [5]> then\n set [del lazer v] to [0]\n clear graphic effects\n set size to (100) %\n go to x: ([x position v] of [sprite3 v]) y: (([y position v] of [sprite3 v]) + (4))\n show\n switch costume to (shoot5a v)\n show\n create clone of (_myself_ v)\n show\n repeat until <<touching (_edge_ v)?> or <touching (sprite11 v)?>>\n change x by (-35)\n create clone of (_myself_ v)\n end\n wait (2) seconds\n set [del lazer v] to [1]\n hide\n wait (2) seconds\n end\n if <(E) = [6]> then\n hide\n if <(costume [number v]) = [15]> then\n set [rsheild v] to [1]\n else\n set [rsheild v] to [0]\n end\n end\nelse\n hide\nend\n\nwhen flag clicked\nhide\nforever\n if <(Eshoot?) = [0]> then\n set [ghost v] effect to (100)\n hide\n else\n set [ghost v] effect to (0)\n end\nend\n\n\n\nrepeat until <<<touching (_edge_ v)?> or <touching (player v)?>> or <touching (sprite11 v)?>>\n go to [front v] layer\n change x by (-20)\nend\nwait (0.1) seconds\nhide\n\nhide\nwait (2) seconds\n\nset size to (100) %\n\nset size to (100) %\n\nset size to (100) %\n\nset size to (100) %\n\nset size to (100) %\n\nhide\n\nchange y by (-9)\n\nhide\n\nwhen I start as a clone\nif <(costume [number v]) = [5]> then\n forever\n if <(Del Lazer) = [0]> then\n switch costume to (shoot5a v)\n wait (0.05) seconds\n switch costume to (shoot5b v)\n wait (0.05) seconds\n else\n delete this clone\n end\n end\nend\nif <(costume [number v]) = [2]> then\n forever\n if <(Del Lazer) = [0]> then\n show\n else\n delete this clone\n end\n end\nend\n\ngo to (sprite3 v)\n\ngo to (sprite3 v)\nshow\nset size to (500) %\nswitch costume to (shoot2 v)\nwait (2) seconds\nhide\nwait (2) seconds\n\n@Sprite11\n\nwhen I receive [sheild v]\nAnimation\nif <(Ground) = [1]> then\n\ndefine Animation\nswitch costume to (costume5 v)\nclear graphic effects\ngo to (sprite6 v)\nset [ghost v] effect to (100)\nrepeat (4)\n change [ghost v] effect by (-25)\nend\nswitch costume to (costume5 v)\ngo to (sprite6 v)\nshow\ncreate clone of (_myself_ v)\nhide\nrepeat (4)\n change [ghost v] effect by (25)\nend\n\nwhen I start as a clone\nswitch costume to (costume5 v)\nrepeat (4)\n next costume\nend\nwait (5) seconds\nswitch costume to (costume2 v)\nrepeat (6)\n change [brightness v] effect by (15)\n change [ghost v] effect by (10)\nend\nrepeat (4)\n change [brightness v] effect by (15)\n change [ghost v] effect by (10)\n switch costume to ((costume [number v]) - (1))\n delete this clone\nend\n\nwhen I receive [boss1 v]\ngo [backward v] (1) layers\n\nshow\n\n@Extra\n\n@Sprite12\n\nwhen I receive [grenade aim v]\nswitch costume to (aim v)\nshow\nwait (0.2) seconds\nrepeat until <mouse down?>\n go to [front v] layer\n go to (mouse-pointer v)\nend\nswitch costume to (grenade v)\nset y to (200)\nrepeat until <<touching color (#000000)?> or <touching color (#666666)?>>\n change y by (-20)\nend\nrepeat (2)\n set y to (0)\n show\n switch costume to (explosion v)\n broadcast (Cancel Sink v)\n wait (0.3) seconds\n hide\nend\n\nwhen I receive [brick aim v]\nswitch costume to (aim2 v)\nshow\nwait (0.2) seconds\nrepeat until <mouse down?>\n go to [front v] layer\n go to (mouse-pointer v)\nend\nswitch costume to (brick v)\nstamp\n\nwhen flag clicked\nerase all\nhide\n\nwhen I receive [next lvl v]\nhide\n\nwhen I receive [trampoline aim v]\nswitch costume to (aim3 v)\nshow\nwait (0.2) seconds\nrepeat until <mouse down?>\n go to [front v] layer\n go to (mouse-pointer v)\nend\nswitch costume to (trampoline v)\nstamp\n\n@Sprite7\n\nwhen flag clicked\nwait (0.1) seconds\ngo to x: (0) y: (0)\nshow\ngo to [front v] layer\nswitch costume to (costume1 v)\ngo to [front v] layer\nrepeat (4)\n wait (1) seconds\n wait until <key (space v) pressed?>\n next costume\nend\nwait (1) seconds\nwait until <key (space v) pressed?>\nhide\nbroadcast (gamestart v)\nbroadcast (gamestart v)\nbroadcast (game start v)\nstop [other scripts in sprite v]\nwait (1) seconds\nbroadcast (game start v)\n\nwhen flag clicked\nwait until <key (s v) pressed?>\nhide\nbroadcast (gamestart v)\nbroadcast (game start v)\nstop [other scripts in sprite v]\nwait (1) seconds\nbroadcast (game start v)\n\n\n\nwhen I receive [game finished v]\nset [ghost v] effect to (100)\nshow\nswitch costume to (costume6 v)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\ngo to [front v] layer\nwait (1.5) seconds\nwait until <key (space v) pressed?>\nnext costume\n\nwait (1) seconds\n\n@Sprite10\n\nwhen I start as a clone\nforever\n go to [front v] layer\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n if <(costume [number v]) = [2]> then\n if <(TGround) = [1]> then\n broadcast (grenade aim v)\n set [brightness v] effect to (-30)\n wait (7) seconds\n set [brightness v] effect to (0)\n end\n end\n if <(costume [number v]) = [3]> then\n if <(TGround) = [1]> then\n broadcast (sheild v)\n set [brightness v] effect to (-30)\n wait (7) seconds\n set [brightness v] effect to (0)\n end\n end\n if <(costume [number v]) = [4]> then\n if <(TGround) = [1]> then\n broadcast (Brick Aim v)\n set [brightness v] effect to (-30)\n wait (7) seconds\n set [brightness v] effect to (0)\n end\n end\n if <(costume [number v]) = [5]> then\n broadcast (Trampoline Aim v)\n set [brightness v] effect to (-30)\n wait (7) seconds\n set [brightness v] effect to (0)\n end\n end\nend\n\nwhen I receive [gamestart v]\n\nwhen flag clicked\nhide\nwait until <([costume # v] of [ground v]) = [3]>\nshow\ngo to x: (210) y: (152)\nswitch costume to (sheild v)\ncreate clone of (_myself_ v)\ngo to x: (160) y: (152)\nswitch costume to (grenade v)\ncreate clone of (_myself_ v)\nhide\n\nwhen flag clicked\nwait until <([costume # v] of [ground v]) = [11]>\nshow\ngo to x: (110) y: (152)\nswitch costume to (brick v)\ncreate clone of (_myself_ v)\nwait until <([costume # v] of [ground v]) = [12]>\nshow\ngo to x: (60) y: (152)\nswitch costume to (trampoline v)\ncreate clone of (_myself_ v)\nhide\n\nwhen I receive [boss1 v]\ngo [backward v] (1) layers\n\nforever\n\nwhen I start as a clone\nwait until <(Game Ended) = [1]>\ndelete this clone\n\nwhen flag clicked\nset [game ended v] to [0]\n\nwhen I receive [game finished v]\nset [game ended v] to [1]\n\n@Sprite4\n\nwhen I receive [next lvl v]\ngo to x: (0) y: (0)\ngo to [front v] layer\nshow\nclear graphic effects\nwait (0.5) seconds\nset [ghost v] effect to (0)\ngo to [front v] layer\nwait until <(#Robots) < [1]>\nrepeat (20)\n change [ghost v] effect by (5)\nend\n\nwhen flag clicked\nforever\n switch costume to ([costume # v] of [ground v])\nend\n\nwhen flag clicked\nwait (0.1) seconds\nswitch costume to ([costume # v] of [ground v])\n\n@Sprite13\n\nwhen flag clicked\nforever\n next costume\n wait (0.1) seconds\nend\n\nwhen flag clicked\nforever\n hide\n if <([costume # v] of [ground v]) = [11]> then\n show\n end\nend\n\n@Sprite2\n\nwhen flag clicked\nwait until <([costume # v] of [ground v]) = [2]>\nswitch costume to (glass v)\nhide\ngo to [front v] layer\nwait until <([costume # v] of [ground v]) = [15]>\nshow\nforever\n if <touching (sprite5 v)?> then\n go to [front v] layer\n next costume\n wait (0.3) seconds\n end\nend\n\nwhen flag clicked\nswitch costume to (glass v)\nhide\ngo to x: (-14) y: (56)\nwait until <(costume [number v]) = [6]>\nbroadcast (Boss1 v)\n\nwhen I receive [boss1 v]\nstop [other scripts in sprite v]\nhide\n\nset [#robots v] to [0]\n\nwhen flag clicked\n\n@Sprite15\n\nwhen I receive [boss1 v]\nwait (3) seconds\nshow\ngo to x: (96) y: (58)\nrepeat until <(Health) = [0]>\n set [r v] to (pick random (7) to (9))\n if <(R) = [7]> then\n switch costume to (glass6 v)\n set rotation style [left-right v]\n set [r v] to (pick random (1) to (6))\n if <(R) = [1]> then\n Animation\n go to x: (96) y: (58)\n point in direction (90)\n Animation2\n end\n if <(R) = [2]> then\n Animation\n go to x: (-96) y: (58)\n point in direction (-90)\n Animation2\n end\n if <(R) = [3]> then\n Animation\n go to x: (-169) y: (152)\n point in direction (-90)\n Animation2\n end\n if <(R) = [4]> then\n Animation\n go to x: (169) y: (152)\n point in direction (90)\n Animation2\n end\n if <(R) = [5]> then\n Animation\n go to x: (-169) y: (-97)\n point in direction (-90)\n Animation2\n end\n if <(R) = [6]> then\n Animation\n go to x: (169) y: (-97)\n point in direction (90)\n Animation2\n end\n end\n if <<(R) = [8]> or <(R) = [9]>> then\n switch costume to (glass2 v)\n broadcast (B Shoot v)\n set [r v] to [0]\n end\n wait (1.3) seconds\nend\n\ndefine Animation\nrepeat (10)\n change [brightness v] effect by (10)\n change [ghost v] effect by (10)\nend\n\nwait (1) seconds\n\ndefine Animation2\nrepeat (10)\n change [brightness v] effect by (-10)\n change [ghost v] effect by (-10)\nend\nclear graphic effects\n\nclear graphic effects\n\nwhen flag clicked\nhide\n\ndefine Health (#)\nset [health v] to (#)\nclear graphic effects\nrepeat until <(Health) = [0]>\n if <touching (sprite5 v)?> then\n clear graphic effects\n set [brightness v] effect to (0)\n repeat (5)\n change [brightness v] effect by (2)\n end\n change [health v] by (-1)\n repeat (5)\n change [brightness v] effect by (-2)\n end\n end\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\nset [brightness v] effect to (0)\nhide\nif <([costume # v] of [ground v]) = [22]> then\n broadcast (Game finished v)\nelse\n broadcast (B1 Defeat v)\nend\n\nwhen I receive [boss1 v]\nHealth [15]\n\nwhen I receive [boss2 v]\nset rotation style [left-right v]\nwait (3) seconds\nshow\npoint in direction (-90)\ngo to x: (96) y: (58)\ngo to x: (-169) y: (-97)\nrepeat until <(Health) = [0]>\n set [r v] to (pick random (7) to (9))\n if <(R) = [7]> then\n switch costume to (glass6 v)\n set rotation style [left-right v]\n set [r v] to (pick random (1) to (6))\n if <(R) = [1]> then\n Animation\n go to x: (-169) y: (-97)\n point in direction (90)\n Animation2\n end\n if <(R) = [2]> then\n Animation\n go to x: (169) y: (-97)\n point in direction (-90)\n Animation2\n end\n if <(R) = [3]> then\n Animation\n go to x: (-13) y: (127)\n point in direction (-90)\n Animation2\n end\n if <(R) = [4]> then\n Animation\n go to x: (-169) y: (-97)\n point in direction (-90)\n Animation2\n end\n if <(R) = [5]> then\n Animation\n go to x: (169) y: (-97)\n point in direction (90)\n Animation2\n end\n if <(R) = [6]> then\n Animation\n go to x: (-16) y: (-27)\n point in direction (90)\n Animation2\n end\n end\n if <<(R) = [8]> or <(R) = [9]>> then\n switch costume to (glass2 v)\n broadcast (B Shoot v)\n set [r v] to [0]\n end\n wait (1.3) seconds\nend\n\nwhen I receive [boss2 v]\nHealth [15]\n\n@Sprite16\n\nwhen I receive [b shoot v]\nif <<([costume # v] of [ground v]) = [16]> or <([costume # v] of [ground v]) = [22]>> then\n show\n go to x: (pick random (-200) to (200)) y: (0)\n if <touching (sprite15 v)?> then\n repeat until <not <touching (sprite15 v)?>>\n change x by (10)\n end\n end\n Animation\nend\n\ndefine Animation\ngo to [front v] layer\nrepeat (2)\n set [ghost v] effect to (100)\n repeat (5)\n change [ghost v] effect by (-20)\n broadcast (Cancel Sink v)\n end\n wait (1) seconds\n repeat (5)\n change [ghost v] effect by (20)\n broadcast (Cancel Sink v)\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [b1 defeat v]\nwait (1) seconds\nstop [other scripts in sprite v]\nhide\n\n\n@Sprite17\n\ndefine Animation\nswitch costume to (costume1 v)\nwait (1) seconds\nrepeat (10)\n next costume\nend\n\nchange y by (1)\n\n@Sprite18\n\nwhen flag clicked\n\ngo to (player v)\n\nwhen I receive [gamestart v]\nhide\nset [phealth v] to [1]\nwait (0.5) seconds\ngo to [front v] layer\nforever\n switch costume to (PHealth)\n go to x: (([x position v] of [player v]) - (3)) y: (([y position v] of [player v]) + (10))\n set size to (60) %\n show\nend\n\nwhen [h v] key pressed\nset [phealth v] to [1]\n\n@Sprite14\n\nwhen flag clicked\nclear graphic effects\nhide\nwait until <([costume # v] of [ground v]) = [14]>\nshow\ngo to x: (-14) y: (63)\nwait until <touching (player v)?>\nrepeat (10)\n change [brightness v] effect by (15)\n change [ghost v] effect by (10)\nend\nrepeat until <(PHealth) = [1]>\n change [phealth v] by (-1)\nend\nset [phealth v] to [1]\nhide\n\nset [phealth v] to [40]\n\n
Space Bar to Shoot\nClick the Grenade for a Grenade\nClick the Shield for a Shield\nDefeat all Robots to Finish the level \nUnlock More Power Ups along the way!\nHold "R" if you get stuck
Pastel - A Platformer
@Stage\n\nwhen I receive [homepage v]\nswitch backdrop to (start v)\n\nwhen I receive [finish v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nclear graphic effects\nswitch backdrop to (the end v)\nwait (2) seconds\nbroadcast (end v)\n\nwhen I receive [end v]\nswitch backdrop to (thanks v)\n\nwhen flag clicked\nswitch backdrop to (logo v)\n\nwhen I receive [start v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext backdrop\nclear graphic effects\n\n@Sprite1\n\nwhen I receive [start v]\ngo to x: (-208) y: (0)\nplaform\n\ndefine plaform\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n switch costume to (right v)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n switch costume to (left v)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#cccccc)?> then\n change y by (1)\n if <touching color (#cccccc)?> then\n change y by (1)\n if <touching color (#cccccc)?> then\n change y by (1)\n if <touching color (#cccccc)?> then\n change y by (1)\n if <touching color (#cccccc)?> then\n change x by ((Xv) * (-1))\n change y by (-4)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#cccccc)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#cccccc)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [15]\n end\n end\n change y by (1)\nend\n\nif <touching color (#dddede)?> then\n broadcast (reset v)\nend\n\nwhen I receive [reset v]\ngo to x: (-208) y: (0)\n\nwhen flag clicked\nhide\nforever\n if <touching color (#ffcccc)?> then\n broadcast (reset v)\n end\n if <touching color (#e0ffb8)?> then\n broadcast (next level v)\n broadcast (start v)\n end\n if <touching color (#ffe9cc)?> then\n broadcast (finish v)\n end\nend\n\nwhen [r v] key pressed\nbroadcast (reset v)\n\nwhen I receive [finish v]\nswitch costume to (right v)\nshow\ngo to x: (-201) y: (-133)\nglide (2) secs to x: (186) y: (-133)\nhide\n\n@Sprite2\n\nwhen I receive [homepage v]\nshow\ngo to x: (-14) y: (-60)\nforever\n next costume\n wait (0.5) seconds\nend\n\nwhen this sprite clicked\nbroadcast (Start v)\nglide (0.25) secs to x: (-14) y: (-180)\nhide\n\nwhen flag clicked\nhide\n\n@Music\n\nwhen I receive [homepage v]\nforever\n play sound [“New In Town” \(Pet Simulator a Roblox Original Soundtrack\) by BSlick.mp3 v] until done\nend\n\n@Star\n\nwhen I receive [end v]\nswitch costume to (star v)\nshow\nset [ghost v] effect to (100)\ngo to x: (-52) y: (135)\nrepeat (20)\n wait (0.05) seconds\n change [ghost v] effect by (-5)\nend\nswitch costume to (star1 v)\nplay sound [pop v] until done\n\nwhen flag clicked\nhide\n\n@heart\n\nwhen I receive [end v]\nswitch costume to (heart v)\nshow\nset [ghost v] effect to (100)\ngo to x: (49) y: (131)\nrepeat (20)\n wait (0.05) seconds\n change [ghost v] effect by (-5)\nend\nwait (1) seconds\nswitch costume to (heart1 v)\nplay sound [pop v] until done\n\nwhen flag clicked\nhide\n\n@arrow\n\nwhen flag clicked\nhide\ngo to x: (207) y: (-158)\n\nwhen I receive [end v]\nshow\nglide (1.6) secs to x: (-52) y: (135)\nset size to (80) %\nwait (0.1) seconds\nset size to (100) %\nglide (0.9) secs to x: (49) y: (131)\nset size to (80) %\nwait (0.1) seconds\nset size to (100) %\nglide (0.5) secs to x: (173) y: (146)\n\n@comment\n\nwhen I receive [end v]\nswitch costume to (comment v)\nshow\nset [ghost v] effect to (100)\ngo to x: (-5) y: (-87)\nrepeat (20)\n wait (0.05) seconds\n change [ghost v] effect by (-5)\nend\nforever\n switch costume to (comment v)\n wait (0.5) seconds\n switch costume to (comment2 v)\n wait (0.5) seconds\nend\n\nwhen flag clicked\nhide\n\n@Sprite4\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen [t v] key pressed\nif <(username) = [_Oxymoron_]> then\n show\nend\n\n@Sprite3\n\nwhen flag clicked\nclear graphic effects\nswitch costume to (costume1 v)\nhide\n\nwhen flag clicked\nplay sound [Brick Bronze OST Route 16 by BSlick v] until done\n\nwhen [space v] key pressed\nif <(username) = [_Oxymoron_]> then\n hide\nend\n\nwhen flag clicked\nset size to (70) %\nshow\ngo to x: (400) y: (-11)\nglide (1) secs to x: (206) y: (-11)\nrepeat (10)\n wait (0.05) seconds\n next costume\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\nbroadcast (name v)\n\nwhen flag clicked\nwait (1) seconds\nplay sound [Super Smash Bros 64 v] until done\n\n@Sprite5\n\nwhen flag clicked\nclear graphic effects\nset [ghost v] effect to (100)\n\nwhen I receive [name v]\nwait (1) seconds\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (3) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nbroadcast (homepage v)\n\n@Sprite6\n\nwhen flag clicked\nhide\nswitch costume to (costume1 v)\nclear graphic effects\nset [ghost v] effect to (100)\n\nwhen I receive [name v]\nshow\ngo to [front v] layer\ngo to x: (-115) y: (-6)\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nrepeat (6)\n next costume\nend\nwait (0.5) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\n@Sprite7\n\nwhen I receive [name v]\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (4) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwhen flag clicked\nswitch costume to (costume1 v)\nclear graphic effects\nset [ghost v] effect to (100)\n\n
Pastel - A Platformer\nIF YOU GET STUCK, PRESS 'R'\n=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=\nAll made my me, _Oxymoron_.\nThis is so old. Enjoy the cringe project my younger self made. \n\nUse the arrow keys to move and jump. Press r to reset yourself on the level.\n\nGREEN gets you to the next level.\nRED kills you (don't worry, you have unlimited lives XD).\n\nHave fun!\n\nREMEMBER TO FAVOURITE, LOVE AND COMMENT :D\n\n=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=\nUpdate Log:\n21/12/18 - shared project\n16/01/19 - fixed some bugs\n17/01/19 - added level 11, because we hit 10 favourites! Yay!\n18/01/19 - 20 FAVES! WHOOO! Level 12 done.\n24/01/2019 - Level 13 done.\n19/02/2019 - Level 14\n21/02/2019 - added new intro\n =+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=+=\n
UNDERWORLD / Atari-Style Platformer / LukeManiaStudios
@Stage\n\nwhen flag clicked\nforever\n Code_C\nend\n\nwhen I receive [music_update v]\nforever\n Code_K\nend\n\nwhen I receive [menu_ready v]\nwait (1) seconds\nplay sound [1 v] until done\nbroadcast (music_update v)\nforever\n Code_D\nend\n\ndefine Code_C\nif <<(Set_Show) = [0]> and <<(Music_Enable) = [1]> and <(Pause) = [0]>>> then\n set volume to (100) %\nelse\n set volume to (0) %\nend\nif <(TPG) = [1]> then\n switch backdrop to (backdrop2 v)\nelse\n switch backdrop to (backdrop1 v)\nend\n\ndefine Code_D\nif <(Level) = [15]> then\n set volume to (100) %\n repeat (10)\n change volume by (-10)\n wait (0.03) seconds\n end\n stop all sounds\n play sound [Sonic Mania OST - Mini Boss Theme v] until done\n broadcast (music_update v)\nend\n\ndefine Code_K\nif <not <(Level) = [15]>> then\n stop all sounds\n play sound [2 v] until done\n stop all sounds\n broadcast (music_update v)\nend\n\nrepeat (50)\n\nstop all sounds\n\nrepeat (10)\n\nstop all sounds\nset [pitch v] effect to (-50)\nplay sound [Marble Zone Intro v] until done\nplay sound [Marble Zone LOOP2 v] until done\n\nchange [pitch v] effect by (-2)\nwait (0.1) seconds\n\nset [pitch v] effect to (0)\nstart sound [Marble Zone LOOP v]\n\nstop all sounds\n\nplay sound [chemical plant2 v] until done\nforever\n play sound [chemical plant3 v] until done\nend\n\n@Dave\n\nset [level v] to [22]\n\nwhen flag clicked\nhide\nset [walk v] to [2]\nforever\n change [walk v] by (1)\n if <(Walk) > [3]> then\n set [walk v] to [2]\n end\n wait (0.01) seconds\nend\n\nCode_A\n\nset [level v] to [24]\n\ngo to x: (-109) y: (180)\n\nif <(Level) = [15]> then\n go to x: (0) y: (-9)\nelse\n go to x: (-189) y: (-4)\nend\n\ndefine platform\nshow\nswitch costume to (hitbox v)\nif <(Moving_Platform) = [0]> then\n if <key (d v) pressed?> then\n point in direction (90)\n change [x v] by (2)\n end\n if <key (a v) pressed?> then\n point in direction (-90)\n change [x v] by (-2)\n end\nend\nchange x by (x)\nif <<touching (level v)?> or <touching (dorr v)?>> then\n change x by ((x) * (-1))\n set [x v] to [0]\nelse\n set [x v] to ((x) * (0.8))\nend\nchange y by (y)\nif <<touching (level v)?> or <touching (dorr v)?>> then\n set [jump v] to [0]\n change y by ((y) * (-1))\n set [y v] to [0]\n if <(lock) = [0]> then\n if <key (w v) pressed?> then\n if <(TPG) = [0]> then\n set [jump v] to [1]\n start sound [PlayerJump v]\n set [y v] to [15]\n set [lock v] to [1]\n else\n set [jump v] to [1]\n start sound [PlayerJump v]\n set [y v] to [15]\n set [lock v] to [1]\n end\n end\n end\nelse\n change [y v] by (-1)\n set [lock v] to [0]\nend\nif <<touching (lava v)?> or <<touching (sprite9 v)?> and <touching color (#cc0000)?>>> then\n set [burned v] to [1]\n switch costume to (burned v)\n play sound [Flameout v] until done\n change [health v] by (-1)\n if <(Level) = [21]> then\n go to x: (-193) y: (24)\n else\n if <(Level) = [23]> then\n go to x: (-193) y: (43)\n else\n if <(Level) = [25]> then\n go to x: (-109) y: (180)\n else\n if <(Level) = [26]> then\n go to x: (-211) y: (-98)\n else\n if <(Level) = [25]> then\n go to x: (0) y: (-9)\n else\n if <(Level) = [16]> then\n go to x: (0) y: (-30)\n else\n if <(Level) = [15]> then\n go to x: (0) y: (0)\n else\n go to x: (-189) y: (-4)\n end\n end\n end\n end\n end\n end\n end\n switch costume to (idle v)\n set [burned v] to [0]\nend\nif <(Level) = [24]> then\n if <<[-180] > (y position)> and <not <(Boss-Lock) = [active]>>> then\n change [level v] by (1)\n if <<<(Level) = [13]> or <(Level) = [14]>> or <(Level) = [17]>> then\n go to x: (-189) y: (-90)\n else\n if <(Level) = [21]> then\n go to x: (-193) y: (24)\n else\n if <(Level) = [23]> then\n go to x: (-193) y: (43)\n else\n if <(Level) = [25]> then\n go to x: (-109) y: (180)\n else\n if <(Level) = [26]> then\n go to x: (-211) y: (-98)\n else\n if <(Level) = [15]> then\n go to x: (0) y: (-9)\n else\n if <(Level) = [15]> then\n go to x: (0) y: (0)\n else\n go to x: (-189) y: (-4)\n end\n end\n end\n end\n end\n end\n end\n end\nelse\n if <<(x position) > [216]> and <not <(Boss-Lock) = [active]>>> then\n change [level v] by (1)\n if <<<(Level) = [13]> or <(Level) = [14]>> or <<(Level) = [16]> or <(Level) = [17]>>> then\n go to x: (-189) y: (-90)\n else\n if <(Level) = [21]> then\n go to x: (-193) y: (24)\n else\n if <(Level) = [23]> then\n go to x: (-193) y: (43)\n else\n if <(Level) = [25]> then\n go to x: (-109) y: (180)\n else\n if <(Level) = [26]> then\n go to x: (-211) y: (-98)\n else\n if <(Level) = [15]> then\n go to x: (0) y: (-9)\n else\n go to x: (-189) y: (-4)\n end\n end\n end\n end\n end\n end\n end\nend\nif <(y) > [2]> then\n if <(TPG) = [0]> then\n set [walk v] to [4]\n end\n if <(TPG) = [1]> then\n set [walk v] to [4]\n end\nend\nif <[-4] > (y)> then\n if <(TPG) = [0]> then\n set [walk v] to [10]\n end\n if <(TPG) = [1]> then\n set [walk v] to [10]\n end\nend\nswitch costume to (idle v)\nif <<key (a v) pressed?> or <key (d v) pressed?>> then\n switch costume to (Walk)\nend\n\nwhen I receive [message1 v]\nshow\nset [moving_platform v] to [0]\nset [level v] to [1]\nforever\n Code_A\nend\n\nwhen I start as a clone\ngo to (random position v)\ncreate clone of (_myself_ v)\ndelete this clone\n\nwhen I receive [message1 v]\ngo to x: (-189) y: (-4)\nset size to (350) %\nforever\n Code_B\nend\n\ndefine Code_A\nplatform\nif <(Level) = [15]> then\n set size to (550) %\nelse\n set size to (350) %\nend\n\nif <<(Set_Show) = [0]> and <(Pause) = [0]>> then\nset [pan left/right v] effect to (x position)\n\ndefine Code_B\nif <key (f v) pressed?> then\n set [pause v] to [1]\n wait until <not <key (f v) pressed?>>\n wait until <key (f v) pressed?>\n set [pause v] to [0]\n wait until <not <key (f v) pressed?>>\nend\n\n@Lava\n\nCode_A\n\nwhen flag clicked\nset [level v] to [0]\nshow\nforever\n Code_F\nend\n\nhide\n\nif <not <touching (anti-cheat v)?>> then\n set [error v] to [code interference]\nend\n\nwhen flag clicked\nforever\n Code_E\nend\n\ndefine Code_E\n\ndefine Code_F\nnext costume\ngo [backward v] (100) layers\nif <<<(Level) = [13]> or <(Level) = [14]>> or <<(Level) = [16]> or <<(Level) = [17]> or <(Level) = [26]>>>> then\n go to x: (0) y: (-40)\nelse\n go to x: (0) y: (-5)\nend\nif <(Level) = [24]> then\n hide\nelse\n show\nend\n\n\n go to x: (0) y: (-40)\nelse\n go to x: (0) y: (-5)\nend\n\nset [level v] to [26]\n\n@Level\n\nwhen flag clicked\ngo to x: (2) y: (6)\n\nwhen flag clicked\nhide\n\nwhen I receive [message1 v]\nshow\nforever\n switch costume to (Level)\nend\n\nCode_G\n\nset [level v] to [15]\n\ndefine Code_G\n\nif <<not <(x position) = [2]>> or <not <(y position) = [6]>>> then\n set [error v] to [code interference]\nend\n\n\nwhen flag clicked\nswitch costume to (level1 v)\nforever\n if <(costume [number v]) = [15]> then\n broadcast (Start_Boss-1 v)\n stop [this script v]\n end\nend\n\nwhen I receive [enable_music v]\nstop all sounds\nset volume to (100) %\n\n@Thumbnail\n\nwhen flag clicked\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nwait (0.1) seconds\ngo to [front v] layer\n\n@Menu\n\nwhen flag clicked\nhide\n\nwhen I receive [menu_ready v]\nCode_H\n\ndefine Code_H\nwait (1) seconds\nset [tpg v] to [0]\nshow\nrepeat until <key (space v) pressed?>\n if <<<key (t v) pressed?> and <<key (p v) pressed?> and <key (g v) pressed?>>> and <(TPG) = [0]>> then\n start sound [Life chest sound v]\n set [tpg v] to [1]\n end\nend\nstart sound [Notice1 v]\nhide\nbroadcast (message1 v)\nstop [this script v]\n\n@Interference\n\nwhen flag clicked\ngo to [front v] layer\nset [ghost v] effect to (94)\ngo to x: (0) y: (0)\n\n@Sprite3\n\nwhen flag clicked\nhide\nset [level v] to [1]\nset [crystals v] to [0]\nset [set_show v] to [0]\nforever\n Code_I\nend\n\ndefine Code_I\nif <<<(Level) = [10]> and <(Crystals) = [0]>> or <<(Level) = [20]> and <(Crystals) = [1]>>> then\n show\n go to x: (8) y: (24)\n if <touching (dave v)?> then\n hide\n change [crystals v] by (1)\n set [set_show v] to [1]\n start sound [MenuPopup1 v]\n wait until <(Set_Show) = [0]>\n end\nend\nif <(TPG) = [1]> then\n switch costume to (tpg v)\nelse\n switch costume to (costume1 v)\nend\n\n@Sprite4\n\nwhen flag clicked\nhide\nforever\n Code_J\nend\n\ndefine Code_J\nif <(TPG) = [1]> then\n switch costume to ((Crystals) + (5))\nelse\n switch costume to (Crystals)\nend\nif <(Set_Show) = [1]> then\n go to [front v] layer\n show\n wait until <key (space v) pressed?>\n start sound [Notice1 v]\n set [set_show v] to [0]\n hide\nend\n\n@Dave2\n\nset size to (100) %\n\n@Sprite5\n\nchange [pixelate v] effect by (-25)\n\nwhen I receive [menu_ready v]\nwait (1) seconds\nhide\n\nwhen flag clicked\nshow\n\n@Sprite6\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\nset [ghost v] effect to (100)\nwait (1) seconds\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nswitch costume to (costume2 v)\nset [pan left/right v] effect to (-200)\nplay sound [cbmx2 v] until done\nwait (0.1) seconds\nswitch costume to (costume6 v)\nset [pan left/right v] effect to (0)\nplay sound [cbmxSPACE v] until done\nwait (0.1) seconds\nswitch costume to (costume7 v)\nset [pan left/right v] effect to (200)\nplay sound [cbmx3 v] until done\nwait (0.3) seconds\nbroadcast (Star v)\n\nwhen I receive [menu_ready v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite7\n\nwhen flag clicked\npoint in direction (90)\nset rotation style [all around v]\nhide\ngo to x: (235) y: (179)\ngo to [front v] layer\n\nwhen I receive [star v]\nshow\nstart sound [gem collect v]\nglide (1) secs to x: (123) y: (33)\nstop all sounds\nstart sound [Notice1 v]\npoint in direction (0)\nrepeat until <touching (_edge_ v)?>\n move (10) steps\n turn right (6) degrees\nend\nhide\nbroadcast (Presents v)\n\nwhen I receive [star v]\nset [pan left/right v] effect to (100)\nwait (0.05) seconds\nrepeat (10)\n change [pan left/right v] effect by (-3)\nend\n\nwhen I receive [star v]\nwait (1) seconds\nrepeat (10)\n change [pan left/right v] effect by (7)\nend\n\n@Sprite8\n\nwhen I receive [presents v]\nset [ghost v] effect to (100)\nwait (1) seconds\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (1) seconds\nbroadcast (Menu_Ready v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen flag clicked\nhide\n\n@Sprite9\n\ndefine Go to opening (number_of_opening)\ngo to [front v] layer\nshow\nif <(number_of_opening) = [1]> then\n show\n set y to (356)\n set x to (-153)\n glide (0.4) secs to x: (-153) y: (0)\n change x by (-3)\n repeat (10)\n change x by (6)\n wait (0.05) seconds\n change x by (-6)\n wait (0.05) seconds\n end\n change x by (3)\n glide (0.4) secs to x: (-153) y: (-696)\n hide\nend\nif <(number_of_opening) = [2]> then\n show\n set y to (356)\n set x to (9)\n glide (0.4) secs to x: (9) y: (0)\n change x by (-3)\n repeat (10)\n change x by (6)\n wait (0.05) seconds\n change x by (-6)\n wait (0.05) seconds\n end\n change x by (3)\n glide (0.4) secs to x: (9) y: (-696)\n hide\nend\nif <(number_of_opening) = [3]> then\n show\n set y to (356)\n set x to (169)\n glide (0.4) secs to x: (169) y: (0)\n change x by (-3)\n repeat (10)\n change x by (6)\n wait (0.05) seconds\n change x by (-6)\n wait (0.05) seconds\n end\n change x by (3)\n glide (0.4) secs to x: (169) y: (-696)\n hide\nend\ndelete this clone\n\nwhen I start as a clone\nif <(State) = [spawn]> then\n Droplet_Generate-at- (pick random (1) to (3))\nend\nif <(State) = [droplets]> then\n show\n repeat (10)\n change y by (-1)\n end\n repeat (10)\n change y by (-15)\n end\n delete this clone\nend\n\nwhen [space v] key pressed\n\nwait until <not <key (space v) pressed?>>\n\ndefine Droplet_Generate-at- (generate)\nset [state v] to [droplets]\nhide\nrepeat (5)\n if <(generate) = [1]> then\n go to x: (-204) y: (176)\n end\n if <(generate) = [2]> then\n go to x: (-41) y: (176)\n end\n if <(generate) = [3]> then\n go to x: (119) y: (176)\n end\n repeat (10)\n change x by (9.4)\n if <(pick random (1) to (5)) = [1]> then\n create clone of (_myself_ v)\n end\n end\n repeat (10)\n change x by (-9.4)\n if <(pick random (1) to (5)) = [2]> then\n create clone of (_myself_ v)\n end\n end\nend\nswitch costume to (costume1 v)\nGo to opening (generate)\n\nwhen I start as a clone\n\nhide\n\ncreate clone of (_myself_ v)\n\nwhen I receive [start_boss-1 v]\nset [boss-lock v] to [active]\nrepeat (10)\n switch costume to (costume2 v)\n set [state v] to [spawn]\n create clone of (_myself_ v)\n wait (0.03) seconds\n set [state v] to [spawn]\n create clone of (_myself_ v)\n wait (7) seconds\nend\nset [boss-lock v] to [inactive]\nbroadcast (End_Boss-1 v)\n\nwhen backdrop switches to [backdrop1 v]\n\nwhen flag clicked\nset [boss-lock v] to [inactive]\n\n@Sprite10\n\ndefine Main_Code\n\nif <(Level) = [16]> then\n if <touching (dave v)?> then\n set [ghost v] effect to (50)\n else\n set [ghost v] effect to (0)\n end\nelse\nend\n\nwhen flag clicked\nforever\n go to x: (214) y: (117)\n set [ghost v] effect to (100)\nend\n\nMain_Code\n\nMain_Code\n\n@Dorr\n\nwhen flag clicked\nset [music_enable v] to [1]\nhide\n\nwhen I receive [start_boss-1 v]\nswitch costume to (costume1 v)\ngo to x: (245) y: (7)\nshow\n\nwhen I receive [end_boss-1 v]\nset [music_enable v] to [0]\nswitch costume to (costume1 v)\nstart sound [DragonRumble1 v]\nrepeat (10)\n change x by (-5)\n wait (0.01) seconds\n change x by (5)\n wait (0.01) seconds\nend\nstop all sounds\nstart sound [DragonBreakout v]\nrepeat (5)\n next costume\n wait (0.05) seconds\nend\nwait (0.05) seconds\nhide\nbroadcast (Enable_Music v)\nset [music_enable v] to [1]\n\n
==============[INFORMATION]==============\nUNDERWORLD / Atari game /LukeManiaStudios\n\n3.0 Edition / v1.0 \n================[CONTROLS]=============== \n [W]\n [A] [S] [D] - To Move\n\n[F] - To pause\n\n[SPACE] - To "accept" or "continue"\n===============[EXTRA BITS]===============\nI made this as a bit of a side project, and i think it turned out quite well! I was inspired by the Atari-2600 and it's style, so i made an entire game with that in mind!\n\nBy the way, it took me 2 years to finally pick up the project again. I released the Demo in June of 2018 and never got any further (the date's different because of a massive clean-up)\n\nPlease ❤️ and ⭐
HitBox - Scrolling Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [setup boss v]\nswitch backdrop to (backdrop2 v)\n\nwhen I receive [bosswin v]\nswitch backdrop to (backdrop3 v)\n\n@Player\n\ndefine In\nhide\nclear graphic effects\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nclear graphic effects\nshow\n\ndefine Out\nshow\nclear graphic effects\nshow\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\nclear graphic effects\n\nwhen flag clicked\n\nwhen I receive [deleteallclones v]\ndelete this clone\n\nwhen I receive [setup v]\npoint in direction (90)\ngo to x: (0) y: (0)\nset size to (30) %\nclear graphic effects\nswitch costume to (hitbox v)\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nset [invincible v] to [false]\nset [contactattack? v] to [false]\nset [prevcostume v] to [0]\nset [bossdead? v] to [false]\nset [scrollx v] to [0]\nset [walk v] to [0]\n\nwhen I receive [playerloop v]\nforever\n Platform Engine [1.7] [10] [-1] [0.77]\n if <key (h v) pressed?> then\n wait until <key (i v) pressed?>\n wait until <key (t v) pressed?>\n wait until <key (b v) pressed?>\n wait until <key (o v) pressed?>\n wait until <key (x v) pressed?>\n wait until <not <key (any v) pressed?>>\n switch costume to (join [Hit] [BoxArt])\n wait until <key (any v) pressed?>\n end\n if <(BossDead?) = [true]> then\n stop [other scripts in sprite v]\n stop [this script v]\n end\nend\n\ndefine Platform Engine (speed) (jumpheight) (gravity) (friction)\nswitch costume to (hitbox v)\nif <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n if <(XV) < [0]> then\n set [xv v] to [0.1]\n end\n change [xv v] by (speed)\n point in direction (90)\nend\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n if <[0] < (XV)> then\n set [xv v] to [-0.1]\n end\n change [xv v] by ((speed) * (-1))\n point in direction (-90)\nend\nset [xv v] to ((XV) * (friction))\nchange x by (XV)\nif <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n set [slope v] to [0]\n repeat until <<<not <touching (level hitbox v)?>> and <not <touching (boss hitbox v)?>>> or <(Slope) = [8]>>\n change [slope v] by (1)\n change y by (1)\n end\n if <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n change y by ((Slope) * (-1))\n repeat ([ceiling v] of ([abs v] of (XV) ) )\n if <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n change x by ((([abs v] of (XV) ) / (XV)) * (-1))\n end\n end\n set [xv v] to [0]\n end\nend\nchange y by (YV)\nif <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n repeat ([ceiling v] of ([abs v] of (YV) ) )\n if <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n change y by ((([abs v] of (YV) ) / (YV)) * (-1))\n end\n end\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> or <key (space v) pressed?>> then\n TouchingFloor?\n if <(TouchingFloor?) = [true]> then\n start sound [Jump Sound Effect v]\n set [yv v] to (jumpheight)\n else\n set [yv v] to [0]\n end\n set [touchingfloor? v] to [false]\n else\n set [yv v] to [0]\n end\nelse\n change [yv v] by (gravity)\nend\nchange [scrollx v] by (x position)\nset x to (0)\nif <(y position) < [-157]> then\n if <(ScrollX) > [7400]> then\n broadcast (StopMusic v)\n start sound [Zoop v]\n broadcast (Fall Down CutScene v)\n stop [this script v]\n else\n Go To CheckPoint\n end\nend\nif <touching (attack v)?> then\n set [contactattack? v] to [true]\nend\nSet Costume\n\ndefine TouchingFloor?\nset [touchingfloor? v] to [false]\nset [prevcostume v] to (costume [number v])\nchange y by (-3)\nswitch costume to (floorhitbox v)\nset [touchingfloor? v] to <<touching (level hitbox v)?> or <touching (boss hitbox v)?>>\nchange y by (3)\nswitch costume to (PrevCostume)\n\ndefine Set Costume\nTouchingFloor?\nif <(TouchingFloor?) = [true]> then\n if <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n switch costume to (join [W] (((Walk) mod (1)) + (1)))\n else\n switch costume to (join [W] [1])\n end\nelse\n if <(YV) > [0]> then\n switch costume to (join [J] [1])\n else\n switch costume to (join [F] [1])\n end\nend\n\ndefine Go To CheckPoint\nif <(ScrollX) < [1605]> then\n Reset At [0] [0]\nelse\n if <<(ScrollX) > [1605]> and <(ScrollX) < [3500]>> then\n Reset At [1605] [0]\n else\n if <<(ScrollX) > [3500]> and <(ScrollX) < [5490]>> then\n Reset At [3500] [0]\n else\n if <<(ScrollX) > [5490]> and <(ScrollX) < [6605]>> then\n Reset At [5490] [0]\n else\n Reset At [6605] [0]\n end\n end\n end\nend\n\ndefine Reset At (scrollx) (y)\nset [scrollx v] to (scrollx)\nset [xv v] to [0]\nset [yv v] to [0]\npoint in direction (90)\nset y to (y)\nswitch costume to (f1 v)\n\nwhen I receive [fall down cutscene v]\npoint in direction (90)\nstop [other scripts in sprite v]\nswitch costume to (f1 v)\nrepeat until <(y position) < [-179]>\n change x by (XV)\n change y by (YV)\nend\nhide\ngo to x: (0) y: (0)\nwait (1) seconds\nbroadcast (Transition In v) and wait\nhide\nwait (1) seconds\nbroadcast (DeleteAllClones v) and wait\nbroadcast (SetUp Boss v) and wait\nbroadcast (BossLevelLoop v)\nwait (1) seconds\nbroadcast (Transition Out v) and wait\nbroadcast (Continue v) and wait\nbroadcast (PlayerLoop v)\nset [invincible v] to [false]\n\nset [touchingfloor? v] to [false]\nset [prevcostume v] to (costume [number v])\nchange y by (-3)\nswitch costume to (floorhitbox v)\nset [touchingfloor? v] to <touching (level hitbox v)?>\nchange y by (3)\nswitch costume to (PrevCostume)\n\nchange y by (10)\n\nwhen I receive [continue v]\nhide\nset y to (180)\npoint in direction (90)\nwait (1) seconds\nswitch costume to (f1 v)\nshow\nrepeat until <(y position) < [-50]>\n change [yv v] by (-1)\n change y by (YV)\nend\nswitch costume to (w1 v)\nset [yv v] to [0]\nset [xv v] to [0]\nset y to (-60)\nwait (1) seconds\nbroadcast (alert v)\nrepeat until <(ScrollX) > [580]>\n change [scrollx v] by (XV)\n change [xv v] by (0.2)\n set x to ((0) - (ScrollX))\n if <([abs v] of ((0) - (ScrollX)) ) > [240]> then\n hide\n else\n show\n end\nend\nstart sound [Music_Kzx-Stalemate.mp3 v]\nwait (2) seconds\nbroadcast (Boss Dialogue v) and wait\nwait (0.75) seconds\nbroadcast (BossJump v) and wait\nset [yv v] to [0]\nset [xv v] to [0]\nrepeat until <[0] > (ScrollX)>\n change [scrollx v] by (XV)\n change [xv v] by (-0.2)\n set x to ((0) - (ScrollX))\n if <([abs v] of ((0) - (ScrollX)) ) > [240]> then\n hide\n else\n show\n end\nend\nset [scrollx v] to [0]\nset [yv v] to [0]\nset [xv v] to [0]\nwait (1) seconds\nset [music v] to [2]\nstop all sounds\nbroadcast (BGMusic v)\nbroadcast (Trigger Boss Activity v)\n\nwhen [x v] key pressed\nset [x v] to (mouse x)\nset [y v] to (mouse y)\n\nwhen flag clicked\nhide\n\nwhen I receive [set var player v]\nset [contactattack? v] to [false]\n\nwhen I receive [playerloop v]\nwait until <(Invincible) = [false]>\nforever\n wait until <(Invincible) = [true]>\n clear graphic effects\n repeat (25)\n if <(LifeHP) > [0]> then\n set [ghost v] effect to (100)\n wait (0.0001) seconds\n set [ghost v] effect to (0)\n wait (0.0001) seconds\n else\n set [ghost v] effect to (0)\n stop [other scripts in sprite v]\n stop [this script v]\n end\n end\n clear graphic effects\n set [invincible v] to [false]\nend\n\nbroadcast (PlayBossBattle v) and wait\n\nwhen I receive [playbossbattle v]\n\nwait (1) seconds\nbroadcast (Transition In v) and wait\nhide\nwait (1) seconds\nbroadcast (DeleteAllClones v) and wait\nbroadcast (SetUp Boss v) and wait\nbroadcast (BossLevelLoop v)\nwait (1) seconds\nbroadcast (Transition Out v) and wait\nbroadcast (Continue v) and wait\nbroadcast (PlayerLoop v)\nset [invincible v] to [false]\n\nwhen I receive [playerhide v]\nhide\n\nwhen I receive [playerbounceback v]\nset [xv v] to ((([abs v] of (direction) ) / (direction)) * (-18))\nset [yv v] to [12]\n\nclear graphic effects\nrepeat (25)\n if <(LifeHP) > [0]> then\n set [ghost v] effect to (100)\n wait (0.0001) seconds\n set [ghost v] effect to (0)\n wait (0.0001) seconds\n else\n set [ghost v] effect to (0)\n stop [other scripts in sprite v]\n stop [this script v]\n end\nend\nclear graphic effects\nset [invincible v] to [false]\n\nwhen I receive [exclamation dive v]\nwait (3) seconds\nswitch costume to (cutscene1 v)\nrepeat (8)\n next costume\n wait (0.03) seconds\nend\nwait (2) seconds\nOut\nnext costume\nIn\nwait (3) seconds\nbroadcast (Transition In v) and wait\nbroadcast (bossWIN v) and wait\nbroadcast (DeleteAllClones v) and wait\nhide\nbroadcast (Transition Out v) and wait\nwait (1) seconds\nbroadcast (Last Dialogue v) and wait\nbroadcast (tbc v) and wait\n\nwhen I receive [unowincutescene v]\npoint in direction (90)\n\nbroadcast (Transition Out v) and wait\n\nwhen I receive [alert v]\nplay sound [Alert v] until done\nplay sound [Alert v] until done\nplay sound [Alert v] until done\n\nset [music v] to [2]\nbroadcast (BGMusic v)\n\nset [music v] to [2]\nbroadcast (BGMusic v)\n\nif <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n set [slope v] to [0]\n repeat until <<<not <touching (level hitbox v)?>> and <not <touching (boss hitbox v)?>>> or <(Slope) = [8]>>\n change [slope v] by (1)\n change y by (1)\n end\n if <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n change y by ((Slope) * (-1))\n repeat ([ceiling v] of ([abs v] of (XV) ) )\n if <<touching (level hitbox v)?> or <touching (boss hitbox v)?>> then\n change x by ((([abs v] of (XV) ) / (XV)) * (-1))\n end\n end\n set [xv v] to [0]\n end\nend\n\n@Level Art\n\nforever\n set x to ((Level_X) - (ScrollX))\n if <([abs v] of ((Level_X) - (ScrollX)) ) > [480]> then\n hide\n else\n show\n end\nend\n\nwhen I receive [deleteallclones v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nwhen flag clicked\nhide\n\nwhen I receive [bosswin v]\nhide\n\ndelete this clone\n\nwhen I receive [deleteallclones v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nset [scrollx v] to [3085]\n\nwhen I receive [levelloop v]\nforever\n set x to ((Level_X) - (ScrollX))\n if <([abs v] of ((Level_X) - (ScrollX)) ) > [480]> then\n hide\n else\n show\n end\nend\n\nwhen I receive [setup v]\nshow\nclear graphic effects\nset [level_x v] to [0]\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nCreate\nhide\n\ndefine Create\nrepeat (15)\n create clone of (_myself_ v)\n change [level_x v] by (480)\n next costume\nend\ncreate clone of (_myself_ v)\nset [level_x v] to [0]\nswitch costume to (costume1 v)\n\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\n@Level HitBox\n\nwhen I receive [deleteallclones v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nwhen flag clicked\nhide\n\nset [scrollx v] to [3085]\n\nwhen I receive [levelloop v]\nforever\n set x to ((Level_X) - (ScrollX))\n if <([abs v] of ((Level_X) - (ScrollX)) ) > [480]> then\n hide\n else\n show\n end\nend\n\nwhen I receive [setup v]\nshow\nclear graphic effects\nset [level_x v] to [0]\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nCreate\nhide\n\ndefine Create\nrepeat (15)\n create clone of (_myself_ v)\n change [level_x v] by (480)\n next costume\nend\ncreate clone of (_myself_ v)\nset [level_x v] to [0]\nswitch costume to (costume1 v)\n\n@Transition\n\nwhen I receive [setup v]\n\ngo to x: (0) y: (0)\nshow\nchange y by (10)\n\nwhen I receive [transition in v]\nswitch costume to (costume1 v)\nhide\nshow\nstart sound [Disconnect v]\nrepeat (16)\n next costume\nend\nbroadcast (StopMusic v)\n\nwhen I receive [transition out v]\nswitch costume to (costume17 v)\nstart sound [Connect v]\nrepeat (16)\n switch costume to ((costume [number v]) - (1))\nend\nhide\n\ngo to x: (0) y: (0)\nswitch costume to (costume17 v)\nhide\n\ngo to [front v] layer\n\nwhen I receive [resetboss v]\nwait (1) seconds\nbroadcast (Transition In v) and wait\nbroadcast (PlayerHide v)\nwait (1) seconds\nbroadcast (DeleteAllClones v) and wait\nbroadcast (SetUp Boss v) and wait\nbroadcast (BossLevelLoop v)\nwait (1) seconds\nbroadcast (Transition Out v) and wait\nbroadcast (Continue v) and wait\nbroadcast (PlayerLoop v)\nset [invincible v] to [false]\n\nswitch costume to (costume1 v)\nhide\nshow\ngo to x: (0) y: (0)\nrepeat (16)\n next costume\nend\nbroadcast (PlayBossBattle v) and wait\n\nwhen I receive [get back to main land v]\nbroadcast (Transition In v) and wait\nbroadcast (Generate v) and wait\nbroadcast (Transition Out v) and wait\n\n@Create\n\nwhen I receive [deleteallclones v]\ndelete this clone\n\nwhen I receive [generate v]\nbroadcast (DeleteAllClones v) and wait\nbroadcast (SetUp v) and wait\nbroadcast (LevelLoop v)\nbroadcast (PlayerLoop v)\nbroadcast (BGMusic v)\nbroadcast (OtherLoop v)\n\nwhen I receive [setup v]\n\nwhen I receive [setup boss v]\n\nbroadcast (BossMusic v)\n\nwhen I receive [>play button v]\nset [music v] to [1]\nbroadcast (Generate v)\n\n@Boss Art\n\nwhen flag clicked\nhide\n\nwhen I receive [bosswin v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nhide\n\nwhen I receive [deleteallclones v]\n\nwhen I receive [deleteallclones v]\ndelete this clone\n\nset [scrollx v] to [3085]\n\nwhen I receive [bosslevelloop v]\nforever\n set x to ((Level_X) - (ScrollX))\n if <([abs v] of ((Level_X) - (ScrollX)) ) > [480]> then\n hide\n else\n show\n end\nend\n\nwhen I receive [setup boss v]\nshow\nclear graphic effects\nset [level_x v] to [0]\nset [scrollx v] to [0]\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nCreate\nhide\n\ndefine Create\nrepeat (2)\n create clone of (_myself_ v)\n change [level_x v] by (480)\n next costume\nend\ncreate clone of (_myself_ v)\nset [level_x v] to [0]\nswitch costume to (costume1 v)\n\n@Boss HitBox\n\nwhen flag clicked\nhide\n\nwhen I receive [bosswin v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nhide\n\nwhen I receive [deleteallclones v]\ndelete this clone\n\nset [scrollx v] to [3085]\n\nwhen I receive [bosslevelloop v]\nforever\n set x to ((Level_X) - (ScrollX))\n if <([abs v] of ((Level_X) - (ScrollX)) ) > [480]> then\n hide\n else\n show\n end\n set [ghost v] effect to (100)\nend\n\nwhen I receive [setup boss v]\nshow\nclear graphic effects\nset [level_x v] to [0]\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nCreate\nhide\n\ndefine Create\nrepeat (2)\n create clone of (_myself_ v)\n change [level_x v] by (480)\n next costume\nend\ncreate clone of (_myself_ v)\nset [level_x v] to [0]\nswitch costume to (costume1 v)\n\n@Boss\n\nwhen I receive [setup boss v]\nset size to (35) %\nswitch costume to (costume1 v)\nset [bossx v] to [600]\nset [remainingpower v] to [5]\nset [yv v] to [0]\nset [bossdead? v] to [false]\nset [animate v] to [0]\nset [attackchance v] to [0]\nset [scrollblocksattack v] to [0]\nset rotation style [left-right v]\nset y to (-56)\npoint in direction (-90)\nhide\n\nwhen I receive [bosslevelloop v]\nforever\n Scroll Blocks\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [recount v]\nforever\n change [animate v] by (1)\n wait (0.05) seconds\n if <(Animate) > [9000]> then\n set [animate v] to [1]\n end\nend\n\nwhen I receive [bossjump v]\nset y to (-56)\nOut\nrepeat (2)\n next costume\nend\nwait (2) seconds\nIn\nwait (1) seconds\nrepeat (20)\n change y by (8)\nend\nwait (0.5) seconds\nrepeat (120)\n switch costume to (((Animate) mod (6)) + (2))\nend\n\ndefine In\nhide\nclear graphic effects\nset [ghost v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nclear graphic effects\nshow\n\ndefine Out\nshow\nclear graphic effects\nshow\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwhen I receive [trigger boss activity v]\nhide\nstop [other scripts in sprite v]\nbroadcast (recount v)\nwait (1) seconds\nforever\n Scroll Blocks\n if <not <<([floor v] of (ScrollX) ) < ([floor v] of ((BossX) + (50)) )> and <([floor v] of (ScrollX) ) > ([floor v] of ((BossX) + (-50)) )>>> then\n point towards (player v)\n change [bossx v] by ((([abs v] of (direction) ) / (direction)) * (4))\n Scroll Blocks\n switch costume to (((Animate) mod (6)) + (2))\n else\n if <((AttackChance) mod (25)) = [24]> then\n Attack\n change [remainingpower v] by (-1)\n if <(RemainingPower) < [1]> then\n switch costume to (costume2 v)\n repeat (20)\n Scroll Blocks\n change y by (-8)\n end\n set [toolate v] to [0]\n repeat until <<<([yv v] of [player v]) < [-1.1]> and <touching (player v)?>> or <(TooLate) > [125]>>\n Scroll Blocks\n change [toolate v] by (1)\n end\n if <<<([yv v] of [player v]) < [-1.1]> and <touching (player v)?>> and <[125] > (TooLate)>> then\n change [bosshp v] by (-1)\n broadcast (PlayerBounceBack v)\n broadcast (flash v)\n end\n set [remainingpower v] to [6]\n if <(BossHP) > [0]> then\n clear graphic effects\n repeat (20)\n Scroll Blocks\n change y by (8)\n end\n clear graphic effects\n else\n Death\n stop [this script v]\n end\n end\n end\n end\nend\n\ndefine Attack\nclear graphic effects\nset y to (104)\nset [prevbossx v] to (BossX)\nrepeat (15)\n set [bossx v] to ((PrevBossX) + (pick random (-3) to (3)))\n set y to ((104) + (pick random (-3) to (3)))\n switch costume to (((Animate) mod (6)) + (2))\n Scroll Blocks\nend\nset [scrollblocksattack v] to [false]\nbroadcast (Attack v) and wait\n\nwhen I receive [continue v]\nbroadcast (recount v)\n\ndefine Scroll Blocks\nset x to ((BossX) - (ScrollX))\nif <([abs v] of ((BossX) - (ScrollX)) ) > [240]> then\n hide\nelse\n show\nend\n\nrepeat (100)\nAttack\n\n\n\nwhen I receive [recount v]\nforever\n change [attackchance v] by (1)\n if <(AttackChance) > [9000]> then\n set [attackchance v] to [1]\n end\nend\n\nwait (pick random (0.2) to (0.6)) seconds\n\nwhen I receive [attack v]\nrepeat until <(ScrollBlocksAttack) = [true]>\n switch costume to (((Animate) mod (6)) + (2))\n Scroll Blocks\nend\n\nwhen I receive [resetboss v]\nstop [other scripts in sprite v]\nstop [other scripts in sprite v]\n\ndefine Death\nrepeat (30)\n Scroll Blocks\nend\nset [bossdead? v] to [true]\nwait (1) seconds\nbroadcast (Transition In v) and wait\npoint in direction (90)\nset y to (-58)\nset x to (100)\nswitch costume to (cutsceme v)\nwait (1) seconds\nrepeat (18)\n play sound (pick random (1) to (3)) until done\nend\nwait (1) seconds\nbroadcast (UnoWINcutescene v) and wait\nbroadcast (Transition Out v) and wait\nbroadcast (the actual cutscene unwin v) and wait\nstop [this script v]\n\nset [lifehp v] to [1]\n\nwhen I receive [flash v]\nrepeat (12)\n set [ghost v] effect to (100)\n wait (0.0001) seconds\n set [ghost v] effect to (0)\n wait (0.0001) seconds\nend\n\nif <(BossHP) > [0]> then\n\nset [bosshp v] to [1]\n\nwhen I receive [the actual cutscene unwin v]\nwait (1) seconds\npoint in direction (90)\nset y to (-58)\nset x to (100)\nswitch costume to (cutsceme v)\nswitch costume to (cutsceme v)\nrepeat (9)\n next costume\n wait (0.03) seconds\nend\nwait (1) seconds\nrepeat (14)\n next costume\n wait (0.005) seconds\nend\nstart sound [High Whoosh v]\nwait (1) seconds\nrepeat (20)\n change y by (8)\nend\nrepeat (10)\n change x by (-6)\nend\nwait (1) seconds\nbroadcast (Exclamation Dive v)\nrepeat (60)\n go to x: (pick random (34) to (40)) y: (pick random (99) to (105))\nend\ngo to x: (37) y: (102)\n\nset [music v] to [2]\nbroadcast (BGMusic v)\n\nbroadcast (bossWIN v) and wait\n\n@Dialogue\n\nwhen I receive [setup boss v]\ngo to x: (0) y: (0)\nclear graphic effects\nswitch costume to (1 v)\nhide\n\nwhen I receive [boss dialogue v]\nswitch costume to (1 v)\nIn\nrepeat (7)\n wait until <key (any v) pressed?>\n wait until <not <key (any v) pressed?>>\n Out\n next costume\n In\nend\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nnext costume\nIn\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nwait (1) seconds\n\ndefine In\nhide\nclear graphic effects\nset [ghost v] effect to (100)\nset [pixelate v] effect to (100)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\n change [pixelate v] effect by (-10)\nend\nclear graphic effects\nshow\n\ndefine Out\nshow\nclear graphic effects\nshow\nrepeat (10)\n change [ghost v] effect by (10)\n change [pixelate v] effect by (10)\nend\nhide\nclear graphic effects\n\nwhen flag clicked\nhide\n\ngo to [front v] layer\n\nwhen I receive [bosswin v]\nswitch costume to (10 v)\nIn\nrepeat (4)\n wait until <key (any v) pressed?>\n wait until <not <key (any v) pressed?>>\n Out\n next costume\n In\nend\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nnext costume\nIn\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nwait (1) seconds\n\nwhen I receive [last dialogue v]\nswitch costume to (16 v)\nIn\nrepeat (7)\n wait until <key (any v) pressed?>\n wait until <not <key (any v) pressed?>>\n Out\n next costume\n In\nend\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nnext costume\nIn\nwait until <key (any v) pressed?>\nwait until <not <key (any v) pressed?>>\nOut\nwait (1) seconds\n\n@Attack\n\nwhen flag clicked\nhide\n\nwhen I receive [setup boss v]\nset x to (0)\nset y to (47)\nset [attackx v] to [0]\nswitch costume to (costume1 v)\nset size to (50) %\nhide\n\nwhen I receive [attack v]\nset [attackx v] to ([bossx v] of [boss v])\nset [yv v] to [-2]\nset x to (([bossx v] of [boss v]) - (ScrollX))\nset y to (47)\nclear graphic effects\nbroadcast (Set Var Player v) and wait\nshow\nstart sound [Pew2 v]\nrepeat until <<(y position) < [-97]> or <([contactattack? v] of [player v]) = [true]>>\n change y by (YV)\n change [yv v] by (-0.4)\n Scroll Blocks\nend\nif <([contactattack? v] of [player v]) = [true]> then\n if <(Invincible) = [false]> then\n set [invincible v] to [true]\n change [lifehp v] by (-1)\n if <(LifeHP) < [1]> then\n broadcast (RESETBOSS v)\n stop [this script v]\n end\n end\nend\nrepeat (5)\n change [ghost v] effect by (20)\n Scroll Blocks\nend\nset y to (47)\nset [scrollblocksattack v] to [true]\n\ndefine Scroll Blocks\nset x to ((AttackX) - (ScrollX))\nif <([abs v] of ((AttackX) - (ScrollX)) ) > [240]> then\n hide\nelse\n show\nend\n\nwhen I receive [unowincutescene v]\nset [scrollx v] to [480]\nhide\n\nwhen I receive [exclamation dive v]\nwait (3) seconds\nswitch costume to (costume3 v)\nclear graphic effects\nshow\nset y to (47)\nset x to (0)\nset [yv v] to [-2]\nstart sound [Pew v]\nrepeat until <(y position) < [0]>\n change y by (YV)\n change [yv v] by (-0.4)\nend\n\nwhen I receive [bosswin v]\nhide\n\n@Player Life\n\nwhen I receive [unowincutescene v]\nhide\n\nwhen I receive [unowincutescene v]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [setup boss v]\nset [lifehp v] to [3]\nswitch costume to (life3 v)\ngo to x: (-213) y: (151)\nset size to (70) %\nshow\n\nwhen I receive [playerloop v]\nforever\n switch costume to (join [Life] (LifeHP))\nend\n\n@Boss Life\n\nwhen I receive [unowincutescene v]\nstop [other scripts in sprite v]\ngo to x: (0) y: (0)\nswitch costume to (exclamation v)\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [setup boss v]\nset [bosshp v] to [3]\nswitch costume to (life3 v)\nclear graphic effects\ngo to x: (206) y: (151)\nset size to (70) %\nshow\n\nwhen I receive [playerloop v]\nforever\n switch costume to (join [Life] (BossHP))\nend\n\nwhen I receive [exclamation dive v]\nshow\nclear graphic effects\nset [ghost v] effect to (100)\nrepeat (4)\n change [ghost v] effect by (-25)\nend\nclear graphic effects\nwait (0.3) seconds\nrepeat (8)\n change [ghost v] effect by (12.5)\nend\nclear graphic effects\nhide\n\n@Sprite1\n\nwhen I receive [bgmusic v]\nforever\n play sound (Music) until done\nend\n\nwhen I receive [setup v]\nset volume to (100) %\n\nwhen I receive [stopmusic v]\nstop [other scripts in sprite v]\nstop all sounds\n\nwhen I receive [bossmusic v]\nforever\n play sound [Relaxing Instrumental Music soft & calm background music - relaxdaily N080 \(mp3cut v] until done\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [bosswin v]\nshow\n\n@Sprite3\n\nwhen flag clicked\ngo to x: (0) y: (0)\nclear graphic effects\nhide\n\nwhen I receive [tbc v]\nshow\nset [ghost v] effect to (100)\nrepeat (40)\n change [ghost v] effect by (-2)\nend\nrepeat (40)\n change [ghost v] effect by (-1)\nend\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nshow\ngo to [front v] layer\n\n@Sprite5\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\nwait (1) seconds\nwait until <mouse down?>\nwait until <not <mouse down?>>\nbroadcast (Transition In v) and wait\nbroadcast (Generate v) and wait\nhide\nbroadcast (Transition Out v) and wait\n\n
Believe | Christmas Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop2 v)\n\nwhen I receive [begin v]\nswitch backdrop to (backdrop1 v)\nforever\n wait (pick random (3) to (33)) seconds\n set [brightness v] effect to (65)\n wait (0.001) seconds\n set [brightness v] effect to (0)\n wait (0.03) seconds\n set [brightness v] effect to (52)\n wait (0.05) seconds\n set [brightness v] effect to (0)\n wait (0.025) seconds\n set [brightness v] effect to (78)\n wait (0.001) seconds\n set [brightness v] effect to (0)\nend\n\nwhen flag clicked\nforever\n play sound [Despair and Triumph.mp3 v] until done\n play sound [Disquiet.mp3 v] until done\nend\n\nwhen I receive [fin v]\nstop all sounds\nstop [other scripts in stage v]\nforever\n play sound [Porch Swing Days - slower.mp3 v] until done\nend\n\n@Player\n\nwhen flag clicked\ngo to x: (-180) y: (10)\nhide\npoint in direction (90)\nset rotation style [left-right v]\nforever\n if <not <key (up arrow v) pressed?>> then\n if <<key (right arrow v) pressed?> or <key (left arrow v) pressed?>> then\n switch costume to (costume1 v)\n wait (0.05) seconds\n switch costume to (costume2 v)\n wait (0.05) seconds\n switch costume to (costume3 v)\n wait (0.05) seconds\n switch costume to (standing2 v)\n wait (0.05) seconds\n switch costume to (costume4 v)\n wait (0.05) seconds\n switch costume to (costume5 v)\n wait (0.05) seconds\n switch costume to (costume6 v)\n wait (0.05) seconds\n switch costume to (standing3 v)\n wait (0.05) seconds\n else\n switch costume to (standing v)\n end\n end\n if <key (up arrow v) pressed?> then\n switch costume to (standing4 v)\n end\nend\n\nwhen flag clicked\nforever\n if <key (right arrow v) pressed?> then\n point in direction (90)\n end\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n end\nend\n\nwhen I receive [begin v]\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n set [costume v] to (costume [number v])\n switch costume to (hitbox v)\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.8)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.8)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#112743)?> then\n change y by (1)\n if <touching color (#112743)?> then\n change y by (1)\n if <touching color (#112743)?> then\n change y by (1)\n if <touching color (#112743)?> then\n change y by (1)\n if <touching color (#112743)?> then\n change y by (1)\n if <touching color (#112743)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#112743)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#112743)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [12]\n end\n end\n change y by (1)\n switch costume to (costume)\nend\n\nwhen I receive [begin v]\nforever\n if <<(x position) = [240]> or <<(x position) > [240]> or <key (s v) pressed?>>> then\n hide\n broadcast (passed v)\n set [xv v] to [0]\n set [yv v] to [0]\n go to x: (-180) y: (10)\n point in direction (90)\n show\n wait (0.01) seconds\n end\n if <<touching color (#000000)?> or <key (r v) pressed?>> then\n hide\n go to x: (-180) y: (10)\n point in direction (90)\n set [xv v] to [0]\n set [yv v] to [0]\n show\n wait (0.01) seconds\n end\n if <<touching color (#2b69a7)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [6]\n end\nend\n\nwhen I receive [fin v]\nstop [other scripts in sprite v]\nswitch costume to (standing v)\nshow\ngo to x: (-180) y: (-90)\n\n@Intro\n\nwhen flag clicked\nshow\nswitch costume to (cover v)\nset [brightness v] effect to (-100)\n\nwhen I receive [glide v]\nrepeat (10)\n change [brightness v] effect by (10)\nend\nwait (6) seconds\nrepeat (100)\n change [brightness v] effect by (-1)\nend\nswitch costume to (begin v)\nclear graphic effects\nwait until <key (space v) pressed?>\nbroadcast (begin v)\nhide\n\n@Intro 2\n\nwhen flag clicked\nset size to (100) %\nshow\ngo to x: (0) y: (0)\nset [brightness v] effect to (-100)\nswitch costume to (costume3 v)\nbroadcast (dedicated v)\nrepeat (10)\n change [brightness v] effect by (10)\nend\nwait (2) seconds\nrepeat (10)\n change [brightness v] effect by (-10)\nend\nset size to (100) %\nwait (0.5) seconds\nswitch costume to (costume2 v)\nbroadcast (presents v)\nrepeat (10)\n change [brightness v] effect by (10)\nend\nwait (2) seconds\nrepeat (10)\n change [brightness v] effect by (-10)\nend\nset size to (100) %\nhide\nbroadcast (glide v)\nswitch costume to (costume1 v)\ngo to x: (0) y: (-120)\nshow\nrepeat (10)\n change [brightness v] effect by (10)\nend\nglide (6) secs to x: (0) y: (0)\nrepeat (100)\n change [brightness v] effect by (-1)\nend\nhide\n\nwhen I receive [dedicated v]\nrepeat (10)\n change size by (2)\nend\n\nwhen I receive [presents v]\nrepeat (10)\n change size by (2)\nend\n\nrepeat (10)\n change [brightness v] effect by (-10)\nend\nwait (0.5) seconds\nset size to (100) %\n\n@Ground\n\nwhen flag clicked\nhide\n\nwhen I receive [begin v]\nshow\nswitch costume to (1 v)\n\nwhen I receive [passed v]\nnext costume\nif <(costume [number v]) = [12]> then\n broadcast (fin v)\nend\n\n@Rain\n\nwhen flag clicked\nhide\n\nwhen I receive [begin v]\nforever\n create clone of (_myself_ v)\n set x to (pick random (240) to (-240))\n set size to (pick random (50) to (100)) %\nend\n\ndefine simplifier\nchange y by (() - ((size) / (3)))\nchange x by ((size) / (10))\nset [ghost v] effect to (75)\n\nwhen I start as a clone\nset y to (190)\nshow\nif <(size) > [75]> then\n go to [front v] layer\nend\nshow\nrepeat (10)\n simplifier\nend\nrepeat until <touching (_edge_ v)?>\n simplifier\nend\ndelete this clone\n\nrepeat (10)\n simplifier\nend\n\nwhen I receive [fin v]\nstop [other scripts in sprite v]\n\n@Final\n\nwhen flag clicked\nhide\nset [brightness v] effect to (100)\n\nwhen I receive [fin v]\nwait (3) seconds\nshow\nrepeat (10)\n change [brightness v] effect by (-10)\n go to [front v] layer\nend\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n set [ghost v] effect to (100)\n go to [front v] layer\n show\nend\n\nshow\ngo to [front v] layer\n\n
The Adventures of Squbla (a platformer) V1.0
@Stage\n\n@Engine\n\ndefine None\nset [lim v] to [1]\nrepeat until <<(lim) > (limit)> or <(touch) < [100]>>\n change [@player x v] by (dx)\n change [@player y v] by (dy)\n change [lim v] by (1)\n Check Collide\nend\nif <(lim) > (limit)> then\n change [@player x v] by ((0) - ((dx) * (limit)))\n change [@player y v] by ((0) - ((dy) * (limit)))\n if <(@Player SX) = [0]> then\n set [@player die v] to [1]\n else\n Check Collide\n if <(@Player SX) > [0]> then\n Move Out Of Collision dir x,y: (-1) (0) limit: (999)\n else\n Move Out Of Collision dir x,y: (1) (0) limit: (999)\n end\n set [@player sx v] to [0]\n end\nend\n\ndefine Check Collide\ngo to x: (round ((@Player X) - (@Scroll X))) y: (round ((@Player Y) - (@Scroll Y)))\nif <touching (level v)?> then\n set [touch v] to [101]\nelse\n if <touching (moving platform ahead v)?> then\n set [touch v] to [102]\n else\n set [touch v] to [0]\n end\nend\n\nset [@player x v] to [3200]\nset [@scroll x v] to (@Player X)\n\ndefine Scroll Level\nchange [@scroll x v] by (round (((@Player X) - (@Scroll X)) * (0.1)))\nif <(@Scroll X) < [0]> then\n set [@scroll x v] to [0]\nend\nchange [@scroll y v] by (round (((@Player Y) - (@Scroll Y)) * (0.1)))\nif <(@Scroll Y) < [0]> then\n set [@scroll y v] to [0]\nend\n\ndefine Player Tick\nset [pushed sx v] to [0]\nif <(on platform) = []> then\n Check Collide\n if <(touch) = [102]> then\n set [pushed sx v] to ((@Platform SX) - (@Player SX))\n change [@player x v] by (@Platform SX)\n set [@player sx v] to [0]\n Check Collide\n if <<(touch) > [100]> and <not <(touch) = [102]>>> then\n Move Out Of Collision dir x,y: (0) (1) limit: (([abs v] of (@Platform SX) ) + (2))\n if <(@Player Die) > [0]> then\n stop [this script v]\n end\n set [@player sy v] to [0]\n set [@falling v] to [0]\n end\n end\nend\nif <<key (up arrow v) pressed?> and <(@Falling) < [3]>> then\n set [@falling v] to [3]\n set [@player sy v] to [14]\nend\nif <(@Player SY) > [-16]> then\n change [@player sy v] by (-1.2)\nend\nchange [@player y v] by (@Player SY)\nif <not <(on platform) = []>> then\n change [@player y v] by (-5)\n Check Collide\n if <not <(touch) = [102]>> then\n change [@player y v] by (5)\n end\nend\nset [on platform v] to [0]\nCheck Collide\nif <(touch) = [102]> then\n set [on platform v] to (@Platform SX)\nelse\n set [on platform v] to []\nend\nif <(touch) > [100]> then\n if <(@Player SY) > [0]> then\n Move Out Of Collision dir x,y: (0) (-1) limit: (999)\n set [@falling v] to [3]\n set [@player sy v] to [0]\n else\n Move Out Of Collision dir x,y: (0) (1) limit: (999)\n set [@player sy v] to ((@Player SY) / (2))\n set [@falling v] to [0]\n end\nelse\n change [@falling v] by (1)\nend\nif <key (left arrow v) pressed?> then\n set [@player dir v] to [-90]\n change [@player sx v] by ((((-7) + (on platform)) - (@Player SX)) * (0.2))\n change [@walking v] by (1)\nelse\n if <key (right arrow v) pressed?> then\n set [@player dir v] to [90]\n change [@player sx v] by ((((7) + (on platform)) - (@Player SX)) * (0.2))\n change [@walking v] by (1)\n else\n set [@walking v] to [-1]\n if <([abs v] of ((@Player SX) - (on platform)) ) > [1]> then\n change [@player sx v] by (((on platform) - (@Player SX)) * (0.35))\n else\n set [@player sx v] to (on platform)\n end\n end\nend\nchange [@player x v] by (@Player SX)\nCheck Collide\nif <(touch) > [100]> then\n Move Out Of Collision dir x,y: (0) (1) limit: (round ((([abs v] of (@Player SX) ) * (2)) + (2)))\n if <(lim) > [2]> then\n set [@player sx v] to ((@Player SX) * (0.6))\n end\nend\nif <not <(pushed sx) = [0]>> then\n change [@player sx v] by (pushed sx)\nend\n\ndefine Reset Player\nset [@player x v] to (@Spawn X)\nset [@player y v] to (@Spawn Y)\nset [@scroll x v] to (@Player X)\nset [@scroll y v] to (@Player Y)\nset [@player sx v] to [0]\nset [@player sy v] to [0]\nset [@falling v] to [0]\nset [@walking v] to [-1]\nset [@player die v] to [0]\nScroll Level\n\nwhen flag clicked\nset [ghost v] effect to (100)\nset [@level v] to [1]\nset [@totalflags v] to [0]\nset [@timer v] to [0]\nset [@player dir v] to [90]\nset [@spawn x v] to [-180]\nset [@spawn y v] to [32]\nReset Player\nbroadcast (setup level v) and wait\nbroadcast (game loop tick v) and wait\nforever\n change [@timer v] by (1)\n if <(@Player Die) = [0]> then\n Player Tick\n if <(@Player Y) < [-200]> then\n set [@player die v] to [25]\n end\n else\n change [@player die v] by (1)\n if <(@Player Die) > [60]> then\n Reset Player\n end\n end\n Scroll Level\n broadcast (game loop tick v) and wait\nend\n\n@Player\n\ndefine Set Costume (costume#)\nif <not <(costume#) = (costume [number v])>> then\n switch costume to (costume#)\nend\n\nwhen I receive [setup level v]\nset size to (100) %\nshow\ngo to [front v] layer\ngo [backward v] (6) layers\nset rotation style [left-right v]\n\nwhen I receive [game loop tick v]\ngo to x: (round ((@Player X) - (@Scroll X))) y: (round ((@Player Y) - (@Scroll Y)))\nif <(@Player Die) = [0]> then\n if <(last Die) > [0]> then\n set size to (20) %\n set [ghost v] effect to (0)\n end\n if <(@Falling) > [2]> then\n if <(@Player SY) > [0]> then\n Set Costume (2)\n else\n if <(@Player SY) > [-2]> then\n Set Costume (4)\n else\n Set Costume (3)\n end\n end\n else\n if <(@walking) < [0]> then\n Set Costume (1)\n else\n if <((@walking) mod (9)) < [3]> then\n Set Costume (6)\n else\n if <((@walking) mod (9)) < [6]> then\n Set Costume (4)\n else\n Set Costume (6)\n end\n end\n end\n end\n if <not <(@Player Dir) = (direction)>> then\n point in direction (@Player Dir)\n end\nelse\n if <(@Player Die) < [25]> then\n set size to ((size) + (10)) %\n change [ghost v] effect by (4)\n change [@player y v] by (-1)\n else\n change [ghost v] effect by (100)\n end\n set [last die v] to [1]\nend\n\n@Level\n\nwhen I receive [setup level v]\nswitch costume to (l1 x0 y0 v)\nsetup clone at x,y: (0) (0)\nswitch costume to (l1 x1 y0 v)\nsetup clone at x,y: (1) (0)\nswitch costume to (l1 x1b y0 v)\nsetup clone at x,y: (2) (0)\nswitch costume to (l1 x2 y0 v)\nsetup clone at x,y: (3) (0)\nswitch costume to (l1 x3 y0 v)\nsetup clone at x,y: (3.7) (0.5)\nswitch costume to (l1 x4 y0 v)\nsetup clone at x,y: (4.9) (0.5)\nswitch costume to (l1 x5 y0 v)\nsetup clone at x,y: (5.6) (0)\nswitch costume to (l1 x6 y0 v)\nsetup clone at x,y: (6.6) (0)\nswitch costume to (l1 x6 y0 v)\nsetup clone at x,y: (7.7) (0)\nset [showing v] to [-1]\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\nend\n\ndefine position (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\nelse\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\nend\n\ndefine setup clone at x,y: (x) (y)\ngo to x: (0) y: (0)\nhide\nset [showing v] to [0]\nset [x v] to (round ((x) * (460)))\nset [y v] to (round ((y) * (340)))\ncreate clone of (_myself_ v)\n\n@moving platform\n\nwhen I receive [setup level v]\nswitch costume to (l1 x2 y0 lift v)\nsetup clone at x,y: (2) (-0.5)\nswitch costume to (barrier v)\nsetup clone at x,y: (7.9) (-0.45)\nset [showing v] to [-1]\n\ndefine None\nset [x v] to (x)\nset [y v] to (y)\n\ndefine None\ngo to x: (0) y: (0)\nhide\nset [ox v] to (round ((x) * (460)))\nset [oy v] to (round ((y) * (340)))\nset [showing v] to [0]\nmoving platform? (@timer)\ncreate clone of (_myself_ v)\n\ndefine None\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\nelse\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\nend\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n moving platform? (@timer)\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\nend\n\ndefine None\nif <(costume [number v]) = [1]> then\n move to (round ((ox) + ((140) * ([cos v] of ((timer) * (1.4)) )))) (round ((oy) + ((70) * ([sin v] of ((timer) * (2.8)) ))))\nelse\n if <(costume [number v]) = [2]> then\n barrier (((timer) / (100)) mod (1)) run length (-700)\n else\n end\nend\n\ndefine None\nif <(percent) < [0.15]> then\n move to (round ((ox) + ((percent) * (len)))) (round ((oy) - (((0.15) - (percent)) * (800))))\nelse\n if <(percent) > [0.85]> then\n move to (round ((ox) + ((percent) * (len)))) (round ((oy) - (((percent) - (0.85)) * (800))))\n else\n move to (round ((ox) + ((percent) * (len)))) (round (oy))\n end\nend\nset [ox v] to (round ((7.9) * (460)))\n\n@moving platform ahead\n\nwhen I receive [setup level v]\nswitch costume to (l1 x2 y0 lift v)\nsetup clone at x,y: (2) (-0.5) width (97)\nswitch costume to (barrier v)\nsetup clone at x,y: (7.9) (-0.45) width (48)\nset [showing v] to [-1]\n\ndefine None\nif <(costume [number v]) = [1]> then\n move to (round ((ox) + ((140) * ([cos v] of ((timer) * (1.4)) )))) (round ((oy) + ((70) * ([sin v] of ((timer) * (2.8)) ))))\nelse\n if <(costume [number v]) = [2]> then\n barrier (((timer) / (100)) mod (1)) run length (-700)\n else\n end\nend\n\ndefine None\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\nelse\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\nend\n\nwhen I start as a clone\nset [ghost v] effect to (100)\n\ndefine None\nif <([abs v] of ((@Player X) - (x)) ) < (width)> then\n set [@platform sx v] to ((x) - (x))\nend\nset [x v] to (x)\nset [y v] to (y)\n\ndefine None\ngo to x: (0) y: (0)\nhide\nset [ox v] to (round ((x) * (460)))\nset [oy v] to (round ((y) * (340)))\nset [width v] to (((width) / (2)) + (16))\nset [showing v] to [0]\nmoving platform? (@timer)\ncreate clone of (_myself_ v)\n\ndefine None\nif <(percent) < [0.15]> then\n move to (round ((ox) + ((percent) * (len)))) (round ((oy) - (((0.15) - (percent)) * (800))))\nelse\n if <(percent) > [0.85]> then\n move to (round ((ox) + ((percent) * (len)))) (round ((oy) - (((percent) - (0.85)) * (800))))\n else\n move to (round ((ox) + ((percent) * (len)))) (round (oy))\n end\nend\nset [ox v] to (round ((7.9) * (460)))\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n moving platform? ((@timer) + (1))\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\nend\n\n@background\n\nwhen I receive [setup level v]\ngo [backward v] (1000) layers\nset [x v] to [0]\nshow\ncreate clone of (_myself_ v)\nset [x v] to [470]\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (((@Scroll X) * (0.5)) mod (470)))) ((0) - (((@Scroll Y) * (0.5)) mod (480)))\nend\n\ndefine None\ngo to x: (x) y: (y)\n\n@Edge Fade\n\nwhen I receive [setup level v]\ngo to x: (0) y: (0)\nshow\ngo to [front v] layer\ngo [backward v] (5) layers\n\n@Check Points\n\ndefine None\ngo to x: (0) y: (0)\nhide\nset [showing v] to [0]\nset [x v] to (x)\nset [y v] to (y)\nchange [@totalflags v] by (1)\ncreate clone of (_myself_ v)\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\n if <(showing) > [25]> then\n delete this clone\n end\nend\n\nwhen I receive [setup level v]\nswitch costume to (l1 x0 y0 v)\nsetup clone at x,y: (457) (-54)\nsetup clone at x,y: (1198) (63)\nsetup clone at x,y: (2483) (62)\nsetup clone at x,y: (3705) (-54)\nset [showing v] to [-1]\n\ndefine on screen\nif <((@timer) mod (5)) = [0]> then\n next costume\nend\nif <touching (engine v)?> then\n set [showing v] to [2]\n set [@spawn x v] to (x)\n set [@spawn y v] to (y)\n change [@totalflags v] by (-1)\nend\n\ndefine None\ngo to x: (x) y: (y)\nif <(showing) < [2]> then\n if <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\n on screen\n else\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\n end\nelse\n set size to ((size) + (15)) %\n change [ghost v] effect by (4)\n change [y v] by (5)\n change [showing v] by (1)\nend\n\n@Tiles\n\nwhen flag clicked\nhide\n\n@Level2\n\nwhen I receive [setup level v]\nswitch costume to (l1 x0 y0 v)\nsetup clone at x,y: (0) (0)\nswitch costume to (l1 x1 y0 v)\nsetup clone at x,y: (1) (0)\nswitch costume to (l1 x1b y0 v)\nsetup clone at x,y: (2) (0)\nswitch costume to (l1 x2 y0 v)\nsetup clone at x,y: (3) (0)\nswitch costume to (l1 x3 y0 v)\nsetup clone at x,y: (3.7) (0.5)\nswitch costume to (l1 x4 y0 v)\nsetup clone at x,y: (4.9) (0.5)\nswitch costume to (l1 x5 y0 v)\nsetup clone at x,y: (5.6) (0)\nswitch costume to (l1 x6 y0 v)\nsetup clone at x,y: (6.6) (0)\nswitch costume to (l1 x6 y0 v)\nsetup clone at x,y: (7.7) (0)\nset [showing v] to [-1]\n\ndefine setup clone at x,y: (x) (y)\ngo to x: (0) y: (0)\nhide\nset [showing v] to [0]\nset [x v] to (round ((x) * (460)))\nset [y v] to (round ((y) * (340)))\ncreate clone of (_myself_ v)\n\ndefine position (x) (y)\ngo to x: (x) y: (y)\nif <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\nelse\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\nend\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\nend\n\n@Sprite1\n\nwhen flag clicked\nshow\nset [ghost v] effect to (0)\ngo to x: (0) y: (0)\ngo to [front v] layer\nwait (1) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Check Points2\n\ndefine None\ngo to x: (0) y: (0)\nhide\nset [showing v] to [0]\nset [x v] to (x)\nset [y v] to (y)\nchange [@totalflags v] by (1)\ncreate clone of (_myself_ v)\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\n if <(showing) > [25]> then\n delete this clone\n end\nend\n\nwhen I receive [setup level v]\ngo to [front v] layer\ngo [backward v] (6) layers\nswitch costume to (l1 x0 y0 v)\nsetup clone at x,y: (242) (-90)\nsetup clone at x,y: (920) (63)\nsetup clone at x,y: (2000) (250)\nsetup clone at x,y: (2930) (-54)\nsetup clone at x,y: (3195) (-54)\nsetup clone at x,y: (3440) (-54)\nset [showing v] to [-1]\n\ndefine on screen\nif <((@timer) mod (3)) = [0]> then\n next costume\nend\nif <touching (engine v)?> then\n set [showing v] to [2]\n change [@totalflags v] by (-1)\n set [+10 v] to [1]\nend\n\ndefine None\nset size to (10) %\nshow\ngo to x: (x) y: (y)\nif <(showing) < [2]> then\n if <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\n on screen\n else\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\n end\nelse\n set size to ((size) + (15)) %\n change [ghost v] effect by (4)\n change [y v] by (5)\n change [showing v] by (1)\nend\n\n@Sprite2\n\nwhen flag clicked\nset [+10 v] to [0]\nhide\nforever\n if <(+10) = [1]> then\n show\n go to (([y position v] of [engine v]) + (50))\n repeat (5)\n set size to ((size) + (15)) %\n change [ghost v] effect by (4)\n change y by (1)\n end\n set [+10 v] to [0]\n else\n hide\n set size to (100) %\n set [ghost v] effect to (0)\n end\nend\n\n@death\n\ndefine None\ngo to x: (0) y: (0)\nhide\nset [showing v] to [0]\nset [x v] to (x)\nset [y v] to (y)\nchange [@totalflags v] by (1)\ncreate clone of (_myself_ v)\n\nwhen I receive [game loop tick v]\nif <(showing) > [-1]> then\n position (round ((x) - (@Scroll X))) (round ((y) - (@Scroll Y)))\n if <(showing) > [25]> then\n delete this clone\n end\nend\n\nwhen I receive [setup level v]\nhide\n\ndefine on screen\nif <touching (engine v)?> then\n set [showing v] to [2]\n change [@totalflags v] by (-1)\n set [+10 v] to [1]\nend\n\ndefine None\nset size to (10) %\nshow\ngo to x: (x) y: (y)\nif <(showing) < [2]> then\n if <<(x) = (x position)> and <(y) = (y position)>> then\n if <(showing) = [0]> then\n set [showing v] to [1]\n show\n end\n on screen\n else\n if <(showing) = [1]> then\n set [showing v] to [0]\n hide\n end\n end\nelse\n set size to ((size) + (15)) %\n change [ghost v] effect by (4)\n change [y v] by (5)\n change [showing v] by (1)\nend\n\nswitch costume to (spike_up v)\nsetup clone at x,y: (442) (-75)\nsetup clone at x,y: (920) (63)\nsetup clone at x,y: (2000) (250)\nsetup clone at x,y: (2930) (-54)\nsetup clone at x,y: (3195) (-54)\nsetup clone at x,y: (3440) (-54)\nset [showing v] to [-1]\n\n
=========================================\n =Controls=\nUse arrow keys to move around, don't fall off the platforms, each flag is a checkpoint. This is the first scrolling platformer that I have released. You play as Squbla (my brother came up with that name) you are trying to get the checkpoints. Fullscreen recommended.\nCAN WE GET THIS TOP LOVED!\n \nFuture updates:\n-enemies\n-water\n-maybe another world\n-coins\n-more levels\n-maybe more character animation\n\ncredit to @Griffpatch for scrolling platformer tutorial.\ncredit to Unity Asset store for platformer tiles/character \n
Gloop Run (Platformer)
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [next level v]\nnext backdrop\n\nwhen backdrop switches to [backdrop9 v]\nbroadcast (end timer v)\n\n@Sprite1\n\nwhen I receive [game start v]\n\nwhen flag clicked\n\nglide (1) secs to x: (10) y: (10)\n\nwhen flag clicked\n\nset [☁ world record v] to [0]\n\nwhen I receive [end timer v]\nset [stop timer v] to [1]\nif <(Time) < (☁ World Record)> then\n set [☁ world record v] to (Time)\nend\n\nwhen I receive [game start v]\nset [stop timer v] to [0]\nset [time v] to [0]\nforever\n if <(stop timer) = [0]> then\n wait (0.1) seconds\n change [time v] by (0.1)\n end\nend\n\nwhen I receive [game start v]\nshow\nset [ghost v] effect to (100)\ngo to x: (-210) y: (-50)\nset rotation style [left-right v]\nset [xv v] to [0]\nset [yv v] to [0]\nset [dead v] to [0]\nforever\n change [yv v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.75)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.75)\n end\n set [xv v] to ((XV) * (0.9))\n change x by (XV)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (1)\n if <touching color (#a2bd8e)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [yv v] to [10]\n if <(XV) > [0]> then\n set [xv v] to [-10]\n else\n set [xv v] to [10]\n end\n else\n change x by ((XV) * (-1))\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (YV)\n if <touching color (#a2bd8e)?> then\n change y by ((YV) * (-1))\n set [yv v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#a2bd8e)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [8]\n end\n change y by (0.5)\n if <<key (space v) pressed?> and <(clear) = [0]>> then\n repeat until <<touching (sprite3 v)?> or <(dead) = [1]>>\n if <(dead) = [0]> then\n point towards (sprite3 v)\n move (10) steps\n end\n if <touching color (#d0ae4b)?> then\n point in direction (90)\n go to x: (-220) y: (-94)\n set [dead v] to [1]\n end\n end\n if <(dead) = [0]> then\n point in direction (90)\n set [yv v] to [0]\n set [xv v] to [0]\n set [touching? v] to [0]\n set [clear v] to [1]\n set [purple v] to [0]\n if <<<touching color (#887ba8)?> or <touching color (#a998d0)?>> and <touching color (#a2bd8e)?>> then\n change y by (10)\n end\n end\n set [dead v] to [0]\n end\n if <touching color (#d0ae4b)?> then\n go to x: (-220) y: (-94)\n end\n if <[235] < (x position)> then\n set [yv v] to [0]\n set [xv v] to [0]\n set [touching? v] to [0]\n set [clear v] to [1]\n set [purple v] to [0]\n go to x: (-220) y: (-94)\n broadcast (next level v)\n end\nend\n\nwhen flag clicked\nset [yv v] to [0]\nset [xv v] to [0]\nset [touching? v] to [0]\nset [clear v] to [1]\nset [purple v] to [0]\ngo to x: (-220) y: (-94)\nshow\nset [ghost v] effect to (100)\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\n@Sprite2\n\nwhen flag clicked\nerase all\nset pen color to (#666666)\nforever\n if <(purple) = [1]> then\n erase all\n go to (sprite6 v)\n pen down\n go to (sprite3 v)\n else\n erase all\n end\n if <(clear) = [1]> then\n erase all\n end\nend\n\nif then\nelse\nend\n\n@Sprite3\n\nwhen flag clicked\n\nforever\nend\n\nwait (0.01) seconds\n\nwhen I receive [game start v]\nhide\nshow\nset size to (75) %\ngo to x: (0) y: (0)\nhide\nset [click? v] to [0]\nset [touching? v] to [0]\nset [clear v] to [1]\nforever\n if <(click?) = [0]> then\n if <<(touching?) = [1]> and <mouse down?>> then\n go to (mouse-pointer v)\n end\n end\n if <<<touching color (#a998d0)?> or <touching color (#887ba8)?>> and <(dead) = [0]>> then\n set [purple v] to [1]\n else\n set [purple v] to [0]\n end\n if <<(clear) = [0]> or <(dead) = [1]>> then\n show\n else\n hide\n end\nend\n\n@Sprite4\n\nwhen flag clicked\nhide\n\nif then\nend\n\nwhen I receive [game start v]\nhide\nforever\n go to (mouse-pointer v)\n if <<<mouse down?> and <<touching color (#a998d0)?> or <touching color (#887ba8)?>>> and <(click?) = [0]>> then\n set [touching? v] to [1]\n set [clear v] to [0]\n else\n set [touching? v] to [0]\n end\n if <<touching color (#a998d0)?> or <touching color (#887ba8)?>> then\n set [purple v] to [1]\n else\n set [purple v] to [0]\n end\n if <(dead) = [1]> then\n set [clear v] to [1]\n end\nend\n\n@Sprite5\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nforever\n wait (0.05) seconds\n next costume\nend\n\nwhen I receive [game start v]\nshow\nset rotation style [left-right v]\nforever\n go to (sprite1 v)\n if <key (left arrow v) pressed?> then\n point in direction (90)\n end\n if <key (right arrow v) pressed?> then\n point in direction (-90)\n end\nend\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nif then\nelse\nend\n\ngo to ( v)\n\nwhen I receive [game start v]\nshow\nset rotation style [left-right v]\nforever\n if <([direction v] of [sprite5 v]) = [90]> then\n point in direction (-90)\n end\n if <([direction v] of [sprite5 v]) = [-90]> then\n point in direction (90)\n end\n if <([direction v] of [sprite5 v]) = [-90]> then\n go to x: (([x position v] of [sprite5 v]) - (15)) y: (([y position v] of [sprite5 v]) + (15))\n end\n if <([direction v] of [sprite5 v]) = [90]> then\n go to x: (([x position v] of [sprite5 v]) - (-15)) y: (([y position v] of [sprite5 v]) + (15))\n end\nend\n\n@Sprite7\n\n@Sprite8\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\nclear graphic effects\ngo to x: (0) y: (0)\nshow\nwait (2) seconds\nrepeat (100)\n change [ghost v] effect by (1)\nend\nhide\nbroadcast (game start v)\n\nwhen backdrop switches to [backdrop10 v]\nbroadcast (end v)\nshow\nclear graphic effects\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nstop [all v]\n\n
GO SUB TO MY YOUTUBE https://www.youtube.com/channel/UCqfUuHTrjZIfwZjmrY9AM3A?
Cave Jumper | A Platformer
@Stage\n\nrepeat (10)\n change [ghost v] effect by (25)\n wait (0.1) seconds\nend\nset [ghost v] effect to (0)\n\nwhen [space v] key pressed\nbroadcast (start v)\n\n@Player\n\nwhen [space v] key pressed\nforever\n if <touching color (#ff0000)?> then\n go to x: (-200) y: (15)\n end\nend\n\nwhen flag clicked\n\nforever\n if <(backdrop [name v]) = [win]> then\n hide\n stop [all v]\n end\nend\n\nforever\n if <touching color (#009999)?> then\n if <key (up arrow v) pressed?> then\n change [yv v] by (-1)\n else\n change [yv v] by (1)\n end\n end\nend\n\nwhen I receive [start v]\nswitch backdrop to (1 v)\nshow\ngo to x: (-202) y: (44)\nforever\n change [yv v] by (-0.5)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(Xv) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n change y by (-1)\n if <touching color (#000008)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n change y by (-2)\n if <touching color (#000000)?> then\n set [yv v] to [10]\n end\n change y by (2)\n end\nend\n\nchange y by (1)\n\nwhen flag clicked\nforever\n if <touching color (#00cccc)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [5]\n else\n set [yv v] to [-1]\n end\n if <<key (down arrow v) pressed?> or <key (s v) pressed?>> then\n set [yv v] to [-5]\n end\n end\nend\n\nwhen [space v] key pressed\nforever\n if <touching color (#cccccc)?> then\n switch backdrop to (next backdrop v)\n go to x: (-210) y: (15)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ffff00)?> then\n set [yv v] to [15]\n end\nend\n\nwhen flag clicked\nforever\n\ngo to x: (87) y: (-184)\n\nwhen flag clicked\nhide\nswitch backdrop to (start v)\n\n@Sprite1\n\nwhen flag clicked\nhide\nwait until <(backdrop [name v]) = [4]>\n\nswitch costume to (2 v)\nswitch costume to (1 v)\nswitch costume to (2 v)\n\nwhen flag clicked\n\nforever\n if <(backdrop [name v]) = [win]> then\n hide\n stop [other scripts in sprite v]\n end\nend\n\nwhen I receive [start v]\n\nwhen flag clicked\n\ngo to x: (10) y: ([y position v] of [player v])\n\nshow\n\nset size to (100) %\ngo [backward v] (1) layers\nshow\nforever\n go to (player v)\nend\n\nglide (1) secs to (random position v)\n\nforever\n if <(pick random (1) to (10)) > (pick random (1) to (10))> then\nend\n\n@Sprite2\n\nwhen flag clicked\nhide\nforever\n if <(backdrop [name v]) = [12]> then\n point in direction (90)\n show\n forever\n switch costume to (costume1 v)\n wait (3) seconds\n switch costume to (costume2 v)\n wait (4) seconds\n end\n end\nend\n\nturn right (3) degrees\n\nwhen flag clicked\nforever\n if <(backdrop [name v]) = [13]> then\n hide\n end\nend\n\nwhen flag clicked\nforever\n \nend\n\n@Sprite3\n\nwhen flag clicked\nhide\ngo to x: (18) y: (28)\n\nwhen flag clicked\nforever\n if <(backdrop [name v]) = [13]> then\n show\n end\nend\n\nwhen I receive [tule lahti uks !!!1! v]\nhide\nstop [this script v]\n\nwhen I receive [tule lahti uks !!!1! v]\nhide\nstop [other scripts in sprite v]\n\n@Sprite4\n\nwhen flag clicked\nforever\n if <(backdrop [name v]) = [13]> then\n show\n end\nend\n\nwhen flag clicked\nhide\ngo to x: (-328) y: (85)\n\nwhen flag clicked\nforever\n if <touching (player v)?> then\n broadcast (tUle lAhtI Uks !!!1! v)\n go to x: (543) y: (0)\n end\nend\n\nhide\nstop [this script v]\n\n
-Arrows or WASD to move(you can wall jump too!)\n-Don´t touch red\n-Yellow makes you jump high\n-You can swim in blue\n-There are currently 13 levels (more coming soon)\n\nwow 1k views.\n\n
Grey's Mission (Platformer + animation) PART 3
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop4 v)\n\nwhen I receive [menu v]\nswitch backdrop to (backdrop3 v)\n\nwhen I receive [cutscene v]\nswitch backdrop to (backdrop5 v)\n\nwhen I receive [start game v]\nswitch backdrop to (backdrop3 v)\n\nwhen I receive [next level v]\nif <([costume # v] of [sprite4 v]) = [9]> then\n switch backdrop to (backdrop6 v)\nend\n\n@Sprite3\n\nwhen flag clicked\ngo to [front v] layer\nset [brightness v] effect to (0)\ngo to x: (0) y: (0)\nset size to (80) %\nhide\n\nwhen I receive [cutscene v]\ngo to x: (52) y: (-36)\nset [ghost v] effect to (100)\nshow\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nswitch costume to (costume1 v)\nbroadcast (text v)\n\nwhen I receive [bounce v]\ngo to x: (52) y: (-36)\nswitch costume to (costume1 v)\nglide (0.2) secs to x: (52) y: (-46)\nswitch costume to (costume2 v)\nglide (0.2) secs to x: (52) y: (-36)\n\nwhen I receive [end cutscene v]\ngo to x: (52) y: (-36)\nset [ghost v] effect to (100)\nshow\nrepeat (100)\n change [ghost v] effect by (1)\nend\nswitch costume to (costume1 v)\nbroadcast (Start game v)\n\nwhen I receive [start game v]\nhide\n\nwhen flag clicked\nset volume to (20) %\nforever\n play sound [Short piece of relaxing music Taste of colors.mp3 v] until done\nend\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\nset volume to (50) %\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nshow\ngo to [front v] layer\nset rotation style [left-right v]\npoint in direction (90)\nset size to (100) %\nforever\n go to (sprite2 v)\n if <key (right arrow v) pressed?> then\n point in direction (90)\n switch costume to (costume2 v)\n end\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n switch costume to (costume2 v)\n end\n if <not <<<key (right arrow v) pressed?> or <key (left arrow v) pressed?>> or <key (up arrow v) pressed?>>> then\n switch costume to (costume1 v)\n end\n if <key (up arrow v) pressed?> then\n switch costume to (costume3 v)\n end\n if <<key (space v) pressed?> and <(db?) = [1]>> then\n switch costume to (costume4 v)\n point in direction (90)\n set rotation style [all around v]\n repeat (24)\n go to (sprite2 v)\n turn right (15) degrees\n end\n set rotation style [left-right v]\n end\nend\n\nwhen I receive [in v]\n\nwhen I receive [next level v]\nset size to (100) %\n\nset size to (100) %\nswitch costume to (costume4 v)\nrepeat (10)\n change size by (-10)\nend\n\ngo to [front v] layer\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\n@Sprite2\n\nwhen I receive [start game v]\nshow\nset [ghost v] effect to (100)\ngo to x: (-220) y: (-90)\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <(stop) = [0]> then\n change [yv v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n end\n set [xv v] to ((XV) * (0.9))\n change x by (XV)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [yv v] to [7]\n if <(XV) > [0]> then\n set [xv v] to [-10]\n else\n set [xv v] to [10]\n end\n else\n change x by ((XV) * (-1))\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (YV)\n if <touching (sprite4 v)?> then\n change y by ((YV) * (-1))\n set [yv v] to [0]\n set [db? v] to [0]\n end\n change y by (-0.5)\n if <<touching (sprite4 v)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [7]\n set [db? v] to [1]\n end\n if <<key (space v) pressed?> and <(db?) = [1]>> then\n set [yv v] to [8]\n set [db? v] to [0]\n end\n change y by (0.5)\n end\n if <touching (sprite6 v)?> then\n go to (sprite6 v)\n end\n if <<touching (sprite12 v)?> or <touching (sprite13 v)?>> then\n go to x: (-220) y: (-90)\n set [stop v] to [0]\n set [xv v] to [0]\n set [yv v] to [0]\n end\n if <key (r v) pressed?> then\n go to x: (-220) y: (-90)\n set [stop v] to [0]\n set [xv v] to [0]\n set [yv v] to [0]\n end\nend\n\nwhen flag clicked\n\nchange [yv v] by (3)\n\nwhen I receive [next level v]\ngo to x: (-220) y: (-90)\nset [stop v] to [0]\nset [yv v] to [0]\nset [xv v] to [0]\n\nif <touching color (#ffff00)?> then\nend\n\nwait (1) seconds\n\nwhen flag clicked\nhide\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\n@Sprite4\n\nwhen I receive [start game v]\nswitch costume to (1 v)\ngo to x: (0) y: (0)\nset [stop v] to [0]\nshow\n\nwhen I receive [next level v]\nnext costume\nset [stop v] to [0]\n\nwhen flag clicked\nswitch costume to (1 v)\nhide\n\n@Sprite5\n\nwhen flag clicked\nshow\nset [ghost v] effect to (99)\ngo to x: (0) y: (0)\nset size to (1) %\nrepeat (99)\n change [ghost v] effect by (-1)\n change size by (1)\nend\nrepeat (99)\n change [ghost v] effect by (1)\n change size by (1)\nend\nbroadcast (logo v)\n\nwhen I receive [start game v]\nhide\n\n@Sprite12\n\nwhen flag clicked\nhide\nerase all\n\nforever\nend\n\nset [bounce v] to []\n\nrepeat (10)\nend\nrepeat (10)\nend\n\nchange y by (bounce)\n\nset [bounce v] to ((bounce) * (0.9))\n\nwhen backdrop switches to [5 v]\n\nwhen I start as a clone\n\nchange x by (10)\n\nset x to (0)\n\nset y to (-68)\n\nset y to (-68)\n\nforever\n wait (0.05) seconds\n next costume\nend\n\nset [bounce v] to [6]\n\ngo to x: (17) y: (-85)\n\nglide (1) secs to x: (200) y: (-39)\n\nwhen backdrop switches to [5 v]\n\nforever\n if <touching (staff v)?> then\n hide\n broadcast (meep v)\n broadcast (staff back v)\n stop [other scripts in sprite v]\n stop [this script v]\n end\nend\n\nwhen I receive [start game v]\nwait (0.1) seconds\nhide\nwait until <([costume # v] of [sprite4 v]) = [4]>\nshow\nforever\n glide (1) secs to x: (-100) y: (-110)\n glide (1) secs to x: (39) y: (-110)\n glide (1) secs to x: (200) y: (-110)\n glide (1) secs to x: (39) y: (-110)\nend\n\nwhen I receive [start game v]\nwait (0.1) seconds\nwait until <([costume # v] of [sprite4 v]) = [4]>\nshow\ngo to x: (34) y: (-39)\nswitch costume to (costume1 v)\nforever\n wait (0.05) seconds\n next costume\nend\n\nforever\n glide (1) secs to x: (-100) y: (-39)\n glide (1) secs to x: (39) y: (-39)\n glide (1) secs to x: (200) y: (-39)\n glide (1) secs to x: (39) y: (-39)\nend\n\nwhen I receive [start game v]\n\nwhen backdrop switches to [5 v]\n\nwhen I receive [next level v]\nwait until <([costume # v] of [sprite4 v]) = [5]>\nhide\nstop [other scripts in sprite v]\n\n@staff\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\n\nwhen I receive [staff back v]\n\ngo to x: (200) y: (100)\n\nif then\nend\n\nif <<touching (sprite7 v)?> or <touching (sprite9 v)?>> then\n repeat (15)\n turn right (15) degrees\n change x by ((([x position v] of [sprite4 v]) - (x position)) / (5))\n change y by ((([y position v] of [sprite4 v]) - (y position)) / (5))\n end\nend\n\nrepeat (15)\n turn right (15) degrees\n change x by ((([x position v] of [sprite4 v]) - (x position)) / (5))\n change y by ((([y position v] of [sprite4 v]) - (y position)) / (5))\nend\n\nset [shoot v] to [0]\n\nwhen flag clicked\n\nif then\nend\n\nif <mouse down?> then\n if <(shoot) = [0]> then\n set [shoot v] to [1]\n repeat (30)\n point towards (mouse-pointer v)\n move (10) steps\n end\n set [shoot v] to [0]\n end\n if <(shoot) = [1]> then\n repeat (15)\n turn right (15) degrees\n change x by ((([x position v] of [sprite4 v]) - (x position)) / (5))\n change y by ((([y position v] of [sprite4 v]) - (y position)) / (5))\n end\n end\n point in direction (90)\n set [shoot v] to [0]\nend\n\nwhen I receive [start game v]\nshow\npoint in direction (90)\ngo to x: (200) y: (100)\ngo to [front v] layer\nswitch costume to (costume1 v)\nset [shoot v] to [0]\nforever\n if <(shoot) = [0]> then\n if <([direction v] of [sprite1 v]) = [90]> then\n change x by (((([x position v] of [sprite1 v]) - (x position)) - (20)) / (5))\n set size to (100) %\n change y by ((([y position v] of [sprite1 v]) - (y position)) / (5))\n end\n if <([direction v] of [sprite1 v]) = [-90]> then\n change x by (((([x position v] of [sprite1 v]) - (x position)) + (20)) / (5))\n set size to (100) %\n change y by ((([y position v] of [sprite1 v]) - (y position)) / (5))\n end\n end\nend\n\n@Sprite6\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nwait (1) seconds\nshow\ngo to x: (207) y: (-102)\nset [stop v] to [0]\nset [ghost v] effect to (100)\nset size to (25) %\nforever\n if <touching (sprite2 v)?> then\n wait (0.05) seconds\n set [stop v] to [1]\n end\n if <not <<<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>> or <([costume # v] of [sprite4 v]) = [8]>>> then\n go to x: (207) y: (-102)\n end\n if <<<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>> or <([costume # v] of [sprite4 v]) = [8]>> then\n go to x: (207) y: (150)\n end\nend\n\nforever\nend\n\nnext costume\n\nswitch costume to (costume9 v)\nrepeat (8)\n switch costume to ((costume [number v]) - (1))\n wait (0.1) seconds\nend\nbroadcast (in v)\n\nif <<([costume # v] of [sprite4 v]) = [1]> or <([costume # v] of [sprite4 v]) = [2]>> then\n go to x: (207) y: (-102)\nend\nif <([costume # v] of [sprite4 v]) = [3]> then\n go to x: (207) y: (150)\nend\n\nif <not <<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>>> then\n go to x: (207) y: (-102)\nend\nif <<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>> then\n go to x: (207) y: (150)\nend\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\n\n@Sprite7\n\nwhen flag clicked\nhide\n\nwhen flag clicked\n\nwhen I receive [logo v]\nshow\nset [ghost v] effect to (99)\ngo to x: (0) y: (0)\nset size to (1) %\nrepeat (99)\n wait (0.05) seconds\n change [ghost v] effect by (-1)\n change size by (1)\nend\nrepeat (99)\n wait (0.05) seconds\n change [ghost v] effect by (1)\n change size by (1)\nend\nbroadcast (menu v)\n\nwhen I receive [menu v]\ngo to x: (0) y: (98)\nset size to (150) %\n\nwhen I receive [start game v]\nhide\n\n@Sprite8\n\nwhen I receive [menu v]\ngo to [front v] layer\ngo to x: (0) y: (-25)\nshow\nset [ghost v] effect to (100)\nset size to (150) %\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nrepeat until <<touching (mouse-pointer v)?> and <mouse down?>>\n if <touching (mouse-pointer v)?> then\n set size to (200) %\n else\n set size to (150) %\n end\nend\nrepeat (50)\n change [ghost v] effect by (2)\nend\nhide\nbroadcast (cutscene v)\nstop [this script v]\n\nbroadcast (oof v)\n\nwhen flag clicked\nhide\n\nwait until \n\n@Sprite9\n\ndefine Type []\nset x to (-230)\nset [letter v] to (letter (1) of (x))\nswitch costume to (letter (1) of (x))\nset [# v] to [1]\nrepeat (length of (x))\n stamp\n change x by (10)\n change [# v] by (1)\n switch costume to (letter (#) of (x))\nend\n\nwhen [space v] key pressed\n\ndefine Next line\nchange y by (-20)\n\nNext line\n\nwhen I receive [text v]\nset [brightness v] effect to (100)\nset size to (110) %\ngo to x: (-220) y: (160)\nerase all\nType [did you recieve my orders?]\nNext line\nType [i gave you a mission.]\nNext line\nType [have you fullfilled your mission duties yet?]\nwait (5) seconds\nbroadcast (bounce v)\nset [brightness v] effect to (100)\nset size to (110) %\ngo to x: (-220) y: (160)\nerase all\nType [good.]\nNext line\nType [return home please.]\nNext line\nType [that staff is going to be needed.]\nhide\nwait (5) seconds\nbroadcast (end cutscene v)\nerase all\n\nwhen flag clicked\n\n@Sprite10\n\nwhen flag clicked\nhide\n\nwhen I receive [start game v]\nwait (1) seconds\nshow\ngo to x: (207) y: (-102)\nset [stop v] to [0]\nswitch costume to (costume9 v)\nforever\n if <<(stop) = [1]> and <touching (sprite1 v)?>> then\n wait (0.05) seconds\n set [stop v] to [1]\n switch costume to (costume9 v)\n repeat (8)\n switch costume to ((costume [number v]) - (1))\n wait (0.1) seconds\n end\n broadcast (in v)\n wait (1) seconds\n set [stop v] to [0]\n switch costume to (costume9 v)\n end\n if <<(stop) = [1]> and <not <touching (sprite1 v)?>>> then\n set [stop v] to [0]\n end\n if <not <<<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>> or <([costume # v] of [sprite4 v]) = [8]>>> then\n show\n go to x: (207) y: (-102)\n end\n if <<<([costume # v] of [sprite4 v]) = [3]> or <([costume # v] of [sprite4 v]) = [4]>> or <([costume # v] of [sprite4 v]) = [8]>> then\n show\n go to x: (207) y: (150)\n end\n if <([costume # v] of [sprite4 v]) = [10]> then\n broadcast (end v)\n stop [this script v]\n end\nend\n\nforever\nend\n\nnext costume\n\nset [stop v] to [0]\n\nbroadcast (in v)\n\nwait (1) seconds\n\nbroadcast (next level v)\n\ngo to x: (10) y: (-102)\n\n@Sprite11\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\nwhen I receive [start game v]\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\n\nwhen I receive [in v]\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nbroadcast (next level v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nbroadcast (next level v)\n\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nbroadcast (next level v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nbroadcast (next level v)\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwhen I receive [start game v]\ngo to [front v] layer\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n go to [front v] layer\n change [ghost v] effect by (-10)\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nrepeat (10)\n go to [front v] layer\n change [ghost v] effect by (-10)\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\nwhen I receive [end v]\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nshow\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nbroadcast (final cutscene v)\n\n@Sprite13\n\nwhen flag clicked\nswitch costume to (1 v)\nhide\n\nwhen I receive [start game v]\nswitch costume to (1 v)\ngo to x: (0) y: (0)\nset [stop v] to [0]\nshow\n\nwhen I receive [next level v]\nnext costume\nset [stop v] to [0]\n\n@Sprite14\n\nforever\nend\n\nforever\nend\n\nwhen I receive [final cutscene v]\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nclear graphic effects\ngo to [front v] layer\nset [ghost v] effect to (100)\nshow\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nwait (3) seconds\nrepeat (50)\n change [ghost v] effect by (2)\nend\nnext costume\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nrepeat (3)\n wait (3) seconds\n next costume\nend\nrepeat (100)\n change [ghost v] effect by (1)\nend\nnext costume\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nrepeat (14)\n wait (0.05) seconds\n next costume\nend\nwait (1) seconds\nrepeat (50)\n change [ghost v] effect by (2)\nend\nnext costume\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nwait (1) seconds\nrepeat (2)\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (2) seconds\nend\nstop all sounds\nstart sound [DJ Striden - Lunar \[Video Game\] by DJ Striden.mp3 v]\nrepeat (5)\n wait (0.05) seconds\n next costume\nend\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (9)\n wait (0.05) seconds\n next costume\nend\nwait (2) seconds\nrepeat (100)\n change [ghost v] effect by (1)\nend\nnext costume\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nwait (3) seconds\nnext costume\nwait (2) seconds\nrepeat (2)\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (1) seconds\nend\nwait (1) seconds\nrepeat (100)\n change [ghost v] effect by (1)\nend\nnext costume\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nwait (2) seconds\nnext costume\nwait (2) seconds\nrepeat (100)\n change [ghost v] effect by (1)\nend\nnext costume\nrepeat (100)\n change [ghost v] effect by (-1)\nend\nstop [all v]\n\nwait (3) seconds\nrepeat (50)\n change [ghost v] effect by (2)\nend\nnext costume\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nrepeat (3)\n wait (3) seconds\n next costume\nend\n\nrepeat (14)\nend\n\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext costume\nrepeat (10)\n change [ghost v] effect by (-10)\nend\nwait (2) seconds\n\nwait (3) seconds\nnext costume\nwait (2) seconds\nrepeat (2)\n repeat (10)\n change [ghost v] effect by (10)\n end\n next costume\n repeat (10)\n change [ghost v] effect by (-10)\n end\n wait (1) seconds\nend\n\nwhen flag clicked\ngo to x: (0) y: (0)\nswitch costume to (costume1 v)\nclear graphic effects\nset [ghost v] effect to (100)\nhide\n\n@Sprite15\n\nwhen flag clicked\nswitch costume to (1 v)\nhide\n\nwhen I receive [start game v]\nswitch costume to (1 v)\ngo to x: (0) y: (0)\nset [stop v] to [0]\nshow\n\nwhen I receive [next level v]\nnext costume\nset [stop v] to [0]\n\n
Scorch-A platformer
@Stage\n\n@Ground\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen I receive [ground show v]\nshow\ngo to [back v] layer\nshow\nswitch costume to (ground 1 v)\n\nwhen I receive [next costume v]\nnext costume\nwait (1) seconds\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [9]> then\n broadcast (Ride v)\n stop [this script v]\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [10]> then\n broadcast (Hide Ride v)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [15]> then\n broadcast (Entrance v)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [15]> then\n broadcast (Entrance v)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [16]> then\n broadcast (Great Caves v)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [20]> then\n broadcast (Water v)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <(costume [number v]) = [20]> then\n broadcast (Done v)\n end\nend\n\n@Player\n\nwhen flag clicked\nhide\n\nwhen flag clicked\nset [game mode v] to [Lobby]\n\nwhen I receive [ground show v]\ngo to x: (-216) y: (-93)\nshow\ngo to [front v] layer\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-0.7)\n switch costume to (costume2 v)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (0.7)\n switch costume to (costume1 v)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (1)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (1)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (1)\n if < or <touching (ride v)?>> then\n change y by (1)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (1)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (1)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <<touching (ground v)?> or <touching (ride v)?>> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<<touching (ground v)?> or <touching (ride v)?>> and <key (up arrow v) pressed?>> then\n set [y v] to [6.5]\n end\n change y by (0.5)\nend\n\nwhen I receive [ground show v]\nforever\n if <(x position) > [244]> then\n broadcast (Next costume v)\n go to x: (-216) y: (-93)\n wait (1) seconds\n end\nend\n\nwhen flag clicked\nforever\n if <<(y position) < [-185]> or <touching (dead water v)?>> then\n go to x: (-216) y: (-93)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <touching (quicksand v)?> then\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching (quicksand v)?> then\n change y by (0)\n if <touching (quicksand v)?> then\n change y by (0)\n if <touching (quicksand v)?> then\n change y by (0)\n if <touching (quicksand v)?> then\n change y by (0)\n if <touching (quicksand v)?> then\n change y by (-0.1)\n if <touching (quicksand v)?> then\n change y by (-0.1)\n if <touching (quicksand v)?> then\n change y by (-1.5)\n if <key (up arrow v) pressed?> then\n set [y v] to [3]\n if <(x) > [0]> then\n set [x v] to [-3]\n else\n set [x v] to [3]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching (quicksand v)?> then\n change y by ((y) * (-1))\n set [y v] to [1]\n end\n change y by (-0.5)\n if <<touching (quicksand v)?> and <key (up arrow v) pressed?>> then\n set [y v] to [3]\n end\n change y by (-0.5)\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <touching (water v)?> then\n change [y v] by (4)\n if <key (left arrow v) pressed?> then\n change [x v] by (-5)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (5)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching (water v)?> then\n change y by (0)\n if <touching (water v)?> then\n change y by (0)\n if <touching (water v)?> then\n change y by (0)\n if <touching (water v)?> then\n change y by (0)\n if <touching (water v)?> then\n change y by (-0.1)\n if <touching (water v)?> then\n change y by (-0.1)\n if <touching (water v)?> then\n change y by (-1.5)\n if <key (up arrow v) pressed?> then\n set [y v] to [3]\n if <(x) > [0]> then\n set [x v] to [-3]\n else\n set [x v] to [3]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching (water v)?> then\n change y by ((y) * (-1))\n set [y v] to [1]\n end\n change y by (-0.5)\n if <<touching (water v)?> and <key (up arrow v) pressed?>> then\n set [y v] to [3]\n end\n if <<touching (water v)?> and <key (down arrow v) pressed?>> then\n set [y v] to [-3]\n end\n change y by (4)\n end\nend\n\n@Loading Screen\n\nwhen flag clicked\nstart sound [Fearless First v]\nhide\n\nwhen I receive [start v]\nforever\n set [game mode v] to [Loading]\n show\n go to x: (0) y: (0)\n switch costume to (costume1 v)\n repeat (16)\n wait (.3) seconds\n next costume\n end\n broadcast (Ground Show v) and wait\n start sound [Industrial Cinematic v]\n hide\nend\n\nwhen I receive [ground show v]\nset [game mode v] to [Playing]\nstop all sounds\nforever\n hide\nend\n\nwhen I receive [ground show v]\nstart sound [Industrial Cinematic v]\n\nstart sound [Man Down v]\n\nstop all sounds\n\nwhen I receive [great caves v]\n\nplay sound [Man Down v] until done\n\nwhen I receive [entrance v]\nstart sound [Man Down v]\n\nstop all sounds\n\nstop [other scripts in sprite v]\n\n\n\nforever\n\nclear sound effects\n\n@Main Lobby\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\n\nwhen I receive [ground show v]\nhide\n\nwhen I receive [start v]\nhide\n\n@Play (Scorch) (1)\n\nwhen flag clicked\ngo to [front v] layer\nswitch costume to (costume2 v)\nshow\ngo to x: (0) y: (0)\nforever\n if <touching (mouse-pointer v)?> then\n switch costume to (costume3 v)\n start sound [recording1 v]\n wait until <<mouse down?> or <not <touching (mouse-pointer v)?>>>\n else\n switch costume to (costume2 v)\n end\n if <<touching (mouse-pointer v)?> and <<mouse down?> and <(Game Mode) = [Lobby]>>> then\n broadcast (Start v)\n hide\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nhide\n\nwhen I receive [ground show v]\nswitch costume to (costume1 v)\nforever\n go to x: (0) y: (0)\n show\n go to [back v] layer\nend\n\nwhen I receive [entrance v]\nswitch costume to (costume2 v)\n\nwhen I receive [great caves v]\nswitch costume to (costume3 v)\n\nwhen I receive [done v]\nhide\n\n@Sprite2\n\nwhen flag clicked\nforever\n hide\nend\n\nwhen I receive [poison v]\nshow\ngo to [front v] layer\nrepeat (10)\n next costume\n wait (1) seconds\nend\n\nrepeat until <[] > [50]>\nend\n\n@Narrator\n\nwhen flag clicked\nhide\n\nwhen I receive [ground show v]\ngo to x: (17) y: (56)\nswitch costume to (scorch 1 v)\nshow\n\nwhen I receive [next costume v]\ngo to x: (17) y: (56)\nnext costume\n\n@Ride\n\nwhen flag clicked\ngo to x: (-175) y: (-136)\nhide\ngo to [back v] layer\n\nwhen I receive [ride v]\ngo to [front v] layer\nshow\nrepeat until <([costume # v] of [ground v]) = [10]>\n glide (3) secs to x: (155) y: (-136)\n wait (3) seconds\n glide (3) secs to x: (-175) y: (-136)\n wait (3) seconds\nend\ngo to [back v] layer\nhide\nstop [this script v]\n\nwhen I receive [ground show v]\nhide\ngo to [back v] layer\n\nwhen I receive [hide ride v]\nhide\ngo to [back v] layer\n\n@Dead Water\n\nwhen flag clicked\nhide\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [10]> then\n switch costume to (costume1 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen I receive [ground show v]\nhide\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [11]> then\n hide\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [12]> then\n switch costume to (costume2 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [13]> then\n hide\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [17]> then\n switch costume to (costume3 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [18]> then\n switch costume to (costume4 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [19]> then\n switch costume to (costume5 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [20]> then\n hide\n end\nend\n\n@Quicksand\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [12]> then\n go to x: (0) y: (0)\n switch costume to (costume2 v)\n show\n end\nend\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [11]> then\n switch costume to (costume1 v)\n go to x: (0) y: (0)\n show\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [ground show v]\nhide\n\nwhen I receive [ground show v]\nforever\n if <([costume # v] of [ground v]) = [13]> then\n hide\n end\nend\n\n@Thumbnail\n\nwhen flag clicked\nforever\n show\n go to [front v] layer\n set [ghost v] effect to (100)\n go to x: (0) y: (0)\nend\n\n@Water\n\nwhen flag clicked\nhide\n\nwhen I receive [ground show v]\nhide\n\nwhen I receive [water v]\nshow\ngo to [back v] layer\ngo to x: (0) y: (0)\n\n
++++++++++++++++Scorch++++++++++++++++\nThe whole world was scorched four years ago. Earthquakes, tidal waves, hurricanes and tornados beated the earth, and then all the water seeped deep into the earth. It's your job to find it!\n-DOUBLE CLICK GREEN FLAG\n-Arrow keys to move\n-Don't touch hazards\n-Leave a love, fave and follow\n\n
Immunity - A Platformer
@Stage\n\nwhen flag clicked\nshow variable [actual level lol v]\nset [level v] to [1]\nset [actual level lol v] to (join (Level) [/9])\nswitch backdrop to (Level)\nforever\n play sound [Immunity - Dex Arson v] until done\nend\n\nset volume to (10) %\n\nwhen I receive [next level v]\nif <(Level) = [10]> then\n set [actual level lol v] to [GG You did it!!!]\n switch backdrop to (10 v)\nelse\n change [level v] by (1)\n set [actual level lol v] to (join (Level) [/9])\n switch backdrop to (Level)\nend\n\nwhen flag clicked\nforever\n if <key (s v) pressed?> then\n broadcast (next level v)\n wait (1) seconds\n end\nend\n\n@Sprite1\n\nwhen flag clicked\nset [x v] to [0]\nset [y v] to [0]\nshow\ngo to x: (-171) y: (-22)\nswitch costume to (costume1 v)\nwait (0.5) seconds\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if <touching color (#ff0000)?> then\n switch costume to (costume2 v)\n broadcast (message1 v)\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#003fff)?> then\n broadcast (next level v)\n end\nend\n\nwhen I receive [next level v]\nset [x v] to [0]\nset [y v] to [0]\nswitch costume to (costume1 v)\nshow\ngo to x: (-171) y: (-22)\nwait (0.5) seconds\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if <touching color (#ff0000)?> then\n switch costume to (costume2 v)\n broadcast (message1 v)\n stop [this script v]\n end\nend\n\nwhen I receive [dead v]\nset [x v] to [0]\nset [y v] to [0]\nswitch costume to (costume1 v)\nshow\ngo to x: (-171) y: (-22)\nwait (0.5) seconds\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if <touching color (#ff0000)?> then\n switch costume to (costume2 v)\n broadcast (message1 v)\n stop [this script v]\n end\nend\n\nplay sound [Virtual Riot - Idols \(EDM Mashup\).mp3 v] until done\n\n@Sprite2\n\nwhen I receive [dead v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [message1 v]\nset [x v] to [0]\nset [y v] to [0]\nswitch costume to (costume1 v)\nshow\ngo to x: (-171) y: (-22)\nwait (0.5) seconds\nforever\n change [y v] by (-0.5)\n if <key (left arrow v) pressed?> then\n change [x v] by (-1)\n end\n if <key (right arrow v) pressed?> then\n change [x v] by (1)\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n change x by ((x) * (-1))\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#000008)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-0.5)\n if <<touching color (#000008)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\n end\n change y by (0.5)\n if <touching color (#ff0000)?> then\n switch costume to (costume2 v)\n broadcast (dead v)\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [message1 v]\nforever\n if <touching color (#003fff)?> then\n broadcast (next level v)\n hide\n go to x: (-171) y: (-22)\n stop [other scripts in sprite v]\n end\nend\n\nset [x v] to [0]\nset [y v] to [0]\n\n@Sprite3\n\n@Sprite4\n\nwhen flag clicked\nhide\n\ngo to x: (0) y: (0)\n\nhide variable [actual level lol v]\n\nhide variable [level v]\n\n
Use the arrow keys to move your player. If needed, let your player self destruct (by touching red) and then complete the level with your 2nd player! Remember, you can only die once or else you restart the level. Also please no advertising. Check lower to see some updates!\n\n~~~~~~~~~~~~~~~~~~UPDATES~~~~~~~~~~~~~~~~~~\nFebruary 6, 2019 - fixed bug where you move a lot after dying\nFebruary 9, 2019 - Nerfed Level 7 because people were having trouble with it\nFebruary 10, 2019 - added a "skip level" option (see level 3 to see how to skip)
A Ninjago Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (title v)\nforever\n forever\n if <(backdrop) = [1]> then\n switch backdrop to (1 v)\n end\n if <(backdrop) = [2]> then\n switch backdrop to (2 v)\n end\n if <(backdrop) = [3]> then\n switch backdrop to (3 v)\n end\n if <(backdrop) = [4]> then\n switch backdrop to (4 v)\n end\n if <(backdrop) = [5]> then\n switch backdrop to (5 v)\n end\n if <(backdrop) = [6]> then\n switch backdrop to (6 v)\n end\n if <(backdrop) = [7]> then\n switch backdrop to (7 v)\n end\n if <(backdrop) = [8]> then\n switch backdrop to (8 v)\n end\n if <(backdrop) = [9]> then\n switch backdrop to (9 v)\n end\n if <(backdrop) = [10]> then\n switch backdrop to (10 v)\n end\n if <(backdrop) = [Title]> then\n switch backdrop to (title v)\n end\n if <(backdrop) = [Pause]> then\n switch backdrop to (pause v)\n end\n end\nend\n\nwhen I receive [finish v]\nset [backdrop v] to (Level)\n\nset [level v] to [9]\n\n@Player\n\nwhen flag clicked\nset [☁ time v] to [0]\nset [x vel v] to [0]\nset [game v] to [Title]\nset [level v] to [0]\nset [backdrop v] to [Title]\nhide\nset size to (100) %\ngo to [front v] layer\ngo to x: (2) y: (2)\nforever\n if <(Game) = [Play]> then\n show\n set [level v] to [1]\n go to x: (-205) y: (-129)\n point in direction (90)\n forever\n if <<(Level) = [7]> or <(Level) = [8]>> then\n platform physics [-1] [.5] [2.5] [7]\n else\n platform physics [-1] [.7] [2] [11]\n end\n if <<touching (spikes v)?> or <touching (crushers v)?>> then\n go to x: (-205) y: (-129)\n set [x vel v] to [0]\n set [y vel v] to [0]\n broadcast (death v)\n end\n if <touching (finish v)?> then\n broadcast (next level v)\n change [level v] by (1)\n go to x: (-205) y: (-129)\n set [x vel v] to [0]\n point in direction (90)\n set [y vel v] to [-5]\n switch costume to (idle v)\n broadcast (finish v)\n end\n if <touching (trampolines v)?> then\n set [y vel v] to [17]\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n set [walk v] to [3]\n wait (0.05) seconds\n set [walk v] to [4]\n wait (0.05) seconds\nend\n\nwhen flag clicked\nforever\n broadcast (positon check v)\nend\n\nwhen flag clicked\nforever\n if <<(Level) = [7]> or <(Level) = [8]>> then\n set size to (50) %\n else\n set size to (100) %\n end\nend\n\nwhen flag clicked\nforever\n if <<(Game) = [Pause]> or <(Game) = [Title]>> then\n set [ghost v] effect to (100)\n else\n set [ghost v] effect to (0)\n end\nend\n\nwhen flag clicked\nforever\n if <not <<(Level) = [0]> or <(Level) = [10]>>> then\n if <key (t v) pressed?> then\n wait until <not <key (t v) pressed?>>\n broadcast (next level v)\n change [level v] by (1)\n go to x: (-205) y: (-129)\n set [x vel v] to [0]\n point in direction (90)\n set [y vel v] to [-5]\n switch costume to (idle v)\n broadcast (finish v)\n end\n end\nend\n\nwhen flag clicked\nset [☁ best time v] to (☁ Best Time)\nforever\n if <not <<(Level) = [0]> or <(Level) = [10]>>> then\n if <key (t v) pressed?> then\n wait until <not <key (t v) pressed?>>\n set [time v] to [9999]\n wait (5) seconds\n hide variable [time v]\n end\n end\n if <(Level) = [10]> then\n set [t? v] to [n]\n wait (0.004) seconds\n set [☁ time v] to (TIME)\n if <(☁ Best Time) > (☁ Time)> then\n set [☁ best time v] to (☁ Time)\n end\n end\nend\n\nwhen flag clicked\nwait until <(Game) = [Play]>\nforever\n if <<(Level) = [10]> or <(Game) = [Pause]>> then\n show variable [☁ best time v]\n else\n hide variable [☁ best time v]\n end\nend\n\nwhen flag clicked\n\nshow variable [☁ best time v]\nwait until <(Level) = [11]>\nforever\n\nset [☁ best time v] to [68.2]\n\nset [☁ time v] to [0]\n\nmove (7-10.52.5) steps\n\nmove (11-10.72) steps\n\nset [x plat speed v] to [jump]\n\nset [x plat speed v] to [gravity]\n\nset [x plat speed v] to [movement]\n\nset [x plat speed v] to [movement]\n\nset [x plat speed v] to [friction]\n\ndefine platform physics (gravity) (friction) (movement speed) (jump height)\nswitch costume to (hitbox v)\nchange y by (y vel)\nif <touching (ground v)?> then\n repeat ([abs v] of (y vel) )\n if <touching (ground v)?> then\n change y by ((-1) * (([abs v] of (y vel) ) / (y vel)))\n end\n end\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <not <(y vel) > [0]>>> then\n set [y vel v] to (jump height)\n else\n set [y vel v] to [0]\n end\nelse\n change [y vel v] by (gravity)\nend\nif <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x vel v] by (movement speed)\n point in direction (90)\nend\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x vel v] by ((-1) * (movement speed))\n point in direction (-90)\nend\nchange x by (x vel)\nif <touching (ground v)?> then\n set [old y v] to (y position)\n repeat (([abs v] of (x vel) ) + (1))\n if <touching (ground v)?> then\n change y by (1)\n end\n end\n if <touching (ground v)?> then\n set y to (old y)\n repeat ([ceiling v] of ([abs v] of (x vel) ) )\n if <touching (ground v)?> then\n change x by ((-1) * (([abs v] of (x vel) ) / (x vel)))\n end\n end\n set [x vel v] to [0]\n end\nend\nset [x vel v] to ((x vel) * (friction))\n\nswitch costume to (idle v)\nif <<<key (right arrow v) pressed?> or <key (d v) pressed?>> or <<key (left arrow v) pressed?> or <key (a v) pressed?>>> then\n switch costume to (Walk)\nend\nif <(y vel) > [1]> then\n switch costume to (jump v)\nend\nif <(y vel) < [-3]> then\n switch costume to (fall v)\nend\n\n@Ground\n\nwhen flag clicked\nset [ghost v] effect to (100)\nshow\nforever\n if <(Game) = [Play]> then\n set [ghost v] effect to (0)\n switch costume to (Level)\n go to x: (0) y: (0)\n switch costume to (costume1 v)\n end\nend\n\nwhen I receive [next level v]\n\nnext costume\n\nwhen flag clicked\nforever\n if <(Game) = [Pause]> then\n set [ghost v] effect to (100)\n end\nend\n\nset [☁ best time v] to [76.5]\n\n@Trampolines\n\nwhen flag clicked\nhide\nforever\n if <(Game) = [Play]> then\n show\n switch costume to (Level)\n go to x: (0) y: (0)\n switch costume to (costume1 v)\n end\nend\n\nwhen I receive [next level v]\n\nnext costume\n\nwhen flag clicked\nforever\n if <(Game) = [Pause]> then\n switch costume to (pause v)\n end\nend\n\n@Spikes\n\nwhen flag clicked\nhide\nforever\n if <(Game) = [Play]> then\n show\n switch costume to (Level)\n go to x: (0) y: (0)\n switch costume to (costume1 v)\n end\nend\n\nnext costume\n\nwhen I receive [next level v]\n\nwhen flag clicked\nforever\n if <(Game) = [Pause]> then\n switch costume to (pause v)\n end\nend\n\n@Finish\n\nbroadcast (next level v)\n\nwhen flag clicked\nforever\n next costume\n wait (0.05) seconds\nend\n\nwhen flag clicked\nforever\n if <<(Level) = [7]> or <(Level) = [8]>> then\n set size to (50) %\n else\n set size to (70) %\n end\nend\n\nset [level v] to [9]\n\nwhen flag clicked\nset [game v] to [Title]\nhide\ngo to [front v] layer\nforever\n if <(Game) = [Play]> then\n show\n go to x: (0) y: (0)\n set size to (70) %\n forever\n if <(Level) = [1]> then\n go to x: (-202) y: (65)\n end\n if <(Level) = [2]> then\n go to x: (190) y: (131)\n end\n if <(Level) = [3]> then\n go to x: (190) y: (120)\n end\n if <(Level) = [4]> then\n go to x: (5) y: (-45)\n end\n if <(Level) = [5]> then\n go to x: (210) y: (85)\n end\n if <(Level) = [6]> then\n go to x: (187) y: (139)\n end\n if <(Level) = [7]> then\n go to x: (198) y: (150)\n end\n if <(Level) = [8]> then\n go to x: (-106) y: (-7)\n end\n if <(Level) = [9]> then\n go to x: (-217) y: (36)\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n if <<<(Game) = [Pause]> or <(Game) = [Title]>> or <(Level) = [10]>> then\n hide\n else\n show\n end\nend\n\n@Bandana\n\nwhen flag clicked\nforever\n set [walk v] to [3]\n wait (0.05) seconds\n set [walk v] to [4]\n wait (0.05) seconds\nend\n\nwhen I receive [positon check v]\ngo to (player v)\n\nwhen flag clicked\nset [game v] to [Title]\nhide\nset size to (100) %\npoint in direction (90)\nforever\n if <(Game) = [Play]> then\n show\n forever\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (90)\n switch costume to (Walk)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (-90)\n switch costume to (Walk)\n end\n end\n end\nend\n\nwhen I receive [next level v]\npoint in direction (90)\n\nwhen flag clicked\nforever\n if <<(Level) = [7]> or <(Level) = [8]>> then\n set size to (50) %\n else\n set size to (100) %\n end\nend\n\nwhen flag clicked\nforever\n if <<(Game) = [Pause]> or <(Game) = [Title]>> then\n hide\n else\n show\n end\nend\n\n@Play\n\nwhen flag clicked\nshow variable [☁ best time v]\nset [time v] to [0]\nhide variable [time v]\ngo to [front v] layer\nforever\n set y to ((-30) + (([cos v] of (((timer) - (0)) * (170)) ) * (6)))\nend\n\nwhen flag clicked\nforever\n if <<(Game) = [Play]> or <(Game) = [Pause]>> then\n hide\n else\n show\n end\nend\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n set size to ((size) + (((120) - (size)) / (4))) %\n else\n set size to ((size) + (((100) - (size)) / (3))) %\n end\nend\n\nwhen this sprite clicked\nset [game v] to [Play]\nset [pause v] to [y]\nset [backdrop v] to [1]\nshow variable [time v]\nforever\n if <not <(Level) = [10]>> then\n if <(T?) = [y]> then\n wait (0.06) seconds\n change [time v] by (0.1)\n end\n if <(T?) = [n]> then\n set [time v] to (TIME)\n end\n end\nend\n\n@Music\n\nwhen flag clicked\ngo to [front v] layer\nforever\n repeat until <(Game) = [Play]>\n play sound [Calm Before The Storm - PaulRHJT v] until done\n end\nend\n\nwhen flag clicked\nwait (0.5) seconds\nforever\n if <(Game) = [Play]> then\n stop all sounds\n play sound [Jump! - PaulRHJT v] until done\n end\nend\n\nwhen I receive [death v]\nstart sound [death v]\n\nwhen I receive [finish v]\nstart sound [finish v]\n\nwhen flag clicked\nforever\n set y to ((0) + (([cos v] of (((timer) - (4)) * (170)) ) * (6)))\nend\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n set size to ((size) + (((27) - (size)) / (10))) %\n else\n set size to ((size) + (((20) - (size)) / (3))) %\n end\nend\n\nwhen flag clicked\nset volume to (100) %\nset size to (20) %\nswitch costume to (costume1 v)\ngo to x: (198) y: (0)\n\nwhen flag clicked\nforever\n if <(Game) = [Play]> then\n hide\n else\n show\n end\nend\n\nwhen this sprite clicked\nnext costume\nif <(volume) > [0]> then\n set volume to (0) %\nelse\n set volume to (100) %\nend\n\nwhen flag clicked\nforever\n go to [front v] layer\nend\n\n@Settings\n\nwhen flag clicked\nset [pause v] to [0]\nset [t? v] to [y]\nforever\n if <touching (mouse-pointer v)?> then\n set size to ((size) + (((70) - (size)) / (4))) %\n else\n set size to ((size) + (((50) - (size)) / (3))) %\n end\nend\n\nwhen flag clicked\nforever\n if <(pause) = [y]> then\n set x to (-213)\n set y to ((146) + (([cos v] of (((timer) - (7)) * (150)) ) * (6)))\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n switch backdrop to (pause v)\n set [game v] to [Pause]\n set [backdrop v] to [Pause]\n set [pause v] to [n]\n set [t? v] to [n]\n stop all sounds\n end\n else\n end\nend\n\nwhen flag clicked\nforever\n if <(pause) = [0]> then\n set x to (-170)\n set y to ((0) + (([cos v] of (((timer) - (7)) * (170)) ) * (6)))\n end\nend\n\nwhen flag clicked\nshow\nshow\nshow\nforever\n go to [front v] layer\nend\n\nwhen flag clicked\nforever\n if <(pause) = [n]> then\n set x to (-170)\n set y to ((0) + (([cos v] of (((timer) - (7)) * (170)) ) * (6)))\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n set [backdrop v] to (Level)\n set [game v] to [Play]\n set [pause v] to [y]\n set [t? v] to [y]\n end\n end\nend\n\n@Title\n\nwhen flag clicked\nforever\n if <<(Game) = [Play]> or <(Game) = [Pause]>> then\n hide\n else\n show\n end\nend\n\nwhen flag clicked\n\nwhen flag clicked\ngo to [front v] layer\nforever\n set y to ((100) + (([cos v] of (((timer) - (8)) * (170)) ) * (6)))\nend\n\n@Texture\n\nwhen flag clicked\nshow\ngo to x: (0) y: (0)\nset size to (150) %\nset [ghost v] effect to (96)\n\nhide\n\n@You Win!\n\nwhen flag clicked\nhide\nhide\nhide\nforever\n if <(Level) = [10]> then\n show\n go to x: (10) y: (42)\n end\nend\n\nset [level v] to [8]\n\nwhen flag clicked\nforever\n set y to ((37) + (([cos v] of (((timer) - (8)) * (170)) ) * (6)))\nend\n\n@Pause\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (0) y: (0)\nset size to (150) %\nforever\n if <(pause) = [n]> then\n show\n else\n hide\n end\nend\n\nwhen flag clicked\nforever\n set y to ((10) + (([cos v] of (((timer) - (8)) * (170)) ) * (6)))\nend\n\nwhen flag clicked\n\n@Thumbnail\n\nforever\n go to [front v] layer\n set [ghost v] effect to (0)\n show\n hide variable [☁ best time v]\nend\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\nforever\n go to [front v] layer\nend\n\n
-----------A NINJAGO PLATFORMER-------------\n-Arrow Keys or WASD to move/jump-\n\nObjective:- Flag- \n\nObstructions: -Spikes-\n\nHelpers: -Jump Panel- -"T" to Skip Level (except it sets your time to 9999!- :P
The Hardest Platformer Ever!
@Stage\n\n@Sprite1\n\nwhen backdrop switches to [backdrop30 v]\npen down\nwait (10) seconds\npen up\nerase all\nswitch backdrop to (backdrop31 v)\n\nwhen I receive [message1 v]\nset [clircles: v] to [1]\nswitch backdrop to (backdrop1 v)\nset [level v] to [1]\ngo to x: (-223) y: (-167)\nset [yv v] to [0]\n\nwhen backdrop switches to [backdrop49 v]\nrepeat until <not <(backdrop [name v]) = [backdrop49]>>\n if <key (3 v) pressed?> then\n switch backdrop to (backdrop50 v)\n change [level v] by (1)\n go to x: (-223) y: (-167)\n set [yv v] to [0]\n wait until <not <key (3 v) pressed?>>\n end\nend\n\nwhen backdrop switches to [backdrop46 v]\nrepeat until <not <(backdrop [name v]) = [backdrop46]>>\n if <key (space v) pressed?> then\n switch backdrop to (backdrop47 v)\n change [level v] by (1)\n go to x: (-223) y: (-167)\n set [yv v] to [0]\n wait until <not <key (space v) pressed?>>\n end\nend\n\nwhen backdrop switches to [backdrop25 v]\nset [clircles: v] to [0]\nwait (4) seconds\nif <(Clircles:) = [0]> then\n switch backdrop to (backdrop26 v)\nend\n\nwhen I receive [pause v]\nset [game v] to [0]\n\nwhen I receive [unpause v]\nset [game v] to [1]\n\nwhen flag clicked\nforever\n if <key (r v) pressed?> then\n start sound [pop v]\n set [yv v] to [0]\n go to x: (-223) y: (-167)\n change [deaths v] by (1)\n wait until <not <key (r v) pressed?>>\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#330066)?> then\n go to x: (138) y: (-158)\n end\nend\n\nwhen flag clicked\nset pen size to (5)\nerase all\npen up\nset pen color to (#666666)\nswitch backdrop to (backdrop1 v)\nset [ghost v] effect to (0)\nset [level v] to [1]\nset [deaths v] to [0]\nset [clircles: v] to [0]\nset [volume: v] to [100]\nset [game v] to [1]\nset [xv v] to [0]\nset [yv v] to [0]\nhide variable [sho v]\ngo to x: (-223) y: (-166)\npoint in direction (90)\nwait (2) seconds\nshow variable [sho v]\nshow\nforever\n if <(game) = [1]> then\n change [yv v] by (-0.5)\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.7)\n point in direction (90)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.7)\n point in direction (90)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-8]\n else\n set [xv v] to [8]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n if <touching color (#000008)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000008)?> then\n if <key (up arrow v) pressed?> then\n start sound [jump v]\n set [yv v] to [10]\n end\n end\n change y by (1)\n if <touching color (#ffff00)?> then\n start sound [next lvl v]\n set [yv v] to [0]\n go to x: (-223) y: (-167)\n switch backdrop to (next backdrop v)\n change [level v] by (1)\n set [starfound v] to [0]\n end\n if <touching color (#003fff)?> then\n start sound [jump v]\n set [yv v] to [15]\n end\n if <touching color (#00ffff)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [5]\n else\n set [yv v] to [-1]\n end\n end\n if <touching color (#ff0000)?> then\n start sound [bxsb v]\n repeat (10)\n change [ghost v] effect by (10)\n end\n set [yv v] to [0]\n set [xv v] to [0]\n go to x: (-223) y: (-167)\n set [ghost v] effect to (0)\n change [deaths v] by (1)\n end\n if <(level) = [101]> then\n set [sho v] to [The end!]\n end\n if <(level) < [101]> then\n set [sho v] to (join [Level ] (join (level) [/100]))\n end\n if <(backdrop [name v]) = [backdrop101]> then\n set [sho v] to [¯\_\(ツ\)_/¯]\n end\n if <(backdrop [name v]) = [backdrop103]> then\n set [sho v] to [♪~ ᕕ\(ᐛ\)ᕗ]\n end\n end\nend\n\nstart sound [jump v]\n\nwhen flag clicked\nset [starfound v] to [0]\nset [staramount v] to [0]\nforever\n set [stars v] to (join [Stars: ] (staramount))\nend\n\nwhen flag clicked\nforever\n if <(starfound) = [0]> then\n if <touching color (#ff99e5)?> then\n change [staramount v] by (1)\n set [starfound v] to [1]\n end\n end\nend\n\nchange [level v] by (1)\n\nchange [level v] by (1)\n\nwhen [x v] key pressed\nif <(skips) < [3]> then\n if then\n change [level v] by (1)\n next backdrop\n change [skips v] by (1)\n go to x: (-223) y: (-166)\n end\nend\n\nwhen flag clicked\nset [skips v] to [0]\n\nwhen flag clicked\nwait until <(level) = [6]>\nbroadcast (rotate v)\nwait until <(level) = [7]>\nbroadcast (hide spin v)\n\nset [level v] to [54]\n\nforever\n\nchange [clircles: v] by (1)\n\nset [skips v] to [-999]\n\nwhen flag clicked\nwait until <key (p v) pressed?>\nwait until <key (l v) pressed?>\nwait until <key (s v) pressed?>\nwait until <key (h v) pressed?>\nwait until <key (e v) pressed?>\nwait until <key (l v) pressed?>\nwait until <key (p v) pressed?>\nset [skips v] to [-1000000000000000000000000000000000]\n\nset [skips v] to [-10000]\n\n@Sprite2\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen backdrop switches to [backdrop49 v]\nhide\n\nwhen backdrop switches to [backdrop20 v]\nshow\nrepeat until <not <(backdrop [name v]) = [backdrop20]>>\n go to (mouse-pointer v)\nend\n\nwhen backdrop switches to [backdrop21 v]\nhide\n\nwhen backdrop switches to [backdrop48 v]\nswitch costume to (costume2 v)\nshow\nrepeat until <not <(backdrop [name v]) = [backdrop48]>>\n go to (mouse-pointer v)\nend\n\n@Sprite3\n\nwhen flag clicked\nhide\nforever\n if <touching (mouse-pointer v)?> then\n set size to (112.5) %\n else\n set size to (100) %\n end\nend\n\nwhen this sprite clicked\nstart sound [pop v]\nbroadcast (message1 v)\nhide\n\nwhen backdrop switches to [backdrop25 v]\nshow\nwait (4) seconds\nhide\n\n@Sprite4\n\nwhen backdrop switches to [null v]\nrepeat until <not <(backdrop [name v]) = [null]>>\n if <touching (mouse-pointer v)?> then\n show\n end\nend\n\nwhen flag clicked\ngo to x: (-51) y: (45)\nhide\n\nwhen backdrop switches to [null2 v]\nhide\n\nwhen backdrop switches to [backdrop101 v]\nrepeat until <not <(backdrop [name v]) = [backdrop101]>>\n if <touching (mouse-pointer v)?> then\n show\n end\nend\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\n@Sprite5\n\nwhen flag clicked\ngo to x: (-110) y: (-74)\nhide\n\nwhen backdrop switches to [null v]\nrepeat until <not <(backdrop [name v]) = [null]>>\n if <touching (mouse-pointer v)?> then\n show\n end\nend\n\nwhen backdrop switches to [null2 v]\nhide\n\n@Sprite8\n\nwhen flag clicked\nshow\nwait (2) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\n\nwhen flag clicked\nset volume to (100) %\nforever\n play sound [ComputerVirus v] until done\nend\n\n@Sprite6\n\nwhen flag clicked\nforever\n if <key (up arrow v) pressed?> then\n switch costume to (costume2 v)\n else\n switch costume to (costume1 v)\n end\nend\n\nwhen flag clicked\nforever\n go to x: (208) y: (163)\n set [ghost v] effect to (50)\n go to [front v] layer\nend\n\n@Sprite7\n\nwhen flag clicked\nforever\n if <key (right arrow v) pressed?> then\n switch costume to (costume2 v)\n else\n switch costume to (costume1 v)\n end\nend\n\nwhen flag clicked\nforever\n go to x: (228) y: (144)\n set [ghost v] effect to (50)\n go to [front v] layer\nend\n\n@Sprite10\n\nwhen flag clicked\nforever\n if <key (left arrow v) pressed?> then\n switch costume to (costume2 v)\n else\n switch costume to (costume1 v)\n end\nend\n\nwhen flag clicked\nforever\n go to x: (186) y: (144)\n set [ghost v] effect to (50)\n go to [front v] layer\nend\n\n
- Press X to skip a level; you have 3 skips\n- Only about half of all levels have been fully buffed\n- I think I need to rework the designs for the early levels...
Rotation: A 100% pen platformer no sound
@Stage\n\nwhen flag clicked\nforever\n play sound [ParagonX9 - Chaoz Airflow.mp3 v] until done\nend\n\nwhen I receive [music v]\nforever\n play sound [ParagonX9 - Chaoz Airflow.mp3 v] until done\nend\n\n@Render\n\ndefine Render\nif <(Render#) = [2]> then\n erase all\nend\nset [loop# v] to [1]\nif <not <(Collided?) = [4]>> then\n set [mysize v] to [15]\n if <(Render#) = [1]> then\n set [collided? v] to [0]\n end\nelse\n if <(Render#) = [2]> then\n change [mysize v] by (2)\n end\nend\nrepeat ((length of [lines v]) / (5))\n FindLinePoints (Loop#) (CamX) (CamY)\n DrawtoEdge (type)\n if <(Render#) = [2]> then\n DrawParticles (Loop#)\n end\n change [loop# v] by (5)\nend\nset [targetdir v] to (FutureDir)\nif <(Render#) = [2]> then\n change [glow v] by (DirTime)\n if <(Glow) < [30]> then\n set [dirtime v] to [3]\n set [glow v] to [30]\n else\n if <(Glow) > [120]> then\n set [dirtime v] to [-3]\n set [glow v] to [120]\n end\n end\n change [size v] by (DirSize)\n if <(Size) < [30]> then\n set [dirsize v] to [1]\n set [size v] to [30]\n repeat (2)\n Add Particle\n end\n else\n if <(Size) > [32]> then\n set [dirsize v] to [-1]\n set [size v] to [32]\n repeat (2)\n Add Particle\n end\n end\n end\n change [glowsize v] by (GlowSizeDir)\n if <(GlowSize) > [50]> then\n set [glowsize v] to [50]\n set [glowsizedir v] to [-4]\n else\n if <(GlowSize) < [30]> then\n set [glowsize v] to [30]\n set [glowsizedir v] to [4]\n end\n end\n if <not <<(round (MyX)) = (TargetX)> and <(round (MyY)) = (TargetY)>>> then\n DrawPlayer\n else\n change [level v] by (1)\n Reset (level)\n set [leveltime v] to (timer)\n end\n if <(MyX) < ((MinX) - (400))> then\n Reset (level)\n else\n if <(MyX) > ((MaxX) + (400))> then\n Reset (level)\n end\n end\n if <(MyY) < ((MinY) - (400))> then\n Reset (level)\n else\n if <(MyY) > ((MaxY) + (400))> then\n Reset (level)\n end\n end\nend\n\ndefine None\nif <not <(type) = [2]>> then\n if <not <<<(X1) > [240]> and <(X2) > [240]>> or <<(X1) < [-240]> and <(X2) < [-240]>>>> then\n if <not <<<(Y1) > [180]> and <(Y2) > [180]>> or <<(Y1) < [-180]> and <(Y2) < [-180]>>>> then\n if <(TargetDir) = (Dir)> then\n if <([floor v] of (X1) ) = ([floor v] of (X2) )> then\n Collide (0) <(Y1) > (Y2)> (Dir)\n else\n Collide (1) <(X1) > (X2)> (Dir)\n end\n else\n if <not <((Dir) mod (90)) = [0]>> then\n Cut to Edge\n end\n end\n if <(Render#) = [2]> then\n Draw (X1) (Y1) (X2) (Y2) (type)\n end\n end\n end\nelse\n if <not <<([abs v] of (X1) ) > [240]> or <([abs v] of (Y1) ) > [180]>>> then\n if <(Render#) = [2]> then\n Draw (X1) (Y1) (X2) (Y2) (2)\n end\n end\nend\n\ndefine ReadKeys\nif <<([abs v] of ((MyY) - (TargetY)) ) < [30]> and <([abs v] of ((MyX) - (TargetX)) ) < [30]>> then\n change [myx v] by (((TargetX) - (MyX)) / (8))\n change [myy v] by (((TargetY) - (MyY)) / (8))\nelse\n if <(Render#) = [1]> then\n if <key (right arrow v) pressed?> then\n change [velx v] by (1)\n end\n if <key (left arrow v) pressed?> then\n change [velx v] by (-1)\n end\n set [velx v] to ((VelX) * (0.9))\n change [vely v] by (-1)\n if <(Collided?) = [1]> then\n if <key (up arrow v) pressed?> then\n set [vely v] to [15]\n end\n else\n if <(Collided?) = [3]> then\n set [vely v] to [20]\n end\n end\n end\n Move\nend\nif <(Render#) = [1]> then\n set [dircos v] to ([cos v] of (Dir) )\n set [dirsin v] to ([sin v] of (Dir) )\nend\nFindPlayerLocation\n\ndefine None\nif <(dir) = [0]> then\n if <greater?> then\n if <<((PlayerY) - (15)) < (Y1)> and <((PlayerY) + (15)) > (Y2)>> then\n if <([abs v] of ((PlayerX) - (X1)) ) < [15]> then\n if <(Render#) = [1]> then\n MoveBack (0) (camdir)\n else\n MoveBack (3) (camdir)\n end\n end\n end\n else\n if <<((PlayerY) - (15)) < (Y2)> and <((PlayerY) + (15)) > (Y1)>> then\n if <([abs v] of ((PlayerX) - (X1)) ) < [15]> then\n if <(Render#) = [1]> then\n MoveBack (0) (camdir)\n else\n MoveBack (3) (camdir)\n end\n end\n end\n end\nelse\n if <greater?> then\n if <<((PlayerX) - (15)) < (X1)> and <((PlayerX) + (15)) > (X2)>> then\n if <([abs v] of ((PlayerY) - (Y1)) ) < [15]> then\n if <(Render#) = [2]> then\n MoveBack (1) (camdir)\n else\n MoveBack (2) (camdir)\n end\n end\n end\n else\n if <<((PlayerX) - (15)) < (X2)> and <((PlayerX) + (15)) > (X1)>> then\n if <([abs v] of ((PlayerY) - (Y1)) ) < [15]> then\n if <(Render#) = [2]> then\n MoveBack (1) (camdir)\n else\n MoveBack (2) (camdir)\n end\n end\n end\n end\nend\nFindPlayerLocation\n\ndefine DrawPlayer\npen up\nset pen size to ((MySize) * (2))\nif <not <(Collided?) = [4]>> then\n DrawTrail\nend\ngo to x: (PlayerX) y: (PlayerY)\nSet Pen Color to R: (0) G: (0) B: (100) Opacity ((256) - (((MySize) - (15)) * (6)))\npen down\npen up\nSet Pen Color to R: (0) G: (0) B: (200) Opacity ((256) - (((MySize) - (15)) * (6)))\nset pen size to (round ((MySize) * (1.3)))\npen down\npen up\nAddTrail\n\ndefine None\nset [type v] to (item (number) of [lines v])\nif <not <(type) = [2]>> then\n set [x1 v] to ((item ((number) + (1)) of [lines v]) - (camx))\n set [y1 v] to ((item ((number) + (2)) of [lines v]) - (camy))\n set [x2 v] to ((item ((number) + (3)) of [lines v]) - (camx))\n set [y2 v] to ((item ((number) + (4)) of [lines v]) - (camy))\n Rotate (DirCos) (DirSin) (1)\nelse\n set [x1 v] to ((item ((number) + (1)) of [lines v]) - (camx))\n set [y1 v] to ((item ((number) + (2)) of [lines v]) - (camy))\n Rotate (DirCos) (DirSin) (2)\nend\n\ndefine None\nset pen color to ((((r) * (65536)) + (((g) * (256)) + (b))) + ((o) * (16777216)))\n\ndefine None\nif <(dir) = [1]> then\n if <(camdir) = [0]> then\n change [myy v] by (() - (VelY))\n Collided? (1)\n set [vely v] to [0]\n else\n if <(camdir) = [90]> then\n change [myx v] by (() - (VelY))\n Collided? (1)\n set [vely v] to [0]\n else\n if <(camdir) = [180]> then\n change [myy v] by (VelY)\n Collided? (1)\n set [vely v] to [0]\n else\n change [myx v] by (VelY)\n Collided? (1)\n set [vely v] to [0]\n end\n end\n end\nelse\n if <(dir) = [0]> then\n if <(camdir) = [0]> then\n change [myx v] by (() - (VelX))\n Collided? (0)\n set [velx v] to [0]\n else\n if <(camdir) = [90]> then\n change [myy v] by (VelX)\n Collided? (0)\n set [velx v] to [0]\n else\n if <(camdir) = [180]> then\n change [myx v] by (VelX)\n Collided? (0)\n set [velx v] to [0]\n else\n change [myy v] by (() - (VelX))\n Collided? (0)\n set [velx v] to [0]\n end\n end\n end\n else\n if <(dir) = [2]> then\n if <(camdir) = [0]> then\n change [myx v] by (() - (VelX))\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [velx v] to [0]\n else\n if <(camdir) = [90]> then\n change [myy v] by (VelX)\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [velx v] to [0]\n else\n if <(camdir) = [180]> then\n change [myx v] by (VelX)\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [velx v] to [0]\n else\n change [myy v] by (() - (VelX))\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [velx v] to [0]\n end\n end\n end\n else\n if <(camdir) = [0]> then\n change [myy v] by (() - (VelY))\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [vely v] to [0]\n else\n if <(camdir) = [90]> then\n change [myx v] by (() - (VelY))\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [vely v] to [0]\n else\n if <(camdir) = [180]> then\n change [myy v] by (VelY)\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [vely v] to [0]\n else\n change [myx v] by (VelY)\n if <(type) = [5]> then\n set [collided? v] to [4]\n end\n set [vely v] to [0]\n end\n end\n end\n end\n end\nend\n\ndefine DrawTrail\nset [trail# v] to [1]\nrepeat ([floor v] of ((length of [trail v]) / (2)) )\n Set Pen Color to R: (0) G: (0) B: (200) Opacity (round ((256) / ((7) - (Trail#))))\n set [x1 v] to ((item (((Trail#) * (2)) - (1)) of [trail v]) - (CamX))\n set [y1 v] to ((item (((Trail#) * (2)) - (0)) of [trail v]) - (CamY))\n Rotate (DirCos) (DirSin) (2)\n go to x: (X1) y: (Y1)\n pen down\n pen up\n change [trail# v] by (1)\nend\n\ndefine None\nResetData\nResetLists\nif <(level) = [1]> then\n Level1\nelse\n if <(level) = [2]> then\n Level2\n else\n if <(level) = [2]> then\n Level2\n else\n if <(level) = [3]> then\n Level5\n else\n if <(level) = [4]> then\n Level3\n else\n if <(level) = [5]> then\n Level4\n else\n if <(level) = [6]> then\n level6\n else\n if <(level) = [7]> then\n Level7\n else\n Level8\n end\n end\n end\n end\n end\n end\n end\nend\n\ndefine FindPlayerLocation\nset [playerx v] to ((MyX) - (CamX))\nset [playery v] to ((MyY) - (CamY))\nRotate (DirCos) (DirSin) (0)\n\ndefine None\nif <(type) = [1]> then\n Rotate (angle1) (angle2) (X1) (Y1)\n set [x1 v] to (RotatedX)\n set [y1 v] to (RotatedY)\n Rotate (angle1) (angle2) (X2) (Y2)\n set [x2 v] to (RotatedX)\n set [y2 v] to (RotatedY)\nelse\n if <(type) = [0]> then\n Rotate (angle1) (angle2) (PlayerX) (PlayerY)\n set [playerx v] to (RotatedX)\n set [playery v] to (RotatedY)\n else\n Rotate (angle1) (angle2) (X1) (Y1)\n set [x1 v] to (RotatedX)\n set [y1 v] to (RotatedY)\n end\nend\n\ndefine None\nif <not <(type) = [4]>> then\n if <(Collided?) < [2]> then\n if <(type) = [5]> then\n set [collided? v] to [4]\n else\n if <(side) = [0]> then\n if <(VelX) > [0]> then\n set [futuredir v] to (((Dir) + (270)) mod (360))\n set [collided? v] to [2]\n else\n set [futuredir v] to (((Dir) + (90)) mod (360))\n set [collided? v] to [2]\n end\n else\n if <(VelY) > [0]> then\n set [futuredir v] to (((Dir) + (180)) mod (360))\n set [collided? v] to [2]\n else\n if <(type) = [3]> then\n set [collided? v] to [3]\n else\n set [collided? v] to [1]\n end\n end\n end\n end\n end\nelse\n if <(side) = [1]> then\n if <(VelY) < [0]> then\n set [collided? v] to [1]\n end\n end\nend\n\ndefine None\npen up\nif <(type) = [1]> then\n set pen size to (20)\n Set Pen Color to R: (Glow) G: (0) B: (Glow) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n set pen size to (5)\n Set Pen Color to R: (200) G: (0) B: (160) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\nelse\n if <(type) = [2]> then\n set pen size to ((Size) + (10))\n Set Pen Color to R: (0) G: (100) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n pen up\n set pen size to (Size)\n Set Pen Color to R: (0) G: (255) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n pen up\n else\n if <(type) = [3]> then\n if <(GlowSize) > [40]> then\n set pen size to (((GlowSize) mod (40)) + (15))\n else\n set pen size to (15)\n end\n Set Pen Color to R: (255) G: (200) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n if <(GlowSize) > [40]> then\n set pen size to (((GlowSize) mod (40)) + (10))\n else\n set pen size to (10)\n end\n Set Pen Color to R: (0) G: (0) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n set pen size to (5)\n Set Pen Color to R: (255) G: (255) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n else\n if <(type) = [4]> then\n set pen size to (5)\n Set Pen Color to R: (200) G: (0) B: (160) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n else\n if <(type) = [5]> then\n set pen size to (20)\n Set Pen Color to R: ((Glow) + (20)) G: (0) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n set pen size to (5)\n Set Pen Color to R: (255) G: (0) B: (0) Opacity (0)\n go to x: (x1) y: (y1)\n pen down\n go to x: (x2) y: (y2)\n pen up\n else\n end\n end\n end\n end\nend\n\ndefine Cut to Edge\nif <<([abs v] of (X1) ) > [240]> or <([abs v] of (X2) ) > [240]>> then\n if <(X1) > [240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y1 v] to ((Y2) + ((((240) - (X2)) / (XDist)) * (YDist)))\n set [x1 v] to [240]\n if <(X2) < [-240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y2 v] to ((Y1) - ((((X1) - (-240)) / (XDist)) * (YDist)))\n set [x2 v] to [-240]\n end\n else\n if <(X1) < [-240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y1 v] to ((Y2) + ((((-240) - (X2)) / (XDist)) * (YDist)))\n set [x1 v] to [-240]\n if <(X2) > [240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y2 v] to ((Y1) - ((((X1) - (240)) / (XDist)) * (YDist)))\n set [x2 v] to [240]\n end\n else\n if <(X2) > [240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y2 v] to ((Y1) - ((((X1) - (240)) / (XDist)) * (YDist)))\n set [x2 v] to [240]\n else\n if <(X2) < [-240]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [y2 v] to ((Y1) - ((((X1) - (-240)) / (XDist)) * (YDist)))\n set [x2 v] to [-240]\n end\n end\n end\n end\nend\nif <<([abs v] of (Y1) ) > [180]> or <([abs v] of (Y2) ) > [180]>> then\n if <(Y1) > [180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x1 v] to ((X2) + ((((180) - (Y2)) / (YDist)) * (XDist)))\n set [y1 v] to [180]\n if <(Y2) < [-180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x2 v] to ((X1) - ((((Y1) - (-180)) / (YDist)) * (XDist)))\n set [y2 v] to [-180]\n end\n else\n if <(Y1) < [-180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x1 v] to ((X2) + ((((-180) - (Y2)) / (YDist)) * (XDist)))\n set [y1 v] to [-180]\n if <(Y2) > [180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x2 v] to ((X1) - ((((Y1) - (180)) / (YDist)) * (XDist)))\n set [y2 v] to [180]\n end\n else\n if <(Y2) > [180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x2 v] to ((X1) - ((((Y1) - (180)) / (YDist)) * (XDist)))\n set [y2 v] to [180]\n else\n if <(Y2) < [-180]> then\n set [xdist v] to ((X1) - (X2))\n set [ydist v] to ((Y1) - (Y2))\n set [x2 v] to ((X1) - ((((Y1) - (-180)) / (YDist)) * (XDist)))\n set [y2 v] to [-180]\n end\n end\n end\n end\nend\n\ndefine Add Particle\nset [x v] to (pick random (-50) to (50))\nif <(pick random (0) to (1)) = [0]> then\n set [y v] to (() - ([sqrt v] of ((2500) - ((X) * (X))) ))\nelse\n set [y v] to ([sqrt v] of ((2500) - ((X) * (X))) )\nend\nrepeat (2)\n add (X) to [particles v]\n add (Y) to [particles v]\nend\nadd [] to [particles v]\n\ndefine None\nif <(number) < (length of [particles v])> then\n set [x1 v] to (((item (number) of [particles v]) + (TargetX)) - (CamX))\n set [y1 v] to (((item ((number) + (1)) of [particles v]) + (TargetY)) - (CamY))\n Rotate (DirCos) (DirSin) (2)\n if <not <<([abs v] of (X1) ) > [240]> or <([abs v] of (Y1) ) > [180]>>> then\n pen up\n Set Pen Color to R: (0) G: (255) B: (0) Opacity (0)\n set pen size to (5)\n go to x: (X1) y: (Y1)\n pen down\n pen up\n end\n replace item (number) of [particles v] with ((item ((number) + (0)) of [particles v]) - ((item ((number) + (2)) of [particles v]) / (10)))\n replace item ((number) + (1)) of [particles v] with ((item ((number) + (1)) of [particles v]) - ((item ((number) + (3)) of [particles v]) / (10)))\n if <<(round ([abs v] of (item (number) of [particles v]) )) < [20]> and <(round ([abs v] of (item ((number) + (1)) of [particles v]) )) < [20]>> then\n repeat (5)\n delete (number) of [particles v]\n end\n end\nend\n\ndefine None\nadd (type) to [lines v]\nadd (x1) to [lines v]\nadd (y1) to [lines v]\nadd (x2) to [lines v]\nadd (y2) to [lines v]\nif <(type) = [2]> then\n set [targetx v] to (x1)\n set [targety v] to (y1)\nend\nif <(x1) < (MinX)> then\n set [minx v] to (x1)\nelse\n if <(x1) > (MaxX)> then\n set [maxx v] to (x1)\n end\nend\nif <(x2) < (MinX)> then\n set [minx v] to (x2)\nelse\n if <(x2) > (MaxX)> then\n set [maxx v] to (x2)\n end\nend\nif <(y1) < (MinY)> then\n set [miny v] to (y1)\nelse\n if <(y1) > (MaxY)> then\n set [maxy v] to (y1)\n end\nend\nif <(y2) < (MinY)> then\n set [miny v] to (y2)\nelse\n if <(y2) > (MaxY)> then\n set [maxy v] to (y2)\n end\nend\n\nwhen flag clicked\nset [stoptime v] to ((timer) + (1000))\nset [stop key pressed? v] to [0]\nset [leveltime v] to [6]\nset [level v] to [1]\nReset (level)\nforever\n set [stoptime v] to ((timer) + (0.3))\n if <(timer) < [3]> then\n broadcast (Spidertest v)\n else\n if <(timer) < [6]> then\n broadcast (Title v)\n else\n if <(level) < [9]> then\n if <(MySize) > [55]> then\n Reset (level)\n end\n RenderTwice\n PrintLevelThings\n else\n broadcast (finish v)\n end\n end\n end\n set [fps v] to ((1) / ((timer) - ((StopTime) - (0.3))))\nend\n\nwhen [timer v] > (StopTime)\n\ndefine AddTrail\nadd (MyX) to [trail v]\nadd (MyY) to [trail v]\nif <(length of [trail v]) > [10]> then\n repeat (2)\n delete (1) of [trail v]\n end\nend\n\ndefine RenderTwice\nset [render# v] to [1]\nset [rotating? v] to [0]\nrepeat (2)\n if <not <(Collided?) = [4]>> then\n ReadKeys\n end\n Render\n change [render# v] by (1)\nend\n\ndefine Move\nif <(Dir) = (TargetDir)> then\n if <(Rotating?) = [0]> then\n if <(Render#) = [1]> then\n if <<(Dir) < [0]> or <(Dir) > [359]>> then\n set [dir v] to ((Dir) mod (360))\n set [targetdir v] to (Dir)\n set [futuredir v] to (Dir)\n end\n if <(Dir) = [0]> then\n change [myx v] by (VelX)\n else\n if <(Dir) = [270]> then\n change [myy v] by (VelX)\n else\n if <(Dir) = [90]> then\n change [myy v] by (() - (VelX))\n else\n if <(Dir) = [180]> then\n change [myx v] by (() - (VelX))\n else\n set [velx v] to [0]\n set [vely v] to [0]\n end\n end\n end\n end\n else\n if <(Dir) = [0]> then\n change [myy v] by (VelY)\n else\n if <(Dir) = [270]> then\n change [myx v] by (() - (VelY))\n else\n if <(Dir) = [90]> then\n change [myx v] by (VelY)\n else\n if <(Dir) = [180]> then\n change [myy v] by (() - (VelY))\n else\n set [velx v] to [0]\n set [vely v] to [0]\n end\n end\n end\n end\n end\n end\nelse\n if <(Render#) = [1]> then\n set [rotating? v] to [1]\n set [velx v] to [0]\n set [vely v] to [0]\n if <<(Dir) = [0]> and <(TargetDir) = [270]>> then\n set [targetdir v] to [-90]\n set [futuredir v] to [-90]\n else\n if <<(Dir) = [270]> and <(TargetDir) = [0]>> then\n set [targetdir v] to [360]\n set [futuredir v] to [360]\n end\n end\n if <(TargetDir) > (Dir)> then\n change [dir v] by (6)\n else\n change [dir v] by (-6)\n end\n end\nend\nif <(Render#) = [2]> then\n if <(VelY) > [-15]> then\n change [camx v] by (((MyX) - (CamX)) / (10))\n change [camy v] by (((MyY) - (CamY)) / (10))\n else\n if <((Dir) mod (180)) = [0]> then\n change [camx v] by (((MyX) - (CamX)) / (10))\n change [camy v] by (((MyY) - (CamY)) / ([floor v] of ((100) / ([abs v] of (VelY) )) ))\n else\n change [camx v] by (((MyX) - (CamX)) / ([floor v] of ((100) / ([abs v] of (VelY) )) ))\n change [camy v] by (((MyY) - (CamY)) / (10))\n end\n end\nend\n\ndefine ResetData\nset [targetdir v] to [0]\nset [collided? v] to [0]\nset [futuredir v] to [0]\nset [dir v] to [0]\nset [myx v] to [0]\nset [myy v] to [0.1]\nset [camx v] to [0]\nset [camy v] to [0]\nset [velx v] to [0]\nset [vely v] to [0]\nset [glow v] to [30]\nset [dirtime v] to [1]\nset [size v] to [40]\nset [dirsize v] to [1]\nset [glowsize v] to [30]\nset [glowsizedir v] to [4]\nset [maxx v] to [0]\nset [minx v] to [0]\nset [maxy v] to [0]\nset [miny v] to [0]\n\ndefine None\nset [rotatedx v] to (((distx) * (angle1)) - ((disty) * (angle2)))\nset [rotatedy v] to (((distx) * (angle2)) + ((disty) * (angle1)))\n\ndefine Level1\nCreate new Block: (-200) (-50) (200) (-50) (4)\nCreate new Block: (200) (-50) (200) (50) (4)\nCreate new Block: (200) (50) (350) (50) (4)\nCreate new Block: (450) (100) (600) (100) (4)\nCreate new Block: (700) (150) (1200) (150) (4)\nCreate new Block: (850) (150) (850) (200) (5)\nCreate new Block: (900) (200) (900) (150) (5)\nCreate new Block: (850) (200) (900) (200) (5)\nCreate new Block: (850) (150) (900) (150) (5)\nCreate new Block: (1050) (150) (1050) (200) (5)\nCreate new Block: (1100) (200) (1100) (150) (5)\nCreate new Block: (1050) (200) (1100) (200) (5)\nCreate new Block: (1050) (150) (1100) (150) (5)\nCreate new Block: (1200) (150) (1200) (225) (4)\nCreate new Block: (1200) (225) (1400) (225) (4)\nCreate new Block: (1500) (225) (1500) (425) (4)\nCreate new Block: (1500) (425) (1600) (425) (4)\nCreate new Block: (1550) (500) (1600) (425) (2)\nCreate new Block: (-200) (-50) (-200) (-100) (4)\nCreate new Block: (-200) (-100) (350) (-100) (4)\nCreate new Block: (350) (50) (350) (-100) (4)\nCreate new Block: (700) (150) (700) (100) (4)\nCreate new Block: (700) (100) (1600) (100) (4)\nCreate new Block: (1600) (425) (1600) (100) (4)\nCreate new Block: (1400) (225) (1500) (225) (3)\n\ndefine Level2\nCreate new Block: (-200) (-50) (200) (-50) (1)\nCreate new Block: (-160) (130) (-200) (130) (2)\nCreate new Block: (200) (-50) (200) (300) (1)\nCreate new Block: (200) (300) (-200) (300) (1)\nCreate new Block: (-200) (300) (-200) (180) (1)\nCreate new Block: (-200) (-50) (-200) (180) (4)\n\ndefine Level3\nCreate new Block: (-50) (-50) (500) (-50) (1)\nCreate new Block: (-50) (125) (600) (124) (1)\nCreate new Block: (100) (-50) (100) (25) (5)\nCreate new Block: (200) (225) (200) (50) (5)\nCreate new Block: (300) (-200) (300) (25) (5)\nCreate new Block: (400) (225) (400) (50) (5)\nCreate new Block: (500) (-125) (500) (35) (5)\nCreate new Block: (300) (-200) (600) (-200) (4)\nCreate new Block: (-100) (225) (0) (225) (4)\nCreate new Block: (300) (200) (0) (0) (2)\n\ndefine Level4\nCreate new Block: (-100) (-50) (100) (-50) (1)\nCreate new Block: (-395) (-175) (-200) (-175) (5)\nCreate new Block: (-60) (-100) (150) (-100) (4)\nCreate new Block: (-395) (-175) (-395) (0) (5)\nCreate new Block: (-415) (-195) (-415) (-15) (1)\nCreate new Block: (-415) (-195) (-200) (-195) (4)\nCreate new Block: (-525) (50) (-525) (150) (4)\nCreate new Block: (-600) (170) (-600) (270) (1)\nCreate new Block: (-750) (300) (-750) (900) (4)\nCreate new Block: (-550) (400) (-550) (900) (5)\nCreate new Block: (-750) (500) (-675) (500) (5)\nCreate new Block: (-750) (700) (-675) (700) (5)\nCreate new Block: (-750) (900) (-675) (900) (5)\nCreate new Block: (-700) (950) (-700) (1050) (3)\nCreate new Block: (-500) (1050) (-400) (1050) (3)\nCreate new Block: (-500) (700) (0) (0) (2)\nCreate new Block: (-500) (200) (500) (200) (5)\nCreate new Block: (-500) (200) (-500) (400) (5)\nCreate new Block: (-500) (400) (-550) (400) (5)\nCreate new Block: (-400) (850) (-300) (850) (1)\n\ndefine Level5\nCreate new Block: (-150) (-50) (100) (-50) (1)\nCreate new Block: (200) (0) (350) (0) (1)\nCreate new Block: (450) (50) (450) (200) (1)\nCreate new Block: (315) (175) (315) (300) (1)\nCreate new Block: (315) (300) (400) (300) (5)\nCreate new Block: (315) (320) (315) (450) (3)\nCreate new Block: (-25) (-150) (0) (0) (2)\nCreate new Block: (50) (-100) (50) (-300) (5)\n\ndefine PrintLevelThings\nif <(level) = [1]> then\n broadcast (arrowKeys v)\n broadcast (Danger v)\n broadcast (bounce v)\n broadcast (NextLevel v)\nelse\n if <<(level) = [2]> and <(Dir) = [0]>> then\n broadcast (Rotate v)\n end\nend\nif <<((timer) - (LevelTime)) > [0]> and <((timer) - (LevelTime)) < [3]>> then\n broadcast (level v)\nend\n\ndefine level6\nCreate new Block: (-50) (-50) (50) (-50) (4)\nCreate new Block: (50) (-50) (50) (50) (4)\nCreate new Block: (50) (50) (150) (50) (4)\nCreate new Block: (150) (50) (150) (150) (4)\nCreate new Block: (150) (150) (250) (150) (4)\nCreate new Block: (250) (150) (250) (250) (4)\nCreate new Block: (250) (250) (350) (250) (4)\nCreate new Block: (350) (250) (350) (350) (4)\nCreate new Block: (450) (350) (450) (150) (1)\nCreate new Block: (350) (350) (450) (350) (4)\nCreate new Block: (450) (150) (350) (150) (4)\nCreate new Block: (350) (150) (350) (50) (4)\nCreate new Block: (350) (50) (250) (50) (4)\nCreate new Block: (250) (50) (250) (-50) (4)\nCreate new Block: (250) (-50) (150) (-50) (4)\nCreate new Block: (250) (-50) (150) (-50) (4)\nCreate new Block: (-50) (-50) (-50) (-250) (4)\nCreate new Block: (-50) (-250) (250) (-250) (4)\nCreate new Block: (250) (-250) (250) (-150) (4)\nCreate new Block: (250) (-150) (350) (-150) (4)\nCreate new Block: (350) (-150) (350) (-50) (4)\nCreate new Block: (350) (-50) (450) (-50) (4)\nCreate new Block: (450) (-50) (450) (50) (4)\nCreate new Block: (450) (50) (550) (50) (4)\nCreate new Block: (550) (50) (550) (450) (4)\nCreate new Block: (450) (450) (450) (550) (4)\nCreate new Block: (550) (450) (450) (450) (4)\nCreate new Block: (450) (550) (350) (550) (4)\nCreate new Block: (350) (550) (350) (450) (4)\nCreate new Block: (350) (450) (250) (450) (4)\nCreate new Block: (250) (450) (250) (350) (4)\nCreate new Block: (250) (350) (150) (350) (4)\nCreate new Block: (150) (350) (150) (250) (4)\nCreate new Block: (150) (250) (50) (250) (4)\nCreate new Block: (50) (250) (50) (150) (4)\nCreate new Block: (50) (150) (-50) (150) (4)\nCreate new Block: (-50) (150) (-50) (50) (4)\nCreate new Block: (-50) (50) (-150) (50) (4)\nCreate new Block: (-150) (50) (-150) (-50) (4)\nCreate new Block: (-150) (-50) (-250) (-50) (4)\nCreate new Block: (-250) (-250) (-60) (-250) (5)\nCreate new Block: (-60) (-125) (-140) (-125) (5)\nCreate new Block: (-100) (-175) (-150) (-125) (2)\nCreate new Block: (150) (-50) (150) (-150) (4)\n\ndefine ResetLists\ndelete (all) of [particles v]\ndelete (all) of [trail v]\ndelete (all) of [lines v]\n\ndefine Level7\nCreate new Block: (100) (-50) (-300) (-50) (1)\nCreate new Block: (-300) (-50) (-300) (250) (1)\nCreate new Block: (-300) (250) (100) (250) (1)\nCreate new Block: (200) (25) (300) (25) (4)\nCreate new Block: (300) (200) (450) (200) (4)\nCreate new Block: (400) (25) (500) (25) (4)\nCreate new Block: (600) (200) (700) (200) (1)\nCreate new Block: (700) (275) (800) (275) (4)\nCreate new Block: (600) (0) (700) (0) (4)\nCreate new Block: (550) (200) (550) (350) (5)\nCreate new Block: (300) (15) (300) (-50) (5)\nCreate new Block: (500) (15) (500) (-65) (5)\nCreate new Block: (800) (0) (900) (0) (4)\nCreate new Block: (700) (-50) (800) (-50) (5)\nCreate new Block: (900) (0) (900) (450) (5)\nCreate new Block: (1000) (150) (0) (0) (2)\n\ndefine Level8\nCreate new Block: (62.5) (-350) (162.5) (-350) (5)\nCreate new Block: (-200) (150) (-200) (50) (4)\nCreate new Block: (-50) (-50) (50) (-50) (1)\nCreate new Block: (-50) (50) (-200) (50) (4)\nCreate new Block: (-200) (150) (-400) (150) (4)\nCreate new Block: (-50) (-250) (50) (-250) (3)\nCreate new Block: (-500) (50) (-600) (50) (4)\nCreate new Block: (-500) (62.5) (-600) (62.5) (5)\nCreate new Block: (-500) (-50) (-575) (-50) (3)\nCreate new Block: (-200) (-125) (-350) (-125) (3)\nCreate new Block: (-200) (-125) (-200) (-200) (5)\nCreate new Block: (50) (-50) (50) (-450) (4)\nCreate new Block: (62.5) (-350) (62.5) (-450) (1)\nCreate new Block: (-250) (350) (0) (0) (2)\nCreate new Block: (-20) (150) (-20) (550) (5)\n\nset [starttime v] to (timer)\nchange [stop key pressed? v] by (1)\nbroadcast (Music v)\nforever\n set [stoptime v] to ((timer) + (0.3))\n if <((timer) - (StartTime)) < [1.5]> then\n broadcast ((Stop Key Pressed?) mod (2))\n else\n if <(timer) < [4]> then\n broadcast (Spidertest v)\n else\n if <(timer) < [8]> then\n broadcast (Title v)\n else\n if <(level) < [9]> then\n if <(MySize) > [55]> then\n Reset (level)\n end\n RenderTwice\n PrintLevelThings\n else\n broadcast (finish v)\n end\n end\n end\n end\nend\n\nwhen [space v] key pressed\nbroadcast (nextlevel v)\n\nbroadcast (level v)\n\n@TextEngine\n\ndefine ResetLists\nset [alphabet v] to [abcdefghijklmnopqrstuvwxyz0123456789!#%^*\(\)-+_=/.,?'":]\nset [alphabet2 v] to [ABCDEFJHIJKLMNOPQRSTUVWXYZ]\ndelete (all) of [chars v]\nadd [/00/0444404202] to [chars v]\nadd [/00/0434320232424000] to [chars v]\nadd [/44/040040] to [chars v]\nadd [/00/043443413000] to [chars v]\nadd [/40/000232020444] to [chars v]\nadd [/00/0232020444] to [chars v]\nadd [/44/0400404222] to [chars v]\nadd [/00/0402424044] to [chars v]\nadd [/04/4424200040] to [chars v]\nadd [/24/2000] to [chars v]\nadd [/34/010004011240] to [chars v]\nadd [/04/0040] to [chars v]\nadd [/00/04224440] to [chars v]\nadd [/00/044044] to [chars v]\nadd [/00/04444000] to [chars v]\nadd [/00/04444202] to [chars v]\nadd [/00/044440004022] to [chars v]\nadd [/00/043432024240] to [chars v]\nadd [/44/14031232413000] to [chars v]\nadd [/20/240444] to [chars v]\nadd [/04/004044] to [chars v]\nadd [/04/2044] to [chars v]\nadd [/04/00224044] to [chars v]\nadd [/00/44/04/40] to [chars v]\nadd [/04/22202244] to [chars v]\nadd [/04/440040] to [chars v]\nadd [/00/0444400044] to [chars v]\nadd [/13/24201030] to [chars v]\nadd [/04/4442020040] to [chars v]\nadd [/04/444212424000] to [chars v]\nadd [/04/02424044] to [chars v]\nadd [/44/0402424000] to [chars v]\nadd [/44/040242400004] to [chars v]\nadd [/04/4420] to [chars v]\nadd [/00/044440000242] to [chars v]\nadd [/00/404202044442] to [chars v]\nadd [/20/20/22/24] to [chars v]\nadd [/00/14/30/44/01/41/03/43] to [chars v]\nadd [/04/14130304/40/30314140/00/44] to [chars v]\nadd [/13/2433] to [chars v]\nadd [/12/34/32/14] to [chars v]\nadd [/20/111324] to [chars v]\nadd [/20/313324] to [chars v]\nadd [/12/32] to [chars v]\nadd [/21/23221232] to [chars v]\nadd [/00/40] to [chars v]\nadd [/13/33/11/31] to [chars v]\nadd [/00/44] to [chars v]\nadd [/20/20] to [chars v]\nadd [/10/21] to [chars v]\nadd [/20/20/22/424424] to [chars v]\nadd [/23/24] to [chars v]\nadd [/13/14/33/34] to [chars v]\nadd [/21/21/23/23] to [chars v]\n\ndefine None\nrepeat (number)\n print: [Faster] at x: (pick random (-240) to (200)) y: (pick random (-170) to (170)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\nend\n\ndefine None\nset pen size to (((s) / (4.5)) * (t))\nset [xint v] to (x)\nset [ii v] to [1]\nset [pen v] to [1]\nrepeat (length of (text))\n if <not <([abs v] of (xInt) ) > [240]>> then\n set [char v] to (letter (ii) of (text))\n if <not <(Char) = []>> then\n if <not <([\['concatenate:with:', \['readvariable', 'char'\], ''\] v] of (join [TextEngine] [])) = [0]>> then\n Draw ([\['concatenate:with:', \['readvariable', 'char'\], ''\] v] of (join [TextEngine] [])) (y) (s) (h) (w) (i)\n end\n end\n end\n change [ii v] by (1)\n change [xint v] by ((w) * ((s) * ((1) + ((0.5) * (sp)))))\nend\n\ndefine None\nset pen color to ((((r) * (65536)) + (((g) * (256)) + (b))) + ((o) * (16777216)))\n\ndefine Set [] to []\nset [\['getparam', 'var', 'r'\] v] to (text)\n\ndefine None\nset [iii v] to [1]\nset [xy v] to [1]\nrepeat (length of (char))\n if <(letter (iii) of (char)) = [/]> then\n set [pen v] to ((0) - (pen))\n if <(pen) = [1]> then\n pen down\n else\n pen up\n end\n else\n set [xy v] to ((0) - (xy))\n if <(xy) = [1]> then\n set [y2 v] to ((y) + (((0.2) * ((s) * (h))) * (letter (iii) of (char))))\n go to x: ((x2) + ((i) * (((y2) - (y)) / (10)))) y: (y2)\n else\n set [x2 v] to ((xInt) + (((0.2) * ((s) * (w))) * (letter (iii) of (char))))\n end\n end\n change [iii v] by (1)\nend\n\ndefine None\nif <(type) = [1]> then\n set [iii v] to [1]\n repeat (26)\n Set (letter (iii) of (alphabet)) to (item (iii) of [chars v])\n change [iii v] by (1)\n end\nelse\n set [iii v] to [1]\n repeat (26)\n Set (letter (iii) of (alphabet)) to (item ((54) + (iii)) of [chars v])\n change [iii v] by (1)\n end\nend\n\nerase all\nResetVars (1)\nprint: [abcdefghijklmnop] at x: (-230) y: (0) size: (16) thickness: (0.5) width: (1) height: (1) spacing: (1) italics (1)\nprint: [qrstuvwxyz] at x: (-230) y: (-30) size: (16) thickness: (0.5) width: (1) height: (1) spacing: (1) italics (1)\n\nwhen I receive [1 v]\nerase all\nSet Pen Color to R: (200) G: (0) B: (0) Opacity (0)\nprint: [I Refuse] at x: (-225) y: (50) size: (41) thickness: (2) width: (1) height: (1) spacing: (0.9) italics (0)\nprint: [to Stop!] at x: (-230) y: (-50) size: (41) thickness: (2) width: (1) height: (1) spacing: (1) italics (0)\nSet Pen Color to R: (255) G: (0) B: (0) Opacity (0)\nprint: [I Refuse] at x: (-225) y: (50) size: (41) thickness: (1) width: (1) height: (1) spacing: (0.9) italics (0)\nprint: [to Stop!] at x: (-230) y: (-50) size: (41) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n\nwhen I receive [0 v]\nerase all\nSet Pen Color to R: (200) G: (0) B: (0) Opacity (0)\nprint: [It will] at x: (-185) y: (60) size: (41) thickness: (2) width: (1) height: (1) spacing: (1) italics (0)\nprint: [never ] at x: (-125) y: (-30) size: (41) thickness: (2) width: (1) height: (1) spacing: (1) italics (0)\nprint: [work!] at x: (-125) y: (-120) size: (41) thickness: (2) width: (1) height: (1) spacing: (1) italics (0)\nSet Pen Color to R: (255) G: (0) B: (0) Opacity (0)\nprint: [It will] at x: (-185) y: (60) size: (41) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\nprint: [never ] at x: (-125) y: (-30) size: (41) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\nprint: [work!] at x: (-125) y: (-120) size: (41) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n\nwhen I receive [spidertest v]\nerase all\nif <(timer) > [2.55]> then\n Set Pen Color to R: (0) G: (255) B: (0) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (round ((timer) * (100))) B: (0) Opacity (0)\nend\nprint: [Spidertest] at x: (-210) y: (25) size: (30) thickness: (2) width: (1) height: (1) spacing: (1) italics (1)\nif <(timer) > [2.55]> then\n Set Pen Color to R: (0) G: (0) B: (255) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (0) B: (round ((timer) * (100))) Opacity (0)\nend\nprint: [Spidertest] at x: (-210) y: (25) size: (30) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\nprint: [presents] at x: (-105) y: (-40) size: (20) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\n\nwhen I receive [title v]\nerase all\nif <((timer) - (3)) > [2.55]> then\n Set Pen Color to R: (0) G: (200) B: (0) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (round (((timer) - (3)) * (75))) B: (0) Opacity (0)\nend\nprint: [Rotation] at x: (-210) y: (50) size: (37) thickness: (2) width: (1) height: (1) spacing: (1) italics (1)\nif <((timer) - (3)) > [2.55]> then\n Set Pen Color to R: (0) G: (0) B: (255) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (0) B: (round (((timer) - (3)) * (100))) Opacity (0)\nend\nprint: [Rotation] at x: (-210) y: (50) size: (37) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\nprint: [ A 100% pen] at x: (-220) y: (-50) size: (25) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\nprint: [ platformer] at x: (-220) y: (-100) size: (25) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\n\nwhen I receive [level v]\nPrintLevel\n\ndefine PrintLevel\nif <((timer) - (LevelTime)) > [2.55]> then\n Set Pen Color to R: (0) G: (255) B: (0) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (round (((timer) - (LevelTime)) * (100))) B: (0) Opacity (0)\nend\nprint: (join [Level:] (level)) at x: (-210) y: (50) size: (37) thickness: (2) width: (1) height: (1) spacing: (1) italics (1)\nif <((timer) - (LevelTime)) > [2.55]> then\n Set Pen Color to R: (0) G: (0) B: (255) Opacity (0)\nelse\n Set Pen Color to R: (0) G: (0) B: (round (((timer) - (LevelTime)) * (100))) Opacity (0)\nend\nprint: (join [Level:] (level)) at x: (-210) y: (50) size: (37) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\n\nwhen I receive [arrowkeys v]\nif <<((-150) - (CamX)) < [240]> and <((-150) - (CamX)) > [-560]>> then\n if <([abs v] of ((0) - (CamY)) ) < [180]> then\n Set Pen Color to R: (255) G: (255) B: (255) Opacity (0)\n print: [use arrow keys to move!] at x: ((-150) - (CamX)) y: ((0) - (CamY)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n end\nend\n\nwhen I receive [danger v]\nif <<((700) - (CamX)) < [240]> and <((700) - (CamX)) > [-480]>> then\n if <([abs v] of ((250) - (CamY)) ) < [180]> then\n Set Pen Color to R: (255) G: (255) B: (255) Opacity (0)\n print: [avoid red lines!] at x: ((700) - (CamX)) y: ((250) - (CamY)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n end\nend\n\nwhen I receive [bounce v]\nif <<((1210) - (CamX)) < [240]> and <((1210) - (CamX)) > [-560]>> then\n Set Pen Color to R: (255) G: (255) B: (255) Opacity (0)\n if <([abs v] of ((180) - (CamY)) ) < [180]> then\n print: [Use it to Jump Higher!] at x: ((1210) - (CamX)) y: ((180) - (CamY)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n end\nend\n\nwhen I receive [nextlevel v]\nif <((1400) - (CamX)) < [240]> then\n if <([abs v] of ((570) - (CamY)) ) < [180]> then\n Set Pen Color to R: (255) G: (255) B: (255) Opacity (0)\n print: [Jump into the Portal!] at x: ((1400) - (CamX)) y: ((570) - (CamY)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n end\nend\n\nwhen I receive [rotate v]\nSet Pen Color to R: (255) G: (255) B: (255) Opacity (0)\nprint: [Jump on glowing lines ] at x: ((-150) - (CamX)) y: ((-100) - (CamY)) size: (10) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\nif <((-150) - (CamY)) > [-180]> then\n print: [to rotate!] at x: ((-130) - (CamX)) y: ((-150) - (CamY)) size: (20) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\nend\n\nwhen I receive [finish v]\nerase all\nprint: [you finished] at x: (-230) y: (30) size: (26) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\nprint: [the game!] at x: (-170) y: (-10) size: (26) thickness: (1) width: (1) height: (1) spacing: (1) italics (0)\n\nSet Pen Color to R: (180) G: (180) B: (0) Opacity (0)\nprint: [rotation] at x: (-230) y: (130) size: (40) thickness: (2) width: (1) height: (1) spacing: (1) italics (1)\nSet Pen Color to R: (255) G: (255) B: (0) Opacity (0)\nprint: [rotation] at x: (-230) y: (130) size: (40) thickness: (1) width: (1) height: (1) spacing: (1) italics (1)\n\n
arrow keys
Stickman - Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (1 v)\n\nwhen [space v] key pressed\nif <(backdrop [number v]) = [1]> then\n switch backdrop to (2 v)\nend\n\nwhen flag clicked\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (0) y: (0)\nswitch costume to (1 v)\nhide\n\nwhen I receive [next level v]\nnext costume\n\nwhen [space v] key pressed\nshow\n\nwhen backdrop switches to [3 v]\ngo to [front v] layer\n\n@Frames\n\nwhen [timer v] > (0.1)\nswitch costume to (stopnaill v)\ngo to [front v] layer\nshow\n\nwhen flag clicked\ngo to x: (0) y: (0)\nforever\n hide\n reset timer\nend\n\nwhen I receive [end v]\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\ngo to [front v] layer\nswitch costume to (thumbnaill v)\nset [ghost v] effect to (100)\nshow\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nstop [all v]\n\nwhen flag clicked\nerase all\nswitch costume to (shadow v)\nset size to (100) %\ngo to x: (0) y: (0)\nset [ghost v] effect to (90)\nstamp\nhide\n\n@Player\n\nwhen backdrop switches to [2 v]\nset size to (100) %\nshow\nrepeat (4)\n go to x: (-200) y: (-96)\nend\n\nwhen flag clicked\nforever\n if <not <(backdrop [number v]) = [1]>> then\n if <<key (right arrow v) pressed?> or <key (left arrow v) pressed?>> then\n switch costume to (join [Walk ] (Walk))\n end\n if <not <key (up arrow v) pressed?>> then\n if <not <key (any v) pressed?>> then\n switch costume to (idle v)\n end\n else\n switch costume to (jump v)\n wait (0.7) seconds\n switch costume to (fall v)\n wait (0.8) seconds\n wait until <not <key (up arrow v) pressed?>>\n end\n end\nend\n\ndefine Death effect\nstart sound [Oops v]\ncreate clone of (_myself_ v)\nset [xv v] to [0]\nset [yv v] to [0]\ngo to x: (-210) y: (-94)\n\nwhen flag clicked\npoint in direction (90)\nwait until <key (space v) pressed?>\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n change [yv v] by (-0.25)\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.75)\n point in direction (-90)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.75)\n point in direction (90)\n end\n set [xv v] to ((XV) * (0.9))\n change x by (XV)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (1)\n if <touching (sprite4 v)?> then\n change y by (-6)\n if <key (up arrow v) pressed?> then\n set [yv v] to [8]\n if <(XV) > [0]> then\n set [xv v] to [-10]\n else\n set [xv v] to [10]\n end\n else\n change x by ((XV) * (-1))\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change y by (YV)\n if <touching (sprite4 v)?> then\n change y by ((YV) * (-1))\n set [yv v] to [0]\n end\n change y by (-0.5)\n if <<touching (sprite4 v)?> and <key (up arrow v) pressed?>> then\n set [yv v] to [6]\n end\n change y by (0.5)\n if <key (r v) pressed?> then\n set [xv v] to [0]\n set [yv v] to [0]\n go to x: (-210) y: (-94)\n end\n if <[225] < (x position)> then\n set [xv v] to [0]\n set [yv v] to [0]\n go to x: (-210) y: (-94)\n broadcast (next level v)\n end\n if <touching (sprite2 v)?> then\n Death effect\n end\nend\n\nwhen I start as a clone\nclear graphic effects\nswitch costume to (idle v)\ngo to [front v] layer\nrepeat (10)\n change y by (5)\n change [ghost v] effect by (10)\nend\n\nwhen flag clicked\nforever\n if <([costume # v] of [sprite4 v]) = [9]> then\n switch backdrop to (3 v)\n end\nend\n\nwhen flag clicked\ngo to x: (-133) y: (-114)\nset size to (200) %\nshow\n\nwhen flag clicked\nset [walk v] to [1]\nforever\n if <<key (left arrow v) pressed?> or <key (right arrow v) pressed?>> then\n change [walk v] by (1)\n wait (0.02) seconds\n if <(Walk) > [4]> then\n set [walk v] to [1]\n end\n end\nend\n\nwhen flag clicked\nforever\n if <<<not <key (left arrow v) pressed?>> and <not <key (right arrow v) pressed?>>> and <<not <key (up arrow v) pressed?>> and <not <key (down arrow v) pressed?>>>> then\n switch costume to (idle v)\n end\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (0) y: (0)\nswitch costume to (1 v)\nhide\n\nwhen I receive [next level v]\nnext costume\n\nwhen [space v] key pressed\nshow\n\n
A kiwi platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (blue sky v)\n\n@Player\n\nwhen flag clicked\npoint in direction (90)\nset size to (100) %\nhide\ngo to x: (-220) y: (-120)\nset rotation style [left-right v]\npoint in direction (90)\nshow\nset [takeoffspeed v] to [12]\nset [runspeed v] to [8]\nset [gravity v] to [-1]\nset [fallspeed v] to [0]\nforever\n run controls\n jump control\n simulate gravity\n if <touching color (#000000)?> then\n hide\n broadcast (die v)\n set rotation style [left-right v]\n go to x: (-220) y: (-120)\n set [takeoffspeed v] to [12]\n set [runspeed v] to [8]\n set [gravity v] to [-1]\n set [fallspeed v] to [0]\n broadcast (start v)\n point in direction (90)\n show\n end\n if <touching color (#ffb500)?> then\n hide\n broadcast (new level v)\n set rotation style [left-right v]\n go to x: (-220) y: (-120)\n set [takeoffspeed v] to [12]\n set [runspeed v] to [8]\n set [gravity v] to [-1]\n set [fallspeed v] to [0]\n broadcast (start v)\n point in direction (90)\n show\n end\n if <touching color (#7f00ff)?> then\n set [takeoffspeed v] to [17]\n change y by (-1)\n set [fallspeed v] to (takeoffspeed)\n change y by (1)\n set [takeoffspeed v] to [10]\n end\n if <touching color (#7f00ff)?> then\n set [takeoffspeed v] to [17]\n else\n set [takeoffspeed v] to [12]\n end\n if <touching color (#00ffff)?> then\n set [gravity v] to [-0.3]\n else\n set [gravity v] to [-1]\n end\n if <touching color (#382d07)?> then\n point in direction (-90)\n say [thank you] for (2) seconds\n point in direction (90)\n set [move v] to [228]\n repeat (20)\n set x to (MOVE)\n change [move v] by (1)\n end\n hide\n wait until <key (space v) pressed?>\n end\nend\n\nshow\nbroadcast (new level v)\n\ndefine simulate gravity\nchange y by (fallspeed)\nif <touching color (#007025)?> then\n if <(fallspeed) < [0]> then\n set [reversestep v] to [1]\n else\n set [reversestep v] to [-1]\n end\n repeat until <not <touching color (#007025)?>>\n change y by (reversestep)\n end\n set [fallspeed v] to [0]\nelse\n change [fallspeed v] by (gravity)\nend\n\ndefine jump control\nif <key (up arrow v) pressed?> then\n if <touching color (#00ffff)?> then\n if <key (up arrow v) pressed?> then\n set [fallspeed v] to ((takeoffspeed) / (2))\n end\n else\n change y by (-1)\n if <touching color (#007025)?> then\n set [fallspeed v] to (takeoffspeed)\n end\n change y by (1)\n end\nend\n\nif <key (right arrow v) pressed?> then\n change x by (runspeed)\n point in direction (90)\n if <touching color (#00ff55)?> then\n if <key (up arrow v) pressed?> then\n change y by (-1)\n change x by ((0) - (runspeed))\n set [fallspeed v] to (takeoffspeed)\n change x by ((0) - (runspeed))\n change y by (1)\n end\n change x by (-5)\n end\nend\nif <key (left arrow v) pressed?> then\n change x by ((0) - (runspeed))\n point in direction (-90)\n if <touching color (#00ff55)?> then\n if <key (up arrow v) pressed?> then\n change y by (-1)\n change x by (runspeed)\n set [fallspeed v] to (takeoffspeed)\n change x by (runspeed)\n change y by (1)\n end\n change x by (5)\n end\nend\n\ndefine run controls\nif <key (right arrow v) pressed?> then\n point in direction (90)\n change x by (runspeed)\n if <touching color (#007025)?> then\n change x by ((0) - (runspeed))\n end\nelse\n change x by ((runspeed) / (2))\n if <touching color (#007025)?> then\n change x by ((0) - (runspeed))\n end\nend\nif <key (left arrow v) pressed?> then\n change x by ((0) - (runspeed))\n point in direction (-90)\n if <touching color (#007025)?> then\n change x by (runspeed)\n end\nelse\n change x by (((0) - (runspeed)) / (2))\n if <touching color (#007025)?> then\n change x by (runspeed)\n end\nend\n\nif <key (left arrow v) pressed?> then\n change [move v] by (-1)\nend\n\nchange x by ((0) - (runspeed))\npoint in direction (-90)\nif <touching color (#007025)?> then\n change x by (runspeed)\nend\n\npoint in direction (90)\nchange x by (runspeed)\nif <touching color (#007025)?> then\n change x by ((0) - (runspeed))\nend\n\nif <key (left arrow v) pressed?> then\n change x by ((0) - (runspeed))\n point in direction (-90)\n if <touching color (#007025)?> then\n change x by (5)\n end\nelse\n change x by (((0) - (runspeed)) / (2))\n point in direction (-90)\n if <touching color (#007025)?> then\n change x by (5)\n end\nend\n\nif <key (right arrow v) pressed?> then\nif <key (right arrow v) pressed?> then\n change [move v] by (-1)\nelse\n repeat until <(MOVE) = [0]>\n change [move v] by (1)\n end\nend\n\nshow variable [move v]\n\nwhen flag clicked\nset [move v] to [0]\n\nchange x by (MOVE)\nif <<key (right arrow v) pressed?> and <not <touching color (#007025)?>>> then\n repeat until <(MOVE) = [5]>\n change [move v] by (1)\n end\nend\nif <<key (left arrow v) pressed?> and <not <touching color (#007025)?>>> then\n repeat until <(MOVE) = [-5]>\n change [move v] by (-1)\n end\nend\n\nset x to (228)\n\n@Platforms\n\nwhen flag clicked\npoint in direction (90)\nset size to (100) %\nswitch costume to (costume5 v)\ngo to x: (0) y: (0)\nshow\nforever\n set [level v] to (costume [number v])\nend\n\nwhen I receive [new level v]\nnext costume\n\n@Sprite1\n\nwhen flag clicked\nhide\ngo to [front v] layer\nforever\n if <(level) = [16]> then\n show\n else\n hide\n end\nend\n\n@Sprite2\n\nwhen flag clicked\nhide\ngo to x: (221) y: (-55)\ngo to [front v] layer\ngo [backward v] (10) layers\nforever\n if <(level) = [16]> then\n show\n else\n hide\n end\nend\n\n@Sprite3\n\nwhen flag clicked\nhide\n\n
Help the kiwi get back to her nest. \n\nArrow keys to move, avoid black\n\nkiwis are little brown birds about the size of a chicken they cannot fly, they are an endangered species. there are 5 types of kiwi, there is only about 400 Rowi (a type of kiwi) left in the world which is kinda sad i guess, they became endangered because of people hunting them, habitat loss, weasels, dogs, hedgehogs, ect. only about 5% of kiwis live to be fully grown up. thankfully some people are trying to save them the Kiwis for kiwi charity have donated $7 million to kiwi conservation groups around NZ
Unexpected (platformer)
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop2 v)\nforever\n play sound [Alkali - Lively v] until done\nend\n\n@Sprite1\n\nwhen flag clicked\nshow\ngo to [front v] layer\nforever\n go to [front v] layer\n if <key (right arrow v) pressed?> then\n switch costume to (costume2 v)\n end\n if <key (left arrow v) pressed?> then\n switch costume to (costume4 v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff9700)?> then\n set [x v] to [20]\n end\nend\n\nwhen flag clicked\nforever\n if <<([costume # v] of [sprite2 v]) = [6]> or <([costume # v] of [sprite2 v]) = [13]>> then\n if <(x position) < [-240]> then\n broadcast (next level v)\n go to x: (-177) y: (8)\n end\n else\n if <(x position) > [240]> then\n broadcast (next level v)\n go to x: (-177) y: (8)\n end\n end\nend\n\nwhen flag clicked\nforever\n if <key (right arrow v) pressed?> then\n change [x v] by (1.5)\n end\n if <key (left arrow v) pressed?> then\n change [x v] by (-1.5)\n end\n set [x v] to ((x) * (0.8))\n change x by (x)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change y by (1)\n if <touching color (#38c300)?> then\n change x by ((x) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [5]\n end\n set [y v] to [10]\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n end\n change [y v] by (-1)\n change y by (y)\n if <touching color (#38c300)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <<key (up arrow v) pressed?> and <touching color (#38c300)?>> then\n set [y v] to [12]\n end\n change y by (1)\nend\n\n\n\nwhen flag clicked\nforever\n if <touching color (#d92020)?> then\n set [x v] to [0]\n go to x: (-177) y: (8)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#35bc00)?> then\n set [x v] to [0]\n go to x: (-177) y: (8)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#9966ff)?> then\n set [x v] to [0]\n go to x: (-177) y: (8)\n end\nend\n\nwhen flag clicked\ngo to x: (-177) y: (8)\nforever\n if <not <<key (right arrow v) pressed?> or <key (left arrow v) pressed?>>> then\n switch costume to (costume3 v)\n end\nend\n\nset [y v] to <touching color (#38c300)?>\n\ncreate clone of (_myself_ v)\n\ncreate clone of (_myself_ v)\n\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\n\nset [ghost v] effect to (0)\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\n@Sprite2\n\nwhen flag clicked\nshow\nswitch costume to (costume2 v)\n\nwhen I receive [next level v]\nnext costume\ngo to x: (0) y: (0)\n\n@Sprite3\n\nwhen flag clicked\nshow\ngo to [back v] layer\n\n
As I promised I shared today, 12 February!\nArrow keys to move :)\nAnd avoid many things XP\nThere will come part 2. With more tricks! :D\nIf you see any glitch, say that please!\n
Mobility - A Platformer
@Stage\n\nwhen I receive [initialize v]\nset volume to (50) %\nforever\n play sound [Jolly Jump - by @happybird123 v] until done\nend\n\n@Player\n\nwhen I receive [initialize v]\ngo to x: (-200) y: (-80)\nset [xv v] to [0]\nset [yv v] to [0]\nset [deaths v] to [0]\nshow\nforever\n if <<(mouse x) > [0]> and <mouse down?>> then\n change [xv v] by (1)\n end\n if <<(mouse x) < [0]> and <mouse down?>> then\n change [xv v] by (-1)\n end\n set [xv v] to ((xV) * (0.9))\n change x by (xV)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change y by (1)\n if <touching (levels v)?> then\n change x by ((xV) * (-1))\n change y by (-5)\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (yV)\n if <touching (levels v)?> then\n change y by ((yV) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching (levels v)?> then\n if <<(mouse y) > [0]> and <mouse down?>> then\n set [yv v] to [12]\n end\n end\n change y by (1)\n if <touching (danger v)?> then\n change [deaths v] by (1)\n show variable [deaths v]\n wait (0.5) seconds\n set [xv v] to [0]\n set [yv v] to [0]\n hide variable [deaths v]\n go to x: (-200) y: (-80)\n end\nend\n\nwhen flag clicked\nhide\nhide variable [deaths v]\n\nwhen I receive [levelchange v]\ngo to x: (-200) y: (-80)\nset [xv v] to [0]\nset [yv v] to [0]\n\n@Levels\n\nwhen flag clicked\nset [level v] to [1]\nhide\n\nwhen I receive [initialize v]\ngo to x: (0) y: (0)\nshow\nforever\n switch costume to (Level)\n if <([x position v] of [player v]) > [220]> then\n change [level v] by (1)\n broadcast (LevelChange v)\n end\nend\n\n@Danger\n\nwhen flag clicked\nhide\n\nwhen I receive [initialize v]\ngo to x: (0) y: (0)\nshow\nforever\n switch costume to (Level)\nend\n\n@Lost Phones\n\nwhen flag clicked\nset size to (20) %\nhide\nset [lost phones v] to [0]\nset [moving v] to [0]\nhide variable [lost phones v]\nhide variable [time v]\nhide variable [score v]\nhide variable [☁ highscore v]\n\nwhen I receive [levelchange v]\nif <(Level) = [1]> then\n hide\nend\nif <(Level) = [2]> then\n go to x: (-86) y: (121)\n show\n Drift [2]\nend\nif <(Level) = [3]> then\n go to x: (-181) y: (95)\n show\n Drift [3]\nend\nif <(Level) = [4]> then\n hide\nend\nif <(Level) = [5]> then\n go to x: (-3) y: (168)\n show\n Drift [5]\nend\nif <(Level) = [6]> then\n hide\nend\nif <(Level) = [7]> then\n go to x: (158) y: (-82)\n show\n Drift [7]\nend\nif <(Level) = [8]> then\n go to x: (-208) y: (51)\n show\n Drift [8]\nend\nif <(Level) = [9]> then\n hide\nend\nif <(Level) = [10]> then\n go to x: (-154) y: (170)\n show\n Drift [10]\nend\nif <(Level) = [11]> then\n hide\n show variable [lost phones v]\n show variable [deaths v]\n set [time v] to (round (timer))\n show variable [time v]\n set [score v] to ((((300) * (Lost Phones)) - ((50) * (Deaths))) - (Time))\n show variable [score v]\n if <(Score) > (☁ Highscore)> then\n set [☁ highscore v] to (Score)\n end\n show variable [☁ highscore v]\nend\n\ndefine Drift (level)\nrepeat until <(Level) > (level)>\n change [moving v] by (3)\n change y by (([cos v] of (moving) ) / (2))\n if <touching (player v)?> then\n hide\n change [lost phones v] by (1)\n show variable [lost phones v]\n wait (1) seconds\n hide variable [lost phones v]\n end\nend\n\n@MF Intro\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [brightness v] effect to (-100)\nswitch costume to (mf intro background v)\ngo to [front v] layer\nshow\nrepeat (20)\n change [brightness v] effect by (5)\nend\ncreate clone of (_myself_ v)\nwait (2) seconds\nrepeat (20)\n change [brightness v] effect by (-5)\nend\nbroadcast (Initialize v)\nhide\n\nwhen I start as a clone\nset [ghost v] effect to (100)\nswitch costume to (mf intro text v)\ngo to [front v] layer\nrepeat (20)\n change [ghost v] effect by (-5)\nend\nwait (2) seconds\ndelete this clone\n\n@Thumbnail\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\nclear graphic effects\n\nwhen I receive [initialize v]\ngo to [front v] layer\nswitch costume to (instructions v)\nshow\nwait until <mouse down?>\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\nclear graphic effects\n\nclear graphic effects\nswitch costume to (thumbnail v)\ngo to [front v] layer\nshow\n\n
This is a pretty standard #platformer. Except, instead of controlling the player with the arrow keys, you're doing it with the #mobile-friendly method of touch controls! Use the mouse to move the player. Clicking on the right will move the player to the right, and vice versa for the left. Moving the mouse to the top of the screen will make the player jump. There's a graphic at the beginning to explain. Complete all 10 levels to beat the game. What score did you get?
an emoji platformer
@Stage\n\nwhen flag clicked\nset [level v] to [1]\nswitch backdrop to (backdrop1 v)\nwait (3.15) seconds\n\nswitch backdrop to (backdrop1 v)\n\n@Player\n\nwhen flag clicked\ngo to x: (-200) y: (-30)\nset [x velocity v] to [0]\nset [y velocity v] to [0]\nhide\nwait (3.1) seconds\nshow\nforever\n if <not <<(Level) = [3]> or <(Level) = [4]>>> then\n Platform (10) (-1) (0.7) (3)\n end\n if <touching (obstacles v)?> then\n go to x: (-200) y: (-30)\n if <(Level) = [4]> then\n go to x: (-220) y: (-95)\n end\n if <(Level) = [8]> then\n go to x: (-220) y: (-95)\n end\n end\n if <touching (endlevel v)?> then\n change [level v] by (1)\n go to x: (-200) y: (-30)\n if <(Level) = [4]> then\n go to x: (-220) y: (-95)\n end\n if <(Level) = [8]> then\n go to x: (-220) y: (-95)\n end\n if <(Level) = [9]> then\n go to x: (-220) y: (-125)\n end\n end\n if <(Level) = [3]> then\n Platform (18) (-0.25) (0.7) (3)\n end\n if <(Level) = [4]> then\n Platform (10) (-1) (0.7) (8)\n end\nend\n\nif <(distance to [portal 1 v]) < [100]> then\n say [Let's jump into that portal!] for (2) seconds\nend\nif <(distance to [portal 2 v]) < [75]> then\n say [Woah!] for (2) seconds\nend\n\ndefine Platform (jump height) (gravity) (friction) (running speed)\nif <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (90)\n change [x velocity v] by (running speed)\nend\nif <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (-90)\n change [x velocity v] by ((running speed) * (-1))\nend\nset [x velocity v] to ((x velocity) * (friction))\nchange x by (x velocity)\nif <<touching (level v)?> or <touching (movinglevel v)?>> then\n set [slope v] to [0]\n repeat until <<(slope) = [8]> or <not <<touching (level v)?> or <touching (movinglevel v)?>>>>\n change [slope v] by (1)\n change y by (1)\n end\n if <<touching (level v)?> or <touching (movinglevel v)?>> then\n change y by ((slope) * (-1))\n repeat ([ceiling v] of ([abs v] of (x velocity) ) )\n if <<touching (level v)?> or <touching (movinglevel v)?>> then\n change x by ((([abs v] of (x velocity) ) / (x velocity)) * (-1))\n end\n end\n set [x velocity v] to [0]\n end\nend\nchange y by (y velocity)\nif <<touching (level v)?> or <touching (movinglevel v)?>> then\n repeat ([ceiling v] of ([abs v] of (y velocity) ) )\n if <<touching (level v)?> or <touching (movinglevel v)?>> then\n change y by ((([abs v] of (y velocity) ) / (y velocity)) * (-1))\n end\n end\n if <<(([abs v] of (y velocity) ) / (y velocity)) = [-1]> and <<key (up arrow v) pressed?> or <key (w v) pressed?>>> then\n set [y velocity v] to (jump height)\n else\n set [y velocity v] to [0]\n end\nelse\n change [y velocity v] by (-1)\nend\n\n@Level\n\nwhen flag clicked\nhide\nwait (3.15) seconds\nshow\nforever\n go to x: (0) y: (0)\n switch costume to (Level)\nend\n\n@EndLevel\n\nwhen flag clicked\ngo to x: (185) y: (140)\nhide\nwait (3.1) seconds\nforever\n show\n if <not <<(Level) = [5]> or >> then\n set y to ((142.5) + (([cos v] of (((timer) - (3)) * (500)) ) * (2.5)))\n end\n if <(Level) = [5]> then\n go to x: (185) y: (140)\n set y to ((140) + (([cos v] of (((timer) - (3)) * (500)) ) * (2.5)))\n end\n if <(Level) = [6]> then\n go to x: (200) y: (127)\n set y to ((127) + (([cos v] of (((timer) - (3)) * (500)) ) * (2.5)))\n end\n if <(Level) = [9]> then\n hide\n end\nend\n\n@Obstacles\n\nwhen flag clicked\ngo to x: (-97) y: (-146)\nhide\nwait (3.1) seconds\nshow\nforever\n switch costume to (Level)\nend\n\n@Music\n\nwhen flag clicked\nforever\n play sound [Flint-L - White Peaks v] until done\nend\n\n@Intro\n\nwhen flag clicked\ngo to x: (20) y: (0)\nshow\nset [ghost v] effect to (100)\nrepeat (50)\n change [ghost v] effect by (-2)\nend\nwait (1.45) seconds\nhide\n\n
all credit goes to @-Nexus85-\n\nwasd to move or arrow keys
platformer 2
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\n@Scratch Cat\n\nwhen flag clicked\nswitch backdrop to (rays v)\nswitch costume to (stand v)\nforever\n point in direction (90)\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n point in direction (90)\n change [xv v] by (1)\n next costume\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n point in direction (-90)\n change [xv v] by (-1)\n next costume\n end\n if <[225] < (x position)> then\n switch backdrop to (next backdrop v)\n go to x: (-198) y: (-21)\n end\nend\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\ngo to x: (-205) y: (-56)\nset [level: v] to [1]\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#000000)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000000)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [15]\n end\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n go to x: (-205) y: (-56)\n end\n if <touching color (#cc99ff)?> then\n go to x: (-205) y: (-56)\n broadcast (changebd v)\n end\n if <touching color (#99ffff)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [5]\n else\n set [yv v] to [-5]\n end\n end\n if <touching color (#ff9400)?> then\n set [yv v] to [23]\n end\n if <key (r v) pressed?> then\n go to x: (-205) y: (-56)\n end\nend\n\nstart sound [boing v]\n\nwhen I receive [struvk v]\ngo to x: (-198) y: (21)\n\nwhen [space v] key pressed\ngo to x: (up) y: (-192)\nhide variable [up v]\n\nwhen [space v] key pressed\ngo to x: (-174) y: (48)\n\nwhen flag clicked\nplay sound [Josh A - No Chill \(Ft. MrTLexify\).mp3 v] until done\n\n@thumbnail\n\nwhen flag clicked\nforever\n show\n go to [front v] layer\n set [ghost v] effect to (100)\n go to x: (0) y: (0)\nend\n\n
use arrows to control the cat and avoid red\nAll rude comments will be reported.\na little bit laggy if there are multiple people playing it.\nlove to limit lag (hee hee)
> Snowy Lands Platformer <
@Stage\n\nwhen flag clicked\nset volume to (100) %\nforever\n play sound [Puzzle-Dreams-2.mp3 v] until done\nend\n\nwhen I receive [ded v]\nchange volume by (-20)\nwait (1) seconds\nchange volume by (20)\n\nwhen flag clicked\nforever\n if <key (m v) pressed?> then\n set volume to (0) %\n end\n wait until <key (m v) pressed?>\n set volume to (100) %\nend\n\n@Levels\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\nforever\n switch costume to (lvl)\nend\n\n@Player\n\nwhen flag clicked\nset size to (15) %\n\nwhen flag clicked\ngo to x: (-210) y: (54)\nset [lvl v] to [1]\nforever\n if <<(x position) > [230]> and <touching (_edge_ v)?>> then\n change [lvl v] by (1)\n go to x: (-213) y: (y position)\n set [x v] to [0]\n set [y v] to [0]\n end\nend\n\nwhen flag clicked\nset [y v] to [0]\nset [x v] to [0]\nset [timer v] to [0]\nforever\n change [y v] by (-1)\n if <(timer) = [0]> then\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [x v] by (1)\n end\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [x v] by (-1)\n end\n end\n set [x v] to ((x) * (0.9))\n change x by (x)\n if <touching color (#c5ebee)?> then\n change y by (1)\n if <touching color (#c5ebee)?> then\n change y by (1)\n if <touching color (#c5ebee)?> then\n change y by (1)\n if <touching color (#c5ebee)?> then\n change y by (1)\n if <touching color (#c5ebee)?> then\n change y by (1)\n change x by ((x) * (-1))\n change y by (-5)\n end\n end\n end\n end\n end\n change y by (y)\n if <touching color (#c5ebee)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <(timer) = [0]> then\n if <<<key (up arrow v) pressed?> or <key (w v) pressed?>> and <touching color (#c5ebee)?>> then\n set [y v] to [14]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\nforever\n if <<touching color (#56656f)?> or <<touching color (#8d8e90)?> or <touching (sprite1 v)?>>> then\n go to x: (-212) y: (167)\n change [deaths v] by (1)\n broadcast (ded v)\n set [x v] to [0]\n set [y v] to [0]\n start sound [julien_matthey_impact_snowball_on_cement_003.mp3 v]\n end\nend\n\nwhen I receive [ded v]\nset [timer v] to [1]\nrepeat (5)\n change [brightness v] effect by (-20)\n wait (0.1) seconds\n start sound [whoop v]\n change [brightness v] effect by (20)\n wait (0.1) seconds\nend\nset [timer v] to [0]\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\n\n@Player Shodow\n\nwhen flag clicked\ngo to [front v] layer\ngo [backward v] (2) layers\nforever\n go to x: ([x position v] of [player v]) y: (-78)\n if <touching color (#b2722b)?> then\n hide\n else\n show\n end\nend\n\nturn right (15) degrees\n\nwhen flag clicked\nforever\n\nset size to ((100) + (([y position v] of [player v]) * (-1))) %\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (99)\ngo to [back v] layer\n\n@Snow\n\nwhen I start as a clone\nforever\n hide\n go [backward v] (1000) layers\n go to x: (x position) y: (180)\n wait (pick random (0) to (7.5)) seconds\n show\n glide (pick random (4) to (10)) secs to x: (x position) y: (-180)\nend\n\nwhen flag clicked\nhide\ngo to x: (-240) y: (180)\nrepeat (60)\n create clone of (_myself_ v)\n change x by (8)\nend\n\n
Snowy Lands Platformer\n\n - Use Arrow Keys or WASD\n - PLAY THE ORIGINAL:\n https://scratch.mit.edu/projects\n /276286494/
Cute Cube Adventure 1 (Platformer Series)
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [message1 v]\nswitch backdrop to (backdrop2 v)\n\nwhen [s v] key pressed\nswitch backdrop to (next backdrop v)\n\nwhen flag clicked\nforever\n play sound [Sidewalk Leafs - KnightKit12 v] until done\nend\n\n@Cute Cube\n\nwhen flag clicked\nset rotation style [left-right v]\nset [y spawn v] to [-115]\nset [x spawn v] to [-218]\ngo to x: (X Spawn) y: (Y Spawn)\nshow\nset size to (50) %\nset [x v] to [0]\nset [y v] to [0]\nforever\n Platformer engine\nend\n\ndefine Platformer engine\nchange [y v] by (-0.5)\nif <key (left arrow v) pressed?> then\n change [x v] by (-1)\n point in direction (-90)\nend\nif <key (right arrow v) pressed?> then\n point in direction (90)\n change [x v] by (1)\nend\nset [x v] to ((x) * (0.9))\nchange x by (x)\nif <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (1)\n if <touching color (#000000)?> then\n change y by (-6)\n change x by ((x) * (-1))\n if <key (up arrow v) pressed?> then\n set [y v] to [10]\n if <(x) > [0]> then\n set [x v] to [-10]\n else\n set [x v] to [10]\n end\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\nend\nchange y by (y)\nif <touching color (#000000)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\nend\nchange y by (-0.5)\nif <<touching color (#000000)?> and <key (up arrow v) pressed?>> then\n set [y v] to [10]\nend\nchange y by (0.5)\nif <touching color (#ff0000)?> then\n go to x: (X Spawn) y: (Y Spawn)\nend\nif <touching color (#ff00eb)?> then\n set [y v] to [16]\nend\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\nwhen backdrop switches to [backdrop2 v]\nshow\n\nwhen [r v] key pressed\nset [y spawn v] to [-115]\nset [x spawn v] to [-218]\ngo to x: (X Spawn) y: (Y Spawn)\nshow\nset size to (50) %\nset [x v] to [0]\nset [y v] to [0]\n\nwhen flag clicked\nforever\n if <(x position) > [234]> then\n switch backdrop to (next backdrop v)\n go to x: (-218) y: (-115)\n end\nend\n\nwhen backdrop switches to [backdrop8 v]\ngo to x: (-218) y: (-115)\n\nwhen backdrop switches to [backdrop8 v]\nif <key (r v) pressed?> then\n go to x: (-218) y: (-115)\nend\n\nwhen flag clicked\nforever\n if <(y position) < [-171]> then\n go to x: (-218) y: (-115)\n end\nend\n\nwhen backdrop switches to [backdrop21 v]\nhide\n\n@Play Game Button\n\nwhen flag clicked\nshow\n\nwhen backdrop switches to [backdrop2 v]\nhide\n\nwhen flag clicked\nforever\n if <touching (mouse-pointer v)?> then\n repeat (4)\n change size by (3)\n end\n wait until <not <touching (mouse-pointer v)?>>\n repeat (4)\n change size by (-3)\n end\n end\nend\n\nwhen this sprite clicked\nbroadcast (message1 v)\n\n@Red Block\n\nwhen backdrop switches to [backdrop11 v]\nshow\nset size to (100) %\ncreate clone of (_myself_ v)\ngo to x: (21) y: (30)\nforever\n glide (1) secs to x: (21) y: (220)\n glide (.2) secs to x: (21) y: (30)\nend\n\nwhen I start as a clone\nshow\ngo to x: (260) y: (30)\nforever\n glide (1) secs to x: (260) y: (220)\n glide (.2) secs to x: (260) y: (30)\nend\n\nwhen backdrop switches to [backdrop12 v]\ndelete this clone\n\nwhen backdrop switches to [backdrop12 v]\nhide\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop1 v]\nhide\n\n@Red Block 2\n\nwhen backdrop switches to [backdrop12 v]\nshow\nset size to (50) %\ngo to x: (268) y: (61)\nforever\n glide (.5) secs to x: (-20) y: (61)\n glide (.5) secs to x: (268) y: (61)\nend\n\nwhen flag clicked\nhide\n\nwhen backdrop switches to [backdrop13 v]\nhide\n\n
Cute Cube Adventure 1 (Platformer Series)\nFRONT PAGED ON 2/20/2019 thanks, @-PixelParty-!!\nCute Cube Adventure 2: https://scratch.mit.edu/projects/289001637/\nCute Cube Adventure 3: https://scratch.mit.edu/projects/291836076/\nSetting:\nHey ya'll! Welcome to Cute Cube Adventure 1, the first part in a platformer series!! Today, Cute Cube wants to take a hike in the peaceful hills of Cube Land! Unfortunately, there are some hard peices of terrain that could hurt Cute Cube. Can you help him have a fun and safe time up in the hills?\n \nInstructions:\n--Use your arrow keys to move--\n--Press the R key to restart any level--\n--Press the S key to skip any level--\n--Dodge the red spikes and other obstacles to help Cute Cube have a fun time in the hills of Cube Land!--\n--Have fun!!--
Grapple Hook Platformer (Test)
@Stage\n\n@Character\n\nwhen flag clicked\ngo to x: (0) y: (30)\nset [y speed v] to [0]\nset [x speed v] to [0]\nforever\n if <(Grappled) = [N]> then\n if <<key (w v) pressed?> and <touching (ground v)?>> then\n change y by (5)\n set [y speed v] to [5]\n end\n if <key (d v) pressed?> then\n if <not <(X speed) > [5.1]>> then\n change [x speed v] by (1)\n end\n else\n if <key (a v) pressed?> then\n if <not <(X speed) < [-5.1]>> then\n change [x speed v] by (-1)\n end\n else\n if <touching (ground v)?> then\n if <(X speed) < [0]> then\n change [x speed v] by (0.5)\n end\n if <(X speed) > [0]> then\n change [x speed v] by (-0.5)\n end\n end\n end\n end\n end\nend\n\nwhen flag clicked\nset [grappled v] to [N]\nforever\n if <(Grappled) = [N]> then\n change x by (X speed)\n change y by (Y speed)\n if <touching (ground v)?> then\n if <not <key (up arrow v) pressed?>> then\n set [grounded v] to [1]\n Grounded\n end\n else\n set [grounded v] to [0]\n change [y speed v] by (-0.5)\n end\n end\nend\n\ndefine Grounded\nrepeat until <not <touching (ground v)?>>\n change y by (1)\nend\nchange y by (-1)\nset [y speed v] to [0]\n\nwhen flag clicked\nset [grapple swing speed v] to [0]\nforever\n if <(Grappled) = [y]> then\n if <key (w v) pressed?> then\n change [grapple disance v] by (-1)\n end\n if <key (s v) pressed?> then\n change [grapple disance v] by (1)\n end\n if <touching (ground v)?> then\n if <not <key (w v) pressed?>> then\n set [grounded v] to [1]\n Grounded\n end\n change x by (X speed)\n change y by (Y speed)\n if <key (d v) pressed?> then\n if <not <(X speed) > [5.1]>> then\n change [x speed v] by (1)\n end\n else\n if <key (a v) pressed?> then\n if <not <(X speed) < [-5.1]>> then\n change [x speed v] by (-1)\n end\n else\n if <(X speed) < [0]> then\n change [x speed v] by (0.5)\n end\n if <(X speed) > [0]> then\n change [x speed v] by (-0.5)\n end\n end\n end\n if <(Grapple Disance) < (distance to [hook v])> then\n if <(X speed) < [0]> then\n if <(X speed) > [0]> then\n point towards (hook v)\n turn right (180) degrees\n set [grapple direction v] to (direction)\n set [grapple swing speed v] to ((X speed) * (-0.75))\n go to (hook v)\n point in direction (Grapple Direction)\n move (Grapple Disance) steps\n end\n else\n set [grounded v] to [0]\n if <key (d v) pressed?> then\n change [grapple swing speed v] by (-0.1)\n else\n if <key (a v) pressed?> then\n change [grapple swing speed v] by (0.1)\n end\n end\n if <touching (hook left v)?> then\n change [grapple swing speed v] by (-0.5)\n end\n if <touching (hook right v)?> then\n change [grapple swing speed v] by (0.5)\n end\n if <(Grapple Swing Speed) < [-7]> then\n change [grapple swing speed v] by (0.15)\n end\n if <(Grapple Swing Speed) > [7]> then\n change [grapple swing speed v] by (-0.15)\n end\n if <<touching (hook left v)?> and <touching (hook right v)?>> then\n if <(Grapple Swing Speed) < [0]> then\n change [grapple swing speed v] by (0.05)\n end\n if <(Grapple Swing Speed) > [0]> then\n change [grapple swing speed v] by (-0.05)\n end\n end\n change [grapple direction v] by (Grapple Swing Speed)\n go to (hook v)\n point in direction (Grapple Direction)\n move (Grapple Disance) steps\n if <touching (ground v)?> then\n set [x speed v] to [0]\n end\n end\n end\nend\n\nwhen flag clicked\nforever\n set y to (round (y position))\n set x to (round (x position))\nend\n\nwhen flag clicked\nset [xpos v] to [280]\nset [ypos v] to [0]\nforever\n if <(y position) > [50]> then\n change [ypos v] by ((y position) - (50))\n set y to (50)\n end\n if <<[-50] > (y position)> and <not <(YPos) = [0]>>> then\n change [ypos v] by ((y position) - (-50))\n set y to (-50)\n end\n if <(YPos) < [0]> then\n set [ypos v] to [0]\n end\n if <(x position) > [50]> then\n change [xpos v] by ((x position) - (50))\n set x to (50)\n end\n if <[-50] > (x position)> then\n change [xpos v] by ((x position) + (50))\n set x to (-50)\n end\n if <touching (_edge_ v)?> then\n go to x: (0) y: (30)\n set [xpos v] to [280]\n set [ypos v] to [0]\n set [grappled v] to [n]\n wait (0.01) seconds\n set [x speed v] to [0]\n set [y speed v] to [0]\n end\nend\n\nwhen I receive [hitbox v]\ngo to (hitbox v)\n\nwhen flag clicked\nhide variable [xpos v]\nhide variable [ypos v]\nwait until <key (r v) pressed?>\nbroadcast (Debug v)\nforever\n if <key (r v) pressed?> then\n set [y speed v] to [5]\n end\nend\n\n@Hook\n\nwhen flag clicked\nforever\n go to (character v)\n point towards (mouse-pointer v)\n if <key (space v) pressed?> then\n point towards (mouse-pointer v)\n repeat until <<touching (ungrappleable ground v)?> or <<touching (ground v)?> or <(distance to [character v]) > (Grapple Range)>>>\n move (15) steps\n end\n if <touching (ungrappleable ground v)?> then\n create clone of (particle v)\n end\n if <<not <touching (ungrappleable ground v)?>> and <touching (ground v)?>> then\n set [grapple disance v] to (distance to [character v])\n point towards (character v)\n set [grapple swing speed v] to [0]\n if <([y position v] of [character v]) > ((y position) - ((Grapple Disance) / (3)))> then\n change [grapple swing speed v] by ((X speed) * (-0.2))\n change [grapple swing speed v] by ((Y speed) * (0.6))\n else\n if <([y position v] of [character v]) > ((y position) - ((Grapple Disance) / (1.5)))> then\n change [grapple swing speed v] by ((X speed) * (-0.6))\n change [grapple swing speed v] by ((Y speed) * (0.2))\n else\n change [grapple swing speed v] by ((X speed) * (-0.8))\n end\n end\n set [grapple direction v] to (direction)\n turn right (180) degrees\n set [grappled v] to [y]\n set [own xpos v] to ((Xpos) + (x position))\n set [own y pos v] to ((YPos) + (y position))\n repeat until <not <<key (space v) pressed?> or <(Grappled) = [n]>>>\n go to x: ((Own Xpos) - (Xpos)) y: ((Own Y POS) - (YPos))\n end\n repeat until <<key (space v) pressed?> or <(Grappled) = [n]>>\n go to x: ((Own Xpos) - (Xpos)) y: ((Own Y POS) - (YPos))\n end\n end\n set [x speed v] to (Frame DifferenceX)\n set [y speed v] to (Frame Difference Y)\n if <key (w v) pressed?> then\n change [y speed v] by (3)\n end\n broadcast (HitBox v)\n set [grappled v] to [n]\n repeat until <touching (character v)?>\n point towards (character v)\n move (10) steps\n turn right (180) degrees\n end\n repeat until <not <key (space v) pressed?>>\n go to (character v)\n end\n end\nend\n\nwhen flag clicked\nforever\n if <(distance to [character v]) > (Grapple Range)> then\n set [grapple disance v] to (Grapple Range)\n end\n if <[25] > (distance to [character v])> then\n set [grapple disance v] to [25]\n end\nend\n\n@Hook Left\n\nwhen flag clicked\nshow\nset [ghost v] effect to (100)\nforever\n go to [back v] layer\n go to (hook v)\n point in direction (90)\n if <touching (character v)?> then\n switch costume to (costume2 v)\n else\n switch costume to (costume1 v)\n end\nend\n\nwhen I receive [debug v]\nset [ghost v] effect to (75)\n\n@Hook Right\n\nwhen flag clicked\nchange [ghost v] effect by (50)\nset [ghost v] effect to (100)\nforever\n go to [back v] layer\n go to (hook v)\n point in direction (90)\n if <touching (character v)?> then\n switch costume to (costume2 v)\n else\n switch costume to (costume1 v)\n end\nend\n\nwhen I receive [debug v]\nset [ghost v] effect to (75)\nshow variable [xpos v]\nshow variable [ypos v]\n\n@Meep\n\ngo to x: ((Own Xpos) - (Xpos)) y: (0)\n\nset [xpos v] to [0]\n\nwhen flag clicked\ngo to (character v)\nforever\n block name\n go to (character v)\n set [ghost v] effect to (75)\n set [own xpos v] to (Xpos)\nend\n\ndefine block name\nset [frame differencex v] to [0]\nset [frame difference y v] to [0]\nif <([x position v] of [character v]) > (x position)> then\n repeat until <(x position) = (round ([x position v] of [character v]))>\n change [frame differencex v] by (1)\n change x by (1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\nelse\n if <(x position) > ([x position v] of [character v])> then\n repeat until <(x position) = (round ([x position v] of [character v]))>\n change [frame differencex v] by (-1)\n change x by (-1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\n end\nend\nchange [frame differencex v] by ((Xpos) - (Own Xpos))\nif <([y position v] of [character v]) > (y position)> then\n repeat until <(y position) = (round ([y position v] of [character v]))>\n change [frame difference y v] by (1)\n change y by (1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\nelse\n if <(y position) > ([y position v] of [character v])> then\n repeat until <(y position) = (round ([y position v] of [character v]))>\n change [frame difference y v] by (-1)\n change y by (-1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\n end\nend\n\n@Ground\n\nwhen flag clicked\nhide\nset [clones v] to [0]\nrepeat (12)\n change [clones v] by (1)\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nswitch costume to (Clones)\nset [own xpos v] to (((round ((Clones) / (2))) * (480)) - (480))\nif <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\ngo to [front v] layer\nforever\n if <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\n go to x: ((Own Xpos) - (Xpos)) y: ((370) - (YPos))\n else\n go to x: ((Own Xpos) - (Xpos)) y: ((0) - (YPos))\n end\n if <not <touching (ground checker v)?>> then\n set [ghost v] effect to (100)\n else\n set [ghost v] effect to (100)\n end\nend\n\nhide\nshow\n\n@Ungrappleable Ground\n\nwhen flag clicked\nhide\nset [clones v] to [0]\nrepeat (12)\n change [clones v] by (1)\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nswitch costume to (Clones)\nset [own xpos v] to (((round ((Clones) / (2))) * (480)) - (480))\nif <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\ngo to [front v] layer\nforever\n if <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\n go to x: ((Own Xpos) - (Xpos)) y: ((370) - (YPos))\n else\n go to x: ((Own Xpos) - (Xpos)) y: ((0) - (YPos))\n end\n if <not <touching (ground checker v)?>> then\n set [ghost v] effect to (100)\n else\n set [ghost v] effect to (0)\n set [ghost v] effect to (100)\n end\nend\n\nhide\nshow\n\n@Pen Drawer\n\nwhen flag clicked\ngo to (character v)\nset [ghost v] effect to (100)\nforever\n block name\nend\n\ndefine block name\nerase all\nset pen color to (#ce815b)\nset pen size to (2)\npen down\ngo to (hook v)\nglide (0) secs to (character v)\npen up\n\n@Ground Checker\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\n\n@Hitbox\n\nwhen flag clicked\ngo to (character v)\nset [ghost v] effect to (100)\nforever\nend\n\nwhen flag clicked\ngo to (character v)\nset [ghost v] effect to (100)\nforever\n go to (character v)\n block name\n switch costume to (all v)\nend\n\ndefine block name\nswitch costume to (right v)\nif <<(Grapple Swing Speed) < [-7]> or <(Grapple Swing Speed) > [7]>> then\n switch costume to (right2 v)\nelse\n set size to (100) %\nend\nif <touching (ground v)?> then\n repeat until <not <touching (ground v)?>>\n change x by (-1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\n broadcast (HitBox v)\n set [grapple swing speed v] to [1]\n set [x speed v] to [0]\nend\nset size to (100) %\nswitch costume to (up v)\nif <touching (ground v)?> then\n repeat until <not <touching (ground v)?>>\n change y by (-1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\n broadcast (HitBox v)\n set [grapple swing speed v] to [0]\n set [y speed v] to [0]\nend\nswitch costume to (left v)\nif <<(Grapple Swing Speed) < [-7]> or <(Grapple Swing Speed) > [7]>> then\n switch costume to (left2 v)\nelse\n set size to (100) %\nend\nif <touching (ground v)?> then\n repeat until <not <touching (ground v)?>>\n change x by (1)\n if <touching (_edge_ v)?> then\n go to (character v)\n end\n end\n broadcast (HitBox v)\n set [grapple swing speed v] to [-1]\n set [x speed v] to [0]\nend\n\nwhen I receive [debug v]\nset [ghost v] effect to (50)\n\n@Shown Detail\n\nwhen flag clicked\nhide\nset [clones v] to [0]\nrepeat (12)\n change [clones v] by (1)\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\nshow\nswitch costume to (Clones)\nset [own xpos v] to (((round ((Clones) / (2))) * (480)) - (480))\nif <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\ngo to [front v] layer\nforever\n if <((costume [number v]) / (2)) = (round ((costume [number v]) / (2)))> then\n go to x: ((Own Xpos) - (Xpos)) y: ((370) - (YPos))\n else\n go to x: ((Own Xpos) - (Xpos)) y: ((0) - (YPos))\n end\n if <not <touching (ground checker v)?>> then\n set [ghost v] effect to (100)\n else\n set [ghost v] effect to (0)\n end\nend\n\nhide\nshow\n\n@Particle\n\nwhen flag clicked\nhide\n\nwhen I start as a clone\nshow\nturn right (pick random (1) to (359)) degrees\ngo to (hook v)\ngo to [front v] layer\nset size to (50) %\nset [ghost v] effect to (50)\nrepeat (5)\n change size by (15)\n change [ghost v] effect by (5)\nend\ndelete this clone\n\n
WASD to move\nSpace to grapple\n\nMainly a Physics test for an Idea I had
minercraft ( platformer in Minecraft )
@Stage\n\nchange [color v] effect by (-20)\n\nset [color v] effect to (0)\n\nset [ghost v] effect to (60)\n\n@Ground\n\nwhen flag clicked\ngo to [front v] layer\nset size to (100) %\ngo to x: (0) y: (0)\nforever\n switch costume to (join [costume] ([level v] of [diamond v]))\n if <([level v] of [diamond v]) > [9]> then\n if <([level v] of [diamond v]) > [10]> then\n set [brightness v] effect to (-60)\n else\n set [brightness v] effect to (-40)\n end\n else\n set [brightness v] effect to (0)\n end\nend\n\n@Player\n\nwhen flag clicked\nshow\nrest\nforever\n go to [front v] layer\n if <<(y position) < [-179]> or <<touching (hitbox2 v)?> or <<touching (zombie v)?> or >>> then\n rest\n end\n if <touching (diamond v)?> then\n set [levelchanging v] to [1]\n rest\n end\n if <(ladder) = [1]> then\n change [yv v] by (0)\n else\n change [yv v] by ((water) * (-0.5))\n end\n set rotation style [left-right v]\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n point in direction (-90)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n point in direction (90)\n end\n set [xv v] to ((xv) * (0.8))\n change x by (xv)\n if <touching (hitbox v)?> then\n change y by (-1)\n if <touching (hitbox v)?> then\n change y by (-1)\n if <touching (hitbox v)?> then\n change y by (-1)\n if <touching (hitbox v)?> then\n change y by (-1)\n if <touching (hitbox v)?> then\n change y by (-1)\n end\n if <touching (hitbox v)?> then\n change y by (5)\n change x by ((xv) * (-1))\n if <key (up arrow v) pressed?> then\n if <(xv) < [0]> then\n set [yv v] to [5]\n set [xv v] to [5]\n else\n set [yv v] to [5]\n set [xv v] to [-5]\n end\n end\n else\n end\n end\n end\n end\n end\n change y by (yv)\n if <touching (hitbox v)?> then\n change y by ((yv) * (-1))\n set [yv v] to [0]\n end\n if <key (up arrow v) pressed?> then\n if <<not <touching (hitbox3 v)?>> and <not <touching (hitbox4 v)?>>> then\n change y by (-1)\n if <touching (hitbox v)?> then\n change [yv v] by (8.5)\n end\n change y by (1)\n end\n end\nend\n\ndefine rest\ngo to x: (-220) y: (50)\nset [xv v] to [0]\nset [yv v] to [0]\n\nwhen flag clicked\nforever\n if <touching (hitbox3 v)?> then\n set [water v] to [-1]\n if <key (left arrow v) pressed?> then\n change [xv v] by (0.5)\n end\n if <key (right arrow v) pressed?> then\n change [xv v] by (-0.5)\n end\n else\n set [water v] to [1]\n end\nend\n\nwhen flag clicked\nforever\n if <key (s v) pressed?> then\n set [levelchanging v] to [1]\n rest\n wait until <not <key (s v) pressed?>>\n wait (1) seconds\n end\nend\n\nwhen flag clicked\nforever\n if <touching (hitbox4 v)?> then\n set [ladder v] to [1]\n if <key (up arrow v) pressed?> then\n set [yv v] to [3]\n end\n if <key (down arrow v) pressed?> then\n set [yv v] to [-3]\n end\n set [yv v] to ((yv) * (0.8))\n else\n set [ladder v] to [0]\n end\nend\n\n@BackGround\n\nwhen flag clicked\nshow\nforever\n go to x: (0) y: (0)\n go [backward v] (2) layers\n if <([level v] of [diamond v]) = [9]> then\n switch costume to (造型3 v)\n set [ghost v] effect to (30)\n else\n switch costume to (造型2 v)\n if <([level v] of [diamond v]) > [9]> then\n set [ghost v] effect to (0)\n if <([level v] of [diamond v]) > [10]> then\n set [brightness v] effect to (-90)\n else\n set [brightness v] effect to (-70)\n end\n else\n set [brightness v] effect to (0)\n set [ghost v] effect to (80)\n end\n end\nend\n\n@Diamond\n\nwhen flag clicked\nset [level v] to [0]\nset [levelchanging v] to [1]\ngo to [front v] layer\npoint in direction (90)\nforever\n if <(LevelChanging) = [1]> then\n change [level v] by (1)\n if <(level) = [1]> then\n go to x: (171) y: (-20)\n show\n else\n if <(level) = [2]> then\n go to x: (175) y: (37)\n else\n if <(level) = [3]> then\n go to x: (170) y: (148)\n else\n if <(level) = [4]> then\n go to x: (189) y: (9)\n else\n if <(level) = [5]> then\n go to x: (210) y: (9)\n else\n if <(level) = [6]> then\n go to x: (195) y: (-53)\n else\n if <(level) = [7]> then\n go to x: (180) y: (24)\n else\n if <(level) = [8]> then\n go to x: (9) y: (143)\n else\n if <(level) = [9]> then\n go to x: (185) y: (-3)\n else\n if <(level) = [10]> then\n go to x: (185) y: (-3)\n else\n if <(level) = [11]> then\n go to x: (185) y: (-3)\n else\n if <(level) = [12]> then\n go to x: (185) y: (15)\n else\n if <(level) = [13]> then\n go to x: (106) y: (-97)\n else\n hide\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n set [levelchanging v] to [0]\n end\nend\n\nwhen flag clicked\nforever\n repeat (28)\n change y by (0.3)\n end\n repeat (28)\n change y by (-0.3)\n end\nend\n\n@Light\n\nwhen flag clicked\nforever\n go [backward v] (1) layers\n go to (diamond v)\n turn right (pick random (0.6) to (2.1)) degrees\n set [ghost v] effect to (40)\n if <([level v] of [diamond v]) = [14]> then\n hide\n else\n show\n end\nend\n\n@Hitbox\n\nwhen flag clicked\nset size to (100) %\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nforever\n switch costume to (join [costume] ([level v] of [diamond v]))\nend\n\n@Hitbox2\n\nwhen flag clicked\nset size to (100) %\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nforever\n switch costume to (join [costume] ([level v] of [diamond v]))\nend\n\n@Hitbox3\n\nwhen flag clicked\nset size to (100) %\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nforever\n switch costume to (join [costume] ([level v] of [diamond v]))\nend\n\n@Hitbox4\n\nwhen flag clicked\nset size to (100) %\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nforever\n switch costume to (join [costume] ([level v] of [diamond v]))\nend\n\n@snow\n\nwhen flag clicked\nhide\nforever\n if <([level v] of [diamond v]) = [9]> then\n create clone of (_myself_ v)\n wait (0.04) seconds\n end\nend\n\nwhen I start as a clone\nshow\ngo to x: (pick random (-200) to (100)) y: (178)\nset [brightness v] effect to (-8)\nset size to (200) %\nforever\n change x by (pick random (3) to (1))\n change y by (pick random (-2) to (-5))\n turn right (pick random (4) to (7)) degrees\n if <not <([level v] of [diamond v]) = [9]>> then\n delete this clone\n end\nend\n\nwhen I start as a clone\nwait (7) seconds\ndelete this clone\n\n@Zombie\n\nwhen I receive [消息1 v]\nforever\n show\n go to [front v] layer\n repeat (120)\n change x by (1.5)\n point in direction (90)\n end\n repeat (120)\n change x by (-1.5)\n point in direction (-90)\n end\nend\n\nwhen I receive [消息1 v]\nforever\n if <touching (player v)?> then\n stop [other scripts in sprite v]\n wait (0.2) seconds\n broadcast (消息1 v)\n end\nend\n\nwhen I receive [消息1 v]\nset size to (45) %\nset [brightness v] effect to (-30)\nset rotation style [left-right v]\ngo to x: (-58) y: (-30)\nforever\n wait (0.06) seconds\n next costume\nend\n\nwhen I receive [消息1 v]\nforever\n if <([level v] of [diamond v]) = [13]> then\n stop [other scripts in sprite v]\n hide\n end\nend\n\nwhen flag clicked\nhide\nwait (1) seconds\nwait until <([level v] of [diamond v]) = [12]>\nbroadcast (消息1 v)\n\n@Eggs\n\nwhen flag clicked\nset [egg v] to [0]\ngo to [front v] layer\nclear graphic effects\nset size to (120) %\nset [gotten v] to [0]\nforever\n go to [front v] layer\n if <([level v] of [diamond v]) = [2]> then\n clear graphic effects\n show\n switch costume to (chickenface v)\n go to x: (-60) y: (-35)\n else\n if <([level v] of [diamond v]) = [6]> then\n clear graphic effects\n switch costume to (chest v)\n show\n go to x: (116) y: (-76)\n else\n if <([level v] of [diamond v]) = [13]> then\n set [brightness v] effect to (-45)\n switch costume to (chest v)\n show\n go to x: (-232) y: (-8)\n else\n hide\n end\n end\n end\nend\n\nwhen I start as a clone\nwait (0.8) seconds\nrepeat (2)\n repeat (5)\n change size by (20)\n end\n repeat (5)\n change size by (-20)\n end\nend\n\nwhen flag clicked\nset [gotten v] to [0]\nwait until <([level v] of [diamond v]) = [3]>\nset [gotten v] to [0]\nwait until <([level v] of [diamond v]) = [4]>\nset [gotten v] to [0]\nwait until <([level v] of [diamond v]) = [10]>\nset [gotten v] to [0]\n\nwhen I start as a clone\ngo [backward v] (1) layers\nswitch costume to (egg v)\nset size to (100) %\nset [v v] to [6]\nrepeat (25)\n change [v v] by (-0.24)\n change y by (v)\nend\nwait (1) seconds\nrepeat (25)\n change [ghost v] effect by (4)\nend\nchange [egg v] by (1)\ndelete this clone\n\nwhen this sprite clicked\nif <(gotten) = [0]> then\n set [gotten v] to [1]\n create clone of (_myself_ v)\nend\n\n@Eggs2\n\nwhen flag clicked\nforever\n go to x: (-169) y: (161)\n go to [front v] layer\n switch costume to ((egg) - (3))\nend\n\n@Door\n\nwhen flag clicked\nforever\n if <([level v] of [diamond v]) = [1]> then\n go to x: (-27) y: (-30)\n if <[75] < (distance to [player v])> then\n switch costume to (door_top_closed v)\n else\n switch costume to (door v)\n end\n clear graphic effects\n show\n else\n if <([level v] of [diamond v]) = [14]> then\n go to x: (-59) y: (-30)\n if <[75] < (distance to [player v])> then\n switch costume to (door_top_closed v)\n else\n switch costume to (door v)\n end\n show\n set [brightness v] effect to (-40)\n else\n hide\n end\n end\nend\n\nwhen flag clicked\nforever\n play sound [Song34.mp3 v] until done\nend\n\n@Thumbnail\n\nwhen flag clicked\nforever\n go to [front v] layer\n set [ghost v] effect to (100)\nend\n\ngo to x: (0) y: (0)\n\nwhen flag clicked\n\n@sign\n\nwhen flag clicked\nforever\n go to x: (96) y: (-32)\n if <([level v] of [diamond v]) = [1]> then\n show\n if <touching (player v)?> then\n switch costume to (sign2 v)\n else\n switch costume to (sign v)\n end\n else\n hide\n end\nend\n\n
hey :D \nThere's minecraft\nEnjoy!\nThanks @CgBB for an art!!!\nVote here: https://strawpoll.com/49810
Cool Platformer stuff =)
@Stage\n\nwhen flag clicked\n\nwhen [1 v] key pressed\nswitch backdrop to (summer v)\n\nwhen [2 v] key pressed\nswitch backdrop to (winter v)\n\n@Sprite1\n\nwhen flag clicked\n\nwhen flag clicked\npoint in direction (90)\nshow\ngo to x: (-200) y: (15)\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.7)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.7)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching (sprite2 v)?> then\n change y by (1)\n if <touching (sprite2 v)?> then\n change y by (1)\n if <touching (sprite2 v)?> then\n change y by (1)\n if <touching (sprite2 v)?> then\n change y by (1)\n if <touching (sprite2 v)?> then\n change y by (1)\n if <touching (sprite2 v)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching (sprite2 v)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching (sprite2 v)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [12]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\n\nwhen flag clicked\nbroadcast (start levels v)\n\nwhen [space v] key pressed\n\nwhen flag clicked\n\nwhen flag clicked\nforever\n if <touching (sprite4 v)?> then\n end\nend\n\nchange y by (15)\n\nset [scroll x v] to [0]\n\nwhen I receive [start levels v]\nforever\n if <key (right arrow v) pressed?> then\n switch costume to (costume2 v)\n end\n if <key (left arrow v) pressed?> then\n switch costume to (costume3 v)\n end\nend\n\nchange [scroll x v] by (-10)\n\nwhen flag clicked\nforever\n if <touching (sprite4 v)?> then\n if <key (up arrow v) pressed?> then\n change y by (5)\n end\n if <key (down arrow v) pressed?> then\n change y by (-5)\n end\n end\nend\n\ngo to x: (-200) y: (15)\n\nchange y by (1)\n\nwhen flag clicked\nforever\n if <touching (sprite3 v)?> then\n go to x: (-200) y: (30)\n end\nend\n\nif <touching (sprite4 v)?> then\n change y by (1)\nelse\n change y by (0)\nend\n\nchange y by (10)\n\nset [jump velocity v] to [15]\n\npoint in direction (90)\ngo to x: (-129) y: (-72)\nforever\n if <key (right arrow v) pressed?> then\n point in direction (90)\n move (10) steps\n end\n if <key (left arrow v) pressed?> then\n point in direction (-90)\n move (10) steps\n end\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (35) y: (27)\nset [ghost v] effect to (100)\n\nchange [color v] effect by (25)\nchange [color v] effect by (25)\n\nwait (1) seconds\nset [ghost v] effect to (100)\n\nwhen [1 v] key pressed\nswitch costume to (ground v)\n\nwhen [2 v] key pressed\nswitch costume to (ground2 v)\n\n@Sprite3\n\nwhen flag clicked\ngo to x: (37) y: (27)\nset [ghost v] effect to (100)\n\nwhen [1 v] key pressed\nswitch costume to (costume1 v)\n\nwhen [2 v] key pressed\nswitch costume to (costume2 v)\n\n@Sprite4\n\nwhen flag clicked\ngo to x: (36) y: (28)\nset [ghost v] effect to (100)\n\nwhen [1 v] key pressed\nswitch costume to (costume1 v)\n\nwhen [2 v] key pressed\nswitch costume to (costume2 v)\n\n
random stuff\nPress arrows to move\n[1] = Summer Level\n[2] = Winter Level\n:)\nhey this have 1000 views.
Scrolling Platformer
@Stage\n\n@player\n\nwhen flag clicked\nbroadcast (Green Flag Clicked v)\nbroadcast (Play Game v) and wait\n\nwhen I receive [play game v]\nset [level v] to [1]\nforever\n broadcast (Reset v) and wait\n broadcast (Setup v) and wait\n Game on\n repeat until <(EXIT) > []>\n Tick\n set [scroll x v] to (x)\n Position\n broadcast (Tick v) and wait\n go to [front v] layer\n if <([costume name v] of [door v]) = [Open]> then\n if <touching (door v)?> then\n broadcast (Press space v)\n if <key (space v) pressed?> then\n switch costume to (player back v)\n broadcast (Press space hide v)\n repeat (10)\n change [ghost v] effect by (10)\n end\n change [level v] by (1)\n set [exit v] to [next level]\n end\n else\n broadcast (Press space hide v)\n end\n end\n end\n Game - die\nend\n\ndefine Game on\nset [exit v] to []\nswitch costume to (player v)\nif <(LEVEL) = [1]> then\n set [x v] to [0]\n set [y v] to [0]\nend\nif <(LEVEL) = [2]> then\n set [x v] to [130]\n set [y v] to [0]\nend\nif <(LEVEL) = [3]> then\n set [x v] to [-130]\n set [y v] to [-100]\nend\nif <(LEVEL) = [4]> then\n set [x v] to [0]\n set [y v] to [130]\nend\nif <(LEVEL) = [5]> then\n set [x v] to [-150]\n set [y v] to [-75]\nend\nif <(LEVEL) = [6]> then\n set [x v] to [-15]\n set [y v] to [0]\nend\nPosition\nset [sy v] to [0]\nset [in air v] to [0]\nshow\nclear graphic effects\n\ndefine Tick\nif <key (left arrow v) pressed?> then\n change player x by [-8]\nend\nif <key (right arrow v) pressed?> then\n change player x by [8]\nend\nif <(in air) < [4]> then\n if <key (up arrow v) pressed?> then\n set [sy v] to [16]\n end\nend\nchange [sy v] by (-2)\nchange player y by (sy)\n\ndefine change player y by (sy)\nchange [y v] by (sy)\nchange [in air v] by (1)\nPosition\nrepeat until <not <touching (platforms v)?>>\n if <(sy) > [0]> then\n change [y v] by (-1)\n else\n change [y v] by (1)\n set [in air v] to [0]\n end\n Position\n set [sy v] to [0]\n Test - die\nend\nif <[-179] > (y position)> then\n set [exit v] to [die]\nend\n\ndefine Position\ngo to x: ((x) - (SCROLL X)) y: ((y) - (SCROLL Y))\n\ndefine change player x by (sx)\nchange [x v] by (sx)\nPosition\nrepeat until <not <touching (platforms v)?>>\n if <(sx) > [0]> then\n change [x v] by (-1)\n else\n change [x v] by (1)\n end\n Position\n Test - die\nend\nif <[-179] > (y position)> then\n set [exit v] to [die]\nend\n\ndefine Test - die\nif <touching color (#ff3333)?> then\n set [exit v] to [die]\nend\nif <[-179] > (y position)> then\n set [exit v] to [die]\nend\n\ndefine Game - die\nrepeat (5)\n hide\n wait (0.1) seconds\n show\n wait (0.1) seconds\nend\nhide\nwait (0.5) seconds\n\nwhen I receive [play game v]\nstop all sounds\nforever\n play sound [Wake Me Up - Avicii \(violincellobass cover\) - Simply Three.mp3 v] until done\n play sound [Counting Stars - OneRepublic \(violincellobass cover\) Simply Three.mp3 v] until done\n play sound [Alan Walker - Faded \(Violin Cover by Robert Mendoza\) \[OFFICIAL VIDEO\].mp3 v] until done\n play sound [Titanium - Violin Piano Cover - David Guetta feat. Sia - Daniel Jang.mp3 v] until done\nend\n\nwhen [r v] key pressed\nset [exit v] to [die]\n\nwhen flag clicked\nwait until <(LEVEL) = [6]>\nadd (username) to [shoutouts v]\n\n@thumbnail\n\nwhen I receive [green flag clicked v]\nhide\n\n@text\n\nwhen I receive [setup v]\nset [x v] to [0]\nset [y v] to [0]\nif <(LEVEL) = [1]> then\n switch costume to (level 1 1 v)\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\nend\nif <(LEVEL) = [2]> then\n switch costume to (level 2 1 v)\nend\nif <(LEVEL) = [3]> then\n switch costume to (level 3 1 v)\nend\nif <(LEVEL) = [4]> then\n switch costume to (level 4 1 v)\nend\nif <(LEVEL) = [5]> then\n switch costume to (level 5 1 v)\nend\nif <(LEVEL) = [6]> then\n switch costume to (level 6 1 v)\nend\n\nwhen I receive [green flag clicked v]\nshow\n\nwhen I receive [tick v]\nPosition ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\ndefine Position (x) (y)\ngo to x: (x) y: (y)\nif <<(x position) = (x)> and <(y position) = (y)>> then\n show\nelse\n hide\nend\n\nwhen I receive [reset v]\ndelete this clone\n\n@door\n\nwhen I receive [green flag clicked v]\nshow\n\nwhen I receive [setup v]\nif <(LEVEL) = [1]> then\n set [x v] to [1179.25]\n set [y v] to [8]\n set [coins in all v] to [0]\nend\nif <(LEVEL) = [2]> then\n set [x v] to [-130]\n set [y v] to [-113]\n set [coins in all v] to [6]\nend\nif <(LEVEL) = [3]> then\n set [x v] to [-130]\n set [y v] to [-114]\n set [coins in all v] to [7]\nend\nif <(LEVEL) = [4]> then\n set [x v] to [91]\n set [y v] to [107]\n set [coins in all v] to [2]\nend\nif <(LEVEL) = [5]> then\n set [x v] to [800]\n set [y v] to [-53]\n set [coins in all v] to [0]\nend\nif <(LEVEL) = [6]> then\n set [x v] to [1400]\n set [y v] to [-10]\n set [coins in all v] to [1]\nend\nset [coins collected v] to [0]\n\nwhen I receive [tick v]\nPosition ((x) - (SCROLL X)) ((y) - (SCROLL Y))\nif <(COINS COLLECTED) = (COINS IN ALL)> then\n switch costume to (open v)\nelse\n switch costume to (closed v)\nend\n\ndefine Position (x) (y)\ngo to x: (x) y: (y)\nif <<(x position) = (x)> and <(y position) = (y)>> then\n show\nelse\n hide\nend\n\nswitch costume to (open v)\n\n@Coins\n\nwhen I receive [setup v]\nhide\nset [x v] to [0]\nset [y v] to [0]\nif <(LEVEL) = [1]> then\n switch costume to (spin1 v)\n set [x v] to [-9999]\nend\nif <(LEVEL) = [2]> then\n switch costume to (spin1 v)\n Clone at x: [18] y: [-70]\n Clone at x: [68] y: [-70]\n Clone at x: [-70] y: [0]\n Clone at x: [-120] y: [0]\n Clone at x: [20] y: [69]\n Clone at x: [70] y: [69]\nend\nif <(LEVEL) = [3]> then\n switch costume to (spin1 v)\n Clone at x: [0] y: [-4]\n Clone at x: [50] y: [-4]\n Clone at x: [100] y: [-4]\n Clone at x: [1167] y: [50]\n Clone at x: [1119] y: [50]\n Clone at x: [1072] y: [50]\n Clone at x: [-294] y: [-42]\nend\nif <(LEVEL) = [4]> then\n switch costume to (spin1 v)\n Clone at x: [0] y: [-120]\n Clone at x: [-190] y: [130]\nend\nif <(LEVEL) = [6]> then\n switch costume to (spin1 v)\n Clone at x: [978] y: [70]\nend\nset [x v] to [-9999]\n\nwhen I receive [tick v]\nPosition x: ((x) - (SCROLL X)) y: ((y) - (SCROLL Y))\n\ndefine Position x: (x) y: (y)\ngo to x: (x) y: (y)\nif <<(x position) = (x)> and <(y position) = (y)>> then\n show\nelse\n hide\nend\n\ndefine Clone at x: (x) y: (y)\nset [x v] to (x)\nset [y v] to (y)\ncreate clone of (_myself_ v)\n\nwhen I receive [reset v]\nset [coins collected v] to [0]\ndelete this clone\n\nwhen I start as a clone\nforever\n next costume\n wait (0.1) seconds\nend\n\nwhen I start as a clone\nwait until <touching (player v)?>\nchange [coins collected v] by (1)\nstart sound [Coin v]\ndelete this clone\n\nwhen I receive [setup v]\nhide\n\n@press space\n\nwhen I receive [tick v]\ngo to (player v)\n\nwhen I receive [press space v]\ngo to [front v] layer\nshow\n\nwhen I receive [press space hide v]\nhide\n\n@platforms\n\nwhen I receive [green flag clicked v]\nshow\n\nwhen I receive [tick v]\nPosition ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\nwhen I receive [setup v]\nRender\n\ndefine Position (x) (y)\ngo to x: (x) y: (y)\nif <<(x position) = (x)> and <(y position) = (y)>> then\n show\nelse\n hide\nend\n\nwhen I receive [reset v]\ndelete this clone\n\ndefine Render\nset [x v] to [0]\nset [y v] to [0]\nif <(LEVEL) = [1]> then\n switch costume to (level 1 1 v)\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\nend\nif <(LEVEL) = [2]> then\n switch costume to (level 2 1 v)\n set [y v] to [-57]\nend\nif <(LEVEL) = [3]> then\n switch costume to (level 3 1 v)\n set [y v] to [-95]\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\n set [y v] to [-118.5000001]\n create clone of (_myself_ v)\n change [x v] by (480)\n set [y v] to [-30]\n next costume\nend\nif <(LEVEL) = [4]> then\n switch costume to (level 4 1 v)\nend\nif <(LEVEL) = [5]> then\n switch costume to (level 5 1 v)\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\nend\nif <(LEVEL) = [6]> then\n switch costume to (level 6 1 v)\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\n create clone of (_myself_ v)\n change [x v] by (480)\n next costume\nend\n\n@fake platform\n\nwhen I receive [tick v]\nif <(LEVEL) = [5]> then\n Position ((x) - (SCROLL X)) ((y) - (SCROLL Y))\nelse\n hide\nend\n\nPosition ((x) - (SCROLL X)) ((y) - (SCROLL Y))\n\nwhen I receive [green flag clicked v]\n\nwhen I receive [reset v]\ndelete this clone\n\nwhen I receive [setup v]\nRender\n\ndefine Render\nif <(LEVEL) = [5]> then\n set [x v] to [0]\n set [y v] to [0]\n switch costume to (level 5 1 v)\n create clone of (_myself_ v)\n next costume\n change [x v] by (480)\n show\nelse\n hide\nend\n\ndefine Position (x) (y)\ngo to x: (x) y: (y)\nif <<(x position) = (x)> and <(y position) = (y)>> then\n show\nelse\n hide\nend\n\nwhen I receive [tick v]\ngo to [front v] layer\ngo [backward v] (1) layers\n\n
Instructions are in-game \nIf anything glitches press r\nAll levels are possible (except level 6 its the end)\nIf you enjoyed then please leave a love, Fave and maybe a follow!\nMaking part two!\n
Magma - A Platformer
@Stage\n\nwhen I receive [start v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nnext backdrop\nclear graphic effects\n\nwhen flag clicked\nbroadcast (_alphareturns_ v)\n\nwhen I receive [homepage v]\nswitch backdrop to (start v)\n\nwhen I receive [finish v]\nswitch backdrop to (finished! v)\n\n@Intro 1\n\nwhen I receive [_alphareturns_ v]\nset [clonetype v] to [0]\nreset timer\nswitch backdrop to (_alphareturns_ v)\nrepeat (5)\n change [clonetype v] by (1)\n create clone of (_myself_ v)\n wait (0.15) seconds\nend\n\nwhen I start as a clone\nif <<(CloneType) > [0]> and <(CloneType) < [10]>> then\n show\n go to x: (0) y: (0)\n switch costume to ((CloneType) + (1))\n set [ghost v] effect to (100)\n set size to (10) %\n if <(CloneType) = [26]> then\n go to [front v] layer\n end\n point in direction (0)\n repeat (50)\n change size by (((100) - (size)) / (8))\n turn right (((90) - (direction)) / (8)) degrees\n change [ghost v] effect by (-4)\n end\n set size to (100) %\n wait until <(timer) > [4.5]>\n repeat (20)\n change size by (((125) - (size)) / (6))\n end\n repeat (50)\n change size by (((10) - (size)) / (8))\n change [ghost v] effect by (4)\n end\n broadcast (outro v)\n delete this clone\nend\n\nwhen flag clicked\nset [clonetype v] to [0]\nhide\ngo to x: (0) y: (0)\nswitch costume to (_alphareturns_ v)\nset [ghost v] effect to (100)\nset size to (150) %\npoint in direction (0)\n\n@Music\n\nwhen I receive [_alphareturns_ v]\nplay sound [Free Intro Music for your Video v] until done\nbroadcast (homepage v)\n\nwhen I receive [homepage v]\nforever\n play sound [Bubbles In The Sky Roblox Bubble Gum Simulator - \(Original Soundtrack\) by BSlick v] until done\nend\n\n@Magma\n\nwhen I receive [reset v]\ngo to x: (-208) y: (0)\n\nwhen [r v] key pressed\nbroadcast (reset v)\n\nwhen I receive [start v]\ngo to x: (-208) y: (0)\nplaform\n\nwhen flag clicked\nhide\nforever\n if <touching color (#00a1ff)?> then\n broadcast (reset v)\n end\n if <touching color (#ff6666)?> then\n broadcast (next level v)\n broadcast (start v)\n end\n if <touching color (#ffce00)?> then\n broadcast (finish v)\n end\nend\n\ndefine plaform\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (1)\n switch costume to (costume1 v)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-1)\n switch costume to (costume2 v)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#989898)?> then\n change y by (1)\n if <touching color (#989898)?> then\n change y by (1)\n if <touching color (#989898)?> then\n change y by (1)\n if <touching color (#989898)?> then\n change y by (1)\n if <touching color (#989898)?> then\n change x by ((Xv) * (-1))\n change y by (-4)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#989898)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#989898)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [15]\n end\n end\n change y by (1)\nend\n\nwhen I receive [finish v]\nhide\n\n@Play \n\nwhen I receive [homepage v]\nset size to (100) %\nshow\ngo to x: (70) y: (-86)\nforever\n repeat (50)\n change size by (0.5)\n end\n repeat (50)\n change size by (-0.5)\n end\nend\n\nwhen flag clicked\nhide\n\nwhen this sprite clicked\nbroadcast (start v)\nglide (0.25) secs to x: (19) y: (-180)\nhide\n\n@Intro 2\n\nwhen I receive [_alphareturns_ v]\nshow\nset [ghost v] effect to (100)\ngo to x: (0) y: (0)\nwait (7) seconds\nrepeat (50)\n wait (0.01) seconds\n change [ghost v] effect by (-5)\nend\nrepeat (50)\n wait (0.01) seconds\n change [ghost v] effect by (2)\nend\nhide\n\n@EXTRAS - HIDDEN\n\n@Thumbnail\n\nwhen flag clicked\nhide\ngo to x: (0) y: (0)\n\nwhen [t v] key pressed\nif <(username) = [_AlphaReturns_]> then\n show\nend\n\n@timer\n\nwhen flag clicked\n\nwhen I receive [start v]\nrepeat until <color (#ff6666) is touching (#facc00)?>\n wait (0.1) seconds\nend\n\nif <touching color (#ffce00)?> then\n\nreset timer\nforever\n go to (magma v)\nend\n\nwhen [timer v] > (10)\n\n
Please remember to love, favourite, and share this game. \n\nUse the arrow keys to move. Basic stuff. Press and hold the jump and right arrow key at the same time to wall jump. Also basic. Don't touch the blue. Red gets you to the next level.\n\n If you get stuck, press R to reset.\n\nHave fun!\n\n═══════✔️UPDATE LOG✔️════════\n20/12/2018 - Start of developing\n23/01/2019 - Released\n26/01/2019 - Bug Fixes\n28/01/2019 - Intro Update\n29/01/2019 - 10 Favourites! Thanks, @IZZYMAGILL for the 10th fave! Level 11 finished.\n03/02/19 - Logo update - By @Hemkernator\n13/02/2019 - Level 12 Done. Enjoy! (I made it for no reason BTW)\n16/02/2019 - 20 Faves! Thank you @GoodMan13579 for the 20th fave! New level!\n12/04/2019 - Just checked again; Got to work on one more level! Thank you so much for 42 faves!\n01/05/2019 - 62 loves and 51 Faves!!! Thanks, everyone! Event is released! \n19/05/2019 - Event ended.\n07/06/2019 - Changed end page, and entered a competition. \n08/06/2019 - 55 FAVES???!!!! Thank you!\n24/07/2019 - Changed and added a 'story' to it. :D\n02/08/2019 - Nup. The story is weird. just normal for now.\n03/11/2019 - Bug fixes\n31/3/2020 - Bug fixes\n16/5/2020 - More bug fixes\n════════_AlphaReturns_════════\n\nHey! I'm _AlphaReturns_, A keen coder and a huge Robloxian. I play Pokemon and ROBLOX
Winter Platformer
@Stage\n\nwhen flag clicked\nforever\n play sound [Winter Reflections v] until done\nend\n\n@player\n\nif <(x) > [0]> then\n set [x v] to [5]\nelse\n set [x v] to [-5]\nend\nset [y v] to [10]\n\nchange [player x v] by \n\nchange [player x v] by \n\nwhen I receive [flag v]\nclear graphic effects\nset [player x v] to (checkpoint)\nset [x v] to [0]\npoint in direction (90)\nset size to (100) %\nshow\ngo to x: (0) y: (180)\nset [y v] to [0]\nset y to (180)\nforever\n if <<key (right arrow v) pressed?> or > then\n change [x v] by (1.2)\n end\n if <<key (left arrow v) pressed?> or > then\n change [x v] by (-1.2)\n end\n set [x v] to ((x) * (0.9))\n change [player x v] by (x)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (1)\n if <touching (ground v)?> then\n change y by (-4)\n change [player x v] by ((x) * (-2))\n if <<key (up arrow v) pressed?> or > then\n if <(x) < [0]> then\n set [x v] to [5]\n else\n set [x v] to [-5]\n end\n set [y v] to [10]\n else\n set [x v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [y v] by (-1)\n change y by (y)\n if <touching (ground v)?> then\n change y by ((y) * (-1))\n set [y v] to [0]\n end\n change y by (-1)\n if <touching (ground v)?> then\n if <<key (up arrow v) pressed?> or <(u) = [1]>> then\n set [y v] to [12]\n end\n end\n if <<(y position) < [-179]> or <touching (bad v)?>> then\n repeat (10)\n change [ghost v] effect by (10)\n end\n repeat until <(round (player x)) = (checkpoint)>\n change [player x v] by (((checkpoint) - (player x)) / (7))\n end\n set [player x v] to (checkpoint)\n point in direction (90)\n set size to (100) %\n show\n go to x: (0) y: (180)\n set [x v] to [0]\n set [y v] to [0]\n set y to (180)\n repeat (10)\n change [ghost v] effect by (-10)\n end\n end\n if <[7134] < (player x)> then\n broadcast (end v)\n end\nend\n\nwhen flag clicked\nset [first? v] to [0]\nset [checkpoint v] to [0]\nhide\n\nwhen I receive [menu v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\ndelete this clone\n\n@ground\n\nwhen I receive [end v]\nstop [other scripts in sprite v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\ndelete this clone\n\nwhen I receive [flag v]\nclear graphic effects\nswitch costume to (costume2 v)\nrepeat (16)\n next costume\n create clone of (_myself_ v)\nend\n\nwhen I receive [menu v]\nhide\ndelete this clone\n\nwhen flag clicked\nhide\n\ndefine set x to (number1) (number2)\nforever\n if <<(player x) > ((number1) - (960))> or <((number1) + (960)) > (player x)>> then\n switch costume to (costume2 v)\n go to x: ((0) - ((player x) + ((0) - (number1)))) y: (0)\n switch costume to (number2)\n show\n else\n hide\n end\nend\n\nwhen I start as a clone\nshow\nset x to (((costume [number v]) - (2)) * (480)) (costume [number v])\n\n@snow\n\nwhen flag clicked\ngo to [back v] layer\nhide\nrepeat (15)\n go to (random position v)\n create clone of (_myself_ v)\nend\nforever\n repeat (10)\n go to (random position v)\n set y to (180)\n create clone of (_myself_ v)\n end\n wait (1) seconds\nend\n\nwhen I start as a clone\nshow\nrepeat until <(y position) < [-179]>\n change y by (-1)\nend\ndelete this clone\n\n@bad\n\nwhen I receive [end v]\nhide\ndelete this clone\n\nwhen I receive [flag v]\nswitch costume to (costume1 v)\nset [bad x v] to [-165]\nset [bad y v] to ((-31) - (11))\ncreate clone of (_myself_ v)\nwait (0.00001) seconds\nset [bad x v] to [144]\nset [bad y v] to ((-26) - (11))\ncreate clone of (_myself_ v)\nwait (0.00000001) seconds\nset [bad x v] to [705]\nset [bad y v] to ((-115) - (11))\ncreate clone of (_myself_ v)\nwait (0.0000001) seconds\nset [bad x v] to [1450]\nset [bad y v] to ((-120) - (11))\ncreate clone of (_myself_ v)\nwait (0.00001) seconds\nset [bad x v] to [1450]\nset [bad y v] to ((-33) - (11))\ncreate clone of (_myself_ v)\nwait (0.00001) seconds\nset [bad x v] to [2800]\nset [bad y v] to ((-118) - (11))\ncreate clone of (_myself_ v)\nwait (0.00001) seconds\nset [bad x v] to [3065]\nset [bad y v] to ((-118) - (11))\ncreate clone of (_myself_ v)\n\nwhen I receive [menu v]\nhide\ndelete this clone\n\nwhen flag clicked\nhide\n\ndefine set x to (number1) (number2) set y to (number3)\ngo to [front v] layer\nforever\n set [ghost v] effect to (0)\n if <<(player x) > ((number1) - (960))> or <((number1) + (960)) > (player x)>> then\n switch costume to (costume2 v)\n go to x: ((0) - ((player x) + ((0) - (number1)))) y: (number3)\n turn right (1) degrees\n switch costume to (number2)\n show\n else\n hide\n end\nend\n\nwhen I start as a clone\nset [bx v] to (bad x)\nset [by v] to (bad y)\nshow\nset x to (bx) (costume [number v]) set y to (by)\n\n@untitled\n\nwhen I receive [how to play v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [menu v]\nclear graphic effects\nshow\n\nwhen I receive [credit v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [menu v]\nclear graphic effects\nshow\n\nwhen I receive [flag v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@checkpoint\n\nwhen I start as a clone\nif <not <(first?) = [0]>> then\n set [ghost v] effect to (100)\n hide\nend\nforever\n set y to (by)\n if <touching (player v)?> then\n change [first? v] by (1)\n set [checkpoint v] to (bx)\n repeat (10)\n change [ghost v] effect by (10)\n change y by (-1)\n end\n delete this clone\n end\nend\n\nwhen I receive [flag v]\nswitch costume to (costume1 v)\nset [c x v] to [3551]\nset [c y v] to [148]\ncreate clone of (_myself_ v)\n\nwhen I receive [end v]\nset [checkpoint v] to [0]\nset [first? v] to [0]\nhide\ndelete this clone\n\nwhen I receive [menu v]\nhide\ndelete this clone\n\nwhen flag clicked\nset [ghost v] effect to (0)\nhide\n\ndefine set x to (number1) (number2) set y to (number3)\ngo to [front v] layer\nforever\n turn left (1) degrees\n if <<(player x) > ((number1) - (960))> or <((number1) + (960)) > (player x)>> then\n switch costume to (costume2 v)\n set x to ((0) - ((player x) + ((0) - (number1))))\n switch costume to (number2)\n show\n else\n hide\n end\nend\n\nwhen I start as a clone\nset [bx v] to (c x)\nset [by v] to (c y)\nshow\nset x to (bx) (costume [number v]) set y to (by)\n\n@Sprite1\n\nwhen I receive [how to play v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [flag v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [menu v]\nclear graphic effects\ngo to x: (0) y: (-40)\nshow\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (flag v)\n\nwhen I receive [credit v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite2\n\nwhen I receive [how to play v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [menu v]\nclear graphic effects\nshow\ngo to x: (-150) y: (-40)\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (credit v)\n\nwhen I receive [flag v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [credit v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [credit v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite3\n\nwhen I receive [menu v]\nclear graphic effects\nshow\ngo to x: (150) y: (-40)\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (how to play v)\n\nwhen flag clicked\nbroadcast (menu v)\n\nwhen I receive [flag v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [how to play v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [credit v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite4\n\nwhen I receive [menu v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\nwhen I receive [flag v]\nclear graphic effects\ngo to x: (181) y: (143)\nshow\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (menu v)\n\nwhen I receive [credit v]\nclear graphic effects\ngo to x: (181) y: (143)\nshow\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (menu v)\n\nwhen I receive [how to play v]\nclear graphic effects\ngo to x: (181) y: (143)\nshow\nrepeat until <<mouse down?> and <touching (mouse-pointer v)?>>\n if <touching (mouse-pointer v)?> then\n set [brightness v] effect to (20)\n else\n set [brightness v] effect to (0)\n end\nend\nbroadcast (menu v)\n\nwhen I receive [no menu v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite5\n\nwhen I receive [credit v]\nclear graphic effects\nshow\n\nwhen I receive [menu v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite6\n\nwhen I receive [how to play v]\nclear graphic effects\nshow\n\nwhen I receive [menu v]\nrepeat (10)\n change [ghost v] effect by (10)\nend\nhide\n\n@Sprite7\n\nwhen I receive [menu v]\nhide\n\nwhen I receive [end v]\nshow\nswitch costume to (costume2 v)\ngo to x: (0) y: (480)\nrepeat until <(y position) < [-480]>\n switch costume to (costume2 v)\n change y by (-1)\n switch costume to (costume1 v)\nend\nswitch costume to (costume1 v)\nbroadcast (menu v)\n\n@untitled2\n\nwhen flag clicked\nhide\nif <(username) = [corn-soup]> then\n wait until <key (t v) pressed?>\n show\n broadcast (no menu v)\nend\n\n
see HOW TO PLAY\n
Blob's Adventure (Platformer)
@Stage\n\nwhen flag clicked\nforever\n play sound [Beatles - I Am The Walrus v] until done\nend\n\n@Fart\n\nwhen flag clicked\nswitch costume to (1 v)\npoint in direction (90)\n\nwhen I receive [next level v]\nwait (1) seconds\nnext costume\n\n@Player\n\nwhen flag clicked\nforever\n if <touching color (#5073ff)?> then\n change [yv v] by (22)\n end\nend\n\nwhen flag clicked\nforever\n if <<touching color (#545454)?> or <touching color (#363636)?>> then\n set [yv v] to [0]\n set [xv v] to [0]\n go to x: (-220) y: (0)\n broadcast (oof v)\n set size to (30) %\n end\nend\n\nwhen flag clicked\ngo to x: (-220) y: (0)\nwait (3.5) seconds\ngo to x: (-220) y: (0)\nshow\nset [xv v] to [0]\nset [yv v] to [0]\nset [level v] to [1]\nswitch costume to (1 v)\nforever\n if <<key (left arrow v) pressed?> or <key (a v) pressed?>> then\n change [xv v] by (-1)\n end\n if <<key (right arrow v) pressed?> or <key (d v) pressed?>> then\n change [xv v] by (1)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#874ed4)?> then\n change y by (1)\n if <touching color (#874ed4)?> then\n change y by (1)\n if <touching color (#874ed4)?> then\n change y by (1)\n if <touching color (#874ed4)?> then\n change y by (1)\n end\n if <touching color (#874ed4)?> then\n change y by (1)\n if <touching color (#874ed4)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [12]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#874ed4)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#874ed4)?> then\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n set [yv v] to [12]\n end\n end\n if <<key (up arrow v) pressed?> or <key (w v) pressed?>> then\n switch costume to (2 v)\n else\n switch costume to (1 v)\n end\n change y by (1)\nend\n\nwhen flag clicked\nforever\n if <touching color (#00c835)?> then\n broadcast (Next Level v)\n wait (0.2) seconds\n hide\n wait (1) seconds\n show\n go to x: (-220) y: (0)\n set size to (30) %\n end\nend\n\nwhen flag clicked\nset size to (30) %\nforever\n if <key (s v) pressed?> then\n set size to (20) %\n end\n if <key (g v) pressed?> then\n set size to (40) %\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#ff91fc)?> then\n change [xv v] by (10)\n end\nend\n\n@Eyes\n\nwhen flag clicked\nforever\n go to (player v)\nend\n\nwhen flag clicked\nshow\nforever\n if <key (left arrow v) pressed?> then\n switch costume to (left v)\n else\n switch costume to (straight v)\n if <key (right arrow v) pressed?> then\n switch costume to (right v)\n else\n switch costume to (straight v)\n end\n end\nend\n\ngo to [front v] layer\n\nwhen I receive [next level v]\nwait (0.2) seconds\nhide\nwait (1) seconds\nshow\nset size to (40) %\n\nwhen flag clicked\nset size to (40) %\nforever\n if <key (s v) pressed?> then\n set size to (30) %\n end\n if <key (g v) pressed?> then\n set size to (50) %\n end\nend\n\nwhen I receive [oof v]\nset size to (40) %\n\n@Check Flag\n\nwhen flag clicked\nforever\n switch costume to (1 v)\n wait (0.3) seconds\n switch costume to (2 v)\n wait (0.3) seconds\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (0) y: (346)\nhide\n\nwhen I receive [next level v]\nshow\nglide (1) secs to x: (0) y: (0)\nglide (1) secs to x: (0) y: (346)\nhide\n\ngo to [front v] layer\n\n@Sprite1\n\nwhen flag clicked\nset [ghost v] effect to (0)\nshow\nwait (2.5) seconds\nrepeat (20)\n change [ghost v] effect by (5)\nend\nhide\n\n
Welcome to Blob's Adventure a platformer. Arrow keys to move. "S" key is to shrink, in a lot of the levels you will have to shrink. "G" to grow. Love, favorite and have fun! 20+ levels
SUCCEED: a Platformer (V.1.5)
@Stage\n\nwhen flag clicked\nswitch backdrop to (backdrop1 v)\n\nwhen I receive [message1 v]\nnext backdrop\n\nwhen flag clicked\nset [time v] to [0]\nforever\n wait (1) seconds\n change [time v] by (1)\n if <(backdrop [number v]) = [14]> then\n stop [this script v]\n end\nend\n\n@Q\n\nwhen flag clicked\ngo to [front v] layer\ngo to x: (-193) y: (-102)\nset [xv v] to [0]\nset [yv v] to [0]\nforever\n if <key (right arrow v) pressed?> then\n change [xv v] by (0.9)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-0.9)\n end\n set [xv v] to ((Xv) * (0.9))\n change x by (Xv)\n if <touching color (#7f7f7f)?> then\n change y by (1)\n if <touching color (#7f7f7f)?> then\n change y by (1)\n if <touching color (#7f7f7f)?> then\n change y by (1)\n if <touching color (#7f7f7f)?> then\n change y by (1)\n if <touching color (#7f7f7f)?> then\n change y by (1)\n if <touching color (#7f7f7f)?> then\n change x by ((Xv) * (-1))\n change y by (-5)\n if <key (up arrow v) pressed?> then\n if <(Xv) > [0]> then\n set [xv v] to [-5]\n else\n set [xv v] to [5]\n end\n set [yv v] to [10]\n else\n set [xv v] to [0]\n end\n end\n end\n end\n end\n end\n end\n change [yv v] by (-1)\n change y by (Yv)\n if <touching color (#7f7f7f)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#7f7f7f)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [15]\n end\n end\n change y by (1)\nend\n\nwhen flag clicked\nset size to (50) %\nforever\n if <touching color (#ff0000)?> then\n go to x: (-195) y: (-116)\n broadcast (dead v)\n end\n if <color (#000000) is touching (#00fffd)?> then\n broadcast (message1 v)\n go to x: (-195) y: (-116)\n end\nend\n\nwhen [s v] key pressed\nbroadcast (message1 v)\nwait (30) seconds\n\nwhen flag clicked\nforever\n if <touching color (#003178)?> then\n broadcast (Playground v)\n end\nend\n\nwhen flag clicked\nforever\n if <touching color (#0068ff)?> then\n broadcast (Next v)\n go to x: (-195) y: (-116)\n end\nend\n\nwhen flag clicked\nset volume to (100) %\nforever\n play sound [Josh A - No Chill \(Ft. MrTLexify\).mp3 v] until done\nend\n\n@Sprite2\n\nwhen flag clicked\ngo to x: (0) y: (0)\nshow\nrepeat (10)\n change [ghost v] effect by (10)\nend\n\n@Sprite3\n\nwhen flag clicked\ngo to x: (0) y: (0)\ngo to [front v] layer\nhide\nforever\n reset timer\nend\n\nwhen [timer v] > (0.3)\ngo to [front v] layer\nshow\nstop [all v]\n\n@Sprite1\n\nwhen flag clicked\nswitch costume to (costume1 v)\nhide\n\nwhen I receive [playground v]\ngo to x: (0) y: (0)\nshow\n\nwhen I receive [next v]\nnext costume\n\n
Use the keys to move. Press S to skip. (Cool time:30 secs)\nFinish to play playground!\n
Smile Platformer
@Stage\n\nwhen flag clicked\nset [min v] to [0]\nset [sec v] to [0]\nrepeat until <[25] = (backdrop [number v])>\n wait (1) seconds\n change [sec v] by (1)\n if <(SEC) = [60]> then\n change [min v] by (1)\n set [sec v] to [0]\n end\nend\n\n@SMILEY\n\nwhen flag clicked\nset size to (100) %\nset drag mode [not draggable v]\nswitch costume to (costume1 v)\nhide variable [x v]\nhide variable [y v]\nset [x v] to [0]\nset [y v] to [0]\nset [level v] to [1]\nset [yy v] to [-1]\nset [xx v] to [1]\nset [v v] to [0]\nset [startpointx v] to [-165]\nset [startpointy v] to [-133]\nset [deaths v] to [0]\nhide variable [deaths v]\nhide variable [level v]\nswitch backdrop to (intro v)\nhide\nswitch backdrop to (backdrop1 v)\nshow variable [level v]\nshow\ngo to x: (startpointx) y: (startpointy)\nset [xv v] to [0]\nset [yv v] to [0]\nset [ehee v] to [0]\nforever\n change [yv v] by (-1)\n if <key (right arrow v) pressed?> then\n change [xv v] by (3)\n end\n if <key (left arrow v) pressed?> then\n change [xv v] by (-3)\n end\n set [xv v] to ((Xv) * (0.7))\n change x by (Xv)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change y by (1)\n if <touching color (#000008)?> then\n change x by ((Xv) * (-1))\n change x by (-1)\n change y by (-5)\n change x by (1)\n end\n end\n end\n end\n end\n end\n change y by (Yv)\n if <touching color (#000008)?> then\n change y by ((Yv) * (-1))\n set [yv v] to [0]\n end\n change y by (-1)\n if <touching color (#000008)?> then\n if <key (up arrow v) pressed?> then\n start sound [jump v]\n set [yv v] to [19]\n end\n end\n change y by (1)\n if <touching color (#ff0000)?> then\n start sound [pop v]\n change [deaths v] by (1)\n go to x: (startpointx) y: (startpointy)\n set [xv v] to [0]\n set [yy v] to [0]\n end\n if <touching color (#3fff00)?> then\n change [level v] by (1)\n switch backdrop to (next backdrop v)\n go to x: (startpointx) y: (startpointy)\n set [xv v] to [0]\n set [yy v] to [0]\n end\n if <touching color (#ed32f6)?> then\n start sound [boing v]\n set [yv v] to [24]\n end\n if <touching color (#00ffca)?> then\n if <key (up arrow v) pressed?> then\n set [yv v] to [8]\n else\n set [yv v] to [-1.5]\n end\n end\n if <touching color (#3fff00)?> then\n change [level v] by (1)\n switch backdrop to (backdrop34 v)\n go to x: (startpointx) y: (startpointy)\n end\n if <(LEVEL) = [26]> then\n set [level v] to [1]\n set size to (100) %\n switch costume to (costume1 v)\n end\nend\n\nwhen [r v] key pressed\nif <(LEVEL) = [34]> then\n switch backdrop to (backdrop37 v)\n go to x: (startpointx) y: (startpointy)\nelse\n change [deaths v] by (1)\n go to x: (startpointx) y: (startpointy)\nend\n\nwhen [space v] key pressed\nif <key (space v) pressed?> then\n if <(EHEE) = [0]> then\n show variable [deaths v]\n set [ehee v] to [1]\n stop [this script v]\n end\n if <(EHEE) = [1]> then\n hide variable [deaths v]\n set [ehee v] to [0]\n stop [this script v]\n end\nend\n\nwhen flag clicked\nforever\n if <(LEVEL) = [25]> then\n switch costume to (costume2 v)\n set size to (200) %\n end\nend\n\n@Sprite1\n\nwhen flag clicked\ngo to x: (0) y: (0)\nset [ghost v] effect to (100)\n\n
Use arrow keys.\nEnjoy!\nThere is a surprise at the end...\nPress r to restart level.\nPress space to see Deaths.\nThe time only works for one time through all 25 levels.
Scrolling Platformer Engine v0.4 [100% Pen]
@Stage\n\n@Pen\n\ndefine Draw Ground\nset [x v] to (Player X)\nset [y v] to (Player Y)\nset [loop counter v] to [0]\nrepeat ((length of [dangers v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [dangers v]) - (X)) Y: ((item ((Loop Counter) - (2)) of [dangers v]) - (Y)) Length: (item ((Loop Counter) - (1)) of [dangers v]) Height: (item ((Loop Counter) - (0)) of [dangers v]) Fill: Outline? <> Jump Pad? <> Danger? \nend\nset [loop counter v] to [0]\nrepeat ((length of [level 1 v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [level 1 v]) - (X)) Y: ((item ((Loop Counter) - (2)) of [level 1 v]) - (Y)) Length: (item ((Loop Counter) - (1)) of [level 1 v]) Height: (item ((Loop Counter) - (0)) of [level 1 v]) Fill: Outline? <> Jump Pad? <> Danger? <>\nend\nset [loop counter v] to [0]\nrepeat ((length of [jump pads v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [jump pads v]) - (X)) Y: ((item ((Loop Counter) - (2)) of [jump pads v]) - (Y)) Length: (item ((Loop Counter) - (1)) of [jump pads v]) Height: (item ((Loop Counter) - (0)) of [jump pads v]) Fill: <> Outline? <> Jump Pad? Danger? <>\nend\n\ndefine Draw Rectangle at X: (x) Y: (y) Length: (length) Height: (height) Fill: <filled?> Outline? <true/false> Jump Pad? <yes/no> Danger? <danger?>\nset pen size to (5)\nif <danger?> then\n set pen color to (#ea0303)\nelse\n if <yes/no> then\n set pen color to (#fff849)\n else\n if <true/false> then\n set pen color to (#2167d0)\n else\n set pen color to (#3692ff)\n end\n end\nend\npen up\nset [counter v] to [5]\nif <filled?> then\n repeat (([floor v] of ((length) / (5)) ) - (1))\n go to x: (((x) - ((length) / (2))) + (Counter)) y: (((y) + ((height) / (2))) - (2))\n pen down\n go to x: (((x) - ((length) / (2))) + (Counter)) y: (((y) - ((height) / (2))) + (2))\n change [counter v] by (5)\n end\nend\nif <danger?> then\n set pen color to (#ea0303)\nelse\n if <yes/no> then\n set pen color to (#fff849)\n else\n set pen color to (#3692ff)\n end\nend\npen up\ngo to x: ((x) + ((length) / (2))) y: ((y) + ((height) / (2)))\npen down\ngo to x: ((x) + ((length) / (2))) y: ((y) - ((height) / (2)))\ngo to x: ((x) - ((length) / (2))) y: ((y) - ((height) / (2)))\ngo to x: ((x) - ((length) / (2))) y: ((y) + ((height) / (2)))\ngo to x: ((x) + ((length) / (2))) y: ((y) + ((height) / (2)))\npen up\n\nDraw Rectangle at X: [0] Y: [-100] Length: [480] Height: [0] Fill: Outline? Jump Pad? <> Danger? <>\nDraw Rectangle at X: [0] Y: [-60] Length: [20] Height: [80] Fill: Outline? <> Jump Pad? <> Danger? <>\nDraw Rectangle at X: [140] Y: [-85] Length: [20] Height: [30] Fill: <> Outline? <> Jump Pad? <> Danger? <>\n\nwhen flag clicked\nset [editor v] to [0]\nif <(Editor) = [0]> then\n broadcast (Game v)\nelse\n broadcast (Editor v)\nend\n\ndefine Draw Player (x) (y) (transparency)\nset pen color to (#2167d0)\nset pen (brightness v) to (transparency)\npen up\ngo to x: ((x) + (4)) y: ((y) + (4))\nset pen size to (12)\npen down\ngo to x: ((x) - (4)) y: ((y) + (4))\ngo to x: ((x) - (4)) y: ((y) - (4))\ngo to x: ((x) + (4)) y: ((y) - (4))\ngo to x: ((x) + (4)) y: ((y) + (4))\npen up\nset [counter v] to [2]\nrepeat (2)\n go to x: (((x) - (4)) + (Counter)) y: ((y) - (4))\n pen down\n go to x: (((x) - (4)) + (Counter)) y: ((y) + (4))\n change [counter v] by (5)\nend\n\ndefine Touching?\nset [touching v] to [0]\nset [touching pad v] to [0]\nset [loop counter v] to [0]\nrepeat ((length of [level 1 v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [level 1 v]) - ((item ((Loop Counter) - (1)) of [level 1 v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [level 1 v]) + ((item ((Loop Counter) - (1)) of [level 1 v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [level 1 v]) - ((item ((Loop Counter) - (0)) of [level 1 v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [level 1 v]) + ((item ((Loop Counter) - (0)) of [level 1 v]) / (2))) + (7))> then\n set [touching v] to [1]\n end\n end\n end\n end\nend\nset [loop counter v] to [0]\nrepeat ((length of [jump pads v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [jump pads v]) - ((item ((Loop Counter) - (1)) of [jump pads v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [jump pads v]) + ((item ((Loop Counter) - (1)) of [jump pads v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [jump pads v]) - ((item ((Loop Counter) - (0)) of [jump pads v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [jump pads v]) + ((item ((Loop Counter) - (0)) of [jump pads v]) / (2))) + (7))> then\n set [touching pad v] to [1]\n end\n end\n end\n end\nend\nset [loop counter v] to [0]\nset [touching bad v] to [0]\nrepeat ((length of [dangers v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [dangers v]) - ((item ((Loop Counter) - (1)) of [dangers v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [dangers v]) + ((item ((Loop Counter) - (1)) of [dangers v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [dangers v]) - ((item ((Loop Counter) - (0)) of [dangers v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [dangers v]) + ((item ((Loop Counter) - (0)) of [dangers v]) / (2))) + (7))> then\n set [touching bad v] to [1]\n end\n end\n end\n end\nend\n\ndefine Touch Y\nTouching?\nif <(Touching) = [1]> then\n repeat until <(Touching) = [0]>\n if <(SY) < [0]> then\n change [player y v] by (1)\n else\n change [player y v] by (-1)\n end\n Touching?\n end\n set [sy v] to [0]\n set [can jump? v] to [True]\nend\n\ndefine Touch X\nTouching?\nif <(Touching) = [1]> then\n repeat until <(Touching) = [0]>\n if <(SX) < [0]> then\n change [player x v] by (1)\n else\n change [player x v] by (-1)\n end\n Touching?\n end\n if <key (up arrow v) pressed?> then\n set [can jump? v] to [False]\n set [sy v] to [8]\n if <(SX) < [0]> then\n set [sx v] to [9]\n else\n set [sx v] to [-9]\n end\n else\n set [sx v] to [0]\n end\nend\n\ndefine Player (transparency start)\ninsert (Player Y) at (1) of [character places v] \ninsert (Player X) at (1) of [character places v] \ndelete (length of [character places v]) of [character places v]\ndelete (length of [character places v]) of [character places v]\nset [counter 2 v] to [22]\nset [player transparency v] to (transparency start)\nrepeat (10)\n change [counter 2 v] by (-2)\n Draw Player [0] [0] (Player Transparency)\n change [player transparency v] by (10)\nend\n\ndefine Set up List\ndelete all of [character places v]\nrepeat (10)\n add (Player X) to [character places v]\n add (Player Y) to [character places v]\nend\n\nset [loop counter v] to [0]\n\nrepeat ((length of [dangers v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [dangers v]) - (Player X)) Y: ((item ((Loop Counter) - (2)) of [dangers v]) - (Player Y)) Length: (item ((Loop Counter) - (1)) of [dangers v]) Height: (item ((Loop Counter) - (0)) of [dangers v]) Fill: Outline? <> Jump Pad? Danger? \nend\nset [loop counter v] to [0]\nrepeat ((length of [level 1 v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [level 1 v]) - (Player X)) Y: ((item ((Loop Counter) - (2)) of [level 1 v]) - (Player Y)) Length: (item ((Loop Counter) - (1)) of [level 1 v]) Height: (item ((Loop Counter) - (0)) of [level 1 v]) Fill: Outline? <> Jump Pad? <> Danger? <>\nend\nset [loop counter v] to [0]\nrepeat ((length of [jump pads v]) / (4))\n change [loop counter v] by (4)\n Draw Rectangle at X: ((item ((Loop Counter) - (3)) of [jump pads v]) - (Player X)) Y: ((item ((Loop Counter) - (2)) of [jump pads v]) - (Player Y)) Length: (item ((Loop Counter) - (1)) of [jump pads v]) Height: (item ((Loop Counter) - (0)) of [jump pads v]) Fill: Outline? <> Jump Pad? Danger? <>\nend\n\nwhen I receive [game v]\nerase all\nset [sx v] to [0]\nset [sy v] to [0]\nset [player x v] to [-200]\nset [player y v] to [-60]\nSet up List\nset [can jump? v] to [False]\nforever\n erase all\n set [counter 3 v] to [0]\n Player (Counter 3)\n Draw Ground\n if <<(Touching Bad) = [1]> or <(Player Y) < [-1500]>> then\n set [counter 3 v] to [0]\n repeat (10)\n erase all\n Player (Counter 3)\n Draw Ground\n change [counter 3 v] by (-10)\n end\n set [sx v] to [0]\n set [sy v] to [0]\n set [player x v] to [-200]\n set [player y v] to [-60]\n Set up List\n set [can jump? v] to [False]\n end\n if <(SY) < [0]> then\n set [can jump? v] to [False]\n end\n if <<key (up arrow v) pressed?> and <(Can Jump?) = [True]>> then\n set [can jump? v] to [False]\n set [sy v] to [13]\n end\n change [sy v] by (-1)\n change [player y v] by (SY)\n Touch Y\n if <(Touching Pad) = [1]> then\n set [can jump? v] to [False]\n set [sy v] to [17]\n end\n if <key (right arrow v) pressed?> then\n change [sx v] by (1.5)\n end\n if <key (left arrow v) pressed?> then\n change [sx v] by (-1.5)\n end\n set [sx v] to ((SX) * (0.8))\n change [player x v] by (round (SX))\n Touch X\n Frame\n set [mouse x v] to ((Player X) + (mouse x))\n set [mouse y v] to ((Player Y) + (mouse y))\nend\n\ndefine Touching? [Old]\nset [touching v] to [0]\nset [touching pad v] to [0]\nset [loop counter v] to [0]\nrepeat ((length of [level 1 v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [level 1 v]) - ((item ((Loop Counter) - (1)) of [level 1 v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [level 1 v]) + ((item ((Loop Counter) - (1)) of [level 1 v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [level 1 v]) - ((item ((Loop Counter) - (0)) of [level 1 v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [level 1 v]) + ((item ((Loop Counter) - (0)) of [level 1 v]) / (2))) + (7))> then\n set [touching v] to [1]\n end\n end\n end\n end\nend\nset [loop counter v] to [0]\nrepeat ((length of [jump pads v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [jump pads v]) - ((item ((Loop Counter) - (1)) of [jump pads v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [jump pads v]) + ((item ((Loop Counter) - (1)) of [jump pads v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [jump pads v]) - ((item ((Loop Counter) - (0)) of [jump pads v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [jump pads v]) + ((item ((Loop Counter) - (0)) of [jump pads v]) / (2))) + (7))> then\n set [touching pad v] to [1]\n end\n end\n end\n end\nend\nset [loop counter v] to [0]\nset [touching bad v] to [0]\nrepeat ((length of [dangers v]) / (4))\n change [loop counter v] by (4)\n if <((Player X) + (7)) > (((item ((Loop Counter) - (3)) of [dangers v]) - ((item ((Loop Counter) - (1)) of [dangers v]) / (2))) - (6))> then\n if <((Player X) - (7)) < (((item ((Loop Counter) - (3)) of [dangers v]) + ((item ((Loop Counter) - (1)) of [dangers v]) / (2))) + (6))> then\n if <((Player Y) + (7)) > (((item ((Loop Counter) - (2)) of [dangers v]) - ((item ((Loop Counter) - (0)) of [dangers v]) / (2))) - (7))> then\n if <((Player Y) - (7)) < (((item ((Loop Counter) - (2)) of [dangers v]) + ((item ((Loop Counter) - (0)) of [dangers v]) / (2))) + (7))> then\n set [touching bad v] to [1]\n end\n end\n end\n end\nend\n\ndefine Frame\nset pen color to (#000000)\npen up\ngo to x: (240) y: (180)\npen down\ngo to x: (-240) y: (180)\ngo to x: (-240) y: (-180)\ngo to x: (240) y: (-180)\ngo to x: (240) y: (180)\npen up\n\n@Thumbnail\n\nwhen flag clicked\ngo to x: (0) y: (0)\nhide\n\n
THIS IS NOT A GAME!!! THIS IS A DEMO!!! IF YOU WANT TO PLAY THE GAME, GO HERE: https://scratch.mit.edu/projects/281236293
Go Home - Unfair Platformer
@Stage\n\nwhen flag clicked\nswitch backdrop to (arrière plan2 v)\nset volume to (50) %\nforever\n play sound [Arcade Game Menu Music Loop Sound Effect \(8-Bit Style\) v] until done\nend\n\nwhen I receive [intro v]\nswitch backdrop to (arrière plan3 v)\nwait (5) seconds\nswitch backdrop to (arrière plan4 v)\n\nbroadcast (Menu v)\n\nwhen I receive [play v]\nswitch backdrop to (arrière plan4 v)\n\n@PTE\n\ndefine Write (text) Size (size) Thickness (thickness) color (color) at x | y (x) (y) Normal/Italic (n/i)\ngo to x: (x) y: (y)\nset pen color to (color)\nset pen size to (thickness)\nset [n° car. v] to [1]\nrepeat (length of (text))\n if <[caractères v] contains (letter (n° car.) of (text))?> then\n set [n° dans liste v] to [0]\n repeat until <(item (n° dans liste) of [caractères v]) = (letter (n° car.) of (text))>\n change [n° dans liste v] by (1)\n end\n else\n set [n° dans liste v] to [0]\n end\n if <not <(n° dans liste) = [0]>> then\n Aller à la ligne ? ((size) / (10)) (x) (y position)\n end\n Letter (n° dans liste) ((size) / (10)) (n/i) (x position) (y position)\n change [n° car. v] by (1)\nend\npen up\n\ndefine Letter (n°) (size) (n/i) (xd) (yd)\nset [lire liste descr. v] to [1]\nset [largeur caract. v] to [0]\nif <not <(n°) = [0]>> then\n repeat until <<(Lire liste Descr.) = (length of (item (n°) of [descr. caractères v]))> or <(Lire liste Descr.) > (length of (item (n°) of [descr. caractères v]))>>\n if <(join (letter (Lire liste Descr.) of (item (n°) of [descr. caractères v])) (letter ((Lire liste Descr.) + (1)) of (item (n°) of [descr. caractères v]))) = [up]> then\n pen up\n change [lire liste descr. v] by (2)\n end\n Go to (join (letter (Lire liste Descr.) of (item (n°) of [descr. caractères v])) (letter ((Lire liste Descr.) + (1)) of (item (n°) of [descr. caractères v]))) (n/i) down left pos. : (xd) (yd) Size (size)\n if <(largeur caract.) < (((join (letter (Lire liste Descr.) of (item (n°) of [descr. caractères v])) (letter ((Lire liste Descr.) + (1)) of (item (n°) of [descr. caractères v]))) mod (5)) + (1))> then\n set [largeur caract. v] to (((join (letter (Lire liste Descr.) of (item (n°) of [descr. caractères v])) (letter ((Lire liste Descr.) + (1)) of (item (n°) of [descr. caractères v]))) mod (5)) + (1))\n end\n pen down\n change [lire liste descr. v] by (2)\n end\nelse\n set [largeur caract. v] to [4]\nend\npen up\nGo to (45) (n/i) down left pos. : (xd) (yd) Size (size)\nchange x by (((largeur caract.) * (size)) * (1.2))\n\ndefine Go to (n°) (n/i) down left pos. : (xd) (yd) Size (size)\nif <(n/i) = [i]> then\n go to x: ((xd) + ((((n°) mod (5)) * (size)) + ((([ceiling v] of (((n°) - (49)) / (5)) ) * (size)) * (-0.7)))) y: ((yd) + ((([ceiling v] of (((n°) - (49)) / (5)) ) * (size)) * (-1)))\nelse\n go to x: ((xd) + (((n°) mod (5)) * (size))) y: ((yd) + ((([ceiling v] of (((n°) - (49)) / (5)) ) * (size)) * (-1)))\nend\n\ndefine Aller à la ligne ? (size) (x) (y)\nif <((x position) + ((5) * (size))) > [238]> then\n go to x: (x) y: ((y) + ((-13) * (size)))\nend\n\nwhen flag clicked\nerase all\n\nwhen I receive [easy v]\nAfficher niveaux dispo.\n\nwhen I receive [medium v]\nAfficher niveaux dispo.\n\nwhen I receive [hard v]\nAfficher niveaux dispo.\n\ndefine Afficher niveaux dispo.\nerase all\ngo to x: (-200) y: (100)\ngo to [front v] layer\nset [ma variable v] to [0]\nrepeat (9)\n change [ma variable v] by (1)\n set x to ((-200) + ((100) * ((((ma variable) - (1)) mod (3)) + (1))))\n if <(item ((ma variable) + ((10) * ((/EASY/MEDIUM/HARD) - (1)))) of [levels win v]) = [1]> then\n if <(/EASY/MEDIUM/HARD) = [1]> then\n set pen color to (#00ff21)\n else\n if <(/EASY/MEDIUM/HARD) = [2]> then\n set pen color to (#fff700)\n else\n set pen color to (#ff0000)\n end\n end\n set pen size to (85)\n pen down\n pen up\n set pen size to (70)\n set pen color to (#ffffff)\n pen down\n pen up\n set pen size to (55)\n if <(/EASY/MEDIUM/HARD) = [1]> then\n set pen color to (#00ff21)\n else\n if <(/EASY/MEDIUM/HARD) = [2]> then\n set pen color to (#fff700)\n else\n set pen color to (#ff0000)\n end\n end\n pen down\n pen up\n else\n set pen size to (75)\n if <(/EASY/MEDIUM/HARD) = [1]> then\n set pen color to (#00ff21)\n else\n if <(/EASY/MEDIUM/HARD) = [2]> then\n set pen color to (#fff700)\n else\n set pen color to (#ff0000)\n end\n end\n pen down\n pen up\n end\n Write (ma variable) Size (60) Thickness (7) color (16777215) at x | y ((x position) - ((length of (ma variable)) * (10))) ((y position) - (18)) Normal/Italic [n]\n set y to ((([floor v] of ((ma variable) / (3)) ) * (-100)) + (100))\nend\ngo to x: (-205) y: (147)\nset size to (100) %\nshow\nswitch costume to (return v)\nstamp\nhide\nwait until <<mouse down?> and <<<(mouse x) < [-184]> and <[125] < (mouse y)>> or <<([abs v] of (mouse x) ) < [137]> and <([abs v] of (mouse y) ) < [137]>>>>\nif <<(mouse x) < [-184]> and <[125] < (mouse y)>> then\n broadcast (Menu v)\nelse\n if <<([abs v] of (mouse x) ) < [137]> and <([abs v] of (mouse y) ) < [137]>> then\n set [#level n° v] to (([ceiling v] of (((mouse x) + (138)) / (100)) ) + (((([ceiling v] of ((((mouse y) * (-1)) + (138)) / (100)) ) - (1)) * (3)) + ((10) * ((/EASY/MEDIUM/HARD) - (1)))))\n broadcast (Play v)\n end\nend\nerase all\n\nwhen I receive [page mort v]\nforever\n erase all\n set [color v] effect to (0)\n switch costume to (costume1 v)\n set size to (200) %\n switch costume to (backgroundforest v)\n go to x: (0) y: (0)\n stamp\n set size to (100) %\n set [color v] effect to ((timer) * (25))\n Write [retry] Size (25) Thickness (8) color (0) at x | y (-25) (-50) Normal/Italic []\n Write [retry] Size (25) Thickness (3) color (16777215) at x | y (-25) (-50) Normal/Italic []\n switch costume to (retry v)\n go to x: (10) y: (-100)\n set size to (100) %\n stamp\n Write [choose] Size (25) Thickness (8) color (0) at x | y (-150) (-40) Normal/Italic []\n Write [level] Size (25) Thickness (8) color (0) at x | y (-140) (-65) Normal/Italic []\n Write [choose] Size (25) Thickness (3) color (16777215) at x | y (-150) (-40) Normal/Italic []\n Write [level] Size (25) Thickness (3) color (16777215) at x | y (-140) (-65) Normal/Italic []\n switch costume to (home v)\n go to x: (-110) y: (-100)\n stamp\n if <(#level n°) < [29]> then\n Write [next] Size (25) Thickness (8) color (0) at x | y (115) (-40) Normal/Italic []\n Write [level] Size (25) Thickness (8) color (0) at x | y (115) (-65) Normal/Italic []\n Write [next] Size (25) Thickness (3) color (16777215) at x | y (115) (-40) Normal/Italic []\n Write [level] Size (25) Thickness (3) color (16777215) at x | y (115) (-65) Normal/Italic []\n switch costume to (next v)\n go to x: (142) y: (-100)\n stamp\n end\n if <<mouse down?> and <<[-70] > (mouse y)> and <[-130] < (mouse y)>>> then\n erase all\n if <([abs v] of (mouse x) ) < [50]> then\n broadcast (Play v)\n else\n if <[50] < (mouse x)> then\n if <(#level n°) < [29]> then\n if <(letter (length of (#level n°)) of (#level n°)) = [9]> then\n change [#level n° v] by (2)\n else\n change [#level n° v] by (1)\n end\n broadcast (Play v)\n end\n else\n broadcast (Menu v)\n end\n end\n stop [this script v]\n end\n switch costume to (costume2 v)\nend\n\nstop [this script v]\n\nwhen I receive [tick2 v]\nset [color v] effect to (0)\nset [ghost v] effect to (0)\nset [brightness v] effect to (0)\nswitch costume to (costume1 v)\nset size to (200) %\nswitch costume to (backgroundforest v)\nset [brightness v] effect to (-5)\ngo to x: ((#level x) / (15)) y: ((#level y) / (10))\nstamp\nswitch costume to (costume1 v)\nset size to (100) %\nswitch costume to (costume3 v)\ngo to x: (0) y: ((#level y) - (3060))\nstamp\nset size to (100) %\nWrite (join (letter (1) of ((#level n°) + (10))) (join [ - ] (letter (2) of ((#level n°) + (10))))) Size (40) Thickness (10) color (0) at x | y (-30) (140) Normal/Italic [n]\nWrite (join (letter (1) of ((#level n°) + (10))) (join [ - ] (letter (2) of ((#level n°) + (10))))) Size (40) Thickness (4) color (16777215) at x | y (-30) (140) Normal/Italic [n]\n\nwhen I receive [page mort v]\nif <not <[levels win v] contains [0]?>> then\n change [☁ scratchers that have finished the whole game v] by (1)\nend\n\n@player's animation\n\ndefine Costume (n°)\nif <(n°) > [2]> then\n switch costume to (costume1 v)\nelse\n wait (n°) seconds\nend\n\nwhen I receive [play v]\nset size to (100) %\nshow\ngo to [front v] layer\npoint in direction (90)\nset rotation style [left-right v]\nforever\n if <([abs v] of (Xv) ) < [3]> then\n switch costume to (costume1 v)\n else\n if <(Xv) < [0]> then\n switch costume to (costume2 v)\n Costume ((0.5) / ([abs v] of (Xv) ))\n switch costume to (costume3 v)\n Costume ((0.5) / ([abs v] of (Xv) ))\n else\n switch costume to (costume4 v)\n Costume ((0.5) / ([abs v] of (Xv) ))\n switch costume to (costume5 v)\n Costume ((0.5) / ([abs v] of (Xv) ))\n end\n end\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [mort v]\nstop [other scripts in sprite v]\n\nwhen I receive [win v]\nstop [other scripts in sprite v]\nswitch costume to (costume1 v)\nwait (0.5) seconds\nswitch costume to (costumewin1 v)\nwait (0.05) seconds\nswitch costume to (costumewin2 v)\nwait (1) seconds\nswitch costume to (costumewin1 v)\nwait (0.05) seconds\nswitch costume to (costume1 v)\n\nwhen I receive [page mort v]\ngo to x: (0) y: (64)\nset size to (300) %\nforever\n switch costume to (costume1 v)\n wait (0.1) seconds\n switch costume to (costume6 v)\n wait (0.1) seconds\n switch costume to (costume7 v)\n wait (0.1) seconds\n switch costume to (costume6 v)\n wait (0.1) seconds\nend\n\nwhen I receive [page mort v]\nstop [other scripts in sprite v]\n\nwhen I receive [menu v]\nhide\nstop [other scripts in sprite v]\n\nwhen I receive [miam champi v]\nset size to (200) %\n\nif <(#level y) > [3000]> then\n broadcast (mort v)\nend\n\nwhen I receive [tick v]\ngo to (hitbox v)\nchange y by (7)\n\nset [#level x v] to [-908]\nset [#level y v] to [8]\n\n@map\n\nwhen I receive [play v]\nreset timer\nshow\nswitch costume to (1 vide v)\nset size to (400) %\nswitch costume to ((#level n°) + (1))\ngo to x: (#level x) y: (#level y)\n\nwhen flag clicked\nhide\n\nwhen I receive [tick v]\ngo to x: (#level x) y: (#level y)\n\nwhen I receive [page mort v]\nhide\n\ngo to [front v] layer\n\nchange [#level x v] by (-500)\n\nwhen I receive [menu v]\nset size to (120) %\nswitch costume to (costume1 v)\nshow\nforever\n go to x: ((-5) - ((mouse x) / (10))) y: (() - ((mouse y) / (10)))\n go to [back v] layer\nend\n\nwhen I receive [easy v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [hard v]\nstop [other scripts in sprite v]\nhide\n\nwhen I receive [medium v]\nhide\nstop [other scripts in sprite v]\n\nchange [brightness v] effect by (25)\n\nset [ghost v] effect to (25)\n\n@hitbox\n\ndefine Touch. sol <+-> <x+->\nchange [chute ? v] by (1)\nswitch costume to (costume1 v)\nif <touching (blocs v)?> then\n broadcast (bloc touché v)\nend\nrepeat until <<<not <touching (map v)?>> and <not <touching (blocs v)?>>> and <not <touching (block chrono v)?>>>\n if <+-> then\n change y by (-1)\n switch costume to (costume2 v)\n else\n change y by (1)\n set [chute ? v] to [0]\n end\n set [yv v] to [0]\nend\nswitch costume to (costume1 v)\nif <touching (tremplin v)?> then\n broadcast (tremplin touché v)\n if <(size) = [100]> then\n set [yv v] to [20]\n else\n set [yv v] to [25]\n end\nend\n\ndefine mouvement\nchange [yv v] by (-1)\nchange y by (Yv)\nset rotation style [left-right v]\nTouch. sol <(Yv) > [0]> <(Xv) > [0]>\nif <<key (left arrow v) pressed?> or <[0] > (x phone)>> then\n set [xv v] to [8]\n avancer (Xv)\nelse\n if <<key (right arrow v) pressed?> or <(x phone) > [0]>> then\n set [xv v] to [-8]\n avancer (Xv)\n else\n set [xv v] to [0]\n end\nend\nchange y by (-3)\nif <<<key (up arrow v) pressed?> or <(y phone) > [0]>> and <(chute ?) < [3]>> then\n set [yv v] to (([sqrt v] of (size) ) / (0.67))\nend\nchange [#level x v] by (() - (x position))\nchange [#level y v] by (() - (y position))\ngo to x: (0) y: (0)\n\ndefine avancer (vitesse)\npoint in direction ((([abs v] of (vitesse) ) / (vitesse)) * (90))\nchange x by ((vitesse) * (-1))\nset [pente de v] to [0]\nif <touching (tremplin v)?> then\n broadcast (tremplin touché v)\n set [yv v] to ((([sqrt v] of (size) ) / (0.67)) + (3))\nend\nrepeat until <<(pente de) = [6]> or <<<not <touching (map v)?>> and <not <touching (blocs v)?>>> and <not <touching (block chrono v)?>>>>\n change y by (1)\n change [pente de v] by (1)\nend\nif <(pente de) = [6]> then\n change x by (vitesse)\n change y by ((pente de) * (-1))\nend\n\nwhen I receive [message1 v]\nrepeat (1)\n erase all\n mouvement\n broadcast (tick v)\n broadcast (tick2 v)\n wait (0) seconds\nend\nforever\n erase all\n mouvement\n broadcast (tick v)\n broadcast (tick2 v)\nend\n\nwhen I receive [play v]\ngo to x: (0) y: (0)\nshow\nset [ghost v] effect to (99)\nset [#level x v] to [700]\nset [#level y v] to [-50]\nset [yv v] to [14]\nset [xv v] to [0]\nset [chute ? v] to [10]\nset [x phone v] to [0]\nset [y phone v] to [0]\nbroadcast (tick v)\nbroadcast (message1 v)\n\nwhen flag clicked\nhide\n\nwhen I receive [win v]\nset volume to (100) %\nstop [other scripts in sprite v]\nplay sound [Win v] until done\nset [#level x v] to [700]\nset [#level y v] to [-50]\nbroadcast (page mort v)\n\nwhen I receive [miam champi v]\nset size to (200) %\n\nwhen I receive [play v]\nset size to (100) %\n\ngo to [front v] layer\n\nwhen I receive [mort v]\nstop [other scripts in sprite v]\nset volume to (100) %\nstart sound [Minecraft Alpha Damage - Sound Effect v]\nplay sound [Lose v] until done\nbroadcast (page mort v)\nset [#level x v] to [700]\nset [#level y v] to [-50]\n\nset size to (100) %\n\nset [yv v] to [-50000000000000]\n\n@home\n\nwhen I receive [play v]\nshow\nswitch costume to (1 vide v)\nset size to (400) %\nswitch costume to (1 v)\ngo to x: ((item ((((#level n°) - (1)) * (2)) + (1)) of [positions points fin v]) + (#level x)) y: ((item ((((#level n°) - (1)) * (2)) + (2)) of [positions points fin v]) + (#level y))\nif <<([abs v] of (x position) ) > [270]> or <<(y position) > [180]> or <[-230] > (y position)>>> then\n set [ghost v] effect to (100)\nelse\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [tick v]\ngo to x: ((item ((((#level n°) - (1)) * (2)) + (1)) of [positions points fin v]) + (#level x)) y: ((item ((((#level n°) - (1)) * (2)) + (2)) of [positions points fin v]) + (#level y))\nif <<<(x position) > [270]> or <[-239] > (x position)>> or <<(y position) > [170]> or <[-230] > (y position)>>> then\n set [ghost v] effect to (100)\nelse\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\nend\nif <touching (hitbox v)?> then\n broadcast (win v)\nend\nif <(#level y) > [3000]> then\n broadcast (mort v)\nend\n\nwhen I receive [page mort v]\nhide\ndelete this clone\n\nwhen I receive [tick v]\nif <(#level n°) = [22]> then\n replace item (43) of [positions points fin v] with (((-900) + ([abs v] of ((((timer) * (80)) mod (152)) - (76)) )) * (-1))\nend\n\nwhen flag clicked\ndelete all of [levels win v]\nrepeat (3)\n repeat (9)\n add [0] to [levels win v]\n end\n add [1] to [levels win v]\nend\n\nwhen I receive [win v]\nreplace item (#level n°) of [levels win v] with [1]\n\n@easy\n\nwhen I receive [medium v]\nhide\n\nwhen I receive [hard v]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [menu v]\nshow\ngo to x: (0) y: (25)\n\nwhen this sprite clicked\nset [/easy/medium/hard v] to [1]\nbroadcast (Easy v)\nhide\n\n@medium\n\nwhen I receive [easy v]\nhide\n\nwhen I receive [hard v]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [menu v]\nshow\ngo to x: (0) y: (-75)\n\nwhen this sprite clicked\nset [/easy/medium/hard v] to [2]\nbroadcast (Medium v)\nhide\n\n@hard\n\nwhen I receive [easy v]\nhide\n\nwhen I receive [medium v]\nhide\n\nwhen flag clicked\nhide\n\nwhen I receive [menu v]\nshow\ngo to x: (0) y: (-180)\n\nwhen this sprite clicked\nset [/easy/medium/hard v] to [3]\nbroadcast (Hard v)\nhide\n\n@pics\n\nwhen flag clicked\nhide\n\ndefine level (level)\nif <(level) = [3]> then\n créer pic en [450] [10] [90]\n créer pic en [945] [10] [90]\nelse\n if <(level) = [6]> then\n créer pic en [430] [0] [0]\n else\n if <(level) = [9]> then\n créer pic en [196] [-310] [90]\n créer pic en [-250] [-143] [90]\n else\n if <(level) = [11]> then\n créer pic en [204] [123] [90]\n créer pic en [108] [42] [90]\n else\n if <(level) = [12]> then\n créer pic en [436] [-205] [90]\n créer pic en [835] [-53] [-90]\n else\n if <(level) = [13]> then\n créer pic en [740] [65] [90]\n créer pic en [370] [65] [90]\n créer pic en [-120] [65] [90]\n else\n if <(level) = [14]> then\n créer pic en [940] [495] [90]\n else\n if <(level) = [15]> then\n créer pic en [110] [28] [90]\n else\n if <(level) = [16]> then\n créer pic en [370] [-15] [0]\n créer pic en [370] [-95] [0]\n créer pic en [215] [-156] [0]\n else\n if <(level) = [17]> then\n créer pic en [169] [-515] [90]\n else\n if <(level) = [18]> then\n créer pic en [92] [-10] [90]\n else\n if <(level) = [19]> then\n créer pic en [-95] [0] [0]\n créer pic en [-95] [25] [0]\n créer pic en [-95] [50] [0]\n créer pic en [124] [402] [90]\n créer pic en [404] [402] [90]\n créer pic en [670] [450] [90]\n créer pic en [772] [312] [-90]\n else\n if <(level) = [21]> then\n créer pic en [94] [240] [0]\n créer pic en [246] [235] [0]\n créer pic en [196] [131] [-90]\n créer pic en [350] [100] [180]\n créer pic en [618] [66] [180]\n créer pic en [-356] [210] [90]\n else\n if <(level) = [22]> then\n créer pic en [398] [0] [90]\n créer pic en [368] [0] [90]\n créer pic en [428] [0] [90]\n créer pic en [458] [0] [90]\n créer pic en [488] [0] [90]\n créer pic en [-172] [109] [90]\n créer pic en [-44] [12] [90]\n créer pic en [-462] [20] [0]\n créer pic en [-580] [-3] [90]\n créer pic en [-550] [-3] [90]\n créer pic en [-520] [-3] [90]\n créer pic en [-490] [-3] [90]\n else\n if <(level) = [23]> then\n créer pic en [455] [-15] [90]\n créer pic en [398] [-42] [90]\n créer pic en [342] [-18] [90]\n créer pic en [188] [32] [90]\n créer pic en [-28] [32] [90]\n else\n if <(level) = [25]> then\n créer pic en [-556] [-190] [-90]\n else\n if <(level) = [26]> then\n créer pic en [245] [-55] [77]\n créer pic en [-220] [-143] [90]\n créer pic en [-315] [-143] [90]\n créer pic en [-412] [-691] [90]\n créer pic en [-412] [-711] [90]\n créer pic en [-412] [-731] [90]\n else\n if <(level) = [27]> then\n créer pic en [-92] [-77] [90]\n else\n if <(level) = [28]> then\n créer pic en [-744] [-472] [90]\n else\n if <(level) = [29]> then\n créer pic en [570] [312] [90]\n créer pic en [530] [312] [90]\n créer pic en [490] [312] [90]\n créer pic en [450] [312] [90]\n créer pic en [410] [312] [90]\n créer pic en [370] [312] [90]\n créer pic en [270] [170] [-90]\n créer pic en [230] [170] [-90]\n créer pic en [190] [170] [-90]\n créer pic en [150] [170] [-90]\n créer pic en [110] [170] [-90]\n créer pic en [70] [170] [-90]\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\nset [x pic v] to [a]\nset [y pic v] to [a]\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [play v]\nwait (0.1) seconds\nlevel (#level n°)\n\ndefine créer pic en (x) (y) (orientation)\nset [x pic v] to (x)\nset [y pic v] to (y)\npoint in direction (orientation)\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nset [ghost v] effect to (100)\nset [brightness v] effect to (-10)\nshow\n\nwhen I receive [tick v]\nif <not <(x pic) = [a]>> then\n go to x: ((#level x) - (x pic)) y: ((#level y) - (y pic))\n if <touching (hitbox v)?> then\n broadcast (mort v)\n switch costume to (costume1 v)\n set [ghost v] effect to (0)\n repeat (4)\n next costume\n end\n end\n go to [front v] layer\nend\n\nset [ghost v] effect to (0)\n\nstop [all v]\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I receive [menu v]\ndelete this clone\n\n@Ennemis\n\nwhen flag clicked\nhide\n\ndefine level (level)\nif <(level) = [7]> then\n créer hérisson qui marche de [370] [-53] à [150] [-53] vitesse [25] début à % [0]\nelse\n if <(level) = [8]> then\n créer hérisson qui marche de [410] [-53] à [150] [-53] vitesse [100] début à % [0]\n créer hérisson qui marche de [410] [-53] à [150] [-53] vitesse [25] début à % [0]\n else\n if <(level) = [11]> then\n créer hérisson qui marche de [36] [29] à [-396] [29] vitesse [100] début à % [0]\n else\n if <(level) = [13]> then\n créer hérisson qui marche de [650] [52] à [100] [52] vitesse [40] début à % [0]\n créer hérisson qui marche de [650] [52] à [100] [52] vitesse [40] début à % [25]\n créer hérisson qui marche de [650] [52] à [100] [52] vitesse [40] début à % [50]\n créer hérisson qui marche de [650] [52] à [100] [52] vitesse [40] début à % [75]\n créer hérisson qui marche de [650] [52] à [100] [52] vitesse [40] début à % [100]\n else\n if <(level) = [14]> then\n créer hérisson qui marche de [380] [47] à [-572] [-216] vitesse [40] début à % [0]\n créer hérisson qui marche de [380] [47] à [-572] [-216] vitesse [40] début à % [3.5]\n créer hérisson qui marche de [380] [47] à [-572] [-216] vitesse [40] début à % [7]\n else\n if <(level) = [15]> then\n créer hérisson qui marche de [300] [15] à [244] [15] vitesse [40] début à % [7]\n else\n if <(level) = [16]> then\n créer hérisson qui marche de [365] [79] à [-188] [210] vitesse [40] début à % [0]\n créer hérisson qui marche de [365] [79] à [-188] [210] vitesse [40] début à % [3]\n créer hérisson qui marche de [365] [79] à [-188] [210] vitesse [40] début à % [6]\n else\n if <(level) = [18]> then\n créer hérisson qui marche de [60] [-22] à [-132] [-24] vitesse [40] début à % [0]\n else\n if <(level) = [21]> then\n créer hérisson qui marche de [788] [193] à [364] [193] vitesse [20] début à % [0]\n else\n if <(level) = [22]> then\n créer hérisson qui marche de [4] [0] à [-140] [0] vitesse [40] début à % [0]\n créer hérisson qui marche de [-412] [96] à [-692] [96] vitesse [40] début à % [0]\n créer hérisson qui marche de [-748] [-400] à [-900] [-400] vitesse [80] début à % [0]\n else\n if <(level) = [24]> then\n créer hérisson qui marche de [900] [-300] à [-1000] [-300] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [-250] à [-1000] [-250] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [-200] à [-1000] [-200] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [-150] à [-1000] [-150] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [-100] à [-1000] [-100] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [-50] à [-1000] [-50] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [0] à [-1000] [0] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [50] à [-1000] [50] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [100] à [-1000] [100] vitesse [40] début à % [0]\n créer hérisson qui marche de [900] [150] à [-1000] [150] vitesse [40] début à % [0]\n else\n if <(level) = [26]> then\n créer hérisson qui marche de [620] [8] à [236] [-69] vitesse [30] début à % [0]\n créer hérisson qui marche de [620] [8] à [236] [-69] vitesse [30] début à % [5]\n créer hérisson qui marche de [260] [-65] à [-148] [-150] vitesse [30] début à % [50]\n créer hérisson qui marche de [260] [-65] à [-148] [-150] vitesse [30] début à % [55]\n else\n if <(level) = [29]> then\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [0]\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [16.2]\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [33.3]\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [49.92]\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [83.6]\n créer hérisson qui marche de [32] [302] à [-568] [302] vitesse [40] début à % [100]\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\nset [x1 v] to [a]\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I receive [play v]\npoint in direction (90)\nwait (0.1) seconds\nlevel (#level n°)\n\ndefine créer hérisson qui marche de (x) (y) à (x2) (y2) vitesse (speed) début à % (%)\nset [x1 v] to (x)\nset [y1 v] to (y)\nset [x2 v] to (x2)\nset [y2 v] to (y2)\nset [dist. x v] to ((x) - (x2))\nset [dist y v] to ((y) - (y2))\nset [dist. xy v] to ([sqrt v] of ((((x2) - (x)) * ((x2) - (x))) + (((y2) - (y)) * ((y2) - (y)))) )\nset [speed v] to (speed)\nset [% v] to (%)\ncreate clone of (_myself_ v)\n\nset [x1 v] to (item (1) of [ennemis v])\nset [y1 v] to (item (2) of [ennemis v])\nset [x2 v] to (item (3) of [ennemis v])\nset [y2 v] to (item (4) of [ennemis v])\nset [dist. x v] to (item (5) of [ennemis v])\nset [dist y v] to (item (6) of [ennemis v])\nset [dist. xy v] to (item (7) of [ennemis v])\nset [speed v] to (item (8) of [ennemis v])\ndelete all of [ennemis v]\n\nwhen I start as a clone\n\nwhen I receive [tick v]\nif <not <(x1) = [a]>> then\n bloc qui va vite comme forest mgl\nelse\n hide\nend\n\ndefine bloc qui va vite comme forest mgl\nshow\ngo to x: ((#level x) - ((x2) + ((([abs v] of (((((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (speed)) mod (dist. xy)) - ((dist. xy) / (2))) ) / ((dist. xy) / (2))) * (dist. xy)))) y: ((#level y) - (((y2) + ((([abs v] of (((((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (speed)) mod (dist. xy)) - ((dist. xy) / (2))) ) / ((dist. xy) / (2))) * (dist y))) - ()))\npoint in direction (90)\nif <touching (hitbox v)?> then\n switch costume to (costume6 v)\n set [ghost v] effect to (0)\n broadcast (mort v)\nend\nswitch costume to ((<((dist. xy) / (2)) > ((((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (speed)) mod (dist. xy))> * (4)) + (((round (((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (10))) mod (4)) + (1)))\nif <<([abs v] of (x position) ) > [240]> or <<(y position) > [180]> or <[-180] > (y position)>>> then\n set [ghost v] effect to (100)\nelse\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\nend\n\nwhen I receive [page mort v]\nhide\ndelete this clone\n\nadd (x) to [ennemis v]\nadd (y) to [ennemis v]\nadd (x2) to [ennemis v]\nadd (y2) to [ennemis v]\nadd ((x) - (x2)) to [ennemis v]\nadd ((y) - (y2)) to [ennemis v]\nadd ([sqrt v] of ((((x2) - (x)) * ((x2) - (x))) + (((y2) - (y)) * ((y2) - (y)))) ) to [ennemis v]\nadd (speed) to [ennemis v]\n\nwhen I start as a clone\nset [ghost v] effect to (0)\nshow\n\nwhen I start as a clone\n\nwait (1) seconds\n\nwhen I receive [menu v]\ndelete this clone\n\ncréer hérisson qui marche de [410] [-53] à [150] [-53] vitesse [25] début à % []\n\nset [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\n\ngo to x: ((#level x) - ((x2) + ((([abs v] of (((((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (speed)) mod (dist. xy)) - ((dist. xy) / (2))) ) / ((dist. xy) / (2))) * (dist. xy)))) y: ((#level y) - (((y2) + ((([abs v] of (((((timer) + (((%) / (100)) * ((dist. xy) / (speed)))) * (speed)) mod (dist. xy)) - ((dist. xy) / (2))) ) / ((dist. xy) / (2))) * (dist y))) - ()))\n\n@passages secrets\n\nwhen flag clicked\nhide\n\ndefine level (level)\nif <(level) = [11]> then\n créer passage [2]\nelse\n if <(level) = [15]> then\n créer passage [3]\n else\n if <(level) = [17]> then\n créer passage [4]\n else\n if <(level) = [18]> then\n créer passage [5]\n else\n if <(level) = [19]> then\n créer passage [6]\n else\n if <(level) = [21]> then\n créer passage [7]\n else\n if <(level) = [23]> then\n créer passage [8]\n else\n if <(level) = [24]> then\n créer passage [9]\n else\n if <(level) = [29]> then\n créer passage [10]\n else\n if <(level) = [26]> then\n créer passage [11]\n else\n if <(level) = [28]> then\n créer passage [12]\n end\n end\n end\n end\n end\n end\n end\n end\n end\n end\nend\nset [clone? v] to [a]\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [play v]\nwait (0.1) seconds\nlevel (#level n°)\n\ndefine créer passage (costume n°)\npoint in direction (90)\nswitch costume to (costume1 v)\nset size to (400) %\nswitch costume to (costume n°)\nset [clone? v] to [1]\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nset [ghost v] effect to (0)\nshow\n\nwhen I receive [tick v]\nif <(clone?) = [1]> then\n go to x: (#level x) y: (#level y)\n if <touching (hitbox v)?> then\n set [ghost v] effect to (40)\n else\n set [ghost v] effect to (0)\n end\nend\ngo to [front v] layer\n\nstop [all v]\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I receive [menu v]\ndelete this clone\n\nif <(level) = [17]> then\n créer passage [4]\nend\n\n@champi\n\ndefine créer champi en (x) (y) (orientation)\nset [x champi v] to (x)\nset [y champi v] to (y)\npoint in direction (orientation)\ncreate clone of (_myself_ v)\n\ndefine level (level)\nif <(level) = [16]> then\n créer champi en [-250] [185] [90]\nelse\n if <(level) = [17]> then\n créer champi en [780] [625] [90]\n créer champi en [12] [270] [90]\n else\n if <(level) = [19]> then\n créer champi en [150] [40] [90]\n else\n if <(level) = [21]> then\n créer champi en [400] [-200] [90]\n else\n if <(level) = [25]> then\n créer champi en [452] [-1050] [90]\n créer champi en [740] [172] [90]\n end\n end\n end\n end\nend\nset [x champi v] to [a]\nset [y champi v] to [a]\n\nwhen I receive [tick v]\nif <not <(x champi) = [a]>> then\n go to x: ((#level x) - (x champi)) y: ((#level y) - (y champi))\n if <touching (hitbox v)?> then\n broadcast (miam champi v)\n delete this clone\n end\n go to [front v] layer\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\n if <([abs v] of ((#level y) - (y champi)) ) > [180]> then\n set [ghost v] effect to (100)\n end\nend\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I start as a clone\nclear graphic effects\nshow\n\nwhen I receive [play v]\nwait (0.1) seconds\nlevel (#level n°)\n\nwhen flag clicked\nhide\n\ncréer champi en [100] [40] [90]\n\n@intro\n\nwhen flag clicked\nhide\ngo to x: (-240) y: (180)\nerase all\npen up\nset pen color to (#ff0000)\nrepeat (12)\n create clone of (_myself_ v)\n change x by (44)\n change pen (color v) by (1.6)\nend\nwait (2) seconds\nbroadcast (intro v)\nstop [other scripts in sprite v]\nset [n intro v] to [0]\nrepeat until <[11] < (n intro)>\n erase all\n broadcast (refresh intro v)\nend\nerase all\nbroadcast (Menu v)\n\nwhen I start as a clone\nset [y v] to (pick random (0.0) to (1))\nwait (y) seconds\nset [y v] to ((1000) + ((y) * (300)))\nset pen size to (44)\nrepeat until <(y position) < [-175]>\n pen down\n change y by (-10)\nend\n\nwhen I receive [refresh intro v]\npen up\nset y to (-180)\nset [x v] to (x position)\nif <<(x position) < [250]> and <[-181] < (y)>> then\n pen down\n set y to (y)\n change [y v] by (-10)\n pen up\n if <(timer) < [5.2]> then\n fast\n end\nelse\n if <(x position) < [250]> then\n change [n intro v] by (1)\n delete this clone\n end\nend\n\nbroadcast (refresh intro v)\n\nwhen I receive [menu v]\ndelete this clone\n\n\n\nwhen I receive [refresh intro v]\nif <not <<(x position) < [250]> and <[-181] < (y)>>> then\n pen down\n change y by (-10)\nend\n\ndefine fast\ngo to x: (0) y: (0)\nset size to ((([cos v] of ((timer) * (100)) ) + (1)) * (50)) %\nswitch costume to (sans titre 3 v)\nshow\nset [ghost v] effect to (0)\nstamp\nhide\nswitch costume to (costume1 v)\ngo to x: (x) y: (0)\n\n@blocs\n\nwhen flag clicked\nhide\n\ndefine level (level)\nif <(level) = [18]> then\n créer bloc en [449] [-100] [100] [1]\n créer bloc en [410] [-100] [100] [1]\n créer bloc en [371] [-100] [100] [1]\n créer bloc en [332] [-100] [100] [1]\nelse\n if <(level) = [21]> then\n créer bloc en [300] [110] [100] [1]\n créer bloc en [269] [110] [100] [1]\n créer bloc en [532] [0] [70] [1]\n créer bloc en [532] [-80] [70] [1]\n else\n if <(level) = [22]> then\n créer bloc en [490] [-100] [100] [1]\n créer bloc en [-640] [-90] [100] [1]\n créer bloc en [-670] [-90] [100] [1]\n else\n if <(level) = [23]> then\n créer bloc en [200] [-50] [100] [1]\n créer bloc en [-75] [-120] [500] [2]\n else\n if <(level) = [25]> then\n créer bloc en [44] [-720] [75] [1]\n créer bloc en [156] [-800] [75] [1]\n créer bloc en [300] [-880] [75] [1]\n créer bloc en [450] [-960] [75] [1]\n créer bloc en [700] [780] [75] [1]\n else\n if <(level) = [26]> then\n créer bloc en [-264] [-402] [75] [1]\n créer bloc en [-240] [-485] [75] [1]\n créer bloc en [-280] [-560] [75] [1]\n créer bloc en [-300] [-640] [75] [1]\n else\n if <(level) = [29]> then\n créer bloc en [-360] [140] [75] [1]\n créer bloc en [-290] [140] [75] [1]\n end\n end\n end\n end\n end\n end\nend\nset [x bloc v] to [a]\nset [y bloc v] to [a]\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [play v]\npoint in direction (90)\nwait (0.1) seconds\nlevel (#level n°)\n\ndefine créer bloc en (x) (y) (taille) (costume)\nset [x bloc v] to (x)\nset [y bloc v] to (y)\nset [chrono v] to [99]\nswitch costume to (costume)\nset size to (taille) %\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nset [ghost v] effect to (99)\nshow\n\nwhen I receive [tick v]\nif <not <(x bloc) = [a]>> then\n go to x: ((#level x) - (x bloc)) y: ((#level y) - (y bloc))\n if <(chrono) = [0]> then\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (35000000))\n end\nend\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [bloc touché v]\nset [ghost v] effect to (99)\nset [chrono v] to [99]\nif <<not <(x bloc) = [a]>> and <(chrono) = [99]>> then\n if <<([abs v] of ((#level x) - (x bloc)) ) < [40]> and <([abs v] of ((#level y) - (y bloc)) ) < [100]>> then\n set [chrono v] to [0]\n set [ghost v] effect to (0)\n end\nend\n\nreset timer\n\nwhen I receive [bloc touché v]\n\ndelete this clone\n\n@tremplin\n\ndefine créer tremplin en (x) (y)\nset [x tremplin v] to (x)\nset [y tremplin v] to (y)\npoint in direction (90)\ncreate clone of (_myself_ v)\n\ndefine level (level)\nif <(level) = [19]> then\n créer tremplin en [150] [194]\n créer tremplin en [130] [194]\n créer tremplin en [110] [194]\n créer tremplin en [90] [194]\n créer tremplin en [170] [194]\n créer tremplin en [190] [194]\n créer tremplin en [210] [194]\nelse\n if <(level) = [22]> then\n créer tremplin en [-748] [13]\n créer tremplin en [-820] [13]\n créer tremplin en [-900] [13]\n créer tremplin en [-748] [-103]\n créer tremplin en [-820] [-103]\n créer tremplin en [-900] [-103]\n créer tremplin en [-748] [-203]\n créer tremplin en [-820] [-203]\n créer tremplin en [-900] [-203]\n créer tremplin en [-748] [-303]\n créer tremplin en [-820] [-303]\n créer tremplin en [-900] [-303]\n else\n if <(level) = [25]> then\n créer tremplin en [-556] [-57]\n else\n if <(level) = [29]> then\n créer tremplin en [610] [303]\n créer tremplin en [570] [303]\n créer tremplin en [530] [303]\n créer tremplin en [490] [303]\n créer tremplin en [450] [303]\n créer tremplin en [410] [303]\n créer tremplin en [370] [303]\n créer tremplin en [330] [303]\n créer tremplin en [290] [303]\n créer tremplin en [250] [303]\n créer tremplin en [210] [303]\n créer tremplin en [170] [303]\n créer tremplin en [130] [303]\n créer tremplin en [90] [303]\n créer tremplin en [50] [303]\n créer tremplin en [10] [303]\n créer tremplin en [-590] [303]\n créer tremplin en [-550] [303]\n créer tremplin en [-510] [303]\n créer tremplin en [-470] [303]\n créer tremplin en [-430] [303]\n créer tremplin en [-390] [303]\n créer tremplin en [-350] [303]\n créer tremplin en [-310] [303]\n créer tremplin en [-270] [303]\n créer tremplin en [-230] [303]\n créer tremplin en [-190] [303]\n créer tremplin en [-150] [303]\n créer tremplin en [-110] [303]\n créer tremplin en [-70] [303]\n créer tremplin en [-30] [303]\n créer tremplin en [-690] [230]\n créer tremplin en [-788] [20]\n créer tremplin en [-788] [-100]\n créer tremplin en [-788] [-300]\n créer tremplin en [-750] [-450]\n else\n if <(level) = [27]> then\n créer tremplin en [-932] [9]\n else\n if <(level) = [26]> then\n créer tremplin en [-524] [-153]\n créer tremplin en [-524] [-253]\n créer tremplin en [-524] [-353]\n end\n end\n end\n end\n end\nend\nset [x tremplin v] to [a]\nset [y tremplin v] to [a]\n\nwhen I receive [tick v]\nif <not <(x tremplin) = [a]>> then\n go to x: ((#level x) - (x tremplin)) y: ((#level y) - (y tremplin))\n go to [front v] layer\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\n if <([abs v] of (y position) ) > [180]> then\n set [ghost v] effect to (100)\n end\nend\n\nwhen I receive [menu v]\ndelete this clone\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I start as a clone\nclear graphic effects\nshow\n\nwhen I receive [play v]\nwait (0.1) seconds\nlevel (#level n°)\n\nwhen flag clicked\nhide\n\nwhen I receive [tremplin touché v]\nif <not <(x tremplin) = [a]>> then\n if <<([abs v] of ((#level x) - (x tremplin)) ) < [20]> and <([abs v] of ((#level y) - (y tremplin)) ) < [150]>> then\n repeat until <(costume [number v]) = [4]>\n next costume\n end\n wait (0.5) seconds\n repeat until <(costume [number v]) = [1]>\n switch costume to ((costume [number v]) - (1))\n end\n end\nend\n\nstop [all v]\n\nif <(level) = [26]> then\n\ncréer tremplin en [548] [230]\ncréer tremplin en [444] [97]\ncréer tremplin en [556] [-35]\ncréer tremplin en [180] [96]\ncréer tremplin en [-36] [-36]\ncréer tremplin en [-188] [-168]\n\n@block chrono\n\nwhen flag clicked\nhide\n\ndefine level (level)\nif <(level) = [27]> then\n créer block chrono [2] [0.8] [0]\n créer block chrono [3] [0.8] [0.5]\nend\nset [clone? v] to [a]\n\nwhen I receive [menu v]\nhide\ndelete this clone\n\nwhen I receive [play v]\nwait (0.1) seconds\nlevel (#level n°)\n\ndefine créer block chrono (costume n°) (fréquence) (+)\npoint in direction (90)\nswitch costume to (costume1 v)\nset size to (400) %\nswitch costume to (costume n°)\nset [clone? v] to [1]\nset [fréquence v] to (fréquence)\nset [+ v] to (+)\ncreate clone of (_myself_ v)\n\nwhen I start as a clone\nset [ghost v] effect to (0)\nshow\n\nwhen I receive [tick v]\nif <(clone?) = [1]> then\n go to x: (#level x) y: (#level y)\n if <((((timer) + ((+) * (fréquence))) mod (fréquence)) / (0.5)) < (fréquence)> then\n show\n else\n hide\n end\nend\ngo to [front v] layer\n\nstop [all v]\n\nwhen I receive [page mort v]\ndelete this clone\n\nwhen I receive [menu v]\ndelete this clone\n\n@Sprite1\n\nwhen I receive [tick v]\nif <(#level n°) = [28]> then\n set size to (400) %\n show\n go to x: ((#level x) - (30)) y: ((#level y) - (190))\n set [ghost v] effect to ((((x position) * (x position)) * ((x position) * (x position))) / (41000000))\n if <<([abs v] of ((#level y) - (190)) ) > [180]> or <([abs v] of (x position) ) > [240]>> then\n hide\n else\n if <<touching (mouse-pointer v)?> and <mouse down?>> then\n set [#level x v] to [-688]\n set [#level y v] to [-500]\n set [yv v] to [20]\n end\n end\nelse\n hide\nend\n\nset [ghost v] effect to (100)\n\n@Sprite2\n\nwhen flag clicked\nhide\nset size to (100) %\ngo to x: (0) y: (0)\nshow\nforever\n set [ghost v] effect to (100)\n go to [front v] layer\nend\n\n@Sprite3\n\nwhen I receive [menu v]\ncreate clone of (_myself_ v)\ngo to x: (198) y: (-147)\nforever\n show\n go to [front v] layer\n switch costume to (Mode)\nend\n\nwhen flag clicked\nset [mode v] to [1]\nhide\n\nwhen I receive [easy v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I receive [hard v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I receive [medium v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I start as a clone\ngo to x: (198) y: (-160)\nforever\n show\n go to [front v] layer\n go [forward v] (1) layers\n switch costume to ((Mode) + (2))\n if <<mouse down?> and <touching (mouse-pointer v)?>> then\n set [mode v] to (((Mode) mod (2)) + (1))\n switch costume to ((Mode) + (2))\n wait until <<not <touching (mouse-pointer v)?>> or <not <mouse down?>>>\n end\nend\n\n@joystick\n\nwhen I receive [play v]\nif <(Mode) = [2]> then\n show\n switch costume to (1 vide v)\n go to x: (155) y: (-175)\n set [clone? v] to [1]\n create clone of (_myself_ v)\n set [clone? v] to [0]\n set size to (175) %\nend\n\nwhen flag clicked\nhide\n\nwhen I receive [tick v]\nif <(Mode) = [2]> then\n go to [front v] layer\n go [forward v] (1) layers\n if <(clone?) = [0]> then\n go to x: (155) y: (-175)\n show\n else\n go to x: (155) y: (-175)\n switch costume to (1 vide2 v)\n set [x phone v] to [0]\n set [y phone v] to [0]\n if <mouse down?> then\n point towards (mouse-pointer v)\n move (75) steps\n set [x phone v] to (round (((x position) - (155)) / (75)))\n set [y phone v] to (round ([abs v] of (((y position) - (-175)) / (75)) ))\n end\n end\nend\n\nwhen I receive [page mort v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nchange [#level x v] by (-500)\n\nwhen I receive [menu v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nwhen I receive [easy v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nwhen I receive [hard v]\nstop [other scripts in sprite v]\nhide\ndelete this clone\n\nwhen I receive [medium v]\nhide\nstop [other scripts in sprite v]\ndelete this clone\n\nchange [brightness v] effect by (25)\n\nset [ghost v] effect to (25)\n\ngo [forward v] (1) layers\n\n@Sprite4\n\nwhen I receive [win v]\nshow\ngo to x: (0) y: (-100)\nset [t v] to ((timer) * (30))\nset size to (2) %\nforever\n set size to (([sin v] of (((timer) * (30)) - (t)) ) * (140)) %\n go to [front v] layer\n go [backward v] (1) layers\nend\n\nwhen I receive [page mort v]\nhide\nstop [other scripts in sprite v]\n\nwhen flag clicked\nhide\n\n@Sprite5\n\nwhen I receive [mort v]\nshow\ngo to x: (0) y: (-100)\nset [t v] to ((timer) * (30))\nset size to (2) %\nforever\n set size to (([sin v] of (((timer) * (30)) - (t)) ) * (140)) %\n go to [front v] layer\n go [backward v] (1) layers\nend\n\nwhen I receive [page mort v]\nhide\nstop [other scripts in sprite v]\n\nwhen flag clicked\nhide\n\n
(Accepted!) Platformer! an FPC application
@Stage\n\nwhen flag clicked\nswitch backdrop to (background v)\nclear graphic effects\nhide variable [level.completed v]\nhide variable [level v]\nhide variable [clones v]\nif <(username) = [mathias1706]> then\n wait (2) seconds\nelse\n wait (0.5) seconds\nend\nrepeat (50)\n change [brightness v] effect by (-2)\nend\nswitch backdrop to (1 v)\nrepeat (25)\n change [brightness v] effect by (4)\nend\nwait (1) seconds\nshow\nforever\n wait until <(Level.Completed) = [1]>\n repeat (25)\n change [brightness v] effect by (-4)\n end\n switch backdrop to ((Level) + (1))\n wait (2) seconds\n repeat (25)\n change [brightness v] effect by (4)\n end\nend\n\nwait until <(Level.Completed) = [1]>\nrepeat (25)\n change [brightness v] effect by (-4)\nend\nswitch backdrop to ((Level) + (1))\nwait (2) seconds\nrepeat (25)\n change [brightness v] effect by (4)\nend\n\n@Player\n\ndefine Controls - Left and Right\nset [x v] to ((X) * (0.7))\nif <key (left arrow v) pressed?> then\n change [x v] by (-1.5)\nend\nif <key (right arrow v) pressed?> then\n change [x v] by (1.5)\nend\n\ndefine Walk (direction) (speed) max steep (max steep)\nchange x by (speed)\nchange [frame v] by (([abs v] of (speed) ) / (8))\nset [slope v] to [0]\nGet Touching <(In.Platform) = [1]>\nrepeat until <<(Slope) = (max steep)> or <(Touch) = [0]>>\n change y by (1)\n change [slope v] by (1)\n Get Touching <(In.Platform) = [1]>\nend\nif <(Slope) = (max steep)> then\n change x by ((0) - (speed))\n change y by ((0) - (Slope))\n if <<(Touch) = [1]> and <(In.Platform) = [1]>> then\n set [in.platform v] to [2]\n Walk (direction) (speed) max steep (max steep)\n if <(X) = [0]> then\n set [in.platform v] to [1]\n end\n else\n if <<key (up arrow v) pressed?> and <<([abs v] of (speed) ) > [3.5]> and <(Touch) > [1]>>> then\n set [x v] to ((-1.2) * (speed))\n set [y v] to [11]\n set [falling v] to [6]\n set [wall.jump v] to [15]\n else\n set [x v] to [0]\n end\n end\nend\n\ndefine Controls - Jump, Crouch\nif <key (up arrow v) pressed?> then\n if <<(Jump.Key) = [0]> and <(Falling) < [3]>> then\n start sound [Jump v]\n set [y v] to [14]\n set [falling v] to [6]\n set [jump.key v] to [1]\n end\nelse\n set [jump.key v] to [0]\nend\n\ndefine Check Hit Ceiling / Floor <up?>\nGet Touching \nif <(Touch) = [0]> then\n set [in.platform v] to [1]\nelse\n if <<up?> and <(Touch) = [1]>> then\n set [in.platform v] to [2]\n end\nend\nrepeat until <(Touch) < (In.Platform)>\n if <up?> then\n change y by (-1)\n else\n change y by (1)\n set [falling v] to [0]\n end\n Get Touching <not <up?>>\n set [y v] to [0]\nend\n\ndefine Get Touching <check platform?>\nif <(Player Touché?) = [non]> then\n if <touching color (#000000)?> then\n set [touch v] to [9]\n else\n if <<check platform?> and <touching (platforms v)?>> then\n set [touch v] to [1]\n else\n set [touch v] to [0]\n end\n end\nend\n\ndefine Gravity\nif <<(y) < [4]> or <key (up arrow v) pressed?>> then\n change [y v] by (-1)\nelse\n change [y v] by (-2)\nend\nchange y by (y)\nchange [falling v] by (1)\n\nwhen I start as a clone\nset size to (50) %\nswitch costume to (arrow1-a v)\nset [ghost v] effect to (100)\ngo to x: (225) y: (item (Level) of [y-2 v])\npoint in direction (90)\nhide\nforever\n set size to (50) %\n switch costume to (arrow1-a v)\n go to x: (225) y: (item (Level) of [y-2 v])\n repeat (10)\n go to x: ((x position) - (1)) y: (y position)\n wait (0) seconds\n if <(Level) = [6]> then\n hide\n stop [this script v]\n end\n end\n go to x: (215) y: (item (Level) of [y-2 v])\n repeat (10)\n go to x: ((x position) + (1)) y: (y position)\n wait (0) seconds\n end\nend\n\nwhen flag clicked\nhide\nset [ghost v] effect to (100)\nswitch costume to (player v)\nhide variable [x v]\nhide variable [player touché? v]\nhide variable [y v]\nhide variable [falling v]\nhide variable [slope v]\nhide variable [in.platform v]\nhide variable [touch v]\nhide variable [frame v]\nhide variable [jump.key v]\nhide variable [wall.jump v]\nhide variable [speed y v]\nshow list [y v]\ndelete (all) of [y v]\nrepeat (6)\n insert [-100] at (last) of [y v] \nend\nshow list [y-2 v]\ndelete (all) of [y-2 v]\nrepeat (6)\n insert [-105] at (last) of [y-2 v] \nend\nif <(username) = [mathias1706]> then\n wait (3.5) seconds\nelse\n wait (2) seconds\nend\nset [clones v] to [1]\nset [level v] to [1]\nset [level.completed v] to [0]\ncreate clone of (_myself_ v)\nset size to (50) %\ngo to x: (-217) y: (-110)\npoint in direction (90)\nshow\nswitch costume to (costume1 v)\nrepeat (25)\n change [ghost v] effect by (-4)\nend\nforever\n switch costume to (costume1 v)\n go to [front v] layer\n show\n Controls - Jump, Crouch\n Gravity\n Check Hit Ceiling / Floor <(y) > [0]>\n if <(Wall.Jump) > [0]> then\n change [wall.jump v] by (-1)\n else\n Controls - Left and Right\n end\n if <(X) < [-0.5]> then\n Walk (-90) (X) max steep (([ceiling v] of ([abs v] of ((X) * (1.3)) ) ) + (1))\n else\n if <(X) > [0.5]> then\n Walk (90) (X) max steep (([ceiling v] of ([abs v] of ((X) * (1.3)) ) ) + (1))\n else\n set [frame v] to [0]\n end\n end\n if <<(x position) > [210]> and <touching color (#ee2a7b)?>> then\n wait (0.1) seconds\n change [level v] by (1)\n set [level.completed v] to [1]\n set [clones v] to [0]\n repeat (25)\n change [brightness v] effect by (-4)\n end\n wait (2) seconds\n go to x: (-225) y: (item (Level) of [y v])\n point in direction (90)\n set [level.completed v] to [0]\n repeat (25)\n change [brightness v] effect by (4)\n end\n end\n if <(X) > [5]> then\n set [x v] to [5]\n end\n if on edge, bounce\n point in direction (90)\n if <(Player Touché?) = [oui]> then\n go [backward v] (3) layers\n wait until <(Player Touché?) = [non]>\n wait (0.7) seconds\n go to [front v] layer\n end\nend\n\nwhen I start as a clone\nforever\n wait until <(Player Touché?) = [oui]>\n wait until <(Player Touché?) = [non]>\n clear graphic effects\n set [ghost v] effect to (100)\n wait (1.5) seconds\n show\n repeat (25)\n change [ghost v] effect by (-4)\n end\n wait until <(Level.Completed) = [1]>\n hide\n if <(Level) = [6]> then\n stop [this script v]\n end\nend\n\n@Question\n\nwhen flag clicked\npoint in direction (90)\nset size to (100) %\nswitch costume to (1 v)\nclear graphic effects\nset [brightness v] effect to (-100)\nset [player touché? v] to [non]\ndelete all of [position x v]\ndelete all of [position y v]\ninsert [185] at (1) of [position x v] \ninsert [7] at (1) of [position y v] \ninsert [16] at (2) of [position x v] \ninsert [130] at (2) of [position y v] \ninsert [183] at (3) of [position x v] \ninsert [42] at (3) of [position y v] \ninsert [10] at (4) of [position x v] \ninsert [104] at (4) of [position y v] \ninsert [129] at (5) of [position x v] \ninsert [132] at (5) of [position y v] \ninsert [5] at (6) of [position x v] \ninsert [-101] at (6) of [position y v] \ngo to [back v] layer\nhide\nif <(username) = [mathias1706]> then\n wait (3.6) seconds\nelse\n wait (2.1) seconds\nend\ngo to x: (185) y: (7)\nshow\nrepeat (25)\n change [brightness v] effect by (4)\nend\nforever\n repeat until <(Level.Completed) = [1]>\n wait (0.2) seconds\n wait until <<touching (player v)?> or <(Level.Completed) = [1]>>\n if <touching (player v)?> then\n set [player touché? v] to [oui]\n end\n wait until <<(Player Touché?) = [non]> or <(Level.Completed) = [1]>>\n wait until <<not <touching (player v)?>> or <(Level.Completed) = [1]>>\n end\n repeat (25)\n change [brightness v] effect by (-4)\n end\n go to x: (item (Level) of [position x v]) y: (item (Level) of [position y v])\n switch costume to (Level)\n wait (2) seconds\n repeat (25)\n change [brightness v] effect by (4)\n end\nend\n\nwhen flag clicked\nwait (3.6) seconds\nforever\n set [ghost v] effect to (0)\n repeat (20)\n change [ghost v] effect by (1)\n end\n repeat (20)\n change [ghost v] effect by (-1)\n end\nend\n\n@Réponse\n\nwhen flag clicked\nset [level v] to [1]\nset size to (100) %\nclear graphic effects\ngo to [front v] layer\nhide\nwait (3) seconds\ncreate clone of (_myself_ v)\nforever\n wait until <(Player Touché?) = [oui]>\n if <(Level) = [6]> then\n set size to (1) %\n switch costume to (texte 6 v)\n go to x: (0) y: (30)\n go to [front v] layer\n clear graphic effects\n set [ghost v] effect to (100)\n show\n repeat (10)\n change [ghost v] effect by (-10)\n end\n set size to (1) %\n repeat until <(round (size)) = [100]>\n change size by (((100) - (round (size))) / (9))\n end\n wait until <(Player Touché?) = [non]>\n repeat (25)\n change [ghost v] effect by (4)\n end\n hide\n else\n switch costume to (join [Texte ] (Level))\n go to x: (0) y: (30)\n go to [front v] layer\n clear graphic effects\n set [ghost v] effect to (100)\n show\n repeat (25)\n change [ghost v] effect by (-4)\n end\n wait until <(Player Touché?) = [non]>\n repeat (25)\n change [ghost v] effect by (4)\n end\n hide\n end\nend\n\nwhen I start as a clone\nset size to (100) %\nclear graphic effects\ngo to [front v] layer\nhide\nforever\n wait until <(Player Touché?) = [oui]>\n if <(Level) = [6]> then\n switch costume to (arrière plan fin v)\n go to x: (0) y: (30)\n go to [front v] layer\n go [backward v] (2) layers\n clear graphic effects\n set [ghost v] effect to (100)\n show\n repeat (20)\n change [ghost v] effect by (-4)\n end\n wait until <(Player Touché?) = [?]>\n else\n switch costume to (arrière plan v)\n end\n go to x: (0) y: (30)\n go to [front v] layer\n go [backward v] (2) layers\n clear graphic effects\n set [ghost v] effect to (100)\n show\n repeat (20)\n change [ghost v] effect by (-4)\n end\n wait until <key (space v) pressed?>\n set [player touché? v] to [non]\n repeat (20)\n change [ghost v] effect by (4)\n end\n hide\nend\n\n@confetti\n\nwhen flag clicked\nwait (3) seconds\nhide\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\nforever\n create clone of (_myself_ v)\nend\n\nwhen I start as a clone\ngo to [front v] layer\nshow\ngo to x: (pick random (-233) to (233)) y: (180)\nswitch costume to (pick random (1) to (4))\nset [color v] effect to (pick random (0) to (100))\nset size to (pick random (100) to (125)) %\nglide (pick random (0.4) to (3)) secs to x: (x position) y: (-177)\ndelete this clone\n\nwhen flag clicked\nwait (3) seconds\nrepeat until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\n set volume to (30) %\n start sound [Particles v]\n reset timer\n wait until <<(timer) > [225]> or <<(Level) = [6]> and <(Player Touché?) = [oui]>>>\nend\nwait until <(Player Touché?) = [oui]>\nrepeat (30)\n change volume by (-1)\nend\nstop all sounds\nforever\n set volume to (50) %\n play sound [Celebration v] until done\nend\n\nwhen flag clicked\nwait (3) seconds\nhide\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\nforever\n create clone of (_myself_ v)\nend\n\nwhen flag clicked\nwait (3) seconds\nhide\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\nforever\n create clone of (_myself_ v)\nend\n\nwhen flag clicked\nwait (3) seconds\nhide\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\nforever\n create clone of (_myself_ v)\nend\n\nwhen flag clicked\nwait (3) seconds\nhide\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\nforever\n create clone of (_myself_ v)\nend\n\n@Scratch Cat\n\nwhen flag clicked\nhide\nwait (3) seconds\nwait until <<(Level) = [6]> and <(Player Touché?) = [oui]>>\ncreate clone of (_myself_ v)\ngo to x: (-122) y: (96)\npoint in direction (90)\nset size to (55) %\nclear graphic effects\nswitch costume to (1 v)\ngo to [front v] layer\nshow\nforever\n wait (1) seconds\n switch costume to (2 v)\n wait (1) seconds\n switch costume to (1 v)\nend\n\nwhen I start as a clone\ngo to x: (130) y: (96)\npoint in direction (90)\nset size to (55) %\nclear graphic effects\nswitch costume to (3 v)\ngo to [front v] layer\nshow\nforever\n wait (1) seconds\n switch costume to (4 v)\n wait (1) seconds\n switch costume to (3 v)\nend\n\n