Datasets:

rubrix

/

big_patent_a_test_100

like 0

Follow

rubrix 5

reference will now be made in detail to embodiments of the invention . wherever possible , same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps . the drawings are in simplified form and are not to precise scale . the word ‘ couple ’ and similar terms do not necessarily denote direct and immediate connections , but also include connections through intermediate elements or devices . for purposes of convenience and clarity only , directional ( up / down , etc .) or motional ( forward / back , etc .) terms may be used with respect to the drawings . these and similar directional terms should not be construed to limit the scope in any manner . it will also be understood that other embodiments may be utilized without departing from the scope of the present invention , and that the detailed description is not to be taken in a limiting sense , and that elements may be differently positioned , or otherwise noted as in the appended claims without requirements of the written description being required thereto . various operations may be described as multiple discrete operations in turn , in a manner that may be helpful in understanding embodiments of the present invention ; however , the order of description should not be construed to imply that these operations are order dependent . referring now to fig1 a and 1b , a proposed cleaning system 1 is provided with a container 2 for retaining , and optionally removably retaining one or more brushes 8 relative to an animal limb 5 ( a paw is shown ) to be cleaned . container 2 includes threads 7 about an outer upper surface thereof for removable engagement with a cleaning cover 3 , or a sealing lid or cover 4 , as will be discussed . during a use , limb 5 is thrust within container 2 and agitated with bristles 8 b of brushes 8 for removal of debris and detritus . additional solutions may be added , including water , detergent , and other types , without departing from the scope and sprit of the present invention . additionally referring now to fig2 and 3 , wherein system 1 is provided with a threadably secured cleaning cover 3 having a cleaning opening 3 a for receiving limb 5 therein . as shown in fig2 and 3 , the inner surface of cleaning opening 3 a additionally contains a brush element 8 with bristles 8 b facing inwardly . additionally , in fig3 , sealing lid 4 is provided having an interior threading section 7 ( as shown ) which may threadably engage an additional outer threaded section on the outer surface of cleaning lid 3 , see fig3 for this version . as will be appreciated in fig3 , an entire system 1 may be modified to have , in combination container 2 , cleaning lid 3 , and sealing lid 4 , or ( as shown in fig2 ) system 1 may including container 2 and cleaning lid 3 , without a cover . in either case , cleaning cover 3 may be readily modified to have threads 7 , on an inner or outer surface , or both , without departing from the scope and spirit of the present invention . additionally , it will be noted that threads 7 may be replaced with sealing tabs ( not shown ) sealing frictio - rings ( like a sealing lid ), or any other type of engagement system to secure cover 3 or lid 4 to container 2 , without departing from the scope and spirit of the present invention . additionally referring now to fig4 and 4a , wherein a cross section and top - section view are provided of a system 1 , engaged and containing solution 6 , which may be any suitable fluid component , or combination of components for washing , sterilizing , etc . and may contain antimicrobial , antibiotic , anti - fungal , or other curative and assistive components , and solutions within the scope of the present invention . for example , medical treatment components may be added to solution 6 . as will be appreciated each brush 8 contains a brush base sa that spaces the respective brush 8 , having bristles 8 b from the outer container 2 . base 8 a contains flow openings 8 c both on a side leg region and a base region supporting bristles 8 b . it will therefore be recognized by those of skill in the art having studied the present invention , that solution 6 may flow readily between bristles 8 b , base 8 a , flow holes 8 c and brush 8 during a use , and may slosh throughout system 1 to aid in treating , cleaning , rinsing , or contacting an animal limb 5 during a use . see for example the flow arrows noted in fig4 and 4a . it will also be understood , that solution 6 may be of any level in system 1 . it will also be understood that any debris or detritus removed from an animal limb 5 during use , may remain within container 2 post - use , so as to allow for easy removal and rinsing - out by removal of cleaning cover 3 . it will additionally be understood , that the proposed system 1 may function suitably without a cleaning cover 3 ( as is shown in fig1 a , 1 b . for example , where an especially large animal limb 5 is used , cover 3 may be unduly restricting , and may be removed . referring now to fig5 and 6 , it will be noted that instead of a roundish , brush 8 ( central brush 8 shown in fig2 - 4a , several component member brushes 8 may be used for similar effects without departing from the scope and spirit of the present invention . for example , as seen in fig5 , four brushes 8 may be arranged ( one on the bottom and three in triangle form ). for another example , as seen in fig6 , six brushes 8 may be arranged ( one on the bottom and five in pentagon form ). in the examples in fig5 and 6 , it will be understood , that a plurality of brushes 8 , or a continuous brush 8 , may be used without departing from the scope and spirit of the present invention . in an alternative embodiment regarding fig2 and 3 , it will be understood that side and bottom brushes 8 maybe formed as a single integral unit , that is slidably removable from within container 2 without departing from the scope and spirit of the present invention . for example , a unitary replacement brush unit ( not shown ) may be slidable removable in and out of container 2 within the scope of the present invention . additionally , a further example would involve a brush - carrier unit ( not shown ), wherein a plurality individual brushes 8 ( linear , arc shaped or otherwise ) may be removably retained in a brush - carrier unit ( not shown ) that is slid within container 2 for holding replacement brushes . in one aspect of the present invention , surgical scrub brushes are employed in the container and cleaning lid derived from scrub care ® which is a surgical scrub brush - sponge / nail cleaning mixed with exidine ® 4 a type of germicidal solution ; allegiance heathcare corporation , mcgaw park , ill . 60085 us , ( ndc 63517 - 007 - 25 ). in this use , the surgical brushes are constructed from a suitable plastic ( polyethylene ( pe ), high density pe ( hdpe ), medium density pe ( mdpe ), low density pe ( ldpe ), or any other type of plastic suitable for the purposes intended . additionally , the brushes are not limited to plastic , but may be constructed from suitable natural materials , including but not limited to , fibers , hair , bristles , and any other type of natural brush - like fiber that would be suitable for the purposes intended . additionally , a brush may be constructed from a combination of materials without departing from the scope and spirit of the present invention . for example , a brush backing may be of plastic and bristles may be boar - hair or other natural material , and vice - versa . it is another alternative aspect of the present invention , that a the brush construction / bristle construction shown within the container may be formed in alternative shapes without departing from the scope and spirit of the present invention . for example , a continuous bounding surface of bristles may be provided ( e . g ., a circular bristle surface ), or any other related shape . additionally , a brush may be removed from a floor / bottom surface of the container as a modification thereof . additionally , a brush - holding cradle may be inserted into the container , so that the brush - holding cradle may be removed from the container ( the brushes not being fixed to the container wall , but fixed to a brush - holding cradle ( noted but not shown ). as a result , it will be apparent to those of skill in the art having studied the present disclosure that the method and system may be modified without departing from the scope and spirit of the present invention . it will also be understood , that as used herein the device may be used with any cleaning solution , soap , detergent , germicidal or antiseptic for dispersion or surface scrubbing known within the surgical or veterinarian arts without departing from the scope and spirit of the present invention . it will be understood that the present invention relates to a method and system for cleaning pet paws or other animal appendages including feet , hooves , and limbs . it will be understood that a dog - paw may be conveniently used , but also conveniently a sheep hoof may be cleaned , or a rabbit foot — all with differing shapes and needs for cleaning , but all ready cleaned by adaptive us of the present device . therefore , it will be recognized by one of skill in the art having studied the present disclosure , that the present device using a plurality of flow - through type brushes may be easily used to clean a range of animals . for example , cleaning sheep hooves for serious medical treatment or disease prevention or cleaning a pet - dog foot following a simple walk during a winter or muddy day . more particularly , the present invention provides a method and system for cleaning pet appendages that is readily transported and stored between uses , readily adapts to specific uses , and environments proximate that treatment surface is not limited . having described at least one of the preferred embodiments of the present invention with reference to the accompanying drawings , it will be apparent to those skills that the invention is not limited to those precise embodiments , and that various modifications and variations can be made in the presently disclosed system without departing from the scope or spirit of the invention . thus , it is intended that the present disclosure cover modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents .

the invention provides a method and system for cleaning pet paws providing a bounded container containing a plurality of soft scrub brushes defining a paw cleaning region within an outer container wall wherein cleaning solution can flow freely within the container between a paw - for - cleaning , the container wall , and the brushes while allowing space for sediment . a spill resistant lid allows easy transport . an optional splash resistant lid containing a further brush boundary enables an enhanced side leg cleaning . the proposed method and system enables an enhanced deep cleaning through repeated submersion within the container and removable of debris . the system aids in prevention of infection and disease .

steel cut oats are well known in the industry as oat particulates produced by cutting whole groats from clean , sound oats without rolling . a preferred form of steel cut oat is commercially known as a &# 34 ; table steel cut oat groat &# 34 ;. a desirable granulation size is about 8 % by weight maximum over a u . s . # 7 sieve and 25 % maximum through a u . s . # 12 sieve . steel cut oats are used in the invention to add texture to the resulting food product . oat bran is water soluble and should be handled in such a manner as to avoid clumping . mild agitation is preferred to break up any clumps that may have formed yet avoid harm to the added oat bran . it is not desirable to have a high rate of agitation as the oat bran will break up and solubilize to the detriment of the resulting flavor . any coarseness or granulation of oat bran can be used depending on the taste and texture desired in the final product . a preferred granulation has 10 % maximum on u . s . # 10 , 55 - 75 % on u . s . # 20 , 10 - 30 % on u . s . # 30 , and 10 % maximum in the pan at an overall density of about 30 - 32 lb / cu . ft . rolled oats come in a variety of commercially available thicknesses . all of these thicknesses are useful in the process according to the invention . rolled oats are available as &# 34 ; thick table rolled &# 34 ;, &# 34 ; regular rolled &# 34 ;, and &# 34 ; quick cooking oats &# 34 ; in order of decreasing thickness . the thick rolled oats are preferred as they retain their texture and overall flavorful contribution while being less susceptible to processing damage . a desirable granulation of thick table rolled oats is about 80 % minimum on a u . s . # 8 sieve and 10 % maximum passing through a u . s . # 20 sieve . in the method for optionally &# 34 ; aseptically &# 34 ; processing oats and oat fractions into a flavorful oatmeal composition , the first step is to hydrate steel cut oats , for example , by soaking in water for up to about 45 minutes at about 65 - 85 ° f . steel cut oats are well known in the industry as oat particulates produced by cutting whole groats from clean , sound oats without rolling . a preferred form of steel cut oat is commercially known as a &# 34 ; table steel cut oat groat &# 34 ;. a desirable granulation size is about 8 % by weight maximum over a u . s . # 7 sieve and 25 % maximum through a u . s . # 12 sieve . steel cut oats are used in the invention to add texture to the resulting food product . to the soaking steel cut oats can be added an optional flavor fraction . a wide variety of flavors agents may be present but preferably comprise cinnamon , honey or other sweetening material , salt , and vanilla in proportions to taste . cinnamon is desirably present in virtually any physical form at a weight ratio with respect to the overall composition of about 0 . 2 to 0 . 6 %, while honey is desirably added in a weight ratio of about 4 to 12 %. salt can be used in a weight ratio of up to about 0 . 26 % depending on flavor and dietary considerations for the product . vanilla can be added in a weight ratio of 0 . 4 to 1 . 2 %, depending on the vanilla flavor concentration ( fold ). it should be understood that the flavor fraction may contain other ingredients or use widely different proportions for the listed components . taste , style , and economic factors will tend to guide the formulation of the flavor fraction if added to the product at all . oat bran is preferably added to the hydrating steel cut oats after the cut oats have been soaking for about 7 to 12 minutes . oat bran is water soluble and should be added in such a manner as to avoid clumping . mild agitation is preferred to break up any clumps that may have formed yet avoid harm to the added oat bran . it is not desirable to have a high rate of agitation as the oat bran will break up and solubilize to the detriment of the resulting flavor . any coarseness or granulation of oat bran can be used depending on the taste and texture desired in the final product . a preferred granulation has 10 % maximum on u . s . # 10 , 55 - 75 % on u . s . # 20 , 10 - 30 % on u . s . # 30 , and 10 % maximum in the pan at an overall density of about 30 - 32 lb / cu . ft . when the steel cut oats and oat bran have been mixed and soaked , the cut oat / bran mixture is desirably transferred to a holding reservoir . this transfer step may be through a series of pipes or other handling apparatus . the rate and amount of shear that is induced is desirably minimized to preserve the texture of the steel cut oats and the oat bran while assuring adequate mixing to avoid clumping . rolled oats ( otherwise known as oat flakes ) can be added at any point in the process before cooking the mixture . desirably , they are added to the cut oat / bran mixture in the holding reservoir . the rolled oats are even more preferably added before the cut oat / bran mix is passed to the reservoir to minimize shear forces on the flakes and thereby preserve their texture . the oat mixture containing cut oats , bran , and flakes is then heated to a temperature of about 250 ° to 325 ° f . for a time sufficient to cook the oatmeal fractions , e . g . for 15 seconds to about 2 minutes , depending on the temperature . it is preferable to maintain aseptic conditions during the cooking and avoid the introduction of any microorganisms or bacteria which could adversely affect the food product . for that reason , conventional aseptic processing equipment such as closed kettles and heating tubes are desirably used . this aseptic product has a shelf like under refrigeration at 40 °- 50 ° f . of about 4 - 6 months . if the storage conditions of the aseptically packaged product are likely to be at temperatures above 75 ° f . for an extended period of time , it may be desirable to add a small quantity of preservative to ensure the safety of the food composition . among the well known , suitable preservatives are potassium sorbate and sodium benzoate . further , where aseptic packaging conditions are not used , conventional preservatives may be added according to conventional protocols as is customary in the industry to preserve product freshness . in the retort preparation , the steel cut oats and oat bran mixture is heated to a temperature of about 150 ° f . to about 220 ° f ., preferably at least 180 ° f . the rolled oats are then added , and the entire mixture is simmered for about 2 to 5 minutes . preferably , the mixture is simmered for about 3 minutes . the mixture is subsequently placed into containers such as bowls or pouches designed as retail or wholesale packaging for the product and additionally cooked for a time sufficient to produce an edible composition . cooking time in the containers is affected by container size and thickness , with larger and / or denser containers requiring longer cooking times . preferred cooking time in containers is about 13 minutes to 1 hour and 25 minutes . preferred cooking temperature is at least about 250 ° f ., more preferably 250 ° to about 310 ° f . further , rotation of the container may be performed , which rotation further shortens cooking time . rotation of the containers of up to 15 rpm may be used . flavorings may be added , as discussed above . in addition , raisins may be included in the composition at any point in the preparation . where raisins are to be added , they are preferably added in the final stages of the procedure . when cooking is complete , the containers are sealed and may be heated to sanitize the contents . alternatively , conventional preservatives may be added . in both the optional aseptic and retort processes above , it is desirable to add the rolled oats at a point in the preparation so that their processing is minimized , in order to avoid production of a paste - like product . although the specific order of the steps discussed above represents the preferred methods of practicing the invention , other variations which would delay processing of the rolled oats are also intended to be encompassed within the invention . for example , the steel - cut oats may be cooked separately , combined with previously hydrated oat bran , and then cooked with rolled oats for a short time . in the &# 34 ; hot fill &# 34 ; and &# 34 ; fresh pack &# 34 ; processes , when the steel cut oats and oat bran have been mixed and soaked , the cut oat / bran mixture may be transferred to a holding reservoir or cooking apparatus , e . g ., an open kettle . this transfer step may be through a series of pipes or other handling apparatus . the rate and amount of shear that is induced is desirably minimized to preserve the texture of the steel cut oats and the oat bran while assuring adequate mixing to avoid clumping . rolled oats ( otherwise known as oat flakes ) are added to the cut oat / bran mixture in the cooking apparatus . the rolled oats are even more preferably added before the cut oat / bran mix is passed to the reservoir , where a reservoir is used , to minimize shear forces on the flakes and thereby preserve their texture . in both the hot - fill and fresh pack processes , it is desirable to add the rolled oats at a point in the preparation so that their processing is minimized , in order to avoid production of a paste - like product . although the specific order of the processing steps discussed below represents the preferred method of practicing the invention , other variations which would delay processing of the rolled oats are also intended to be encompassed within the invention . for example , the steel - cut oats may be first hydrated , combined with the oat bran , and then cooked , with subsequent addition of rolled oats and optionally further cooking for a short time . in a preferred embodiment of the fresh pack process , the steel cut oats and water are cooked at a rolling boil for about 5 to 15 minutes , preferably about 10 minutes , at about 15 - 18 psi . the rolled oats are then added and the mixture is cooked for an additional approximately 3 to 8 minutes . the oat bran is then added and cooking is continued for up to about 3 minutes . preferably , the bran is previously hydrated to shorten cooking time , e . g ., soaked for about 1 to 5 minutes in hot water . the mixture is then transferred to containers , e . g ., through a pump system and chilled to about 40 ° to 85 ° f ., preferably to approximately 50 ° to 80 ° f . the container and oatmeal may be cooled using a variety of conventional container cooling techniques , e . g ., contact with cold water or gas , refrigeration , etc . depending on the desired end use of the product , the containers may be large pails for food service applications or retail packs for consumer use . where such packaging is not sterile , preservatives are added , generally to the cooking apparatus during processing . among the well known , suitable preservatives are potassium sorbate and sodium benzoate . these and other conventional preservatives may be added according to conventional protocols as is customary in the industry to preserve product freshness . in a preferred embodiment of the hot fill technique , the oatmeal composition can be acidified with suitable ph modifier using an open kettle for the cooking . suitable ph modifiers include glucono delta lactone , apple butter , apple pectin , any naturally acidic flavorings , and combinations thereof . the resulting product can then be filled into containers at an elevated temperature , e . g ., about 140 ° to 160 ° f ., sealed with a removable plastic film , and inverted . preferably , the container is hot filled with about 80 - 98 vol . % oatmeal with the remainder being air that is naturally drawn into the container during the filling step and becomes heated to the oatmeal temperature . an inversion step permits hot air within the container to rise through the oatmeal composition and kill any bacteria that might have been introduced as a result of the open kettle cooking . the result of the inversion is a sterile package . the hot fill product according to the invention has a refrigerated shelf life of approximately 4 - 6 months for a 24 ounce container . the product can be opened and heated on a conventional stove or in a microwave oven set at high for about 45 to 90 seconds depending on the oven power . additional flavoring agents may be added to the cooked product if desired . in either process , an optional flavor fraction may be added during processing , preferably to the steel cut oats . a wide variety of flavors agents may be present but preferably comprise cinnamon , honey or other sweetening material , salt , and vanilla in proportions to taste . cinnamon is desirably present in virtually any physical form at a weight ratio with respect to the overall composition of about 0 . 2 to 0 . 6 %, while honey is desirably added in a weight ratio of about 4 to 12 %. salt can be used in a weight ratio of up to about 0 . 26 % depending on flavor and dietary considerations for the product . vanilla can be added in a weight ratio of 0 . 4 to 1 . 2 %, depending on the vanilla flavor concentration ( fold ). it should be understood that the flavor fraction may contain other ingredients or use widely different proportions for the listed components . taste , style , and economic factors will tend to guide the formulation of the flavor fraction if added to the product at all . in addition , raisins may be included in the composition at any point in the preparation . where raisins are to be added , they are preferably added in the final stages of the procedure . without further elaboration , it is believed that one skilled in the art can , using the preceding description , utilize the present invention to its fullest extent . the following preferred specific embodiments are , therefore , to be construed as merely illustrative , and not limitative , of the remainder of the disclosure in any way whatsoever . the entire texts of all applications , patents and publications , if any , cited above and below , are hereby incorporated by reference . table 1______________________________________ingredient wt . % ______________________________________water 73 . 9steel cut oat groats 8 . 0thick rolled oats 8 . 0wildflower honey 8 . 0oat bran 0 . 76mccormick vanilla extract ( v - 401 ) 0 . 7ground cinnamon 0 . 4salt 0 . 24______________________________________ to prepare the oatmeal composition as shown in table 1 , the following process was used : in a kettle , warm water at 70 ° f . was mixed with steel cut oats and soaked for a total time of 30 minutes . during the soaking , a flavor fraction of water , honey , vanilla , salt , and cinnamon was dissolved in the water . oat bran was added to the soaking cut oat / flavor mixture with mild agitation . rolled oats were then added as a dry feed at the rate of 2 . 1 lbs / min . when mixed , the oatmeal composition was passed through a cooking tube of 130 inches long at 276 ° f . at the rate of 3 gallons per minute . the cooked mixture was filled into six ounce plastic cups at 110 ° to 120 ° f . and capped . water was brought to a rolling boil , and a honey container was placed into the hot water bath and set aside to loosen up . two gallons of water was removed to hydrate the oat bran , blended with the bran until smooth and until no lumps existed , set aside and covered with a plastic bag to retain heat . preservatives were added directly to the water in the kettle and stirred to dissolve . salt , vanilla and cinnamon were added while stirring constantly . steel - cut oats were added , cooked for 10 minutes at an even , rolling boil throughout cooking ( approximately 15 - 18 psi or 210 °- 212 ° f .). at 10 minutes , rolled oats were added and cooked for an additional 6 minutes . at 16 minutes , the hydrated oat bran , honey ( and raisins ) were added and cooked for an additional 3 minutes . steam was shut off immediately and as quickly as possible the product was bucketed out into large pails , followed immediately by co 2 chilling to 50 °- 85 °. co 2 time : approximately 2 minutes 35 seconds . table 2______________________________________ percentage ofingredients description quantity ingredient______________________________________water potable 10509 . 5 77 . 23oats conagra steel cut 1088 . 6 8 . 00 ( code 8273 ) honey wild flower ( tm . sub . 2 ) 680 . 4 5 . 00vanilla gold medal - borden 81 . 6 0 . 60salt non - iodized 21 . 8 0 . 16cinnamon mccormick ( tm . sub . 2 ) 34 . 0 0 . 25oat bran mothers ( code 8l1j ) 103 . 4 0 . 76oats conagra # 3 rolled 1086 . 6 8 . 00 ( code 8273 ) 13607 . 9 100 . 00______________________________________ 1 . combine all ingredients ( except rolled oats ) to maintain identity . heat to 180 ° f . ______________________________________pouches bowls______________________________________process temperature - 250 ° f . process temperature - 250 ° f . rotations / minute - 9 rpm rotations / minute - 0processing pressure - 30 psi processing pressure - 30 psitotal cook time - 13 minutes total cook time - 26 minutes______________________________________ the preceding examples can be repeated with similar success by substituting the generically or specifically described reactants and / or operating conditions of this invention for those used in the preceding examples . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions .

the invention comprises a process for preparing oatmeal , which process comprises soaking steel cut oats and oat bran for a period of time sufficient to hydrate the oats , mixing rolled oats into the hydrated oat fraction , cooking the resultant mixture for a period of time sufficient to produce a flavorful food product , and optionally aseptically packaging the resulting product . the invention also comprises a process for preparing an oatmeal composition , which process comprises cooking steel cut oats in a manner so that the material is hydrated , adding rolled oats after a cooking time such that cooking of steel cut oats is substantially complete , adding optionally hydrated oat bran either before or after addition of the rolled oats , cooking the entire mixture for a time sufficient to render the product edible and packaging the product . the packaging steps in this aspect of the invention may comprise adding an acidic modifier to the cookable oat mixture , filling containers with the cooked oat mixture , inverting the filled containers allowing hot air to rise through the containers , and cooling the oatmeal . alternatively , the packaging steps may comprise transferring the product to containers and cooling the product and container to a temperature sufficiently low so as to maintain product freshness and to retard spoilage .

the trunk rotation conditioning device of this invention provides the following . the user is in a weight bearing position that simulates a stance in many sports ( e . g ., golf , baseball or hockey ). the angle of the inclination ( posture ) is adjustable about a pivot to accommodate individual variation in the standing position . fig1 is a side view illustrating the basic elements of the trunk rotation conditioning device , as well as the position of the user and how it can accommodate to user size . in the preferred embodiment of a golf exercise apparatus , the device provides resistance during an exercise emulating a golf swing of a golfer to strengthen muscles of the axial skeleton and lower extremities of the performing golfer . fig1 shows exercise apparatus 10 that provides resistance during an exercise using dynamic movement for shoulder , hip , knee , back and abdominal musculature to strengthen muscles of the axial skeleton and lower extremities of performing user 12 . apparatus 10 comprises support base 14 , member 16 pivotally mounted to the support base , variable resistance , torso pivotally mounted axial shaft 18 coupled to pivotally mounted member 16 , shoulder harness 22 connected to torso axial shaft 18 , hip harness 24 connected to pelvis axial shaft 20 , torso independent torque resistor 26 connected to torso axial shaft 18 , and pelvis , independent torque resistor 28 connected to pelvis axial shaft 20 . the angle of inclination ( posture ) is adjustable along axis a - a ′. fig1 illustrates the standing neutral position of the user in the device . the user is strapped at the shoulder and hip using restraints which are connected rigidly to the arms that rotate about the axis “ a ” at pivots points . the length of these arms is adjustable to accommodate users of different sizes / heights . fig1 also shows controller 140 and computer 142 operating exercise apparatus 10 through conventional circuitry , not shown . controller 140 and computer 142 are wired to their respective drives , sensors and actuators in apparatus 10 through conventional circuitry , not shown . fig2 is a side view in perspective illustrating the hips and shoulders of user 12 . the hip and shoulder turn are shown in greater detail in fig3 . apparatus 10 includes a support base , a member pivotally mounted to the support base ; a torso pivotally mounted axial shaft coupled to the pivotally mounted member ; and a pelvis pivotally mounted axial shaft coupled to the pivotally mounted member as described for fig1 . fig3 is a front view of the prospective illustration showing a shoulder and hip turn to the left . the user locates himself / herself in this posture within machine 10 such that the axis a - a ′ of rotation of the exercise motion passes through user &# 39 ; s 12 spine , the desired axis of rotation of the hips and shoulders . fig3 shows shoulder harness portion 22 l and hip harness portion 24 l turned upwardly and to the left . also shown in shoulder harness portion 22 r and hip harness portion 24 r turned downwardly and to the left . fig2 and 3 illustrate the torso and pelvis rotation of the user towards the left . a shoulder harness is connected to the torso axial shaft ; and a hip harness is connected to the pelvis axial shaft . a torso , independent force resistor is connected to the torso axial shaft and includes a means for providing resistance in at least two directions . the hips and shoulders are provided with variable resistance about the pivots in the form of disc brakes ( fig4 ). these brakes can be in the form of dry friction , fluid damping , eddy currents , or magneto - heterodyne . the braking will provide resistance in either direction across the range of possible movement . fig3 is a front view that illustrates torso and pelvis rotation of the user towards the left . a pelvis , independent force resistor also is connected to the pelvis axial shaft , and includes a means providing resistance in at least two directions . in a preferred embodiment , the apparatus includes a means to independently lock the torso shaft in a neutral position and a means to independently lock the pelvis shaft in a neutral position . linear potentiometers are provided at the pivots points to measure the angular position of the torso and pelvis . load cells are located at the pivots to measure the exerted force of the user , independently at the torso and pelvis . fig4 is a view showing the hydraulic disk brakes . in another embodiment , magnetic brakes will be shown that provide the resistance to rotation at the torso and pelvis resistance arm axes of movement . the machine has the following additional attributes . the resistance of the shoulders and hips are independently adjustable , and will be user determined and controlled , via a control panel within reach of the user while in the device . the torso and pelvis pivot arms can be independently locked in the neutral position in order to isolate the exercise to the other element . fig4 shows resistor 26 and 28 in greater detail . resistors 26 and 28 each comprise caliper 30 , pivot arm 32 , rotor 34 and torque and angle measurement device 36 . these connect shaft 18 and 20 to member 16 through housing 38 . a real - time digital display unit will be provided to the user regarding the position and torque exerted by the torso and pelvis . the maximum difference between the torso and pelvis angle will be calculated and displayed for each exercise cycle . fig4 also shows axial assembly 19 in greater detail . axial assembly 19 connects arm 18 and arm 20 to member 16 through housing 38 . fig8 also shows adjustable torso angle control 17 connected to member 16 via housing 38 . fig5 illustrates shoulder turn according to this invention . the exercise apparatus provides resistance during an exercise using dynamic therapeutic movement for shoulder , hip , knee , back and abdominal musculature to strengthen muscles of the axial skeleton and lower extremities of a performing user . it includes a means for providing adjustable resistance in all directions and adjustable assisted stretching in all directions . fig6 illustrates side to side and front to back rotation according to this invention . the method includes steps of : providing an exercise apparatus that provides resistance during an exercise using dynamic therapeutic movement for shoulder , hip , knee , back and abdominal musculature to strengthen muscles of the axial skeleton and lower extremities of a performing user ; and providing adjustable resistance in all directions and adjustable assisted stretching in all directions . fig7 is a front view showing the preferred embodiments including back supports and a real time display unit . fig7 shows shoulder harness 22 , upper back support 72 , lower back support 74 , real time display unit 76 and support base 14 . display unit 76 preferably is positioned where the user may view the display . display unit 76 is connected to controller 140 and computer 142 through conventional circuitry , not shown . fig8 is a sectional view showing the preferred embodiments of magnetic brakes and an adjustable torso angle control . fig8 shows upper back arm 18 and lower back arm 20 connected to magnetic brakes 80 and 82 . magnetic brakes 80 and 82 replaces the disc or resistance brakes shown in fig4 . member 16 supports and houses magnetic brakes 80 and 82 . member 16 also supports and houses control 84 which provides an adjustable torso angle to apparatus 10 . adjustable torso angle 84 comprises a lever , slot and rod for controlling torso angle . fig9 is a sectional view showing the preferred embodiment of a control for the adjustable lower back support . fig9 shows adjustable lower back control 90 connected and positioned between lower back arm 20 and lower back support 74 . controls 92 provide adjustments for the hip size of the user . fig1 is a section view showing the preferred embodiment of a ratchet for the shoulder harness . fig1 shows ratchet 100 for shoulder harness 22 and upper back support 72 . fig1 is a section view showing the preferred embodiment of real time position display unit 76 . display unit 76 includes run screen 110 , current status screen 112 , cycle in use screen 114 , soft key functions 116 and conventional key pad 118 . fig1 is a sectional view showing the preferred embodiment of magnetic brake controls . fig1 shows control unit 140 including magnetic brake controls 120 and 122 . controls 120 and 122 are connected to control unit 140 , computer 142 and magnetic brakes 80 and 82 through conventional circuitry , not shown . in one embodiment , we employ a computer chip that tracks all aspects of performance over time . in this embodiment , a means measures at least one or all aspects of performance and converts the performance into an electrical signal representative of the performance being monitored . a programmed microprocessor including the computer chip is configured to identify the signal representative of the performance being monitored . the programmed microprocessor also is configured to identify and store the parameter ( performance ) being monitored . this enhanced version allows the professional to track their students . it also is used for the physical therapist and chiropractor to monitor a patient . in another embodiment , shoulder harness 22 is not a true harness connected to a user &# 39 ; s shoulders by a means such as a strap or belt . preferably , shoulder harness 22 has a distal end with handles attached thereto . the user grasps the handles during use of apparatus 10 . in still another embodiment , base 14 includes sensors which provide signals to the programmed microprocessor . these , for example , would help a pga professional , to monitor a student &# 39 ; s weight shift during a golf swing . knowing if a right handed golfer &# 39 ; s weight is on the inside of the right foot at the top of the back swing would be a valuable teaching tool . monitoring a weight shift to the outside of the left foot at the completion of the follow through would be equally valuable . the above detailed description of the present invention is given for explanatory purposes . it will be apparent to those skilled in the art that numerous changes and modifications can be made without departing from the scope of the invention . accordingly , the whole of the foregoing description is to be construed in an illustrative and not a limitative sense , the scope of the invention being defined solely by the appended claims .

this trunk rotation device uses dynamic movement of one &# 39 ; s body such as , shoulder , hip , knee , back , thigh , and abdominal musculature . the device provides a method for exercising the spinal column and the muscles of the torso , including those in the abdominal lumbar and thoracic regions involving rotational torque . in a preferred embodiment , the device is a golf exercise and flexibility apparatus . the golf exercise apparatus provides resistance to a golfer during a golf swing to strengthen and condition the muscles of the axial skeleton of the golfer in a functional posture .

the present invention provides an electrolyte gel based on a crosslinked natural gum as the thickening agent . the preferred gums are guar gum and locust bean gum . structurally , the useful natural gums are high polymeric saccharides comprised of hexose , pentose or uronic acid groups linked together . one feature of the natural gums is their ready availability and low cost . a feature of guar gum is that it can be obtained in a rather pure state without extensive processing . guar gum in its natural state is relatively pure , having very few impurities such as sulphur ( sometimes found in agar ) or extraneous ions ( as found in many of the less pure gums ). a useful practical feature of guar gum gels is that they can be produced at room temperature or at only slightly raised temperature due to the fact that guar gum powder mixes well with room temperature water unlike synthetic gels such as polyvinyl alcohol which requires heating and more complicated production techniques . in addition , the natural ph of guar gum gels of this invention is approximately 7 - 8 . 5 , which is an excellent ph range for a composition to be used against the skin since it is close to the physiological ph . gels of the prior art have been neutralized or buffered in order to achieve an acceptable ph . natural gums are polysaccharides obtained from natural substances . for example , guar gum is a polysaccharide obtained from the seeds of the guar plant . the structure of guar gum , as illustrated below , is that of a chain mannose sacharide polymer with repeating single - unit galactose branches , referred to as galactomannan . ## str1 ## guar gum is available in anionic , cationic and nonionic forms . the nonionic type has been found most suitable for use with ag / agcl electrodes and is preferred for use with sensitive biomonitoring electrodes . applicant has surprisingly found that gels made from a hydroxy - propylated nonionic guar gum , sold by the stein hall co . under the trademark jaguar ® hp - 11 , are stable to concentrations of chloride ion greater than 10 percent by weight . thus , this guar gum gel can be successfully utilized where the transmission of high currents is desired ( i . e ., high salt concentrations are required ) without breakdown of the gel &# 39 ; s cohesive structure . however , in applications where the electrodes are to contact the skin for periods longer than an hour , lower concentrations , 0 . 1 - 5 percent by weight , of chloride ion are preferred . the lower concentrations of chloride are also preferred for electrodes which have been gelled and stored a long time prior to use in order to avoid corrosion effects on other parts of the electrode . both anionic and cationic guars are also useful as conductive gels . anionic guar , sold by the stein hall co . under the trademark jaguar ® cmhp , and cationic guar , sold by the stein hall co . under the trademark jaguar ® c - 13 , have been successfully tested . additionally , even a food - grade guar has been used successfully . gels made from these gums are of different viscosities and achieve peak viscosity at different times than do gels made from nonionic guar gum . mixtures of crosslinkable natural gums with other thickeners are also within the scope of the present invention . for example , the addition of polyvinyl alcohol ( pva ) to guar gum increases the cohesive strength of the final gel , and decreases its cold flow . this formulation is not particularly advantageous for biomonitoring electrodes , but can be valuable in electrodes where the gel is under high compressive loads , such as in electrosurgery or in transcutaneous nerve stimulation . other thickeners which can be mixed with the crosslinkable natural gums include hydroxyethyl cellulose , and hydroxypropyl methyl cellulose . examples of other natural gums which can be mixed with the crosslinkable natural gums of the present invention include gum arabic , sodium alginate and gum tragacanth . the gels of the present invention have increased internal cohesiveness and are able to be easily removed from surfaces with which they come in contact due to their crosslinked nature . the preferred crosslinking agent is borate ion , supplied by potassium tetraborate or sodium tetraborate . borate ion reacts effectively with the preferred gums , guar gum and locust bean gum , to form stable gels . in addition compositions crosslinked with borate are acceptable for contact with human skin . the exact nature of the crosslinking of guar gum with borate ion is not well understood . a degree of ester formation between the borate anions and the hydroxyl groups of the gums is possible . the formation of coordinate bonds would also account for the observed crosslinking effect . it is noted that polysaccharides with cis - hydroxyl groups on adjacent chains , such as guar gum and locust bean gum , are those most usefully crosslinked by borate ions for purposes of this invention . that is , gels made with polysaccharides having cis - hydroxyl groups exhibit the greatest degree of crosslinking ( e . g ., the stiffest gel is produced ) for given concentrations of gum and borate . it is possible that borate ion reacts with polysaccharides containing cis - hydroxyl groups to form bridges between adjacent cis - polyhydroxy moieties on different polymeric molecules . other crosslinking agents useful in the gels of the present invention include salts , such as ferric chloride , calcium chloride and the acetates of the multivalent cations of lead , chromium or nickel . those skilled in the art will recognize that by careful manipulation of reaction conditions , e . g ., temperature , ph , agitation , time of reaction , etc ., a degree of crosslinking can be achieved in the gel without the use of these crosslinking agents . such crosslinking can be detected by viscosity changes or by gel formations . however , the difficulty in preparing a stable medically - acceptable gel makes the above means of crosslinking less desirable than the borate - guar system . the preferred embodiment of the present invention includes within the crosslinked gum , any salt suitable to act as a conductor for the passage of electric current from an electrode to the body of a patient . however , crosslinked gums containing no salt are also contemplated since the gels of the present invention are aqueous in major portions and can conduct a current when subjected to high voltages . the preferred salts are chlorides , particularly those of sodium or potassium , since these are the most compatible with the normal electrolytes within the body . the chlorides are particularly preferred for use with the very sensitive ag / agcl ( silver / silver chloride ) electrodes , as they take part in the cell reaction and contribute to the proper functioning of the electrode . as previously mentioned the ag / agcl electrodes are particularly well suited for measuring minute electrical bio - events . the electrolyte concentration is important as it affects both current carrying capacity and skin irritation . for monitoring purposes , where electrodes may be worn for days at a time , it is desirable to keep the salt concentration below about 3 %. higher salt concentrations become irritating to the skin when in contact for prolonged periods and may cause serious lesions in the most severe cases . for short - term use as in cardiac stress testing , electrotherapy or electrosurgery , where the total contact time may be less than one hour , much higher salt concentrations can be used . the low electrical resistance necessary for the above - mentioned uses can only be exhibited by gels with high concentrations of electrolyte . a surprising feature of the crosslinked gels of the present invention are their stability even in the presence of saturated sodium chloride , approximately 25 percent by weight . thus , the present invention provides a gel which is stable in the presence of essentially any salt concentration desired . electrode storage time is another factor in the determination of electrolyte type and concentration . lower salt concentrations are preferred when electrodes are to be stored a long time between manufacture and use . salt solutions of sodium chloride and potassium chloride are corrosive to ferrous metals , with the result that gels high in concentrations of these salts may corrode the electrodes when in contact with the electrodes over a sufficiently long period of time . where storage periods are long and higher salt concentrations are desired , salts less corrosive than sodium chloride or potassium chloride , such as sodium citrate , should be used . the choice of electrolyte is also affected by electrode composition . where electrodes made of aluminum , stainless steel or german silver ( a silver - white alloy of copper , zinc and nickel ) are employed for biomonitoring purposes spurious signals or electrical noise are commonly experienced . such signals are thought to be generated by chemical reactions taking place between the electrode and corrosive conductive salts , such as sodium chloride . potassium citrate can be substituted for more corrosive salts , in order to reduce electrical noise . another aspect of the present invention may include the presence of humectants , plasticizers , and wetting agents in the crosslinked gel . humectants increase the ability of the gel to resist drying out when exposed to the atmosphere or to conditions of low humidity . plasticizers add smoothness and increased pliability to the gel . wetting agents permit the gel powder to disperse in water in a homogeneous and lump - free manner . 1 , 3 - butylene glycol , tetrahydrofurfuryl alcohol and dipropylene glycol are known plasticizers and humectants . diethylene glycol and glycerol have been commonly utilized as humectants . however , glycerol competes with guar gum for borate , and can interfere with proper gel formation by inhibiting crosslinking if present in sufficient quantity . propylene glycol can function in the gels of the present invention as a humectant , a plasticizer and a wetting agent for guar gum powder during manufacture . the gels of the present invention may also contain preservatives to prevent bacterial growth during storage and use . the parabens , e . g ., methyl and propyl - p - hydroxy - benzoates , are well - accepted preservatives for use in medicinal preparations . preferred components and concentrations for the gels of the present invention follow . all percentages are given in percents by weight . ______________________________________component percent by weight______________________________________guar gum ( sold by the stein hall 1 to 5 % co . under the trademarkjaguar ® hp - 11 ) nacl 0 . 8 to 25 % potassium tetraborate 0 . 05 to 3 . 0 %( k . sub . 2 b . sub . 4 o . sub . 7 . 5h . sub . 2 o ) propylene glycol 5 to 50 % propyl - p - hydroxy benzoate 0 . 01 to 0 . 05 %( propylparaben ) methyl - p - hydroxybenzoate 0 . 01 to 0 . 9 %( methylparaben ) water to 100 % ______________________________________ raising the amount of guar gum increases the viscosity of the gel , and conversely lowering the amount of guar gum decreases the viscosity of the gel . raising the chloride ion concentration increases the electrical conductivity of the gel and decreases the gel - skin impedance , and conversely lowering the chloride ion concentration decreases the electrical conductivity of the gel and increases gel - skin impedance . raising the borate ion concentration increases the degree of crosslinking and the stiffness of the gel , and conversely lowering the borate ion concentration decreases the degree of crosslinking and thus the stiffness of the gel . raising the amount of propylene glycol , a humectant , increases the ability of the gel to resist drying out . an especially preferred composition for use in the practice of the present invention , particularly with a biomonitoring electrode , is the following : ______________________________________component percent by weight______________________________________guar gum ( hp - 11 , stein hall & amp ; co .) 2 . 0nacl 2 . 4propylene glycol 15 . 0methyl - p - hydroxy benzoate 0 . 1propyl - p - hydroxy benzoate 0 . 02potassium tetraborate 0 . 57water to 100______________________________________ this composition has excellent electrical properties in addition to a useful combination of physical properties . the gel makes good contact with both skin and electrode , is stable with regard to moisture loss ( a major factor affecting shelf - life and useful life on patient ), and possesses excellent cohesive strength . the following examples further illustrate the present invention . in these examples , all parts and percents are by weight , unless otherwise indicated . approximately 300 ml of distilled water is heated in a 600 ml beaker to a temperature of 60 °- 75 ° c . and 9 . 9 gm of sodium chloride is added to the heated water with stirring until dissolved . in a separate vessel , 0 . 16 gm of propyl - p - hydroxy benzoate and 0 . 8 gm of methyl - p - hydroxy benzoate are mixed well with 80 . 0 gm of propylene glycol until dissolved . to this mixture 6 . 4 gm of guar gum powder ( commercially available as jaguar ® hp - 11 from the stein hall co .) is added slowly with constant stirring until homogeneously dispersed . the dispersion of guar gum in paraben / propylene glycol solution is added slowly to the aqueous sodium chloride solution with vigorous stirring , e . g ., with a high shear mixer ( homo - mixer commercially available from gifford wood , inc ., hudson , n . y .). vigorous mixing is continued and the temperature is maintained at about 60 °- 75 ° c . until the mixture is smooth and the guar gum is completely dissolved ( about 10 - 20 minutes ). the resultant mixture is a homogenous , viscous solution . the heat source is removed and vigorous mixing is continued while 20 ml of a 10 % w / v solution of potassium tetraborate is slowly added . the stirring is discontinued and the mixture is allowed to cool to room temperature . following the procedure of example 1 gels were prepared having the following compositions : ______________________________________ amount amount potassium amountexample gum tetraborate nacl / kcl * number gum (% by wt .) (% by wt .) (% by wt . ) ______________________________________2 guar 1 . 6 0 . 5 2 . 4 ( jaguar ® cmhp ) 3 guar 1 . 6 0 . 5 2 . 4 ( jaguar ® c - 13 ) 4 locust bean 1 . 6 0 . 375 2 . 45 guar 1 . 6 0 . 583 2 . 4 ( jaguar ® hp - 11 ) 6 guar 1 . 6 0 . 5 30 . 0 * ( jaguar ® c - 13 ) 7 guar 1 . 6 0 . 5 30 . 0 * ( jaguar hp - 11 ) ______________________________________ examples 6 and 7 illustrate that a gel can be made according to the present invention which can accomodate high salt concentrations . approximately 300 ml of distilled water is heated in a 600 ml beaker to a temperature of 60 °- 75 ° c . 9 . 9 gm of sodium chloride , 0 . 16 gm of propyl - p - hydroxy benzoate and 6 . 4 gm of guar gum powder ( commercially available as jaguar ® a2s from the stein hall co .) are added to the water and the mixture is stirred vigorously , e . g ., with a homo - mixer , until a homogeneous mixture is obtained ( 15 - 20 minutes ). the heat source is removed and , using moderate stirring ( e . g ., with a propeller - type stirrer ), a 10 % w / v solution of potassium tetraborate , and propylene glycol are slowly added in alternate aliquots over a period of about 5 - 10 minutes as follows : 1 . 2 - 5 ml 10 % w / v solution of potassium tetraborate ( until gelation starts ). thereafter 2 ml aliquots of the 10 % potassium tetraborate solution are alternated with 10 gm aliquots of propylene glycol until a total of 20 ml of the potassium tetraborate solution and 80 gms of propylene glycol have been added . upon cooling , a gel of this invention is obtained . following the procedure of example 8 a gel was prepared having the following composition : ______________________________________ amount potassium amountexample amount gum tetraborate naclnumber gum (% by wt .) (% by wt .) (% by wt . ) ______________________________________9 guar 1 . 6 0 . 25 2 . 4 ( jaguar ® a - 40 -( f )) ______________________________________ the following table ( table i ) is a list of the physical properties of the gels of examples ( 1 - 9 ). table i__________________________________________________________________________ electrical amount amount ph of resistivity viscosity ( poise ) example gum potassium crosslinked ohm - cm nacl / kcl * at shear ratenumbergum (% by wt .) tetraborate gel at 10 khz (% by wt .) 0 . 025 / sec . 0 . 1 / sec . __________________________________________________________________________1 guar ( hp - 11 ) 1 . 6 0 . 50 7 . 66 42 . 8 2 . 4 11 . 8 × 10 . sup . 3 5 . 2 × 10 . sup . 32 guar ( cmhp ) 1 . 6 0 . 50 7 . 70 44 . 0 2 . 4 12 . 0 × 10 . sup . 3 5 . 5 × 10 . sup . 33 guar ( c - 13 ) 1 . 6 0 . 50 7 . 66 43 . 7 2 . 4 20 . 0 × 10 . sup . 3 9 . 6 × 10 . sup . 34 locust bean 1 . 6 0 . 375 7 . 65 42 . 8 2 . 4 20 . 0 × 10 . sup . 3 -- 5 guar ( hp - 11 ) 1 . 6 0 . 583 7 . 6 18 . 4 6 . 4 9 . 2 × 10 . sup . 3 -- 6 guar ( c - 13 ) 1 . 6 0 . 5 7 . 6 6 . 8 30 . 0 * -- -- 7 guar ( hp - 11 ) 1 . 6 0 . 5 7 . 8 5 . 4 30 . 0 * -- -- 8 guar ( a2s ) 1 . 6 0 . 50 7 . 35 41 . 5 2 . 4 2 . 0 × 10 . sup . 3 1 . 7 × 10 . sup . 39 guar ( a40f ) 1 . 6 0 . 25 7 . 60 43 . 8 2 . 4 11 . 7 × 10 . sup . 3 8 . 3 × 10 . sup . 3__________________________________________________________________________ the viscosities of the gels of examples 6 and 7 were not measured since these gels were prepared to show high salt concentration capability . electrical resistivity was measured using a plastic cell of approximately 3 c . c . volume . the cell consisted of two circular platinized platinum electrodes approximately 0 . 7 cm in diameter , which faced each other and were approximately 0 . 8 cm . apart . the cell constant ( k cell ) was calculated according to known experimental technique ( see american society of testing materials standards , report number d202 - 77 , part 39 , section 48 , pp . 73 , 1978 annual ) and found to be equal to 1 . 39 at 10 khz ( sinusoidal signal ). resistivity measurements were taken at 10 khz ( sinusoidal signal ) using a hewlett packard model 4800 a vector impedance meter . a 10 khz frequency was chosen to minimize electrode polarization effects . the cell was filled with the appropriate gel and its measured resistance ( rm ) was obtained . resistivity ( ρ ) is given in ohm - cm by the equation all viscosity measurements were made using a mechanical spectrometer ( model rms - 7200 made by rheometrics , inc .) and according to the instrument instruction manual , using a 72 mm diameter cone and plate , a 0 . 04 radian angle and a 0 . 05 mm gap . all measurements were made at room temperature ( 18 25 ° c .). a 1 . 6 % by weight solution of jaguar ® hp - 11 in distilled water was prepared . to a 40 c . c . sample of the guar gum solution approximately 1 c . c . of a 10 % by weight solution of fecl 3 in water was added with stirring . to this a concentrated solution of potassium hydroxide was added dropwise and the ph of the mixture was monitored . when the ph rose to an alkaline ph of about 11 . 2 , from a starting ph of about 2 . 25 , a crosslinked , cohesive , non - sticky gel was obtained . a 1 . 6 % by weight solution of jaguar ® cmhp in distilled water was prepared . to a 20 gm sample of the guar gum solution , 15 drops of a 10 % by weight solution of chromium acetate was added with stirring . a concentrated solution of potassium hydroxide was then added dropwise to the mixture with stirring and the ph was monitored . at an alkaline ph of above about 9 , an excellent crosslinked gel of the present invention was obtained . subsequently 20 drops of a saturated solution of potassium chloride was mixed with the gel . the gel remained crosslinked , cohesive and non - sticky .

a cohesive nonsticky electrically conductive gel is disclosed , for facilitating low resistance contact between a metal electrode and a biological body . the gel comprises an aqueous solution of up to saturated concentrations of ionized salts as the conducting agent , a natural gum capable of crosslinking , and a crosslinking material which provides the electrically conductive gel with sufficient internal strength to remain cohesive without reinforcement . the gel has good electrical characteristics and improved physical properties which prevent the gel from leaving a messy residue on the skin of the patient or on the electrode .

with reference now to the drawings and in particular to fig1 a log rolling apparatus incorporating the principles and concepts of the present invention and generally designated by the reference numeral 10 will be discussed in detail . specifically , fig1 shows the log rolling apparatus 10 as including a body member 12 having a topmost curved surface 14 extending over a substantial portion of the body member , and further including a depression or well 16 formed therein as an integral part thereof . further illustrated is the use of a sheet of canvas 18 , or other flexible material , which is comformingly positioned in an overlying relationship across the body member 12 including the topmost curved surface 14 and the well 16 . in this respect , the canvas 18 is fixedly secured to opposed ends 20 , 22 of the body member 12 through the use of respective attachment means 24 , 26 . the attachment means 24 , 26 are of a conventional construction and are designed to operate in a manner which permits the canvas sheet 18 to be adjusted in length , whereby the amount of canvas overlying the body member 12 can be controlled as desired . viewing fig1 and 2 together , it can be seen that the log rolling apparatus 10 further includes a rotation member 28 which is formed from a pair of first pivot arms 30 , 32 pivotally attached to opposed sides 34 , 36 , respectively , of the body member 12 and second pivot arms 38 , 40 respectively pivotally attached to the pivot arms 30 , 32 . additionally , the second pivot arms 38 , 40 are connected together through the use of a handle member 42 in the manner illustrated in fig2 . in this connection , it can be seen that the first pivot arms 30 , 32 respectively pivot about pivot points 44 , 46 , while the second pivot arms 38 , 40 are respectively pivotally attached to the first pivot arms at pivot points 48 , 50 . as is further evident with reference to fig1 - 3 , the rotation member 28 also includes a roller 52 which is normally positionable on a flat support surface 54 formed as a part of the body member 12 and which is rotatably attached between the second pivot arms 38 , 40 in the manner most clearly illustrated in fig2 . in this connection , the roller 52 is rotatably positioned on a roller shaft 56 fixedly secured to the second pivot arms 38 , 40 , while spring 57 is provided which is attached between the body member 12 and the pivotable arm 30 so as to facilitate a return of the rotation member 28 to the position shown in fig1 . as can be further ascertained with reference to fig1 - 3 , the roller 52 is positioned on the log rolling apparatus 10 in a manner whereby it lies between the canvas 18 fixedly secured to the body member 12 and the uppermost surface of the body member 12 per se , to include the topmost curved surface 14 as well as the surface associated with the well 16 . also , clearly shown in fig2 and 3 is the fact that the canvas 18 extends substantially across the entire transverse width of the body member 12 so as to essentially entirely cover the roller 52 , the well 16 and the topmost curved surface 14 . fig4 has been provided to illustrate a second slightly modified embodiment of the present invention which differs only in the structural form of the body member 58 . in this respect , the body member 58 functions in the same manner as the body member 12 illustrated in the embodiment of fig1 with the exception that the topmost curved surface 14 of the fig1 embodiment has been replaced by a topmost flat surface 60 . to support this configuration , the well 62 has a first side portion 64 which is of a substantially greater length than a second side portion 66 associated with the other side of the well . this construction differs to some degree from the construction of fig1 and accordingly , the embodiment of fig4 can be operated by a user with somewhat less movement than that required by the first embodiment above described . as can be appreciated , the other elements associated with the log rolling apparatus 10 illustrated in fig4 are essentially the same as those disclosed in the embodiment of fig1 including a roller 52 positioned on a flat surface 54 and located between a canvas 18 fixedly secured to respective ends 20 , 22 of the body member 58 . further , a rotation member 28 is provided which includes the use of the same first pivot arms 30 , 32 , as well as second pivot arms 38 , 40 . as such , the embodiments of fig1 and 4 are closely related in structure and are functionally operable in the exact same manner . with respect to the operation of the present invention and with reference to fig1 it can be seen that the log rolling apparatus should initially be provided with the rotation member 28 in the position illustrated , wherein the roller 52 is resting between the canvas 18 and the flat support surface 54 . a user may then position a sheet of material 68 , which typically might consist of a sheet of newspaper or the like , in the manner illustrated whereby the sheet 68 partially extends into the well portion 16 , as well as overlying a portion of the topmost curved surface 14 . as desired then , any type of flammable material 70 may be positioned in the well 16 so that the same fills a substantial portion of the well and partially overlies the sheet 68 . at this point of the operation then , a user need only to grip the rotation member 28 , preferably by the handle 42 , and then rotate the same about the pivot point 44 in the manner indicated in phantom lines in fig1 . specifically , it can be seen that a movement of the rotation member 28 to a first intermediate position 72 , as shown in phantom lines , results in a rolling up of the sheet of material 68 due to the cross surface translational movement of the canvas 18 caused by the securing of the canvas to the body member 12 through use of attachment means 24 . at this point , it can be appreciated that the roller 52 facilitates the movement of the rotation member 28 in the manner described since canvas portion 74 , also indicated in phantom lines , increases in length during the rotational movement of the member 28 , such increase in length being afforded by the canvas slidably rolling across the roller 52 . as such , the canvas portions 76 and 78 lying proximate to the sheet material 68 move in opposite directions relative to one another so as to afford a rolling effect on the sheet . as can be further appreciated with reference to fig1 the rolling of the sheet 68 into a cylindrical shape results in the flammable material 70 becoming permanently captured therein whereby a log 80 is created which is suitable for burning in a fireplace or the like . by the same token , it should noted that the multi - link construction of the arms of the rotation member 28 permits the distance between the shaft 56 , which is the axis of rotation of the roller 52 , and the arm pivot points 44 , 46 to vary so as to accommodate the rolling movement of the roller over the surface 14 of the body member 12 . in this respect , the multi - link construction permits the arm lengths to vary so that it is not necessary to construct the body member surface 14 in a perfectly circular shape , which would otherwise be required if the arm lengths were not variable . once the rotation member 28 as been rotated about the pivot point 44 to the position 82 , also illustrated in phantom lines , it can be seen that the rolling operation has been completed so that the log 80 may be removed from the log rolling apparatus 10 . the return spring 57 will then operate to assist the user in returning the rotation member 28 to the &# 34 ; at rest &# 34 ; position shown in fig1 whereby a new sheet of material 68 may be inserted in the well 16 preparatory to making another log 80 . of course , the embodiment of fig4 operates in essentially the same manner as that above described with reference to the embodiment of fig1 . in this regard , it can be seen that a rotation of the member 28 about the embodiment of fig4 will create a similar log 80 once the member has been moved to the phantom position 84 , and a continued rotation thereof will result in the log being positioned ready for removal on the topmost flat surface 60 . with respect to the above embodiments described , it can be understood that the optimum dimensional relationships for the parts of the invention are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the invention , subject only to limitations specifically appearing in the claims . in this connection , the types of materials as well as the structural configurations of the parts may take many different forms . for example , the present invention could be utilized to roll exclusively sheets of material into logs , such as logs which are constructed entirely of newspaper , while the flammable material 70 positionable within sheets 68 of newspapers or the like , might be wood chips , corn fodder , leaves , etc . further , it can be appreciated that the sheets 68 might be formed from materials other than newspapers , such as cloth , plastics , etc . the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .

a log rolling apparatus includes a body having a depression or well positioned therein and a large sheet of canvas or similar flexible material positioned over the body and the well . the canvas is fixedly attached to respective ends of the body and a dual link pivotal member is provided to which is attached a roller movable between the body and the canvas . sheets of flammable material and optionally other burnable material , such as leaves or the like , may be placed within the well over the top surface of the canvas , and the pivotal member may then be rotated about the body in a manner which causes the canvas to attempt to follow the roller attached to the member , thus causing the top surface of the canvas to slide against itself so as to roll up the flammable sheet material into a log shape with the leaves , if used , enclosed by the sheet material .

the terms , “ muzzle ”, “ headgear ” and “ helmet ” may all be used interchangeably to describe this invention . the term “ clamshell ” halves or portions , refers to a pair of complementary shapes , each generally defining a concavity and having a periphery that is complementary to the other “ clamshell ” half or portion . “ complementary ” in this regard includes a straight or planar periphery as well and one marked by alignment or indexing features such as teeth or pins and receiving sockets or other detentes that are used to ensure proper alignment of the clamshell halves when closed . the need for these depends in part on the rigidity of the hinge . although the surface of a marine clamshell may be continuous , surface continuity is not required of the headgear disclosed herein . the shape surfaces may be continuous except for suitable holes or orifices defined therein as explained herein ; or they may be discontinuous , such as one made of strips of material to form a loose mesh - like structure . “ pets ” refers generally to a domesticated or tamed animal kept for companionship or pleasure and treated with care and affection . dogs and cats are the most common , but certainly not the only , types of “ pets ” amenable to this invention . primates , pigs , goats , sheep , birds , lemurs , ferrets and other types of animals have also been reported as pets , and this list is still not exhaustive . although the description may refer to the more typical pets , it will be understood that the invention is broadly applicable to any animal , domesticated or not , that has a head and mouth . “ handlers ” refers to anyone who is responsible for moving , transporting , or manipulating the pet in any way . this explicitly includes owners and family members of owners ; caregivers such as veterinarians , veterinary dentists , groomers , trainers , instructors , kennel operators , zoo personnel , etc . ; and implicitly includes any other party meeting the general definition . referring to fig3 , the head or nose of an animal is referred to anatomically as the anterior end and the tail is referred to as the posterior ( sometimes caudal ) end . in organisms , that have distinct heads ( such as cats , dogs , birds , primates , and most other vertebrates ) the anterior end is sometimes referred to as the rostral or cranial end . while “ anterior ”/“ posterior ” has broader applicability for all animals , applicant prefers rostral ( for nose or beak ) and caudal ( tail ) as directional terms . this is consistent with nomina anatomica veterinaria , and with common usage in veterinary medicine . moreover , given that the invention relates to headgear , cranial might be confusing . of course , dorsal / ventral , medial / lateral , proximate / distal and other anatomical terms may also be used in the description . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are described herein . all references cited herein , including books , journal articles , published u . s . or foreign patent applications , issued u . s . or foreign patents , and any other references , are each incorporated by reference in their entireties , including all data , tables , figures , and text presented in the cited references . numerical ranges , measurements and parameters used to characterize the invention — for example , angular degrees , quantities of ingredients , polymer molecular weights , reaction conditions ( ph , temperatures , charge levels , etc . ), physical dimensions and so forth — are necessarily approximations ; and , while reported as precisely as possible , they inherently contain imprecision derived from their respective measurements . consequently , all numbers expressing ranges of magnitudes as used in the specification and claims are to be understood as being modified in all instances by the term “ about .” all numerical ranges are understood to include all possible incremental sub - ranges within the outer boundaries of the range . thus , a range of 30 to 90 units discloses , for example , 35 to 50 units , 45 to 85 units , and 40 to 80 units , etc . unless otherwise defined , percentages are wt / wt %. referring first to fig1 a - 1c and fig4 , one embodiment of the headgear 10 is illustrated showing the “ clamshell ” nature of the head gear 10 , having two portions 10 a and 10 b , joined at a hinge area 12 . throughout this description a reference numeral , ( e . g . 6 ) may have a suffix “ a ” ( e . g . 6 a ) for a right - side part , and a suffix “ b ” ( e . g . 6 b ) for a corresponding or complementary left - side part , relative to the animal . fig1 a shows only the right half portion 10 a in top and bottom views ; while fig1 b shows only the right half portion 10 a in rostral ( front ) and caudal ( rear ) views . each of the half portions 10 a and 10 b define a periphery 11 a , 11 b that is complementary to periphery of the other side , and are cup - like or arcuate defining a cavity 13 for enclosing a spherical - like head . at a caudal area 19 of the periphery 11 ( near the hinge area 12 in this embodiment ), each of the half portions 10 a and 10 b also define semicircular recesses 14 a and 14 b that together form a generally circular opening to accommodate the neck of the animal . at the apex of a rostral end 21 , there may be one or more openings 17 to admit air and or light to the interior cavity 13 . the embodiment of the headgear 10 illustrated in fig1 a to 1c may be solid , but preferably transparent . near the rostral end 21 of the clamshell headgear 10 is a fastening mechanism such as latch 16 , which typically comprises a first portion 16 a on half 10 a , and a complementary portion 16 b located on half 10 b . the fastening mechanism may comprise one or more latches that hold the headgear closed securely about the head . generally at least one latch is in a rostral area opposing the hinge area . as shown in fig1 e to 1g in particular , the latch 16 is generally opposite from the hinge 12 . alternative locations for fastening mechanisms that may still oppose the hinge area include the ventral neck area below the jaw and / or forehead area near the eyes . other fastening mechanisms are described below . a pleasant sensory zone ( psz ) 40 may optionally be incorporated at or near the rostral end 21 of the headgear 10 . these also are described below . also shown in this embodiment in fig4 is a ring 18 or other attachment point for a leash . the ring 18 may appear on one or both halves 10 a , 10 b of the clamshell headgear 10 . referring now to fig1 d to 1g , an embodiment is illustrated wherein the device may be solid and not transparent , but includes orifices 20 a , 20 b for ears , orifices 22 a , 22 b for eyes , and orifice 17 or slots 24 a , 24 b for mouth / nose or other ventilation . in this way the pet can see externally . in other variations , the slots may also be replaced with a single extended opening ( as shown in fig5 a ) so that the handler can better see into the pet &# 39 ; s mouth . the ear orifices 20 also permit the headgear 10 to be smaller and lighter and fit closely to the head of the animal for a more secure , tighter fit . especially in closely - fitted headgear , it may be desirable to provide cushioning or padding 26 a , 26 b in areas of the device that might rub on parts of the animal &# 39 ; s head , causing irritation . headgear that closely fits the head will have skull - following contours either molded into the device or as a result of selective padding in the interior of the headgear . a second embodiment is illustrated in fig2 a to 2c . in this embodiment , the headgear 30 is composed of two halves 30 a , 30 b fabricated as a loose mesh material of criss - crossing bands that also allow for visibility and breathing . higher strength , thicker sagittal bands 52 a and 52 b form the periphery of each clamshell half along a mid - sagittal plane . similar wider or reinforced coronal bands 52 a , and 54 b may be used in a coronal plane to provide a more rigid clamshell shape . the remainder of the headgear 30 is formed of either solid material like front wall 60 , or the intermediate bands 56 that form a loose mesh or a combination of these . the headgear 30 includes a hinge area 32 , typically at a caudal end 39 opposing the rostral end 41 , and semicircular recesses 34 a , 34 b that form the neck opening . in some embodiments , headgear 30 may include fenestrations , openings , or orifices 41 a , 41 b for ears , orifices 42 a , 42 b for eyes , and orifices for mouth as well ( not shown in fig2 a - 2c ). however , unless otherwise indicated , both the solid headgear 10 and the mesh or open headgear 30 may have similar features and advantages and will be described together . the clamshell half portions may be sized in various dimensions to define a cavity 13 and orifices that accommodate the varied nose size and head shapes of pets of different genus , species , or breeds . for example a large size cup is required to encase breeds such as great danes , newfoundlands or st . bernards ; while much smaller cup portions are required for smaller breeds such as chihuahuas , shih - tzus , and many ‘ miniature ’ breeds . a special version may be devised for pugs , as they have almost no rostral protrusion . similarly , cats and pets of other species will require headgear halves proportioned for their respective noses . fig5 - 6 further illustrate embodiments for different species . referring to fig1 and 4 , the clamshell headgear comprises two half - shell portions that are hinged or fastened together . the hinge area 32 may be reinforced with thicker or wider sections as best shown in fig2 a and 2b . the hinge may comprise a “ living ” hinge as is well known in the injection molding arts , and the halves can easily be molded as one unit . alternatively the hinge may be fabric , as shown in fig1 g , or other material . in some embodiments , the hinge may be located rostrally . these embodiments are generally positioned on the pet &# 39 ; s head from and anterior perspective . embodiments that have a hinge along a top or superior aspect of the head gear are generally put on from a superior approach ; embodiments that have a hinge along a lower or inferior aspect of the head gear are generally put on from below , using an inferior approach ; and embodiments that have a hinge along a lateral aspect of the head gear would be put on using a right or left lateral approach . in a more preferred variation , the hinge is located at a caudal part of the headgear , allowing an approach posteriorly . as noted , this is advantageous in that the pet will not see the device approaching and will not enter the anxiety and resistance modes so quickly . at the aspect of the clamshell headgear opposing the hinge is a fastener or latch mechanism . the fastener or latch may comprise any type of device suited for securing the two clamshell halves together about the pet &# 39 ; s head . illustrative types of fasteners include buckles ( e . g . quick release , side release , and conventional ), snaps , hook - and - loop fasteners ( such as velcro ™ brand ), resilient clips or tabs with detents that may insert under opposing clips , tabs or slots , or other securing mechanism may be used to secure the two halves together . as best shown in fig2 c near the rostral end 41 , the sagittal band area may be reinforced with thicker or wider band sections or a solid portion to accommodate a fastening mechanism . alternatively , the latch may be located at a rostral end or simply at the ventral side of the neck , relying on the size of the neck relative to the base of the skull to secure the device . while right and left halves that part along a sagittal plane are depicted in fig1 and 2 , it will be understood that the halves may also part along a transverse plane , producing top and bottom halves instead of right and left halves . in the case of transverse plane top and bottom halves , the hinge and fastener are located on opposite lateral sides of the headgear , and the headgear is brought near to the animal &# 39 ; s head from the side containing the hinge . fig5 a and 5b show an alternative embodiments of the headgear 110 , 210 in a closed position about the head h of an animal such as a cat . the hinge area 112 lies at a caudal position . in the embodiment of fig5 a , and there are openings 120 , 122 and 124 to allow access to the animal &# 39 ; s ears , eyes and nose / mouth , respectively . these openings allow a handler access for examining , treating , feeding , dosing medication or other necessary activity associated with the ears , eyes and nose / mouth of the animal . recess 14 a is shown for the animal &# 39 ; s neck . in phantom , a variation is shown having an elongated neck or collar portion 128 if there is a need or desire to restrict flexion of the neck . latch 116 is shown along the ventral side of the neck , although it could alternatively be anywhere under the chin area up to the rostral tip . a psz 40 for taste or smell sensations may be located between the eye opening 120 and the nose / mouth opening 124 at the rostral end . the openings 122 , 124 over the eyes and nose / mouth may be completely open , or they may have solid inserts ( not shown ) with air perforations for breathing and / or made of transparent material for sight , or opaque material if the animal tends to be calmed by less visual stimulation . in the embodiment of fig5 b , the headgear 210 is of a mesh construction similar to the embodiment of fig2 a - 2c , and having recesses 234 to define a neck opening , a fastening latch mechanism 216 , and web or band members such as 256 . a psz may or may not be present . although the animal shown in fig5 a and 5b is a cat , this same type of headgear could also be used on a dog or other animal , with only minimal modifications to size the headgear to closely fit the animals head ; for example elongating the headgear in a caudal - rostral dimension for a dog having a longer jaw and nose area , or adjusting the locations of ear and / or eye openings to be suitable for the dog or other animal . fig6 illustrates another embodiment of the headgear 310 in a closed position about the head h of a dog . the halves of the clamshell are again hinged at a caudal location 312 . the neck or collar portion 328 is shown in a moderately extended position , but may extend even further if desired to minimize or prevent neck flexion as shown in phantom . there is little coronal aspect to this embodiment . the head and eyes are relatively free . however , there is a rostral portion 330 that is fairly lengthened in order to prevent bites . latch 316 and leash attachment 318 are also shown in this embodiment . in some embodiments , the headgear device can act as a base for attachment of novelty headgear such as reindeer ears , bunny ears , baseball caps , sun shades , rain gear , etc . it can also act as an attachment point for halloween type masks and costumes . in some cases , the headgear , with or without other attachments can help promote wound healing by restricting the animal &# 39 ; s ability to lick or bite at the wounded area . in this sense , it can act like the well - known “ elizabethan collar ” restraints but is infinitely more comfortable and tolerable than the traditional cone of shame collars in present use . in use , the headgear is easily placed about the pet &# 39 ; s head and secured . in psz embodiments , the psz may be preloaded with an appropriate stimulus for the particular pet as discussed above . alternatively , the headgear may be fitted first , and the stimulus is loaded into the headgear in situ . the location of the hinge generally dictates the direction of approach to the pet . since the fastener is on an opposite side as the hinge , the clamshell opening is with the latch and that side must be brought towards the pet first . this is why the caudal hinge location is a preferred embodiment — it allows the handler to fit the headgear posteriorly , from behind the pet . the handler then biases or presses the clamshell halves closed about the head . for sagittal plane ( right and left halves ) the bias is towards a medial direction to the mid - sagittal plane ; while for coronal plane embodiments , the bias is from a ventral and dorsal extreme toward the midline . the biasing force is easily delivered by the handler &# 39 ; s hands . another advantage of the caudal hinge embodiment is that the hands and arms of the handler doing the biasing remain behind the animal , relatively safe from bites or scratches . once closed , the fastener of the headgear is secured , clamping the two halves together . the device allows restraint for such procedures as examination , venipuncture , pedicures , bathing , and grooming . in other uses , the device is useful for socializing and training an animal . in some situations , and aggressor animal may need to be restrained to prevent it from harming another anima . thus the invention includes a method to mitigate injury from interspecific and intraspecific interactions such as aggression between two dogs or two cats , or a cat and a dog . this can allow training and socialization in situations in which the aggressor could not be trusted with the non aggressor , or to prevent escalation of aggression between animals . a leading cause of death for dogs under the age of 3 is due to poor socialization which results in fear and associated aggression . a critical socialization period for dogs is between 3 weeks and 3 months of age . animals not well socialized during this time can become more fearful and aggressive when they encounter new dogs , new people , unfamiliar situations that interfere with appropriate socialization later . the headgear can protect people and other animals during these interactions so that the animal can learn appropriate behavior . it can also mitigate dangerous behavior and allow the animal to coexist . the clamshell headgear material will be lightweight , durable , and somewhat flexible . it will also need to be fairly strong and tactile so that the handler has no issues manipulating or maneuvering the animal . a couple of potential materials are mesh wire coated in plastic , or a synthetic plastic that would be injection molded . an animal will react negatively towards the headgear if it is any way uncomfortable for them , so , along with custom sizing , this design is made from a lightweight material so it is almost weightless for the animal wearing it . color : the color of this product can vary greatly . there will be different options for purchase such as a deluxe model and a standard model . in the deluxe model there could be any color produced and for the standard they may only be a few colors offered . not every animal will have the same size or shape of the head . the “ clamshell ” headgear will come in a variety of sizes and offer a superior fit than any other product on the market . this custom sizing ensures that the headgear will not be removed during use and will be comfortable for the animal . in some embodiments , inside of the headgear there is optionally another layer of security and comfort added . a soft wrap or padding may be employed in animals needing only limited restriction . by utilizing technology similar to that of an air cast one can reproduce a “ hug ” effect on the animal . this serves to reduce stress and calms the animal , making the restraint more acceptable , which is important for fractious animals and reduces the need for repeated sedations . the headgear preferably has openings for access to the ears , eyes , and the mouth . this is extremely important in veterinary and veterinary dental settings where the animal may need to have routine examinations and / or medicine applied to these areas . use of the device facilitates and aids in administration of oral treatments and medications ; dental treatment and medications ; ophthalmic treatments and medications ; and ear treatments and medications . grips : properly positioned grips are preferably built - in to the headgear to allow for safe manipulation of the animal &# 39 ; s head without risk of injury . this is especially important for medical treatment caregivers , when blood needs to be drawn from the animal . ear clamp : the implementation of an ear clamp will serve two main purposes . the first is to secure the ear during procedures and examinations , and the second is to get a pulse rate from the animal to know when dangerous levels are being approached . this is added security for the handler and the patient . plastic cover : a plastic cover or “ overshell ” that goes around the “ clamshell ” headgear will be developed as well so once the headgear is applied , the animal can be isolated within it . this case can serve as an oxygen mask and also a way of anesthetizing the patient . oral speculum : an oral speculum is another feature that could be added to the headgear . this speculum would hold the mouth open during examinations and procedures reducing the risk of a bite . fixation and venipuncture : a feature of the headgear is that it allows the head and neck area to be immobilized , particularly if the neck collar extension 128 is employed . this may be useful in treating neck injuries . in addition , with or without the collar extension , a jugular venipuncture is more easily accomplished to draw blood samples if the head and neck are immobilized through use of the headgear device . sensors & amp ; indicators : the headgear may be fitted with sensors and indicators that provide useful information about the animal &# 39 ; s biological or physiologic status . it may include lights that vary in color or number ( e . g . red , yellow , green ) to indicate dangerous or safe conditions . such sensors may also be useful in a positive reinforcement feedback loop that operates to release the pleasant stimulus in response to sensors that detect a calm and relaxed physiologic state , so as to reinforce this desired behavior . this feature is particularly useful for training purposes . as noted above , a key aspect of the invention is the pleasant sensory zone ( psz ) or module that is designed specially to appease the pet and reduce the anxiety and stress caused by strange handlers , strange environments , and foreign smells sounds and sights , and strange , unusual and sometimes uncomfortable manipulations or procedures . the psz is designed to pleasurably stimulate any of the pet &# 39 ; s senses , specifically one or more of the senses of : vision / sight , olfactory / smell , auditory / sound , taste , and tactile / touch . the psz may be incorporated as a module or portion of the headgear that facilitates the delivery of a pleasant sensory stimulus to the proper area of the pet receptors for receiving that stimulus . for example , as discussed below , pheromones or flavors might be includes in a psz near the pet &# 39 ; s nostrils at a rostral end of the headgear . similarly , a tactile psz might be included along a portion of the headgear adjacent a ventral neck or chin area or a dorsal nape of the neck area ; while an auditory stimulus would be included near the ear ( s ). a flavor port located at a rostral portion near the mouth would provide a host of benefits for the handler . this allows for easy distraction of the animal during procedures , helps habituate them to the headgear through positive reinforcement , and reduces stress . for dogs , this might include peanut butter , bacon or other treat . for cats , tuna , catnip or chicken might be preferred . this port may stimulate gustatory receptors , olfactory receptors , or both . a specific embodiment of a flavor port type of psz 40 is illustrated in cross - section in fig2 d . in the clamshell portion near the rostral aspect , the wall 60 forms an opening 62 through which a wafer or disk 64 of candy or other treat may be exposed and smelled or licked by the animal . extension wall 66 extends outwardly and around the disk or wafer 64 to form a pocket between the wall 60 and extension wall 66 . at one end or top of the pocket an extension wall may be eliminated to allow the handler to slide the wafer or disk 66 into the pocket from outside the headgear to provide the stimulus for the animal . flanges 68 of wall 60 extend beyond the limit of extension walls 66 to hold the wafer or disk 64 in the pocket so it cannot immediately be eaten by the animal . an alternative flavor port takes the form of a treat dispenser that , upon activation , dispenses a candy or other treat though an opening into the cavity 13 for the animal to eat . the pez candy dispenser loaded with animal treats is a suitable mechanism that could be used in for this type of flavor port . to help make the headgear more attractive for the animal the use of pheromones could be applied as an olfactory stimulus . by infusing the headgear with specific pheromones in a psz area near the nostrils , it will reduce the stress levels for the animal , and have a calming effect . the pet may actually learn to enjoy wearing the device , and it may in turn be used more frequently and with ease . olfactory stimuli such as pheromones could be delivered using a pocket - like structure described above having a scent infused wafer , but having a perforated barrier in wall 60 rather than a complete opening . this would allow the scent to permeate the perforated barrier while preventing the animal from eating the wafer . pleasing sounds , such as “ white noise ” generators may have a calming effect . obviously , these pszs would be located near an ear area of the headgear . miniature speakers driven by onboard integrated chips and battery power could provide this stimulus . music might be stored in the chip or preferably communicated to the chip wirelessly from a phone or tablet or computer by using , for example , bluetooth technology and paring the devices . a tactile sensation may be provided by means of finger - like protrusions that “ scratch ” the pet in key places like under the chin or the neck . another tactile stimuli might be bumps or ridges that apply pressure to key points on the animal . such pressure points may include the carotid body to perform a vagal maneuver to slow the heart rate and calm the animal . other useful pressure points are known to those versed in acupressure techniques . in some animals , it is calming to “ blind ” them visual stimuli . in such cases , an opaque cover over an eye opening may have a pleasant and calming effect as a psz . the foregoing description of the various aspects and embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive of all embodiments or to limit the invention to the specific aspects disclosed . obvious modifications or variations are possible in light of the above teachings and such modifications and variations may well fall within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally and equitably entitled .

a pet headgear comprises two halves operable in “ clamshell ” fashion to surround the head , nose and mouth of a pet , to facilitate handling of the pet in familiar or especially unfamiliar environments , such as veterinary offices , groomers , kennels or during transporting . the clamshell hinges at one end , preferably a caudal end , so it may be applied from behind the pet and the two halves biased medially to close the shell about the pet &# 39 ; s head , prior to latching the halves closed . openings may be provided for access to the pet &# 39 ; s ears , nose , teeth , and / or mouth . a pleasant sensory zone or module may be added to quiet and appease the pet and habituate them to the headgear through positive reinforcement .

the active components of the present pharmaceutical composition are present in the toothpaste vehicle in the following ranges of quantities : in the pharmaceutical compositions of the invention , the bicarbonate , fluoride , and zinc salts that can be used to provide the bicarbonate , fluoride and zinc ions are the pharmaceutically acceptable salts which are compatible with the ingredients of the toothpaste vehicle . in the pharmaceutical composition of this invention , the zinc salts that could be used to supply all or part of the zinc ion , are the chloride , citrate , acetate , lactate , salicylate , and , in general , glycerol soluble , pharmaceutically acceptable zinc salts . the preferred salt is zinc chloride . in the pharmaceutical compositions of this invention , the bicarbonates that could be used to supply all or part of the bicarbonate ion are sodium bicarbonate and potassium bicarbonate . the preferred salt is sodium bicarbonate . in the pharmaceutical composition of this invention , the fluoride salts that could be used to supply all or part of the fluoride ion are pharmaceutically acceptable fluorides such as sodium fluoride , and the like . the active components are incorporated into a suitable toothpaste vehicle containing polishing agents , thickening agents , sudsing agents , humectants , flavoring agents , and sweetening agents . these agents are standard pharmaceutical tools used in these preparations and are not an essential aspect of this invention . therefore , the amount of these additive materials used can be varied . any suitable water insoluble polishing agent can be employed in the compositions of this invention , such as , for example , dicalcium phosphate , aluminum hydroxide , calcium carbonate , calcium polymetaphosphate , dicalcium orthophosphate dihydrate , sodium polymetaphosphate and mixtures thereof . if a thickening agent is required , cellulose derivatives such as , for example , sodium carboxumethylcellulose and sodium carboxymethylhydroxyethyl cellulose or natural gums such as gum arabic or gum tragacanth may be employed . exemplary of sudsing agents which may be employed are , for example , sodium lauryl sulfate , sodium n - lauroyl sarcosinate , sulfonated monoglycerides of fatty acids having from 10 to 18 carbon atoms such as , for example , sodium monoglyceride sulfonates or mixtures thereof . among the specific compounds which may be employed as humectants are sorbitol , glycerine , polyhydric alcohols of like nature or mixtures thereof . as examples of compounds that may be used as flavoring agents are clove oil , menthol , peppermint oil , spearmint oil , wintergreen oil , sassafras oil and anise oil . sweetening agents would include compounds such as , for example , saccharin , dextrose , and sodium cyclamate . the following examples together with the accompanying drawing further serve to illustrate the pharmaceutical toothpaste compositions of this invention . a pharmaceutical toothpaste composition suitable for treatment of gingivitis is formulated from the following ingredients in two separate portions , including a flavor portion , which are then admixed to form the final composition . ______________________________________ first portion % byphase ingredient weight______________________________________a glycerine 96 % 5 . 00a carboxymethylcellulose 7mf 1 . 00b sorbitol 70 % 15 . 00c deionized water 23 . 05c zinc chloride 0 . 25c sodium benzoate 0 . 10c sodium saccharine 0 . 25c sodium fluoride 0 . 22c sodium chloride 5 . 00c srf 1 . 23c sodium bicarbonate 20 . 00d syloid b - 30 13 . 00d sicosil 63m 4 . 00e titanium dioxide # 3328 1 . 00e sorbitol 70 % 2 . 00f sorbitol 70 % 5 . 00f sodium lauryl sulfate 2 . 40f flavor 1 . 50______________________________________ the flavor portion which is a component of phase f above is composed of the following ingredients which are weighed and placed into a suitable stainless steel container fitted with a mixer . the mixer is then started and the mixing is continued until all of the menthol crystals have dissolved . ______________________________________ % byingredient weight______________________________________cinamic aldehyde 8 . 20menthol , racemic crystals 49 . 30methyl salycilate 20 . 50peppermint oil 4 . 10spearmint oil 4 . 10clove oil 13 . 80______________________________________ 1 . in an appropriate vessel equipped with adequate mixers weigh in glycerine . 4 . in another vessel , dissolve ingredients of phase c in order in deionized water . maintain heat at 50 ° to 70 ° c . for a few minutes . cool to room temperature . add to first vessel . 5 . to a kettle with vacuum draw at least 28 inches of vacuum . mix under vacuum for 5 minutes . 6 . break vacuum and add dry powders of phase d to batch one at a time under agitation . 8 . break vacuum . in a separate vessel , disperse titanium dioxide in sorbitol . add to batch under agitation . 9 . dissolve sodium lauryl sulfate , flavor , and color in sorbitol ( phase f ). add to batch . this embodiment of the pharmaceutical composition of the invention will be described with respect to a toothpaste tube or package in which the srf is separated from the other active ingredients until the time of use . fig1 is a vertical central sectional elevation of a dispensing end of a tube useful in packaging the pharmaceutical composition of the present invention . referring to fig 1 , collapsible dispensing tube 11 has a side wall 13 lined on the inside surface and a shoulder portion 15 terminating in a neck 17 onto which is pressed and held firmly in place a blending fitting 19 , preferably made of synthetic organic polymeric plastic materials , such as nylon or other suitable moldable and form - retaining polymer , preferably of the thermoplastic type . blending fitting 19 includes a longitudinally extending tubular portion 21 , the wall 22 of which is shown tapered and containing internal ribs 23 . wall 22 determines a longitudinal passageway 25 . a plurality ( usually from 2 to 6 but even single passageways may be employed ) of transverse passageways 27 , located near the joinder of the shoulder and neck portions of the tube , passes through wall 22 . the blending fitting includes an externally threaded outer portion 29 and a dispensing opening 31 , which is a continuation of passageway 25 . a sealing cap 33 may be screwed onto threaded portion 29 of the blending fitting to prevent unintentional discharge of contents from tube 11 . as is illustrated in fig1 initially a first portion of srf in a suitable vehicle at a ph of about 5 designated 35 is filled into the tube , as is fully described in u . s . pat . no . 4 , 098 , 435 , to the level or interface indicated by numeral 37 . preferably then , an &# 34 ; insulating &# 34 ; or protective intermediate layer of non - reactive material 39 is applied and then the second portion of the dentifrice , identified by numeral 41 , containing the balance of the periodontal toothpaste ingredients set forth in example 2 is filled into the tube while the tube is maintained in inverted position , as illustrated . upon application of pressure to the tube , streams of the first portion of the dentifrice containing srf pass through openings 27 into passageway 25 , forming stripes or &# 34 ; inlays &# 34 ; in the surface of the second portion of the dentifrice in such passageway . entry of the first portion into the second portion is facilitated by the presence of the &# 34 ; upstream &# 34 ; ribs 23 and a correct and uniform proportion of first dentifrice portion to second dentifrice portion is obtained . because of the location of the tranverse openings 27 , essentially all of the product can be discharged and the dispensed product is of substantially uniform composition throughout dispensing . ideally , the portion of dispensing passage 31 &# 34 ; downstream &# 34 ; ( upon dispensing ) of transverse openings 27 will be as short as is feasible so as to minimize contacting of any reactive portions of the dentifrice with each other during storage for any appreciable time between uses . the material of construction of the tube is preferably a conventional polymeric plastic with polymeric plastic cap and blending fitting . the dentifrice and the different portions thereof , the various compositions of which will be described later , will normally be extrudable through the dispensing opening . the number of openings through the dispensing passageway walls will be chosen to regulate the desired proportions of the dentifrices to be discharged . the formulation of the toothpaste of example 2 is as set forth below . ______________________________________ % byphase ingredient weight______________________________________a glycerine 96 % 5 . 00a cmc 7mf 1 . 00b sorbitol 70 % 15 . 00c deionized water 24 . 28c zinc chloride 0 . 25c sodium benzoate 0 . 10c sodium saccharine 0 . 25c sodium fluoride 0 . 22c sodium chloride 5 . 00c sodium bicarbonate 20 . 00d syloid b - 30 13 . 00d sicosil 63m 4 . 00e titanium dioxide # 3328 1 . 00e sorbitol 70 % 2 . 00f sorbitol 70 % 5 . 00f sodium lauryl sulfate 2 . 40f flavor 1 . 50 srf concentrate crude * ______________________________________ * adjust concentration of srf to 3000 units / ounce of product . the flavor component present to the extent of 1 . 50 % by weight contains the ingredients and is produced by the procedure of example 1 . the preparation of the first portion of the toothpaste containing the srf is as follows : mix the srf with one - third of the sorbitol 70 % set forth above for phase b and one - fifth of the glycerine 96 % set forth above for phase b . this first portion at a ph of about 5 , is first added to the tube of example 1 and designated 35 . a small amount of sorbitol 70 %, i . e . one - fifth of the amount set forth above for phase f , is added to the tube to separate the srf first portion from the higher ph second portion . the second portion containing the balance of the ingredients is prepared using the procedure described in example 1 and then added to the tube and sealed . the preparation of another embodiment of the periodontal toothpaste of the invention is described below using the following ingredients . ______________________________________ % w / wingredient q . s . adjust to______________________________________part ipurified water deionized 100 . 000sodium benzoate , nf ( preservative ) 0 . 100sodium saccharin , usp 0 . 250sodium fluoride , usp 0 . 220sodium chloride , usp 10 . 000zinc chloride granular , usp 0 . 250srf concentrate crude * sorbitol solution , usp 22 . 000sodium bicarbonate , usp 15 . 000part iiglycerin 99 percent , usp 3 . 000cmc 7mf 1 . 000part iiiglycerin 99 percent , usp 2 . 000part ivsyloid b - 30 ( silica gel hsg - 750 ) 13 . 000sicosil 63m 4 . 000titanium dioxide ansb div sun 1 . 000sodium lauryl sulfate , nf 2 . 400part vperiodontal toothpaste - flavor mix 1 . 500______________________________________ * adjust concentration of srf to 3000 units / oz . of product . sodium benzoate , sodium saccharin , sodium fluoride , sodium chloride , zinc chloride and srf were placed in a suitable container and mixed for 5 minutes . sorbitol solution was added and stirring continued for an additional 5 minutes . to the mixture was added the sodium bicarbonate and the resulting mixture heated to 60 ° c . with stirring and maintained at that temperature for 10 minutes . the mixture was cooled to 25 ° c . and deaerated . concurrently the glycerin was placed in a separate suitable container equipped with a stirrer . the carboxymethylcellulose was added with stirring until evenly dispersed . the carboxymethylcellulose dispersion was transferred to the mixture of part i with the aid of vacuum . to this was added the glycerin of part iii with the aid of rinsing water . the mixture was deaerated and mixed 30 minutes . the viscosity and ph was checked . to this mixture was added a blended mixture of the syloid , sicosil , titanium dioxide and sodium lauryl sulfate . the resulting mixture was deareated . to the deareated mixture was added the flavor mix of part v with the aid of rinsing water . the resulting mixture was stirred for an additional 20 minutes and packaged in toothpaste tubes . the flavor component contains the same ingredients and is produced by the same method as in example 1 . ______________________________________ % byphase ingredient weight______________________________________a glycerine 96 % 5 . 00a cmc 7mf 1 . 00b sorbitol 70 % 15 . 00c deionized water 22 . 61c zinc chloride 0 . 25c sodium benzoate 0 . 10c sodium saccharine 0 . 25c sodium fluoride 0 . 22c sodium chloride 5 . 00c srf 1 . 37c sodium bicarbonate 20 . 00d syloid b - 30 13 . 00d sicosil 63m 4 . 00e titanium dioxide # 3328 1 . 00e sorbitol 70 % 2 . 00f sorbitol 70 % 5 . 00f sodium lauryl sulfate 2 . 40f flavor 1 . 50g d & amp ; c red # 33 ( 1 %) 0 . 30______________________________________ the components are formulated into a toothpaste by the procedure of example 1 . the flavor component present to the extent of 0 . 30 % by weight contains the ingredients and is produced by the procedure of example 1 . the method in accordance with this invention , to treat gingivitis or to induce an anti - gingivitis effect , comprises administering to the oral cavity of an animal organism , preferably humans , suffering from gingivitis , an amount sufficient to retard and treat said gingivitis . the preferred method is by brushing the toothpaste formulation onto the teeth and gums , and rinsing out . the procedure is used three times per day until results conform to the dentist &# 39 ; s treatment desires . in general , the pharmaceutical preparation of the present invention attacks gram - negative and gram - positive bacteria , both the aerobic and anaerobic spirochetes , large virus and certain protozoa , in addition to exercising an antifungal activity for oral infections caused by candida albicans . it acts as a protective for irritated and inflamed mucous membranes and as an oral lavage , and assists in the removal of tenacious mucus . the antimicrobial activity of the toothpaste of example 3 was determined against various organisms in an agar diffusion assay according to the following procedure : 1 . a 24 hour culture of each organism was diluted 1 - 1000 in sterile saline ( 1 - 100 for c . albicans ). 2 . 0 . 1 ml of this dilution was streaked onto the surface of 3 trypticase soy agar plates . 3 . one 8 mm well was dug into each plate with a cork borer . 5 . the plates were incubated for 24 hours at 35c and then the zones of inhibition were measured in mm . table 1______________________________________zone of inhibitation against various organisms fortoothpaste of example 3 ( in millimeters ) organism well # 1 well # 2 well # 3 average______________________________________c . albicans 50 50 47 49strep . mutans 42 44 44 43 . 3ps . aeruginosa 23 21 20 21 . 3______________________________________ ______________________________________ grams______________________________________gelatin ( finely powdered ) 47srf 3000 units per oz . of productmineral oil 47 . 5polyethylene ( mol . wt . 21 , 000 ) 2 . 5______________________________________ as a night time adjunct to the above brushing treatment of gingivitis the active ingredient , srf , may be formulated in a vehicle suitable for topical application to the gingavae . said formulation is a viscous pharmaceutical composition essentially comprising srf and an intimate admixture of particulate gelatin with mineral oil containing dispersed therein polyethylene having a molecular weight of at least 3 , 500 in an amount equal to approximately 0 . 25 % to 50 % of the combined weight of polyethylene and mineral oil , the srf preferably representing about 3000 units per oz . of the composition . ( a ) a polyethylene - mineral oil dispersion is prepared as described in u . s . pat . no . 2 , 628 , 187 . ( b ) the srf is blended with an equal weight of the dispersion of ( a ) in a planetary type mixer and then the material is passed through a roller mill . to 2 gm . of milled material is added 2 gm . of the dispersion ( a ) with mixing in a planetary type mixer until homogeneous . again add ( a ) in an amount equal to that in the planetary mixer and mix until homogeneous . continue this geometric addition process until the dispersion ( a ) has been completely utilized . ( c ) the gelatin is introduced into the bowl of a planetary type mixer , covered with ( b ) and blended until homogeneous . it is thus seen that i have provided a dentifrice which is eminently satisfactory to accomplish all of the aforesaid stated objectives .

pharmaceutical composition of skin respiratory factor , sodium chloride , bicarbonate , fluoride and zinc chloride in a suitable toothpaste vehicle provides effective therapy for gingivitis when brushed on the teeth and gingivae . pharmaceutical composition of srf in a viscous composition suitable for application to the gingivae and effective over an extended period of time for healing tissue damaged by gingevitis . a toothpaste tube for packaging a pharmaceutical composition of srf , sodium chloride , bicarbonate , fluoride and zinc chloride .

the weight loss composition of this invention comprises a formulation of extracts of bauhinia — saponins , kempferitrin , flavanoids , astragalin , alkaloids , micro - glycosides , bauhinosides , betasitosterol , flavonols , guanidine , organic acids , quercimocides , rhamnose , and saponins . set forth below is a list of the types & amp ; species of bauhinia that can be used in the composition and method of this invention . the preferred herbal substance for use in the composition and method of this invention is obtained from leaves of the bauhinia forficata tree . this tree is found in the amazon forest of south america , including ecuador . however , even though it is preferred to use the leaves , the herbal substance can also be obtained from any part of the tree including the root , bark and branches of it . extractions : the bauhinia herb can be used in connection with the following types of carriers : delivery : the bauhinia herb can be administered or delivered to the recipient in the following manner : methods of preparing herbal compositions are found in the book “ the healing power of rainforest herbs ” by leslie taylor ( square one publishers , inc ., 2004 ), incorporated by reference herein . the concentration of bauhinia herbal substance in the carrier can range from about 0 . 1 % to 99 % or more . the exact concentration will depend on the carrier , and method of administering the herbal substance . a series of tests were run to demonstrate the efficacy of the composition and method of the invention . in these tests , the bauhinia herbal substance was a mixture of four varieties of bauhinia in substantially equal amounts . the varieties were : bauhinia racemosa , bauhinia tarapotensis , bauhinia purpurea l ., and bauhinia candicans . test subjects subject a - male 60 year old , 5 ft . 11 in . taken bauhinia water / alcohol extract 5 grams leaves in 10 cc concentrate taken 3 times daily , 15 minutes before meal . no changes in dietary habits , exercise , or medication . test run for 6 weeks . before wt : 7158 # after wt : 147 # before bmi : 22 after bmi : 20 before waist : 33 after waist : 29 net wt . loss : 11 lbs . bmi deceased : 2 waist measurement decreased : 4 inches subject b - female 55 year old , 5 ft . 5 in . taken bauhinia leaves dried powder 5 grams 3 times daily before meal . no changes in dietary habits , exercise , or medication . test run for 6 weeks . before wt : 174 # after wt : 168 # before bmi : 29 after bmi : 28 before waist : 37 after waist : 36 net wt . loss : 6 lbs . bmi deceased : 1 waist measurement decreased : 1 inch subject c - male 58 year old , 5 ft . 8 in . taken 10 drops bauhinia extract concentrate in a food candy bar , once times daily in middle of the day on full stomach . no changes in dietary habits , exercise , or medication . test run for 6 weeks . before wt : 181 # after wt : 174 # before bmi : 26 . 7 after bmi : 25 . 7 before waist : 38 . 5 after waist : 37 net wt . loss : 7 lbs . bmi deceased : 1 waist measurement decreased : 1 . 5 inches subject d - female 46 year old , 5 ft . 4 in . taken bauhinia water extracted powder with 1 gram 2 times daily on empty stomach 30 minutes before meals . no changes in dietary habits , exercise , or medication . test run for 6 weeks . before wt : 188 # after wt : 178 # before bmi : 32 . 3 after bmi : 30 . 6 before waist : 38 after waist : 35 . 5 net wt . loss : 10 lbs . bmi deceased : 1 . 7 waist measurement decreased : 2 . 5 inches the foregoing test results indicate that weight loss in human beings can be facilitated by administering physiologically effective amounts of bauhinia herbal substance to individuals . the bauhinia in the above tests was administered in the form of powders of dried leaves or extracts . as used herein , the term “ physiologically effective amount ” refers to that amount of herbal substance which , when administered , is effective to cause loss of weight in an individual . another series of tests were conducted to further demonstrate the efficacy of the compositions and method of the invention . in this example , the results of a four week pilot project studying the effect of the herbal substance , bauhinia forficata , on weight loss in overweight humans in the absence of dietary or exercise intervention is provided . a total of 31 patients ( 18 male , 13 female ) were recruited for the study . they each signed a consent form and were told the study involved an herb used in south america for weight loss and other purposes , and that the substance to be taken was generally regarded as safe . they were instructed to keep their diet and exercise unchanged . patients were randomly assigned to a treatment or placebo group and instructed to take 5 ml . of the test material ( either bauhinia leaf extract or a placebo solution ) 30 minutes before each meal . they were also given a vitamin / mineral supplement to take each morning . measurements of weight and circumference of waist , chest , and hips were made and recorded at the start of the study and four weeks . participants were asked about side effects at each visit . results were recorded for those who completed the study and analyzed by anova . all subjects completed the study . table 2 below summarizes the changes in various measurements over the study period treatment for each of the groups . comparing each group &# 39 ; s final to initial values revealed no statistically significant changes , although the differences approached significance for the following parameters in the treatment group : weight ( p = 0 . 06 ), bmi ( p = 0 . 06 ), waist circumference ( p = 0 . 06 ), and waist to hip ratio ( 0 . 888 ). comparing the amount of change between the two groups revealed that there was a statistically significant difference ( p & lt ; 0 . 008 ) in the change in bmi between the two groups . there were no reported adverse effects in either group during the duration of the study . several subjects reported increased energy or improved sense of well being . one reported “ darkening of hair ” as a beneficial side effect . the statistically significant effect of the bauhinia extract on weight loss and various measurements did not include dietary or exercise intervention . there was no evidence of toxicity . bauhinia forficata is a small tree that grows in a small area of the amazonian plateau in ecuador . it has long held a place in the folk medicine of south america . its bark has been used as an anti - diarrheal and was not used in the preparation involved in the present study . the leaves have been used for a variety of purposes , including in the treatment of diabetes , as a general tonic , as an antivenin and as a vermifuge . it has also been associated with beneficial changes in lipid levels indicating there were no toxic effects in either normal or diabetic rats , including pregnant diabetic rats . it is not known precisely why the administration of the bauhinia herbal substance is effective to facilitate weight loss in various individuals , however it is postulated that the bauhinia normalizes pha - leptin - insulin receptor insensitivity and central satiety physiology . whatever the mechanism , it is clear that it is effective to facilitate weight loss in human beings who take it in physiologically effective amounts . although various illustrative embodiments of the composition and method of the invention have been described and shown herein , it is to be understood that the present invention is not limited to the precise embodiments described , and that various other changes and modifications may be affected therein by one skilled in the art without departing from the spirit and scope of the invention . all such changes and modifications are intended to be included within the scope of the invention as defined by the appended claims .

disclosed is a composition and method for facilitating weight loss in individuals . the composition is a physiologically effective amount of the herbal substance bauhinia in a suitable carrier . the carrier can be water , alcohol , mixtures thereof , capsules , powders , tinctures , liposomes , chewing gum , lozenges , candies , food , skin creams , or lotions . the method is to administer a physiologically effective amount of the herbal substance to an individual seeking to lose weight . the preferred herbal substance is obtained from the leaves of a bauhinia forficata tree .

in the embodiment of fig1 a cornea marker 10 is shown with a marker blade assembly 30 having a blade support frame 30a in the form of an annular cap . as seen in fig2 the frame or cap 30a carries on its underside a pattern or array of edge - mounted radially disposed knife blade pairs 32a and 32b . the frame has a central opening 31 with inner and outer edges 31a , 31b . the frame also has a circumferential skirt 30b depending from its underside that together define a circumferential skirt groove 30c . the top side of the frame carries blade alignment indicia 30d . as seen in fig2 the blades have a cutting edge 33 with concave curvature terminating at an inner end 34 and an outer end 35 . in relation to the surface of the cornea 20 for purposes of marking , the cutting edges of the blade pair 32a , 32b are located for concentric placement in co - extensive matching contact with the corneal surface . the inner edges 34 of the blades are spaced from the clear zone 21 while the outer edges 35 are spaced away from the corneal limbus 22 . also as seen in fig2 the blade assembly is supported for rotation in a holder 40 having an annular base plate 41 carried for manipulation by a handle 42 . the base plate has meridian indicia 46 on its upper face and has inner and outer edges 44 , 45 and the inner edge defining a circular opening and being configured for engagement with the skirt groove 30c , also circular . in a preferred embodiment , the two parts 30 and 40 are constructed such that they can be assembled together and disassembled ( as shown in fig3 ), as desired , preferably by means of a snap fit allowing relative rotation as between the two parts . when the blade assembly 30 is rotated , the same can be advanced to any desired position for marking by setting the blade alignment indicia 30d to coincide with the meridian indicia 46 requiring marking , such as the vertical ( 90 °) meridian or the horizontal ( 0 ° or 180 °) meridian . different patterns of marking can be achieved by using any of the different blade configurations shown in fig4 to 7 . a preferred embodiment of the cornea marker is illustrated in fig8 . the blase assembly 30 has a circumferential groove 35a that is circular and the holder 40 has an inner edge 44 defining a matching central opening 43 so that when assembled the two parts can be rotated relative to each other . the blade assembly has an annular cap 30a that is elliptical with an elliptical central opening 31 . the blade pairs are secured to the cap 30a by suitable means such as welding and are arranged with their inner and outer ends 34 , 35 open to view for precise placement and marking when held in the operative position shown in fig8 . in operation , by marking methods which will be understood by those skilled in eye surgery , a blade assembly of the invention is selected that provides the most suitable pattern of marking for the particular surgical procedure , whether for correction of myopia , astigmatism or a combination of these . the appropriate blade assembly and the holder are assembled , and the assembly is rotated if necessary to the desired meridial alignment , for example the alignment shown in fig8 for a marking pattern to correct for astigmatism . the marker is then placed in a marking position such as that shown in fig2 ( with the long axis blade pair on the horizontal meridian ), and the corneal surface surrounding and adjacent to the clear zone is marked for purposes of pachymetry and refractive keratotomy . what is desired to claim as my exclusive property in the invention , as described , is the following .

cornea marker apparatus and a method of corneal marking are provided for purposes of corrective surgery . the apparatus features a blade assembly having readily visible blade ends as well as a blade assembly concept with a radial guide allowing rotation of the blades to selected meridian alignments for precise marking of the surface of the cornea .

jm216 is a platinum antitumor complex having poor water - solubility . this low solubility may be associated with bioavailability problems seen in a recent phase i clinical study where the compound was orally administered in the form of hard gelatin capsules with excipients ( microcrystalline cellulose , sodium starch glycolate , lactose anhydrous and magnesium stearate ). it was an object of the present invention to find a way of increasing the aqueous solubility of jm216 so as to improve the bioavailability of the compound and perhaps also eliminate or reduce side effects seen with oral dosing such as nausea and vomitting . it was another object of the invention to develop a suppository dosage formulation of jm216 which could provide the same therapeutic advantages of the existing oral formulation while also improving the bioavailability . it was hoped that the suppository formulation would also have an improved side - effect profile as well as being an alternate dosage form for those patients who cannot tolerate oral dosing , e . g . infant patients or patients with disorders of the digestive organs . the present inventors first attempted to reduce the particle size of the jm216 powder obtained from chemical synthesis by grinding or milling it to an amorphous state ( as confirmed by x - ray diffraction pattern ). the amorphous state indicates the disappearance of particles or crystalline drug and a particle size close to the molecular level . however , it was found to be very difficult to obtain an amorphous state by simply grinding the drug alone owing to the re - aggregation of drug powder by electrostatic force during the grinding process . the addition of β - cyclodextrin or polymers to the jm216 during the grinding did allow obtaining the drug as an amorphous powder by reduction of the aggregation . interestingly , the effect on solubility was quite dependent on the polymer used , with gelatin , polyvinylpyrrolidinone and hydroxypropylmethyl cellulose showing marked improvement of dissolution rate over drug alone . the ratio of drug : β - cyclodextrin or drug : polymer also has some effect on solubility , with solubility generally increasing at higher β - cyclodextrin : drug or polymer : drug ratios . ratios of drug : β - cyclodextrin or drug : polymer of from about 1 : 1 to about 1 : 15 ( w / w ) can be used with ratios of from about 1 : 4 to 1 : 15 being preferred and ratios of from about 1 : 9 to about 1 : 15 being most preferred . table i below shows dissolution results when various jm216 : polymer or jm216 : β - cyclodextrin mixtures , after grinding with an automatic mortar for three hours , were evaluated in a standard dissolution test . table 1______________________________________dissolution of jm216 dissolved jm216 ( mg / ml ) 1 min . 5 min . 15 min . 30 min . 60 min . ______________________________________jm216 bulk drug alone 0 . 2 0 . 3 0 . 5 0 . 5 0 . 5jm216 : gelatin ( 1 : 9 , w / w ) 1 . 4 1 . 2 1 . 2 1 . 1 1 . 1jm216 : gelatin ( 1 : 4 , w / w ) 1 . 1 1 . 1 1 . 0 0 . 9 1 . 0jm216 : gelatin ( 1 : 1 , w / w ) 0 . 5 0 . 6 0 . 7 0 . 7 0 . 6jm216 : hpmc ( 1 : 9 , w / w ) 0 . 9 1 . 1 1 . 0 0 . 9 0 . 9jm216 : hpmc ( 1 : 4 , w / w ) 0 . 7 0 . 8 0 . 7 0 . 7 0 . 7jm216 : hpmc ( 1 : 1 , w / w ) 0 . 6 0 . 7 0 . 6 0 . 6 0 . 6jm216 : pvp ( 1 : 9 , w / w ) 0 . 8 0 . 9 1 . 0 0 . 9 0 . 9jm216 : pullulan 0 . 5 0 . 8 0 . 7 0 . 7 0 . 7 ( 1 : 9 , w / w ) jm216 : peg 6000 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 ( 1 : 9 , w / w ) jm216 : avicel ( 1 : 9 , w / w ) 0 . 7 0 . 7 0 . 7 0 . 7 0 . 7jm216 : lactose 0 . 7 0 . 7 0 . 7 0 . 7 0 . 7 ( 1 : 9 , w / w ) jm216 : β - cyclodextrin 0 . 9 0 . 9 0 . 9 0 . 9 0 . 9 ( 1 : 9 , w / w ) ______________________________________ hpmc = hydroxypropylmethyl cellulose , pvp = polyvinylpyrrolidone , peg = polyethylene glycol , pullulan = natural polysaccharide , avicel is the tradename of fmc corporation for microcrystalline cellulose dissolution test : the ground mixture containing 5 mg . of jm216 was transferred directly into 50 ml of phosphate buffer ( 1 / 15 m , ph 7 . 5 ) kept at 37 ° c . and was stirred with a magnetic stirrer bar at 300 rpm . an aliquot of the solution was pipetted at the indicated time intervals and filtered through a 0 . 45 μm membrane filter . the concentration of the dissolved jm216 was determined by high performance liquid chromatography ( hplc ). grinding of the jm216 : β - cyclodextrin or jm216 : polymer mixtures may be accomplished by standard procedures , e . g . automatic mortar and pestle machines or a hybridizer ( milling machine ). the time needed in the grinding process may be readily determined by simple test ( period analysis of the mixture by x - ray diffraction studies ). a suitable grinding time with the automatic mortar and pestle machine is three hours and with the hybridizer , five minutes . as can be seen from table i , use of amorphous jm216 with β - cyclodextrin or certain polymer additives significantly increases the water - solubility of jm216 . the preferred formulations with increased solubility are those where the jm216 is ground to an amorphous state in the following drug : β - cyclodextrin or drug : polymer ratios : such formulations result in approximately a doubling of the aqueous solubility over bulk jm216 powder alone and are one important aspect of the present invention . such amorphous jm216 can be used in a wide variety of jm216 pharmaceutical formulations , including both oral and non - oral forms , to improve the bioavailability of jm216 . the present inventors also explored developing a suppository dosage form of jm216 which would provide an alternative dosage form for those patients unable to use the current oral capsules . it was a goal to develop such a suppository dosage form which would have better absorption than the oral form and reduced side effects , e . g . nausea and vomitting . in their studies in vitro drug absorption of the test formulations was examined using excised rat rectum in accordance with the method described by t . ogiso et al in j . pharmacobio - dyn ., 14 , 385 ( 1991 ). the rectum was freshly excised from each rat and was opened lengthwise using scissors . the excised rectum , serous membrane side down , was mounted on a franz diffusion cell ( reservoir volume 10 ml , 7 mm i . d . o ring flange ). each preparation ( 80 mg ., 2 mg as jm216 ) was uniformly applied to the mucosal side and was occluded with a sheet of aluminum foil . gentamicin solution ( 10 mg / ml ) was added to the reservoir fluid ( phosphate buffer , ph 7 . 3 ) in the ratio of 1 : 100 . the assembly was incubated at 37 ° c . and aliquots ( 200 ( μl ) of the reservoir fluid were periodically withdrawn for 23 hours . the amount of jm216 permeated through rat rectum was determined by hplc . the various test samples were incorporated into standard suppository bases and then subjected to the in vitro drug absorption test . in addition , jm 216 powder alone and the ground anhydrous jm216 : β - cyclodextrin or jm216 : polymer mixture suspended in water were also subjected to the tests . the suppository samples were prepared by fusion method melting the base at 50 ° c . for fatty bases or at 75 ° c . for polyethylene glycol water - soluble base . the drug was incorporated into the base at a concentration of 2 mg / 80 mg base . medium chain fatty acids ( or na salts thereof ) and surface active agents were also added at the appropriate level . the results in the rat rectum absorption model are as shown below in table ii . table ii__________________________________________________________________________jm216 absorption through excised rat rectum suppository jm216 absorbed (%) drug additives bases 14 h 17 h 20 h 23 h__________________________________________________________________________jm216 water 0 . 0 0 . 0 0 . 0 0 . 0 ( non - amorphous ) jm216 witepsol h - 15 0 . 0 0 . 0 0 . 0 0 . 0 ( non - amorphous ) jm216 pharmasol 0 . 0 0 . 0 0 . 0 0 . 0 ( non - amorphous ) jm216 isocacao 0 . 0 0 . 0 0 . 0 0 . 2 ( non - amorphous ) jm216 miglyol 0 . 0 0 . 0 0 . 0 0 . 0 ( non - amorphous ) jm216 peg 0 . 2 0 . 5 0 . 9 1 . 2 ( non - amorphous ) jm216 peg + pharmasol 0 . 0 0 . 0 0 . 0 0 . 3 ( non - amorphous ) jm216 3 %, capryl - na peg 7 . 5 8 . 6 10 . 5 11 . 5 ( non - amorphous ) jm216 3 %, bl - 21 peg 1 . 8 4 . 6 5 . 2 6 . 2 ( non - amorphous ) jm216 3 %, blyk peg 0 . 6 1 . 1 1 . 3 3 . 7 ( non - amorphous ) jm216 3 %, bl - 21 pharmasol 0 . 1 0 . 3 0 . 6 0 . 8 ( non - amorphous ) jm216 3 %, glyk pharmasol 0 . 0 0 . 0 0 . 1 0 . 3 ( non - amorphous ) jm216 : gelatin ( 1 : 9 ) water 0 . 0 0 . 0 0 . 1 0 . 3jm216 : gelatin ( 1 : 9 ) peg 0 . 2 0 . 6 1 . 8 3 . 8jm216 : gelatin ( 1 : 9 ) pharmasol 0 . 0 0 . 0 0 . 1 0 . 3jm216 : gelatin ( 1 : 9 ) miglyol 0 . 0 0 . 0 0 . 2 0 . 7jm216 : gelatin ( 1 : 9 ) 3 %, caproic peg 1 . 8 2 . 8 3 . 6 5 . 0 acidjm216 : gelatin ( 1 : 9 ) 3 %, caprylic peg 5 . 2 6 . 5 7 . 9 9 . 4 acidjm216 : gelatin ( 1 : 9 ) 3 %, capric peg 1 . 2 1 . 8 2 . 9 4 . 1 acidjm216 : gelatin ( 1 : 9 ) 3 %, oleic peg 0 . 7 1 . 4 2 . 2 3 . 2 acidjm216 : gelatin ( 1 : 9 ) 3 %, linoleic peg 0 . 8 1 . 4 2 . 2 3 . 3 acidjm216 : gelatin ( 1 : 9 ) 3 %, linolenic peg 0 . 2 0 . 6 1 . 2 1 . 8 acidjm216 : gelatin ( 1 : 9 ) 3 %, caproic - peg 5 . 9 9 . 5 11 . 3 14 . 6 najm216 : gelatin ( 1 : 9 ) 3 %, capric - na peg 2 . 4 3 . 6 4 . 3 6 . 4jm216 : gelatin ( 1 : 9 ) 3 %, lauric - na peg 1 . 5 2 . 2 3 . 4 4 . 9jm216 : gelatin ( 1 : 9 ) 3 %, oleic - na peg 2 . 0 3 . 1 3 . 5 5 . 3jm216 : gelatin ( 1 : 9 ) 3 %, capryl - na miglyol 0 . 1 0 . 2 0 . 4 0 . 8jm216 : gelatin ( 1 : 9 ) 3 %, capryl - na peg + miglyol * 2 . 5 3 . 7 4 . 8 6 . 1jm216 : gelatin ( 1 : 9 ) 1 %, capryl - na peg 3 . 8 5 . 3 6 . 5 7 . 5jm216 : gelatin ( 1 : 9 ) 3 %, capryl - na peg 7 . 0 9 . 0 10 . 8 13 . 2jm216 : gelatin ( 1 : 9 ) 7 %, capryl - na peg 2 . 3 3 . 0 4 . 0 4 . 8jm216 : gelatin ( 1 : 9 ) 3 %, glyk peg 0 . 1 0 . 7 1 . 3 1 . 9jm216 : gelatin ( 1 : 9 ) 3 %, pluronic peg 0 . 3 0 . 5 0 . 8 1 . 2jm216 : gelatin ( 1 : 9 ) 3 %, capryl - najm216 : gelatin ( 1 : 9 ) + 3 %, pluronic peg 6 . 6 8 . 6 10 . 1 11 . 1jm216 : gelatin ( 1 : 9 ) 3 %, capryl - na peg 5 . 7 7 . 4 8 . 8 9 . 5 + 3 %, tween 80jm216 : gelatin ( 1 : 9 ) 3 %, capryl - na peg 1 . 5 2 . 5 3 . 2 4 . 3 + 3 % m bl - 21jm216 : β - 3 %, capryl - na peg 0 . 3 0 . 8 1 . 6 2 . 0cyclodextrin ( 1 : 9 ) jm216 : β 3 %, pluronic peg 1 . 1 2 . 0 2 . 7 3 . 2cyclodextrin ( 1 : 9 ) jm216 : hpmc ( 1 : 9 ) 3 %, capryl - na peg 1 . 5 2 . 1 3 . 7 4 . 3__________________________________________________________________________ * miglyol was used here as an additive to change the nature of the peg suppository base . the base gradually dissolves in water because of the addition of miglyol . it is prepared by adding 3 - 10 % of miglyol to peg at 75 ° c . mixing ( stirring ) with 1 - 5 % pluronic f68 . the actual formulation of base used here was peg + 3 % pluronic f68 + 5 % miglyol . tween 80 could be substituted for the pluronic f68 . witepsol h15 = fatty suppository base manufactured by huls aktiengesellsc pharmasol = fatty suppository base manufactured by nippon oil & amp ; fats co ., ltd . isocacao = fatty suppository base manufactured by kao co . miglyol = medium chain fatty acid triglyceride suppository base manufactured by huls aktiengesellsch peg = polyethylene glycol ( watersoluble suppository base ) caprylna = sodium caprylate ( fatty acid ) bl21 = polyoxyethylene ( 21 ) lauryl ether ( surface active agent ) glyk = dipotassium glycyrrhizinate ( surface active agent ) caproic acid ( fatty acid ) caprylic acid ( fatty acid ) capric acid ( fatty acid ) oleic acid ( fatty acid ) linoleic acid ( fatty acid ) linolenic acid ( fatty acid ) capricna = sodium caprate ( fatty acid ) lauricna = sodium laurate ( fatty acid ) oleicna = sodium oleate ( fatty acid ) caproicna = sodium caproate ( fatty acid ) pluronic = f68 ( poloxamer ) ( surface active agent ) tween 80 = polysorbate 80 = a surface active agent looking at the results of this study , jm216 bulk drug ( non - amorphous ) was little absorbed in the form of a suspension in water or in fatty suppository bases . the drug alone was , however , absorbed to some extent when incorporated into the water - soluble base , polyethylene glycol ( peg ). peg was thus determined to be the most appropriate suppository base for jm216 . peg having molecular weights of from about 400 - 6000 is preferred ( the peg used in the above study was a mixture of 400 , 1500 and 4000 ( 2 : 1 : 5 , w / w ) molecular weight material ). based on their experience , the present inventors determined that in the rat rectum absorption model a percentage absorption of 4 % or greater was considered necessary for a commercially useful suppository formulation of jm216 . addition of certain fatty acids to the peg suppository base containing non - amorphous jm216 gave the desired absorption levels while similar peg formulations without these fatty acids were unacceptable . the amorphous jm216 produced by grinding or milling jm216 with β - cyclodextrin or polymers , particularly gelatin , hpmc or pvp , can also be added to a peg suppository base and certain fatty acids , particulary caproic acid or its sodium salt , caprylic acid or its sodium salt , capric acid or its sodium salt and the sodium salt of oleic acid , to obtain a suppository dosage form having excellent absorption properties . the fatty acid is used in an amount of from 0 . 5 to 10 % ( w / w ) of the total suppository weight . addition of surface active agents to the suppositories employing a peg base , amorphous jm216 and a fatty acid selected from caproic acid or its sodium salt , caprylic acid or its sodium salt , capric acid or its sodium salt and the sodium salt of oleic acid also resulted in suppository formulations showing high absorption . again , in the case of amorphous jm216 , material made by grinding jm216 with gelatin , hpmc , pvp or β - cyclodextrin , is preferred for achieving the best absorption results . the surface active agent is employed in an amount of from 0 . 5 to 7 % of the total suppository weight . preferred surface active agents include tween 80 and pluronic ( e . g . pluronic f68 ). the jm216 , whether amorphous or non - amorphous , is used in an amount of from 0 . 1 to 10 % ( w / w ) of the total suppository weight . particularly preferred suppository formulations according to the present invention include the following : jm216 : gelatin ( 1 : 9 , w / w ), peg suppository base , 3 % capryl na , 3 % pluronic surface active agent jm216 : gelatin ( 1 : 9 , w / w ), peg suppository base , 3 % capryl na , 3 % tween 80 surface active agent the suppository formulations are prepared by mixing of the jm216 and fatty acid with a peg suppository base by any recognized method of making suppositories using water - soluble peg bases . the surface active agents and other excipients such as miglyol can also be added to the mixture . the dosage amount of jm216 in the suppository formulation is sufficient to insure the release of sufficient dosage units of jm216 into the blood to provide the desired therapeutic effect and may be readily determined by those skilled in the art by simple test . peg400 , peg1500 and peg6000 were mixed in a ratio of 2 : 1 : 5 ( w / w ) and then melted at 75 ° c . the ground mixture ( 20 g ) of jm216 and gelatin ( 1 : 9 , w / w ) was added to the melted peg mixture ( 57 . 6 g ) and stirred until the ground mixture was dispersed homogeneously . sodium caproate ( 2 . 4 g ) was added and then stirred for a short time at 70 ° c . the mass was immediately poured into molds and allowed to solidify at room temperature . the above process was carried out in a light - free environment . peg400 , peg1500 and peg6000 were mixed in a ratio of 2 : 1 : 5 ( w / w ) and then melted at 75 ° c . the ground mixture ( 20 g ) of jm216 and gelatin ( 1 : 9 , w / w ) was added to the melted peg mixture ( 57 . 6 g ) and stirred until the ground mixture was dispersed homogeneously . caprylic acid ( 2 . 4 g ) was added and then stirred for a short time at 70 ° c . the mass was immediately poured into molds and allowed to solidify at room temperature . the entire process was carried out in a light - free environment . peg400 , peg1500 and peg6000 were mixed in a ratio of 2 : 1 : 5 ( w / w ) and then melted at 75 ° c . pluronic f68 ( 2 . 4 g ) was added to the melted peg mixture ( 55 . 2 g ) and stirred vigorously . the ground mixture ( 20 g ) of jm216 and gelatin ( 1 : 9 , w / w ) was added to the mixture and stirred until the ground mixture was dispersed homogeneously . sodium caprylate ( 2 . 4 g ) was added and then stirred for a short time at 70 ° c . the mass was immediately poured into molds and allowed to solidify at room temperature . the entire process was carried out in a light - free environment .

novel suppository pharmaceutical formulations of the platinum antitumor agent , jm216 , are provided . such dosage forms provide an alternative to the oral form currently available and offer improved bioavailability of this promising drug .

in the following descriptions , the present invention will be explained with reference to various example embodiments ; nevertheless , these example embodiments are not intended to limit the present invention to any specific example , embodiment , environment , application , or particular implementation described herein . therefore , descriptions of these example embodiments are only provided for purpose of illustration rather than to limit the present invention . the invention is to cover all modifications , equivalents , and alternatives falling within the scope of the invention as defined by the appended claims . referring to fig1 and fig2 , a knee pad assembly 100 is shown . the assembly generally comprises a base 102 and a removable cover 104 . the base 102 fastens to the user &# 39 ; s knee using fastening straps 106 , such as the ratcheting adjustable straps as shown in these figures with ratcheted fastener 109 . an upper and a lower strap are shown but more or fewer straps are within the scope of the invention . the base 102 presents a forward facing cover receiving portion 108 . the cover 104 is disposed over the forward facing portion 108 of base 102 as indicated in these figures and secured via attachment means , in this example via corner hooks 110 disposed at the corners of base 102 . the assembled knee pad 100 is shown in fig2 . the knee pad base can be configured in short or long versions as appropriate for the particular application and a user &# 39 ; s desired level of coverage . the cover is correspondingly sized . the cover may be formed from any suitable material , including rubber and plastic , and formed in any suitable shape . in addition , the cover may fully or partially comprise multirole materials such as leather , cloth , plastic , fiber glass , foam , rubber , carbon fiber , composites , metal or any other material that is designed for the end user &# 39 ; s specific job requirements . a wide variety of cover attachments means are within the scope of the invention . such means include , but are not limited to hooks , snaps , clips , hook and loop components ( e . g . velcro fasteners ) on respective portions of the base and cover , and combinations of two or more different attachment means . the user &# 39 ; s ability to change covers on the knee pad bases allows for a single pair of knee pads to be adapted to a wide variety of surface types . the ability to change covers also provides the user with the option to replace individual worn covers , wash soiled covers , and / or use job specific covers as needed , avoiding the need to purchase a replacement or additional set of knee pads . referring to fig3 and 4 , another example embodiment of a knee pad assembly 200 is shown . the base 202 is provided with one or more front facing suspension components 212 , such as rubber or foam pads . in this example embodiment , base 202 is slideably engaged with pad 204 by straps 214 that are integrated into the corners of pad 204 . straps 214 secure the knee pad assembly 200 to a user by wrapping straps 214 securely around the back of the users knee . it should also be noted that straps 214 could also be integrated with base 202 and slide through corresponding openings ( not shown ) in pad 204 to also achieve the floating suspension effect . cords may also be used instead of straps . while secured , the back surface of pad 204 engages the suspension member 212 of base 202 , and slides on guide rails 216 , allowing pad 204 to float on suspension member 212 and remain aligned via guide rails 216 , without being fixably connected to base 202 . this allows pad 204 to move in toward the knee and out away from the knee , depending on the pressure exerted on the front surface of pad 204 while in use . this provides cushioned suspension for the knee while the improved knee pad assembly is in use . the spring force of the compression component 212 may be adapted to a desired range of cushioning or compression based upon a user &# 39 ; s weight , and / or the conditions of use of the knee pad , and / or the length of time of intended use . preferably a material with an ild ( indention load deflection ) of between 45 and 100 may be used . urethane and other foams may also be used with densities of weights between 1 and 10 pounds per square foot of material . the outer cover 204 may comprise a semi - rigid or a hard plastic shell ( or similar material ) that will compress one or more of the suspension components 212 and distribute the force over the cover 204 . the cover 204 cooperates with a plurality of integrated straps 214 , guide rails 216 and guide plate 218 to facilitate slideable engagement , and uniform alignment , of the cover to the base . this example embodiment also illustrates a tension / release mechanism or feature . when kneeling , compression placed on the cap 204 would compress suspension components 212 and release strap tension on straps 214 and when standing , compression would be released and strap tension would be allowed to return . the purpose is to release strap tension on the back of the worker &# 39 ; s leg , nerves and blood vessels while the worker is kneeling , yet maintain security of the knee pad when the worker is standing or walking . the cap 204 , straps 214 , suspension components 212 , guide rails 216 and guide plate 218 cooperate to achieve this feature , as well as providing a uniform alignment of the cap 204 with the base 202 , and providing extended comfort to the user . referring to fig5 and 6 , another embodiment of a knee pad assembly 300 is shown . the base 302 comprises a knee cup 304 and a suspension member 306 disposed on the outer front surface of the base . an outer cover or shell 308 is disposed over knee cup 304 and suspension member 306 by straps 310 . this arrangement allows force applied to the cover to compress the collapsible or suspension member towards the base to provide cushioning . the edges of the cover 308 slide toward the user &# 39 ; s knee along the outer perimeter surface of the base . when the pressure on the cover is released , the suspension member 306 expands to its original shape . in one variant , the suspension member 306 is partially collapsible in order to provide adequate support and air space while collapsible enough to provide desired cushioning . in addition open areas 312 in suspension member 306 allow additional cushioning and support for the knee . similar to the embodiments described and depicted in fig3 and 4 , the contact and cooperation between cover or shell 308 and suspension member 306 provides a floating type suspension for the knee while the knee pad 300 is strapped to a user by straps 310 . referring to fig7 , depicted is yet another exemplary embodiment where knee pad assembly 400 is comprised of base 402 , which is a partial shell that is disposed behind the user &# 39 ; s leg , such as on the calf and behind the knee , and cap 404 . for example , straps or a neoprene back of leg wrap 402 may be substituted for the base and straps described in the preceding examples . the cover 404 is then placed over the knee cap and restrained in place via tension members 418 , such as cords , on either side of the base spanning between the base and the cover . this arrangement promotes good pressure management on the user &# 39 ; s knee and leg . the cover 404 is shown with a honeycomb pattern 420 in a soft rubber material in order to enhance traction and provide cushioning for the user . a further feature illustrated in this example is the ratchet system 422 disposed on top of cover structure 404 and functionally connected to the tension members 418 . via the ratchet system 422 , the wearer has the ability to tighten or loosen strap pressure ( snugness ) of the knee pad . a dial 424 or other user actuator is provided to allow the user to actuate the ratchet system . referring to fig8 through 15 , depicted are various means to removeably attach a pad to a base . fig8 provides a base 502 with one or more sleeves or pockets 504 to receive the tongues 508 of cover 506 . the front receiving surface 510 of the base 502 and back surface 511 of cover 506 , may further be provided with a respective portion of a hook and loop fastener 512 to further secure the cover to the base . the cover 506 shown in this example is a generally rectangular and slightly curved semi - rigid board comprising a polyethylene material . however , the board can vary in size , shape and material as appropriate for the particular usage . referring to fig9 , an exemplar knee pad assembly is shown with another cover fastening means . an elastic hem 522 is provided around the perimeter 524 of the cover receiving surface 526 of the base 520 . the perimeter 528 of the cover 530 includes corresponding protruding tabs or projections 532 that are sized and shaped for being received in the elastic hem 522 . hook and loop 527 may also be used as shown in fig8 , and can further be used with all embodiment disclosed herein . referring to fig1 , a further embodiment of a knee pad assembly is shown . the base and cover is shown in fig9 . in addition , an overlay cover 534 is now provided . the overlay cover 534 is disposed over the cover 530 and then secured to the base with a plurality of reinforced strap loops 536 . the straps 538 used to secure the base to the knee region of the user are placed through the reinforced loops 536 of the overlay cover 534 to secure the cover and overlay in place . referring to fig1 , another embodiment of a knee pad assembly is shown . the cover or overlay 540 includes a plurality of elastic bands or cords 542 . the cords 542 can extend through the cover 540 for better securement . a tab 544 is provided at an approximate mid - point of each band 542 . the cover 540 is secured to the base 546 by inserting the tabs 544 into respective slots or pockets 548 in the base 546 . channels 550 in the outer perimeter surface 552 of the base 546 may be provided to further retain the bands in place . hook and loop fasteners 554 may further be provided on respective portions of the cover and base to further secure the cover to the base . fig1 illustrates a cord - lock means 562 for securing the cover 564 to the base 566 . raised corners 568 on the cover are inserted behind portions of the locking cord 570 . the locking cord or cords 570 are then tightened by pulling on cords 563 and retainer 562 is then used to maintain the tension in the retaining cord ( s ). fig1 through 15 illustrate other exemplar attachment embodiment means for a knee pad assembly . the cover or overlay 578 includes a plurality of elastic bands or cords 572 shown at the corners of the cover 578 . the cords can extend through the cover in a crossing pattern or “ x ” shape 574 for better securement , as shown in fig1 . a tab 576 is provided at an approximate mid - point of each band 572 . the cover 578 is secured to the base 580 by inserting the tabs 576 into respective slots or pockets 582 in the base at the corners thereof . the corner pockets may be raised to facilitate insertion and removal of the tabs . fig1 further illustrates that cover 578 may be used to secure pads used in previous embodiments to a base such as base 580 . note that the underlayment of pad 584 of fig1 includes a plurality of slots 586 for receiving the knee pad retaining straps 581 . the compressibility factor ( including material property and physical dimensions and shape ) of the collapsible or suspension members disclosed herein can be varied to accommodate different user weight ranges and to accommodate a user &# 39 ; s desired cushioning factor . the cover can be secured using a variety of means as discussed in this disclosure . alternatively , the cover may include straps that secure the assembly directly to the user &# 39 ; s knees , such as elastic cord or adjustable straps that extend behind the knee of the user . the collapsible or suspension members may comprise a wide variety of materials , including , springs , pen cell foam , closed cell foam , air bag , molded eva , soft 3d fabric ( spacer mesh ), a resilient honeycomb structure , rubber , or any combination of these or other materials . the cushioning factor can also be selected according to body weight or according to average time spent kneeling / hour . for example , body weight ranges of 80 to 150 lb , 150 to 225 lb , and over 225 lb ; kneeling 10 min ./ hour , 30 min ./ hour and 50 min ./ hour . however more or fewer ranges may be specified . features of the various embodiments discussed herein can be mixed and matched in any manner of additional embodiments that are all within the scope of the invention regardless of whether or not explicitly discussed herein . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiments , it will be apparent to those of ordinary skill in the art that the invention is not to be limited to the disclosed embodiments . it will be readily apparent to those of ordinary skill in the art that many modifications and equivalent arrangements can be made thereof without departing from the spirit and scope of the present disclosure , such scope to be accorded the broadest interpretation of the appended claims so as to encompass all equivalent structures and products . moreover , features or aspects of various example embodiments may be mixed and matched ( even if such combination is not explicitly described herein ) without departing from the scope of the invention . for purposes of interpreting the claims for the present invention , it is expressly intended that the provisions of section 112 , sixth paragraph of 35 u . s . c . are not to be invoked unless the specific terms “ means for ” or “ step for ” are recited in a claim .

disclosed are knee pad assemblies , methods and systems comprising a knee pad base and an outer cover that forms the contacting surface of the knee pad . a removable cover may be secured to a knee pad base . replacement cover configurations may be provided that are adapted to various surfaces , including roofing , tile , wood , carpet , concrete and asphalt . the knee pad base can be adapted for different user weights and durations for wearing the pad . the outer cover can provide a floating suspension . the knee pad base may be held in place on knee of the user by various mechanisms . the restraint mechanisms can be adjusted by the user . the knee pad assembly can also include a tension / release mechanism so that strap tension is decreased or released when kneeling but increases tension or engage when the user stands to retain the knee pad in the desired location .

the following detailed description should be read with reference to the drawings in which like elements in different drawing are numbered identically . the drawings , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of the invention . examples of constructions , materials , dimensions , and manufacturing processes are provided for selected elements . all other elements employ that which is known to those skilled in the field of the invention . those skilled in the art will recognize that many of the examples provided have suitable alternatives that may also be used . fig1 shows a first embodiment of the guide wire 10 . core 20 may be 50 - 450 cm in length and 0 . 008 - 0 . 038 inches in diameter depending on the medical application . the distal portion 25 of core 20 may be tapered to provide flexibility to guide wire 10 . preferably the tapered distal portion 25 is formed by grinding 5 - 20 cm of core 20 . the tapered distal portion 25 may be ground into a conical shape with a circular cross - section or stamped such that it has a rectangular cross - section . core 20 may be formed of a super - elastic material such as the alloys of nickel and titanium , commonly known as nitinol . while nitinol is the most common super - elastic material , any of a variety of other super - elastic materials may be used for core 20 . other alloys by chemical name include ; cualni , cusn , cuzn , inti , nial , fept , mncu , and femnsi . a detailed discussion of super - elastic alloys and their processing is presented in u . s . pat . no . 4 , 925 , 445 to sakamoto and is herein incorporated by reference . in addition to super - elastic materials , linear - elastic materials may be used . linear - elastic materials are describe in u . s . pat . no . 5 , 238 , 004 to sahatjian which is also incorporated by reference . in general , linear - elastic materials are composed of the same alloys above . however , different material processing strategies are used to provide a wire which has many of the important characteristics of a super - elastic material without some of the difficulties related to machining , specifically grinding . as such , core 20 may preferably be formed of a linear - elastic alloy of nickel - titanium . surrounding core 20 is coil 30 . coil over core wires are well known in the art and are described in detail in u . s . pat . no . 5 , 147 , 317 to shank which is incorporated by reference . coil 30 may be made of a variety of metallic materials including super - elastic or linear - elastic materials such as nitinol , radio - opaque materials such as gold or tungsten , precipitation hardenable alloys such as the non - ferrous cobalt - based alloys mp35n or elgiloy ™ and the ferrous alloys such as k91 from sanvic corp . and ph455 from carpenter , or more conventional stainless steel alloys such as 304 . preferably coil 30 may be 0 . 001 - 0 . 015 inches in diameter , and made of 304 stainless steel . coil 30 is wrapped around substantially the entire length of core 20 . preferably , coil 30 is not wrapped around the tapered distal portion 25 of core 20 . coil 30 may be formed of flat ribbon ranging in dimensions 0 . 001 - 0 . 003 inches in thickness by 0 . 005 to 0 . 015 inches in width . coil 30 is wrapped in a helical fashion about core 20 by conventional winding techniques . the pitch of adjacent turns of coil 30 may be tightly wrapped so that each turn touches the succeeding turn or the pitch may be set such that coil 30 is wrapped about core 20 in an open fashion shown at 35 . preferably , the pitch coil 30 is such that the coils are tightly wrapped over most of the proximal portion of core 20 with the pitch of each turn changing such that coil 30 has an open wrap shown at 35 near the distal end of core 20 . varying the pitch of coil 30 allows guide wire 10 to have a more flexible distal segment . alternatively , coil 30 may be formed of cross - wound multifilar or multifilar single coil wire . multifilar cross - wound coils are described in u . s . pat . no . 4 , 932 , 419 to de toledo which is herein incorporated by reference . a cross - wound multifilar coil consists essentially of a first inner coil of multiple coil wires wound in a first helical direction and a second outer coil of multiple coil wires disposed about the first coil and wound in a second opposite helical direction . coil over core wires tend to wind up and store energy when torqued rather than transmitting the torque . multifilar coils provides less wind up and therefore lessen the potential for the distal tip of the wire to whip while the proximal end is being turned . bonding core 20 to coil 30 also improves the torque transmission of guide wire 10 . coil 30 may be bonded to core 20 along the length of core 20 or in discrete sections . bonding may be achieved in a variety of ways including using adhesives , brazing , welding , crimping , and swaging . welding may be done through any of the techniques known in the art including spot welding using laser or resistance welding or ball welding using laser or plasma welding . soldering may be done through any of the techniques known in the art and must include the step of preparing the surface of the nitinol core 20 by plating or etching . preferably the coil 30 will be bonded to the core 20 by laser spot welding thereby removing the need for preparing the surface of the core 20 . laser spot welding is also advantageous because it may be done through coatings . an alternative method of bonding the coil 30 to the core 20 is to provide a stainless steel hypotube ( not shown ) with an inner diameter dimensioned to closely fit about core 20 . the stainless steel hypotube may then be crimped onto core 20 and the coil 30 wound about the hypotube . the hypotube then provides a surface which is much easier to bound to a stainless steel coil 30 using conventional methods . metal a foils or other materials may also be used as an intermediate which facilitates bonding between the coil 30 and the core 20 . yet another bonding method utilizes the polymer jacket 40 of the distal tip . the polymer may be applied in a manner that allows the polymer to flow between the coil and core . the polymer will provide a high integrity bond which will help to prevent the polymer jacket from separating from the coil 30 and bond the coil to core 20 . in addition to the these improvements , the polymer coating will make a better transition from the core 20 to the distal portion 25 . a tip bonded in this manor provides a further improvement by producing coloration differences between the coil wire and polymer . these differences act as stripes for the detection of guidewire advance in endoscopy application . the distal portion 25 of core wire 20 may further include a polymer tip 40 . polymer tip 40 serves several functions . polymer tip 40 improves the flexibility of the distal portion 25 of core wire 20 . choice of polymers for polymer tip 40 will vary the flexibility of the distal portion 25 of core wire 20 . for example , polymers with a low durometer or hardness will make a very flexible or floppy tip . conversely , polymers with a high durometer will make a wire tip which is stiffer . polymer tip 40 also provides a more atraumatic tip for guide wire 10 . an atraumatic tip is better suited for passing through fragile body passages . finally , polymer tip 40 may act as a binder for radio - opaque materials . loading polymers with radio - opaque materials is well known in the art for producing a bright image under fluoroscopy and thereby allowing the user of guide wire 10 a better understanding of where the distal portion 25 of guide wire 10 is located within a patient &# 39 ; s body . suitable medical grade radio - opaque materials include tungsten , platinum , and iridium . suitable polymeric materials for polymer tip 40 include urethanes , elastomeric nylons such as pebax , silicones , and co - polymers . polymer tip 40 may be a single polymer , multiple layers , or a blend of polymers . coating ( not shown ) may also be done to the wire proximal to polymer tip 40 . hydrophobic coatings such as fluoropolymers provide a dry lubricity which improves guide wire handling and device exchanges . a second lubricious polymer ( not shown ) may coat distal portion 25 of guide wire 10 or the entire wire 10 . lubricious coatings improve steerability and improve lesion crossing capability . suitable lubricious polymers are well known in the art and may include hydrophilic polymers . guide wire 10 may further include a colored coating . colored guide wires are described in detail in u . s . pat . no . 5 , 739 , 779 to rowland which is herein incorporated by reference . in general , colored coatings may improve the visibility of the guide wire when it is being used in an endoscopic procedure . striping may also be done . striping allows the physician to gauge wire movement and position . striping may be achieved by spray coating different colors on the wire 10 . another way to stripe the wire 10 is to coat the wires of coil 30 prior to winding . fig2 depicts a second embodiment of the high performance coil wire where like elements are similarly numbered . all design advantages , materials of construction , and methods of manufacture are similar to those described above unless explicitly modified below . guide wire 10 is comprised of a solid core 20 surrounded by a coil 30 . the distal portion 25 of core 20 may be tapered as described above or preferably is not tapered . similar to the embodiment of fig1 , the distal portion 35 of coil 30 changes pitch to provide a softer less traumatic tip . guide wire 10 further includes a rounded tip 37 . tip 37 may be polymeric or a metal tip welded to the distal portion 35 of coil 30 . unlike common spring tipped guide wires , guide wire 10 does not have a safety ribbon connecting core 20 to tip 37 . instead guide wire 10 may include a polymer 40 which may be flowed into the space between coils 35 and the space between the distal portion 25 and tip 37 . as shown in fig2 , polymer 40 flows proximally from tip 37 and terminates at a distal facing surface of a proximal portion of coil 30 without any portion of the polymer 40 extending proximally of the distal facing surface of the proximal portion of coil 30 . suitable polymers are described above where choice of polymer may control the flexibility of the tip . polymer 40 may also be loaded with radio - opaque materials . finally , guide wire 10 may be coated as described above and may also include various colors or stripes . the distal portion of guide wire 10 is thereby provided with a very floppy tip which uses polymer 40 as a safety ribbon instead of a metallic safety ribbon . guide wire 10 is provided with the advantage that core 20 does not need to be ground . while the specification describes the preferred designs , materials , methods of manufacture and methods of use , those skilled in the art will appreciate the scope and spirit of the invention with reference to the following claims .

a high performance coil over - core guide wire . the guide wire incorporates a nickel - titanium core with a stainless steel coil to provide a wire with improved kink resistance and good pushability .

a maltogenic alpha - amylase ( ec 3 . 2 . 1 . 133 ) having more than 70 % identity ( particularly more than 80 % or 90 %, such as at least 95 % or 96 % or 97 % or 98 % or 99 %) with the novamyl sequence shown as seq id no : 1 may be used as the parent enzyme for designing sucrose tolerant variants . amino acid identity may be calculated as described in u . s . pat . no . 6 , 162 , 628 . for novamyl ( seq id no : 1 ), a 3d structure including a substrate or inhibitor as described in u . s . pat . no . 6 , 162 , 628 or in the protein data bank with the identifier 1qho or 1qhp may be used . alternatively , a novamyl variant may be used , such as a variant described in u . s . pat . no . 6 , 162 , 628 or in this specification , e . g . the variant f188l + d261g + t288p . a 3d structure of a variant may be developed from the novamyl structure by known methods , e . g . as described in t . l . blundell et al ., nature , vol . 326 , p . 347 ff ( 26 mar . 1987 ); j . greer , proteins : structure , function and genetics , 7 : 317 - 334 ( 1990 ); or example 1 of wo 9623874 . the inventors found that sucrose may inhibit novamyl by binding in the active site . docking of sucrose into the active site of novamyl ( using the software gold version 2 . 1 . 2 , cambridge crystallographic data centre , 12 union road , cambridge , cb2 1ez , uk and the protein part of the x - ray structure 1qho . pdb ) reveals a specific binding configuration as unique to sucrose . the cartesian coordinates for the sucrose atoms in this binding configuration , using the coordinate system of the x - ray structure 1qho . pdb are given in fig1 . the activity of a maltogenic alpha - amylase may be determined using an activity assay such as the manu method . one manu ( maltogenic amylase novo unit ) is defined as the amount of enzyme required to release one micro - mole of maltose per minute at a concentration of 10 mg of maltotriose substrate per ml in 0 . 1 m citrate buffer at ph 5 . 0 , 37 ° c . for 30 minutes . the amino acid sequence of a maltogenic alpha - amylase may be altered to decrease the sucrose inhibition . the inventors found that the alteration may be made at an amino acid residue having at least one atom within 4 ångstroms from any of the sucrose atoms when the sucrose molecule is docked in the 3d structure of the maltogenic alpha - amylase . using the novamyl structure 1qho and the sucrose docking in fig1 , the following novamyl residues are within 4 å : k44 , n86 , y89 , h90 , y92 , w93 , f188 , t189 , d190 , p191 , a192 , f194 , d372 , p373 , r376 . further the following positions have been identified as relevant : i15 , r81 , t87 , g88 , l196 , n371 or n375 of seq id no : 1 . the alteration may be a substitution or deletion of one or more of the selected residues , or one or more residues ( particularly 1 - 4 residues or 5 - 6 residues ) can be inserted adjacent to a selected residue . the substitution may be with a smaller or larger residue . a substitution to increase the size of the residue may diminish the space obtained by the docked sucrose molecule thereby preventing the binding of sucrose . amino acid residues are ranked as follows from smallest to largest : ( an equal sign indicates residues with sizes that are practically indistinguishable ): the substitution may also be such as to eliminate contacts with the sucrose molecule , in particular by moving or removing potential sites of hydrogen bonding or van der waals interactions . the substitution may particularly be with another residue of the same type where the type is negative , positive , hydrophobic or hydrophilic . the negative residues are d , e , the positive residues are k / r , the hydrophobic residues are a , c , f , g , i , l , m , p , v , w , y , and the hydrophilic residues are h , n , q , s , t . some particular examples of substitutions are i15t / s / v / l , r18k , k44r / s / t / q / n , n86q / s / t , t87n / q / s , g88a / s / t , y89w / f / h , h90w / fn / r / k / n / q / m , w93y / f / m / e / g / v / t / s , f188h / l / i / t / g / v , d190e / q / g , a192s / t , f194s / ln , l196f , n371k / r / fn / q , d372e / q / s / t / a and n375s / t / d / e / q . examples of deletions are deletion of residue 191 or 192 . an example of an insertion is ala inserted between 192 and 193 . the polypeptide may include other alterations compared to novamyl ( seq id no : 1 ), e . g . alterations to increase the thermostability as described in u . s . pat . no . 6 , 162 , 628 . in this specification , an amino acid substitution is described by use of one - letter codes , e . g . k44r . slashes are used to indicate alternatives , e . g . k44r / s / t / q / n to indicate substitution of k44 with r or s etc . p191 * indicates a deletion of p191 . * 192aa indicates insertion of one ala after a192 . commas are used to indicate multiple alterations in the sequence , e . g . f188l , d261g , t288p to indicate a variant with three substitutions . the amylase for use in high - sucrose dough may be selected so as to have mainly exo - amylase activity . more specifically , the amylase hydrolyzes amylose so that the average molecular weight of the amylose after 0 . 4 - 4 % hydrolysis is more than 50 % ( particularly more than 75 %) of the molecular weight before the hydrolysis . thus , the amylase may hydrolyze amylose ( e . g . wheat amylose or synthetic amylose ) so that the average molecular weight of the amylose after 0 . 4 - 4 % hydrolysis ( i . e . between 0 . 4 - 4 % hydrolysis of the total number of bonds ) is more than 50 % ( particularly more than 75 %) of the value before the hydrolysis . the hydrolysis can be conducted in a 1 . 7 % amylose solution by weight at suitable conditions ( e . g . 10 minutes at 60 ° c ., ph 5 . 5 ), and the molecular weight distribution before and after the hydrolysis can be determined by hplc . the test may be carried out as described in c . christophersen et al ., starch 50 ( 1 ), 39 - 45 ( 1998 ). an exo - amylase for use in high - sucrose dough may have a specified sugar tolerance . compared to its activity in the absence of sucrose , the amylase may have more than 20 % activity at 10 % sugar , more than 10 % activity at 20 % sucrose , or more than 4 % activity at 40 % sucrose . the sugar tolerance may be determined as described in the examples . the exo - amylase may have optimum activity in the ph range 4 . 5 - 8 . 5 . it may have sufficient thermostability to retain at least 20 % ( particularly at least 40 %) activity after 30 minutes incubation at 85 ° c . at ph 5 . 7 ( 50 mm na - acetate , 1 mm cacl 2 ) without substrate . the exo - amylase may be added to the dough in an amount corresponding to 1 - 100 mg enzyme protein per kg of flour , particularly 5 - 50 mg per kg . the exo - amylase may be non - liquefying . this can be determined by letting the exo - amylase act on a 1 % wheat starch solution until the reaction is complete , i . e . addition of fresh enzyme causes no further degradation , and analyzing the reaction products , e . g . by hplc . typical reaction conditions are e . g . 0 . 01 mg enzyme per ml starch solution for 48 hours . the exo - amylase is considered non - liquefying if the amount of residual starch after the reaction is at least 20 % of the initial amount of starch . the exo - amylase may have maltogenic alpha - amylase activity ( ec 3 . 2 . 1 . 133 ). the exo - amylase may be the amylase described in dk pa 2004 00021 , or it may be a novamyl variant described in this specification . the dough may have a sucrose content above 10 % by weight , particularly above 20 % or 30 %, e . g . 30 - 40 %. the flour content is typically 25 - 35 % by weight of total ingredients . the dough may be made by a conventional cake recipe , typically with cake flour , sugar , fat / oil and eggs as the major ingredients . it may include other conventional ingredients such as emulsifiers , humectants , gums , starch and baking powder . it generally contains such ingredients as soft wheat flour , milk or other liquids , sugar , eggs , chemical leaveners , flavor extracts and spices , as well as others that may or may not include shortening . the dough is generally heat treated , e . g . by baking or deep frying to prepare an edible product such as cakes including pound cake , yellow and white layer cakes , cakes containing chocolate and cocoa products , sponge cakes , angel food cake , fruit cakes and foam - type cakes and doughnuts . the amylase activity of a number of polypeptides were tested by incubation with phadebas tablets ( product of pharmacia ®) for 15 minutes at 60 ° c . in the presence of sucrose at various concentrations ( in % by weight ). the results are expressed in % of the result without sugar : a number of polypeptides were tested as in example 1 . the results are expressed as activity with 10 % sucrose in % of the activity without sucrose : the following variants are also considered of interest in the context of the present invention : the following amylases were tested for thermostability and sugar tolerance : bacterial alpha - amylase from b . amyloliquefaciens ( ban ™, product of novozymes a / s ), fungal alpha - amylase from a . oryzae ( fungamyl ®, product of novozymes a / s ), maltogenic alpha - amylase having the sequence of seq id no : 1 ( novamyl ®, product of novozymes a / s ), a novamyl variant having seq id no : 1 with the substitutions f188l + d261g + t288p , and bacterial alpha - amylase from b . licheniformis ( termamyl ®, product of novozymes a / s ). the five amylases were tested for exo - amylase activity as described above . the results show that novamyl and the novamyl variant had exo - amylase activity by this test , and the other three did not . each amylase was incubated at 85 ° c . at ph 5 . 7 ( 50 mm na - acetate , 1 mm cacl 2 ) without substrate , and the amylase activity was measured after 0 , 15 , 30 and 60 minutes heat treatment . the results are expressed as residual activity in % of the initial activity : the results show that the novamyl variant and termamyl were not deactivated by the heat - treatment . ban and fungamyl lose all their activity after 15 min while novamyl loses it gradually with heat - treatment time . the experiment was repeated in 10 % sucrose solution . the results are expressed as residual activity in % of the initial activity without sucrose : the results show that ban and termamyl were not inhibited by sugar while fungamyl and the novamyl variant were somewhat inhibited , and novamyl was heavily inhibited by sugar . the combination of sugar and heat - treatment shows that the novamyl variant and termamyl could be active during baking of cakes . termamyl and the novamyl variant fulfill the criterion for thermostability and sugar tolerance used in this invention . sponge cakes were made with addition of amylase as follows : ban ( 0 . 83 . 8 . 3 or 83 mg / kg flour ), novamyl ( 1 . 3 or 13 mg / kg flour ) or the novamyl variant used in example 1 ( 1 , 10 10 or 100 mg / kg flour ). a control cake was made without amylase . the cakes were baked according to the high ratio sponge sandwich cake ( hrssc ) method . after baking , the cakes were cooled down for 60 - 120 minutes , and the cakes were stored at room temperature in sealed plastic bags filled with nitrogen until analysis . the cakes were evaluated on day 1 , 3 , 7 or 23 . texture profile analysis ( tpa ) was performed as described in bourne m . c . ( 2002 ) 2 . ed ., food texture and viscosity : concept and measurement . academic press . the results showed that the increase in hardness was slower with increasing dosage of the novamyl variant . the addition of ban or novamyl had only a slight effect , and only at the highest dosage . the cohesiveness of the cakes decreased with storage time . the addition of the novamyl variant delayed this decrease . the addition of ban or novamyl had a slight effect , and only at the highest dosage . water mobility was characterized by low field nmr . the addition of the novamyl variant and ban increased the mobility , indicating that the two amylases were able to keep the cakes more moist . novamyl had virtually no effect . a small sensory evaluation of softness and moistness was performed on day 13 for the 3 cakes with the novamyl variant and the control cake . the cakes were evaluated regarding three parameters ; firmness , moistness and preferability . the control was the firmest , driest and least preferred . the higher dosage of the novamyl variant , the less firm ( softer ), moister and better liked . a large panel sensory evaluation was performed on day 13 . it was a paired comparison test where a control cake was compare to the cake with the novamyl variant at the highest dosage . a 30 - member panel was asked two questions ( 1 ) which cake is moister and ( 2 ) which cake is fresher . all panel members agreed on that the cake with the novamyl variant was moister and fresher . the preference was significant at a significance level above 99 . 999 %. to summarize , the data show that the novamyl variant had anti - staling properties and was able to improve moistness perception and moistness measured by nmr . the two other amylases had only a slight effect . cakes were made with addition of amylase as follows : ban ( 0 . 83 . 8 . 3 or 83 mg / kg flour ) or the novamyl variant used in example 1 ( 1 , 10 or 100 mg / kg flour ). a control cake was made without amylase . cakes were baked according to the high ratio unit cake ( hruc ) method . after baking , the cakes were cooled down for 60 - 120 minutes , and the cakes were stored at room temperature in sealed plastic bags filled with nitrogen until analysis . the cakes were evaluated on day 7 , 20 and 34 by the same methods as in the previous example . the increase in hardness was slower with the novamyl variant at the highest dosage . the addition of ban to the cake resulted in a low volume and a doughy cake which gave poor results in hardness measurements . the addition of the novamyl variant delayed the decrease in cohesiveness while ban did not influence it at all . the novamyl variant and ban were able to keep the cake more moist than the control . this increase in mobility of the free water could partly be explained by the cakes with ban and the novamyl variant being able to retain the moisture content . a small sensory evaluation on day 34 showed that the cake with the novamyl variant at the highest dosage was clearly better than the control cake ; it was more moist and it was less crumbly . over - all , there was an anti - staling effect of the novamyl variant at the high dosage , similar to the effect on sponge cakes in the previous example . the staling of hruc cakes was slower than sponge cakes but it was still evident that the novamyl variant had an anti - staling effect . the anti - staling effect was seen with texture analysis , nmr and sensory evaluation . ban showed anti - staling effects in hruc but it was sensitive to over - dosage which resulted in cake collapse and a doughy cake . sponge cakes were made with addition of the amylase of dk pa 2004 00021 at dosages 0 . 5 , 1 , 2 , 5 and 20 mg / kg flour and a control cake without amylase . texture and nmr was measured on day 1 , 7 and 13 . the addition of the amylase reduced the increase in firmness , especially at the highest dosage . the amylase also had a beneficial effect on the mobility of water which was correlated with the moistness of the cake . a blind sensory ranking evaluation performed on day 14 showed a ranking according to the dosage , the higher dosage the more soft and moist cake . the most preferred cake was the one with the highest dosage . the ingredients were scaled into a mixing bowl and mixed using an industrial mixer ( e . g . bjørn a r 5 a varimixer ) with a suitable paddle speed . 300 g of the dough was poured into forms . the cakes are baked in a suitable oven ( e . g . sveba dahlin deck oven ) for 45 min . at 180 ° c . the cakes were allowed to cool down at room temperature for 1 hour . the volume of the cakes was determined when the cakes had cooled down using the rape seed displacement method . the cakes were packed under nitrogen in sealed plastic bags and stored at room temperature until analysis . the cakes were evaluated on day 1 , 7 and 14 , two cakes were used at each occasions . the cohesiveness and hardness of the cakes was evaluated with texture analyser and the water mobility was characterized by low field nmr . the texture profile analysis ( tpa ) was performed as described in bourne m . c . ( 2002 ) 2 . ed ., food texture and viscosity : concept and measurement . academic press . the mobility of free water was determined as described by p . l . chen , z . long , r . ruan and t . p . labuza , nuclear magnetic resonance studies of water mobility in bread during storage . lebensmittel wissenschaft and technologie 30 , 178 - 183 ( 1997 ). the mobility of free water has been described in literature to correlate to moistness of bread crumb . compared to cakes with no addition of enzymes the volume of the cakes is not affected by the addition of the reference enzyme ( seq id no . : 1 ) nor by the addition of variants hereof , i . e . the cakes did not collapse upon addition of enzyme . the cohesiveness of the cakes decreased with storage time . the addition of variants of seq id no : 1 delayed this decrease as can be seen in table 1 . the free water mobility is correlated with the moist perception of the cake crumb , it decreases with time . the addition of the novamyl variants increased the mobility compared to the control , indicating that the amylases were able to keep the cakes more moist . results are listed in table 2 . the hardness of the cakes increased with storage time . the addition of variants of seq id no : 1 delayed this increase in hardness as can be seen in table 3 .

dough with a high sucrose content tends to inhibit the activity of an anti - staling amylase such as novamyl , making it less effective to prevent the staling of dough - based products with high sucrose content such as cakes . a good anti - staling effect in cakes can be achieved by using a carefully selected anti - staling amylase with certain properties . analysis of a 3d structure of novamyl shows that sucrose may inhibit by binding in the active site . sucrose docks into the active site of novamyl differently from the substrate or inhibitor in published models 1qho and 1qhp . this finding is used to design sucrose - tolerant variants .

as discussed in the furneaux et al . references cited above , aluminum can be anodized in acid to produce a uniform array of cells or openings having cylindrical pores which preferably branch from larger pore - size openings in one face of the film to smaller pore - size openings in the other face of the film . such filters are available in a variety of pore sizes , and ones having a pore size of the smaller pores of less than about 1000 nm are preferred for use in the present invention , although smaller or larger pore - sizes can be used depending on the final application of the liposomes . ( hereinafter , unless otherwise noted , “ pore size ” for such filters shall refer to the minimum pore size of the smaller pores .) at present , of the anopore ™ anodized aluminum porous filters commercially available from anotec separations , those of pore size under 200 nm are of the branched - pore structure , and those of pore size of 200 nm or larger are of uniform pore size from one surface to the other . when the desired average particle size of the liposomes is less than about 200 nm , then the preferred pore size of the filter is less than about 100 nm . these filters are also of the preferred branched - pore type structure . these aluminum oxide filters are hydrophilic ; they do not swell in aqueous solvents ; they have good organic solvent resistance ; and they have pores of uniform size which promote high flow - through characteristics . because of the properties of such films , it was found that liposomes could be extruded through them at relatively high flow rates under relatively low pressure ( see example 3 , below ). thus , aluminum oxide filters are shown to be superior for extruding liposomes over the previously known polymeric filters . in the present invention , the branched - pore filters are preferably used so that the liposomes enter the face with the smaller size pores and exit though the face with the larger size pores . however , as shown in the examples below , good extrusion can also be obtained with a filter mounted in the inverted position , so that the liposomes enter the large pore - size face . in accordance with the process of present invention , a population of liposomes substantially free of liposomes above a predetermined maximum size is produced from a suspension of liposomes , a portion of which are of sizes larger than the predetermined maximum size . the process includes passing the suspension of liposomes under pressure one or more times through an aluminum oxide porous film , such as one of the type described above . to determine whether a population of liposomes is “ substantially free of liposomes above a predetermined maximum size ”, the liposomes can be tested using a standard sizer . one such standard sizer is a malvern sizer , available from malvern instruments , malvern , england , which is described and used in some of the examples below . another sizer which can used to determine particle size distributions is a nicomp ™ laser particle sizer , available from hiac / royco instruments , menlo park , calif ., which is also described and used in some of the examples below . in the particle size distributions reported in the examples below , a test result indicating that 0 . 0 percent of the liposomes present in the population are above a given size indicates that the population is “ substantially free ” of such large - size liposomes . although not required , the particle size , and particularly the particle - size distribution , of liposomes may be made smaller and more uniform by extruding though a larger filter as a first step . for example , extruding the liposomes through a suitable filter of 2 - 10 micrometer size , such as one made from polytetrafluoroethylene ( ptfe ), as is well known in the art , will reduce the particle size and particle - size distribution prior to extruding through the aluminum oxide filter , and may thereby reduce the time for extrusion . the pressure during the extrusion will be varied depending upon the liposomes employed , their mean particle diameter and particle - size distribution , and the rate of flow desired . extrusion pressures may vary from about 200 to about 1000 psi ( 1 . 4 - 6 . 9 mpa ), but pressures of less than about 600 psi ( 4 . 2 mpa ) are preferred . in general , fewer extrusion passes are required when using the branched - pore type aluminum oxide filters of the present invention , as opposed to the previously known polycarbonate filters , for similar results in terms of particle size , particle - size distribution and flow rates . however , repeated extrusion passes through the aluminum oxide filters may be used to obtain a narrower particle - size distribution , and particularly to reduce all liposomes to below a predetermined maximum size . for example , 2 - 10 extrusions of the liposomes through the filters are preferred to decrease the particle - size distribution , thereby producing relatively uniform liposomes of high capacity in a rapid , efficient and inexpensive manner . multiple extrusions may also convert multilamellar vesicles to more desired oligolamellar or unilamellar forms . subsequent to the extrusion process of the invention , any free unencapsulated therapeutic agent or other solution can be readily removed , as by dialysis or diafiltration , leaving stable drug encapsulating liposomes of relatively uniform size . the resultant liposomes may be readily measured into uniform dosages for administration parenterally or orally . the invention will be further illustrated by the following examples , but the invention is not meant to be limited to the details described therein . three batches of liposomes ( hereinafter designated a , b and c ) were prepared as follows : 71 . 3 mg / ml egg phosphatidylcholine ( obtained from princeton lipids , princeton , n . j .) and 28 . 7 mg / ml cholesterol ( j . t . baker , phillipsburg , n . j .) were dissolved in 0 . 15 to 0 . 5 ml of methylene chloride and added to a 300 - mm citrate buffer solution ( ph 4 . 0 ) to make up a 1 - ml volume . the methylene chloride was removed by heating the mixture to about 40 ° c . to aid in the removal of the solvent , nitrogen was sparged through batches a and c , while batch b was heated under partial vacuum . the resultant liposomes were vesicles of various sizes and various size distributions . the initial size distributions of these liposomes prior to size reduction were measured on a malvern sizer 3600 e type with a 63 - mm lens , available from malvern instruments , malvern , england . the results are presented in table i , in which the mean diameters and size distribution ranges are expressed in micrometers ( um ). before extrusion , batch b was presized through a 5 - um pore - size mitex ™ ptfe filter ( millipore corp ., bedford , mass . ), and the mean diameter and distribution range for the batch b liposomes after presizing is included in the table . batches a and c were not put through presizing . the results show a considerable batch - to - batch variation in the size distribution of the unsized liposomes . in accordance with the present invention , the liposomes of example 1 were extruded five times under pressure through an anopore ™ 90 - mm diameter , 100 - nm pore size ( small pores ) branched - pore aluminum oxide filter of the type described above . the placement of the filter for batches a and b was with the input through the small - pore surface . good results were also obtained for batch c , which was extruded with the filter inverted so that the input was through the large - pore surface . the mean diameter of the liposomes and the particle - size distributions of the liposomes were measured after the indicated passes through the filter . the size distributions were measured on a nicomp ™ model 370 laser particle sizer , available from hiac / royco instruments , menlo park , calif . the results measured after each extrusion pass are summarized in table ii : for comparison , a sample of the liposomes prepared in batch c of example i was extruded through a total of eight passes , first five times through a 90 - mm diameter , 200 - nm pore size nuclepore ™ polycarbonate filters , two times through a 100 - nm nuclepore ™ filter , and once though a 220 - nm sterilization filter . ( nuclepore ™ filters are commercially available from nuclepore , inc ., pleasanton , calif .) a second sample was extruded in four passes through a 90 - mm diameter , 100 - nm pore size anopore ™ filter , in accordance with the present invention . as with the first sample , this sample was then passed through a 220 - nm sterilization filter . size data was measured after the pass numbers indicated in the first column . all of the extrusions were conducted at the same pressure of 400 psi ( 2 . 8 mpa ). the results are presented in table iii : the branched - pore type aluminum oxide filters of the present invention required fewer passes with a higher flow rate than the polycarbonate filters to obtain a similar particle - size distribution . an additional test was conducted to compare the size - reduction capabilities of a branched - pore type anodized aluminum oxide film with an equivalent pore - sized polycarbonate filter . the tests were performed using egg phosphatidylcholine and cholesterol liposomes , made in accordance with example 1 , with the liposomes in aqueous suspension at 100 mg / ml . for this example , the cholesterol was obtained from croda chemicals , new york , n . y . the initial size distribution , as measured on the malvern sizer , showed a median diameter of 10 . 9 um , and a range of diameters of 2 . 4 to 118 um . to facilitate submicron size reduction , the batch was processed twice through a 5 - um mitex ™ ptfe filter at a pressure of 100 psi ( 0 . 7 mpa ). after this step , the median diameter of the liposomes was measured as 3 . 5 um , and the range of diameters was 1 . 9 to 11 um . the batch was divided into two portions . portion number one was extruded through a 0 . 1 micrometer anopore ™ filter , and portion two was extruded through a 0 . 1 micrometer nuclepore ™ polycarbonate filter . the starting extrusion pressure for both portions was 300 psi ( 2 . 1 mpa ). the extrusion flow rate , particle size , and particle size distribution were measured for each pass through the filters . a total of five passes were performed on each portion . the results are presented in table iv : these data demonstrate that both filters are capable of producing similar size distributions with the same number of passes . however , the aluminum oxide filter used for the first portion required less pressure and operated at a much higher flow rate than the polycarbonate filter used for the second portion . all of the passes through the aluminum oxide filter were conducted at 300 psi ( 2 . 1 mpa ), with flow rates of 0 . 6 - 0 . 8 liters / min . when the extrusion was repeated using the polycarbonate filter , the initial pressure had to be increased from 300 psi ( 2 . 1 mpa ) to 500 psi ( 3 . 4 mpa ) just to complete the first pass through the filter at a very low flow rate of 0 . 02 liter / min . for passes 2 through 5 , a higher pressure of 700 psi ( 4 . 8 mpa ) was needed to maintain a flow rate of 0 . 2 - 0 . 3 liter / min . a further test was conducted to study the differences in the extrusion properties of liposomes with respect to the orientation of the 100 nm anopore ™ branched - pore filter used to size reduce the liposomes . as discussed above , the anopore 0 . 1 um branched - pore filter has a small - pore side , having 100 nm pores , and a large - pore side , having 200 nm pores . in this test , a comparison was made to determine the effects of passing aliquots of the same liposome material through the 100 nm anopore filters with the small - pore side upstream or with the large - pore side upstream . the test was performed using egg phosphatidylcholine and cholesterol liposomes , made in accordance with example 1 , with the liposomes in aqueous suspension at 100 mg / ml . the material was prepared in a single - five liter lot , mixed well , and divided into four 750 ml samples ( a - d ). samples a and b were extruded using the 100 - nm upstream orientation , and samples c and d used the 200 - nm upstream orientation . extrusion of the liposomes was carried out by passing them twice though the branched - pore filters , under 400 psig ( 2 . 8 mpa ) pressure . the particle size distributions of the filtered materials from each of the test samples were measured using a nicomp ™ sizer , as described in example 2 , and found to be generally equivalent . however , the time required to size reduce the liposomes was significantly less for samples a and b , with the 100 - nm filter side upstream , as opposed to samples c and d , with the 200 - nm filter side upstream . table v presents the mean particle size diameter in nanometers ( nm ) and the filtration time in minutes ( min ): the extruded material was then sterile filtered through a 220 - nm sterilization filter , of the same type used in the comparative example . the sterilization filter used in this test , and in the above comparative example , was a commercially available millipak ™ 200 filter supplied by millipore corp ., bedford , mass , and described as having a durapore ™ polyvinylidene difluoride ( pvdf ) tortuous path membrane . sterile filtration was considered complete when all of the material had passed through the sterilization filter , or when the steady stream of material had broken into a slow drip . the mean particle diameter ( nm ), the time required to pass through the filter ( min ), and the percent volume of material which passed through the sterilization filter were measured for each sample , and the results are presented in table vi : these data demonstrate that the sterile filtration was very efficient for samples a and b , in which almost all of the material successfully passed through the sterilization filter . in contrast , only about half of the volume of samples c and d was able to pass through the sterilization filter before the flow stopped . fig1 is a simplified top view , not to scale , of a filter assembly ( 10 ) made in accordance with a particular embodiment of the present invention , designed for use with a 90 - mm diameter anopore ™ filer . it should also be recognized that this filter assembly could also be used to house other types of filters as well , such as , for example , the nuclepore ™ filters used in the comparative tests in example iii above . fig2 is a simplified cross - sectional side view , not to scale , of figure assembly ( 10 ) cut along line 2 — 2 of fig1 . filter assembly ( 10 ) comprises a filter housing top half ( 11 ) and a filter housing bottom half ( 12 ), held together by a plurality of fastening screws ( 13 ). referring to fig2 filter unit ( 14 ) represents a 90 - mm anopore filter mounted on a drain disk ( nuclepore catalog # 231700 ) cut to 90 mm , which is in turn mounted on a 90 - mm teflon r coated mesh filter support ( millipore catalog # yy30 090 54 ). filter unit ( 14 ) is in turn mounted on a stainless steel filter support plate ( 15 ), which is provided with fluid passage means , such as transverse channels ( 16 ). support plate ( 15 ) sits into a seat portion ( 17 ) of filter housing bottom half ( 12 ), with the seat portion ( 17 ) provided with radial grooves ( not shown ) to channel the liquid which passes through the filter into liquid outlet ( 18 ). filter housing top half ( 11 ) includes a ring portion ( 19 ) which holds filter unit ( 14 ) in place when top half ( 11 ) is tightened down onto bottom half ( 12 ) by screws ( 13 ). in operation , the liquid to be filtered enters filter assembly ( 10 ) through liquid inlet ( 20 ), flows through filter unit ( 14 ) and filter support plate ( 15 ), and then is channeled out through filter outlet ( 18 ). preferably , housing top half ( 11 ) is provided with a relief outlet ( 21 ), by which a relief valve ( not shown ) can be connected to the housing . although filter assembly ( 10 ) has been described in terms of a “ top half ” and a “ bottom half ”, these references are for purposes of describing the structure , and do not reflect the orientation of the housing in operation . because the liquid being filtered is sent to the assembly at such relatively high pressures , it is believed that the assembly can be used in any orientation . fig3 is a schematic representation of an extrusion system made in accordance with the present invention . the liposome composition to be filtered is contained in a high pressure supply vessel ( 31 ), and the filtrate is collected in a similar receiving vessel ( 32 ). both of these vessels are shown as being equipped with stirrers to maintain the liposome mixtures , and heat jacketed for temperature control . the liquid exits supply vessel ( 31 ) through a bottom outlet , and is carried through a one or more filter assemblies ( 33 ), of the type described above , containing 90 - mm anopore ™ filters . the filter assemblies ( 33 ) are connected in parallel , with the number of such assemblies used determined by the desired total flow rate from supply vessel ( 31 ) to receiving vessel ( 32 ). from receiving vessel ( 32 ), the filtrate is forced through a sterilization filter ( 35 ), such as a millipak ™ 200 filter as described in example 4 above , and is then collected in a stirred holding vessel ( 36 ). in addition , a recycle line ( 34 ) may be provided to allow a portion of the output of receiving vessel ( 32 ) to be recycled to supply vessel ( 31 ). the terms and expressions which have been employed are used as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention claimed .

a method of sizing liposomes by passing a suspension of liposomes through an aluminum oxide porous film by entering the film via the smaller pores and extruded via the larger pores , under pressure , is disclosed . in a preferred embodiment , the porous film is a branched - pore type anodic aluminum oxide porous film . the process produces a population of liposomes substantially free of liposomes above a predetermined maximum size . also disclosed is an apparatus for carrying out the invention .

embodiments of the present invention are described below . it is , however , expressly noted that the present invention is not limited to these embodiments , but rather the intention is that modifications that are apparent to the person skilled in the art are also included . in particular , the present invention is not intended to be limited to sports shoes , but rather it is to be understood that the present invention can also be used to improve the foot climate of any article of footwear . further , only a left or right sole and / or shoe is depicted in any given figure ; however , it is to be understood that the left and right soles / shoes are typically mirror images of each other and the description applies to both left and right soles / shoes . generally , a sole in accordance with the invention includes at least three layers that may include several function specific components . each of the layers has one or more openings disposed therein , such that ventilation and air exchange may occur within the shoe , thus improving the climate properties of the shoe . the one or more openings in each layer partially overlap the openings in the adjacent layer when the shoe sole is fully assembled . by the arrangement of the three or more layers with openings that only partially overlap , a substantially greater number of openings can be provided in the insole layer without reducing the mechanical stability of the shoe . as a result , the heat and humidity generated can be removed directly from the foot sole much more quickly than with conventional shoe designs . a sole 100 in accordance with the invention is shown in fig1 . the sole 100 includes a support layer 10 arranged below an insole layer 1 and an outsole layer 30 arranged below the support layer 10 . the insole layer 1 includes a plurality of openings 2 , 3 and can act as a cushioning layer for the sole 100 . the support layer 10 may be reinforced from below by a support element 20 . alternatively , the support layer 10 may include a plurality of support elements 20 located at various locations along the sole 100 . the outsole layer 30 shown includes a forefoot part 31 and a rearfoot part 32 . alternatively , the outsole layer 30 may include additional sole elements . a tread layer 40 may be provided directly below the outsole layer 30 to improve traction . the tread layer 40 includes a front part 41 , which corresponds to the forefoot part 31 of the outsole layer 30 and a rear part 42 that corresponds to the rearfoot part 32 of the outsole layer 30 . the outsole layer 30 may also include a cushioning layer 70 . fig3 and 4 depict the sole 100 assembled , as indicated by the dashed arrows in fig1 . in addition , an upper 102 of a shoe 101 can be attached to the sole 100 , as best seen in fig1 . the insole layer 1 is depicted in fig2 and includes a plurality of generally circularly shaped openings 2 , 3 . alternatively , the openings 2 , 3 may have a shape other than circular , for example square , rectangular , elliptical , or any combination thereof . the openings 2 , 3 may be distributed over substantially the entire area of the insole layer 1 . generally , the openings 3 have a greater open area than the openings 2 to optimize the permeability of the insole layer 1 for air and humidity transfer . further , in order to avoid excessive local pressure on the foot sole and at the same time provide adequate ventilation , the openings 2 of the insole layer 1 are preferably smaller in the heel region 6 and / or the ball region 7 of the insole layer 1 . in one embodiment , the diameter of the openings 2 in these regions is only about 2 mm to about 3 mm , whereas the diameter of the openings 3 in the remaining regions of the insole layer 1 is about 4 mm to about 5 mm . in other embodiments , the openings 2 located in the heel region 6 and / or the ball region 7 may be substantially smaller than the openings 3 located in other regions of the sole . the openings 2 , 3 are interconnected on a bottom side 14 of the insole layer 1 by at least one channel . in the embodiment shown , a plurality of channels 4 , 5 are used . the channels 4 , 5 can be arranged on the top side 15 or the bottom side 14 of the insole layer 1 or can even be integrated into the insole layer 1 . it has been found , however , that in order to avoid excessive friction between the foot sole and the insole layer 1 , and for reasons associated with the manufacture of the insole layer 1 , an arrangement on the bottom side 14 is typically beneficial . in one embodiment , most of the larger openings 3 are connected to their respective next opening 3 only by a single channel 5 and the smaller openings 2 are interconnected by a grid - like pattern of crossing channels 4 . not all openings 2 , 3 need to be connected to other openings 2 , 3 . the insole layer 1 can be manufactured by , for example , injection molding or extrusion . extrusion processes may be used to provide a uniform shape . insert molding can then be used to provide the desired geometry of the open spaces , or the open spaces could be created in the desired locations by a subsequent machining operation . the insole layer 1 can be manufactured from any suitable polymeric material or combination of polymeric materials , either with or without reinforcement . suitable materials include polyurethanes ( pu ), such as a thermoplastic polyurethane ( tpu ), ethylene vinyl acetate ( eva ), or other comparatively soft material . other suitable materials will be apparent to those skilled in the art . by the repeated compression of the insole layer 1 from the mechanical loading of the shoe 101 during ground contact , a pumping action is caused , which quickly transports the humidity surrounding the foot sole down to the support layer 10 . for example , in the case of extreme physical activity , such as during a basketball game , hot and humid air develops below the foot sole in the interior of the shoe . in shoe soles 100 according to the present invention , the hot and humid air is transported through the openings 2 , 3 down to the support layer 10 . the network of channels 4 , 5 arranged on the bottom side 14 of the insole layer 1 allow a fast horizontal diffusion of the humidity to the adjacent openings 11 , 12 in the support layer 10 . this diffusion is facilitated by the repeated compression of the channels 4 , 5 on the bottom side 14 of the insole layer 1 , which act as small pumps . referring to fig1 , and 4 , the support layer 10 , together with the additional support element 20 , forms a frame or chassis around which the shoe 101 is built . the support layer 10 , in part , determines the mechanical properties of the shoe in which it is used , such as the response of the shoe to loads arising during a particular sport . the support layer 10 includes a forefoot part 21 having a generally planar shape and a rearfoot part 22 that three - dimensionally encompasses the heel of a wearer &# 39 ; s foot , thereby providing support . in one particular embodiment , the support layer 10 extends into the heel region 6 and the ball region 7 of the sole 100 to withstand particularly high mechanical loading on shoes in these areas during repeated ground contact and push - off motions . in addition , a plurality of openings 11 can be arranged in the toe region 9 and / or the arch region 8 of the sole 100 so as not to degrade the support provided by the support layer 10 . additional longitudinal supports 13 can be used to reinforce the stability of the support layer 10 in the toe region 9 , and struts 14 can be used to reinforce the support layer 10 in the arch region 8 . in addition , lateral flanges 24 can be provided on the support layer 10 with openings 12 to contribute to ventilation of the interior of the shoe 101 . the openings 11 , 12 are formed by a series of closely spaced , generally parallel bands or ribs 27 that form a grill or cage pattern and provide a moisture and air pervious structure . as best seen in fig1 b , the ribs 27 are generally circularly shaped and have a diameter of about 1 mm to about 2 mm and a spacing of about 2 mm to about 3 mm . the grill pattern is used to achieve a very low resistance to the flow of humidity and hot air while also maintaining the greatest stability of the sole 100 . alternatively , the openings 11 , 12 could be circular , rectangular , elliptical , or any combination thereof . the distribution of the openings 11 , 12 may affect the mechanical properties of the support layer 10 . for example , in one embodiment of the sole 100 , no openings are provided in the heel region 6 and the ball region 7 of the sole 100 , because these two regions of the sole 100 require a high degree of support in order to avoid excessive pronation or supination of the wearer &# 39 ; s foot . when the insole layer 1 is arranged on top of the support layer 10 , the hot and humid air coming down through the openings 2 , 3 can pass through the openings 11 , 12 in the support layer 10 . the majority of the openings 2 , 3 in the toe region 9 and the arch region 8 directly overlap with the openings 11 , 12 of the support layer 10 . the greatest density of the foot &# 39 ; s sweat pores are located in the toe region 9 and the arch region 8 of the wearer &# 39 ; s foot , therefore , openings in the sole 100 corresponding to those regions furthers the downward guidance of the hot and humid air . the humidity developing in the heel region 6 and the ball region 7 is at first “ pumped ” through the channels 4 , 5 along the bottom side 14 of the insole layer 1 , i . e ., along the upper side of the support layer 10 , until the closest opening 11 , 12 in the support layer 10 is reached . the support layer 10 can be manufactured by , for example , injection molding or extrusion . extrusion processes may be used to provide a uniform shape , such as a single monolithic frame . insert molding can then be used to provide the desired geometry of the open spaces , or the open spaces could be created in the desired locations by a subsequent machining operation . other manufacturing techniques include melting or bonding portions together . for example , the lateral flanges 24 may be adhered to the support layer 10 with a liquid epoxy or a hot melt adhesive , such as ( eva ). in addition to adhesive bonding , portions can be solvent bonded , which entails using a solvent to facilitate fusing of the portions . the support layer 10 can be manufactured out of substantially compression resistant plastic materials , which have the advantage of withstanding the mechanical loads arising during contact of the shoe with the ground and also have the required flexibility not to hinder movements of the foot , such as those that occur during the rolling - off and pushing - off phase of the gait cycle . in particular , the support layer 10 can be manufactured from any suitable polymeric material or combination of polymeric materials , either with or without reinforcement . suitable materials include : polyurethanes , such as a thermoplastic polyurethane ( tpu ); eva ; thermoplastic polyether block amides , such as the pebax ® brand sold by elf atochem ; thermoplastic polyester elastomers , such as the hytrel ® brand sold by dupont ; polyamides , such as nylon 12 , which may include 10 to 30 percent or more glass fiber reinforcement ; silicones ; polyethylenes ; and equivalent materials . reinforcement , if used , may be by inclusion of glass or carbon graphite fibers or para - aramid fibers , such as the kevlar ® brand sold by dupont , or other similar method . also , the polymeric materials may be used in combination with other materials , for example rubber . other suitable materials will be apparent to those skilled in the art . the specific materials used will depend on the particular application for which the shoe is designed , but generally should be sufficiently compression - resistant , supportive , and flexible to the extent necessary for a particular sport . the support layer 10 can be reinforced by a support element 20 disposed in the arch region 8 of the sole 100 . the support element 20 can be an open frame construction with a plurality of openings 23 , which may correspond to the openings 11 , 12 and the struts 14 of the support layer 10 . the support element 20 can affect the resistance of the sole 100 to foot movements , for example torsional movements of the forefoot with respect to the rearfoot . the support element can also control the longitudinal stiffness of the shoe 101 . the exact configuration of the support layer 10 and support element 20 can be varied to accommodate numerous applications . for example , different embodiments of the support layer 10 and / or the support element 20 will be used to customize the sole 100 and / or the shoe 101 for a particular activity . in addition , the support element 20 may be secured to the support layer 10 by adhesive bonding , solvent bonding , mechanical retention , or similar techniques . various alternative embodiments of the support layer 10 , 110 , 210 , the support element 20 , 120 , 220 , and the outsole layer 30 , 130 , 230 are schematically illustrated in fig5 to 8 . the support element 20 can be manufactured in any of the manners and materials as described hereinabove for the support layer 10 . although in the embodiment shown in fig1 the support layer 10 and the support element 20 are shown as separate components of the sole 100 , an integrated alternative is possible . for example , the support layer 10 and any support elements 20 can be produced as an integral component by dual injection molding . referring again to fig1 , and 4 , the outsole layer 30 is positioned below the support layer 10 and any additional support elements 20 . in the embodiment shown in fig1 the outsole layer 30 includes a forefoot part 31 and a rearfoot part 32 . the weight of the shoe 101 is reduced by the absence of any outsole material in the arch region 8 of the sole 100 . in addition , large recesses or openings 33 , 34 , 35 are disposed in the outsole layer 30 to facilitate the dispersion of the hot and humid air from the interior of the shoe 101 via the openings 11 , 12 in the support layer 10 to the outside air . essentially , the openings 33 , 34 , 35 do not affect the damping properties of the outsole layer 30 . the openings 33 , 34 , 35 are positioned such that they generally correspond with the openings 11 , 12 of the supporting layer 10 ; however , the openings 33 , 34 , 35 can be positioned to accommodate a particular application . because of the thickness of the outsole layer 30 , which is in the range of about 0 . 5 centimeters ( cm ) to about 2 cm , the openings 11 , 12 of the support layer 10 are not in direct contact with the ground . accordingly , this prevents humidity ( water vapor and / or fluid ) from easily entering the interior of the shoe 101 . if the shoe 101 is not used exclusively for indoor sports , then a breathable membrane 26 can be provided for complete watertightness . the breathable membrane 26 may be positioned between the support layer 10 and the insole layer 1 . the breathable membrane 26 may be made out of a breathable , but watertight , material that may further improve the climate properties of the shoe 101 , for example the gore - tex ® brand sold by w . l . gore & amp ; associates . the sole 100 includes enough openings arranged above and below the membrane 26 that the breathing properties of the membrane 26 are effective without endangering the overall stability of the shoe 101 . furthermore , the grill - like openings 11 , 12 of the support layer 10 protect the membrane 26 against damage from below . further , the membrane 26 prevents stones or dirt from entering the interior of the shoe 101 and , thereby prevents deterioration of the ventilation properties of the shoe 101 by clogged or closed openings . in the case of sports with high lateral loading , for example basketball , the outsole layer 30 can extend upwards over the edge of the sole 100 , as shown in fig4 . such an arrangement cushions against lateral ground contacts . in addition , the flexibility of the outsole layer 30 can be improved by strategically positioning one or more grooves 36 in the outsole layer 30 , for example to facilitate an easier rolling - off phase of the gait cycle . fig5 to 8 depict alternative embodiments of the outsole layer 30 , 130 , 230 . in the case of a sport such as tennis , which requires a high degree of lateral stability due to strong lateral loading , the embodiment shown in fig5 may be used advantageously . the traction properties of the sole 100 may be enhanced by the addition of a tread layer 40 below the outsole layer 30 . depending on the particular application , different materials can be used , such as tpu or suitable rubber mixtures that simultaneously provide high abrasion resistance and good traction . the shape of the tread layer 40 typically corresponds to the outsole layer 30 so that the ventilation properties of the sole 101 are not affected by the function specific selection of a suitable tread layer 40 . the tread layer 40 can also extend sideways over the edge of the sole 100 to improve grip during lateral ground contact of the foot . additionally , the outsole layer 30 can include a cushioning layer 70 to enhance the damping properties of the sole 100 . the outsole layer 30 , the tread layer 40 , and the cushioning layer 70 can be manufactured by any of the methods disclosed herein . in addition , the outsole layer 30 , the tread layer 40 , and the cushioning layer 70 can be manufactured from any of the materials described herein to suit their particular application . for example , the arrangement and materials used in the outsole layer 30 can affect the damping properties of the shoe 101 . as such , foamed materials , such as pu , eva , and like elastomeric materials , are recommended . these materials are subjected to a strong compression set during the course of their manufacture , such that they permanently keep their elastic damping properties even under high mechanical loading . with respect to the cushioning layer 70 , comparatively soft materials , such as pu or eva , are recommended . athletic shoes used in sports with many jumps and frequent changes of direction , for example basketball , typically extend upwards over the ankle joint to support the joint and protect against injuries . in one embodiment , the shoe 101 includes a flexible net - like protection element 60 , which is shown in fig9 in an unfolded position and in fig1 in its position proximate the ankle area 62 of the shoe 101 . in the finished shoe 101 , the element 60 is typically covered by a suitable air permeable fabric or mesh . the protection element 60 is made out of a flexible material , for example eva or a material based on a silicone elastomer . alternatively , other soft thermoplastic materials or a pu can be used . the protection element 60 is manufactured in a generally planar configuration and is folded or otherwise manipulated into shape and then secured in place within the shoe 101 . alternatively , the protection element 60 can be directly three - dimensionally shaped , for example by injection molding or other suitable techniques , and then bonded to the shoe 101 and / or sole 100 . the protection element 60 includes a plurality of openings 61 that improve the air permeability of this area of the shoe 101 . the shape and dimensions of the openings 61 will vary to suit a particular application . the dimensions are in the range of about 2 mm to about 4 mm , up to about 1 cm . the shape of the openings 61 can be circular , rectangular , elliptical , or any combination thereof . in the embodiment shown on fig9 and 10 , the openings 61 have an essentially rectangular shape . the protection element 60 provides good support and protection for the ankle joint , as well as improved ventilation of the interior of the shoe 101 , because it replaces commonly used denser materials . similar protection elements can also be used in other parts of the upper 102 , for example in the instep region 64 where excessive pressure may be caused by a lacing system 65 ( fig1 ) of the shoe 101 , without reducing the air permeability of the upper 102 . [ 0055 ] fig1 depicts a shoe 101 and sock 103 assembly according to one aspect of the invention . the shoe 101 includes an upper 102 and a sole 100 in accordance with the invention . the upper 102 can be a reinforced mesh material that includes bands or members 108 that are anchored to the sole 100 . the members 108 can provide the structural support for the lacing system 65 . the upper 102 can be attached to an edge of the sole &# 39 ; s support layer 10 by gluing , stitching , or other suitable techniques . alternatively , the upper 102 can be any known type or configuration of an upper . the upper 102 shown includes a lacing system 65 , which can be any conventional lacing system , such as laces or a hook and loop type fastener , such as the velcro ® brand sold by velcro industries b . v . the special sock 103 functions to improve the climate properties of the shoe 101 when used in combination with the sole 100 . the sock 103 , together with the sole 100 , forms an overall system that determines the thermophysiological conditions a foot is subjected to . these conditions are defined by the heat and steam transmission resistances , the steam or water absorption / emission , and the friction forces of the surfaces of the sock and the shoe . in one embodiment , the sock 103 includes a two layer mesh construction having an inside layer 104 with good diffusion properties and an outsole layer 105 with good absorption properties . the good diffusion properties of the insole layer 104 cause the sweat generated by the foot to be immediately transferred away from the skin to the outer layer 105 , for example by capillary wicking . the outside layer &# 39 ; s good absorption properties act as a storage for the humidity before it is transported to the ambient air through the openings in the layers of the sole 100 . these particular properties of the sock 103 can be achieved by using synthetic fiber materials , such as the polycolon ® brand sold by schöller , the dacron ® brand sold by dupont , or the rhoa ®- sport brand sold by rhodia . a shoe in accordance with the invention was compared to a conventional shoe , the results of which are represented by the graphs shown in fig1 a and 12 b . as can be seen , the shoe in accordance with the invention has substantially improved ventilation properties as compared to the conventional shoe . the testing was performed using a foot climate measuring sock , which made it possible to determine how fast humidity developing in the interior of the shoe is transported to the outside through the sole and the upper . a foot climate measuring sock is a cotton or polyester sock provided with capacitive sensors for measuring humidity and additional sensors for measuring temperature . since the sensors are very thin , they are not felt by the wearer of the sock . the data measured by the sensors is sent to a personal computer where the humidity and temperature results are analyzed . [ 0058 ] fig1 a shows the measurements taken during an approximately twenty - five minute test on a tread mill with a person wearing a shoe in accordance with the invention . the results are plotted on a graph where the y - axis represents the humidity index as measured in millivolts ( mv ) and the x - axis represents the length of the test as measured in hours , minutes , and seconds . the increase in humidity in the interior of the shoe is reflected in the increasing voltage plotted along the y - axis and represented as 110 . the graph represents a slow , generally linear increase from approximately 170 mv to approximately 400 mv , i . e ., an increase of about 330 mv over a period of about twenty - five minutes . [ 0059 ] fig1 b depicts the results of the same experiment , but performed with a person wearing a conventional sports shoe . note the scaling of the y - axis is different in the graph shown in fig1 b than in fig1 a . accordingly , to best illustrate the significant improvement of the inventive shoe , the voltage plot 110 of fig1 b is manually overlaid on the graph of 12 b . as can be seen , the voltage 120 , which is proportional to the humidity in the interior of the conventional shoe , rises rapidly from approximately 150 mv to approximately 800 mv , i . e ., an increase of about 650 mv over a similar twenty - five minute period . therefore , shoes in accordance with the invention reduce the increase in humidity in the shoe interior by almost 100 % with respect to conventional shoes . this result corresponds to reports by test subjects who noticed the improved foot climate properties of the inventive shoes , as compared to the conventional shoes . having described certain embodiments of the invention , it will be apparent to those of ordinary skill in the art that other embodiments incorporating the concepts disclosed herein may be used without departing from the spirit and scope of the invention . the described embodiments are to be considered in all respects as only illustrative and not restrictive .

disclosed are articles of footwear and soles therefor , in particular sports shoe soles that include openings for ventilation and vapor exchange . the soles include an insole layer with a plurality of first openings , a support layer with a plurality of second openings that partially overlap the plurality of first openings , and an outsole layer with at least one third opening that at least partially overlaps the plurality of second openings to provide fluidic communications through the sole from an interior of the shoe to an exterior of the shoe . a substantial portion of the plurality of first openings in the insole are interconnected to provide a path for diffusion . the shoes and soles can include a cushioning layer , a tread layer , a breathable membrane , and additional support elements . in addition , the shoes can be used with climate control socks to further enhance the climate control properties of the shoes .

referring more specifically to the drawings , for illustrative purposes the present invention is embodied in the apparatus generally shown in fig1 through fig1 , wherein like reference numerals denote like parts . it will be appreciated that the apparatus may vary as to configuration and as to details of the parts without departing from the basic concepts as disclosed herein . referring to fig1 and fig2 a finger flossing apparatus 10 in accordance with the present invention is generally shown . apparatus 10 generally comprises a thimble 12 , a pair of tines 14a , 14b extending from the distal end 16 of thimble 12 , and a section of dental floss 18 is horizontally suspended between the tips 20a , 20b of tines 14a , 14b , respectively . tines 14a , 14b can be configured to either be straight , or curved as shown in fig2 and are typically about 3 / 4 inches long . thimble 12 has an opening 22 sized and configured to receive the tip of a finger or thumb therein . the wall 24 of thimble 12 is preferably distally tapered to generally match a fingertip &# 39 ; s profile , and distal end 16 of thimble is generally convex . thimble 12 can be sized to accommodate all the varying finger sizes from children to adults , and thimble 12 is preferably fabricated from an elastic material , such as rubber , abs plastic or polypropylene , to better conform to the fingertip of the user and to provide a better grip when worn . where a collapsible elastic material is used , a band 26 is provided around opening 22 to hold open and facilitate placement of apparatus 10 over the tip of the finger or thumb , much like a finger cot . dental floss 18 is preferably fabricated from puffed teflon ™ or other similarly tough floss material . however , those skilled in the art will appreciate that use of apparatus 10 can be practiced with any type of dental floss . dental floss 18 is permanently affixed at points 28a , 28b adjacent tips 20a , 20b of tines 14a , 14b during manufacturing by an injection molding process that also forms thimble 12 and tines 14a , 14b of apparatus 10 . in this embodiment , tines 14a , 14b can either be rigid or semi - rigid . apparatus 10 manufactured in this manner is a single - use disposable article . to use apparatus 10 for flossing teeth , thimble 12 is inserted over the tip of any finger or thumb . since some manipulation of the finger or thumb within the mouth is necessary during flossing with apparatus 10 , the preferred finger used for flossing with apparatus 10 is the index finger , as most users have better control of their index fingers . thimble 12 is sized such that a fairly tight fit results with the finger is inserted therein , and the elasticity of thimble 12 serve to better grip thimble around the tip of the finger . a vacuum is also created after insertion of the finger into thimble 12 , which further aids in securely holding thimble 12 onto the finger or thumb . once thimble 12 is in place over the finger or thumb tips , apparatus 10 is maneuvered within the mouth so that dental floss 18 can be slid between teeth for flossing action . various other means for supporting dental floss 18 on thimble 12 are also contemplated . these alternative attachment means provide for the removal and replacement of dental floss 18 , thus rendering apparatus 10 reusable . for example , as shown in fig3 through fig6 an alternative embodiment and a second alternative embodiment of apparatus 10 is generally shown . dental floss 18 can include gripper handles 30a , 30b as shown in fig3 or gripper handles 32a , 32b , as shown in fig5 and fig6 which are disposed at each end of the dental floss as taught in u . s . pat . no . 4 , 016 , 892 , which is incorporated herein by reference . the gripper handles can be spherical as shown in fig3 elongated as shown in fig5 and fig6 or any other shape ( e . g ., hex , triangular , star - shaped , etc .) that is desired and convenient for attachment and use . to accommodate dental floss 18 having gripper handles , a channel or slot 34a , 34b is disposed adjacent each tip 20a , 20b of tines 14a , 14b . each slot 34a , 34b preferably has an opening 36a , 36b for the insertion of dental floss 18 therein . slots 34a , 34b and openings 36a , 36b are sized to receive and allow passage of dental floss 18 therethrough . to prevent dental floss 18 from slipping off during flossing , slots 34a , 34b preferably follow an arced or curvilinear path from openings 36a , 36b to receptacles 38a , 38b , respectively , which receive the gripper handles . in the embodiments shown , receptacles 38a , 38b are semi - spherical depressions to receive spherical gripper handles , but it will be appreciated that neither the shape of the gripper handles nor that of the receptacles is limited . in the embodiment shown in fig3 tines 14a , 14b are preferably sufficiently flexible that they can be flexed toward each other for attachment of dental floss 18 , and dental floss 18 preferably has a length slightly less than the distance between tips 20a , 20b when tines 14a , 14b are in a relaxed position ( no floss installed ). receptacles 38a , 38b are sized to be smaller than gripper handles 30a , 30b to prevent passage of gripper handles 30a , 30b therethrough . as dental floss 18 is placed in receptacles 38a , 38b , tines 14a , 14b are flexed toward each other . the tendency for tines 14a , 14b to return to their relaxed position serves to maintain constant tautness on dental floss 18 necessary for flossing . in the second alternative embodiment shown in fig5 and fig6 gripper handles 32a , 32b are inserted into receptacles 40a , 40b , respectively , as shown . receptacles 40a , 40b are disposed on wall 24 of thimble 12 below tines 14a , 14b , respectively . receptacles 40a , 40b are sized to snugly receive gripper handles 32a , 32b therein and to securely maintain said handles in place during flossing . the length of dental floss 18 , in conjunction with the position of receptacles 40a , 40a provides for tautness of dental floss 18 when placed on apparatus 10 . it will be appreciated that the means for suspending dental floss between the tines shown in fig3 and fig4 and between the tine and the thimble shown in fig5 and fig6 could be combined . for example , a hybrid could be configured where one gripper handle is retained by the tip of a tine as in fig3 while the other gripper handle fits into a receptacle in the thimble as shown in fig6 . referring also to fig7 and fig8 a third alternative embodiment 42 of the present invention is generally shown wherein still another means for supporting dental floss 18 from thimble can be seen . a single tine 14a extends from the distal end 16 of thimble 12 and dental floss 18 is suspended between tip 20a of tine 14a and thimble 12 . tine 14a is typically angled or curved , as shown in fig7 to better allow for the vertical suspension of dental floss 18 , and is preferably centered as shown in fig8 . dental floss 18 can be attached to either wall 24 or distal end 16 of thimble 12 . dental floss 18 is preferably fixedly attached to both tip 20a of tine 14a and thimble 12 during manufacture by an injection molding process . this embodiment is particularly well suited to flossing anterior teeth such as rear molars . it will also be appreciated that , as an alternative , dental floss with gripper handles could be used . here , the tip of the tine would be configured similarly to that shown in the alternative embodiment of fig3 and fig4 and the receptacle in the thimble would be like that shown in second alternative embodiment of fig6 . referring now to fig9 and fig1 , a fourth alternative embodiment of a dental flossing apparatus is generally shown . here , a second thimble 46 is used in conjunction with thimble 12 to allow for additional torque control and leverage during flossing . second thimble 46 is placed in tandem with thimble 12 and connected thereto by a bridge 48 . second thimble includes an opening 50 , a band 52 peripherally disposed around opening 50 , a tapered wall 54 extending from opening 50 and a convex - shaped distal end 56 . bridge 48 is attached to wall 24 of thimble 12 and wall 54 of second thimble 46 . tines 14a , 14b is fixedly attached and extends from distal end 16 of thimble 12 , as also shown in the first embodiment . it is also contemplated that tines 14a , 14b can extend from distal end 56 of second thimble 46 . it is further contemplated that tine 14a may extend from thimble 12 while tine 14b may extend from second thimble 46 . tines 14a , 14b are formed with thimbles 12 , 46 during manufacturing preferably by an injection molding process . the additional of second thimble 46 in tandem to thimble 12 permits two adjacent fingers to be used to floss which increases the user &# 39 ; s torque control and leverage especially when flossing hard to reach areas within the mouth . referring also to fig1 , a fifth alternative embodiment 58 of a dental flossing apparatus is generally shown . in this embodiment , a finger holder 60 is attached in tandem to thimble 12 by bridge 48 . finger holder 60 comprises a semi - circular member having a tapered wall 62 that extends to a cover 64 located adjacent its distal end 66 longitudinally separated approximately adjacent its midpoint . cover 64 and wall 62 form a void ( not shown ) configured to receive and hold a finger therein . finger holder 60 increases the user &# 39 ; s torque control and leverage . in fig1 through fig1 , a sixth alternative embodiment 68 of a dental flossing apparatus is generally shown . tines 14a , 14b are part of a tine assembly 70 that is detachable from thimble 12 . assembly 70 comprises a cross - member 72 connecting tines 14b , 14b together in a generally parallel fashion . a pair of legs 74a , 74b extend downwardly from cross - member 72 . legs 74a , 74b each includes a tang 76a , 76b , respectively , at their lower end , which is adapted to slidably engage within a pair of longitudinally - disposed grooves 78a , 78b along wall 42 of thimble 12 . grooves 78a , 78b are spaced approximately 180 ° apart and extend downward from distal end 16 of thimble 12 to approximately the mid - section of thimble 12 . a pair of recesses 80a , 80b are located within grooves 78a , 78b , respectively to serve as anchor points for tangs 76a , 76b . legs 74a , 74b are somewhat flexible and naturally spaced such that when tangs 76a , 76b are inserted into respective recesses 80a , 80b , legs 74a , 74b exert pressure on wall 24 of thimble 12 to help maintain tangs 76a , 76b within recesses 80a , 80b , during stresses encountered by dental floss 18 during flossing . it is contemplated that recesses 80a , 80b can be also located on wall 54 of second thimble 46 , providing the user the option of which thimble to place tine assembly 70 upon . in fig1 , a seventh alternative embodiment 82 of a dental flossing apparatus is generally shown . tine assembly 70 is adapted to attach onto thimble 12 which includes finger holder 60 tandemly attached thereto . the configuration and benefits provided by finger holder is discussed above with respect to fifth alternative embodiment 58 . referring to fig1 and fig1 , an eighth alternative embodiment 84 of a dental flossing apparatus is generally shown . dental floss 18 is attached onto thimble 12 by single tine 14a , and second thimble 46 is tandemly attached to thimble 12 by bridge 48 . in fig1 , a ninth alternative embodiment 86 of a dental flossing apparatus is generally shown . in addition to dental floss 18 attached to thimble 12 by single tine 14a , finger holder 60 is tandemly attached to thimble 12 . accordingly , it will be seen that this invention eliminates the problems commonly associated with flossing teeth by using a teeth flossing apparatus that is placed over the tip of a finger or thumb . although the description above contains many specificities , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . thus the scope of this invention should be determined by the appended claims and their legal equivalents .

a dental floss apparatus generally comprising a thimble , a pair of tines extending from the top surface of the thimble and a section of dental floss suspended between the tips of the tines . to floss , a forefinger or thumb is typically inserted into the thimble , which remains relatively fixed onto the forefinger or thumb by pressing the opposing forefinger or thumb on the same hand onto the side of the thimble . the thimble is sized and configured such that insertion of the forefinger or thumb causes a suction within the thimble that further aids holding the thimble . the section of dental floss across the tips is used to floss between the teeth . in an alternate configuration , a single tine extends upward from said thimble and dental floss is suspended between the tip of the tine and the thimble . in still another configuration , a second thimble is attached in tandem onto the first thimble for additional torque control . in lieu of the second thimble , a finger holder is attached in tandem onto the first thimble for torque control .

essentially , the invention relates to a hangover cure for persons who have ingested alcohol . the alcohol functions as a vasodilator , which means that when it is added to the bloodstream , it causes a dilation effect on the blood vessels . when added to the alcohol rich blood system , ephedra counteracts the effects of alcohol by acting as a vasoconstrictor thereby decreasing the size of the blood vessels , and relieving the perceived pressure on the brain . ephedrine , which is an extract of ephedra , is the nonproprietary name for the chemical substance - 2 - methylamino - 1 - phenylpropanol - 01 and while it is not regulated as a controlled substance under the controlled substances act ( csa ), it is listed as a chemical under that law . however , small doses of l - ephedrine are available off the shelf . one of the most common forms is ma huang a chinese herb sold over the counter in nutrition and vitamin stores . ephedrine is used as a stimulant and a bronchodilator and is chemically similar to drugs in the amphetamine group . it functions as a main ingredient in legally available energizers , nutritional suppliments , and dietary teas . essentially , ephedrine triggers a mild burst of energy when ingested into the body . in addition to the stimulant effects , which can include feelings of alertness and reduced appetite , ephedrine also relaxes bronchial muscles and dilates airways , and can cause an increase in blood pressure and heart rate . a synthetic form of the drug pseudoephedrine is found in over the counter and prescription cold and allergy products . charcoal is also used to help a person recover from a hangover because it functions as an adsorbent . adsorbents are chemically inert powders that have the ability to adsorb gasses , toxins , and bacteria usually in the gastrointestinal tract . charcoal is widely considered to be the emergency treatment of choice for virtually all drug and chemical poisoning . the adsorptive properties of charcoal can be greatly increased by treating it with various substances such as steam , air , carbon dioxide , oxygen , zinc chloride , sulfuric acid or phosphoric acid or a combination of some other substances at a temperature ranging from 500 degrees fahrenheit to 900 degrees fahrenheit . this treatment is commonly referred to as activation wherein the activating agent presumably removes substances previously adsorbed on the charcoal and , breaks down the granules of carbon into smaller ones having a greater surface area . for example , it has been estimated that one milliliter of charcoal has a surface area of 1000 m 2 . in addition to wood , many other substances can be used as a source for charcoal such as , sucrose , lactose , rice starch , coconut pericarp , bone , blood , various industrial wastes . the end product is a fine black odorless and tasteless powder that is free from gritty matter that is insoluble in water or other known solvents . furthermore , another supplement to this cure is vitamin b6 , also known as pyridoxine . this vitamin is involved in the formation of body protein and structural compounds , chemical transmitters in the nervous system , red blood cells , and prostaglandins . in addition , vitamin b6 is also important in maintaining hormonal balance and proper immune function . deficiency in vitamin b6 is characterized by depression , convulsions , glucose intolerance , anemia , impaired nerve function , cracking of the lips and tongue and seborrhea or eczema . those with the following health conditions : asthma , premenstrual syndrome , carpal tunnel syndrome , depression , morning sickness , and kidney stones reported positive responses when they supplemented their diet with vitamin b6 . because vitamin b6 is especially helpful in reducing nervous disorders , it forms a beneficial compliment to the effect of alcohol on the nervous system . in the following examples , the indicated compositions are intended for three separate embodiments . these compositions could be taken in the form of a capsule , a pill , or other forms of ingestion such as a drink containing the active ingredients . example 1 ma huang ( 6 wt % ephedra ) 334 mg elcema g - 250 powder cellulose 54 mg captex 300 8 mg magnesium stearate lubricant 2 mg sipernat 50s 2 mg the first embodiment of the invention is a 400 mg capsule that contains 334 mg of ma huang extract containing 6 wt . % ephedra ( approximately 20 mg of ephedra ), 54 mg of elcema g - 250 powder cellulose for binding , 8mg of captex 300 to aid in the encapsulation , 2mg of magnesium stearate lubricant , and 2mg of sipernat 50s as a flow aid . as stated above , the ephedra functions as a vasoconstrictor counteracting the effects of alcohol in the bloodstream . in addition , because alcohol can also act as a depressant on the body , the stimulating quality of ephedra also functions to counteract this side effect . furthermore , since ephedra acts as a decongestant , it also relieves the congestive symptoms commonly associated with hangovers . example 2 ma huang ( 6 wt % ephedra extract ) 167 mg charcoal 100 mg elcema g - 250 powder cellulose for 46 mg binding captex 300 8 mg magnesium stearate 2 mg sipernat 50s 2 mg the second embodiment of the invention is a 325 mg capsule that contains 167 mg of ma huang extract powder containing 6 % ephedra ( approximately 10 mg of ephedra ), 100 mg of charcoal , 46 mg of elcema g - 250 powder cellulose for binding , 8 mg captex 300 to aid in the encapsulation , 2 mg of magnesium stearate lubricant , and 2 mg of sipernat 50 s as a flow aid . in this case , the addition of the charcoal allows this dosage to function with greater headache relief because the carbon in the charcoal acts as a detoxification agent by extracting impurities in the intestinal system from the introduction of alcohol moving them to the large intestine for removal . furthermore , the addition of charcoal as an adsorbent in the digestive system will also relieve diarrhea , flatulence , and acidity in the stomach , symptoms that are common to most hangovers . example 3 ma huang ( 6 wt % ephedra extract ) 167 mg charcoal 100 mg vitamin b - 6 ( pyridoxine ) 25 mg elcema g - 250 powder cellulose for 46 mg binding captex 300 8 mg magnesium stearate 2 mg sipernat 50s 2 mg a third embodiment of the invention is a 350 mg capsule that is similar to the second embodiment but contains an additional 25 mg of vitamin b - 6 . in this case , the 25 mg of vitamin b6 is added to the capsule so that when it is adsorbed into the bloodstream , it helps to counteract any harmful side effects of alcohol in the bloodstream . for example , alcohol functions as a diuretic depleting a person &# 39 ; s body of water soluble vitamins and minerals . thus , because vitamin b - 6 is water soluble , a person experiencing a hangover may have relatively low levels of vitamin b - 6 . therefore , by adding vitamin b - 6 or any other type of water soluble vitamin , a person may recover from a hangover at a faster rate . all three of these embodiments are preferably presented in capsule form . in this way , the active ingredients of ephedrine , charcoal and vitamin b - 6 can be presented in powder form to enter the bloodstream more rapidly . once the capsule has been ingested , the gelatin outer coating breaks down and the powdered active and non - toxic ingredients that break down within the digestive system of a person and enter their blood stream . the solution shown in example 3 was used in a double blind randomized parallel study comparing the test product in example 3 to a placebo . thirty four volunteers between the ages of 21 and 45 were invited to participate in the study . after signing a consent form and answering questions on a questionnaire relating to their demographic characteristics , drinking habits and state of health , the volunteers were entered into the study . all of the volunteers followed the same procedure for the study . volunteers reported at the study site which was a hotel and signed the consent form . these volunteers were then examined by a physician and vital signs were then taken . upon approval to enter the study , a bal reading was taken , and the volunteers were free to drink at an open bar , and partake of a food buffet . the bar was open until 2 a . m . on saturday . at their discretion , volunteers went to their designated hotel room to sleep , after having vital signs taken , responding to a questionnaire relating to their symptoms , taking a physical sobriety exam administered by a physician , and taking a bal test . they were instructed not to have any alcohol after leaving the study premises , and to report for breakfast the following morning at 8 a . m . the following morning , the subjects were examined by a physician , wherein vital signs and bal were taken . the subjects then answered a questionnaire relating to their symptoms . next , the study drugs were then administered wherein there were 2 capsules of the test drug or placebo used in a double blind fashion . the two different drugs were applied across a random group using the answers to the questionnaire to equalize the frequency of the active drug and the placebo with patients having similar answers on the questionnaire . volunteers were then asked to have breakfast wherein no caffinated foods or beverages were served . at periods of one and two hours after the initial exam , the volunteers repeated the original procedure consisting of an examination by the physician , a reading of vital signs and a blood alcohol level ( bal ) reading . they then answered the same questionnaire relating to their symptoms . thus , the data was available at a baseline test at approximately 8 a . m . when the test products were first given , and then at one and two hour intervals following the administration of the test products . to determine the effects of the drugs repeated measures analysis of variance were performed on the percentage change in score from baseline at one and two hours after study products were administered . the baseline score was used to covariate . each of the five questions on the questionnaire was scored from 1 to 3 with 1 equaling an absence of a symptom and 3 equaling a severe symptom . thus , the total score for each participant could either equal 5 which is a complete absence of symptoms or 15 wherein all symptoms are severe . the reported scores of the active group receiving the dosage according to example 3 , and the placebo group receiving a placebo dosage are shown in table 1 below . based upon this test and the analysis of the results , the volunteers on the active product showed symptom improvement compared to the placebo . taking the value of 8 . 4 as the base measurement for both the active group and the placebo group , the best possible ratio for improvement would be 0 . 6 with the scores dropping to the minimum number 5 . after ingesting either the active group or the placebo group , the active group participants showed a greater and faster recovery at 9 am ( 6 . 89 score and 0 . 788 ratio ) than the placebo group ( 7 . 67 score and 0 . 93 ratio ) with these scores taken from the average score of approximately 8 . 4 at 8 am . in addition , at 10 am the active group participants also showed a greater and faster recovery ( 6 . 32 score and 0 . 755 ratio ) than the placebo group ( 7 . 06 score and 0 . 859 ratio ). these scores were then analyzed using a statistical analysis to determine the significance of the improvement for the active group . with this study , a statistical analysis was performed to determine the statistical significance of these values . a test result for the active group or the placebo group is statistically significant over the baseline if the p value is less than 0 . 05 ( p & lt ; 0 . 05 ). a repeated measures analysis of covariance ( baseline score and weight as covariates ) shows the improvement in the active group compared to the placebo group was significant ( p & lt ; 0 . 05 ). the symptoms of the users improved in both treatment groups in the second hour , as time became a factor in the alleviation of symptoms . the ratios after one hour post dosage were also significantly different ( p & lt ; 0 . 05 ) favoring the active treatment , based on an analysis of covariance . the second hour results favored the active treatment , but just missed statistical significance ( p & lt ; 0 . 08 ). in addition , looking at the individual scores , one hour after dosing , 9 of 19 ( 47 %) of the volunteers showed greater than 50 % improvement in the active group . in the placebo group 2 of 18 ( 11 %) of the volunteers showed a similar improvement ( p = 0 . 2 ), supporting the statistically significant difference in average results . more than 50 % improvement in symptom score is more than twice as probable with the active product than with the placebo . two hours after dosing , 13 of 19 ( 68 %) of the volunteers showed greater than 50 % improvement in the active group . in the placebo group only 7 of 18 volunteers ( 39 %) showed a similar improvement . thus , it seems apparent that the administration of this third embodiment of the invention helps to alleviate the side effects associated with the consumption of alcohol . accordingly , while several embodiments of the present invention have been shown and described , it is to be understood that many changes and modifications may be made thereunto without departing from the spirit and scope of the invention .

a cure for a hangover containing the active ingredient ephedrine in powdered form enclosed in a capsule . in a second embodiment this cure contains ephedrine and charcoal , while in a third embodiment , this cure contains ephedra , charcoal and vitamin b6 . the use of any one of the three embodiments reduces the symptoms associated with alcohol intoxication and hangovers thereby speeding up recovery . the ephedra , vitamin b - 6 and charcoal may be combined on a wt . % ratio of 1 : 2 . 5 : 10 . the ephedra may come in the form of ma huang having 6 % wt . % ephedra . one type of dosage is in the form of individual capsules having 10 mg of ephedra , 25 mg of vitamin b - 6 and 100 mg of activated charcoal . the recommended dosage would be two capsules so that users who are experiencing a hangover or alcohol related side effects may take up to 20 mg of ephedra , 50 mg of vitamin b - 6 and 200 mg of activated charcoal . this cure may also consist of a therapeutic method for curing the effects of alcohol consumption wherein this dosage could be taken after the consumption of alcohol .

the present invention provides a “ brushcard ”, which is planar until needed , lightweight , and completely portable . through its planar design this toothbrush is received by the consumer in a form similar in size and shape to a common credit card . yet it transforms easily to form a disposable toothbrush with handle . one or more recesses in the substrate allow for optional placement of a single use ( e . g . foil wrapper ) ration of toothpaste , dental floss , or other dental care adjunct . this unique design allows it to be stored in the most efficient manner without any adverse use of space . that it is similar in size and width to a common credit card it can easily be carried concealed on one &# 39 ; s person ( e . g . shirt pocket ) without protruding . the benefits of such a device are obvious in social or business settings . its shape , size and composition also allows it to be imprinted with a logo similar to and much in the way that a common credit card bears the mark of its issuer . this benefit the innkeeper who can have a promotional message or mark placed on the device , much in the way that a card key carries a corporate message . the card shape also allows for it to be dispensed through vending machines , in a candy rack or on the checkout counter . in other applications it can fit quickly into a lunchbox , be served with an airplane meal , or be included in an office food delivery . should the device be exposed in a social setting it would be difficult to distinguish it as a toothbrush prior to assembly . additional cost savings can be realized by providing an efficient , measured amount of toothpaste and floss to accompany each toothbrush . accordingly , the present invention provides a planar member with a plurality of sections . the planar member , also referred to herein as a “ brushcard ”, may be made of any number of materials , including but not limited to , fiberglass , teflon , ceramics , glass , silicon , mica , any number of different plastics ( including acrylics , polystyrene and copolymers of styrene and other materials , polypropylene , polyethylene , polybutylene , polycarbonate , polyurethanes , etc . ), resins and other polymers ; or any materials that would give the appearance , texture or size of a credit card . in certain other embodiments construction could be of cardboard , coated , waxed or pulp based paper , or a combination of material that allow it to be assembled and used as a toothbrush . the planar substrate is divided into a plurality of sections , each separated by a line or weakness , sometimes also referred to as “ crease guides ” or “ living hinges ”. in general this is a type of scoring , or thinning in the example of injection molded members , that allow easy folding of the planar member into a three dimensional device . in some embodiments the sections may be made independently and then attached , for example through tapes or other adhesives . each section of the planar member comprises a handle region and a bristle region , as is depicted in the figures . the bristles in one embodiment are formed or constructed out of polypropylene or similar material so as to allow the entire unit to be formed as a single unit e . g . injection molded . in other embodiments the bristles that ultimately form the brush are constructed of any number of materials , normally plastic materials , that are bound together in bundles and associated ( e . g . glued ) to the bristle portion of each section such that remain associated during use of the brushcard . in addition , bristles may be cut , channeled , chamfered , or shaped to allow the most efficient manner of dental cleaning , and may come in different stiffnesses ( e . g . soft , medium , hard ) depending on the consumer &# 39 ; s desires . the brushcard usually includes one or more recesses ( also referred to herein as “ reservoirs ”, “ storage spaces ” or “ wells ”) that serve several purposes . as depicted in the figures , the recesses generally allow the folded toothbrush to separate the bristle section from the handle section . in addition , the recess ( es ) can be used to store one or more aliquots of tooth care products . for example , small aliquots of toothpaste ( including toothpaste , tooth powder or other tooth cleaning agents , for example in foil or plastic containers ), mouthwash ( including mouth care products such as listerine ®), dental floss ( including small spools , threaders , etc ), toothpicks , orthodontic care products ( picks , brushes , etc . ), or any other tooth cleaning or mouth freshening compounds . in additional embodiments , particularly when the planar thickness of the device is not of concern , these toothcare products need not reside within the recesses in the planar form , but instead are included within a kit as outlined herein . in some embodiments , the recesses are present only after assembly ; for example , in case where increased strength of the planar member is desired , the recesses may be filled with the substrate and “ punched out ” prior to assembly of the toothbrush . for example , recess 70 in the figures may actually be plastic , that is separated from the remainder of the planar member by small columns of plastic , which allows the user to “ punch out ” the recess and then assemble the device . in one embodiment , the device may also allow for imprinting , stamping , or the adhering of a logo or design . this can be done in a variety of ways . in one embodiment , the kit comprises a cover can be made of any disposable materials , including the materials outlined herein for the member , including plastics , such as a plastic wrapper or shrink wrap , vinyl , waxed paper , cardboard , etc . in some embodiments , a thin cover is designed to slide over all or part of the brushcard , with the two components being configured to slide apart ; other embodiments utilize a “ wrapper ” type configuration where the cover is peeled / pulled off of the brushcard . this may be particularly useful when certain adhesives are used . similarly , a clear plastic wrapper can be used . separate printed instructions can also be optionally included in the kits . the cover can be imprinted , embossed , labeled , etc . with instructions , advertising , logos , etc . or any combination thereof . in some cases , the lettering and / or pictures can be molded as part of the brushcard , or can be applied later . the brushcard is assembled by folding , bending or connecting in any manner that configures the device to look and perform as a toothbrush . the sections of the device are held together after folding in any manner so as to form a single unit . thus , in one embodiment , the folded sections are held together using adhesive on one or more of the sections . thus , the device can be held together using an adhesive section or strip . as will be appreciated by those in the art , any number of suitable adhesives can be used , including glues , reversible adhesives , gums , pressure sensitive adhesives , etc . one embodiment utilizes approved by the fda for use in the mouth , e . g . denture adhesives . for example , suitable dental adhesives include , but are not limited to , karaya and sodium borate with or without acacia denture adhesive , ethylene oxide homopolymer and or carboxymethylcellulose sodium denture adhesive , carboxymethylcellulose sodium and cationic polyacrylamide polymer denture adhesive , ethylene oxide homopolymer and or karaya denture adhesive , polyacrylamide polymer ( modified cationic ) denture adhesive , carboxymethylcellulose sodium and or polyvinylmethylether maleic acid calcium - sodium double salt denture adhesive , polyvinylmethylether maleic anyhydride ( pvm - ma ), acid copolymer , and carboxymethylcellulose sodium ( nacmc ) denture adhesive . in some cases , the adhesive is a rubber , silicon or gel strip that adheres the sections together . in other embodiments the device may snap , insert , align or connect together or be formed using a combination of methods and attachments . for example , in one embodiment , one or more of the sections comprises tabs and tab holders that are used to snap the device into a three dimensional toothbrush . additional methods of securing the assembled device may include a strap , hinge , sleeve , band e . g . rubber , lock or pin . in some cases , the brushcard does not utilize particular holding means but instead relies on the user to hold it together during use . additional explanations and expansions of the invention are made by reference to the figures .

brushcards are provided . the brushcards include a planar member having a plurality of sections , each separated by lines of weakness , each section having a handle region and a bristle region . the planar member includes at least one recess , and the member is configured to fold into a toothbrush .

the aforementioned alkyloxypolyethyleneoxyethanols are biodegradable nonionic surfactants consisting of a mixture of ethoxylates of secondary alcohols having from 9 to 15 carbon atoms in the aliphatic hydrophobic chain , and which have an average of 3 to 5 , 7 , 9 , 12 , 15 , 20 , 30 or 40 moles of ethylene oxide , respectively in the hydrophillic entity . materials which correspond to the compositions are available commerically as tergitol 15 - s series of ethylene oxide derivatives manufactured by union carbide corporation ( i . e . 15 - s - 3 , 15 - s - 5 , 15 - s - 7 , 15 - s - 9 , 15 - s - 12 , and 15 - s - 15 .) one method for the manufacture of such nonionic surface active agents is believed to be set forth in u . s . pat . no . 2 , 870 , 220 of union carbide . a blend or combination of these secondary alcohol ethoxylates such as tergitol 15 - s - 3 added to tergitol 15 - s - 9 results in clear , easily handled materials for application . of the available ethoxylates of secondary alcohols , tergitol 15 - s - 9 is preferred . as indicated above , it is understood that these nonionic surfactants can be represented by the formula : ## str3 ## where n is from 9 to 15 and m is from 3 to 40 . the above nonionic surfactants in the same instances can be applied to targets ( buildings , soils , etc .) in technical strength if desired . however , because of the active nature of the secondary alcohol ethoxylates , it is recommended that they be admixed with a suitable carrier , this is especially true when applied to targets such as plants , foilage and animals . suitable inexpensive carriers that are preferred are either water or vegetable oil . other more expensive carriers can also be used . in accordance with my invention , the above nonionic surfactants are applied in an amount of approximately 8 oz . to about 16 oz . per acre . the amount of water or vegetable oil used as the carrier can vary considerably as long as about 8 oz . to about 16 oz . of the nonionic surfactant is applied to the plants per acre . because vegetable oil is capable of forming a much finer mist than is possible with water , a substantially less volume of oil can be used with the surfactant compared to the same amount of surfactant in water . the following examples are presented for the purpose of further illustrating and explaining the present invention and are not to be taken as limiting in any regard . ______________________________________tergitol 15 - s - 9 16 . 0 oz . water 250 . 0 gallons 250 . 16 - total solution in gallons______________________________________ this solution was sprayed on mature citrus trees with severe rust mite infestation . a rate of 250 . 16 gallons of solution per treated acre was used with temperatures in the low 60 ° f . range . after three days , the only detectable rust mites to be found were &# 34 ; inside &# 34 ; the canopy of the dense foliage of the trees . only carcasses of dead mites were detected in over 98 % of those trees inspected . depending upon the type of spray application , tests indicated that solutions including as little as 15 gallons of water could be applied per acre and be effective . this solution was applied to one acre of cotton severely infested with bollworms of approximately 1 / 4 inch to 1 / 64 of an inch in length by means of fixed - wing aircraft . within twenty minutes of application only bollworms one inch in length or larger were found alive in the field . ______________________________________tergitol 15 - s - 9 8 . 0 oz . vegetable oil 32 . 0 oz . 40 . 0 oz . total solution______________________________________ this solution was applied to cotton infested with bollworms , aphids and spider mites at the rate of 40 . 0 oz . per acre by means of a fixed - wing aircraft . within twenty minutes of application , no live pests were found . this solution was applied to the floor of a residential kitchen in a semi - tropical area of florida . it was noted that brown spiders , and two other types of insects , carpenter ants and a centipede died after being placed in contact with the wet floor within 10 minutes of contact . this solution was used as a &# 34 ; bath &# 34 ; for a dog which had been in contact with ticks and fleas found in hunting areas in south georgia . after being place in the bath container for a period of several minutes , no live parasitic insects were found on the dog . this solution was applied to peanuts during one entire production year . no other fungicide was applied until two weeks prior to digging . at that point the product bravo was applied at recommended rates . there was no leaf spot present when the fungicide bravo was applied . no additional insecticide was used during the production year to the acreage treated with the surfactant . the yield on the test areas was in excess of 1 . 75 tons / acre . this solution was applied to an area of a building foundation where termites were found . the solution was injected into the termite bed area beneath the surface of the soil . after a twelve hour period , the &# 34 ; bed &# 34 ; area under and around the infested area was excavated . all termites found , were dead . no other fumigant was used . this solution was sprayed around shrubs and ornamental flowers of a south georgia residence , where mosquitos were present in large numbers . spraying resulted in killing of the pests , with no reinfestation for a period of three days . stronger solutions of tergitol may result in leaf damage . a plot of land was tested and found to have a nematode count of 400 per test soil sample , which made the land unsuitable for raising cotton . in view of the soil unsuitability , peanuts were selected to be planted in the plot . the land was thereafter treated in accordance with my invention by first ground spraying with a solution consisting of tergitol 15 - s - 9 ( 16 ounces per acre ) and water ( 10 - 20 gallons per acre ) and thereafter tilling . the land was thereafter sprayed with a liquid composition from a plane at a per acre concentration of 8 - 16 ounces of tergitol 15 - s - 9 and 10 - 20 gallons of water . similar applications were made every 6 - 10 days for several months . at the end of several months another soil test was made and the nematode count was essentially zero per test soil sample . in addition , the peanuts were free of insects and white mold during the entire growing season . a plot of land was prepared for cotton by initially ground spraying approximately 16 oz ./ acre of tergitol 15 - s - 9 with 10 - 20 gallons of water / acre and then tilling the land . thereafter the cotton crop was periodically sprayed by air plane utilizing 8 - 16 oz . tergitol 15 - s - 9 and 3 - 5 gallons of water / per acre except when small worms were noted and then the tergitol 15 - s - 9 was applied at 8 - 16 oz . with 26 - 34 oz . of vegetable oil per acre . the spraying applications were effective in controlling eggs , bollworms , mites , white flies , and aphids . several orange trees in florida were treated for rust mites by spraying with a solution of approximately 2 oz . of tergitol 15 - s - 9 and approximately 15 gallons of water . the treatment eliminated the rust mite problems . the surfactant solutions of the present invention have also been tested and found effective for controlling lice on hogs , aphids on roses and pecan trees , mold on pecan trees , fungus on shrubs , and insects on garden and vegetable plants . in addition to the surfactants of the present invention being useful in controlling fungus , mites , nematodes , worms , mold and other insects , it is believed that the surfactants function as soil neutrilizers . as a result of some of the tests set forth above , it has been noted that the soil ph in the test plots has been increased and remains between approximately 6 . 5 to less than 7 . 0 without the use of lime being necessary . in one test plot , several acres of the soil were generally non - productive due to soil ph levels of less than 6 . 0 . after repeated applications of the surfactants as set forth above over an entire test plot , it was noted that the previously unproductive acres became productive . tests indicated that the ph levels had been raised to above 6 . 5 . although my invention has been described in connection with the above examples , it is not limited by these examples and should be construed in connection with the following claims and obvious equivalents thereof . for instance , tergitol 15 - s - 3 , 15 - s - 7 , 15 - s - 12 and 15 - s - 15 have been used for similar applications and the same rates as set forth in the examples in oil and / or water solutions with similar results being achieved . therefore , it is believed that the nonionic surfactants of the tergitol - 15 - s series are believed to fall within the scope of the present invention .

this invention relates to the discovery that a very particular kind of nonionic surfactant , namely an alkyloxypolyethyleneoxyethanol can be used as the sole active ingredient to control fungus , mites , worms , termites , nematodes and other insects . it is believed that these alkyloxypolyethyleneoxyethanols can be represented by the formula : ## str1 ## wherein n is from 9 to 15 and m is from 3 to 40 .

fig1 shows an adjustable rack of the present invention . in fig1 a bottom frame is defined by a front member , 1 , a pair of side members , 2 , and a rear member , 3 . pivotally attached to the front member of the frame is a bin suitable for holding merchandise . the bin is defined by a front wall , 4 , a pair of side walls , 5 , and a floor , 6 . the bin can pivot between two extremes . in one extreme the floor can be substantially parallel to the bottom frame . in the other extreme the floor can be substantially perpendicular to the bottom frame . attached to the rearward portion of the bottom frame and the rearward portion of the bin is at least one adjustable support member , 7 , suitable for maintaining a predetermined angle between the floor of the bin and the bottom frame . a multiplicity of legs , 8 , are optionally attached to the bottom frame . fig2 shows a cutaway view of one embodiment of the present invention . in fig2 the bin floor and walls are not shown . the bottom frame , legs and adjustable support members are similar to similarly numbered elements in fig1 . a bin frame , comprising front bin frame member , 9 , a pair of side bin frame members , 10 and a back bin frame member , 11 , is pivotally attached to the front member , 1 , by a pair of hinges , 12 . the rearward portion of the bin frame is connected to the rearward portion of the bottom frame by a pair of adjustable support members , 7 . fig3 shows one embodiment of an adjustable support member of the present invention . the adjustable support member comprises a finger , 21 , suitable for mating with a substantially round void , 22 , in a bottom frame member , 23 . rigidly attached to the finger , 21 , is a tube , 24 , capable of accepting a discrete sliding member , 25 , therein . the discrete sliding member , 25 , comprises a multiplicity of adjustment holes , 26 , each of which are capable of aligning with a tube hole , 27 , in the tube , 24 . to change the length of the adjustable support member , a predetermined adjustment hole , 26 , is aligned with the tube hole , 27 , and a pin , 28 , is inserted through the pair of aligned holes . the upper extent of the discrete sliding member comprises a mounting bracket , 29 , rotatably mounted to the discrete sliding member on an axle , 30 . the mounting bracket , 29 , preferably comprises a multiplicity of mounting holes , 31 , for attachment to the bin . one advantage offered with the present invention is the simplicity of operation and the rigidity of the adjustable support member . the adjustable support member can rotate on the axis defined by the finger , 21 , as shown by the arrows a and b . the mounting bracket , 29 , is also capable of rotating on the axis defined by the axle , 30 as shown by the arrows c and d . as the adjustable support member is lengthened the entire adjustable support member rotates on the axis defined by the finger , 21 , in the direction of arrow a and the mounting bracket , 29 , rotates on the axis defined by the axle , 30 , in the direction of arrow c . it would be apparent to one skilled in the art that this allows the entire bin to be raised and lowered with minimal manipulation since the only part of the adjustable support member which must be manipulated is the pin , 28 . fig4 shows another embodiment of the adjustable support member . in fig4 the finger , 21 , substantially round void , 22 , bottom frame member , 23 , tube , 24 , mounting bracket , 29 and axle , 30 , are similar to the similarly numbered elements in fig3 . the tube , 24 , comprises a threaded hole , 32 . a similarly threaded pin , 33 , mates with the threaded hole to abut against the continuously adjustable sliding member , 34 , and retain the continuously adjustable sliding member in place . the length of the adjustable support member can be altered by twisting the threaded pin , 33 , until it sufficiently disengages with the continuously adjustable sliding member to allow free movement of the continuously adjustable member within the tube . the continuously adjustable sliding member is then moved to the desired position in the tube , the threaded pin is then twisted to abut against the continuously adjustable sliding member . the mounting bracket , 29 , is secured to a bin member , 35 , by attachment means , 36 , such as glue , screws , nails , bolts and the like . fig5 shows a partial side view of a preferred embodiment of the bin of the present invention . the bin comprises a frame element , 37 , with a multiplicity of floor joist elements , 38 , attached thereabove . the wall element , 39 , is attached to the top of the bin by a multiplicity of attachment means , 40 , such as screws , nails , bolts and the like . the floor joist elements may be attached to the frame element by glue , screws , nails , or any similar attachment means known to the art . fig6 shows an embodiment of the present invention wherein the elements similar to those of fig1 are numbered accordingly . a shelf is slidably attached to the slotted front member , 41 , of the bottom frame . the shelf comprises a shelf frame member , 42 , shelf floor , 43 , and front wall , 44 . the shelf is attached to the front member of the bottom frame with drawer brackets ( not shown ) as known in the art . the overall shape of the produce table is preferably rectangular or square . other shapes are considered within the teachings of the present invention including triangular , semicircular , or multifaceted such as expected from half of a hexagon , octagon or the like . the bottom frame and bin may be the same shape or they may be of a different shape . limitations on the combinations of shapes available would be apparent to one skilled in the art yet the constraints to be considered are limited to those combinations which allow for a pivotal attachment at the front and a suitable mounting position for the adjustable support member in the rearward portion of the produce stand . the bottom frame is preferably a rectangle , or square , as illustrated in the drawings . also considered within the teachings of the present invention are frames which are shaped substantially like the letter &# 34 ; h &# 34 ;. while four sides are preferred it is considered within the teachings to employ a three sided frame and in fact this may be so preferred if weight is a concern for the intended application . the bottom frame members may be constructed from wood , metal , plastic , hardened resin , graphite and the like and the members may be secured one to the other in any conventional method including , nails , screws , bolts , glue , weld , rivet , framing brackets , or by common joining techniques such as rabbet joints , tongue and groove and the like , as known in the art . the bin configuration is preferably rectangular or square , as described above , yet other shapes are considered within the teachings of the present invention . the bin may comprise a frame such as that illustrated in fig2 with a floor and sides attached thereto . the bin may also comprise a floor element with the walls , adjustable support member , and pivotal attachment means attached directly to the floor . in this embodiment the floor member acts as the support frame and should be of sufficient strength to provide rigidity to the bin . a particularly preferred embodiment comprises a bin frame , substantially as illustrated in fig2 with a multiplicity of substantially parallel slats attached to the bin frame as illustrated in fig5 . walls are then attached to either the sides of the bin frame ( not illustrated ) or to the top of the slats as shown in fig5 . this embodiment is particularly preferred since water can be applied to the contents of the bin and the excess water will drop directly below the stand . the bin preferably comprises at least one wall to insure that contents do not fall out of the bin . it is most preferred that the one wall be on the same side of the bin as the pivotal connection to the bottom frame . up to four outer walls may be employed as would be readily realized by one skilled in the art . it would also be realized to one skilled in the art to include a multiplicity of walls within the outer walls to define compartments within which various items could be placed for display . it is preferable , but not necessary , for the produce stand to have a multiplicity of legs . it is most preferable that the length of the legs be adjustable as known in the art and it is most preferred that the legs have wheels in which the rotation of the wheels are capable of being locked and released as known in the art . the bin is pivotally mounted to the front member of the bottom frame . the pivotal mount is preferably a hinge . any conventional hinge known to the art is considered within the teachings of the present invention . a single hinge may be employed as well as a multiplicity of hinges . the finger may be unthreaded or threaded and preferably extends through the bottom frame member . to insure that the finger does not become dislodged from the bottom frame member a keeper is preferred such as a &# 34 ; c &# 34 ; shaped spring in a slot of the finger , a cotter pin , a threaded nut and the like . the tube may be substantially square , substantially round or any other shape commonly employed for tubes . it is most preferred that the tube and sliding member are substantially of the same shape . the sliding member may slide on the inside of the tube , as illustrated in the drawings , or it may slide on the outside of the tube . if the sliding member slides on the outside of the tube it is most preferably that the cross - section of the sliding member be shaped substantially like the letter &# 34 ; c &# 34 ; to allow the finger to traverse the open side of the sliding member . it would be apparent to one skilled in the art that the tube may be solid when the sliding member is exterior thereto and that the sliding member may be solid when the tube is exterior thereto . the holes in the sliding member and tube preferably align at various increments and the inserted pin maintains the alignment . the pin may go completely through the tube and sliding member or it may stop within the interior of the inner member . a threaded pin may be employed with , or without , associated holes in the sliding member . when the sliding member is exterior to the tube the threaded hole may be integral to the sliding member . drawer brackets are well known in the art and many varieties are commercially available and suitable for the invention described herein . most desirable is a drawer bracket which comprises a pair of tracks mounted to both the drawer and the frame wherein the tracks are capable of sliding one in the other .

an adjustable display rack is detailed which provides several advantages including ease of operation and stability . the adjustable display rack comprises a bottom frame , a bin pivotally mounted to the bottom frame , an adjustable support member connecting the rearward portion of the bottom frame and bin , optional legs , optional walls and optional drawers .

in the apparatus shown in fig1 a rotating frame 2 is mounted on a frame member 1 for rotating about an axis 4 which substantially coincides with the longitudinal axis of a subject 3 to be examined . an x - ray tube 5 and a radiation measuring arrangement 6 are mounted on the rotating frame 2 . the x - ray tube 5 is fixed to the rotating frame 2 , whereas the measuring arrangement 6 is arranged on a rail 9 for linear movement perpendicularly of the central ray of the x - ray tube 5 and the axis of rotation 4 . the rotating frame 2 is rotated about the axis 4 by a drive system 10 . another drive system 11 produces the linear scanning movement of the measuring arrangement 6 by means of a cable 12 . a box - shaped ( or cuboid ) compensating element 13 , of a strong plastics material equivalent to body tissue in its density , for example acrylic glass , is also fixedly connected to the rotating frame 2 . this compensating body 13 comprises , symmetrically to the axis of rotation 4 , a cylindrical recess into which a form - body in the shape of a ring 14 , which also consists of a strong plastics material equivalent to body tissue in its density , is slidingly inserted in a form locking manner . a contouring member 15 of an elastic material is attached to the inside of the ring 14 . this contouring member 15 can be filled with water by means of a pump ( not shown ) so that under selectable pressure it will fit firmly against the outside of the photographic subject , which may be the head of a patient , for example . the ring 14 is fixedly connected to a supporting table 17 by means of a bracket or plate 16 so that , despite the rotational movement of the compensating element 13 , no torque is applied to the photographic subject 3 resting on the supporting table 17 . the x - ray tube 5 is connected to an x - ray generator 18 which supplies it with constant electrical voltage of selectable magnitude . the radiation receiver 6 is connected via a circuit arrangement or measurand converter 19 to a computer 20 which delivers the data computed by it to a page printer 21 and / or to a data display unit 22 for documentation and / or visual evaluation . the drive system 10 for the circular movement and 11 for the linear movement are connected to a control device 23 which controls the two movements in accordance with a principle of motion to be explained hereinafter . the x - ray tube 5 is fixedly arranged on the rotating frame 2 and comprises a primary diaphragm 24 which is fixedly arranged in relation to the x - ray tube 5 and which determines the beam ( or aperture ) angle of the issuing x - rays in accordance with the scanning range of the measuring arrangement 6 . preceding the opening accommodating the photographic subject 3 with respect to the radiation direction is a diaphragm 25 which is displaceable parallel to the path of the measuring arrangement 6 and which is attached to a cable 26 by means of a supporting bar 7 . the cable 26 is moved by a drive system 27 including an adjustment motor 27a , the drive system 27 also being connected to the drive control device 23 . the diaphragm 25 has a narrow slit 28 which transmits a part of the x - radiation issuing from the x - ray tube 5 which is condensed by the primary diaphragm 24 . the x - ray beam allowed through by the slit 28 is used for penetrating the photographic subject 3 , and its cross - sectional spread perpendicularly of the layer under examination is equal to the thickness of that layer . parallel to this layer , the extent of the beam transmitted by primary diaphragm 24 is substantially equal to or less than the thickness of the layer . after the apparatus has been switched on , the drive control 23 initially actuates the drive system 10 which moves the rotating frame 2 into a starting position offset through 90 ° relative to the position illustrated . once this position has been reached , scanning of the object 3 to be examined begins with the drive systems 11 and 27 putting the measuring arrangement 6 and the diaphragm 25 into a linear scanning movement , during which the desired transversal layer of subject 3 is penetrated and scanned with the aid of the x - rays which have been condensed into a narrow beam by means of the diaphragm 25 . the linear scanning of parts 6 , 24 and 25 is shown in fig2 . during a scanning movement , the diaphragm 25 and the measuring arrangement 6 are displaced in the direction of the arrows 29 and 30 in such a way that , during its displacement , the measuring arrangement 6 is struck in each position by the x - ray beam which is defined by the aperture 28 of diaphragm 25 . the synchronous displacement of the components 6 and 25 is ensured by the control device 23 by way of the drive motors 11a , 27a , fig1 . a further position of the beam 31 and measuring arrangement 6 is indicated by dash lines at 31 &# 39 ; and 6 &# 39 ; in fig2 . the radiation which has penetrated the photographic subject 3 is measured by the measuring arrangement 6 and the measured values are fed by the circuit arrangement 19 into the computer 20 where they are initially stored . during each scanning movement , the output of the measuring arrangement 6 is probed ( or sampled ) by the circuit arrangement 19 in such a way that , during this movement , approximately 100 individual values are determined and fed into the computer 20 . on completion of the first scanning movement , the control device 23 actuates the drive system 10 which rotates the rotating frame 2 through an angle of , for example , 2 °. thereafter , the control device 23 again sets the drive systems 11 and 27 in motion in a direction opposite to the instance described above , so that a second linear scanning movement can take place . on completion of this second scanning movement , the control device 23 switches the drive system 10 on again so that the rotating frame 2 again rotates through an angle of about 2 °. thereafter the control device 23 reactivates the drive systems 11 and 27 so that a third scan can be carried out . this operation is repeated , for example , 90 times . during these scanning movements , the computer 20 computes an image of the penetrated layer on the basis of the measured values fed into it . this image appears either in digital form on the page printer 21 or on the data display unit 22 . fig3 illustrates a plan view of the photographic subject 3 . by way of example , the examined body layer 30 is illustrated . this body layer is scanned by an x - ray beam 31 which is condensed by means of diaphragm 25 ; namely through its slit 28 . in the example , the x - ray beam has an approximately circular cross - section whose diameter is equal to the thickness of layer 30 . however , it is also possible within the framework of the invention to limit ( or define ) the x - ray beam in such a manner that its cross - sectional spread , perpendicular to layer 30 , is equal to the thickness of this layer , and that , parallel to layer 30 , it is less than the layer thickness . it will be apparent that many modifications and variations may be effected without departing from the scope of the novel concepts and teachings of the present invention .

in an illustrated embodiment linear scanning of a narrow x - ray beam is produced by linear movement of an apertured diaphragm interposed between the x - ray source and the patient receiving space , a measuring arrangement being linearly moved in step with the diaphragm aperture so as to provide a desired number of samples such as one hundred , for each angular position of the components . in the illustrated embodiment a primary diaphragm is interposed between the x - ray source and the linearly movable diaphragm and serves to determine the beam angle in accordance with the scanning range of the measuring arrangement .

in the inventive method , apparatus and workflow a degree of correspondence between a virtual angiography from a cfd simulation and a real angiography scene is determined and this degree of correspondence is used to purposefully and iteratively optimize the cfd simulation . this degree of correspondence is based on the comparison between a virtual angiography and a real angiography from identical angulation and adjusted recording geometry of the individual patient . the inventive determination of the degree of correspondence in 2 - d is an alternative approach to sun et al . [ 4 ]. output data for this degree of correspondence is dynamic angiography scenes , which show the diffusion or passage of the contrast agent through the corresponding vascular system . the virtual dynamic angiography s * ( the values indicated by * always relate in the following to the data derived from the virtual angiography ) is obtained by means of cfd simulation . the time intensity curves tic i , j and tic * i , j are now obtained from these two scenes s and s * for each pixel ( or combination of several pixels ). in the next step one or also more characteristic variables can be extracted from these time intensity curves , as described in “ parametric color coding of digital subtraction angiography ” by strother et al . [ 5 ]. these can be time values and / or intensity values or intensity values at defined times . fig2 shows by way of example a time intensity curve ( tic ) with drawn - in characteristic variables , in which the blood flow is plotted as intensity i over time t . after a noise - like behavior of the bolus curve 10 the intensity i climbs to the intensity maximum 11 ( i max ), in order then to drop back to a noise level . the bolus curve 10 is furthermore characterized by its half - width 12 ( fwhm — full width at half maximum ), which lies between the mean rise and the mean drop of the bolus curve . the arrival time 13 ( t rise ) is the time that elapses until the occurrence of the contrast agent bolus at the point under examination and thus until the rise in the bolus curve 10 . the mean rise time 14 ( t rise , fwhm ) is the time that elapses until the occurrence of the half - width 12 of the bolus curve 10 , i . e . until the bolus curve 10 has reached half of the intensity maximum 11 ( i max ). the time until the intensity maximum 11 ( i max ) is called the maximum time 15 ( t max ). the rise time 16 or wash - in time ( t wash in ) characterizes the steep rise in the bolus curve 10 . the drop in the bolus curve 10 is characterized by the drop time 17 or wash - out time ( t wash out ). the duration of the occurrence of the contrast agent bolus is characterized by the bolus or maximum time 18 ( t peak ). in the following let t i , j or t * i , j be the extracted variable for each pixel i , j from both angiographies . this produces a degree of correspondence b i , j of both angiographies from a mathematical link between both values t i , j or t * i , j , such as a simple subtraction for example . this degree of correspondence is thus a two - dimensional field , which can be represented for example as an image ( e . g . color - coded ) and permits an evaluation of the correspondence between the virtual and the real angiography . theoretically this degree of correspondence can be determined as in sun et al . [ 4 ] as a mean quadratic error for the entire curves tic i , j and tic * i , j . however , this means it is then subsequently not possible to say anything about the nature of the deviation and thus it cannot be used for purposeful control of the cfd optimization . until now , however , the two angiography scenes have not been synchronized . in this application there are various excellent vascular regions in the angiography images , among which are the vascular regions into which the blood or the contrast agent flows . in an improved embodiment regions of interest ( roi ) in these vascular regions can be defined in both images . in this case one or more roi , or corresponding roi * in the virtual image can be selected such that they cover the vascular inflow regions . in a next step the mean value of the characteristic variable t i , j , or t * i , j under consideration can be determined : mwt i , j , or mwt * i , j . from a comparison of these mean values a normalization is calculated in the following . this can be a difference ( in the case of temporal values ) or a factor e . g . in the case of intensity values , as well as other algorithms . thus the normalized degree of correspondence b i , j of both angiography recordings can be balanced : it is especially advantageous if the contrast inflow curve from the real angiography scene is used for the ( initial ) cfd simulation . if the simulation of the virtual angiography is performed such that the virtual inflow of the contrast agent matches reality , a normalization can be dispensed with however , it can also happen that both curves are delayed in respect of one another at the time of inflow or have different grayscale values . in this case , depending on the question , normalization will bring an improvement . essential for the invention are the definition of a degree of correspondence and the use thereof to assess and optimize the cfd simulation individual to the patient which until now has not been possible in - vivo . in particular the missing information on the local flow , into and out of the vascular segment under consideration , can herewith be adjusted iteratively to the real recorded 2d angiography recordings . this results in an improvement in the cfd results . this is based on the idea of comparing a virtual angiography obtained from the cfd simulation with the real angiography , determining a degree of correspondence , or if there is a difference optimizing the cfd so that the correspondence becomes better . in the case of a patient a 3d subtraction angiography with a c - arm system of the cerebral vessels and one ( or more ) 2d subtraction angiography scenes are recorded . in a first step a 3d surface model is generated in the computer following a segmentation of the relevant vascular section around an aneurysm , which is then used as geometry for the cfd simulation . moreover inflow and outflow regions are established . fig3 shows a vascular segment 20 with an afferent vessel 21 as an example for the definition of the region of interest roi and the associated basic conditions flow q and pressure p , which vessel branches into a first efferent vessel 22 and a second efferent vessel 23 . the vascular segment 20 furthermore has an aneurysm 24 . the inlet to the afferent vessel 21 is formed by an inflow region 25 . the outlet of the first efferent vessel 22 is formed by a first outflow region 26 and the outlet of the second efferent vessel 23 by a second outflow region 27 . a flow q in ( t ) and a pressure p in ( t ) prevail in the region of interest roi in of the inflow region 25 . in the region of interest roi out1 of the first outflow region 26 a flow q out1 ( t ) and a pressure p out1 ( t ) are measured and in the region of interest roi out2 of the second outflow region 27 a flow q out2 ( t ) and a pressure p out 2 ( t ) are measured . the selected volume is adjusted here to the 2d angiography , i . e . an angulation and projection geometry corresponding to the 2d angiography are determined in the 3d angiography . if both recordings originate from an examination which involves no movement of the patient this is simple to calculate , but otherwise a registration must be performed . thus the inflow region 25 and the outflow regions 26 and 27 are now also established in the 2d angiography . in the following cfd simulation the propagation of an injected contrast agent is simulated , among other things . the temporal dynamics of the contrast agent inflow can be adjusted to the averaged time intensity curve from the 2d angiography . after the simulation a virtual 2d angiography is calculated by means of known angulation and projection geometry using forward projection ( drr ), as is described for example in de 10 2007 039 034 a1 . in a next step the normalized degree of correspondence b ′ i , j e . g . for the bolus arrival times of both angiographies ( real and virtual ) is calculated . if for example the typical vascular segment 20 with the afferent vessel 21 , the aneurysm 24 and the two efferent vessels 22 and 23 is considered , a further evaluation for control of an iterative cfd simulation can now take place . to this end the normalized degree of correspondence averaged in the roi of the outflow regions 26 and 27 of the two efferent vessels 22 and 23 is considered . if it lies within a predefined tolerance , the result of the simulation is satisfactory in respect of these parameters , but otherwise this can be interpreted as a too fast or too slow flow in the entire vascular segment 20 . physically this means that the basic condition of pressure difference between inflow region 25 and outflow regions 26 and 27 was selected suboptimally . this can happen , since the vascular resistance distally to the vascular arborization section under consideration is generally not known . the tolerances can for example be predefined by a user . it is thereby determined how closely both angiographies , the virtual and the real angiography , must correspond before the user is satisfied . if the normalized degree of correspondence is positive , the calculated flow is too low and in the subsequent cfd simulation the pressure difference or the pressure conditions must be increased at the outflow regions 26 and 27 ( or variables corresponding thereto such as flow rate at the inflow region 25 ). in the case of a negative value the pressure difference can be reduced correspondingly . if the correspondence in both outflowing vascular segments roi out1 and roi out 2 is different , this can be corrected individually for each segment by the individual selection of the parameters . another example of this is concerned with the vascular walls . in cfd simulations the vascular walls are increasingly treated elastically . a corresponding analysis can orient the regions of interest along the vascular walls . these are segmented to this end . the degree of correspondence is now determined locally for all pixels along the vascular wall and if values are too large the elasticity for the subsequent cfd simulation is adjusted . it is especially advantageous here if real angiographies from several angulations are present . the inventive method is explained in greater detail on the basis of a flow chart shown in fig4 . first comes an acquisition 30 of a 3d angiography image dataset for model generation 31 . in the further method step a recording 32 of a contrast agent propagation is generated by means of dynamic real 2d angiography . then a cfd simulation 33 is performed , wherein it is possible to input 34 blood flow parameters as basic conditions . a virtual 2d angiography 35 from angulation identical to the real angiography 32 and adjusted recording geometry of the individual patient is calculated from this data . then follows a determination 36 of a degree of correspondence based on a comparison between the virtual angiography 35 and the real angiography 32 and then a check 37 to see whether the degree of correspondence is sufficient , i . e . whether the degree of correspondence is within a predefined tolerance . if the degree of correspondence is insufficient , a change 38 in the basic conditions in terms of an optimization is performed . then follows a new optimized cfd simulation 38 , by means of which again a determination 36 is performed , followed by a check 37 on the degree of correspondence . if in contrast the degree of correspondence is sufficient , the degree of correspondence is output 40 , for example as a color - coded image and the end of the examination is initiated . a ( percentage ) figure , if a global correspondence is considered , as well as a local figure can be described , which then itself can be output as a color map ( degree of correspondence ). however , it is also possible to describe other values ( for example the time difference for the maximum grayscale values ). fig5 shows the method sequence or workflow of the inventive method with the following steps in greater detail : s 1 ) 3d imaging for model generation , e . g . by means of 3d rotational angiography . s 2 ) recording a contrast agent propagation by means of dynamic 2d angiography . s 3 ) initial cfd simulation and generation of a virtual 2d angiography . s 4 ) determining a degree of correspondence between real and virtual 2d angiography . s 5 ) if degree of correspondence is sufficient , continue with s 9 ). s 6 ) changing one or more basic conditions of the cfd simulation according to the result of the degree of correspondence . s 7 ) renewed , optimized cfd simulation with basic conditions changed in terms of an optimization . s 8 ) back to s 4 ). s 9 ) done — optimum cfd simulation was achieved . the result is an iterative optimization of cfd simulation results based on the comparison between real and virtual 2 - dsa recordings on the basis of a determination of a degree of correspondence between both recordings . image - based computational simulation of flow dynamics in a giant intracranial aneurysm ; david a . steinman , jaques s . milner , chris j . norley , stephen p . lownie and david w . holdsworth ; american journal of neuroradiology ( 2003 ), number 24 , pages 559 - 566 blood flow in cerebral aneurysm : comparison of phase contrast magnetic resonance and computational fluid dynamics — preliminary results ; c . karmonik , r . klucznik , g . benndorf ; fortschr röntgenstr 2008 ; 180 : 1 - 7 methodologies to assess blood flow in cerebral aneurysm : current state of research and perspectives ; l . augsburger , p . reymond , e . fonck , z . kulcsar , m . farhat , m . ohta , n . stergiopulos , d . a . rüfenacht ; j . neurorad .- 168 : 2009 ; pages 1 - 8 quantitative evaluation of virtual angiography for interventional x - ray acquisitions ; qi sun , alexandra groth , irina waechter , olivier brina , jürgen weese , til aach ; ieee ; 2009 ; pages 895 - 898 parametric color coding of digital subtraction angiography ; c . m . strother , f . bender , y . deuerling - zheng , k . royalty , k . a . pulfer , j . baumgart , m . zellerhoff , b . aagaard - kienitz , d . b . niemann , m . l . lindstrom ; ajnr am j neuroradiol ; 2010 ; www . ajnr . org ; pages 1 - 7

a method for simulating a blood flow in a vascular segment of a patient is proposed . a 3d image dataset of an examination region is recorded by a radiographic diagnostic device for generating a 3d vascular model . contrast agent propagation in the examination region is captured by a dynamic 2d angiography method for generating a real 2d angiography recording . a cfd simulation of the blood flow is performed in the 3d vascular model based on a blood flow parameter for generating a virtual 2d angiography recording . a degree of correspondence between the real and the virtual 2d angiography recordings is determined from identical angulation and adjusted recording geometry of the patient and compared with predefinable tolerance values . the cfd simulation is iteratively optimized while changing the blood flow parameter as a function of the comparison . the degree of correspondence is outputted when the optimum cfd simulation is achieved .

in order that the invention may be more fully understood , adjustable heimlich maneuver device 12 will now be described by way of example with reference to the accompanying drawings . fig1 - 6 illustrate adjustable heimlich maneuver device 12 . it is comprised of body 14 and strap 16 . body 14 has front surface 18 that has a concave shape , narrower at the front and top and wider at the back and bottom as illustrated in fig1 - 5 . body 14 &# 39 ; s back surface 20 has desk side support notch 22 embedded at approximately a 45 degree angle as shown in fig2 - 5 . it also has hand rest 28 across the bottom of back surface 20 for manually applying force to body 14 when victim is in prone position as in fig1 . strap 16 is a flexible strap that is either connected on each side of body 14 or body 14 has a slip fit slot through body 14 on which body 14 slides on strap 16 as shown in fig6 and is of sufficient length to allow even a small caregiver to reach around a very large adult . fig7 illustrates a standard use of adjustable heimlich maneuver device 12 as body 14 is shown placed between the navel and sternum and strap 16 is wrapped around the hands of a caregiver and utilized to pull body 14 rapidly upward in a jerking motion to expel a large burst of air by applying force to the stomach , diaphragm and lungs . the shape of body 14 &# 39 ; s front surface 18 is critical to the improved function relative to standard spherical shapes and is designed to fit between the navel and the sternum . the narrowing at the interface front edge allows for the force to be concentrated in a smaller area increasing the local pressure at point of attack . the top to bottom taper allows body 14 to be nestled close to the sternum directly over the diaphragm without putting pressure on the victim &# 39 ; s ribs which suffer the most damage from improperly applied heimlich maneuvers . the fact that strap 16 is quite long allows a similar application even though the victim remains seated , perhaps even slumped over as shown in fig8 . fig9 shows an application of adjustable heimlich maneuver device by a solitary victim . in this case the victim places back surface 20 of body 14 at desk side support notch 22 on any square cornered solid piece of furniture , places his abdomen against front surface 18 of body 14 and leans sharply in a rearward and down motion forcing a burst of air , clearing the breathing channel . fig1 shows yet another method of use of adjustable heimlich maneuver device 12 where the victim has already fallen to the floor . in this case the victim is rolled onto his back and body 14 is placed in the same position as before and the heel of the care giver &# 39 ; s hand is placed on hand rest 28 and a sharp downward and forward force is applied again forcing a burst of air through the larynx and clearing the air way .

this invention relates generally to a device to assist a smaller person in applying the heimlich maneuver to a larger person that is sitting , standing or lying prone on his back or in performing the maneuver on himself .

while the present invention may be embodied in many different forms , designs or configurations , for the purpose of promoting an understanding of the principles of the invention , reference will be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation or restriction of the scope of the invention is thereby intended . any alterations and further implementations of the principles of the invention as described herein are contemplated as would normally occur to one skilled in the art to which the invention relates . fig1 a and fig1 b illustrate the first preferred embodiment of the current invention , where a specimen dispenser is integrated within an ultrasound skin treatment device . fig1 a shows the front view of the proposed device . fig1 b shows the cross - section view along the center line 101 of fig1 a . the first embodiment , which represents the best mode of this invention , contains the following aspects : ( 1 ) an enclosure body 11 which is made of metal , alloy or plastics ; ( 2 ) an ultrasound transmission plate 12 for contacting the skin with a smooth treatment surface 13 and transmitting ultrasonic vibration generated by an ultrasound generator 16 to the target skin area ; ( 3 ) a skin treatment specimen container and a dispenser , collectively referred to as dispenser 14 that contains skin treatment specimen 19 which can be , but not limited to , liquid , gel , cream , paste and powder ; ( 4 ) a specimen outlet 15 existing on the same continuous surface 13 of the ultrasound transmission plate 12 , through which skin treatment specimen 19 is dispensed close to or , preferably , directly on top of the surface 13 that is to be in contact with the skin during skin treatment ; ( 5 ) an electronic control unit 17 containing electrical circuits , electronic components and necessary embedded software exists within the enclosure body 11 ; and ( 6 ) an electrical interface 18 exists between the ultrasound generator 16 and the electronic control unit 17 so that the performance of the ultrasound generator 16 can be controlled by the electronic control unit 17 . the electronic control unit 17 controls ultrasonic generation from 16 , and may also provide user interface , power supply and charging functions . additionally , the electronic control unit 17 may send electrical signals to the specimen dispenser 14 or receives electrical signals from the specimen dispenser 14 to achieve required skin treatment procedure through another electrical interface 140 that connects to the electrical contacts 141 on dispenser 14 . in the most preferred mode , the enclosure body is in an easy - holding oval shape and includes two continuous pieces — front and back pieces — which are mechanically coupled together . the specimen outlet 15 is on the front piece immediately coupled to the ultrasonic transmission plate 12 . in use , the back piece is for palm - holding . the device includes a wireless charger and thus it can be charged wirelessly . so , except the specimen outlet 15 , the device does not have any other outlet or connectors . as an example , fig6 a - fig . 6 c illustrates a typical exterior shape of the device 60 according to the present invention , wherein it contains a skin treatment surface 62 as a front piece and a specimen outlet 65 on the treatment surface 62 . the device 60 can be wirelessly charged when it is placed in the recharger frame 61 as shown in fig6 b and fig6 b . the dispenser 14 may have any of the below features : ( 1 ) the dispenser 14 can be removable , in other words , it may be taken out and installed back into the enclosure body 11 by the user ; ( 2 ) the specimen 19 may be replenished within dispenser 14 by the user after depletion of the specimen during skin beatification process , i . e . dispenser 14 may be re - used ; ( 3 ) the dispenser 14 may be disposable and for one - time use only , where specimen 19 is pre - filled within the dispenser before usage ; ( 4 ) the dispenser 14 can be configured as multiple dispensers containing same or different specimens such that the dispensers can be individually selected to dispense contained specimen ; ( 5 ) the dispenser 14 can be configured as a single dispenser with multiple specimen compartments that may contain same or different specimens , such that each compartment within the dispenser can be individually selected and dispense specimen ; ( 6 ) the dispensing of the specimen 19 is fulfilled by a manually exerted force to the dispenser , upon which a pressure generation component that is part of the dispenser , for example a lead , a lever , a gauge , a cap , a piston , or a stretched porch , forces the specimen 19 to flow out of the dispenser through the outlet 15 ; ( 7 ) the dispensing of the specimen 19 is fulfilled by an electrically powered driving mechanism that is part of the dispenser and operated by the electrical interface 140 located within the enclosure 11 body ; ( 8 ) the dispensing of the specimen 19 is fulfilled by an electrically powered driving mechanism that is part of the device and electrically controlled by the control unit 17 . the driving mechanism forces the specimen 19 to flow out of the dispenser through the outlet 15 . in other words , the dispenser can be any of : a removable and replaceable dispenser ; a refillable dispenser ; a disposable and for one - time use only dispenser ; an integrated dispenser having multiple sub - dispensers containing same or different specimens , the sub - dispensers being individually selected to dispense specimen therein ; and an integrated dispenser with multiple specimen compartments containing same or different specimens , each of the compartments being individually selected to dispense specimen therein . the dispenser 14 may also have any of the following features with one or more electrical contacts 141 that exist within the dispenser 14 . the dispenser 14 may include an embedded specimen dispensing or releasing mechanism that is controlled by the electronic control unit 17 through the electrical interface 140 and the contacts 141 . the dispenser 14 may include an embedded memory or data storage device for storing information such as , but not limited to : ( 1 ) information of the specimen contained within the dispenser 14 , which can be , but not limited to , specimen brand , name , type , original , composition , production date and expiration date , specimen level within the dispenser and ordering information ; ( 2 ) information of optimal or pre - set operational mode of the ultrasonic generator 16 through the electronic control unit 17 when the specimen 19 contained in dispenser 14 is to be used , where the operational mode can be , but not limited to , timing , ultrasonic vibration strength and location of the operation to be generated on transmission plate 12 ; ( 3 ) information of optimal or pre - set operational mode of the different dispensers 14 or difference specimen compartments within a single dispenser , where the operational mode can be , but not limited to , timing of specimen application from each different dispenser or each different compartment , amount of specimen to be dispensed from each different dispenser or each different compartment ; ( 4 ) the information of historic usage data of the device , the dispenser and specimen ; and ( 5 ) information that is created or input by the user ; and ( 6 ) biographic information of the user . the electronic control unit 17 may receive data stored in the dispenser 14 to display information to the user through visual , skin contact or sound effects . alternatively , the electronic control unit 17 may receive data stored in the dispenser 14 to operate the ultrasonic generator 16 in a specific manner determined by the information stored in the said data . the control unit 17 may also comprise another embedded memory or data storage device for storing information such as , but not limited to , device operation data , user skin information data , user personal and biometrics information , dispenser identification data . such stored information may be updated as needed . control unit 17 may also contain embedded programs that utilize all the information stored in the control unit 17 and dispenser 14 to operate and control the serum dispensing from dispenser 14 , as well as the ultrasound generator 16 . such embedded programs may also be updated for better function . alternatively , the electronic control unit 17 may send data to be stored in the dispenser 14 . the dispenser 14 may be recovered by the manufacture and data stored within the dispenser 14 may be retrieved . although fig1 a and 1b show dispenser 14 residing within the enclosure body 11 , in practice the dispenser 14 may also be externally attached to the enclosure body 11 . however , when attached , the lotion 19 is still dispensed through a conduit that connects from the inside to the outside of the enclosure body 11 and finally through the outlet 15 . thus , the attached dispenser 14 still functions as an integral part of the device . fig2 a and fig2 b illustrate the second preferred embodiment of the present invention , where a specimen dispenser is integrated within an electrically powered brush device for skin treatment . fig2 a shows the front view of the device and fig2 b shows the cross - section view along the center line 101 of fig2 a . the device according to this embodiment includes the following components : ( 1 ) an enclosure body 21 made of metal , alloy or plastics ; ( 2 ) a brush head 22 , which can have any of rotational , tapping , pulsating and vibration movements during skin treatment that are powered and controlled by a brush head driver 26 ; ( 4 ) various brush fiber 23 for skin treatment being attached to the brush head ; ( 5 ) a skin treatment specimen container and dispenser 24 that contains a skin treatment specimen 29 , which can be , but not limited to , liquid , gel , cream , paste and powder ; ( 6 ) a specimen outlet 25 that is either in the form of a clearance into the brush head surface where brush fiber ( s ) 23 are disposed , or in the form of a tube extruding from the brush head surface to a height slightly shorter than the maximum length of the brush fibers , and through the specimen outlet 25 , the specimen 29 is dispensed to the surface of the brush head 22 and , preferably , to the brush fibers 23 that are to be in contact with the skin during skin treatment ; ( 7 ) an electronic control unit 27 containing electrical circuits , electronic components and necessary embedded software exists within the enclosure body 21 ; ( 8 ) an electrical interface 28 that exists between the brush head driver 26 and an electronic control unit 27 so that the performance of the brush head driver 26 can be controlled by the electronic control unit 27 , where the electronic control unit 27 controls the motion of the brush head 22 via the brush head driver 26 and may , optionally , also provide user interface , power supply and charging functions . additionally , the electronic control unit 27 may send electrical signals to the specimen dispenser 24 or receives electrical signals from the specimen dispenser 24 to achieve required skin treatment procedure through another electrical interface 240 that connects to the electrical contacts 241 on dispenser 24 . the dispenser 24 may have any of the below features : ( 1 ) the dispenser 24 is removable , i . e ., it may be taken out and installed back into the enclosure body 21 by the user ; ( 2 ) the specimen 29 may be replenished within dispenser 24 by the user after depletion of the specimen during skin beatification process , i . e . dispenser 24 may be re - used ; ( 3 ) the dispenser 24 may be disposable and for one - time use only , where specimen 29 is pre - filled within the dispenser before usage ; ( 4 ) the dispenser 24 can be configured as multiple dispensers containing same or different specimens may be installed in one enclosure body 21 , such that dispensers can be individually selected to dispense contained specimen ; ( 5 ) the dispenser 24 can be configured as a single dispenser with multiple specimen compartments that may contain same or different specimens , such that each compartment within the dispenser can be individually selected and dispense specimen ; ( 6 ) the dispensing of the specimen 29 is fulfilled by a manually exerted force to the dispenser , upon which a pressure generation component that is part of the dispenser , for example a lead , a lever , a gauge , a cap , a piston , or a stretched porch , forces the specimen 29 to flow out of the dispenser through the outlet 25 ; and ( 7 ) the dispensing of the specimen 29 is fulfilled by an electrically powered driving mechanism that is part of the dispenser and operated by the electrical interface 240 located within the enclosure 21 body ; ( 8 ) the dispensing of the specimen 29 is fulfilled by an electrically powered driving mechanism that is part of the device and electrically controlled by the control unit 27 . the driving mechanism forces the specimen 29 to flow out of the dispenser through the outlet 25 . the dispenser 24 may also include an embedded specimen dispensing or releasing mechanism within the dispenser 24 that is controllable by the electronic control unit 27 through the electrical interface 240 and one or more electrical contacts 241 embedded in the dispenser 24 . the dispenser 24 may also include an embedded memory or data storage device 242 within dispenser 24 for storing information such as , but not limited to : data stored in digital format by an embedded memory or data storage device within dispenser 24 that may contain any of the below information : ( 1 ) information of the specimen contained within the dispenser , such as but not limited to , specimen brand , name , type , original , composition , production date and expiration date , specimen level within the dispenser and ordering information ; ( 2 ) information of optimal or pre - set operational mode of the brush head 22 through the control electronics 27 when the specimen 29 contained in dispenser 24 is to be used , such as but not limited to , timing , motion type , motion strength and sequence of motions of the brush head 22 ; ( 3 ) information of optimal or preset operational mode of the different dispensers 24 or difference specimen compartments within a single dispenser , such as but not limited to , timing of specimen application from each different dispenser or each different compartment , amount of specimen to be dispensed from each different dispenser or each different compartment ; ( 4 ) information of historic usage data of the device , the dispenser and specimen ; ( 5 ) information that is created or input by the user ; and ( 6 ) biographic information of the user . the electronic control unit 27 may receive data stored in the dispenser 24 to display information to the user through visual , skin contact or sound effects . the electronic control unit 27 may receive data stored in the dispenser 24 to operate the brush head 22 in a specific manner determined by the information stored in the said data ; the control unit 27 may also comprise another embedded memory or data storage device for storing information such as , but not limited to , device operation data , user skin information data , user personal and biometrics information , dispenser identification data . such stored information may be updated as needed . control unit 27 may also contain embedded programs that utilize all the information stored in the control unit 27 and dispenser 24 to operate and control the serum dispensing from dispenser 24 , as well as the brush head driver 26 . such embedded programs may also be updated for better function . alternatively , the electronic control unit 27 may send data to be stored in the dispenser 24 . the dispenser 24 may be recovered by the manufacture and data stored within dispenser 24 may be retrieved . although fig2 a and 2b show dispenser 24 residing within the enclosure body 21 , in practice the dispenser 24 may also be externally attached to the enclosure body 21 . however , when attached , the lotion 29 is still dispensed through a conduit that connects from the inside to the outside of the enclosure body 21 and finally through the outlet 25 . thus , the attached dispenser 24 still functions as an integral part of the device . fig3 a and fig3 b illustrates the third preferred embodiment of the current invention , where a specimen dispenser is integrated within an electrically powered skin massaging device for skin treatment . fig3 a shows the front view of the proposed device . fig3 b shows the cross - section view along the center line 101 of fig3 a . the embodiment contains the following components : ( 1 ) an enclosure body 31 made of metal , alloy or plastics or a combination thereof ; ( 2 ) a skin massaging tip 32 for contacting the skin with a treatment surface 33 and transmitting the mechanical massaging motion to the target skin area , where the massaging motion of the massaging tip can be , but not limited to , vibration , pulsating , rotation , tapping , expansion and contraction ; ( 3 ) a motion generator 36 which generates the massaging motions ; ( 4 ) a skin treatment specimen container and dispenser , herein after collectively referred to as dispenser 34 , that contains specimen 39 which can be , but not limited to , liquid , gel , cream , paste and powder ; ( 5 ) an specimen outlet 35 existing on the same continuous surface 33 of the massaging tip 32 , through which skin treatment specimen 39 is dispensed close to or preferably , directly on top of the massaging tip 32 surface 33 that is to be in contact with the skin during skin treatment ; ( 6 ) an electronic control unit 37 containing electrical circuits , electronic components and necessary embedded software exists within the enclosure body 31 ; and ( 7 ) an electrical interface 38 located between the motion generator 36 and the electronic control unit 37 so that the performance of the massaging tip 32 can be controlled by the electronic control unit . the electronic control unit 37 controls the motions of the massaging tip 32 and it may , alternatively , also provide user interface , power supply and charging functions . additionally , the electronic control unit 37 may send electrical signals to the specimen dispenser 34 or receives electrical signals from the specimen dispenser 34 to achieve the required skin treatment procedure through another electrical interface 340 that connects to the electrical contacts 341 on dispenser 34 . the dispenser 34 may have any of the below features : ( 1 ) the dispenser 34 may be taken out and installed back into the enclosure body 31 by the user ; ( 2 ) the specimen 39 may be replenished within the dispenser 34 by the user after depletion of the specimen during skin beatification process , i . e . dispenser 34 may be re - used ; ( 3 ) the dispenser 34 may be disposable and for one - time use only , where the specimen 39 is pre - filled within the dispenser before usage ; ( 4 ) the dispenser 34 can be configured as multiple dispensers containing same or different specimens may be installed in a single enclosure body 31 , such that dispensers can be individually selected to dispense contained specimen ; ( 5 ) the dispenser 34 can be configured as a single dispenser with multiple specimen compartments that may contain same or different specimens , such that each compartment within the dispenser can be individually selected and dispense specimen ; ( 6 ) the dispensing of the specimen 39 is fulfilled by a manually exerted force to the dispenser , upon which a pressure generation component that is part of the dispenser , for example a lead , a lever , a gauge , a cap , a piston , or a stretched porch , forces the specimen 39 to flow out of the dispenser through the outlet 35 ; ( 7 ) the dispensing of the specimen 39 is fulfilled by an electrically powered driving mechanism that is part of the dispenser and operated by the electrical interface 340 located within the enclosure 31 body ; ( 8 ) the dispensing of the specimen 39 is fulfilled by an electrically powered driving mechanism that is part of the device and electrically controlled by the control unit 37 . the driving mechanism forces the specimen 39 to flow out of the dispenser through the outlet 35 . the dispenser 34 may also include a specimen dispensing or releasing mechanism embedded in the dispenser 34 . the embedded specimen dispensing or releasing mechanism is controlled by the electronic control unit 37 through the electrical interface 340 and various electrical contacts 341 embedded in the dispenser 34 . the dispenser 34 may also include an embedded memory or data storage device for storing information , such as but limited to : ( 1 ) the information of the specimen contained within the dispenser , such as but not limited to , specimen brand , name , type , original , composition , production date and expiration date , specimen level within the dispenser and ordering information ; ( 2 ) information of optimal or pre - set operational mode of the massaging tip 32 through the electronic control unit 37 when the specimen 39 contained in dispenser 34 is to be used , such as but not limited to , timing , motion type , motion strength and the sequence of motions of the massaging tip 32 ; ( 3 ) the information of optimal or pre - set operational mode of the different dispensers 34 or difference specimen compartments within a single dispenser , such as but not limited to , timing of specimen application from each different dispenser or each different compartment , amount of specimen to be dispensed from each different dispenser or each different compartment ; ( 4 ) the information of historic usage data of the device , the dispenser and specimen ; ( 5 ) the information that is created or input by the user ; and ( 6 ) the biographic information of the user . the electronic control unit 37 may receive data stored in the dispenser 34 to display information to the user through visual , skin contact or sound effects . the electronic control unit 37 may , alternatively , also receive data stored in the dispenser 34 to operate the massaging tip 32 in a specific manner determined by the information stored in the said data . the control unit 37 may also comprise another embedded memory or data storage device for storing information such as , but not limited to , device operation data , user skin information data , user personal and biometrics information , dispenser identification data . such stored information may be updated as needed . control unit 37 may also contain embedded programs that utilize all the information stored in the control unit 37 and dispenser 34 to operate and control the serum dispensing from dispenser 34 , as well as the motion generator 36 . such embedded programs may also be updated for better function . the electronic control unit 37 may send data to be stored in the dispenser 34 . the dispenser 34 may be recovered by the manufacture and data stored within the dispenser 34 may be retrieved . although fig3 a and 3b show dispenser 34 residing within the enclosure body 31 , in practice the dispenser 34 may also be externally attached to the enclosure body 31 . however , when attached , the lotion 39 is still dispensed through a conduit that connects from the inside to the outside of the enclosure body 31 and finally through the outlet 35 . thus , the attached dispenser 34 still functions as an integral part of the device . fig4 a and fig4 b illustrate the fourth preferred embodiment of the current invention , where a specimen dispenser is integrated within an electrically powered galvanic skin treatment device that produces electric current flowing along skin surface and / or through skin cells . fig4 a shows the front view of the proposed device . fig4 b shows the cross - section view along the center line 101 of fig4 a . the embodiment contains the following components : ( 1 ) an enclosure body 41 made of metal , alloy or plastics or a combination thereof ; ( 2 ) a galvanic skin treatment head 42 for contacting the skin with one or more electrodes 43 and producing electric voltage and current on the target skin area ; ( 3 ) a voltage or current driver 46 which generates the electric voltage or current ; ( 4 ) a skin treatment specimen container and dispenser , collectively referred to as dispenser 44 that contains specimen 49 that can be , but not limited to , liquid , gel , cream , paste and powder ; ( 5 ) a specimen outlet 45 existing on the surface of the treatment head 42 where the electrodes 43 reside , through the specimen outlet 45 , the skin treatment specimen 49 is dispensed close to or , preferably , directly on top of one or more of the electrodes 43 that are to be in contact with the skin during skin treatment ; ( 6 ) an electronic control unit 47 containing electrical circuits , electronic components and necessary embedded software exists within the enclosure body 41 ; and ( 7 ) an electrical interface 48 located between the voltage or current driver 46 and the electronic control unit 47 so that the voltage or current exerted by the electrodes 43 on the skin can be controlled by the electronic control unit . the electronic control unit 47 controls the electrode 43 by the voltage or current driver 46 , and may also provide user interface , power supply and charging functions . additionally , the electronic control unit 47 may send electrical signals to the specimen dispenser 44 or receives electrical signals from the specimen dispenser 44 to achieve required skin treatment procedure through another electrical interface 440 that connects to the electrical contacts 441 on dispenser 44 . the dispenser 44 may have any of the below features : ( 1 ) the dispenser 44 is removable , i . e ., may be taken out and installed back into the enclosure body 41 by the user ; ( 2 ) the specimen 49 may be replenished within dispenser 44 by the user after depletion of the specimen during skin beatification process , i . e . dispenser 44 may be re - used ; ( 3 ) the dispenser 44 may be disposable and for one - time use only , where the specimen 49 is pre - filled within the dispenser before usage ; ( 4 ) the dispenser 44 may be configured as multiple dispensers 44 containing same or different specimens , such that dispensers can be individually selected to dispense contained specimen ; ( 5 ) the dispenser 44 may be configured as a single dispenser with multiple specimen compartments that may contain same or different specimens , such that each compartment within the dispenser can be individually selected and dispense specimen ; ( 6 ) the dispensing of the specimen 49 is fulfilled by a manually exerted force to the dispenser , upon which a pressure generation component that is part of the dispenser , for example a lead , a lever , a gauge , a cap , a piston , or a stretched porch , forces the specimen 49 to flow out of the dispenser through the outlet 45 ; ( 7 ) the dispensing of the specimen 49 is fulfilled by an electrically powered driving mechanism that is part of the dispenser and operated by the electrical interface 440 located within the enclosure 41 body ; ( 8 ) the dispensing of the specimen 49 is fulfilled by an electrically powered driving mechanism that is part of the device and electrically controlled by the control unit 47 . the driving mechanism forces the specimen 49 to flow out of the dispenser through the outlet 45 . the dispenser 44 may also include an embedded specimen dispensing or releasing mechanism within the dispenser 44 . the embedded specimen dispensing or releasing mechanism is controlled by the electronic control unit 47 through the electrical interface 440 and various electrical contacts 441 embedded in the dispenser 44 . the dispenser 44 may also include an embedded memory or data storage device for storing information , such as but not limited to : ( 1 ) the information of the specimen contained within the dispenser , such as but not limited to specimen brand , name , type , original , composition , production date and expiration date , specimen level within the dispenser and ordering information ; ( 2 ) the information of optimal or pre - set operational mode of electrodes 43 through the control electronics 47 when the specimen 49 contained in dispenser 44 is to be used , such as but not limited to , timing , voltage or current type ( dc or ac ), voltage or current level , voltage or current temporal waveform , and frequency of the voltage or current applied by the electrodes 43 to the skin ; ( 3 ) the information of optimal or pre - set operational mode of the different dispensers 44 or difference specimen compartments within a single dispenser , such as but not limited to , timing of specimen application from each different dispenser or each different compartment , amount of specimen to be dispensed from each different dispenser or each different compartment ; ( 4 ) the information of historic usage data of the device , the dispenser and specimen ; ( 5 ) the information that is created or input by the user ; and ( 6 ) the biographic information of the user . the electronic control unit 47 may receive data stored in the dispenser 44 to display information to the user through visual , skin contact or sound effects . the electronic control unit 47 may receive data stored in the dispenser 44 to operate the electrodes 43 in a specific manner determined by the information stored in the said data . the control unit 47 may also comprise another embedded memory or data storage device for storing information such as , but not limited to , device operation data , user skin information data , user personal and biometrics information , dispenser identification data . such stored information may be updated as needed . control unit 47 may also contain embedded programs that utilize all the information stored in the control unit 47 and dispenser 44 to operate and control the serum dispensing from dispenser 44 , as well as the voltage or current driver 46 . such embedded programs may also be updated for better function . the electronic control unit 47 may send data to be stored in the dispenser 44 the dispenser 44 may be recovered by the manufacture and data stored within dispenser 44 may be retrieved . although fig4 a and 4b show dispenser 44 residing within the enclosure body 41 , in practice the dispenser 44 may also be externally attached to the enclosure body 41 . however , when attached , the lotion 49 is still dispensed through a conduit that connects from the inside to the outside of the enclosure body 41 and finally through the outlet 45 . thus , the attached dispenser 44 still functions as an integral part of the device . fig5 a and fig5 b illustrates the fifth preferred embodiment of the current invention , where a specimen dispenser is integrated within an electrically powered light illumination device for skin treatment . fig5 a shows the front view of the proposed device . fig5 b shows the cross - section view along the center line 101 of fig5 a . the embodiment contains the following components : ( 1 ) an enclosure body 51 made of metal , alloy or plastics or a combination thereof ; ( 2 ) a lightening housing 52 for treating skin with light illumination generated by one or more lightening units 53 which are powered by a light controller 56 ; ( 3 ) a skin treatment specimen container and dispenser , collectively referred to as dispenser 54 that contains specimen 59 which can be , but not limited to , liquid , gel , cream , paste and powder ; ( 4 ) a specimen outlet 55 existing on the surface of the lighting housing 52 where lightening units 53 reside , through the outlet 55 , the skin treatment specimen 59 is dispensed either on the surface of the housing unit , or directly onto the skin area to be treated ; ( 5 ) an electronic control unit 57 containing electrical circuits , electronic components and necessary embedded software exists within the enclosure body 51 ; and ( 6 ) an electrical interface 58 located between the light controller 56 and the electronic control unit 57 so that the light emission from the lightening unit 53 can be controlled by the electronic control unit 57 . the electronic control unit 57 controls the lightening unit 53 via the lightening controller 56 . it may also provide user interface , power supply and charging functions . additionally , the electronic control unit 57 may send electrical signals to the specimen dispenser 54 or receives electrical signals from the specimen dispenser 54 to achieve required skin treatment procedure through another electrical interface 540 that connects to the electrical contacts 541 on dispenser 54 . the dispenser 54 may have any of the below features : ( 1 ) the dispenser 54 is removable , i . e ., it may be taken out and installed back into the enclosure body 51 by the user ; ( 2 ) the specimen 59 may be replenished within dispenser 54 by the user after depletion of the specimen during skin beatification process , i . e . dispenser 54 may be re - used ; ( 3 ) the dispenser 54 may be disposable and for one - time use only , where specimen 59 is pre - filled within the dispenser before usage ; ( 4 ) the dispenser 54 may be configured as multiple dispensers containing same or different specimens , such that the dispensers can be individually selected to dispense contained specimen ; ( 5 ) the dispenser 54 may be configured as a single dispenser with multiple specimen compartments that may contain same or different specimens , such that each compartment within the dispenser can be individually selected and dispense specimen ; ( 6 ) the dispensing of the specimen 59 is fulfilled by a manually exerted force to the dispenser , upon which a pressure generation component that is part of the dispenser , for example a lead , a lever , a gauge , a cap , a piston , or a stretched porch , forces the specimen 59 to flow out of the dispenser through the outlet 55 ; ( 7 ) the dispensing of the specimen 59 is fulfilled by an electrically powered driving mechanism that is part of the dispenser and operated by the electrical interface 540 located within the enclosure 51 body ; ( 8 ) the dispensing of the specimen 59 is fulfilled by an electrically powered driving mechanism that is part of the device and electrically controlled by the control unit 57 , where the driving mechanism forces the specimen 59 to flow out of the dispenser through the outlet 55 . the dispenser 54 may also include a specimen dispensing or releasing mechanism which is controlled by the electronic control unit 57 through the electrical interface 540 and various electrical contacts 541 embedded in the dispenser 54 . the dispenser 54 may also include a memory or data storage device embedded in the dispenser 54 that may store information , such as but not limited to : ( 1 ) the information of the specimen contained within the dispenser such as but not limited to , specimen brand , name , type , original , composition , production date and expiration date , specimen level within the dispenser and ordering information ; ( 2 ) the information of optimal or pre - set operational mode of lightening unit 53 through the control electronics 57 when the specimen 59 contained in dispenser 54 is to be used , such as but not limited to , timing , light power , light duration , light wavelength and sequence of different lightening schemes that are emitted by the lightening unit 53 ; ( 3 ) the information of optimal or pre - set operational mode of the different dispensers 54 or difference specimen compartments within a single dispenser , such as but not limited to , timing of specimen application from each different dispenser or each different compartment , amount of specimen to be dispensed from each different dispenser or each different compartment ; ( 4 ) the information of historic usage data of the device , the dispenser and specimen ; ( 5 ) the information that is created or input by the user ; ( 6 ) the biographic information of the user . the electronic control 57 may receive data stored in the dispenser 54 to display information to the user through visual , skin contact or sound effects . the electronic control 57 may also receive data stored in the dispenser 54 to operate the lightening units 53 in a specific manner determined by the information stored in the said data . the electronic control 57 may also send data to be stored in the dispenser 54 . the control unit 57 may also comprise another embedded memory or data storage device for storing information such as , but not limited to , device operation data , user skin information data ; user personal and biometrics information , dispenser identification data . such , stored information may be updated as needed . control unit 57 may also contain embedded programs that utilize all the information stored in the control unit 57 and dispenser 54 to operate and control the serum dispensing from dispenser 54 , as well as the light controller 56 . such embedded programs may also be updated for better function . the electronic control unit 57 may send data to be stored in the dispenser 54 the dispenser 54 may be recovered by the manufacture and the data stored within dispenser 54 may be retrieved . although fig5 a and 5b show dispenser 54 residing within the enclosure body 51 , in practice the dispenser 54 may also be externally attached to the enclosure body 51 . however , when attached , the lotion 59 is still dispensed through a conduit that connects from the inside to the outside of the enclosure body 51 and finally through the outlet 55 . thus , the attached dispenser 54 still functions as an integral part of the device . the present invention has numerous advantages over the prior arts . for examples : ( 1 ) the integrated specimen dispenser with various electronic skin treatment devices enhances the portability and flexibility of the skin treatment process ; ( 2 ) the integrated specimen dispenser with electrical interface , together with the embedded memory within the dispenser or the control unit , enables customizability of the various electronic devices to provide treatment methods that are specific for each individual &# 39 ; s own skin care need , including personalized skin care product synthesized at the spot of treatment ; and ( 3 ) with the integrated dispenser containing product information , best mode of operation , pre - set beautification process and usage data , the device greatly increases the positive effect of the skin beautification process , reduces the complexity of the user &# 39 ; s operation and provides means of feedback from user to manufacture for further improvement on the skin care products . while one or more embodiments of the present invention have been illustrated above , the skilled artisan will appreciate that modifications and adoptions to those embodiments may be made without departing from the scope and spirit of the present invention .

an electronic skin treatment device with an integrated specimen dispenser is disclosed , with which specimen dispense can be concurrently applied to target skin area while ultrasonic vibrations , mechanical massaging motions , galvanic stimulations , or light illuminations are used and as such a customizable , easier and better skin beautification can be achieved .

the instant invention is a novel method for posterior pelvic stabilization . the method uses internal hardware placed in a minimally invasive fashion . stabilization of pelvic ring injuries is most often indicated when the volume of the pelvis is increased and / or an unstable pattern of injury is present . this stabilization method must be applied in the operating room under sterile conditions with adequate fluoroscopic guidance . it can be utilized in an emergent setting following provisional stabilization in the emergency room with a pelvic binder , sheet or clamp . to aid in the determination of utilizing internal fixation methods , we prefer the tile classification since it is based on the concept of pelvic stability . in the tile classification , type a fractures involve a stable pelvic ring . the partially stable type b lesions , such as “ open - book ” and “ bucket - handle ” fractures , are caused by external and internal rotation forces , respectively . in type c injuries , there is complete disruption of the posterior sacroiliac complex . these unstable fractures are almost always caused by high - energy severe trauma associated with motor vehicle accidents , falls from a height , or crushing injuries . type a and type b fractures make up 70 % to 80 % of all pelvic injuries . internal fixation methods are typically considered for tile b and c type injuries . in many patients with partially stable injury patterns , the presence of significant pain with upright posture can be alleviated with the addition of internal fixation . if adequate reduction cannot be obtained in a closed manner , then more traditional open reduction techniques need to be employed . the patient may be positioned in the supine position on a radiolucent table . the skin may be prepped and draped from above the umbilicus to the proximal thigh . the lower extremity may be prepped into the field as well to facilitate reduction techniques . the posterior instability may be addressed first . the inventive procedure for placement of iliosacral screws and bone plate ( s ) for posterior pelvic instability will be described herein below , but first we need to describe the sacrum and sacroiliac joint in more detail . the sacroiliac joint is a diarthrodial joint that joins the sacrum to the ilium bones of the pelvis . in the sacroiliac joint , the sacral surface has hyaline cartilage that moves against fibrocartilage of the iliac surface . fig2 a depicts the medial aspect of a left ilium . the surface of the ilium and sacrum that form the sacroiliac joint is also known as the auricular surface 4 . the iliosacral screws of the present invention pass from the ilium into the sacrum through this auricular surface 4 . fig2 b depicts the anterior view of a sacrum . the auricular surface 4 is on either side of the sacrum 2 . among other things , the sacerum contains five vertebral bodies , s1 - 55 . the iliosacral screws pass through the ilium , through the auricular surface 4 , and into the s1 vertebral body for the upper screw and the s2 vertebral body for the lower screw . the method and apparatus for the minimally invasive treatment of unstable pelvic ring injuries with internal posterior iliosacral screw ( s ) and bone plate ( s ) will now be described with respect to the figures . fig3 a is a depiction of the posterior of a pelvis having a pelvic ring fracture in which the left ilium 1 has separated from the sacrum 2 and right ilium 1 ′. fig3 b is a depiction of the posterior of a pelvis , wherein the first step of the inventive method has been performed . in the first step , the separated ilium 1 and the remainder of the pelvis are manipulated to bring the auricular surfaces of the separated ilium 1 and the sacrum 2 into alignment . then a cannulation guide wire 5 is inserted into the posterior of the ilium 1 adjacent to the s1 vertebral body and is then passed through the auricular surface and into the s1 vertebral body . the guide wire 5 should be advanced to near the medial area of the s1 vertebral body . fig3 b ′ depicts an anterior view of a horizontal cross section of the pelvis at the end of the first step , where the guide wire 5 has been advanced through the ilium 1 , through the auricular surface 4 ( also known as the sacroiliac joint 3 ), and into the sacrum . fig3 c is a depiction of the posterior of a pelvis , wherein the second step of the inventive method has been performed . in the second step , another cannulation guide wire 5 ′ is inserted into the posterior of the ilium 1 adjacent to the s2 vertebral body and is then passed through the sacroiliac joint , into and through the s2 vertebral body and into the opposite ilium 1 ′. the second guide wire 5 ′ should be advanced through the s2 vertebral body , and if a second plate is to be placed on the opposite ilium 1 ′, the guide wire should be advanced completely through the opposite auricular surface and through the opposite ilium 1 ′. it should be noted that the order of the first and second steps is interchangeable . in practice , in some instances , there may be some advantage to the order in which the cannulation guide wires 5 , 5 ′ are inserted . fig3 d is a depiction of the posterior of a pelvis , wherein the third step of the inventive method has been performed . in the third step a two holed bone plate 6 is slid over the guide wires 5 , 5 ′ and advanced to the surface of the ilium 1 . fig3 d ′ depicts an anterior view of a horizontal cross section of the pelvis at the end of the third step of the inventive method , where the bone plate 6 has been slid over guide wires 5 , 5 ′ and advanced to the surface of the ilium 1 . fig3 e is a depiction of the posterior of a pelvis , wherein the fourth step of the inventive method has been performed . in the fourth step a cannulated screw 7 ( either cancellous or cortical and either fully or partially threaded ) is inserted onto the superior cannulation guide wire 5 , and screwed through the superior opening in the bone plate 6 , through the ilium 1 , the auricular surface and into the s1 vertebral body . preferably , the cannulated screw 7 is long enough to extend from the bone plate 6 , to a medial location within the s1 vertebral body . fig3 e ′ depicts an anterior view of a horizontal cross section of the pelvis at the end of the fourth step of the inventive method , where the cannulated screw 7 has been screwed through the bone plate 6 and into the s1 vertebral body . fig3 f is a depiction of the posterior of a pelvis , wherein the fifth step of the inventive method has been performed . in the fifth step another cannulated screw 8 is inserted onto the inferior cannulation guide wire 5 ′, and screwed through the inferior opening in the bone plate 6 , through the ilium 1 , the auricular surface and the s2 vertebral body . preferably , the cannulated screw 8 is long enough to extend from the bone plate 6 to a position all of the way through the s2 vertebral body and into the opposite ilium 1 ′. again , if a second plate is to be placed on the opposite ilium 1 ′, the cannulated screw 8 should be advanced completely through the opposite ilium 1 ′ and protrude far enough that it may be affixed to the second plate . it should be noted that the order of the fourth and fifth steps is interchangeable . in practice , in some instances , there may be some advantage to the order in which the cannulated screws 7 , 8 are inserted . fig3 g is a depiction of the posterior of a pelvis , wherein the sixth step of the inventive method has been performed . in the sixth step , the cannulation guide wires 5 , 5 ′ are removed leaving the cannulated iliosacral screws 7 , 8 and the bone plate 6 in place to fixate the unstable pelvic ring fracture . fig3 g ′ depicts an anterior view of a horizontal cross section of the pelvis at the end of the sixth step of the inventive method , where the cannulation guide wires 5 , 5 ′ have been removed leaving the iliosacral screws 7 , 8 and the bone plate 6 in place . fig3 h is a depiction of the posterior of a pelvis , wherein optional additional steps have been performed to create a bilateral fixation by adding an additional iliosacral screw 7 ′ and bone plate 6 ′ to the opposite iliosacral joint of the pelvis . that is , a cannulation guide wire is inserted through the other ilium 1 ′, the other auricular surface and into the s1 vertebral body . another bone plate 6 ′ is placed over the cannulation guide wire and then an additional cannulated screw 7 ′ is placed onto the additional cannulation guide wire , and screwed through the superior opening in the bone plate 6 ′, through the ilium 1 ′, the auricular surface and into the s1 vertebral body . preferably , the cannulated screw 7 ′ is long enough to extend from the bone plate 6 ′, to a medial location within into the s1 vertebral body . the inferior opening in the bone plate 6 ′ is affixed to the end of the cannulated screw 8 that protrudes from the opposite ilium 1 ′. this may be accomplished by either : 1 ) threading the protruding end of the cannulated screw 8 into the threads of the second bone plate 6 ′; or , 2 ) by passing the protruding end of the cannulated screw 8 through the inferior opening in the bone plate 6 ′ and threading a nut ( not shown ) onto the protruding end the cannulated screw 8 and tightening the nut against the bone plate 6 ′. fig3 h ′ depicts an anterior view of a horizontal cross section of the pelvis at the end of the optional additional steps of the inventive method . as described above an additional cannulated screw 7 ′ is inserted through the superior opening in an additional bone plate 6 ′, through the opposite ilium 1 ′, the opposite auricular surface 4 ′, and into the s1 vertebral body . fig4 a depicts a cross section of a cannulated screw 7 and specifically shows how a cannulated screw 7 may be inserted onto the cannulation guide wire 5 . fig4 b show a cannulated screw 7 inserted onto a cannulation guide wire 5 . also shown in both figures is the locking head 9 of the screw , because the preferred embodiment is used in a variable - angle locked plating system . fig5 is a depiction of a lateral view of a pelvis ( ilium 1 , sacrum 2 ) having been fixated using the inventive method and apparatus . the cannulated screws 7 , 8 pass through the auricular surface 4 , holding ilium 1 and sacrum 2 together . the bone plate 6 gives the fixation construct additional strength by resisting the possibility of pulling the cannulated screws 7 , 8 through the ilium 1 , 1 ′ when the pelvis is weight bearing . further , one can see the cannulation openings 7 ″, 8 ″ in the cannulated screws 7 , 8 . fig6 a and 6b are depictions of different views of a type bone plating system , a variable - angle locked plating system , useful in the present invention . while other bone plating systems may be used , the variable - angle locked plating system is preferred in that this type of system allows for conformity of the bone plate 6 , 6 ′ with the ilium 1 , 1 ′, while allowing the cannulated screws 7 , 7 ′, and 8 to be inserted into the ilium / sacrum at the needed proper angle . the screws and plates of the present invention are formed from sturdy bio - compatible materials , preferably titanium . the screws may be between 7 . 0 - 8 . 5 mm in outer diameter ( o . d . ), inclusive , and the cannulation guide wires may be 3 mm o . d . after stabilizing the posterior elements via the iliosacral screws and bone plate ( s ) method / construct of the present invention , the anterior pelvis may be addressed . preferably the anterior fixation methods / apparatuses are those disclosed in u . s . pat . nos . 8 , 900 , 278 ; 8 , 814 , 866 ; 8 , 398 , 635 ; and 8 , 177 , 785 , the disclosures of which are herein incorporated by reference . it is to be expected that considerable variations may be made in the embodiments disclosed herein without departing from the spirit and scope of this invention . accordingly , the significant improvements offered by this invention are to be limited only by the scope of the following claims .

the instant invention is a novel method for stabilization of the posterior pelvis when treating an unstable pelvic ring fracture . cannulated screws are inserted through the posterior of the ilium through the sacroiliac joint and into the sacrum . the screws are used to affix the iliosacral joint while it heals . the screws are used in conjunction with a bone plate to provide the construct / fixation with added strength and stability compared to iliosacral fixation using screws alone .

it has been discovered that certain flavonoids will inhibit the production and secretion of il - 6 from human mast cells and macrophages , and that this effect provides a potential treatment of those inflammatory conditions that are mediated by or involve elevated levels of that messenger cytokine ( see background section above for a discussion of such diseases ). flavonoids have previously been reported to inhibit mast cell secretion ( middleton , e et al , biochemical pharmacology 43 : 1167 ( 1992 ) and other inflammatory processes ( see middleton et al ., 2000 above ), but there was no awareness of an effect of these compounds on il - 6 . certain plant flavones ( in citrus fruit pulp , seeds , sea weed ) are being touted as anti - allergic , anti - inflammatory , anti - oxidant and cytoprotective with possible anti - cancer properties . i report here that only some flavones , such as quercetin , myrisetin , genistein , and kaempherol inhibit mast cell secretion of il - 6 , and reverse or relieve inflammatory conditions , such as coronary artery disease , asthma , atopic dermatitis , inflammatory bowel disease , interstitial cystitis , migraines , multiple sclerosis , and rheumatoid arthritis ( see expanded list above ). quercetin inhibits secretion from human mast cells ( kimata et al . allergy 30 : 501 ( 2000 )), and has also been used effectively for the treatment of chronic prostatitis ( shoskes et al ., urology 54 : 960 ( 1999 )). other flavonoids may have opposite effects . use of the term “ bioflavonoids ” or “ citrus flavonoids ” listed in certain commercial products , therefore , provides little information , and may include molecules that have detrimental effects . for instance , pycnogenol , marketed as an anti - inflammatory compound , actually promotes the secretion of inflammatory molecules in vitro . the present discovery of an inhibitory effect of certain flavonoids on the production and secretion of il - 6 from human mast cells and macrophages was unexpected , as such flavonoids had previously been shown to inhibit degranulation of mast cells , and , as discussed below , i have now observed that il - 6 is not stored in mast cell granules , but rather in small ( 20 - 70 um ) vesicles . nor is it obvious to the art , as no other compound was known to inhibit il - 6 secretion from mast cells or macrophages . it will be shown below that il - 1 induces selective secretion of il - 6 , but not granule - stored tryptase , from hcbmc or hhmc - 1 cells . stimulation of hmc - l cells with il - 1 and tnf - α lead to a 10 - fold synergistic increase in il - 6 production , still without tryptase arising only from degranulation that in this case does not occur . ultrastructural immunogold localization indicates that il - 6 is compartmentalized in 20 - 70 nm - size vesicles and is excluded from the secretory granules . these findings indicate that il - 1 induces selective secretion of il - 6 through a mechanism distinct from degranulation . the compositions of the invention may be formulated in any standard means of introducing pharmaceuticals orally or parenterally into a patient , e . g ., by means of tablets or capsules , or administering topically by means of creams , ointments and transdermal formulations in the case of skin disease . standard excipients and carriers for the active ingredients of the inventive compositions are described in remington &# 39 ; s pharmaceutical sciences , mack publishing co ., easton , pa . the preferred flavonoid compounds for inhibiting the release of il - 6 from mast cell vesicles are quercetin , myrisetin , genistein and kaempferol ; quercetin is highly preferred . in order to increase absorption , these flavonoids may be administered as their glycoside derivatives . these compounds may be obtained from kaden biochemicals , hillsborough , n . j . the preferred concentration range of the flavonoid components of oral formulations are 10 - 3 , 000 mg per tablet or capsule . the number of capsules or tablets to be taken per day is determined by the nature and severity of the medical condition , and is readily determinable by the patient &# 39 ; s physician . other representative formulations are described in the examples below . human cord blood - derived mast cells ( hcbmc ) were grown from cd34 + progenitor mononuclear umbilical cells isolated from umbilical cord blood by positive selection of ac133 ( cd 133 +/ cd34 + high ) cells by magnetic cell sorting ( miltenyi biotec , auburn , calif .). cd34 + cells were then cultured in isocove &# 39 ; s modified dulbecco &# 39 ; s medium ( 1mdm ) containing 100 ng / ml stem cell factor ( from amgen , thousand oaks , calif .) plus test components in 10 % fbs at 37 ° c . in 5 % co 2 balanced air . by 10 weeks , 95 % of the cells in culture could be identified as mast cells by immuno - staining for tryptase . hcbmc were washed three times in pbs and resuspended in culture medium ( 1 × 10 5 cells / 200 ul sample ). test substances , e . g ., il - 1 were added and cells were incubated at 37 ° c . in 5 % co 2 for six hours for dose - response experiments or for the indicated times in time - course experiments . il - 6 and tryptase were measured in cell - free supernatant fluids by elisa ( r & amp ; d systems , minneapolis , minn .) and fluoroenzymeimmunoassay ( pharmacia , uppsala , sweden ), respectively . human leukemic mast cells ( hmc - 1 ) was obtained from dr . butterfield ( mayo clinic , rochester , minn . ), and cultured in imdm medium supplemented with 10 % fbs , pbs and 2 μm alpha . thioglycerol . hcbmc or hmc - i cells 2 × 10 5 / 200 μl sample were stimulated in full culture medium as indicated . dose - response of il - 6 and tryptase secretion from hcbmc and hmc - 1 cells were tested after stimulation for six hours with indicated concentrations of il - 1 or other stimuli . time - course of il . 6 production induced by 50 ng / ml of il - 1 a from cbmc or by 10 ng / ml il - 1 from hmc - 1 cells could be tested . the data in general represent means +/− standard error of the mean from 3 to 4 experiments done in duplicate for each cell type used . this technique was employed to localize il - 6 . hcbmc or hmc - 1 cells were fixed with 5 % acrolein and embedded in lr white . microthin sections were cut and these were mounted on grids . for il - 6 localization , grids were incubated with 6 . 3 μg / ml ( cbmc ) or 20 μg / ml ( hmc - 1 ) polyclonal rabbit antihuman il - 6 antibody ( biologicals ) overnight , followed by goat anti - rabbit igg conjugated with 10 nm gold particles ( 1 : 30 , polyscience , warrington , pa .). monoclonal mouse anti - human tryptase antibody ( chemicon , tenecula , calif .) at 40 μg / ml ), followed by goat anti - mouse igg conjugated with 10 nm gold particles , was used to localize tryptase . processed grids were stained with uranylacetate and lead citrate and viewed with a cm20 transmission electron microscope . 11 - 6 was localized in microvesicles ( 20 - 70 nm ) and tryptase in mast cell granules . negative controls were processed similarly , but without the primary antibody . magnification was 17 , 800 ×. the results are shown in fig1 . curved arrows indicate vescicles ( about 50 nm ) containing il - 6 shown by bound electron - dense gold particles . note the clusters of gold particles ( dark dots ) inside ( white curved arrows ) and outside ( dark curved arrows ) of the cell ( bar = 50 nm ). in this experiment , the effect of quercetin on the production of il - 6 and tnf - a from rat peritoneal macrophages and human mast cells that are involved in inflammation was studied . the results are shown in table 1 . the results indicated that quercetin almost completely inhibited the production of il - 6 from both cell types , and also greatly inhibited the production of tnf - a from both cell types . in this experiment , the inhibition of il - 6 secretion by quercetin from hcbmc was studied in the presence of anti - ige , an inhibitor of the stimulating effect of ige on production of il - 6 . the results are shown in table 2 . the controls showed that anti - ige antibody itself had no effect on the production and release of il - 6 . however , quercetin had a profound inhibitory effect on il - 6 production and release in the presence of antibody . s another experiment examining the inhibition of the release of il - 6 from hcbmc by quercetin , with the results set forth graphically in fig3 . in the graph , column 1 shows the spontaneous release of il - 6 from the cultured mast cells . column 2 shows the increase in il - 6 secretion after incubation of cells with anti - ige alone . column 3 shows incubation of the cells with 0 . 1 mm quercetin for 30 mins ., followed by incubation of the cells for 6 hrs . with amti - ige . the experiment was replicated 6 times per variable . the results , which are statistically significant , show that quercetin profoundly inhibited the secretion of il - 6 from mast cells whose production of il - 6 had been stimulated by anti - ige antibodies . the effects of anti - ige , alone and or after with the flavonoid n on the secretion of il - 6 from hcbmc . the compositions of fig3 are shown below . bar # drug and concentration 1 spontaneous 2 anti - ige * 3 quercetin , 100 μm 4 ″ 10 μm 5 ″ 1 μm 6 ″ 0 . 1 μm 7 ″ 0 . 01 μm 8 morin 100 μm 9 ″ 10 μm 10 ″ 1 μm 11 ″ 0 . 1 μm 12 ″ 0 . 01 μm 13 cromolyn 100 μm as anticipated , anti - ige more than doubled the secretion of il - 6 over the spontaneous control . the two highest concentrations of quercetin greatly reduced the secretion of il - 6 compared to either the spontaneous control or the anti - ige value alone ; the three lower concentration of the flavonoid only slightly reduced the secretion of the cytokine compared to ige alone . the two concentrations of the flavonoid morin had only a small effect on il - 6 secretion in the presence of anti - ige ; so did a high concentration of cromolyn , but this effect was not statistically significant . these results demonstrate the specificity of the flavonoid effect that is quercetin , but not morin , inhibited the anti - ige - mediated increase in the secretion of il - 6 from human mast cells . in this experiment , the selective secretion of il - 6 from hcbmc in the absence and presence of crh , il - 1 or anti - ige antibody was studied . in parallel incubations , the effect of each of these agents on the secretion of tryptase from mast cell granules was also examined . the results are shown in table 3 . low concentrations of crh , il - 1 and anti - ige antibody profoundly increased the production and secretion of il - 6 . neither crh nor il - 1 increased the secretion of the marker tryptase , suggesting that neither of these agents stimulated degranulation of the cells . in contrast , anti - ige antibody greatly increased the secretion of this marker protein . in this experiment , the effects of quercetin , alone or together with il - 1 , on the production and secretion of il - 6 from human mast cells was studied . the results are shown in table 4 . the results indicate that neither quercetin alone northe solvent ( dmso ) in which it was dissolved had a significant effect on il - 6 secretion , even though the highest concentration slightly decreased the spontaneous formation of il - 6 . il - 1 alone caused a great increase in il - 6 . this effect of il - 1 on il - 6 was greatly inhibited by quercetin in a dose - dependent fashion . it is known ( marshall et al . j . clin . invest . 97 : 1122 ( 1996 )) that interleukin - 10 ( il - 10 ) can inhibit il - 6 production from rat peritoneal mast cells stimulated by lipopolysaccharide ( lps ) and anti - ige antibody , even though il - 10 did not influence histamine release . no one has examined this phenomenon in human mast cells . the effect of il - 10 on hmc - 1 leukemic cells producing il - 6 , especially cells stimulated by il - 1 that induces selective release of il - 6 , was studied alone or together with a flavonoid compound . the results are shown in table 5 . the results of these experiments indicate that a combination of low doses of il - 10 and quercetin had a synergistic inhibitory effect on il - 6 secretion from hmc - 1 cells . this combination may , therefore , be effective in the treatment of inflammatory diseases presenting with high il - 6 , especially systemic mastocytosis . certain histamine - i receptor antagonists have been shown to inhibit cytokine secretion from human leukemic mast cells ( lippert et al , exp . dermatol . 2 : 118 ( 2000 ). azelastine , like olopatadine , is a histamine - 1 receptor antagonist , and has been reported to inhibit tryptase secretion ( lytinas et al ., allergy asthma proc . 23 : ( 2002 )). here we show ( fig4 ) that azelastine is a potent inhibitor of il - 6 secretion from hcbmc ; this inhibition was dose - dependent and , at 60 μm , this compound reduced il - 6 secretion to below control levels . azelastine . hcl may be obtained from wallace laboratories , cranbury , n . j . it may also be obtained from the same company as astelin , a nasal spray containing 0 . 1 % azelastine . hcl in aqueous solution . in vivo , azelastine may be administered at a dosage of about 2 to 100 mg per 70 kg body weight per day . at concentrations below 1 μm azelastine was ineffective ; however , when added together with 10 μm quercetin , the combination inhibited il - 6 secretion from hcbmc ( table 6 ). these results , taken together , demonstrate that certain flavonoid compounds inhibit the production and secretion of il - 6 from human mast cells that are stimulated by different inflammatory stimuli .

the invention is a method of treating il - 6 - mediated inflammatory diseases with flavonoid inhibitors of the production and secretion of il - 6 from human or animal mast or macrophage cells . the most effective flavonoid compounds include quercetin , kaempferol , myricetin and genistein , and these can be administered alone or in combination with s - adenosylmethionine , folic acid , interleukin - 10 or a histamine - 1 receptor antagonist such as azelastine .

hereinafter , embodiments of the present invention will be described in detail . a cooking method according to the present invention includes two aging processes performed under different conditions and two roasting processes . in particular , a raw meat is cut into pieces , each having an average diameter of 4 ˜ 10 cm and a weight of 70 ˜ 150 g and put in a salt - containing sauce for primary aging . the salt - containing sauce is a marinade containing refined salt , soy sauce , pepper powder , white sugar , and onion juice as main components . the aging time may be in a range of 24 ˜ 48 hours . the spices soak into the raw meat through the aging process . next , the surface of each of the raw meat pieces is coated with coating powder . when it is necessary to relieve the salty taste of the meat , the salt - containing sauce can be removed from the surface of the raw meat pieces before it is coated with coating powder . the coating powder is prepared by adding seasonings , such as refined salt , monosodium l - glutamate , red pepper powder , black pepper powder , garlic powder , etc ., into wheat flour or corn starch , which are main components . an appropriate mixing ratio of seasonings in the coating powder is shown in table 1 . an optimal mixing ratio of seasonings in coating powder determined through several times of test cooking is shown in table 2 . a hot seasoning may be further added to emphasize the hot taste . next , the raw meat pieces coated with the coating powder is subjected to secondary aging for a predetermined time to allow the coating powder on the surface of the raw meat to absorb moisture in the raw meat and form a coating powder layer . in this secondary aging process , the raw meat pieces on which the coating powder has been coated are maintained in a dark refrigeration space at a temperature of − 2 . 0 ˜ 10 . 0 ° c . for 1 ˜ 2 hours . alternatively , if necessary to cook quickly , instead of waiting for the coating powder layer to be formed by absorbing moisture in the raw meat , the coating power layer can be formed by spraying water on the coating power of the surface of the raw meat . however , for more crispy taste of the surface of the meat prepared according to present invention , it is better to wait for the coating powder layer to be formed by absorbing moisture in the raw meat through the secondary aging process . next , the secondarily aged raw meat pieces are roasted in an oven in a closed state at a temperature of 130 ˜ 270 ° c . for 7 ˜ 20 minutes . any type of cooking device , such as a gas oven , an electric oven , etc ., can be used provided that it has a closed space for heating . however , cooking devices using radiation heat or convection heat are preferred to cooking devices using heat conduction , like frying fans . in the cooking method according to the present invention , cooking devices using radiation heat or convection heat are suitable to uniformly heat the aged raw meat pieces of a predetermined size . next , the raw meat pieces are further roasted at a temperature of 130 ˜ 270 ° c . for 2 ˜ 5 minutes while supplying an air flow to the oven . in this process , air is flowed into the oven to evaporate moisture from the surface of the coating powder layer of the meat and exhaust the moisture out of the oven . this process facilitates the evaporation of moisture from the surface of the meat . if air is flowed throughout the entire roasting operation , i . e ., from the beginning to the end of the roasting operation , or if the duration of roasting the meat while supplying an air flow is longer than 5 minutes , too much moisture in the meat is evaporated and the meat texture becomes too tough or chewy . if the duration of roasting the meat while supplying an air flow is shorter than 2 minutes , a proper amount of moisture cannot be evaporated from the coating powder layer and the roasted meat is not crispy . the roasting time ranging from 2 ˜ 5 minutes can be varied according to the water content of the raw meat . the surface of the meat roasted through the above - described processes looks very similar to common fried chicken . in addition , the surface of the roasted meat is crispy while the inner flesh is tender and moist . although the surface of the meat cooked according to the present invention looks very similar to common fried chicken , the meat cooked according to the present invention has very different composition from the common fried chicken . in particular , since the coating powder layer on the meat is fried by oil contained in the meat through two roasting processes , its fat and cholesterol contents are markedly lower than those of common fried chicken , which is fried in cooking oil . in addition , since the oil in the meat comes out , the inner flesh becomes non - greasy , soft , and less tough . in conventional methods of cooking by frying , due to the repeated use of frying oil and the oxidization of the oil , cholesterol content increases . in addition , it is highly likely that foreign substance is incorporated into the oil during storage , and small fragments of previously fried foods remain , raising a hygienic problem . however , in the cooking method according to the present invention , such problems do not arise , and low fat , cholesterol , and calory food can be hygienically cooked . the two roasting processes in the cooking method according to the present invention may be performed in reverse order . in other words , the roasting process performed while supplying an air flow can be performed first . however , to accelerate the evaporation of moisture to obtain cooked meat with a crispy surface coating , it is preferable to perform the roasting process while supplying an air flow secondly . any kind of raw meat can be cooked using the above - described cooking method according to the present invention . examples of raw meat that can be cooked according to the present invention include : meats , such as pork , beef , etc . ; fowls , such as chicken , duck , goose , turkey , etc . ; seafoods , such as lobster , shrimp , shellfish , fishes , etc . for a high fat content raw meat , such as pork , bread crumbles may be added to the coating powder such that a larger amount of the oily component in the raw meat can be absorbed . as a result , a less greasy , tender , and moist cooked meat with a crispy coating can be obtained . as described above , in a cooking method according to the present invention , instead of frying a raw meat in boil , after coating the raw meat with a coating powder layer , the raw meat is roasted using oil contained in the raw meat while supplying an air flow for a predetermined duration to evaporate moisture in the meat and increase crispiness of the surface of the meat . the obtained cooked meat has low fat content and is not greasy . in addition , the surface coating of the cooked meat is crispy while the inner flesh thereof is tender and moist . in a nutritional aspect , using the cooking method according to the present invention , which does not involve frying in oil , low calory , fat , and cholesterol foods can be cooked , which complies with the currently spread healthy diet trend . in particular , when the cooking method according to the present invention is used to cook chicken , low calory , fat , and cholesterol , healthy cooked chicken , which is very similar to popular fried chicken , can be obtained . according to the present invention , a plate of chicken that has low trans fatty acid content and is good for health can be prepared . trans fatty acids in diet , which are generated as a result of partial hydrogenation of vegetable oils , have been implicated to cause or exacerbate most modern diseases , including heart disease , cancer , diabetes , obesity , immune dysfunction , and bone loss . the major form of trans fatty acid included in milk , dairy products , meat etc . is vaccenic acid ( trans - 11 , 18 : 1 ). table 3 shows the contents of vaccenic acid ( trans - 11 , 18 : 1 ) in the skin of chicken prepared to be served to a customer . the content of vaccenic acid ( trans - 11 , 18 : 1 ) in the skin of the plate of chicken prepared according to the method of present invention was about 4 . 25 %. however , in the case of comparative example 1 ( fried chicken cooked by frying in oil , company a ), the content of vaccenic acid ( trans - 11 , 18 : 1 ) was about 12 . 94 %. in the case of comparative example 2 ( fried chicken cooked by frying in oil , company b ), the content of vaccenic acid ( trans - 11 , 18 : 1 ) was about 6 . 12 %. a cooking method according to another embodiment of the present invention is the same , from cutting raw meat into pieces to aging the raw meat pieces with a salt - containing sauce , as the embodiment described above . when the aging process is completed , primary roasting is performed . in primary roasting , the raw meat pieces are cooked to an extent of about 30 % to about 70 % using steam or oven heat . for example , the raw meat pieces may be primarily roasted using a far - infrared radiation oven . when a far - infrared radiation oven is used , the temperature of a far - infrared bulb may be maintained at about 300 ° c . to about 550 ° c . in this case , the surface temperature of the raw meat pieces is maintained at about 30 ° c . to about 80 ° c . for about 10 to about 20 minutes . the primary roasting process sterilizes the raw meat pieces to some extent and removes oil from the raw meat pieces . in addition , water contained in surface regions of the raw meat pieces is partially evaporated . in the primary roasting operation , the water content of the raw meat pieces may be reduced to about 10 . 0 wt % to about 15 . 0 wt %. if the water content is less than 10 . 0 wt %, crispness of the surface of a coating powder layer of cooked meat may be reduced . on the other hand , if the water content is more than 15 . 0 wt %, the cooked meat may become tough . next , a coating powder layer is formed . the oil removed from surface regions of the raw meat pieces in the primary roasting operation enables coating powder to easily adhere the surface of the raw meat pieces , and thus forms the coating powder layer . examples of the coating powder are the same as described in the previous embodiment . in addition , the composition of the coating powder is not limited to the compositions suggested in tables 1 and 2 above . for example , wheat flour or corn starch may be partially or wholly substituted with one component selected from the group consisting of rice flour , barley flour , soybean flour , potato starch and sweet potato starch . next , secondary roasting is performed to finish cooking the raw meat pieces . the secondary roasting operation includes preheating a roasting utensil and placing and heating the raw meat pieces in the preheated roasting utensil . in the secondary roasting operation , the heating temperature may be in a range of about 130 ° c . to about 270 ° c ., and the heating time may be in a range of about 9 to about 25 minutes . the roasting utensil may include any type of cooking device for roasting in a closed environment , such as a gas oven , an electric oven , etc . for example , the roasting utensil may include heating wires in upper and lower racks where the raw meat pieces are to be placed so that the top and bottom surfaces of the raw meat pieces can be heated . in the secondary roasting operation , air may be made flow into the roasting utensil for about 2 to about 5 minutes . air flowing into the oven exhausts water vapor out of the roasting utensil , and thus facilitates the evaporation of water from the surfaces of the raw meat pieces . if air is made to flow throughout the entire roasting operation , i . e ., from the beginning to the end of the roasting operation , or if the duration of roasting the raw meat pieces while supplying an air flow is longer than 5 minutes , too much moisture in the raw meat pieces is evaporated and the meat texture becomes too tough or chewy . if the duration of roasting the raw meat pieces while supplying an air flow is shorter than 2 minutes , a proper amount of moisture cannot be evaporated from the coating powder layer and the roasted meat is not crispy . the roasting time ranging from about 2 to about 5 minutes may be varied according to the water content of the raw meat . the surface of the meat roasted by performing the above - described processes looks very similar to common fried chicken . in addition , the surface of the roasted meat is crispy while the inner flesh is tender , non - greasy and moist . although the surface of the meat cooked according to the present invention looks very similar to common fried chicken , the meat cooked according to the present invention has a very different composition from common fried chicken . in particular , since the coating powder layer on the meat is fried by oil contained in the meat through two roasting processes , its fat and cholesterol contents are markedly lower than those of common fried chicken , which is fried in cooking oil . in addition , since the oil in the meat is removed , the inner flesh becomes non - greasy , soft , and less tough . in conventional methods of cooking by frying , due to the repeated use of frying oil , it is highly likely that foreign substances are incorporated into the oil during storage , and small fragments of previously fried foods remain , raising a hygienic problem . however , in the cooking method according to the present invention , such problems do not arise , and low fat , and low calorie food can be hygienically cooked . while the present invention has been particularly shown and described with reference to embodiments thereof , the embodiments are for only descriptive purposes and are not intended to limit the scope of the invention . the scope of the invention is defined only by the appended claims . it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims .

provided are a method of cooking a raw meat and a plate of chicken prepared using the method . the plate of chicken is a healthy food and has a crispy coating and tender and moist inner flesh , like common fried chicken . the method of cooking a raw meat using oil contained therein includes : cutting the raw meat into pieces of a predetermined size and putting the cut raw meat pieces in a salt - containing sauce to age the raw meat pieces ; removing the salt - containing sauce from the surface of the primarily aged raw meat pieces ; putting the primarily aged raw meat pieces in an oven and roasting the raw meat pieces at a relatively low temperature such that juices come from the raw meat ; uniformly coating the surface of each of the juicy raw meat pieces with coating powder ; putting the raw meat pieces having the coating powder layer in an oven again and roasting the raw meat pieces ; and further roasting the raw meat pieces , with the oven open , while supplying ambient air flow into the oven , such that having moisture vaporized from the coating powder layer of the raw meat pieces be exhausted out of the oven .

referring now to fig1 where the preferred embodiment for the present invention is generally referred to with numeral 10 , it can be observed that it basically includes root form implant fixture 20 and abutment member 100 . root form implant fixture 20 includes anchorage section 30 and engagement section ( neck ) 40 . anchorage section 30 includes shaft 32 with threads 34 having sufficient separation of its threads to permit the bone in which it is inserted to occupy the space in between for best anchorage results . shaft 32 can also be of the type known in the art as the fin type , as shown in fig3 under numeral 32 , wherein several disks are rigidly , and positioned in a spaced apart parallel relationship with respect to each other , mounted to shaft 32 &# 39 ;. another type of shaft 32 &# 39 ; is the one shown in fig4 and it corresponds to a cylinder with a helical grooves . as shown in fig1 engagement section 40 is integrally built at one of the ends of shaft 32 and it includes cylindrical portion 60 , beveled portion 70 and multi - face portion 80 , all adjacent to each other in that order . multi - face portion 80 has a hexagonal shape , in the preferred embodiment . central and longitudinally extending cavity 90 extends through the center of cylindrical , beveled and multi - face portions 60 , 70 and 80 , as well as part of shaft 32 , as best seen in fig2 . in the preferred as well as the alternate embodiment shown in fig2 cavity 90 narrows down ( tapers ) as it extends toward anchorage section 30 . at the end of cavity 90 , in the alternate embodiment shown in fig2 there is a threaded bottom part 92 . it should be noted that for both , the preferred embodiment shown in fig1 and the alternate embodiment of fig2 the same cavity 90 is used even if the abutment &# 39 ; s post 120 of the preferred embodiment lacks a mating thread . abutment member 100 has head 110 with elongated post 120 that is built in , as seen in fig1 . the angle of head 110 with respect to the longitudinal axis of member 100 varies depending on the correction for parallelism that may be necessary . in the figures applicant has shown abutments with 0 degrees of connection to facilitate the description of the invention . lack of parallelism is undesirable and it arises when fixtures 20 are not positioned parallel to each other . elongated post 120 , in the preferred embodiment shown in fig1 is smooth and bites against internal walls of central cavity 90 thereby locking it in place . the metal to metal biting engagement of post 120 and internal walls of cavity 90 provides a retention of abutment 100 and hermetic seal for any unoccupied space inside cavity 90 thereby preventing the collection of saliva , blood or any other decaying substance . in fig2 alternate abutment member 100 &# 39 ; includes threaded pin 130 &# 39 ; rigidly mounted at the distal end of post 120 &# 39 ;. threaded pin 130 &# 39 ; cooperatively engages with threaded bottom part 92 of cavity 90 . the second and third alternate embodiments shown in fig3 and 4 for fixtures 20 &# 34 ; and 20 &# 39 ;&# 34 ; are basically similar to those shown in fig1 and 2 except that shafts 32 &# 34 ; and 32 &# 39 ;&# 34 ; of anchorage sections 30 &# 34 ; and , 30 &# 39 ;&# 34 ; are of the fin and helical groove types , respectively . a fourth alternate embodiment is shown in fig6 and is generally referred to with numeral 10 &# 34 ;&# 34 ;. root form implant fixture 20 &# 34 ;&# 34 ; used with dental implant device 10 &# 34 ;&# 34 ; is identical to the one used with devices 10 and 10 &# 39 ;. fixture 20 &# 34 ;&# 34 ; can be of any type ( threaded , fin or cylinder ). abutment head 110 &# 34 ;&# 34 ; is removably mounted over fixture 20 &# 34 ;&# 34 ; and in cooperative non - rotational engagement thereon . inwardly chamfered rim 112 &# 34 ;&# 34 ; matingly comes in complementary abutting contact with beveled portion 70 &# 34 ;&# 34 ;. this flat face to face engagement of rim 112 &# 34 ;&# 34 ; and beveled portion 70 &# 34 ;&# 34 ; will create a hermetic seal that will prevent the infiltration of saliva , bacteria , exudate or soft tissue invagination or any other foreign bodies . internal multi - faced socket 114 &# 34 ;&# 34 ; similarly matingly and cooperatively engages with multi - face portion 80 &# 34 ;&# 34 ;, thereby preventing rotation of abutment 110 &# 34 ;. post 120 &# 34 ;&# 34 ; is coaxially inserted through central opening 111 &# 34 ;&# 34 ; of abutment head 110 &# 34 ;&# 34 ; and pin member 130 &# 34 ;&# 34 ; at one end protrudes through rim 112 &# 34 ;&# 34 ; to engage with cavity 90 &# 34 ;&# 34 ; in fixture 20 &# 34 ;&# 34 ;. this engagement is accomplished in the same manner as described for the preferred and the first alternate embodiments . the only difference being that post 120 &# 34 ;&# 34 ; is also provided with an internal socket 122 &# 34 ;&# 34 ; to permit rotating it and causing sleeve 124 &# 34 ;&# 34 ; to come in contact with counterbore surface 116 &# 34 ;&# 34 ;, thereby holding abutment head 110 &# 34 ;&# 34 ; down . screw member 200 &# 34 ;&# 34 ; is designed to hold the prosthesis ( fixed or removable ) to abutment head 110 &# 34 ;&# 34 ;, as best seen in fig7 . the foregoing description conveys the best understanding of the objectives and advantages of the present invention . different embodiments may be made of the inventive concept of this invention . it is to be understood that all matter disclosed herein is to be interpreted merely as illustrative , and not in a limiting sense .

a dental implant device for mounting a prosthesis and minimizing the lodging of extraneous substances in interstitial spaces . a root form implant fixture is permanently implanted in a user &# 39 ; s jaw bone . the fixture includes anchorage and engagement sections . the engagement section includes a cylindrical portion adjacent to the anchorage section , a beveled portion that is adjacent to and coaxially disposed with respect to the cylindrical portion and a hexagonal portion adjacent to and coaxially disposed with respect to the beveled portion .

the container 12 of the invention is shown assembled in fig1 - 5 and is shown disassembled in fig6 and 7 . as stated earlier , the container 12 has a two - piece construction . one piece forms the exterior of the container 12 and the other piece is a flexible sheet that seals the contents of the container . the basic two piece construction of the container enables it to be manufactured easily and inexpensively . this results in the container being offered to consumers at a reduced price . the first piece of the disassembled container is shown in fig6 . the first piece forms both the bottom part 14 and top part 16 of the container exterior . the two parts are connected by a hinge 18 that extends along the back of the assembled container . in the exemplary embodiment the bottom part 14 , top part 16 and hinge 18 are all molded of a semi - rigid plastic , or other similar material . although the parts of only one container 12 are shown in fig6 , it is possible that several containers can be molded from a single sheet of plastic material and then subsequently separated from each other . additionally , although the top part 14 and bottom part 16 of the container shown in fig6 have complementary rectangular configurations , the container 12 could be formed with other configurations such as a circular configuration , a triangular configuration , etc . the container bottom part 14 has a central area that is formed as a receptacle 22 for the ant bait to be contained in the container . the receptacle 22 has a generally rectangular bottom surface 24 defined by a rectangular perimeter edge 26 of the bottom surface . four sidewalls 28 , 32 , 34 , 36 extend upwardly from the bottom surface perimeter edge 26 . in another embodiment of the container having a circular configuration , the container receptacle would have a cylindrical configuration with a circular bottom surface and a single cylindrical sidewall . together the sidewalls 28 , 32 , 34 , 36 and the bottom surface 24 define the receptacle 22 . the top edges of the sidewalls 28 , 32 , 34 , 36 define a perimeter edge 38 of an open top of the receptacle 22 . a substantially flat , rectangular border surface 42 extends around the open top perimeter edge 38 . an upwardly angled rear flange 44 extends from the back of the border surface 42 to the hinge 18 . a pair of upwardly angled left 46 and right 48 flanges extend along the opposite sides of the border surface 42 as viewed in fig6 . the left 46 and right 48 side flanges extend upwardly to respective left 52 and right 54 side strips as viewed in fig6 . the two side strips 52 , 54 are substantially coplanar . an inclined surface 56 extends downwardly from the forward ends of the border surface 42 , the left 46 and right 48 flanges and the left 52 and right 54 side strips . as the incline surface 56 extends away from the receptacle 22 it angles downwardly to a forward edge 58 of the surface . the forward edge 58 is in substantially the same plane as the receptacle bottom surface 24 . the container top part 16 has a similar configuration to that of the bottom part 14 although it does not include a receptacle 22 . the top part 16 has a central area defined by a substantially flat top surface 62 . the top surface 62 has basically the same configuration as the bottom part border surface 42 , although slightly longer in length . although the top surface 62 is shown as a continuous surface , it could also have one or more holes . the top surface 62 is connected to the hinge 18 by a rear flange 64 . the rear flange 64 is angled upwardly as it extends from the hinge 18 to the top part 62 . the top part 16 also has an upwardly angled left flange 66 and an upwardly angled right flange 68 , as well as a left side strip 72 and a right side strip 74 . the left flange 66 and right flange 68 angle upwardly as they extend from the respective left strip 72 and the right strip 74 to the top surface 62 . the left strip 72 and right strip 74 are also substantially coplanar . a tab 76 is formed at the forward edge of the top surface 62 . the tab 76 is connected to the top surface 62 by a frangible connection , for example a line of perforations 78 . other types of frangible connections could be employed to secure the tab 76 to the top surface 62 . the flexible sheet 82 of the container 12 is shown disassembled from the container in fig7 . the sheet 82 can be constructed of any known material typically employed in hermetically sealing packages such as plastic , foil , etc . the sheet 82 has an elongate length with a pair of parallel left 84 and right 86 side edges that extend along a majority of the sheet length to an end edge 88 of the sheet . the end edge 88 is substantially perpendicular to the side edges 84 , 86 . the width of the sheet between the side edges 84 , 86 is substantially the same as the width of the flat border surface 42 of the container bottom part 14 . a pair of inwardly angled edges 92 , 94 extend forwardly from the respective left 84 and right 86 side edges of the sheet . the angled edges 92 , 94 extend forwardly to a tab 96 formed on the sheet 82 . the tab 96 has substantially the same configuration as the tab 76 on the container top part 16 . in an alternate embodiment the tab 96 could just be an extension of the sheet and not have the configuration shown . when the sheet is assembled into the container 12 it is folded over at a fold 98 . the folded sheet has a lower piece 102 and an upper piece 104 . after the ant bait or other substance 106 has been positioned in the receptacle 22 , the sheet 82 is assembled to the container 12 as shown in fig8 . the end edge 88 of the sheet is positioned adjacent the forward end of the border surface 42 of the container bottom part 14 . in an alternate embodiment the sheet end edge 88 could be positioned adjacent the forward edge 58 of the inclined surface 56 . the lower piece 102 of the sheet is laid across the border surface 42 and over the receptacle 22 . the portion of the sheet lower piece 102 that engages with the border surface 42 is removably secured to the border surface by adhesives , by heat sealing , by rf welding , or by other equivalent means . the fold 98 of the sheet is positioned adjacent the container hinge 18 . from the fold 98 the sheet upper piece 104 extends across the top surface 62 of the container top piece 16 . this portion of the sheet is not secured to the top surface 62 or any other portion of the container top piece 16 . however , the tab 96 of the sheet is secured by adhesives , heat sealing , rf welding or other equivalent means to the container top piece tab 76 . with the sheet 82 assembled to the container bottom part 14 and top part 16 as shown in fig8 , the container top part 16 is folded over the bottom part 14 to complete the assembly of the container 12 as shown in fig1 - 5 . the angled flanges of the bottom part 44 , 46 , 48 and the angled flanges of the top part 64 , 66 , 68 space the top part tab 76 above the inclined surface 56 and form an opening 108 into the container interior . the side strips 52 , 54 of the container bottom part 14 and the respective side strips 72 , 74 of the container top part 16 are secured together by adhesives , by heat sealing , by rf welding or by other equivalent means . this completes the assembly of the container . use of the container 12 is shown in fig9 - 12 . in use of the container 12 , the tab 76 of the container top part 16 and the connected tab 96 of the sheet 82 are manually grasped and pulled from the remainder of the container . when the top part tab 76 separates from the top surface 62 , continued pulling of the container tab 76 and the connected tab 94 of the sheet will pull the sheet through the container opening 108 . continued pulling will gradually cause the sheet lower piece 102 to peel away from the border surface 42 of the container bottom part 14 . continued pulling will remove the sheet 82 from the interior of the container 14 and expose the ant bait 106 in the receptacle 22 to the exterior environment of the container through the container opening 108 . still further pulling will separate the sheet 82 from the container 12 . the container 12 is then ready for use as an ant trap . when placed on a floor surface , the inclined surface 56 provides access to the opening 108 and the ant bait in the container interior . although the container 12 is described above is being used as an ant trap containing an ant bait , it should be appreciated that the container can be used to contain any substance , for example other types of insect baits , or air fresheners , or animal repellents , or other types of substances . additionally , although the container 12 is described as having only one receptacle 22 , it should be appreciated that the container could be formed with multiple receptacles positioned side - by - side along the flat border surface 42 of the container bottom part 14 . pulling the sheet 82 from the container could be stopped after one of the receptacles 22 is uncovered , exposing the substance of the one receptacle to the exterior environment of the container through the opening 108 . once the substance in the one receptacle is no longer useful , the sheet 82 could then be further pulled from the container to expose the second receptacle to the exterior environment . still further , although the container 12 has been described with the bottom part 14 and top part 16 being connected by a hinge 18 , the container could be constructed with the bottom part 14 and top part 16 being separate parts . as various modifications could be made in the construction of the invention herein described and illustrated without departing from the scope of the invention , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting . thus , the breadth and scope of the present invention should not be limited by any of the above described exemplary embodiments , but should be defined only in accordance with the following claims appended hereto and their equivalents .

a container for a substance , such as an ant trap container for ant bait is comprised of a minimum number of component parts that are each formed in a cost effective manner to produce an inexpensive container . the component parts of the container include a flexible sheet that seals the substance inside the container . the sheet can be easily manually grasped and pulled from an opening of the container to expose the substance to the opening of the container .

an orthopedic device 10 in accordance with the present invention is shown in fig1 as it is positioned on a human body to support the lumbosacral region consisting of the five lumbar vertebrae and the sacrum . specifically , device 10 in the embodiment shown is a belt or brace or support which is comprised of a trapezoidal back panel 12 and first and second side panels 14 and 16 . spinous stays 18 are support members attached to back panel 12 . additional support members in the form of lateral stays 20 are positioned as seen in fig1 or 2 at the side edges of back panel 12 . fig2 shows device 10 opened flat with the top edge 22 corresponding to the portion which is adjacent to the wearer &# 39 ; s waist and the bottom edge 24 corresponding to the portion which is adjacent to the wearer &# 39 ; s hips . spinous members or stays 18 are shown as oriented parallel to the vertical midline 26 of back panel 12 . spinous stays 18 are displaced from vertical midline 26 by a distance sufficient to place them closely adjacent to the spine but not in contact with it when the device is worn by the wearer as shown in fig1 . stays 18 are placed 1 . 25 inches on center from the midpoint of device 12 . in the preferred embodiment shown , the gap between the inside edges of the spinous stays is approximately 1 . 5 inches . although most of the measurements of devices 10 may vary considerably in the various size configurations of the series of orthopedic devices , the separation of the spinous stays remains at the same distance throughout the series of varying size belts because the distance necessary to keep the stays from directly contacting the spine is essentially the same over the entire range in sizes . in the embodiments shown herein back panel 12 is formed of a suitable stretchable fabric such as 100 % stretch elastic or a stretchable spandex material . side panels 14 and 16 are made from loop fabrics while fastening means or hook material 28 is attached on the outside of left side panel 14 so that device 12 is closed by pulling right side panel 16 over left side panel 14 so that hook material 28 engages the loops on the outside surface of left side panel 14 . the loop material of side panels 14 and 16 and hook material 28 may be of any type well known in the industry which would form a hook type fastener such as velcro ( registered trademark ) brand . the loop materials are relatively non - stretchable . in order to provide an adjustable additional tension on the supported portion of the back , adjustable support straps 30 are provided . one end of support straps 30 is anchored adjacent to spinous stays 18 while the other end is connected to a velcro hook closure 32 which has the operable side facing side panels 14 or 24 for engagement therewith at selected locations in accordance with wearer preference and comfort . in the preferred embodiment shown , support strap hook closures 32 are 3 . 5 inches in length with 2 . 75 inches thereof overlapping side panels 14 and 16 as a guard against peeling . closures 32 are centered on the ends of elastic panels 14 and 16 . as shown in fig2 there are two support straps on each side of the centerline of device 10 . the total span of support straps 30 is proportionately varied for the various supports in the inventory of supports necessary to fit an optimal percentage of the wearer population . in accordance with the present invention , the total length of the unstretched support straps 32 is approximately 0 . 45 times the total length l total of device 10 . in accordance with the present invention it can be seen that a series of belts may be manufactured in varying sizes using the dimensional relationships outlined above . for example a series of belts might include the six sizes listed on the graphs of fig3 and 4 . it has been determined that belts manufactured in the sizes indicated will be suitable for a very high percentage of the potential wearer population . in order to fit a potential wearer to a belt in a series of belts manufactured in accordance with the present invention , the waist and hip circumference of the wearer would be measured and the hip to waist differential would be calculated . the suitable belt would be determined by selecting a belt within the series having a hip to waist differential closest to the measured hip to waist differential . since the hip to waist differential determines the length of the belt , the height and the length of the support straps , there is no need to provide multiple belts in each waist size with varying belt widths as has been previously necessary using conventional belt fitting and sizing methods . although the present invention has been described in terms of the presently preferred embodiment , it is to be understood that such disclosure is not to be interpreted as limiting . various alterations and modifications will no doubt become apparent to those skilled in the art after having read the above disclosure . accordingly , it is intended that the appended claims be interpreted as covering all alterations and modifications as fall within the true spirit and scope of the invention .

a lumbosacral support belt , a series of lumbosacral support belts , and a method of fitting lumbosacral support belts which are manufactured with specific relationships of certain dimensions so that a minimum inventory of belts fits a large percentage of the wearer population . in particular the hip to waist differential and the total waist measurement determine the height of the belt , the dimensions of the back panel and the length of the adjustable support straps .

the physiological / microbial activity occurring in the tampon during menstrual wear indicates a possibility that if the toxin producing strain of s . aureus is present it may produce toxin within or near the surface of the tampon . moreover , the toxin initiates disease by coming into contact with and penetrating the vaginal mucosa . the risk of tss can be reduced by 1 ) preventing s . aureus from colonizing the tampon ; 2 ) altering the conditions within the tampon to insure that the perceived required conditions for toxin production are not present ; 3 ) disrupting the epithelial or antigen presenting cell and t - cell binding sites for the toxin ; 4 ) and / or retaining the toxin within the tampon . section a will provide terms which will assist the reader in best understanding the features of the invention and not to introduce limitations in the terms not consistent with the context in which they are used in this specification . theses definitions are not intended to be limiting . there are three phases to prevent a diseased state . section b will discuss phase i which involves the decrease in and / or prevention of surface or internal bacterial colonization of the tampon . section c will discuss phase ii which addresses potential toxin production by the tsst - 1 producing strain of s . aureus and therefore attempt to inhibit production of toxin within and / or on the surface of the tampon . section d will discuss phase iii in which the goal is to deactivate the binding site of the toxin and / or prevent the toxin from coming into contact with the vaginal mucosa when the tampon is colonized by the tsst - 1 producing strain of s . aureus and it is exposed to the required conditions for toxin production . in general in this specification , the term “ tampon ” is used to refer to a finished tampon typically after a compression process and to any type of absorbent structure that is inserted into the vaginal canal or other body cavities for the absorption of fluid therefrom . as used herein the terms “ vaginal cavity ,” “ within the vagina ,” and “ vaginal interior ,” are intended to be synonymous and refer to the internal genitalia of the human female in the pudendal region of the body . the term “ vaginal cavity ” as used herein is intended to refer to the space located between the introitus of the vagina ( sometimes referred to as the sphincter of the vagina ) and the cervix and is not intended to include the interlabial space , including the floor of vestibule . the externally visible genitalia generally is not included within the term “ vaginal cavity ” as used herein . as used herein , the term “ bound ” means less than about 10 % of the biological activity associated with inhibiting toxin production or growth of s . aureus in the tampon is lost by soaking the tampon over an 8 hour period at 100 ° f . in three times the syngnya capacity of sterile physiologic saline solution . the saline is removed from the tampon by compressing the tampon at 1 psi on a series of blotter paper until ≦ 0 . 5 grams of fluid is absorbed by the blotter paper on the last compression / absorption sequence and remeasuring the biological activity remaining in the tampon . the extraction and testing should be conducted in the absence of light . the ratio of initial biological activity of the tampon pre - extraction to post extraction is & gt ; 90 %. as used herein , the term “ partially bound ” means less than about 50 % of the biological activity associated with inhibiting toxin production or growth of s . aureus in the tampon is lost by soaking the tampon over an 8 hour period at 100 ° f . in three times the syngnya capacity of sterile physiologic saline solution . the saline is removed from the tampon by compressing the tampon at 1 psi on a series of blotter paper until ≦ 0 . 5 grams of fluid is absorbed by the blotter paper on the last compression / absorption sequence and remeasuring the biological activity remaining in the tampon . the extraction and testing should be conducted in the absence of light . the ratio of initial biological activity of the tampon pre - extraction to post extraction is & gt ; 50 %. as used herein , the term “ substantially bound ” means less than about 25 % of the biological activity associated with the toxin production organic growth associated with s . aureus of the tampon is lost by soaking the tampon over an 8 hour period at 100 ° f . in three times the syngnya capacity of sterile physiologic saline solution . the saline is removed from the tampon by compressing the tampon at 1 psi on a series of blotter paper until ≦ 0 . 5 grams of fluid is absorbed by the blotter paper on the last compression / absorption sequence and remeasuring the biological activity remaining in the tampon . the extraction and testing should be conducted in the absence of light . the ratio of initial biological extraction to post extraction is & gt ; 75 %. as used herein , the term “ biological activity ” of a tampon is measured by the method described by j . parsonnet , et . al . ( j . infect . dis . 1996 , 173 : 98 - 103 ). as used herein , the term “ encapsulation ” means the surrounding off or “ caging ” of a compound using a physical or chemical component . as used herein , the term “ nonabsorbent ” means a non - absorbing component of an absorbent article , as distinct from the absorbing article itself , and that individual component ( particle or fiber ) will not swell or absorb fluid . typically , this means less than a 0 . 15 % weight gain of the component when placed in a saline solution for 10 minutes and then removed and compressed at 1 psi repeatedly against a series of blotter papers until less than about 0 . 5 gram of saline is absorbed by the blotter paper on the last compression / absorption sequence . as used herein an absorbent material , as distinct from an absorbent component is a material from which the absorbent core is made and may hold fluid in the intercapillary fibers or voids and may itself be an absorbent or non - absorbent component . as used herein , the term “ inhibitor ” means any agent that prevents the normal growth of an organism or the activity of an enzyme or protein . as used herein , the term “ pre - toxin limiting agent ” means any agent that prevents the initiation or actual production of a toxin . as used herein , the term “ deactivation ” means to make less toxic or nontoxic . as used herein , the term “ permeable structure ” means any article that selectively allows components of a particular size less than or equal to the particular size to readily pass through without substantial resistance . an overwrap is an example of a permeable structure . to reduce the risk of tss , antimicrobial agents are incorporated within an absorptive product such as a tampon to prevent the colonization of the tampon by bacterial species . if the bacterial species colonize , the bacteria can create toxin . if s . aureus is present and the toxin is created , the woman is at risk for tss . the tampon represents a new ecological niche within the vaginal environment for the indigenous bacterial species of the vagina to colonize . new understandings of this indigenous population point toward the hypothesis that the greatest diversity , especially of minor species , in the vaginal biofilm / colony occurs at the surface of the vaginal mucosa . the highest probability of s . aureus initial colonization occurs at this vaginal mucosa surface / tampon interface . components secreted by other species of vaginal bacteria can amplify toxin production by s . aureus . therefore , to reduce the risk of an increase in population of s . aureus , via growth in the tampon , and extracellular components secreted by other organisms from affecting the potential rate of toxin produced , the present invention incorporates inhibitors that inhibit colonization into the tampon &# 39 ; s design and construction . section i . discusses the incorporation of antimicrobial agents into the absorptive product . section ii . discusses the incorporation of antifouling agents into the absorptive product . section iii . discusses the incorporation of biostatic agents into the absorptive product . section iv . discusses the incorporation of negatively charged molecules . finally , section v . discusses the encapsulation of antimicrobial agents and biostatic agents . antimicrobial agents may be incorporated into the construction of the absorptive , non - absorptive , and / or overwrap components of the tampon . antimicrobial agents are agents which inhibit growth or kill bacteria . controlling the localization of these antimicrobial agents is important . if the localization of the antimicrobial agents is not controlled , disruption and / or depletion of the indigenous microflora covering the vaginal mucosa would potentially be harmful to the overall health of the vaginal canal . the antimicrobial activities of many antimicrobial agents are dependent upon solubilization and uptake by the microorganisms of interest . the antimicrobial agents may be covalently linked to the non - absorbent material of the tampon , either directly or through modification . the presence and detection of the antimicrobial agents by the vaginal microorganisms would be sufficient to delay or decrease the potential overall colonization of the tampon during typical wear . modification of the antimicrobial agent to allow the antimicrobial to be immobilized , for example via — ch 2 — or — ch 2 — ch 2 — etc . linker , while not obstructing their active sites would allow for increased availability and effectiveness against colonization of the tampon . however , linking the anitmicrobial agents to the absorbent component of the tampon may decrease the tampon &# 39 ; s overall effectiveness . antimicrobial agents that can be utilized for this purpose may include but are not limited to clindamycin , lysostaphin , phmb , triclosan , and quaternary ammonia compounds . clindamycin and lysostaphin are discussed in more detail below . an additional benefit of using clindamycin is that this agent depresses toxin production by s . aureus . clindamycin hydrochloride , or cleocin ® hcl , is currently used to treat vaginal infections . it is a semisynthetic antibiotic produced by 7 ( s )- chloro - substitution of the 7 ( r )- hydroxyl group of the parent compound lincomycin . clindamycin inhibits bacterial protein synthesis at the level of the bacterial ribosome . it binds preferentially to the 50s ribosomal subunit and affects the process of peptide chain initiation . although clindamycin phosphate is inactive in vitro , rapid in vivo hydrolysis converts this compound to the antibacterially active form . clindamycin has been shown to be an effective antimicrobial agent for a number of organisms reported to be associated with bacterial vaginosis , such as bacteroides spp ., prevotella spp ., gardnerella vaginalis , mycoplasma hominis and peptostreptococcus spp . the antimicrobial agent lysostaphin ( a zinc dependent , 25 - kda glycyl - glycine endopeptidase isolated from s . simulans ) is a specific peptidoglycan hydrolase (“ pgh ”) enzyme for staphylococcus bacteria . pgh enzymes are incorporated and coordinated with the use of absorbent articles to reduce the risk of colonization of the absorbent article by staphylococcus . pgh enzymes are naturally present in small amounts in bacteria where they are essential for cell wall re - modeling that must occur with cell growth and division . because bacterial peptidoglycan structures differ significantly , pghs can be found to target specific bacterial species or groups of related organisms . specifically , the action of lysostaphin is hydrolysis of the — gly + gly — bond in the pentaglycine inter - peptide link joining staphylococcal cell wall peptidoglycans , thereby , digesting the peptidoglycan “ structural barrier ” of the bacterial cell walls . added in excess they rapidly digest peptidoglycan resulting in cell rupture . therefore , lysostaphin , which is a specific pgh enzyme to staphylococcal organisms , would prevent s . aureus and other staphylococcal organisms from colonizing the tampon without adversely affecting the non - staphylococcal dominate species of the vaginal canal . lysostaphin &# 39 ; s n - terminal of the enzymatic protein is the enzymatically active region and the c - terminal is what confers target cell specificity and allows it to distinguish between s . aureus and its parent cells s . simulans ( baba & amp ; schneewind , embo j . 1996 ). crosslinking the protein to a matrix via its c - terminal region would anchor the protein and still allow it to some degree to be enzymatically active against staphylococcal spp . antibiofilm formation agents may be incorporated into an absorbent product such as a tampon to prevent the colonization of the absorbent product . antifouling agents are an antibiofilm formation agent which may also be incorporated into the tampon &# 39 ; s construction . the antifouling agents can be incorporated into the tampon &# 39 ; s construction by binding . the binding of the antifouling agents is important because of the non impact or influence upon an environment external to its current environment . for example , an anti - microbial agent located in the tampon should not impact or influence the growth of bacteria outside the tampon . the two types of antifouling agents which may be incorporated are furanones and l - acyl homoserine lactones . furanones are halogenated compounds that are known to depress gram - negative bacterial growth and kill gram - positive bacteria . l - acyl homoserine lactones are specific to gram - negative bacteria and are also known to control virulence factors . these agents need to be immobilized to the components of the tampon and prohibited from coming into direct contact with the microflora of the vaginal canal . furthermore , quorum sensing signals are active biofilm forming signals for gram - positive organisms and may be employed to inhibit colonization of a tampon . quorum signals will be discussed in depth in section c of the phase ii discussions . biostatic agents decrease bacterial growth . biostatic agents such as the common histochemical dyes , methylene blue , and gentian violet can be cross - linked to cellulose fibers and other potential absorptive materials . methylene blue is a redox dye that raises the oxygen consumption of cells . this means that the protons ( hydrogens ) of the materials to be oxidized are passed on to the oxygen molecules present in the environment . methylene blue in an unbound state acts as an electron carrier short circuiting the electron transport process which is responsible for atp ( adenosine triphosphate ) production within the cell ( as shown in fig1 ). a similar mechanism is hypothesized when methlene blue is bound to a fiber structure . coating the absorbent article and its components with negatively charged molecules prevents the colonization of the absorbent product / tampon . negatively charged tampon and / or its components electrostatically repel bacterial cell surfaces which are negatively charged . if the materials of the absorbent product were negatively charged via the use of po 4 or so 4 etc ., bacteria would be repelled from forming biofilm and or rapidly dividing in this negatively charged environment . incorporating the encapsulation of enzymes and or active agents with an absorptive product such as a tampon prevents the colonization of s . aureus . antimicrobial and / or biostatic agents can be encapsulated by the use of hydrophilic isocyanate polymers . these polymers are water - soluble and a variety of molecules can be incorporated into these hydrophilic urethane type polymers . during the polymerization of hydrophilic isocyanate prepolymers , carbon dioxide is typically generated keeping the oxygen levels in the immediate environment low . this low oxygen environment aides in the overall stability of any enzyme added to the prepolymer emulsion which becomes an integral part of the resultant copolymer . the enzyme ( s ) or other chemical antimicrobial / biostatic agent ( s ) participates in the polymerization and is typically chemically attached at multiple points within the resulting isocyanate copolymer matrix essentially becoming caged within the isocyanate polymer . as described previously , the overall availability and effectiveness of the caged enzyme may be increased by first modifying the attachment site of the enzyme to the polymer matrix via the addition of a “ linker ” molecule . within this copolymer matrix a variety of enzymes have been shown to be thermally stable over time . since this is an aqueous polymerization event , upon hydration of the copolymer matrix the enzyme or microbial agent becomes “ active ” and can exhibit a retention of specific activity as high as 80 % of “ uncaged ” activity . this solubilization of the isocyante polymer allows for a controlled release of the enzyme as fluid triggers the solubilization of the urethane like gel . the components , which exhibit antimicrobial or biostatic activity , are covalently bound to the polymer . upon hydration , the polymer is eroded to release the active material at the preferred site of action . it is preferred to keep antimicrobial and biostatic agents isolated from the vaginal mucosa . this may be accomplished by the use of appropriate overwraps that cover the absorbent core . for example , formed film overwraps may be used or nonwoven overwraps made of rayon , cotton , polyesters , polyolefins that provide separation where the core is isolated from the surrounding vaginal tissue preventing destruction and / or alteration to the vaginal flora . the overwrap may also act in combination with the absorbent core to provide a one - way valve such that fluid enters the tampon and is irreversibly trapped . this tampon exhibits the one - way property when it is loaded with saline at 75 % of syngyna capacity , allowed to equilibrate for fifteen minutes and then placed on blotter paper , the tampon is then rolled over the blotter paper without pressure applied to remove free fluid on the surface of the tampon . the tampon is then placed on a fresh blotter paper and compressed with a force of 1 psi . if the squeeze out on the blotter paper is less than 0 . 1 grams the tampon is considered to be a one - way valve . physical separation of the inhibitor or antimicrobial agent can be demonstrated by adding sterile saline solution ( at syngyna capacity ) gently blot the surface to remove free fluid and place the tampon containing the inhibitor onto an agar place colonized with a lawn of lactobacillas . if the lactobacillas lawn is not disturbed / killed at the contact point between the tampon and the agar plate physical separation is demonstrated . extensive in vitro work describes the environmental and genetic conditions required for s . aureus to produce tsst - 1 toxin . current in vivo physiological understanding of the dynamics of dissolved oxygen and carbon dioxide in the tampon during menstrual wear indicate that optimum conditions for toxin production by s . aureus must exist within the tampon . the oxygen required for potential toxin production within the tampon is believed to come from the inherent air within the tampon and the oxygen carried by the menstrual fluid absorbed by the tampon . the inherent oxygen of the tampon is essentially unutilized by the facultative microorganisms of the vaginal canal in the absence of blood / menses . however , in the presence of a heavy loading of blood / menses virtually all of the oxygen in the tampon can be consumed , while the dissolved carbon dioxide levels within the tampon rise significantly above that present in the vaginal environment . as shown in fig2 a , during non - menstrual wear , carbon dioxide levels of the tampon rose to be essentially equivalent to those observed in the vagina . however , as shown in fig2 a , the oxygen levels within a non - menstrual tampon remained essentially at atmospheric levels . as shown in fig2 b , during menstruation , the mean levels of carbon dioxide in about 50 % of the tampons exceed the carbon dioxide levels of the vaginal environment . the mean levels of oxygen within the tampon decrease with apparent loading of the menses such that about 50 % of the menstrual tampons reached an oxygen level near the ranges of oxygen levels observed in the vagina after 8 hours of wear . the decline of oxygen and the increase of carbon dioxide within a menstrual tampon may be at least partially related to microbial metabolic activity . since menses is a mixture of venous and arterial blood , some of the oxygen may be “ lost ” due to partitioning from the gas phase to the liquid phase where it binds to un - oxygenated heme molecules present in the menses . the oxygen and carbon dioxide levels observed in a menstrual tampon after prolonged wear are consistent with in vitro data showing high levels of toxin production by s . aureus under similar o 2 / co 2 conditions . phase ii provides several approaches to prevent toxin from being produced by the tsst - 1 producing strains of s . aureus . particularly , pre - toxin limiting agents are used to retard the production of bacteria produced toxins . part i . discusses oxygen scavengers incorporated into the construction of the tampon . part ii . discusses the alteration of the heme in menses . part iii . discusses the encapsulation of antimicrobial agents via hydrophilic isocyanate polymers . part iv . discusses the construction and / or additive to an absorbent structure , which either moderates ( i . e . reduces ) the thermal energy released during expansion of a tampon and / or cools the absorbent article . part v . discusses the blockage of either the production of the octapeptide ( quorum signal ) or the binding of the peptide to the cell membrane receptor . in a number of in vitro experiments , oxygen has been shown to be essential for toxin production by s . aureus . an oxygen scavenger incorporated into the construction of a tampon would significantly reduce , if not entirely prohibit , toxin production within the product . examples of oxygen scavengers , which could be employed , are antioxidants such as ascorbic acid , tocopherol and retinal . compounds such as the antioxidants used in food substances such as butylated hydroxyanisole , di - tertiary - butyl - patacresol , propyl gallate , phenylenethiourea , and aldoalpha - napthylamine could also be used . other oxygen scavenging agents employed may be composed of transition metal complexes , chelates of a salicyclic acid , salicylate salt , metal complex , and / or chelate of an organic polycarboxylic acid preferably an amino polycarboxylic acid wherein the transition metal could be supplied via the iron present in menses from the degraded heme molecules present in this body fluid . this type of oxygen scavenging molecule is typically activated by contact with water or water vapor . these same oxygen - scavenging agents have the additional benefit of moderating the ph of the tampon . because optimum toxin production occurs at a neutral ph , any agent which will lower the ph of the internal environment of the tampon into the acidic range could effectively reduce toxin production . such agents are organic acids , for example ascorbic acid , polycarboxylic acid , etc . not only does ascorbic acid act as a means to lower the ph and / or scavenge oxygen , but the ascorbic acid also deactivates the toxin . while the mechanism of deactivation is unknown , the present application includes the use of ascorbic acid in a tampon to deactivate the potential presence of tsst - 1 toxin to the point of rendering it non - toxic , i . e . not lethal in animal experiments . another approach is to alter the heme in menses such that it has a lower affinity for oxygen . this may be accomplished by placing bpg ( 2 , 3 - bisphosphoglycerate ) within the tampon . bpg lowers the affinity of oxygen for hemoglobin by a factor of 26 . this is the compound used to dissociate oxygen from the heme enabling the unloading of oxygen to tissue capillaries in the body . if the oxygen can not associate with heme , it is probable that it will no longer be bioavailable to the microorganisms potentially colonizing the tampon such as s . aureus and therefore , avoid the perceived required conditions for toxin production within the tampon during menstruation . in phase i , there was a discussion of encapsulation of antimicrobial agents via hydrophilic isocyanate polymers to prevent colonization of the tampon . this same technology can be utilized to encapsulate agents which would prevent or decease the production of toxin by s . aureus . an alternative method to the isocyanate polymer encapsulation would be the use of alginates precipitated from solution . material that may be physically encapsulated includes but is not limited to carbon black , antimicrobials , oxygen scavengers ( i . e . ascorbic acid ), quorum signal analogs and / or blockers , methylene blue , chitosan malate , etc . these same compounds can be added to absorbent foams either pre - or post - polymerization . other agents which can be added include but are not limited to ascorbic acid , tocopherol , glycerol , etc ., all of which have been shown to reduce toxin production and / or deactiviate the toxin tsst - 1 . algenic acid can also be made into fibers via reaction with cellulosic fibers and provides a matrix for the additional cross - linking of a number of compounds such as chitosan malate , which is known to depress microbial growth of s . aureus and significantly reduce its ability to produce the tsst - 1 toxin . thus , alginate particles / fibers act as an active agent carrier that can be used with or in a component of the construction of an absorbent article such as a tampon to depress microbial growth of s . aureus and significantly reduce its ability to produce the tsst - 1 . iv . construction and / or additive to an absorbent structure which either moderates or reduces the thermal energy released during expansion of a tampon and / or cools the absorbent article a potential risk factor for toxin production in vivo is believed to be elevated temperature . in an attempt to moderate or depress any tendency the tampon may have to exist at an elevated temperature in vivo , a number of compounds could be used . as shown in fig3 a , in in vitro experiments a one degree fahrenheit increase in temperature can result in a 50 % increase in tsst - 1 production by s . aureus . this patent application claims any technique of construction and / or additive to an absorbent structure , which either moderates ( i . e . reduces ) the thermal energy released during expansion of a tampon and / or cools the absorbent article ( either of compressed or non - compressed construction ) such that it preferably remains at or below typical body temperature of 98 . 6 ° f . if the internal tampon temperature does rise above the ambient body temperature of 98 . 6 ° f ., it returns to 98 . 6 ° f . within 30 minutes . a number of currently marketed products are tested for their potential change in internal temperatures upon hydration , i . e . a measure of their absorbent material &# 39 ; s heat of dissolution . the experimental design involves the use of non - lubricated condoms submerged with the open end above water into a 98 . 6 ° f . water bath . a thermocouple is placed in a small hole drilled through the middle of a tampon , which is inserted into the condom such that it too is submerged into the water bath . a second thermocouple is placed between the tampon and the surrounding condom . the condom - surrounded tampon is then allowed to come to the temperature of 98 . 6 ° f . sterile saline is also allowed to come to a temperature of 98 . 6 ° f . in the same water bath . a gush of the 98 . 6 ° f . sterile saline ( at syngyna capacity ) is then pumped in such that the tampon becomes saturated . the internal and external tampon temperature is monitored . in addition to commercially available products , a tampon constructed of a super absorbent material as well as one constructed of foam absorbent material ( fam ) is tested . as shown in fig3 b , no changes were observed for the tampons “ external ” temperature . as shown in fig3 b , currently marketed products that are constructed as a compressed “ plug ” of absorbent material exhibited a sharp rise in internal temperature upon hydration with fresh menses . the thermal energy is a result of the release of expansion energy upon hydration of the compressed absorbent plug structure . referring to fig3 b , note that the temperature of the commercially available products quickly returned to water bath temperature after the action of hydration . the tampon composed of super absorbent material exhibited an internal temperature of over 2 ° f . above that of the water bath and sustained this temperature for a prolonged period of time of 7 hours . temperature increase of the super absorbent tampon may be related to the heat of dissolution of the materials used in its construction , a phenomena previously not considered in tampon construction . the foam absorbent material (“ fam ”) constructed tampon &# 39 ; s internal temperature rose only slightly and quickly returned to the original ambient temperature of 98 . 6 ° f . the epson salt or magnesium sulfate hepta - hydrate ( mgso 4 — h 2 o ) is somewhat endothermic in nature and could be employed to counteract any physical reactions to elevate temperature within the tampon . epsom salt or magnesium sulfate hepta - hydrate ( mgso 4 — h 2 o ) has a low energy of dissolution . certain absorbent materials such as psyllium husk and certain fams have been shown to moderate the temperature of a tampon under the experimental conditions outlined above such that the temperature of the tampon is not significantly elevated ( as shown in fig3 a and fig3 b ). other agents that possess zero or less than zero heats of dissolution include but are not limited to nacl , ca ( no 3 ) 2 - 4h 2 o , na 2 co 3 - 10h 2 o , cacl 2 - 6h 2 o and various other magnesium salts . an absorbent foam such as fam or another absorbent may be saturated with a solution of salt such as cacl2 , mgcl2 , or sodium ascorbate or absorbic acid and then dried leaving a residual salt or acid content within the foam . it has been found that concentrations of these materials on a weight percent of foam between 0 . 1 % and 10 % can inhibit tss - 1 production . the architecture of the tampon being either a compressed plug or a loose sack has been demonstrated to impact the internal temperature of the tampon upon hydration . the loose sack design moderates the temperature of the tampon such that its internal environment does not exceed the temperature of the body during absorption of bodily fluids . in this design cellulose could also be employed in the construction of the product to act to establish a less dense product to allow for better temperature control , i . e . body temperature or less . v . blockage of either the production of the octapeptide ( quorim signal ) or the binding of the peptide to the cell membrane receptor this patent application claims the use of such signals and / or signal analogs / antagonist , either natural or artificial in origin to repress the signal for the ultimate production of tsst - 1 by s . aureus in an absorbent article and or menstrual cup , diaphragm or other like devices . likewise any agent that can either prevent the production of the octapeptide , bind up the octapeptide after its production such that it is no longer available to “ feed back ” to the cell or occupy the binding sites on the cell membrane such that the cyclic peptide — signaling molecule octapeptide ( agr d / autinducing peptide ) can not bind and signal for toxin production in the absorbent articles . the gene cluster or operon that regulates the expressions of the toxin designated tsst - 1 is an example of quorim sensing . when an infectious agent such as s . aureus invades a host , it first attaches and attempts to grow and form a biofilm . the agr system controls the production of many secreted proteins : positively regulating enterotoxins , epidermolytic toxins and enzymes produced by staphylococci , and negatively controls such proteins such as protein a , fibronectin - binding protein and coagulase . during this time signals are sent out into the immediate environment where the biofilm is forming . when enough of this signal is present , it binds to a membrane receptor on the s . aureus cells to indicate that a critical density of bacteria has been reached and cells of s . aureus may be released into the environment to continue the process of infection . therefore , when the population of the cells is dense enough and the concentration of signal is high enough such that an individual bacterial cell can detect the signal toxin synthesis is initiated . this high level of signal is referred to , as a “ quorum ” of signal , the signal compound in the case of tsst - 1 is an octapeptide auto inducing peptide . toxin production occurs due to a cascade of phosphorylation events in response to the quorum signal within the cell that brings about the activation of the promoter region , which controls the expression of the genes encoded for the toxin . after the biofilm “ burst ”, the s . aureus cells adhere to a new site within the host and the “ quorum sensing ” process begins again . fig4 depicts the production of the octapeptide , its release into the environment and its signaling for the production of the toxin . ( arvidson , s . european conference on toxic shock , september 1997 ) as shown in fig4 , blockage of either the production of the octapeptide auto inducing peptide ( quorum signal ) or the binding of the peptide to the cell membrane receptor , could essentially lock the door to toxin production . with the use of natural repressors for tsst - 1 production such as competing analogs or antagonists peptides . therefore , this patent application claims the application of such an analog or antagonist peptide / compound to the construction of and / or as an additive to an absorbent article such as a tampon to reduce the expression of tsst - 1 toxin by s . aureus during the absorbent articles use . phase iii of this patent application claims any technique ( i . e . application of technique to an absorbent article ) or tampon construction that acts to retain / adsorb the toxin into / on the tampon preventing the toxin and / or toxin producing strains of s . aureus from coming into contact with the vaginal mucosa . to prevent any tsst - 1 toxin production from contacting the vaginal mucosa , the tampon will be designed to specifically attract and bind tsst - 1 toxin from and within the tampon from the immediate environment around the tampon or from blood / menses entering the tampon . several ways have been developed to retain the toxin in the tampon by a variety of ligand binding sites . the binding of the specific toxins onto the fiber surfaces of the tampon prevents them from contacting vaginal mucosal tissue , and thereby , is expected to provide some degree of protection to the wearer against the toxin . the toxin can be retained by a direct affinity to its own antibody or antibody fragment or a chemical hapten resembling its own binding site . specific polypeptides or fragments of polypeptides which show an affinity for the toxin can also be employed to directly link the toxin . toxins may also adhere to specific oligonucleotide sequences which create direct or combinatorial libraries and screen them for binding activity to the toxin that can identify these oligonucleotides . indirectly the toxin can be linked by saturating the environment with protein a . there are a variety of methods to attach ligands to fibers and / or materials , such as : 1 ) solid matrix support though cullulosic fibers : 2 ) activation coupling chemistry with the use of sodium periodate : 3 ) site directed antibody coupling though carbohydrates : 4 ) coupling of antibody fragments with sulfhydral residues : and 5 ) amplification of antibody binding sites such as avidin coupled matrixes or biotinylated antibodies or fragments . the above - described ligands need not only be linked to the tampon &# 39 ; s absorptive fibers / particles and / or overwrap and / or materials ( i . e . psyllium , fam , etc .). the toxin binding ligands may also be attached to non - absorptive / or absorptive glass beads , zeolites and charcoal as examples . in addition , the ligands may be attached to the inner surface of the tampon overwrap composed of formed film topsheet , 3 - d films , high loft structures , low capillary force gradients ( hollow fibers , etc .). these materials act not only as one - way flow valves , allowing flow into the tampon but not out , but also as the final “ net ” to catch the toxin before coming into contact with the vaginal mucosa . in order for the toxin to remain in the tampon once it becomes linked to a particular ligand , the ligand must be anchored to the particular absorbent or non - absorbent material composing the tampon . if the biologically active molecules is not bound or partially bound to the internal matrix of the tampon there may be a risk of the toxin coming into contact with the vaginal mucosa . here again , the one - way flow valve overwrap structure can be incorporated to the final “ safety net ” to catch any toxin or toxin complex from coming into contact with the vaginal mucosa . overwraps that isolate or trap fluid in the tampon by providing a physical separation between the fluid in the core and the top surface of the tampon or vaginal membrane are defined as “ one way valves .” all documents cited in the detailed description of the invention are , in relevant part , incorporated herein by reference ; the citation of any document is not construed as an admission that it is prior art with respect to the present invention while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .

an absorbent article has an absorbent material and an outer surface including an inhibitor which is partially bound to the absorbent material and substantially inhibits the colonization of bacteria within the absorbent article . an absorbent article has an absorbent material . the absorbent material has an outer surface . the absorbent article includes a pre - toxin limiting agent which is partially bound to the absorbent material and substantially retards the production of bacteria - produced toxins by the bacteria residing within the absorbent article . an absorbent article has an absorbent material . the absorbent material has an outer surface . the absorbent article includes a toxin enclosing agent . the toxin enclosing agent substantially inhibits the migration of toxin outwardly from within the absorbent article towards the outer surface of the absorbent article .

55 grams of carmiosine red pigment and 20 grams of ponceau r4 124 red pigment , 90 g sucrose is added to 180 mls of water and boiled until the carmiosine red and sucrose are dissolved . 260 mls of glycerol and 395 mls of ethanol is then added to form the following 1 litre of ink composition 26 % glycerol 39 . 5 % ethanol 9 % sucrose 18 % water and 7 . 5 % colouring agent . it will be readily appreciated by a person skilled in the art that solvents other than water may be used to dissolve the pigment or dye in the formation of the colouring agent will vary according to the pigment or dye being used . other solvents may include appropriate food acids , such as formic acid . depending on the dye or pigment used in the formation of the ink the dye or pigment may be ground finely and suspended in the ink composition . the percentage composition of ink outlined in example 1 has been found to be effective for food grade red , blue and brown dye pigments . in a similar manner to example 1 ink was formed using brilliant blue dye pigment to create an ink comprising ; 6 % glycerol 32 % ethanol 30 % sucrose 25 % water and 7 % colouring agent . in a similar manner to example 1 ink was formed using ht brown dye pigment to create an ink comprising ; 20 % glycerol 28 % ethanol 25 % sucrose 20 % water and 7 % colouring agent . in a similar manner to example 1 ink was formed using tartrazine dye pigment to create an ink comprising ; 20 % glycerol 28 % ethanol 25 % sucrose 23 . 5 % water and 3 . 5 % colouring agent . it is preferable when forming inks comprising tartrazine as the colouring agent that the colouring agent is present in a concentration of between 2 . 5 to 4 . 5 % to prevent the ink from becoming to viscose . it will be appreciated by the person skilled in the art that a number of dye pigments may be used in the formation of a suitable ink in order to create a broad range of colours , e . g . combining brilliant blue and tartrazine to form a green colouring agent . the combined stamp and cutter 10 includes a hollow cylindrical housing 11 . a circular edge 12 of the housing is sharp and is used to cut biscuit dough into a circular shape . it should be appreciated that shape of the edge 12 may be changed to vary the shape of the biscuits . a shaft 13 extends through the housing 11 substantially along a central axis of the housing 11 . the shaft 13 is mounted to a top of the housing and is able to reciprocate with respect to the housing 11 . a stop 14 is located on the shaft to prevent the shaft from being reciprocated past a predetermined point . an internal spring 15 and an external spring 16 are mounted to the shaft locate the shaft 13 in a desired rest position . a stamp 17 is located at the end of the shaft and is located within the housing 11 . the stamp 17 comprises a backing plate 18 and a stamping plate 19 . the backing plate 18 is attached to an end of the shaft 13 and is removably attached to the stamping plate 19 . the stamping plate 19 is normally made of plastic or rubber . the stamping plate 19 is cut to reflect the desired impression to be placed on a biscuit . to make a batch of marked biscuits , biscuit dough is mixed and rolled into a sheet of desired thickness . the ink of any one of the above examples is applied to the stamp plate 19 through the use of an inkpad ( not shown ). the combined stamp plate 19 and cutter 10 is located over the inkpad and the top of the shaft 13 is pushed toward the top of the housing 11 until the stamping plate 19 contacts the inkpad . the shaft 13 is released and returns to the rest position . the combined stamp and cutter 10 is placed on the sheet of biscuit dough and force is again applied to the shaft 13 . this causes the stamping plate 19 to contact the biscuit dough and apply ink to the biscuit dough . at the same time , the edge 12 of the housing 11 cuts the biscuit dough to produce an image . this process is repeated until all the biscuit dough is cut . the biscuit dough is then baked to produce the batch of biscuits . fig2 show a comparison of a biscuit dough stamped using the method of the invention in a similar manner to that described in example 5 ( a ), compared with biscuit dough stamped with commercially available inks using a hand stamp ( b ). it can be readily seen that the method of the invention provides a printed biscuit that has a clear image and can convey fine detail . whilst the printing using commercially available ink results in bleeding of the ink to the extent that detail of the image is lost thorough the ink bleeding over the biscuit . the method of the invention and the ink used within the method provides the advantage that when applied to the biscuit dough , the ink does not bleed into the biscuit dough and hence a clear , crisp image can be produced on the biscuit . further , the ink is not affected by baking and does not burn . the application of ink allows a quick and efficient image to be placed on a biscuit . different colours can be used to create a more noticeable image . it has found that by altering the solvent ; glycerol ; water content of a commercially available ink that surprising improvements in quality and appearance of marking or printing on bakery products can be achieved . it is believed that currently available edible inks bleed when printing onto bakery products because on initial application the ink beads , as it settles into the bakery product the bead spreads to cause a disperse area of colouring , or bleeding . it has surprisingly been found that by increasing the ethanol and glycerol contents of commercially available edible inks compositions to create inks which have a surface tension which is sufficiently low to prevent beading of the ink on application to bakery product , thus preventing bleeding and allowing the producing of a printed or marked product having a clear and image , patter , words and / or letters . the method of the invention provides greater flexibility to a baker in that with the method of the invention they may now clearly printing or marking a broad range of bakery products , including the pastry crust of pies , bread rolls and loaves , shortcrust etc . prior to the development of the method of the invention it was not possible to produce a clear printed or marked bread roll or loaf , without scorching the image onto the roll or loaf that affected the taste of the bread . furthermore , a broad range of printing apparatus may be utilised to in the method of the invention . it should be appreciated that the ink may be applied to the biscuit dough using any number of different methods . for example , a self - inking stamp and cutter may be used so that the inkpad is unnecessary . alternatively , the biscuit dough may be cut separately and a separate stamp used to apply the ink to the biscuit dough . still alternatively , the ink may be used with an automatic baking machine in which the ink is applied in an automated fashion . the bakery product may be printed using a roller stamping method , a mechanical stamping method , stencil spraying and / or laser and ink jet printing techniques . the stamping surface may be selected from gun metal , brass , cast steel , natural rubber , synthetic rubber , and food grade elastomeric materials . it is anticipated that if the above method employs a laser jet or ink jet printing apparatus it may be necessary lower the glycol content to less than 1 % of the ink . the glycerol is required help the dye pigment to dry as a thin film but needs to be in sufficiently low concentrations to prevent fouling of the printing head . without the glycerol the dye pigment dries as a powder during baking of the bakery product . it will be appreciated by the person skilled in the art that the ink compositions described above may be altered or customised within the defined ranges to suit the various printing techniques , apparatus or stamp surfaces that may be utilised to apply the ink to a bakery product prior to baking . the methods and inks described above may also be applied to bakery products for animal consumption , such as dog and cat biscuits . it should be appreciated that various other changes and modifications may be made to the invention described without departing from the spirit or scope of the invention .

the invention provides a method of marking bakery products including the steps of : mixing a bakery dough to make a bakery product ; applying an ink to the bakery dough and baking the bakery dough to make the bakery product . the ink has a sufficiently low surface tension to prevent beading when applied to said bakery dough and comprises : glycerol between the percentages 0 to 60 % by volume ; solvent between the percentages 10 to 60 % by volume ; sucrose between the percentages 5 to 60 % by volume ; water between the percentages 1 to 55 % by volume ; and colouring agent between the percentages 0 . 5 to 20 % by volume .

fig1 shows an example non - limiting illustrative implementation of a system 100 providing a motion - coupled visual environment . in the fig1 example shown , system 100 includes three main components : a sensing arrangement 200 that detects the physically indicated motion , a coupling arrangement and associated algorithm 300 that couples the physically indicated motion , and a presenting arrangement 400 that presents an evocative scene . in the example implementation , the sensing arrangement 200 includes one or more sensors that sense inertial motion . in one example implementation , sensing arrangement 200 is disposed somewhere on the same platform carrying the person ( e . g ., mounted to a vehicle frame , vehicle floor , transport platform etc .). sensing arrangement 200 can sense motion using any of a variety of different sensor types or combinations thereof , including for example : accelerometer ( s ) global positioning system ( gps ) gyroscope ( s ) mechanical sensor ( s ) inclinometer ( s ) vibration sensor ( s ) altimeter ( s ) optical - based sensor ( s ) image - based sensor ( s ) firmware software other implementations . motion sensing arrangement 200 provides an output to coupling arrangement 300 . coupling arrangement 300 in one example implementation comprises firmware , hardware , software and / or other implementation that performs a coupling algorithm or method to derive one or more control parameters from the sensed motion . this derived control parameters is supplied to a presentation arrangement 400 that generates a visual scene for viewing by the person who may be subject to motion sickness . the scene presentation arrangement 400 may include for example : virtual environment liquid crystal display a cathode ray tube display head mounted display projection type display holographic display other implementations . many different configurations are possible . four examples of system configurations are shown in fig2 through fig5 . in fig2 , a passenger ( p ) is shown viewing a computer - generated scene shown on a flat - panel display ( d ). the scene is being modified by coupling arrangement 300 to incorporate elements of the inertial environment that are sensed via a sensing arrangement 200 . a corresponding motion - coupled virtual environment is presented on a display 402 . in fig3 , a radar systems operator r is shown viewing an electronic display 404 . the display d is encapsulated within a window w that is moved by coupling arrangement 300 to incorporate elements of the inertial environment as sensed by sensor 200 . even though the operator r could have some access to the external environment through porthole p in this example , this is immaterial since his or her attention is focused elsewhere ( i . e ., on the display d ). in fig4 , a passenger p on an aircraft is shown using a laptop computer l having a display 406 . the computer l is shown displaying on display 404 a window of graphic / test information . the laptop runs software providing a coupling arrangement 300 that manipulates the window location to better correspond with the inertial environment as sensed by sensor 200 . although the passenger has access to an external view through a window ( w ), his or her attention is focused on the laptop or the external view may not be sufficiently evocative due to weather or lack of visual cues . in fig5 , a user ( u ) is using a simulator s for training . he or she is presented with an immersive virtual environment via an electronic display 408 . the user &# 39 ; s perspective within this virtual environment is modified by system 100 , of which the sensor package 200 is shown . again , reference to an external environment ( w ) is not of any utility in this example . many types of displays are possible . some examples are shown in fig6 a - 6e . a projector 408 may display either digital signals from a computer or television images onto a screen 409 . a virtual environment may be displayed using a head mounted display ( hmd ) 410 , a projected virtual environment such as a cave 412 or some other means . a crt or flat panel display 414 may also be used to show an immersive scene or other information window ( w ). a conventional television 415 can be used to display a windowed image that could be text , graphics or a combination . many other display types are also possible . there are a multitude of sensors and methods that can be used to monitor the inertial environment , as well as acquiring and processing the information . for any such system , the motion data would consist of some combination of translational and the rotational degrees of freedom . in most applications it will be sufficient to track the inertial components for the physically indicated motion produced by the environment . these inertial components are the main contributor to motion sickness . one example of a sensor arrangement 200 is an array of three orthogonal accelerometers . especially for slower moving platforms , such as a ship , pitch and roll may be approximated by sensing off - axis angles to the gravity normal vector , and heave , defined as vertical translation parallel to the gravity normal , may be calculated via a double integration of acceleration or via some other means . for faster moving platforms , such as an automobile or aircraft , it is sometimes desirable to sense further degrees of freedom to estimate horizontal degrees of freedom and the yaw component . this may be done , for example , by using gyroscopes or rate gyroscopes to measure rotational degrees of freedom , freeing the accelerometers or other measurement device to sense translational information . in general , an implementation of sensor arrangement 200 for acquiring the physically indicated inertial motion can combine accelerometers , gyroscopes , gps , other sensors , and information processors . an illustrative example of such an implementation is depicted in fig7 . here , a processor board 102 indicates a gyroscope 202 , an analog devices adxl202 accelerometer chips 204 a , 204 b , a led and switch connector 206 , a battery connector 208 , an rs232 or other serial port connector 210 , a rs232 converter 212 , a seeprom 214 , a pic 16c73 8 bit microcontroller 216 and operational amplifiers 218 . in the example , the sensor arrangement 200 is mounted to the motion platform with minimal mechanical compliance such that the data acquired matches the motion experienced . for more accurate motion data , the sensor should be placed in proximity to the user or users with known relative orientation . it may be calibrated to establish relative directions of motions such as front , back , left , right , etc . with respect to the user . this calibration may either take place in the factory , implying that the system is to be oriented to the user is a set manner , or it may take place at the point of use . fig8 shows an example block diagram of an illustrative non - limiting sensor arrangement 200 . accelerometers 204 or other sensors record inertial frame reference data . these data arc processed by signal conditioning hardware 218 before being input to a computer 216 , normally a microcontroller or microprocessor . the computer 216 communicates with a sepiprom memory device 214 or other memory device , which stores programming code , calibration parameters and run - time and other data in memory , or the computer 216 may use its own internal memory . the computer 216 also interacts with an rs232 serial communications system 210 , 212 or other communications system that is often power regulated to better interface with external devices . the communications system 210 , 212 transmits and receives information at a variety of baud rates . the electronics hardware is often controlled by software embedded into various devices on the hardware such as the microcontroller 216 and other devices . fig9 shows one example of how this software may operate although many other configurations are possible . once system 100 is turned on , the software begins an autostart function by waiting a set period ( block 250 ). after this period is complete , the system 100 checks to see of its registers have received a command from the offboard system such as an “ r ” or a “ f ” ( blocks 252 , 254 ). these commands , for example , would indicate that the system 100 should perform other functions ( blocks 256 , 258 ) before stopping the loop . likewise , if the auto - start mode fails ( decision block 260 ), the system will attempt to recover ( block 262 ) before stopping . assuming that the systems starts successfully , it will sample the sensors ( block 264 ), communicate data to an output port ( block 266 ) and send check sums to the microcontroller that uses these data to check for errors ( block 268 ). after completing these tasks , the system will loop back to sampling the sensors again . an example of the motion coupling arrangement 300 provides an algorithm that takes selected vectors of the physically indicated motion and generates appropriate visual scene information . the appropriate coupling algorithm may be different for different individuals . recent research has shown that humans often perceive their inertial environment incorrectly when they lack any or sufficient visual cues . since it is the perceived zineuial environment that must be rationalized with the perceived visual environment , even a perfect match of inertial and visual environments may still cause motion sickness . in these cases , it is possible to test the user in a well - controlled motion environment and record inaccurate tendencies of their proprioceptive receptors . for example , in testing subjects in a vertical linear oscillator ( vlo ), only a small percentage of the population may be able to accurately perceive their motion . of the majority of humans tested , a large number experienced a stable and predictable error in perception . other subjects , however , perceive the inertial environment as changing . for the subjects perceiving a stable environment , an exemplary instantiation may be calibrated to individual inertial sensing predilections , thus greatly accentuating the effectiveness of the system in relieving motion sickness . in addition to calibration beforehand , another possible implementation would allow for passive and non - passive feedback / control from the user . the physiological effects of motion sickness are well documented and can be monitored . using this physiological feedback , such as heart rate and / or perspiration and / or pupil dilation . etc ., the coupling algorithm would adjust to the individual . in addition , individuals can be provided with controls that allow them to adjust various parameters of the coupling algorithm , such as magnitude or motion profile of the physically indicated motion . an example of one coupling arrangement 300 is depicted in fig1 , although other instantiations are possible . such controls could be mechanical in nature , a graphical user interface ( gui ) or some other means . fig1 depicts a mechanical control panel 302 . there are two sections of control : sensitivity section 304 and cross coupling section 306 . the sensitivity section 304 controls the mapping of a given degree of freedom from the inertial reference frame to the visual . for example , an indicator 308 of + 0 . 52 for pitch would imply that the pitch output is 52 % of that input . example digital readouts 300 are shown . analog readings by the dials 310 as they point to graduated markings 312 are also possible . the user may control these sensitivity channels via knobs 314 or some other interface . cross coupling section 306 provides several channels such as roll 316 indicating the mapping from one inertial degree of freedom onto a different visual degree of freedom . for example , roll channel 316 could map partially onto yaw and heave or other degree of freedom as indicated on a scale 318 using , for example , a slide bar 320 . in general , great care should be taken in making these modifications . recent experiments have shown that some cross couplings are beneficial , while others are counterproductive . the user interface does not need to be mechanical ; it can be a graphical user interface on a computer , voice activated or many other types of interface or the coupling parameters can be preprogrammed or preset and the user interface eliminated altogether . the fig1 arrangement shows a flexible interface providing many different types of couplings and cross - couplings , but other implementations can be substantially simpler and more con strained . the coupling arrangement 300 can be implemented through hardware , software , or combination of the two . for example , hardware may be used for signal processing and conditioning , and may be complemented with firmware and software to modify and generate appropriate coupling output . in this example , the hardware provides for fast signal processing , while the firmware and software provide flexibility and a readily available interface . the display arrangement 400 will often be interfaced to the hardware via software oftentimes called a “ device driver .” one example of such software is shown in fig1 . once the exemplary display program is first opened , it begins by initializing communications with the sensor arrangement 200 through an interface such as a serial port 210 ( block 404 ). it will then read calibration data as in 212 that are installed either at the factory or set via , the supplied user interface ( block 406 ). the software then enters a continuous loop block 214 where it is continuously reading sensor data provided by the hardware and adjusts the values for input to higher - level display software as required by the calibration parameters and other data and algorithms ( block 408 ). the exemplary implementation of system 100 may be implemented using a preset algorithm for mapping inertial motion to the visual scene , or the user may modify the mapping for personal preference using either a mechanical or graphical user interface . furthermore , the exemplary presentation arrangement 400 in certain applications does not necessarily generate an image that realistically portrays the direction of inertial motion sensed by sensor arrangement 200 . for example , it may not always be possible or even desirable for an essentially two - dimensional information display such as a radar screen , a television program , or a computer text document display to accurately depict inertial motion sensed in three - dimensions . one example mapping algorithm maps inertial heave information to display motion in the pitch direction . human subject experiments have shown that while subjects can easily perceive heave , a physically correct representation of heave in the visual environment is only rarely visually stimulating to a sufficient degree to produce the necessary correlation between visual and inertial environments . therefore , exemplary illustrative implementations of system 100 may map sensed inertial heave into the visual pitch direction , normally adjusting pitch motion to remain within 10 degrees of throw or some other range of motion . we find this produces much better results for at least some applications in terms of subjects sensing a correlation between visual and inertial environments . the frequencies that cause motion sickness symptoms are known to be centered around 0 . 2 hz , regardless of more complex , higher - frequency motions that may be superimposed . in this sense , it matters little whether the exemplary system described above is used in a land vehicle , aircraft or ship . however , illustrative non - limiting implementations can be configured to record the frequencies associated with motion sickness and electronically filter out very high frequencies associated with vibration . interim frequencies , in the 1 hz to 20 hz region have largely been ignored since they are not prevalent in either the ship or aircraft environments . on the other hand , other platforms such as military vehicles , commercial vehicles and perhaps certain types of amusement rides , generate appreciable motion energy across a much broader range of frequencies . the challenge of implementing motion - coupled visual environments in a complex motion environment involves primarily selecting the correct motions to display from the panoply of motions experienced . typically , this involves filtering or otherwise modifying higher frequencies so that the filtering process itself does not introduce conflicting visual motion . there is also the problem of displaying a workstation window , simulation or other type of visual display in a manner that leads to decreased visual - vestibular conflict . additional exemplary illustrative implementations for accomplishing this include the following : horizon - centric : the exemplary illustrative non - limiting implementations above move the display window in a manner that can be reasonably associated with a view of the horizon from the inertial environment . for example , if the vehicle pitches up , the display is moved down as if the user were focused on a point on the horizon . driver - centric : ( see fig1 ) the driver of a vehicle only rarely suffers motion sickness to the same degree as equally susceptible passengers , one possible reason for this is that the driver can anticipate motions and adjust body posture and head motion accordingly . we can place a sensor on the steering wheel and possibly even foot pedals or driver ankle to record driver motions as soon as possible . the subject display will then be adjusted to cause head and body motions similar to the driver . passenger - centric : ( see fig1 ) it is well known that head motions within an inertial environment can lead to motion sickness . another approach is to stabilize the subject &# 39 ; s head relative to a stable inertial frame to the degree possible . for this approach , a sensor can be attached to the subject &# 39 ; s head or some other body reference point , and the illustrative exemplary non - limiting implementation would cause the screen window itself to move so as to stabilize the head or body motion . simulation surround : ( see fig1 ) one of the challenges is to transfer 6 directions of freedom motion to a 2d display . a 2d visual display may not give the subject an ideal visual reference frame from which to decrease the visual - vestibular conflict . the simulation surround approach places a working window or desktop at the center of the display with an ample border of display screen around it . this border is filled with a simple motion simulation such as an aircraft flying over gridded farmland . the motion of the simulation surround is linked closely to the inertial environment so that the user always has an inertially correct visual flowfield presented in the periphery of the display . illustrative exemplary non - limiting implementations use a virtual environment such as shown in fig1 and change the viewer &# 39 ; s perspective within the environment as a means to rectify visual and vestibular senses . horizon - centric : for a desktop display of a computer screen or a tactical display , there is no visual perspective to change . instead , we will cause the viewer &# 39 ; s eye motion to move as if it were looking at an environment . this should be similarly effective in reducing or controlling the onset of motion sickness effects as use of a simulation environment . the primary challenge involved in this task is creating a window of the desktop as shown in fig1 that moves smoothly and with the desired speeds . it is also important that the mouse cursor move in conjunction with the window . the use of touch screen inputs promises to be an interesting problem . here , there are two schools of thought . in one instance , the on - screen buttons may be required to be stationary so that the user does not have to “ chase ” the buttons around the screen . on the other hand , if the user is mentally oriented to the motions outside the cockpit , he may be adjusting naturally and expecting the buttons to move . in fact , moving the buttons may itself be a way to connect cognitively the user to the actual motion of the platform . other important issues include the offset from the edge of the physical display to the reduced window . this offset is required so that the window may move within the display , but it is unclear as to how much the display needs to move to attain the desired effect . obviously , the greater the reduction in window size , the more difficult it is to incorporate all elements of a tactical display . driver - centric : ( see fig1 ) assuming that both the steering column and driver motions will be recorded , a non - limiting illustrative approach would be to use a wireless version of the sensor . fig1 shows an exemplary illustrative non - limiting implementation of a system that includes an 8 mb embedded data logger of accelerometer and gyroscope data . this system can be made wireless by use of an appropriate communications system such as the ant network radio or zigbee - compliant low - power network communications system . use of a wireless system is beneficial for ease of placement and use for sensors that must be placed on the body . passenger - centric : ( see fig1 ) stabilizing the display window relative to the driver can be accomplished using a sensing device almost identical to the one used in the horizon - centric approach . the primary difference is that display software would use the sensed inertial data to move the window so as to best stabilize the head and body motions of the user . simulation surround : ( see fig1 ) the simulation for this approach may consume relatively few computer cycles and still present a scene that is sufficiently evocative to elicit the desired effect . the sensor to be used again may resemble that for the horizon - centric approach . sensor data will be transmitted to simulation software that control the simulated scene in the window surround . the invention is not to be limited to the disclosed exemplary illustrative non - limiting implementations , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the scope of the claims .

a motion - coupled visual environment prevents , reduces and / or treats motion sickness by sensing inertial motion and providing a corresponding evocative image for a subject to view , inertial sensors may include accelerometers , gyroscopes or a variety of other different sensor types . a cross - coupling algorithm may be used to cross couple different sensed inertial motions . a variety of mapping schemes may be used to map sensed inertial motion to corresponding motion within the evocative scene displayed on the display . driver - centric , passenger - centric and simulation surround systems are possible . applications include reducing motion sickness on passenger vehicles such as airplanes , trains and cars ; on military vehicles such as ships , airplanes , helicopters and the like ; and reducing “ cybersickness ” in the context of simulations on moving platforms .

according to one aspect of the present , there is provided a novel process for the preparation of 4 -[[ 6 - chloro - 2 -[( 4 - cyanophenyl ) amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethylbenzonitrile of formula i : in the presence of a base to obtain a compound of formula i . preferably the base used in the process may be organic base or inorganic base and more preferable base is inorganic base selected from alkali metal hydroxides , alkali metal carbonates or alkali metal bicarbonates . still more preferable base is potassium carbonate . the reaction may preferably be carried out in a solvent selected from n - methylpyrrolidone , dimethylformamide , dimethylacetamide and dioxane , and more preferable solvent is n - methylpyrrolidone . according to another aspect of the present invention , there is provided a process for the preparation of etravirine crystalline form i , which comprises : a ) providing a solution of etravirine in an organic solvent ; b ) adding a solvent selected from water and hydrocarbon solvent to the solution obtained in step ( a ); and c ) isolating etravirine crystalline from i . etravirine used in step ( a ) may preferably be etravirine obtained by the known process or etravirine crystalline form ii of the invention or etravirine crystalline form iii of the invention . the organic solvent used in step ( a ) may preferably be a solvent or mixture of solvents selected from the group consisting of an alcoholic solvents such as methanol , ethanol and isopropyl alcohol ; an ester solvents such as ethyl acetate , methyl acetate , isopropyl acetate , tert - butyl methyl acetate and ethyl formate ; acetonitrile ; dimethylformamide ; dimethylsulfoxide ; an chlorinated solvents such as methylene chloride , chloroform , carbontetrachloride and ethylene dichloride ; an ether solvents such as tetrahydrofuran , 1 , 4 - dioxane , tert - butyl methyl ether and diethyl ether ; n - methylpyrrolidone and dimethylacetamide . more preferable solvent is an ether solvent , n - methylpyrrolidone and dimethylacetamide , and still more preferable solvent is tetrahydrofuran , 1 , 4 - dioxane , n - methylpyrrolidone and dimethylacetamide . the hydrocarbon solvent used in step ( b ) may preferably be a solvent or mixture of solvents selected from cyclohexane , hexane , n - heptane , benzene , toluene and xylene , and more preferable hydrocarbon solvent is n - heptane . the reaction in step ( b ) may optionally be carried out in the presence of etravirine crystalline form i crystals . isolation of etravirine crystalline form i in step ( c ) may preferably be performed by conventional techniques such as centrifugation and filtration . according to another aspect of the present invention , there is provided a crystalline form of etravirine designated as form ii characterized by peaks in the powder x - ray diffraction spectrum having 2θ angle positions at about 11 . 1 , 12 . 2 , 13 . 1 , 13 . 8 , 18 . 1 , 18 . 4 , 19 . 8 , 21 . 3 , 22 . 7 , 22 . 9 , 24 . 5 and 27 . 2 ± 0 . 2 degrees . the powdered x - ray diffractogram ( pxrd ) of etravirine crystalline form ii is shown in fig2 . according to another aspect of the present invention , there is provided a process for the preparation of etravirine crystalline form ii , which comprises : a ) providing a solution of etravirine in a mixture of alcoholic solvent and chlorinated solvent in a ratio of 0 . 7 : 1 to 1 . 2 : 1 ; b ) removing the solvent completely from the solution obtained in step ( a ); and c ) drying the solid obtained in step ( b ) to obtain etravirine crystalline from ii . etravirine used in step ( a ) may preferably be etravirine obtained by the known process or etravirine crystalline form i or etravirine crystalline form iii of the invention . the alcoholic solvent used in step ( a ) may preferably be a solvent or mixture of solvents selected from methanol , ethanol and isopropyl alcohol , and more preferable alcoholic solvent is methanol . the chlorinated solvent used in step ( a ) may preferably be a solvent or mixture of solvents selected from methylene chloride , chloroform , carbontetrachloride and ethylene dichloride , and more preferable chlorinated solvent is methylene dichloride . removal of the solvent in step ( b ) may be carried out at atmospheric pressure or at reduced pressure . removal of the solvent may preferably be carried out until the solvent is almost completely distilled off . the reaction in step ( b ) may optionally be carried out in the presence of etravirine crystalline form ii crystals . drying of the solid in step ( c ) may be carried out at 45 to 55 ° c . under high vacuum . according to another aspect of the present invention , there is provided a crystalline form of etravirine designated as form iii characterized by peaks in the powder x - ray diffraction spectrum having 2θ angle positions at about 6 . 0 , 8 . 7 , 9 . 1 , 11 . 2 , 12 . 1 , 13 . 7 , 18 . 1 , 19 . 8 , 22 . 9 , 24 . 4 , 25 . 3 and 27 . 3 ± 0 . 2 degrees . the powdered x - ray diffractogram ( pxrd ) of etravirine crystalline form iii is shown in fig3 . according to another aspect of the present invention , there is provided a process for the preparation of etravirine crystalline form iii , which comprises : a ) stirring a solution of etravirine in a mixture of alcoholic solvent and chlorinated solvent in a ratio of 1 . 3 : 1 to 2 : 1 ; b ) removing the solvent partially or completely from the solution obtained in step ( a ); c ) adding ether solvent to the reaction mass obtained in step ( b ); and d ) isolating etravirine crystalline from iii . etravirine used in step ( a ) may preferably be etravirine obtained by the known process or etravirine crystalline form i or etravirine crystalline form ii of the invention . the alcoholic solvent used in step ( a ) may preferably be a solvent or mixture of solvents selected from methanol , ethanol and isopropyl alcohol , and more preferable alcoholic solvent is methanol . the chlorinated solvent used in step ( a ) may preferably be a solvent or mixture of solvents selected from methylene chloride , chloroform , carbontetrachloride and ethylene dichloride , and more preferable chlorinated solvent is methylene dichloride . removal of the solvent may be carried out in step ( b ) at atmospheric pressure or at reduced pressure . removal of the solvent may preferably be carried out until the solvent is almost completely distilled off . the ether solvent used in step ( c ) may preferably be a solvent or mixture of solvents selected from tetrahydrofuran , 1 , 4 - dioxane , tert - butyl methyl ether and diethyl ether , and more preferably ether solvent is tert - butyl methyl ether . the reaction in step ( c ) may optionally be carried out in the presence of etravirine crystalline form iii crystals . isolation of etravirine crystalline form iii in step ( d ) may preferably be performed by conventional techniques such as centrifugation and filtration . according to another aspect of the present invention , there is provided a pharmaceutical composition comprising novel crystalline forms of etravirine selected from crystalline form ii and crystalline form iii or a mixture thereof ; and a pharmaceutically acceptable excipient . the pharmaceutically acceptable inert carrier which can be used may be a solid to or liquid . the solid pharmaceutical preparation is in the form of tablets , capsules , powders and pills . the liquid pharmaceutical preparation includes solutions , suspensions , syrups , elixirs and emulsions . the invention will now be further described by the following examples , which are illustrative rather than limiting . a solution of p - aminobenzonitrile ( 100 gm ), ethanol ( 500 ml ), concentrated nitric acid ( 36 ml ) and aqueous cyanamide ( 50 %, 54 ml ) was heated at reflux . the solution was maintained for 16 hours at reflux . the reaction mass was further cooled to 0 ° c . and then added methyl tert - butyl ether ( 500 ml ) at 0 to 5 ° c . the reaction mass was maintained for 5 hours at 0 to 5 ° c . and separated solid obtained was collected by filtration to obtain 59 gm of guanidine nitrate . guanidine nitrate ( 59 gm ) was dissolved in water ( 590 ml ) and then added sodium hydroxide solution ( 1m , 325 ml ). the separated solid obtained was filtered and dried to obtain 33 gm of 1 -( 4 - cyanophenyl ) guanidine . diethyl malonate ( 30 gm ) was added to 1 -( 4 - cyanophenyl ) guanidine ( 30 gm ) at room temperature . a solution of sodium ( 17 . 2 gm ) in ethanol ( 450 ml ) was added to the above reaction mass . the contents were heated to reflux and maintained for 12 hours . distilled off the solvent completely under vacuum and then added water ( 500 ml ). the reaction mass was stirred for 30 minutes and filtered . the solid obtained was dried to obtain 40 gm of 4 -( 4 , 6 - dihydroxypyrimidine - 2 - yl - amino ) benzonitrile . phosphoryl chloride ( 159 ml ), n , n - dimethyl aniline ( 118 ml ) and 4 -( 4 , 6 - dihydroxypyrimidine - 2 - yl - amino ) benzonitrile ( 40 gm ) are added and heated to reflux . the reaction mass was maintained for 6 hours at reflux and then poured into ice water ( 1000 ml ). the reaction mass stirred for 2 hours at room temperature and filtered . the solid obtained was dried to obtain 35 gm of 4 -( 4 , 6 - dichloropyrimidine - 2 - yl - amino ) benzonitrile . 4 -( 4 , 6 - dichloropyrimidine - 2 - yl - amino ) benzonitrile ( 35 gm ) as obtained in preparative example 3 was added to 4 - hydroxy - 3 , 5 - dimethylbenzonitrile ( 22 gm ) and then added a mixture of n - methylpyrrolidone and potassium carbonate ( 22 gm ) at 45 ° c . the reaction mass was stirred for 12 hours at 45 ° c . and then added water ( 1000 ml ). the reaction mass was cooled to 25 ° c . and stirred for 2 hours at 25 ° c ., filtered . the wet solid obtained was dissolved in acetone ( 140 ml ) under stirring and the separated solid was filtered , and then dried at 50 ° c . to obtain 24 gm of 4 -[[ 6 - chloro - 2 -[( 4 - cyanophenyl ) amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethylbenzonitrile . 4 -[[ 6 - chloro - 2 -[( 4 - cyanophenyl ) amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethyl - benzonitrile ( 24 gm ) was dissolved in aqueous ammonia ( 240 ml ) and 1 , 4 - dioxane ( 274 ml ) at room temperature . the contents were heated to 120 ° c . and maintained for 12 hours at 120 ° c . to the reaction mass was added water ( 360 ml ) and the reaction mass was slowly cooled to 50 to 60 ° c . the reaction mass was further cooled to 0 to 5 ° c . and stirred for 1 hour at 0 to 5 ° c ., filtered . the wet solid obtained was dissolved in toluene ( 150 ml ) under stirring . the separated solid was filtered and dried at 50 ° c . to obtain 10 gm of 4 -[[ 6 - amino - 2 -[( 4 - cyanophenyl ) amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethylbenzonitrile . 4 -[[ 6 - amino - 2 -[( 4 - cyanophenyl ) amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethyl - benzonitrile ( 10 gm ) was dissolved in dichloromethane ( 100 ml ) at 0 to 5 ° c . and then added bromine solution ( 4 . 7 gm in 50 ml of dichloromethane ). the reaction mass was stirred for 4 hours at 0 to 5 ° c . and then added water ( 100 ml ). the ph of the reaction mass was adjusted to 9 to 10 with sodium hydroxide solution ( 4n , 10 ml ). sodium metabisulphite solution ( 0 . 5 gm in 2 ml of water ) was added to the reaction mass and ph of the reaction mass was maintained between 7 . 5 to 8 . 5 with sodium hydroxide solution ( 4n , 10 ml ). the separated solid was filtered and dried at 50 to 55 ° c . to obtain crude etravirine . crude etravirine obtained above was dissolved in acetone ( 200 ml ) at 50 to 55 ° c . and then treated with activated charcoal ( 1 . 5 gm ). the reaction mass was filtered through celite and the filtrate was distilled off acetone completely to obtain residue . the residue was cooled to 5 to 10 ° c . and filtered . the solid obtained was dried at 60 ° c . to obtain 5 . 2 gm of pure etravirine . etravirine ( 500 mg ) as obtained example 3 was dissolved in tetrahydrofuran ( 5 ml ) under stirring at room temperature . the insolubles were filtered . to the filtrate was added n - heptane ( 15 ml ) and stirred for 1 hour at room temperature . the separated solid was filtered and dried under vacuum for 1 hour to obtain 460 mg of etravirine crystalline form i . etravirine ( 2 gm ) was dissolved in 1 , 4 - dioxane ( 25 ml ) under stirring at room temperature . the insolubles were filtered . to the filtrate was added n - heptane ( 60 ml ) and stirred for 1 hour at room temperature . the separated solid was filtered and dried under vacuum for 1 hour to obtain 1 . 8 gm of etravirine crystalline form i . etravirine ( 500 mg ) was dissolved in n - methylpyrrolidone ( 5 ml ) at room temperature . to the reaction mass was added water ( 10 ml ) and stirred for 2 hour at room temperature , filtered . the solid obtained was dried under vacuum for 1 hour to obtain 450 mg of etravirine crystalline form i . etravirine ( 1 gm ) was dissolved in dimethylacetamide ( 10 ml ) at room temperature . to the reaction mass was added water ( 18 ml ) and stirred for 2 hour at room temperature , filtered . the solid obtained was dried under vacuum for 1 hour to obtain 0 . 85 gm of etravirine crystalline form i . example 4 was repeated using methyl tert - butyl ether solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . example 4 was repeated using methylene dichloride solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . example 4 was repeated using ethyl acetate solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . example 4 was repeated using methanol solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . example 4 was repeated using dimethylformamide solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . example 4 was repeated using dimethylsulfoxide solvent instead of tetrahydrofuran solvent to obtain etravirine crystalline form i . etravirine crystalline form ii ( 2 gm ) was dissolved in tetrahydrofuran ( 18 ml ) under stirring at room temperature . the insolubles were filtered . to the filtrate was added n - heptane ( 55 ml ) and stirred for 1 hour at room temperature . the separated solid was filtered and dried under vacuum for 1 hour to obtain 1 . 8 gm of etravirine crystalline form i . example 14 was repeated using etravirine crystalline form iii instead of etravirine crystalline form ii to obtain etravirine crystalline form i . etravirine ( 500 mg ) was dissolved in a mixture of methanol ( 30 ml ) and methylene dichloride ( 30 ml ) at room temperature . the insolubles were filtered . the filtrate was stirred for 15 minutes and distilled off the solvent completely under vacuum . the solid obtained was dried under high vacuum for 15 minutes to obtain 460 mg of etravirine crystalline form ii . etravirine ( 2 gm ) was dissolved in a mixture of methanol ( 110 ml ) and methylene dichloride ( 120 ml ) at room temperature . the insolubles were filtered . the filtrate was stirred for 15 minutes and distilled off the solvent completely under vacuum . the solid obtained was dried under high vacuum for 15 minutes to obtain 1 . 8 gm of etravirine crystalline form ii . example 16 was repeated using ethanol solvent instead of methanol solvent to obtain etravirine crystalline form ii . example 16 was repeated using etravirine crystalline form i instead of etravirine to obtain etravirine crystalline form ii . example 16 was repeated using etravirine crystalline form iii instead of etravirine to obtain etravirine crystalline form ii . etravirine ( 500 mg ) was dissolved in a mixture of methanol ( 36 ml ) and methylene dichloride ( 24 ml ) at room temperature . the reaction mass was stirred for 12 hours at room temperature and the insolubles were filtered . the filtrate was distilled off the solvent completely under vacuum to obtain a residue . to the residue was added tert - butyl methyl ether ( 20 ml ) and stirred for 15 minutes at room temperature . the separated solid was filtered and dried under vacuum for 10 minutes to obtain 455 mg of etravirine crystalline form iii . etravirine ( 1 mg ) was dissolved in a mixture of methanol ( 80 ml ) and methylene dichloride ( 48 ml ) at room temperature . the reaction mass was stirred for 12 hours at room temperature and the insolubles were filtered . the filtrate was distilled off the solvent completely under vacuum to obtain a residue . to the residue was added tert - butyl methyl ether ( 20 ml ) and stirred for 15 minutes at room temperature . the separated solid was filtered and dried under vacuum for 10 minutes to obtain 0 . 82 gm of etravirine crystalline form iii . example 21 was repeated using ethanol solvent instead of methanol solvent to obtain etravirine crystalline form iii . example 21 was repeated using etravirine crystalline form i instead of etravirine to obtain etravirine crystalline form iii . example 21 was repeated using etravirine crystalline form ii instead of etravirine to obtain etravirine crystalline form iii .

4 - amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethyl - benzonitrile is a key intermediate for the preparation of etravirine . the present invention provides a process for preparation of 4 - amino ]- 4 - pyrimidinyl ] oxy ]- 3 , 5 - dimethylbenzonitrile . the present invention also provides a novel process for the preparation of etravirine crystalline form i . the present invention further provides novel crystalline forms of etravirine , processes for their preparation and pharmaceutical compositions comprising them .

any feature or combination of features described herein are included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context , this description , and the knowledge of one skilled in the art . in addition , any feature or combination of features may be specifically excluded from any embodiment of the present invention . for purposes of summarizing the present invention , certain aspects , advantages and novel features of the present invention are described herein . of course , it is to be understood that not necessarily all such aspects , advantages or features will be embodied in any particular embodiment of the present invention . it should be noted that the drawings are in simplified form and are not to precise scale . in reference to the disclosure herein , for purposes of convenience and clarity only , directional terms , such as , top , bottom , left , right , up , down , over , above , below , beneath , rear , and front , are used with respect to the accompanying drawings . such directional terms should not be construed to limit the scope of the invention in any manner . although the disclosure herein refers to certain illustrated embodiments , it is to be understood that these embodiments are presented by way of example and not by way of limitation . the intent of the following detailed description , although discussing exemplary embodiments , is to be construed to cover all modifications , alternatives , and equivalents of the embodiments as may fall within the spirit and scope of the invention . referring more particularly to the drawings , a biodegradable surgical prosthesis 10 is shown in fig1 comprising a tissue - ingrowth biodegradable region 12 and an opposing adhesion - resistant biodegradable region 14 . the biodegradable surgical prosthesis 10 is constructed for use in the repair of soft tissue defects , such as soft tissue defects resulting from incisional and other hernias and soft tissue defects resulting from extirpative tumor surgery . the biodegradable surgical prosthesis 10 may also be used in cancer surgeries , such as surgeries involving sarcoma of the extremities where saving a limb is a goal . other applications of the biodegradable surgical prosthesis 10 of the present invention may include laparoscopic or standard hernia repair in the groin area , umbilical hernia repair , paracolostomy hernia repair , femora hernia repair , lumbar hernia repair , and the repair of other abdominal wall defects , thoracic wall defects and diaphragmatic hernias and defects . each of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 can comprise , for example , a biodegradable , and more preferably bioresorbable , polyhydroxyacid material . according to certain strict definitions , biodegradable polymers , which may be used with the invention , require enzymes of microorganisms for hydrolytic or oxidative degradation , whereas bioresorbable polymers , which are presently preferred , degrade in the physiological environment with the by - products being eliminated or completely bioabsorbed . generally , a polymer that loses its weight over time in the living body can be referred to as an absorbable , resorbable , bioabsorbable , or even biodegradable polymer . this terminology applies regardless of its degradation mode , in other words for both enzymatic and non - enzymatic hydrolysis . biodegradable polymers , including resorbable polymers , can be classified on the basis of their origin as either naturally occurring or synthetic . among synthetic resorbable polymers for implants , polyhydroxyacids occupy the main position . non limiting examples of these each of which may individually or in combination be used to form all or part of the biodegradable prosthesis include poly ( l - lactide ), poly ( glycolide ) and polymers or copolymers based on l - lactide , l / dl - lactide , dl - lactide , glycolide , trimethyl carbonate , ε - caprolactone , dioxanone , and physical and chemical combinations thereof . biodegradable polymer devices are eliminated from the body by hydrolytic degradation and subsequent metabolism after serving their intended purpose . in modified embodiments , part or all , in any combination , of the tissue - ingrowth region 12 can comprise or consist of a non - biodegradable polymer , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof . according to an aspect of the present invention , the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may differ in both ( a ) surface appearance and ( b ) surface function . for example , the tissue - ingrowth biodegradable region 12 can be constructed with at least one of a surface topography ( appearance ) and a surface composition ( function ), either of which may facilitate strength , longevity and / or a substantial fibroblastic reaction in the host tissue relative to for example the anti - adhesion biodegradable region 14 . on the other hand , the adhesion - resistant biodegradable region 14 can be constructed with at least one of a surface topography and a surface composition , either of which may facilitate , relative to the tissue - ingrowth biodegradable region 12 , an anti - adhesive effect between the biodegradable surgical implant 10 and host tissues . the tissue - ingrowth biodegradable region 12 can be formed to have an open , non - smooth and / or featured surface comprising , for example , alveoli and / or pores distributed regularly or irregularly . in further embodiments , the tissue - ingrowth biodegradable region 12 can be formed to have , additionally or alternatively , an uneven ( e . g ., cracked , broken , roughened or flaked ) surface which , as with the above - described surfaces , may cause tissue turbulence ( e . g ., potential tissue inflammation and / or scarring ) between host tissues and the tissue - ingrowth biodegradable region 12 . over time , with respect to the tissue - ingrowth biodegradable region 12 , the patient &# 39 ; s fibrous and collagenous tissue may substantially completely overgrow the tissue - ingrowth biodegradable region 12 , growing over and affixing the tissue - ingrowth biodegradable region 12 to the tissue . in one implementation , the tissue - ingrowth biodegradable region 12 comprises a plurality of alveoli or apertures visible to the naked eye , through or over which the host tissue can grow and achieve substantial fixation . as an example , pores may be formed into the tissue - ingrowth biodegradable region by punching or otherwise machining , or by using laser energy . non - smooth surfaces may be formed , for example , by abrading the tissue - ingrowth biodegradable region 12 with a relatively course surface ( e . g ., having a 40 or , preferably , higher grit sandpaper - like surface ) or , alternatively , non - smooth surfaces may be generated by bringing the tissue - ingrowth biodegradable region 12 up to its softening or melting temperature and imprinting it with a template ( to use the same example , a sandpaper - like surface ). the imprinting may occur , for example , during an initial formation process or at a subsequent time . on the other hand , the adhesion - resistant biodegradable region 14 can be formed to have a closed , continuous , smooth and / or non - porous surface . in an illustrative embodiment , at least a portion of the adhesion - resistant biodegradable region 14 is smooth comprising no protuberances , alveoli or vessel - permeable pores , so as to attenuate occurrences of adhesions between the tissue - ingrowth biodegradable region 12 and host tissues . in a molding embodiment , one side of the press may be formed to generate any of the tissue - ingrowth biodegradable region surfaces discussed above and the other side of the press may be formed to generate an adhesion - resistant biodegradable region surface as discussed above . additional features ( e . g ., roughening or forming apertures ) may subsequently be added to further define the surface of , for example , the tissue - ingrowth biodegradable region . in an extrusion embodiment , one side of the output orifice may be formed ( e . g . ribbed ) to generate a tissue - ingrowth biodegradable region ( wherein subsequent processing can further define the surface such as by adding transverse ribs / features and / or alveoli ) and the other side of the orifice may be formed to generate an adhesion - resistant biodegradation region surface . in one embodiment , the adhesion - resistant biodegradable region is extruded to have a smooth surface and in another embodiment the adhesion - resistant biodegradable region is further processed ( e . g ., smoothed ) after being extruded . as presently embodied , the tissue - ingrowth biodegradable region 12 comprises a first material , and the adhesion - resistant biodegradable region 14 comprises a second material which is different from the first material . in modified embodiments , the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may comprise the same or substantially the same materials . in other embodiments , the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may comprise different materials resulting from , for example , an additive having been introduced to at least one of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 . the adhesion - resistant biodegradable region 14 can be formed to have any of the structures or dimensions disclosed in u . s . pat . no . 6 , 673 , 362 , entitled biodegradable barrier micro - membranes for attenuation of scar tissue during healing , the entire contents of which are incorporated herein by reference , and / or may be formed with or in combination with any of the materials described herein , preferably to facilitate tissue separation with attenuated ( e . g ., eliminated ) adhesion . according to an implementation of the present invention , the adhesion - resistant biodegradable region 14 is constructed to minimize an occurrence of adhesions of host tissues ( e . g ., internal body viscera ) to the biodegradable surgical prosthesis 10 . in being formed to be absorbable , the adhesion - resistant biodegradable region 14 should be sufficiently non - inflammatory while being absorbed so as not to cause adhesions itself . for example , it is believed that resorption into the body too quickly of the adhesion - resistant biodegradable region 14 may yield undesirable drops in local ph levels , thus possibly introducing / elevating , for example , local inflammation , discomfort and / or foreign antibody responses . as distinguished from the function ( s ) of the tissue - ingrowth biodegradable region 12 , an object of the adhesion - resistant biodegradable region 14 can be to attenuate tissue turbulence and any accompanying inflammation ( e . g ., swelling ). in modified embodiments , the adhesion - resistant biodegradable region 14 and the tissue - ingrowth biodegradable region 12 of the biodegradable surgical prosthesis 10 may be formed of the same material or relatively less divergent materials , functionally speaking , and the adhesion - resistant biodegradable region 14 may be used in conjunction with an anti - inflammatory gel agent applied , for example , onto the adhesion - resistant biodegradable region 14 at a time of implantation of the biodegradable surgical prosthesis 10 . according to other broad embodiments , the adhesion - resistant biodegradable region 14 and the tissue - ingrowth biodegradable region 12 may be formed of any materials or combinations of materials disclosed herein ( including embodiments wherein the two regions share the same layer of material ) or their substantial equivalents , and the adhesion - resistant biodegradable region 14 may be used in conjunction with an anti - inflammatory gel agent applied , for example , onto the adhesion - resistant biodegradable region 14 at a time of implantation of the biodegradable surgical prosthesis 10 . the tissue - ingrowth biodegradable region 12 can be formed of similar and / or different materials to those set forth above , to facilitate strength , longevity and / or direct post - surgical cell colonization via , for example , invoking a substantial fibroblastic reaction in the host tissue . in an illustrated embodiment , the tissue - ingrowth biodegradable region 12 is constructed to be substantially incorporated into the host tissue and / or to substantially increases the structural integrity of the biodegradable surgical prosthesis 10 . following implantation of the biodegradable surgical prosthesis 10 , body tissues ( e . g ., subcutaneous tissue and / or the exterior fascia ) commence to incorporate themselves into the tissue - ingrowth biodegradable region 12 . while not wishing to be limited , it is believed that the body , upon sensing the presence of the tissue - ingrowth biodegradable region 12 of the present invention , is disposed to send out fibrous tissue which grows in , around and / or through and at least partially entwines itself with the tissue - ingrowth biodegradable region 12 . in this manner , the biodegradable surgical prosthesis 10 can become securely attached to the host body tissue . regarding different materials , according to an aspect of the present invention , the tissue - ingrowth biodegradable region 12 can comprises a biodegradable ( e . g ., resorbalbe ) polymer composition having one or more different characteristics than that or those of a biodegradable ( e . g ., resorbalbe ) polymer composition of the adhesion - resistant biodegradable region 14 . the different characteristics may include ( 1a ) time or rate of biodegradation affected by additives , ( 1b ) time or rate of biodegradation affected by polymer structures / compositions , ( 2 ) polymer composition affecting strength or structural integrity , and ( 3 ) ability to facilitate fibroblastic reaction . the time or rate of biodegradation for the adhesion - resistant biodegradable region 14 may be substantially greater than the rate of biodegradation of the tissue - ingrowth biodegradable region 12 . this rate differential may be effectuated through , for example , use of ( a ) additives and / or ( b ) polymer structures / compositions . in accordance with one implementation , the characteristic is a time or rate of biodegradation influenced by the incorporation of an additive to at least one of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 . in accordance with one implementation of the present invention , a rate of biodegradation of the adhesion - resistant biodegradable region 14 is substantially greater than a rate of biodegradation of the tissue - ingrowth biodegradable region 12 . to adjust the biodegradation rate , an accelerator or retardant can be provided in one or more of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 . the additive may comprise , in typical embodiments , one or more of ( i ) retardants for retarding a rate of biodegradation of a polymer when added to the polymer and ( ii ) accelerators for accelerating a rate of biodegradation of a polymer when added to the polymer . in accordance with an implementation of the present invention , retardants can be added to ( e . g ., incorporated into ) the tissue - ingrowth biodegradable region 12 and / or accelerators can be added to ( e . g ., incorporated into ) the adhesion - resistant biodegradable region 14 . retardants of the present invention can include hydrophobic compounds ( i . e ., repelling , tending not to combine with , or incapable of dissolving in water ), to decrease the rate of biodegradation . agents which may serve as retardants in accordance with the present invention include non - water soluble polymers , e . g . high molecular weight methylcellulose and ethylcellulose , etc ., and low water soluble organic compounds . exemplary hydrophobic agents of an implementation of the invention may comprise compounds which have less than about 100 μg / ml solubility in water at ambient temperature . according to a broad aspect of the invention , a retardant may include any matter which is hydrophobic , wherein one implementation includes particles , for example powders or granules , which are at least partially made up of hydrophobic polymers . accelerators of the present invention can include hydrophilic compounds ( i . e ., having an affinity for , readily absorbing , or dissolving in water ), to increase the rate of biodegradation . the accelerators of the present invention may be physiologically inert , water soluble polymers , e . g . low molecular weight methyl cellulose or hydroxypropyl methyl cellulose ; sugars , e . g . monosaccharides such as fructose and glucose , disaccharides such as lactose , sucrose , or polysaccharides such as cellulose , amylose , dextran , etc . exemplary hydrophilic compounds of the invention may comprise components which have at least about 100 μg / ml solubility in water at ambient temperature . according to a broad aspect of one implementation of the present invention , an accelerator may include any matter which is hydrophilic , wherein an implementation includes particles , for example powders or granules , which comprise hydrophilic polymers . in an exemplary embodiment , the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 both comprise resorbable compositions , and a resorption retarding agent ( retardant ) is provided in the tissue - ingrowth biodegradable region 12 so that the tissue - ingrowth biodegradable region 12 biodegrades at a relatively slow rate . in a modified embodiment , the retardant may also be provided in the adhesion - resistant biodegradable region 14 at , for example , the same or a lower concentration . according to one implementation , the tissue - ingrowth biodegradable region 12 biodegrades at a relatively slow rate to provide ample time for host tissues to form over and into the space occupied by the tissue - ingrowth biodegradable region 12 . for example , in accordance with one aspect the biodegradable surgical prosthesis 10 is biodegraded ( e . g ., resorbed ) into a mammalian body within a period of about 24 months or longer from an initial implantation of the implant into the mammalian body . in one embodiment , the biodegradable surgical prosthesis 10 loses its mechanical strength within 18 months and , preferably , within 24 months and , more preferably , with a period of or greater than 36 or 48 months from the time of implantation . in accordance with another implementation , the characteristic is a polymer composition of at least one of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 . a rate of biodegradation of the tissue - ingrowth biodegradable region 12 can be relatively low and / or can be less than a rate of biodegradation of the adhesion - resistant biodegradable region 14 . to obtain such a biodegradation rate , the tissue - ingrowth biodegradable region 12 can be formed , for example , with synthesized polymers that have hydrolytically stable linkages in the backbone relative to those of faster biodegrading polymers and / or to those of the adhesion - resistant biodegradable region 14 . common chemical functional groups suitable for formation of the tissue - ingrowth biodegradable region 12 , in addition to those already described herein , can include esters , anhydrides , orthoesters , and amides . depending on the chemical structure of the polymer backbone , degradation can occur by either surface or bulk erosion . surface erosion can occur when the rate of erosion exceeds the rate of water penetration into the bulk of the polymer of either the tissue - ingrowth biodegradable region 12 or the adhesion - resistant biodegradable region 14 . this type of degradation can be obtained , for example , in oly ( anhydrides ) and poly ( ortho esters ). the hydrolysis of bulk degrading bioresorbable polymers as described herein may typically proceed by loss of molecular weight at first , followed by loss of mass in a second stage . generally , hydrolysis ( including enzyme - mediated hydrolysis ) is a preferred degradation mechanism for heterochain polymers in vivo . as an example , the degradation of poly ( ε - caprolactone ) and related polyesters such as poly ( lactide ) and its copolymers first involves non - enzymatic hydrolysis of ester linkages , autocatalyzed by the generation of carboxylic acid end groups , followed by the loss of mass . in accordance with an aspect of the present invention , lengthening of the in vivo elimination time of bioresorbable polymers can be determined by one or more of the nature of the polymer chemical linkage , the solubility of the degradation products , the size ( e . g ., thickness ), shape and density of the region or prosthesis , the drug or additive content , the molecular weight of the polymer , the extent of cross - linking of the polymer , and the implantation site . as an example , the size and form of the region or prosthesis can be used to control at least one of biodegradation time and rate . for instance , a smaller surface to mass ratio can be implemented to retard the rate of biodegradation of the tissue - ingrowth biodegradable region 12 . a relatively thick construction of the tissue - ingrowth biodegradable region 12 is believed to decelerate the absorption time or rate thereof , compared to times or rates of absorption of thinner prostheses of the same material . the tissue - ingrowth biodegradable region 12 of the present invention can have a uniform thickness greater than about 500 microns , or greater than about 1000 microns , and even greater than about 1500 or 3000 microns . a tissue - ingrowth biodegradable region 12 of a biodegradable surgical prosthesis 10 can be shaped at the time of surgery by bringing the material to its glass transition temperature , using heating iron , hot air , heated sponge or hot water bath methods . in certain embodiments , poly lactides which become somewhat rigid or brittle at greater thicknesses can be softened by formation with another polymer or copolymer , such as poly - ε - caprolactone . in modified embodiments , the poly lactides ( or other materials forming part , most or substantially all of the tissue - ingrowth region 12 ) may alternatively or additionally be combined with one or more non - biodegradable polymers , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof . more generally , in examples wherein tissue - ingrowth biodegradable regions 12 are formed by polymers ( e . g ., homo and / or copolymers ) derived from one or more cyclic esters , such as lactide ( i . e ., l , d , dl , or combinations thereof ), ε - caprolactone , and glycolide , compositions can comprise about 1 to 99 % ε - caprolactone , or 20 to 40 % ε - caprolactone , with the remainder of the polymer comprising a lactide such as poly ( l - lactide ). in modified embodiments wherein tissue - ingrowth regions 12 are formed by polymers ( e . g ., homo and / or copolymers ) derived from one or more cyclic esters and / or other materials , part or all of the tissue - ingrowth regions 12 can comprise or consist of one or more non - biodegradable polymers , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof . in further embodiments , other softening polymers ( e . g ., having low glass transition temperatures ) such as other lactones may be used with or as a substitute for ε - caprolactone . in still further embodiments , one or more non - biodegradable polymers , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof , may be used with or as a substitute for ε - caprolactone and / or other softening polymers or lactones . a preferred form of polymer for the tissue - ingrowth biodegradable region 12 is semicrystalline poly ( l - lactide ), which can have a degradation time in the order of 3 to 5 years , as compared to poly ( dl - lactide ) which degrades in 12 to 16 months . polyhydroxyacids degrade to monomeric acids and subsequently to carbon dioxide and water . these are removed from the body via respiratory routes and the kidneys ( the krebs cycle ). included among the polyesters of interest are polymers of d - lactic acid , l - lactic acid , racemic lactic acid , glycolic acid , polycaprolactone , and copolymers / combinations thereof . in modified embodiments , part or all , in any combination , of the polymer ( e . g ., polyester ) or polymers can comprise or consist of a non - biodegradable polymer , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof . by employing the l - lactate or d - lactate , for example , a slowly biodegrading polymer can be achieved for the tissue - ingrowth biodegradable region 12 , while for the adhesion - resistant biodegradable region 14 degradation may be substantially enhanced with a racemate . copolymers of lactic and glycolic acid ( poly ( lactide - co - glycolides )) can be of particular interest , wherein the rate of biodegradation can be controlled by the ratio of glycolic to lactic acid . the degradation of lactic acid and / or glycolic acid polymers in biological medium occurs exclusively by a chemical mechanism of nonspecific hydrolysis . the products of this hydrolysis are metabolized and then eliminated by the human body . chemical hydrolysis of the polymer is complete , whereby the more pronounced its amorphous character and the lower its molecular mass , the more rapidly it occurs . accordingly , the tissue - ingrowth biodegradable region 12 may be formed , for example , using at least one polymer or copolymer having a less pronounced amorphous character and / or an increased molecular mass . although the most rapidly degraded copolymer has roughly equal amounts of glycolic and lactic acid , either homopolymer is more resistant to degradation making it more suitable for formation of the tissue - ingrowth biodegradable region 12 . biodegradation rate or time thus may be decreased , for example , in the context of forming a tissue - ingrowth biodegradable region 12 , by acting on the composition of the mixture and / or on the molecular mass of the polymer ( s ). the biocompatibility of the poly ( lactide ) and poly ( lactide - co - glycolide ) polymers makes them suitable supports for cellular growth and tissue regeneration in the context of the present invention . it should also be considered that , other things being equal , the ratio of glycolic acid to lactic acid may also affect the brittleness of the resulting biodegradable surgical prosthesis . furthermore , the characteristic may be a strength , structural integrity , or a related parameter , wherein , for example , the effects of bulging , wrinkling and / or curling of the biodegradable surgical prosthesis 10 may be attenuated . since the present invention seeks to allot a substantially greater proportion of the biodegradable surgical prosthesis &# 39 ; strength and structural integrity to the tissue - ingrowth biodegradable region 12 , the focus of adding strength or structural integrity to the biodegradable surgical prosthesis 10 is directed on the tissue - ingrowth biodegradable region 12 . properties which may be adjusted in accordance with the present invention to augment the mechanical performance of the tissue - ingrowth biodegradable region 12 are monomer selection , polymerization and process conditions , and the presence of additives ( e . g . fillers ). these properties , in turn , can be adjusted so as to influence one or more of the hydrophilicity , crystallinity , melt and glass transition temperatures , molecular weight , molecular weight distribution , end groups , sequence distribution ( random versus block ), and the presence of residual monomer or additives in the tissue - ingrowth biodegradable region 12 . furthermore , a portion or all of these properties in combination then can influence the rate of biodegradation of the tissue - ingrowth biodegradable region 12 . lactide is the cyclic dimer of lactic acid , which exists in three stereoisomeric forms , l - lactide , naturally occurring isomer , d - lactide and meso - lactide , which contains an l - lactyl unit and a d - lactyl unit in the ring . additionally , dl - lactide is an equimolar mixture of l - and d - lactides . in accordance with an implementation of the present invention , the tissue - ingrowth biodegradable region 12 comprises poly ( l - lactide ), which has been found to exhibit high tensile strength and low elongation and consequently to have a high modulus , rendering it more suitable than many amorphous polymers for load - bearing applications such as hernia mending and sutures . poly ( l - lactide ) has a melting point around 170 ° c . and glass transition temperature in the range of 55 - 60 ° c . poly ( dl - lactide ) is an amorphous polymer ( tg 45 - 55 ° c . ), having a random distribution of both isomeric forms of lactic acid and lacking the ability to arrange into a crystalline organized structure . poly ( dl - lactide ) has a lower tensile strength , slightly higher elongation and substantially more rapid degradation time , making it more attractive for use in , for example , construction of the adhesion - resistant biodegradable region 14 . poly ( ε - caprolactone ) is a ductile semicrystalline polymer , melting in the range of 54 - 64 ° c . the glass transition temperature of − 60 ° c . can be increased by copolymerisation with lactide , which also may enhance the biodegradation of the polymer . in modified embodiments , one or more non - biodegradable polymers , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof , may be combined with the poly ( ε - caprolactone ). the tissue - ingrowth biodegradable region 12 of a biodegradable surgical prosthesis 10 in accordance with an aspect of the present invention can be manufactured of biodegradable polymers by using one polymer or a polymer alloy . the biodegradable surgical prosthesis 10 can be strengthened by reinforcing the material with fibers manufactured from a resorbable polymer or of a polymer alloy , or with biodegradable glass fibers , such as β - tricalsiumphosphate fibers , bio - glass fibers or cam fibers , as described in , e . g ., publication ep146398 , the entire disclosure of which is incorporated herein by reference . in modified embodiments , the surgical prosthesis 10 can be modified ( e . g ., strengthened ) by including ( e . g ., for reinforcement ) fibers or other elements manufactured from or with , in part or entirely , non - biodegradable polymers , such as , for example , one or more of ( a ) various thermoplastic resins that are polymers of , for example , propylene , ( b ) polymethacrylate , ( c ) polymethylmethacrylate ( pmma ), or ( d ) combinations thereof . the tissue - ingrowth biodegradable region 12 according to another aspect of the present invention can further , or alternatively , comprise or consist of at least one outer layer , which is a surface layer that improves the toughness of the implant and / or operates as a hydrolysis barrier . moreover , an interior of the biodegradable surgical prosthesis 10 may additionally or alternatively comprise or consist of a stiffer and / or stronger layer or core . to prepare an example of such an embodiment , the biodegradable surgical prosthesis can be coated ( e . g ., brush , spray , bond , or dip coated ) with an outer layer having different chemical and mechanical properties ( e . g ., hydrolysis and / or strength retention ) than the core of the region or prosthesis . in one such case , an outer layer having greater resistance to hydrolysis than the biodegradable surgical prostheses &# 39 ; strength - enhanced core can be used , enabling the prosthesis ( after insertion in a patient ) to retain its strength and biodegrade over a longer period of time than it would have without such an outer coating or enhanced interior . according to another implementation of the present invention , the characteristic may comprise an ability to facilitate a substantial fibroblastic reaction in the host tissue . the tissue - ingrowth biodegradable region 12 can be constructed to facilitate a fibroblastic reaction , while the adhesion - resistant biodegradable region 14 preferably does not cause a fibroblastic reaction . the facilitation by the tissue - ingrowth biodegradable region 12 of a fibroblastic reaction can be based on one or more of the above - discussed characteristics ( e . g ., time or rate of biodegradation affected by additives , time or rate of biodegradation affected by polymer structures / compositions , and polymer composition affecting strength or structural integrity ), since the biodegradable surgical prosthesis 10 will need to maintain its structure long enough for reacting tissues to take a firm hold . in one embodiment , the tissue - ingrowth biodegradable region 12 of the present invention can comprise or consist of at least one outer layer , which is a tissue ingrowth promoter . in another embodiment , all or substantially all of the biodegradable surgical prosthesis 10 , except for the adhesion - resistant biodegradable region 14 , comprises a tissue ingrowth promoter . when applied to a roughened tissue - ingrowth biodegradable region 12 comprising , for example , at least one of protuberances , alveoli and pores , the biodegradable surgical implant 10 can provide interstitial space for the host body tissue to enter by ingrowth . tissue ingrowth promoters can render the interstitial space conducive to the ingrowth therein of body tissue by providing chemically and / or physically improved surface characteristics . in accordance with one aspect of the present invention , the tissue - ingrowth biodegradable region 12 may comprises a substance for cellular control , such as at least one of a chemotactic substance for influencing cell migration , an inhibitory substance for influencing cell - migration , a mitogenic growth factor for influencing cell proliferation , a growth factor for influencing cell differentiation , and factors which promote neoangiogenesis ( formation of new blood vessels ). in particular implementations , one or several growth promoting factors can be introduced into or onto the tissue - ingrowth biodegradable region 12 , such as fibroblast growth factor , epidermal growth factor , platelet derived growth factor , macrophage derived growth factor , alveolar derived growth factor , monocyte derived growth factor , magainin , and so forth . furthermore , one or more medico - surgically useful substances may be incorporated into or onto the tissue - ingrowth biodegradable region 12 , such as those which accelerate or beneficially modify a growth or healing process . for example , the tissue - ingrowth biodegradable region 12 can carry ( e . g ., via mixing during formation , implanting , or coating ) one or more therapeutic agents chosen for one or more of antimicrobial properties , capabilities for promoting repair or reconstruction and / or new tissue growth and / or for specific indications . antimicrobial agents such as broad spectrum antibiotics ( gentamicin sulphate , erythromycin or derivatized glycopeptides ) can be carried ( e . g ., via mixing during formation , implanting or coating ) to aid in combating clinical and sub - clinical infections in a tissue repair site thus facilitating ingrowth of host tissues onto and / or into the tissue - ingrowth biodegradable region 12 . as an example , one or more of the above additives may be incorporated into the polymer of the tissue - ingrowth biodegradable region 12 itself prior to forming the tissue - ingrowth biodegradable region 12 as part of the biodegradable surgical prosthesis 10 , for example , by addition to the polymer in suitable amounts so that at the conclusion of the polymeric particle manufacturing process , the material of the tissue - ingrowth biodegradable region 12 will contain a predetermined amount of one or more of such substances which for example will be released gradually as the polymer is biodegraded . as shown in fig2 , and in accordance with a method of the present invention , the biodegradable surgical prosthesis 10 can be used to facilitate repair of , for example , a hernia in the ventral region of a body . fig3 shows an implanted biodegradable surgical prosthesis 10 having both an adhesion - resistant biodegradable region 14 and a tissue - ingrowth biodegradable region 12 partially disposed on one side and having a tissue - ingrowth biodegradable region 12 disposed on a second side of the biodegradable surgical prosthesis 10 . the abdominal wall includes muscle 15 enclosed and held in place by an exterior fascia 16 and an interior fascia 19 . an interior layer , called the peritoneum 22 , covers the interior side of the interior fascia 19 . the peritoneum 22 is a softer , more pliable layer of tissue that forms a sack - like enclosure for the intestines and other internal viscera . a layer of skin 25 and a layer of subcutaneous fat 28 cover the exterior fascia 16 . surgical repair of a soft tissue defect ( e . g ., a hernia ) can be performed by using , for example , conventional techniques or advanced laparoscopic methods to close substantially all of a soft tissue defect . according to one implementation , an incision can be made through the skin 25 and subcutaneous fat 28 , after which the skin 25 and fat 28 can be peeled back followed by any protruding internal viscera ( not shown ) being positioned internal to the hernia . in certain implementations , an incision can be made in the peritoneum 22 followed by insertion of the biodegradable surgical prosthesis 10 into the hernia opening so that the biodegradable surgical prosthesis 10 is centrally located in the hernia opening . one or both the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may be attached by , e . g ., suturing to the same layer of the abdominal wall , e . g ., the relatively - strong exterior fascia 16 . alternatively , the adhesion - resistant biodegradable region 14 may be attached to another member , such as the interior fascia 19 and / or the peritoneum 22 . in fig3 , the tissue - ingrowth biodegradable region 12 is surgically attached to the exterior fascia 16 while the adhesion - resistant biodegradable region is attached to the tissue - ingrowth biodegradable region 12 and / or optionally to the exterior fascia 16 using , e . g ., heat bonding , suturing , and / or other affixation protocols disclosed herein or their substantial equivalents . those possessing skill in the art will recognize that other methods of sizing / modifying / orientating / attaching a biodegradable surgical prosthesis 10 of this invention may be implemented according to the context of the particular surgical procedure . the size of the biodegradable surgical prosthesis 10 typically will be determined by the size of the defect . use of the biodegradable surgical prosthesis 10 in a tension - free closure may be associated with less pain and less incidence of post surgical fluid accumulation . exemplary sutures 31 and 34 may be implemented as shown to at least partially secure the biodegradable surgical prosthesis to the abdominal wall structure . the sutures 31 and 34 can be preferably implemented so that no lateral tension is exerted on the exterior fascia 16 and / or muscle 15 . when disrupted , the skin 25 and fat 28 may be returned to their normal positions , with for example the incisional edges of the skin 25 and fat 28 being secured to one another using suitable means such as subsurface sutures . in modified embodiments of the present invention , one or both of the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 of the biodegradable surgical prosthesis 10 , can be heat bonded ( or in a modified embodiment , otherwise attached , such as by suturing ). heat bonding may be achieved , for example , with a bipolar electro - cautery device , ultrasonicly welding , or similar sealing between the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 and / or directly to surrounding tissues . such a device can be used to heat the biodegradable surgical prosthesis 10 at various locations , such as at edges and / or at points in the middle , at least above its glass transition temperature , and preferably above its softening point temperature . the material is heated , e . g ., along with adjacent tissue , such that the two components bond together at their interface . the heat bonding may also be used initially , for example , to secure the tissue - ingrowth biodegradable region 12 to the adhesion - resistant biodegradable region 14 . since the tissue - ingrowth biodegradable region 12 serves more of a load - bearing function , a few typical embodiments may exclude heat - bonding as the sole means for securing this region to host tissues . in other embodiments , the technique of heat bonding the biodegradable surgical prosthesis 10 to itself or body tissue may be combined with another attachment method for enhanced anchoring . for example , the biodegradable surgical prosthesis 10 may be temporarily affixed in position using two or more points of heat bonding using an electro - cautery device , and sutures , staples or glue can subsequently ( or in other embodiments , alternatively ) be added to secure the biodegradable surgical prosthesis 10 into place . the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may be arranged to form more than one layer or substantially one layer , or the regions may both belong to a single , integrally formed layer . for example , the tissue - ingrowth biodegradable region 12 and the opposing adhesion - resistant biodegradable region 14 may be arranged in two layers , wherein one of the regions is disposed on top of , and opposite to , the other region . in one embodiment , the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may be combined on a single side of the biodegradable surgical prosthesis 10 in , for example , substantially one layer , wherein the regions are adjacent each other on one side of the biodegradable surgical prosthesis 10 . as a slight deviation , a biodegradable surgical prosthesis having a tissue - ingrowth biodegradable region on at least one ( and preferably , both ) side ( s ) thereof may be manufactured using any of the techniques described herein and , subsequently , an adhesion - resistant biodegradable region may be formed on , e . g ., one side , by smoothing , filling , or otherwise processing an area of the tissue - ingrowth biodegradable region with a suitable material as disclosed herein or technique ( e . g ., coating or filling with a liquid or flowable polymer composition , and / or mechanically smoothing ) to thereby form an adhesion - resistant biodegradable region having adhesion - resistant properties relative to those of the tissue - ingrowth biodegradable region . similarly , as depicted in fig3 , a patch of adhesion - resistant biodegradable region 14 may be sized and affixed ( e . g ., heat bonded , such as with a bipolar electro - cautery device , ultrasonicly welded , or similarly affixed ) at a time of implantation directly to at least one of the tissue - ingrowth biodegradable region 12 and surrounding host tissues . in modified embodiments , the affixing may be accomplished using , for example , press or adhesive bonding , or sutures . in further embodiments , at least part of the affixing may occur at a time of manufacture of the biodegradable surgical prosthesis 10 before packaging . the patch of adhesion - resistant biodegradable region 14 alternatively may be partially affixed ( e . g ., using techniques enumerated in this paragraph ) at , for example , a non - perimeter or central area thereof to an area ( e . g ., a non - perimeter or central area ) of the tissue - ingrowth biodegradable region 12 , so that a surgeon can trim the adhesion - resistant biodegradable region 14 ( and / or the tissue - ingrowth biodegradable region 12 ) at a time of implantation while the adhesion - resistant biodegradable implant 14 is affixed to the tissue - ingrowth biodegradable region 12 . for instance , a tissue - ingrowth biodegradable region 12 may substantially surround an adhesion - resistant biodegradable region 14 on one side of the biodegradable surgical prosthesis 10 , and only a tissue - ingrowth biodegradable region 12 may be formed on the other side of the biodegradable surgical prosthesis 10 . in such an implementation , the adhesion - resistant biodegradable region 14 of the biodegradable surgical prosthesis 10 can be sized and shaped so as to substantially cover any opening created by the soft tissue defect , with the tissue - ingrowth biodegradable regions 12 facilitating surgical attachment to , and incorporation into , the host tissue on at least one side of , and , preferably , on both sides of , the biodegradable surgical prosthesis 10 . in modified embodiments , the tissue - ingrowth biodegradable region 12 and / or the adhesion - resistant biodegradable region 14 on a given surface or surfaces of the biodegradable surgical prosthesis 10 each may be of any size or shape suited to fit the particular soft tissue defect . for example , either of the tissue - ingrowth biodegradable region 12 and / or the adhesion - resistant biodegradable region 14 on a given surface of the biodegradable surgical prosthesis 10 may have shapes of ovals , rectangles and various complex or other shapes wherein , for each such implementation , the two regions may have essentially the same , or different , proportions and / or dimensions relative to one another . in general , various techniques may be employed to produce the biodegradable surgical prosthesis 10 , which typically has one or two layers defining the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 . useful techniques include solvent evaporation methods , phase separation methods , interfacial methods , extrusion methods , molding methods , injection molding methods , heat press methods and the like as known to those skilled in the art . the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may comprise two distinct layers or may be integrally formed together as one layer . an exemplary process for making a biodegradable surgical prosthesis of the present invention having an adhesion - resistant biodegradable region , and a tissue - ingrowth biodegradable region with an additive , includes the steps of ( a ) forming a polymer layer to define the anti - adhesion biodegradable region such as described in u . s . pat . no . 6 , 673 , 362 ; ( b ) providing a water hydrolysable polymer ; ( c ) forming the hydrolysable or hydratable polymer into an implantable solid portion ; and ( d ) attaching the polymer layer to the implantable solid portion whereby the solid portion defines a tissue - ingrowth biodegradable region . the step of forming the hydrolysable polymer into an implantable solid portion can comprise adding a retardant to the hydrolysable polymer to form a mixture , followed by forming a layer from the mixture and subsequently drying and purifying the layer to form the implantable solid portion . the tissue - ingrowth biodegradable region 12 and the adhesion - resistant biodegradable region 14 may be partially or substantially entirely formed or joined together . joining can be achieved by mechanical methods , such as by suturing or by the use of metal clips , for example , hemoclips , or by other methods , such as chemical or heat bonding . the above - described embodiments have been provided by way of example , and the present invention is not limited to these examples . multiple variations and modification to the disclosed embodiments will occur , to the extent not mutually exclusive , to those skilled in the art upon consideration of the foregoing description . additionally , other combinations , omissions , substitutions and modifications will be apparent to the skilled artisan in view of the disclosure herein . accordingly , the present invention is not intended to be limited by the disclosed embodiments .

a prosthesis for repairing a hernia includes an adhesion - resistant biodegradable region and an opposing tissue - ingrowth biodegradable region . when the prosthesis is implanted into the patient , the adhesion - resistant biodegradable region covers a fascial defect of the hernia , and the tissue - ingrowth biodegradable region is located above the adhesion - resistant biodegradable region while being exposed substantially only to the host &# 39 ; s subcutaneous tissue layer . this orientation allows the tissue - ingrowth biodegradable region to become firmly incorporated with the host &# 39 ; s body tissue . the adhesion - resistant biodegradable region faces the internal organs and decreases the incidence of adhesions and / or bowel obstruction .

referring now in more detail to the exemplary drawings for purposes of illustrating embodiments of the invention , wherein like reference numerals designate corresponding or like elements among the several views , referring first to fig2 and 4 , the personal water filtration cup apparatus of the present invention includes , generally , a pair of inner and outer containers 21 and 23 forming , respectively , a cup device and a fluid receptacle 21 and 23 . the cup device 21 includes in its lower extremity a through filter device , generally designated 25 , for flow of liquid upwardly through a grill 27 to lift a flapper 29 of an isolation device , generally designated 31 , off the grill for flow of liquid into the upper cup 33 to provide filtered water . when pressurization of the filter device is diminished , the flapper 31 will lay down over the grill 27 as shown in fig3 to prevent backflow of liquid into the filter device . the receptacle 23 is conveniently constructed of readily available plastic material and is formed in its lower portion with a peripheral rib 41 ( fig4 ) to elevate the bottom wall 43 slightly . the bottom wall 43 is formed with a through - port 45 which receives the stem 47 of a poppet valve , generally designated 49 , that serves to vent air into the receptacle when the plunger - type cup apparatus is elevated . the upper portion of the receptacle 23 is formed with an upwardly and readily outwardly tapered flange 52 configured for convenient receipt of a turnback engagement flange 53 formed in the upper extremity of the cup apparatus . the cup apparatus 21 is configured in its lower portion with an integral transverse wall defining the grill 27 ( fig1 ) to form a plurality of through - ports 49 arrayed thereabout and covering the majority of the transverse cross - section of the cup 33 to thereby provide for a high - volume combined flow area to provide minimal resistance to flow of fluid . the grill 27 may take numerous different forms , and in the preferred embodiment provides a combined flow area of at least 50 % of the overall cross - sectional area of the cup and preferably approximately 60 % of the overall flow area to thereby provide for the desired structural integrity while still minimizing the resistance to fluid flow upon pressurization of the filter device . with continued reference to fig1 , the grill 27 is spaced a distance upwardly about one - fifth the length of the overall cup apparatus from the bottom end 51 thereof , and is formed in its upper extremity with coarse internal female threads 53 . an upwardly opening filter cup , generally designated 57 , is received in the lower extremity of the cup apparatus and is formed with a cylindrical wall configured in its upper extremity with male threads 61 for meeting with the lower extremity of the filter cup is configured with a radially outwardly projecting rib 65 to complement a fit within a cross section of the receptacle . the filter cup 57 is formed with a lower wall defining a grill generally designated 67 . also configured throughout the majority of its transverse area with a plurality of flow ports 69 which provide a combined flow area in excess of 25 % of the overall transverse cross section of the cup apparatus and in the preferred embodiment provide a combined cross - sectional flow in excess of 50 % of the overall transverse cross - section of the cup apparatus . the grill 27 is formed centrally with an enlarged bore 60 which receives a downwardly projecting compressible stem 62 of the isolation device 31 . the stem 62 is formed on its lower extremity within an enlarged cross - section stop 64 to cooperate in securing the isolation device to the grill . the filter apparatus includes a cylindrical filter 71 which may be constructed of any desirable commercially available filter media for filtration of water such as conventional charcoal filter . the filter 71 is sandwiched between a pair of felt retainer disks 73 and 75 to provide for containment against any possibly dislodged particles , but to allow for free flow of fluid as introduced from the lower grill 67 and to pass through the upper grill 27 . the interior wall of the cup above the grill 27 is preferably formed with a cylindrical peripheral retainer rib 40 configured to cooperate with the peripheral edge of the flapper to provide for protection of the thin peripheral edges thereof . the flapper itself is in the form of a circular plate and is configured to taper radially outwardly from a thick central section to a thin peripheral edges to thereby , in the manner dictated by well - known plate stress formulas , provide for a memory tending to maintain the flexible flapper 29 by its downwardly into contacting relationship over the pores 49 of the grill 27 to provide for sealing engagement therewith , but , to , upon application of pressure from the filter chamber on the order of 15 psi or so , provide for bending of the flapper to allow the peripheral edges to be raised for high volume flow therepast to provide for rapid flow of the newly filtered liquid . the isolation device is selected and configured to provide for effective sealing thereof as described above while providing for ready flexing under upward acting pressure to thereby provide for efficient flow . as will be appreciated by those skilled in the art , the flapper is to be constructed of material which is relatively tough and resistant to high temperatures on the order of 450 degrees fahrenheit and more , as would be consistent with washing in a dishwasher or the like and to yet provide for the operation dictated by the disciplines of the present invention . a material found successful for this operation is floor silicone material , but may be one of several food - safe elastomeric materials known to those skilled in the art . it will be appreciated by those skilled in the art the outer receptacle and cup apparatus may be molded of pc material and the filter cup 57 of an abs or abs blend material . in manufacture , these components may be molded separately and available for ready assembly . in one preferred embodiment , a pouring closure in the form of a cap device , generally designed 81 ( fig1 - 14 ) may be provided for snap fit onto the personal filter body assembly of the present invention as shown in fig1 . the cap device 81 is formed with a domed closure 83 configured in its lower peripheral wall with a gland 85 configured to be friction - fit over the exterior of the lip to set on the top of the combined apparatus . the cap assembly 83 may be constructed of , for instance , abs , and will be formed with an upwardly open stub drinking tube 87 covered by a friction fit plug 89 carried from a strap 90 hinged at a pivot pin 91 of an upstanding stem 93 for convenient opening and closure of the tube 87 . in manufacture , it will be appreciated that there are a minimum number of assembly steps . as an example , referring fig3 , the disk 75 may be nested down into the filter cup 57 overlying the grill 67 , the filter stacked up thereon and the disk 73 placed thereover , and the combination then fitted up into the bottom end of the cup apparatus and the filter cup 57 rotated to engage the respective threads 61 and 53 to tighten the assembly in position to slightly compress the filter media to maintain a slight pressure thereon and maintain some force on the engaged threads to facilitate closure of the filter cup into the cup apparatus . an o - ring 99 will be fitted down over the filter cup 57 to nest on the peripheral rib 65 . the umbrella isolation device 31 may be then introduced to the cup assembly from the top end thereof and the stem 62 inserted through the bore 60 to drive the conical holer 64 downwardly through such bore to compress the sides thereof , and , upon clearing the lower edge of the lower surface of the grill 27 , expand and maintain the isolation device in place . it will be appreciated that a relief bore 98 is formed in a center top of the filter to provide clearance for the fastener 64 . it will be appreciated that the diameter of the cup apparatus is of a size sufficiently smaller than the inside diameter of the receptacle such that the cup apparatus will telescope efficiently into the receptacle without binding , it being further appreciated that the o - ring 99 will provide a dynamic seal with the wall thereof . thus , the components may be easily separated and the receptacle 23 filled with , for instance , tap water , and the cup apparatus 21 introduced thereinto as guided by the flare of the bell section so as to slide conveniently downwardly in plunger fashion to contact the lower extremity thereof with the water in the receptacle as shown in fig9 and 10 . as the cup apparatus is plunged downwardly , the o - ring will prevent escape therepast of water . thus , as the apparatus is forced downwardly , causing the water to flow upwardly through the opening 69 in the grill 67 and into and through the filter device 71 to flow upwardly through the top felt discs 73 and through the ports 49 to apply a pressure underneath the reduced in thickness peripheral portions of the flap 29 , thereby applying a bending force to the diametrically outer portions thereof to thus bend the flapper and raise the edges thereof a shown in fig1 to permit a high volume flow of water as depicted by the directional arrows 101 upwardly into the cup 33 . as the full volume of water is passed upwardly through the filter device 71 , as for instance 16 ounces thereof , while the cup device is pressed downwardly through its full stroke , the cup 33 will be filled with filtered water ready for consumption . as the end of the downward stroke is reached , the other portion of the lip 51 will flex and snap over the upper edge of the bell section 51 to draw the cup apparatus into place within the receptacle for a secure joinder . the filtered water is then available for ready consumption , and , if desirable , the cap 81 ( fig1 and 14 ) may be snapped down into place over the lip 53 to close the top of the cup portion while making the filtered water available for consumption by merely lifting the lever 91 to unplug the stub tube 87 for ready access to the water . in the meantime , it will be appreciated that when the pressure in the filter chamber has been reduced , the memory of the material in the flapper will cause it to return to its horizontal position shown in fig4 to be disposed in overlying sealing relationship over the ports 49 to thus act somewhat as a check valve to prevent flow of water back downwardly and to the filter compartment . thus , in those many instances where users add energy or flavoring substances to the filtered water , the filter will be isolated from those substances to thus prevent contamination and clogging of the filter and protect the long life thereof . if desirable , the cup apparatus may be removed from the exterior receptacle and will be available for transporting the filtered water about as desired by the user . it should also be noted that , when the cup apparatus is retained in the receptacle 23 as shown in fig4 , once the filtered water has been consumed , the cup assembly 21 may be rapidly withdrawn by the user grasping the overhang of the rib 53 to draw it vertically upwardly as the wall of the cup defining the bell mouth 51 is flexed inwardly to allow for release , thereby freeing the cup assembly to be lifted relative to the receptacle . it will be appreciated that this action will cause a partial vacuum to be generated beneath the lower grill 67 , thereby applying a pressure differential across the poppet valve 49 , causing such poppet valve to be raised off its seat for introduction of atmospheric air to thereby break the partial vacuum and free the cup assembly to be drawn quickly and rapidly upwardly to be removed from the receptacle for refill of the receptacle itself . when the apparatus is emptied and it is desired to wash the cup apparatus , it can be placed directly in an automatic dishwasher or the like and tests have proven that the isolation device , filter and components will accommodate the heat and environment of such a dishwasher and will be available for subsequent . from the foregoing it will be appreciated that the self - filtering portable bottle apparatus of the present is economical to manufacture , efficient to use and offers the flexibility of allowing the user to supplement his or her drink with additives and supplements without concern for clogging the filter to thereby provide for a long and trouble free life . the invention may be embodied in other forms without departure from the spirit and essential characteristics thereof . the embodiments described therefore are to be considered in all respects as illustrative and not restrictive . although the present invention has been described in terms of certain preferred embodiments , other embodiments that are apparent to those of ordinary skill in the art are also within the scope of the invention . accordingly , the scope of the invention is intended to be defined only by reference to the appended claims .

inner and outer containers , telescoped together so the outer container can receive unfiltered liquid to be forced through a filter in the inner container , the inner container including an isolation flapper to permit flow from the filter but block flow back to the filter .

in reference to the drawings , referring to fig1 : this view shows the golf grip and swing repeater training aid on the left hand and wrist from the palm view . the arrow indicating the prevention of wrist ulnar deviation . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist and 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 10 is an elastic fabric loop that the thumb goes thru to guide the golf grip and swing repeater training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 13 represents the thumb of the hand . 14 represents the forefinger of the hand . 15 represents the forearm . fig2 : this view shows the golf grip and swing repeater training aid on the left hand and wrist from the thumb side view with the wrist facing upwards . the arrow indicating the prevention of wrist extension . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion . 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 10 is an elastic fabric loop that the thumb goes thru to guide the golf grip and swing repeater training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the training aid 3 itself . 13 represents the thumb of the hand . 14 represents the forefinger of the hand . 15 represents the forearm . fig3 : this view shows the golf grip and swing repeater training aid on the left hand and wrist from the little finger palm up view . the arrow indicating the prevention of wrist flexion . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion . 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 8 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 4 runs thru to assist in securing the strap 4 around the training aid for a secure fit to the wrist . 9 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 5 runs thru to assist in securing the strap 5 around the training aid for a secure fit to the wrist . 10 is an elastic fabric loop that the thumb goes thru to guide the golf grip and swing repeater training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 13 represents the thumb of the hand . 14 represents the forefinger of the hand . 15 represents the forearm . fig4 : this view shows the golf grip and swing repeater training aid on the left hand and wrist as seen gripping a golf club . the arrow indicating the prevention of wrist flexion . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion 3 and is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 8 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 4 runs thru to assist in securing the strap 4 around the training aid for a secure fit to the wrist . 9 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 5 runs thru to assist in securing the strap 5 around the golf grip and swing repeater training aid for a secure fit to the wrist . 10 is an elastic fabric loop that the thumb goes thru to guide the golf grip and swing repeater training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 14 represents the forefinger of the hand . 15 represents the forearm . fig5 : this view shows the golf grip and swing repeater training aid on the left hand and wrist from the thumb up with the back of the wrist view . the arrow indicating the prevention of wrist radial deviation . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the plane simple golf grip and swing repeater training aid to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the plane simple golf grip and swing repeater training aid for securing the golf grip and swing repeater training aid to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 8 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 4 runs thru to assist in securing the strap 4 around the training aid for a secure fit to the wrist . 9 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 5 runs thru to assist in securing the strap 5 around the golf grip and swing repeater training aid for a secure fit to the wrist . 10 is an elastic fabric loop that the thumb goes thru to guide the training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 13 represents the thumb of the hand . 14 represents the forefinger of the hand . 15 represents the forearm . fig6 : this view shows the golf grip and swing repeater training aid on the left hand and wrist from the palm view while gripping a golf club . the arrow indicating the angle formed between the left wrist and the shaft of the golf club . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion . 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the golf grip and swing repeater training aid to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the golf grip and swing repeater training aid to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 10 is an elastic fabric loop that the thumb goes thru to guide the training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 13 represents the thumb of the hand . 14 represents the forefinger of the hand . 15 represents the forearm . fig7 : this view shows the golf grip and swing repeater training aid on the left hand and wrist showing both hands on the grip of a golf club . this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion . 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the training aid ( repeater ) for securing the golf grip and swing repeater training aid to the wrist . 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the training aid ( repeater ) to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the plane simple golf grip and swing repeater training aid 3 itself . 10 is an elastic fabric loop that the thumb goes thru to guide the training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the plane simple golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . 15 represents the forearm . fig8 : this is a view ( front , right and top ) of the back of hand plate 1 . the back of hand plate is made from plastic material and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . fig9 : this is a view ( front , right and top ) of the inside wrist plate 2 . the wrist plate is made from plastic material and is sewn into the fabric and assists in the prevention of wrist flexion . fig1 : this is a view of the outside of the golf grip and swing repeater training aid this view is in relation to a right handed golfer . the training aid is fabricated from nylon and polyester material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the golf grip and swing repeater training aid to the wrist 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing the golf grip and swing repeater training aid to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 8 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 4 runs thru to assist in securing the strap 4 around the training aid for a secure fit to the wrist . 9 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 5 runs thru to assist in securing the strap 5 around the training aid for a secure fit to the wrist . 10 is an elastic fabric loop that the thumb goes thru to guide the training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation . 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the golf grip and swing repeater training aid 3 itself . fig1 : this is a view of the inside of the golf grip and swing repeater training aid this view is in relation to a right handed golfer . the golf grip and swing repeater training aid is fabricated from breathable cell foam covered with a layer of nylon and polyester velcro material and incorporates velcro ended straps to assist in securing the device to the wrist . 1 is the back hand plate made from plastic and is curved down on one side to go around the forearm and fit against the base of the thumb . it is sewn into the fabric and assists in the prevention of wrist extension and wrist radial deviation . 2 is the wrist plate made from plastic and is sewn into the fabric and assists in the prevention of wrist flexion 3 is the golf grip and swing repeater training aid itself . 4 is one of the straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid for securing it to the wrist . 6 is the end portion of the strap 4 consisting of velcro to fasten the strap 4 down to the golf grip and swing repeater training aid 3 itself . 7 is the end portion of the strap 5 consisting of velcro to fasten the strap 5 down to the golf grip and swing repeater training aid 3 itself . 10 is an elastic fabric loop that the thumb goes thru to guide the training aid into the proper position and to assist in keeping it in place . 11 is a third strap fabricated from nylon and polyester material that is attached to the golf grip and swing repeater training aid and runs from the back of the wrist underneath the end of the wrist and forearm and attaches to the top of the golf grip and swing repeater training aid to assist in the prevention of wrist ulnar deviation 12 is the end portion of the strap 11 consisting of velcro to fasten the strap 11 down to the training aid 3 itself . fig1 : is a view of one of the straps 4 and 5 used in securing the golf grip and swing repeater training aid to the wrist . 4 is one of these straps fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid with a velcro end 6 for securing the golf grip and swing repeater training aid to the wrist 5 is a second strap fabricated from nylon and polyester material attached to the golf grip and swing repeater training aid with a velcro end 7 for securing the golf grip and swing repeater training aid to the wrist . 8 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 4 runs thru to assist in securing the strap 4 around the training aid for a secure fit to the wrist . 9 is a plastic oval ring ( metal can be used also ) that is sewn in and attached to the golf grip and swing repeater training aid which strap 5 runs thru to assist in securing the strap 5 around the golf grip and swing repeater training aid for a secure fit to the wrist . a variation on the shape and design of the hand plate 1 a is shown in fig1 - 15 . this hand plate is designed for use as a substitute for the hand plate previously described in fig8 , and shown at its location within the training aid as explained in fig1 . as can be seen in fig1 , which is a left side view of the hand plate , it is of a thin line construction , and is generally made of a polymer , of a more hardened type of polymer , such as polypropylene , or any other polymer that has sufficient rigidity to act as a structural reinforcement to hold the various components of the golfer &# 39 ; s hand , and grip , in place , during a swing . as can be seen in fig1 , the hand plate 1 a has some degree of arcuateness to it , as at 1 b , so that when it is in place upon the hand of the user , as disclosed in the variety of drawings previously provided and described in this application , the hand plate will embrace that segment of the hand in the vicinity and below the thumb 13 , and extend down into the wrist area , as previously reviewed , and then extends slightly over the region of the left side of the palm , in order to prevent wrist extension , and wrist radial deviation , when the golfer undertakes the significant pressure involved in performing a golf swing , and at the same time , with this component , and the entire training aid to keep the player &# 39 ; s wrist proper in alignment , so as to avoid the various deviations as previously explained , that do occur in man golfer &# 39 ; s , regardless of their being of a beginning status , or even a somewhat experienced golfer . fig1 - 18 show what is identified as the back hand plate 1 b of this invention . essentially , it is a length of polymer , metal , or other rigid material , which has a bent upper end , as can be seen , and that particular back hand plate rest upon , obviously , that back of the hand of the user , upon installation . the back hand plate , at its location within the training aid , can be readily seen in fig5 , at reference character 1 b . the plate locates within the training device , with its slightly bent upper end biasing against the upper part of the back of the hand . this also prevents the unauthorized movement of the hand , to control the type of deviations as explained on page 6 of the specification . in this modified design , which provides for total control of the golf grip , through this training aid , generally includes all the various types of plates as identified herein . for example , the style of hand plate 1 a , or 1 , as noted within in the training aid , locates within the aid , and generally curves around the thumb edge of the hand and wrist , and has the shape and appearance as generally shown and described in fig1 - 15 . furthermore , the wrist plate 2 as can be seen embedded within the training aid , as noted in fig1 , generally locates against the lower part of the palm , just above the wrist , and then extends down into the region of the upper wrist , as located therebelow , in order to prevent flexion of the wrist at that location . furthermore , that leaves the actual palm of the hand , arranged thereabove , for clear application and gripping of the handle of the golf club , so that the wrist plate 2 provides no interference with the grip and swing of the golf club , during usage of this training aid . finally , the style of back hand plate 1 b , as shown and described in fig1 - 18 , can be seen in fig5 , resting against the back of the hand , and the upper part of the wrist , when located within the training aid . each of the various plates as identified herein fit within their own little pouch or pocket contained within the training aid , primarily to keep them in proper position . furthermore , the training aid itself is formed like a glove , having a more durable outer covering made of a heavy fabric , leather , polymer , or the like , to withstand repeated usage , while the inner layer may be of a softer type of material , for gripping purposes , and for comfort . through the use of these three combinations of plates , the training aid can help reduce and eliminate movement of the four wrist deviations , prevents wrist extension , prevents wrist radial deviation , further prevents wrist ulnar deviation , and finally , reduces wrist flexion . this provides a complete training aid to help correct the swing of the golfer , while participating in this sport . this is an example as to how this training aid , for the golfer , can be used to reduce those detriments that lead towards a poor drive or hit of the golf ball , and through the usage of this training aid , can substantially reduce if not eliminate those faults that lead to wrist extension , wrist radial deviation , wrist ulnar deviation , and wrist flexion . furthermore , while this invention has generally been described as a training aid for use by the right handed golfer , obviously , a mirror image of all of the components as previously shown , described , and explained , could be assembled into a training aid for use by the left handed golfer , and applied to his / her right hand , to provide the same benefits and enhancements to their golf swing , while participating in this popular sport . variations or modifications to the subject matter of this development may occur to those skilled in the art ; upon review of the invention as provided herein . such variations , if within the spirit of this invention , are intended to be encompassed within the scope of any claims to patent protection issuing herein . the description of the invention in the preferred embodiment , and as depicted in the drawings , are set forth for illustrative purposes only .

this invention relates to a training aid to assist the golfer in performing the proper golf swing technique for the effective golf swing . this training aid will be placed on the leading wrist of the golfer to develop the proper swing technique and to create muscle memory and to allow for repeated practice for game improvement and consistency . it includes a cover with straps to wrap around the hand of the user , and incorporates a back hand plate to hold the hand and wrist in alignment and place during a golf swing . it may also incorporate a wrist plate .

previous work by the present inventors has been published as u . s . patent application no . 2008 / 0081692 a1 , which is herein incorporated by reference thereto in its entirety . the present invention now will be described more fully hereinafter , in which preferred embodiments of the invention are discussed . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . the present invention includes a method of transforming physiological information obtained from biomedical instruments in order to use that information to modify the functioning of computer simulation or game controllers or joysticks . the invention involves modulation that transforms the controller signals received at a computer &# 39 ; s game port or a game console prior to their being used by the computer simulation or game software . the result can be that the magnitude of the effect of the game or simulation &# 39 ; s input device ( e . g ., joystick , game pad , steering wheel ) is modulated by the strength of the physiological signal ( s ). by making the joystick &# 39 ; s “ control authority ” proportional to the physiological signal ( s ), the player is encouraged to change the physiological signals ) according to a programmed criterion ( e . g ., increase , decrease , or maintain ) in order to perform better at the game task . when the physiological signal ( s ) are the target of physiological self - regulation or biofeedback training , the game play reinforces therapeutic changes in related physiological processes . however , the reinforcing feedback is preferably implicit in the task , and not explicit in the form of direct feedback ( bar graphs , tracings ), as in conventional biofeedback training . in this way , contingencies for subtle conditioning of the desirable physiological response ( s ) are set up . different embodiments of the present invention are possible , and the components of the invention can vary depending upon implementation . further , the invention is intended to be used with a variety of systems , such as standard video game systems ( e . g ., sony playstation , nintendo , etc . ), with standard personal computer systems , and with computer simulators and professional job training systems . additionally , one or more of a wide variety of different measured physiological signals can be used in accordance with the present invention , for example , eegs , skin temperature , skin conductance , heart rate , and / or event - related potentials ( erps ). u . s . pat . no . 5 , 377 , 100 , issued on dec . 27 , 1994 to pope et al , and which is incorporated herein by reference as if set forth in its entirety , and also specifically at column 3 , line 8 to column 5 , line 60 that details a method for determining an individual &# 39 ; s eeg index of attention , which index can be used to assess his or her mental engagement in a task . in accordance with at least one embodiment of the present invention , the disclosed apparatus and methods can be used specifically for entertainment purposes . for example , a player might simply use the system for the enjoyment and challenge of mastering a game or simulation , as well as the satisfaction of controlling his own physiological states . it is also within the scope of the present invention that a player could entertain himself by personally using data feedback to set challenges , thresholds and goals for the player to achieve . further , it is within the scope of the present invention to utilize a variety of input devices or controllers , as well as to utilize not just joystick or gamepad input ports , but to utilize a variety of other computer input ports as well , and thus varying the connection apparatus , as appropriate , to accommodate the type of port and / or system being utilized . the present invention could possibly utilize interface devices such as touch pads , light pens , power gloves , keyboards and weapons ( e . g ., hand - held guns ), for example . additionally , it should be noted that when the term “ counts ” has been used herein the term potentially referred to any one of a variety of types or forms of information that a computer , video game system , and / or training simulator might receive at a computer or game port . for example , it is within the scope of the present invention that the information that the computer software reads from a port could be in the form of a digital value which can be expressed as a number , counts , etc . additionally it is expressly within the scope of the present invention that substantially all of the described hardware known to the art , for example as described in u . s . pat . no . 6 , 450 , 820 , that is incorporated in its entirety by reference herein , could be replaced with software . that is to say , for example , many functions , such as comparators , timers , threshold detectors , relays , voltage controlled amplifier , voltage controlled modulator , offset circuitry , and gates , vco , baseline deviation deriving system , etc ., can be accomplished with software . for example , these functions could possibly be programmed in what is commonly known as a “ virtual instrument ” environment , such as national instruments &# 39 ; labview . in at least one embodiment , this type of environment would allow hardware used in the present invention to be replaced by functional modules represented as icons on a screen , which can be set - up and “ wired ” together . the resulting software system can then function just like its hardware counterpart , for example , interacting with external signals through analog and digital input and output boards installed in the computer . the present invention fully integrates biofeedback training into a true dynamic video game , or realistic simulation , which turns the popular home pastime of playing video games into an opportunity for therapy or self - improvement . it is the prototype of a new generation of computer game environments that train valuable mental skills beyond eye - hand coordination . current systems typically deliver biofeedback in bland , minimally motivating task formats with direct feedback . the present invention &# 39 ; s video game or task challenge format motivates trainees to participate in and adhere to the training process through the rewards inherent in mastery of popular video games or job simulators , and without the demand , monotony or frustration potential of direct concentration on physiological signals . in accordance with at least one embodiment of the present invention , the entertainment value and social interaction experience of electronic gameplay is enhanced by distributing the control and modulation of inputs to electronic games among two or more players , so that joint game goals are collaboratively pursued and accomplished by separate players who provide different means of control and modulation . for example , one or more player may provide physical activity control via game controller ( s ) ( these players may be termed the physical operators ) and one or more other individuals influencing the game through physiological activity measured via body sensors ( these players may be termed physiological operators ). such an embodiment avoids the problem of movement disruption of physiological sensing by modulating one player &# 39 ; s game controller using the physiological signals of another , collaborating player who is physically inactive . the invention further enables collaborative team play by multiple players with different roles on the team — one or more providing physiological mastery to facilitate game performance and one or more others simultaneously providing manual or physical skills needed to operate the game . this creates richer and more complex gaming opportunities than present games provide , enabling engaging and rewarding team social interactions among people who have different skill sets and interests or who take turns playing different roles on a team — on one hand , providing the physiological self - mastery , and on the other , providing physical performance action skills . such an embodiment modulates one or more players &# 39 ; game controller ( i . e ., game input device operated by physical activity ) using the physiological signals of another / other , collaborating player ( s ) who is / are not providing input to the game via a game controller . the invention accomplishes this function by transmitting control signals , either wired or wirelessly , derived from one or more player &# 39 ; s / players &# 39 ; physiological signals to modulate the control over the game of one or more other player / players who are using electronic game controllers , in a way that either retards or boosts game performance influence of the game controllers . alternatively , this shared influence over a game of a physiological operator and physical ( game controller ) operators , respectively , can be implemented by blending influences from both into a single control input into the game ; in this manner , game action tasks could be operated either via a game controller or particular predefined physiological input , or through pre - defined combinations of both . for instance , a video game task of an avatar game character jumping over a canyon could be initiated by either the game controller operator or by a physiological operator &# 39 ; s particular body activity , and the height or length of the jump could then be solely dependent on the physiological activity of the physiological operator whereas the direction of the jump and place of landing on the other side could be controllable only by the game controller input . thus , the physiological and game controller operators will have to collaborate to succeed at the task of jumping for good success in the game . such an embodiment may be implemented in any of the above - described game systems , simply by having one player &# 39 ; s physiological signal ( s ) sensed by the physiological signal conditioning system ( e . g ., 104 of fig1 of u . s . pat . no . 6 , 450 , 820 ) and having another player control the game controller ( s ) ( e . g ., joystick 105 of fig1 of u . s . pat . no . 6 , 450 , 820 ). such an embodiment enables two new categories of electronic game play : ( 1 ) modulating one or more player &# 39 ; s game controller input using the physiological signals of another / other collaborating individuals ; and ( 2 ) modulating game activity through joint authority over game actions by game controller input from one or more individuals and physiological sensor input from other separate individuals not using game controllers . the embodiment enables physiological and manual control of electronic games to be allocated in various combinations to several players . such an embodiment permits individuals who are physically challenged to participate in electronic game play by collaborating with a player who is able to manipulate controls that the challenged player cannot , and enables individuals with different skill sets and interests ( physiological self - control vs . physical performance skills ) to join together in rewarding game play . such an embodiment also enables implementation of unprecedented electronic games that incorporate a classic motif in superhero comics and movies in which differently - abled protagonists collaborate and / or interact , such as professor x and his cohorts in the x - men series or elijah price and david dunn in the movie “ unbreakable ” and provides opportunities for new kinds of games where the application of “ mental powers ” of particular individuals ( i . e ., particular deliberately produced eeg characteristics ) can enable or enrich the performance of other individuals playing a game . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range . unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein . including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .

disclosed are methods and apparatuses provided for modifying the effect of an operator controlled input device on an interactive device to encourage the self - regulation of at least one physiological activity by a person different than the operator . the interactive device comprises a display area which depicts images and apparatus for receiving at least one input from the operator controlled input device to thus peiiiiit the operator to control and interact with at least some of the depicted images . one effect modification comprises measurement of the physiological activity of a person different from the operator , while modifying the ability of the operator to control and interact with at least some of the depicted images by modifying the input from the operator controlled input device in response to changes in the measured physiological signal .

the preferred embodiments of the instant invention are now described referring to fig1 , 2 a , 2 b and 3 . identical elements in the various figures are identified with the same reference numerals . reference will now be made in detail to embodiment of the present invention . such embodiments are provided by way of explanation of the present invention , which is not intended to be limited thereto . in fact , those of ordinary skill in the art may appreciate upon reading the present specification and viewing the present drawings that various modifications and variations can be made thereto . referring now to fig1 , a block diagram of the invention is shown . a microprocessor 101 , a charge coupled device ( ccd ) image capture array 102 , program memory 103 , data memory 104 , usb connector 105 , display 106 , user controls 107 , light source 108 , optics 109 , data transfer port 110 , near field communications ( nfc ) feature 111 , heating / drying unit 112 and a smart phone 113 are shown . still referring to fig1 , according to a preferred embodiment the user turns the device on from user controls 107 . the microprocessor 101 having a program memory 103 and data memory 104 will turn the light source 108 on once a sample is inserted in the device . a preferred embodiment also has a heating / drying unit 112 at a sample receptacle to dry the saliva sample after inserting the sample on a transparent plate in the device . the microprocessor 101 turns the heating element of the heating / drying unit 112 on upon inserting the sample and off once the sample is dry . according to one preferred embodiment the device includes a thermosensitive element that turns on when the sample receptacle contacts the element upon inserting the sample into the device and turns off when the sample is dry . according to one preferred embodiment the microprocessor 101 turns the heating / drying unit off after a predetermined time period , for example 30 seconds after the sample is inserted into the sample receptacle . the device has an autofocus features , focusing automatically to the saliva sample . preferably the magnification is 100 ×, but any magnification showing the ferning pattern can be used . the user can then take an image of the desired view of the sample by using user controls 107 to activate the ccd 102 to capture the image and convert it on digital values . data may then be saved on an internal or external memory , such as a memory stick . the memory preferably has capacity to at least 365 images . i . e . one image each day of the year . according to one preferred embodiment , the user may select one or more of the saved images for viewing and comparing them on the display 106 . according to one preferred embodiment the display can display at least two images simultaneously . according to one preferred embodiment there are template images saved in the device memory and the display is capable of showing simultaneously one or more template images and one or more images of user &# 39 ; s saved data . according to a preferred embodiment the images may be transferred and saved on a smart phone 113 or a tabloid . the user may then share the pictures for example with her doctor via email or text messages and can easily bring the pictures to her next appointment . according to one preferred embodiment the device has a nfc - feature 111 and the date can be transferred wirelessly . according to a preferred embodiment the user takes a picture of her saliva sample every morning when she wakes up before eating , drinking or smoking . it is not necessary to take any more than one image per day . the most reliable results of ovulation likelihood are received by taking the image at the time of waking up before eating , drinking or smoking . the user can then share the saved data with her doctor . according to one embodiment the device includes software capable of using an algorithm to provide a sampling schedule for the user to provide samples . according to this embodiment the device provides a schedule for sampling around the most probable time of the ovulation . the device may provide an alarm or notification for the user for sampling . the alarm or notification may be a voice , light , or shaking of the device . according to a preferred embodiment the device has heating / drying unit 112 controlled by the microprocessor . the heating element of the unit 112 dries the sample within few seconds whereby the sample can be inspected , displayed and saved immediately . according to one preferred embodiment the user may provide a pre - dried sample . such pre - dried sample may for example be air dried sample . according to a preferred embodiment the user control includes means to insert the date of the sample . via the optics unit the user may view images saved in the memory and choose any desired date , e . g . the first day of each month to be viewed or images of every day of a desired month . now referring to fig2 a , the device is shown in a front perspective view . the figure shows a housing 210 , a display 260 , user controls defined as a date control 272 , on / off button 274 , take a picture button 275 and search button 278 , a receptacle 212 to insert a sample , a transparent slide 216 with an orientation groove 201 to consistently place the sample on , and memory stick ( s ) or other memory device 270 , 271 to save the data . the memory device may for example be a smart phone ( 111 in fig1 ). still referring to fig2 a , the user places a sample on the transparent slide 216 . the transparent slide may be a glass slide . the sample is most preferably a drop of saliva , but it can as well be a drop of cervical fluid . the transparent slide 216 having the sample is now pushed into the sample receptacle 212 ( which has a relief 202 ( shown in fig2 b ) to protect the sample ) of the device . the device is turned on using the on / off - button 274 . in a preferred embodiment turning the device on will turn on the heating / drying unit ( 112 in fig1 ) to dry the sample on the transparent plate ( e . g . glass ) within second ( s ). turning the device on will also turn the light source ( not shown in fig2 a ) on . the light source is preferably a led light and it illuminates the sample . the device has an autofocus feature and the image of the sample ( see fig3 a - c ) is displayed on the display screen always in focus . the user has to set the date from the date control 272 . through the take - a - picture button 275 the user is activating the ccd ( 102 in fig1 ) to capture the picture and transform it into digital format . the microprocessor saves the pictures with the date information . the user may download the images taken on different days through the optics unit ( 109 in fig1 ), print the saved images , or transfer them to another suitable device , e . g . a smart phone to email the images for example to her doctor . the device is preferably handheld and can be run with batteries . the device may also be charged ( receptacle in fig2 b ). now referring to fig2 b , the device is shown in a side perspective expanded view . the figure shows a transparent slide 216 with recess or a groove 201 for consistency of orientation of the samples , a receptacle 212 ( see fig2 a and fig2 b ) to inset a sample and a relief 202 to prevent damaging of the samples . the figure shows receptacles 203 , 204 are temperature information to the user . this embodiment allows the user to record her body temperature and save the data into the memory of the device . according to a preferred embodiment the user measures her temperature with a thermometer ( s ) attached to inlet 203 or 204 in the morning . the user can save the data on the device memory with the date and time information . the user then provides a saliva sample and takes pictures as described above . this data can be saved along with the temperature data . in fig2 b 205 is receptacle for battery charging . the stored images and the temperature data and associated algorithmic data ( see below ) may be transferred through a number of generally accepted methodologies including a smart phone ( 113 in fig1 ). a direct data transfer may occur through a data transfer port ( 110 in fig1 ). in such a scenario , the data transfer port receives a cable which enables the user to transfer selected data to a secondary device much like the transference of images and data from a digital camera to a computer . alternatively , the data transfer port may accept a secure digital ( sd ) card that enables an arbitrary amount of storage depending on the card selected . the sd card can then be readily transferred to a secondary device and the data saved to that card can then be uploaded to the secondary device . even yet , in embodiments where no such data transfer port exists , the device may use near field communications ( nfc ) ( 111 in fig1 ) to transfer data between devices . this method enables the wireless transfer of data via radio wave communication . in a preferred embodiment the user may manipulate the saved data in a way that the results may be compared to pre - determined norms derived from many other user samples or to template data saved in the memory of the device . furthermore , the microprocessor may be programmed to use one or more algorithms to provide prediction of likely ovulation time and to provide a sampling schedule for the user . generally , the ferning pattern ( see fig3 ) in the saliva sample is created by the crystallization of sodium chloride in the presence of increased hormone levels such as estrogen . estrogen and the associated estrogen levels are key factors is determining potential fertility . the increase in estrogen , in turn , results in an increase in the crystallization pattern , which is detected by the ccd and stored in the computer readable memory within the device . the microprocessor analyzes the stored images for detecting crystallization lines via optical analysis within a given sample based on the known parameters ( i . e . size , resolution , etc .) of the image captured by the ccd . the microprocessor can then arrive at a value for the degree of crystallization of a given sample to make a determination whether the level of crystallization meets or exceeds an accepted or arbitrary level determined to signify peak ovulation . thus , this numerical figure can then be compared either manually by the tester or automatically by the device to signify whether or not the tester has reached peak ovulation . according to another embodiment the device may also include a unit to measure body base temperature or other parameters and the software may use an algorithm to utilize that data in addition to the data captured from the body fluid sample . according to a preferred embodiment the device is handheld . the measures of the housing may be about 2 . 5 ″ times 3 ″ times 0 . 5 ″ ( 6 . 35 × 7 . 62 × 1 . 27 cm ). a hand held device is preferable when the device is meant for predicting ovulation of human females . the device may be more robust in its size when it is meant to be used for dogs and livestock breeders . it is understood by a skilled artisan that several changes and alterations may be made to the device and method without diverting from the spirit of this invention .

this disclosure provides a stand alone electronic device to predict a likely time of ovulation based on crystal formation in a mucous body fluid sample . optionally body temperature data may also be measured and saved on the device memory . the device allows user to save the data , download images , and compare results from different times . the disclosure further provides a device that includes software using an algorithm to calculate frequency of crystals on the sample and allowing comparison of the frequencies . the algorithm may use the temperature data also . the device includes an option to transfer data onto a smart phone or similar device . the device is suitable for predicting ovulation of any mammal , including human beings , dogs and livestock including horses .

the following is a detailed description of the new prune tree cultivar that was obtained from the observation of eight year - old asexually propagated trees during the 1999 growing season ( except where otherwise indicated ). the trees were propagated on prunus cerasifera ‘ myrobalan 29c ’ plum rootstock . the trees were grown at the kearney agricultural center of the university of california located at parlier , calif . tree spacing was 5 . 49 m between rows and 4 . 88 m spacing between trees down the row . the color chart used in the identification of colors is that of the royal horticultural society , london ( r . h . s . colour chart ). other color terminology is to be accorded its customary dictionary significance . size .— the height during october at the end of the growing season ranges from approximately 4 . 2 to 4 . 7 m including approximately 1 . 7 to 1 . 8 m of current season &# 39 ; s growth . the width across the crown ranges from approximately 3 . 7 to 4 . 3 m . hardiness .— hardy under typical san joaquin valley of california climatic conditions . size .— average in thickness for prunus domestica . the trunk circumference at 35 cm above the ground is approximately 12 cm . texture .— relatively smooth with only a slight amount of short scarfskin . lenticels .— numerous , prominent , oval in configuration , most pronounced on the trunk and large scaffold limbs where they are the most abundant , and commonly raised with a calloused surface . the height commonly ranges from approximately 1 . 5 to 2 . 0 mm and the width from approximately 2 . 0 to 6 . 0 mm . the coloration is brownish - tan , near grey - orange group 173c . diameter .— average thickness for prunus domestica . the diameters of primary scaffold branches average 7 . 4 cm and range from 6 . 1 to 8 . 4 cm , and the diameters at the base of the secondary scaffold branches average 4 . 5 cm and range from 3 . 3 to 5 . 7 cm . the basal diameters of fruiting hanger limbs average 1 . 1 cm and range from 0 . 7 to 1 . 7 cm . the diameters of fruiting spurs average 0 . 5 cm with a range from 0 . 3 to 0 . 7 cm . these dimensions were obtained from the observation of ten - year - old trees during april 2001 . surface .— substantially pubescent especially on current season &# 39 ; s growth . such pubescence is moderately dense and short . color .— branch color is somewhat variable . mature current season &# 39 ; s shoots are medium brown of near brown group 200d . immature shoots range from light green of yellow - green group 144b to darker green of yellow - green group 144a on more mature growth . young shoots exposed to the direct sunlight often are blushed with a rose - red hue of red group 48a . new expanding shoot tips commonly are bright yellow - green of yellow - green group 151a . two year - old or older branches commonly are near grey - brown group 199b to darker brown of grey - brown group 199a . lenticels .— substantial presence on mature current season &# 39 ; s shoots , and two year - old or older branches . internode length .— normal for prunus domestica . the distance between nodes commonly ranges from approximately 19 to 36 mm on moderately vigorous current season &# 39 ; s shoots . size .— medium to large . leaves produced near mid - shoot on vigorous current season &# 39 ; s shoots range in length from approximately 10 . 9 to 15 . 4 cm including the petiole and in width from approximately 5 . 5 to 6 . 8 cm . the leaves are moderately thick and are slightly above average in thickness . form .— variable , frequently obovate , and with the occasional presence of oval leaves . the leaf apices are acute and commonly are very slightly reflexed sideways . with advancing maturity some older leaves are folded downwards from the midrib . color .— the upper surface is dark green . yellow - green group 146a to yellow - green group 147a . the under surface is lighter green , yellow - green group 147c to yellow - green group 148c . the primary mid - vein on the under surface is pale green , yellow - green group 145c . both the under surface and the leaf mid - vein on the under surface are highly pubescent . margin .— crenate with large somewhat irregular crenations . the margins tend to be slightly undulate . petiole .— average in size , commonly approximately 17 to 32 mm in length , approximately 1 . 5 to 2 . 0 mm in thickness , and light green , yellow - green group 145b , in coloration . with advancing age the petiole coloration can darken and assume a reddish blush near red group 37a . such blush tends to be most evident along the ridges of the petiole groove . glands .— from 0 to 2 small glands commonly can be observed at the extreme base of the leaf blade margin . such glands are globose in configuration and occur on stalks which are distinct or indistinct . usually no glands are present on the petiole itself . the gland position is alternate . the coloration when young is bright green , yellow - green group 151c , with darkening and deterioration with age . stipules .— medium to large in size , linear lanceolate in configuration , located at the very base of the petiole and arise from the base of the petal groove area , partially deciduous with some stipules remaining on the leaf throughout the growing season , margins are serrate and substantially pubescent , commonly approximately 5 to 11 mm in length and 1 . 5 to 2 . 0 mm in width at full maturity , and the coloration of young stipules is green , yellow - green group 145a . picking .— first pick was july 30th and the last pick was aug . 9 , 1999 . the 1999 fruit growing season in the san joaquin valley area of california was one of the latest on record and ranged from 12 to 15 days later than average . a more typical first - pick date is july 15th and a more typical last pick date is july 25th . size .— very large for the species and of relatively good uniformity . fruit from a well - thinned tree ranges from approximately 40 to 53 mm in the suture diameter and approximately 54 to 68 mm in the axial diameter . form .— most frequently oval in lateral aspect , is well rounded basally and apically , and tends to be slightly more pointed apically . nearly globose to slightly oval in the apical aspect and at times is slightly irregular . the fruit varies from symmetrical to slightly asymmetrical . suture .— very thin , with a somewhat indistinct line extending from the base to apex . most frequently is similar in coloration to that of the surrounding skin surface . at times is slightly depressed especially over the ventral apical shoulder . a very slight amount of stitching occasionally is observed over the apical shoulder . ventral surface .— usually quite smooth ; however , at times a very low lipping is observed . stem cavity .— oval , quite regular in configuration , very small , tight and very shallow . the width commonly ranges from approximately 2 . 5 to 5 . 0 mm and the depth commonly ranges from 2 . 0 to 2 . 5 mm . at times a small oval fleshy ring is observed within the cavity basin which surrounds the stem at the point of attachment to the basal cavity . such ring is narrow and averages approximately 1 . 0 mm in thickness . when the stem is removed from the fruit , the ring can remain in the cavity or be attached to the distal end of the stem . base .— regular and rounded . the stem attachment and stem cavity frequently are not positioned at the highest point of the fruit base , but rather are positioned approximately 5 to 8 mm down the ventral edge from the basal apex . the basal angle tends to be decidedly oblique to the fruit axis . apex .— slightly raised and somewhat more pointed than the fruit base with no depression at the apex . the pistil point is variable and at times is apical and at times is moderately oblique . stem .— medium in length and pubescent with the abundant presence of short and stiff hairs . the length commonly ranges from approximately 11 to 18 mm . the thickness commonly ranges from 1 . 5 to 2 . 0 mm . the color is pale green at commercial maturity , near yellow - green group 146c . skin pubescence .— generally glabrous but with a small amount of scattered very fine pubescence covering the surface of the fruit . skin tendency to split .— no tendency to crack or split has been observed . skin color .— grey - blue , violet - blue group 97b , at commercial maturity when the waxy cuticle bloom is intact . once the bloom is removed the coloration is dark purple , greyed - purple group 187a . the fruit usually is fully colored with no visible ground color . occasionally a lighter reddish - purple , greyed - purple group 187c , is observed especially on an exposed fruit surface . at full maturity a small number of light colored dots sometimes are observed , primarily on the lateral surfaces and over the basal shoulder . flesh color .— commonly varies from yellow - orange group 20b to a darker yellow orange , yellow - orange group 20a . a small number of fibers also commonly are observed within the stone cavity and along the margins of the stone . flesh texture .— at commercial maturity the flesh is firm , relatively fine textured , and moderately juicy . at more advanced maturity the fruit becomes softer and very juicy . flavor .— mild and sweet with a relatively low acidity . during the 1999 growing season on july 30th , soluble solids reached 17 degrees brix at 5 . 0 pounds pressure for fresh shipment . on august 13th of the same year , soluble solids reached 20 degrees brix at a drying maturity of 2 . 6 pounds pressure . aroma .— very slight to lacking at commercial maturity . the aroma becomes slightly stronger as maturity progresses . attachment .— semi - freestone . the flesh fibers are attached primarly at the base of the stone and along the suture edges , but are generally free laterally . the stone tends to become more free with advancing maturity . size .— relatively large , commonly ranges from approximately 28 to 33 mm in length , approximately 14 to 17 mm in width , and approximately 7 . 5 to 9 . 5 mm in thickness . hilum .— very small and commonly averages approximately 2 to 3 mm in length . is oval , but the shoulder commonly is distinctly eroded along the ventral edge . the basal area under the hilum scar is somewhat necked . distinct ridges commonly are present on the basal neck which converge basally . surface .— slightly rough with the lateral surfaces being covered with very low netted ridges . ventral edge .— relatively narrow , smooth and regular . very low wings of often less than 1 mm sometimes are present on the basal one - third of the ventral edge and sometimes are completely absent . commonly a shallow but distinct groove is present laterally and runs roughly parallel to the ventral edge at approximately 2 to 3 mm below the edge . the ventral edge sometimes is slightly pitted and at times is discontinuous . dorsal edge .— a distinct groove commonly is present along the dorsal edge from the base to the apex . at times the dorsal groove is discontinuous at or near med - suture . the dorsal groove is usually wider and more distinct from the base of the stone up to mid - suture . the groove tends to be narrower beyond mid - suture towards the apex . color .— cinnamon , greyed - orange group 165c . the wet color is darker , greyed - orange group 165b . chilling season .— data for this description was obtained during march 1999 . there were approximately 1331 chilling hours below 45 ° f . for the 1998 - 1999 winter season . floral buds .— medium in size , commonly 4 to 5 mm in length and 2 to 3 mm in width , conic in form , plump , slightly appressed to the bearing stem , and hardy under typical san joaquin valley climatic conditions . the bud surface scales are dark brown , brown group 200b , in coloration , are lightly pubescent , and are most distinct along the margins . the number of buds per node can range from approximately 1 to 6 and most commonly is approximately 3 . such buds commonly are present in abundance on one year - old wood which is uncommon for the species . blooming time .— early in relation to other prunus domestica cultivars . initial sustained bud burst began on mar . 14th during 1999 . full bloom occurred on mar . 19th during 1999 . the duration of bloom was approximately 10 days with nearly complete shatter by mar . 24th in 1999 . in contrast the ‘ improved french ’ cultivar attained full bloom on march 28th under the same conditions . size .— medium to large for the species . the fully expanded flower diameter commonly is approximately 22 to 30 mm . petals .— medium to large in size and commonly range from approximately 11 to 14 mm in length and approximately 10 to 12 mm in width . the number is 5 per flower . the form varies from oval to very slightly obovate and at times is notched at the apex . the coloration is white , white group 155b . the petal claw is short and truncate , approximately 0 . 5 to 1 . 0 mm in length and approximately 1 . 0 mm in width . the margins are variable and range from relatively smooth to slightly undulate and are somewhat cupped inwards . the apices are also somewhat variable and range from smoothly rounded to distinctly notched . pedicel .— commonly approximately 7 to 12 mm in length and a thickness of approximately 0 . 8 to 1 . 0 mm . the coloration is light green , green group 143c , and the surface is pubescent with short erect hairs throughout . calyx .— lightly pubescent with short fine pubescence , and greenish - yellow in coloration , yellow - green group 146c . sepals .— five in number , approximately 5 mm in length , approximately 3 to 4 mm in width , pubescent on the surfaces with greater density along the margins , oval in form , and the external coloration is light green , green group 143c . anthers .— average in size , and yellow - gold , yellow group 13a , both ventrally and dorsally in coloration . stamens .— approximately 20 to 27 and most frequently approximately 25 , the length is variable and commonly approximately 5 to 9 mm , and commonly equal in height to slightly shorter than the pistil . the filament color is white , white group 155b . pistils .— the surface of the ovary is pubescent and surface of the style is substantially glabrous . the length including the ovary is approximately 10 to 13 mm . the style is yellow - green , yellow - green group 145c , and the ovary is darker shiny green , yellow - green group 144b , in coloration . under normal environmental conditions only one pistil is present per flower . in seasons following very hot summers it is possible to observe a low number of double pistils ( e . g ., 2 to 3 percent ).

a new and distinct cultivar of prune tree is provided that resulted from a controlled breeding program . the new cultivar exhibits extreme precocity and a vigorous growth habit . flowers are formed in abundance . very large early - maturing fruit also is formed in abundance on a regular basis that is dark purple under a greyish and waxy epidermal bloom . the fruit is particularly well suited for the fresh prune market .

the following examples set forth preferred materials and procedures in accordance with the present invention , it is to be understood , however , that these examples are provided by way of illustration only , and nothing therein should be deemed a limitation upon the overall , scope of the invention . this example compares the relative yields of orf2 using methods of the present , invention with methods that are known in the prior art . four 1000 ml spinner flasks were each seeded with approximately 1 . 0 × 10 6 sf + cells / ml in 300 ml of insect serum free media , excell 420 ( jrh biosciences , inc ., lenexa , kans .). the master cell culture is identified as sf +( spodoptera frugiperda ) master cell stock , passage 19 , lot # n112 - 095w . the cells used to generate the sf + master cell stock were obtained from protein sciences corporation , inc . meriden , conn . the sf + cell line for this example was confined between passages 19 and 59 . other passages will work for purposes of the present invention , but in order to scale the process up for large scale production , at least 19 passages will probably be necessary and passages beyond 59 may have an effect on expression , although this was not investigated . in more detail , the initial sf + cell cultures from liquid nitrogen storage were grown in excell 420 media in suspension in sterile spinner flasks with constant agitation . the cultures were grown in 100 ml to 250 ml spinner flasks with 25 to 150 ml of excell 420 serum - free media . when the cells had multiplied to a cell density of 1 . 0 - 8 . 0 × 10 6 cells / ml , they were split to new vessels with a planting density of 0 . 5 - 1 . 5 × 10 6 cells / ml , subsequent expansion cultures were grown in spinner flasks up to 36 liters in size or in stainless steel bioreactors of up to 300 liters for a period of 2 - 7 days at 25 - 29 ° c . after seeding , the flasks were incubated at 27 ° c . for four hours . subsequently , each flask was seeded with a recombinant baculovirus containing the pcv2 orf2 gene ( seq id no : 4 ). the recombinant baculovirus containing the pcv2 orf2 gene was generated as follows : the pcv2 orf2 gene from a north american strain of pcv2 was pcr amplified to contain a 5 ′ kodak &# 39 ; s sequence ( seq id no : 1 ) and a 3 ′ ecor1 site ( seq id no : 2 ), cloned into the pgem - t - easy vector ( promega , madison . wi ). then , it was subsequently excised and subcloned into the transfer vector pvl1392 ( bd biosciences pharmingen , san diego , calif .). the subcloned portion is represented herein as seq id no : 7 . the pvl1392 plasmid containing the pcv2 orf2 gene was designated n47 - 064y and then co - transfected with baculogold ® ( bd biosciences pharmingen ) baculovirus dna into sf + insect cells ( protein sciences . meriden , conn .) to generate the recombinant baculovirus containing the pcv2 orf2 gene . the new construct is provided herein as seq id no : 8 . the recombinant baculovirus containing the pcv2 orf2 gene was plaque - purified and master seed virus ( msv ) was propagated on the sf + cell line , aliquotted , and stored at − 70 ° c . the msv was positively identified as pcv2 orf2 baculovirus by pcr - rflp using baculovirus specific primers . insect cells infected with pcv2 orf2 baculovirus to generate msv or working seed virus express pcv2 orf2 antigen as detected by polyclonal serum or monoclonal antibodies in an indirect fluorescent antibody assay . additionally , the identity of the pcv2 orf2 baculovirus was confirmed by n - terminal amino acid sequencing . the pcv2 orf2 baculovirus msv was also tested for purity in accordance with 9 c . f . r . 113 . 27 ( c ), 113 . 28 , and 113 . 55 . each recombinant baculovirus seeded into the spinner flasks had varying multiplicities of infection ( mois ). flask 1 was seeded with 7 . 52 ml of 0 . 088 moi seed ; flask 2 was seeded with 3 . 01 ml of 0 . 36 moi seed ; flask 3 was seeded with 1 . 5 ml of 0 . 18 moi seed ; and flask 4 was seeded with 0 . 75 ml of 0 . 09 moi seed . a schematic flow diagram illustrating the basic steps used to construct a pcv2 orf2 recombinant baculovirus is provided herein as fig1 . after being seeded with the baculovirus , the flasks were then incubated at 27 ± 2 ° c . for 7 days and were also agitated at 100 rpm during that time . the flasks used ventilated caps to allow for air flow . samples from each flask were taken every 24 hours for the next 7 days . after extraction , each sample was centrifuged , and both the pellet and the supernatant were separated and then microfiltered through a 0 . 45 - 1 . 0 μm pore size membrane . the resulting samples then had the amount of orf2 present within them quantified via an elisa assay . the elisa assay was conducted with capture antibody swine anti - pcv2 pab igg prot . g purified ( diluted 1 : 250 in pbs ) diluted to 1 : 6000 in 0 . 05m carbonate buffer ( ph 9 . 6 ). 100 μl of the antibody was then placed in the wells of the mictrotiter plate , sealed , and incubated overnight at 37 ° c . the plate was then washed three times with a wash solution which comprised 0 . 5 ml of tween 20 ( sigma , st . louis , mo . ), 100 ml of 10 × d - pbs ( gibco invitrogen , carlsbad , calif .) and 899 . 5 ml of distilled water . subsequently , 250 μl of a blocking solution ( 5 g carnation non - fat dry milk ( nestle , glendale , calif .) in 10 ml of d - pbs qs to 100 ml with distilled water ) was added to each of the wells . the next step was to wash the test , plate and then add pre - diluted antigen . the pre - diluted antigen was produced by adding 200 μl of diluent solution ( 0 . 5 ml tween 20 in 999 . 5 ml d - pbs ) to each of the wells on a dilution plate . the sample was then diluted at a 1 : 240 ratio and a 1 : 480 ratio , and 100 μl of each of these diluted samples was then added to one of the top wells on the dilution plate ( i . e . one top well received 100 μl of the 1 . 240 dilution and the other received 100 μl of the 1 : 480 dilution ). serial dilutions were then done for the remainder of the plate by removing 100 μl form each successive well and transferring it to the next well on the plate . each well was mixed prior to doing the next transfer . the test plate washing included washing the plate three times with the wash buffer . the plate was then sealed and incubated for an hour at 37 ° c . before being washed three more times with the wash buffer . the detection antibody used was monoclonal antibody to pcv orf2 . it was diluted to 1 : 300 in diluent solution , and 100 μl of the diluted detection antibody was then added to the wells . the plate was then sealed and incubated for an hour at 37 ° c . before being washed three times with the wash buffer . conjugate diluent was then prepared by adding normal rabbit serum ( jackson immunoresearch . west grove , pa .) to the diluent solution to 1 % concentration . conjugate antibody goat anti - mouse ( h + i )- hrp ( jackson immunoresearch ) was diluted in the conjugate diluent to 1 : 10 , 000 . 100 μl of the diluted conjugate antibody was then added to each of the wells . the plate was then sealed and incubated for 45 minutes at 37 ° c . before being washed three times with the wash buffer . 100 μl of substrate ( tmb peroxidase substrate , kirkgaard and perry laboratories ( kpl ), gaithersberg , md . ), mixed with an equal volume of peroxidase substrate b ( kpl ) was added to each of the wells . the plate was incubated at room temperature for 15 minutes . 100 μl of 1n hcl solution was then added to all of the wells to stop the reaction . the plate was then run through an elisa reader . the results of this assay are provided in table 1 below : these results indicate that when the incubation time is extended , expression of orf2 into the supernatant of the centrifuged cells and media is greater than expression in the pellet of the centrifuged cells and media . accordingly , allowing the orf2 expression to proceed for at least 5 days and recovering it in the supernate rather than allowing expression to proceed for less than 5 days and recovering orf2 from the cells , provides a great increase in orf2 yields , and a significant improvement over prior methods . this example provides data as to the efficacy of the invention claimed herein . a 1000 ml spinner flask was seeded with approximately 1 . 0 × 10 6 sf + cells / ml in 300 ml of excell 420 media . the flask was then incubated at 27 ° c . and agitated at 100 rpm . subsequently , the flask was seeded with 10 ml of pcv2 orf2 / bac p + 6 ( the recombinant baculovirus containing the pcv2 orf2 gene passaged 6 additional times in the sf9 insect cells ) virus seed with a 0 . 1 moi after 24 hours of incubation . the flask was then incubated at 27 ° c . for a total of 6 days . after incubation , the flask was then centrifuged and three samples of the resulting supernatant were harvested and inactivated . the supernatant was inactivated by bringing its temperature to 37 ± 2 ° c . to the first sample , a 0 . 4m solution of 2 - bromoethyleneamine hydrobromide which had been cyclized to 0 . 2m binary ethlylenimine ( bei ) in 0 . 3n naoh is added to the supernatant to give a final concentration of bei of 5 mm . to the second sample , 10 mm bei was added to the supernatant . to the third sample , no bei was added to the supernatant . the samples were then stirred continuously for 48 hrs . a 1 . 0 m sodium thiosulfate solution to give a final minimum concentration of 5 mm was added to neutralize any residual bei . the quantify of orf2 in each sample was then quantified using the same elisa assay procedure as described in example 1 . the results of this may be seen in table 2 below : this example demonstrates that neutralization with bei does not remove or degrade significant amounts of the recombinant pcv2 orf2 protein product . this is evidenced by the fact that there is no large loss of orf2 in the supernatant from the bei or elevated temperatures . those of skill in the art will recognize that the recovered orf2 is a stable protein product . this example demonstrates that the present invention is scalable from small scale production of recombinant pcv2 orf2 to large scale production of recombinant pcv2 orf2 . 5 . 0 × 10 5 cells / ml of sf + cells / ml in 7000 ml of excell 420 media was planted in a 20000 ml applikon bioreactor . the media and cells were then incubated at 27 ° c . and agitated at 100 rpm for the next 68 hours . at the 68 th hour , 41 . 3 ml of pcv2 orf2 baculovirus msv + 3 was added to 7000 ml of excell 420 medium . the resultant mixture was then added to the bioreactor . for the next seven days , the mixture was incubated at 27 ° c . and agitated at 100 rpm . samples from the bioreactor were extracted every 24 hours beginning at day 4 , post - infection , and each sample was centrifuged . the supernatant of the samples were preserved and the amount of orf2 was then quantified using sds - page densitometry . the results of this can be seen in table 3 below : this example tests the efficacy of seven pcv2 candidate vaccines and further defines efficacy parameters following exposure to a virulent strain of pcv2 . one hundred and eight ( 108 ) cesarean derived colostrum deprived ( cdcd ) piglets , 9 - 14 days of age , were randomly divided into 9 groups of equal size . table 4 sets forth the general study design for this example . seven of the groups ( groups 1 - 7 ) received doses of pcv2 orf2 poly peptide , one of the groups acted as a challenge control and received no pcv2 orf2 , and another group acted as the strict negative control group and also received no pcv2 orf2 . on day 0 , groups 1 through 7 were treated with assigned vaccines . piglets in group 7 were given a booster treatment on day 14 . piglets were observed for adverse events and injection site reactions following vaccination and on day 19 , piglets were moved to the second study site . at the second study site , groups 1 - 8 were group housed in one building while group 9 was housed in a separate building . all pigs received keyhole limpet hemocyanin ( klh )/ incomplete freund &# 39 ; s adjuvant ( icfa ) on days 21 and 27 and on day 24 , groups 1 - 8 were challenged with a virulent pcv2 . pre - and post - challenge , blood samples were collected for pcv2 serology . post - challenge , body weight data for determination of average daily weight gain ( adwg ), and clinical symptoms , as well as nasal swab samples to determine nasal shedding of pcv2 , were collected . on day 49 , all surviving pigs were necropsied , lungs were scored for lesions , and selected tissues were preserved in formalin for immunohistochemistry ( ihc ) testing at a later date . this was a partially blinded vaccination - challenge feasibility study conducted in cdcd pigs , 9 to 14 days of age on day 0 . to be included in the study . pcv2 ifa titers of sows were ≦ 1 : 1000 . additionally , the serologic status of sows were from a known prrs - negative herd . twenty - eight ( 28 ) sows were tested for pcv 2 serological status . fourteen ( 14 ) sows had a pcv2 titer of ≦ 1000 and were transferred to the first study site . one hundred ten ( 110 ) piglets were delivered by cesarean section surgeries and were available for this study on day − 4 . on day − 3 , 108 cdcd pigs at the first study site were weighed , identified with ear tags , blocked by weight and randomly assigned to 1 of 9 groups , as set forth above in table 4 . if any test animal meeting the inclusion criteria was enrolled in the study and was later excluded for any reason , the investigator and monitor consulted in order to determine the use of data collected from the animal in the final analysis . the date of which enrolled piglets were excluded and the reason for exclusion was documented . initially , no sows were excluded . a total of 108 of an available 110 pigs were randomly assigned to one of 9 groups on day − 3 . the two smallest pigs ( no . 17 and 19 ) were not assigned to a group and were available as extras , if needed . during the course of the study , several animals were removed . pig 82 ( group 9 ) on day − 1 , pig no . 56 ( group 6 ) on day 3 , pig no . 53 ( group 9 ) on day 4 , pig no . 28 ( group 8 ) on day 8 , pig no . 69 ( group 8 ) on day 7 , and pig no . 93 ( group 4 ) on day 9 , were each found dead prior to challenge . these six pigs were not included in the final study results . pig no 17 ( one of the extra pigs ) was assigned to group 9 . the remaining extra pig . no . 19 , was excluded from the study . the formulations given to each of the groups were as follows : group 1 was designed to administer 1 ml of viral orf2 ( vorf2 ) containing 16 μg orf2 / ml . this was done by mixing 10 . 24 ml of viral orf2 ( 256 μg / 25 μg / ml = 10 . 24 ml vorf2 ) with 3 . 2 ml of 0 . 5 % carbopol and 2 . 56 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 1 . 6 ml of formulation for group 1 . group 2 was designed to administer 1 ml of orf2 containing 8 μg vorf2 / ml . this was done by mixing 5 . 12 ml of vorf2 ( 128 μg / 25 μg / ml = 5 . 12 ml vorf2 ) with 3 . 2 ml of 0 . 5 % carbopol and 7 . 68 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 16 ml of formulation for group 2 . group 3 was designed to administer 1 ml of vorf2 containing 4 μg vorf2 / ml . this was done by mixing 2 . 56 ml of vorf2 ( 64 μg / 25 μg / ml = 2 . 56 ml vorf2 ) with 3 . 2 ml of 0 . 5 % carbopol and 10 . 24 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 16 ml of formulation for group 3 . group 4 was designed to administer 1 ml of recombinant orf2 ( rorf2 ) containing 16 μg rorf2 / ml . this was done by mixing 2 . 23 ml of rorf2 ( 5 . 12 μg / 230 μg / ml = 2 . 23 ml rorf2 ) with 6 . 4 ml of 0 . 5 % carbopol and 23 . 37 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 32 ml of formulation for group 4 . group 5 was designed to administer 0 . 1 ml of rorf2 containing 8 μg rorf2 / ml . this was done by mixing 1 . 11 ml of rorf2 ( 256 μg / 230 μg / ml = 1 . 11 ml rorf2 ) with 6 . 4 ml of 0 . 5 % carbopol and 24 . 49 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 32 ml of formulation for group 5 . group 6 was designed to administer 1 ml of rorf2 containing 8 μg rorf2 / ml . this was done by mixing 0 . 56 ml of rorf2 ( 128 μg / 230 μg / ml = 0 . 56 ml rorf2 ) with 6 . 4 ml of 0 . 5 % carbopol and 25 . 04 ml of phosphate buffered saline at a ph of 7 . 4 . this produced 32 ml of formulation for group 6 . group 7 was designed to administer 2 ml of pcv2 whole killed cell vaccine ( pcv2 kv ) containing the max pcv2 kv . this was done by mixing 56 ml of pcv2 kv with 14 ml of 0 . 5 % carbopol . this produced 70 ml of formulation for group 7 . finally group 8 was designed to administer klh at 0 . 5 μg / ml or 1 . 0 μg / ml per 2 ml dose . this was done by mixing 40 . 71 ml klh ( 7 . 0 μg protein / ml at 0 . 5 μg / ml = 570 ml ( 7 . 0 μg / ml )( x )=( 0 . 5 )( 570 ml )), 244 . 29 ml phosphate buffered saline at a ph of 7 . 4 , and 285 ml freunds adjuvant . table 5 describes the time frames for the key activities of this example . following completion of the in - life phase of the study , formalin fixed tissues were examined by immunohistochemistry ( ihc ) for detection of pcv2 antigen by a pathologist ; blood samples were evaluated for pcv2 serology , nasal swab samples were evaluated for pcv2 shedding , and average daily weight gain ( adwg ) was determined from day 24 to day 49 . animals were housed at the first study site in individual cages in five rooms from birth to approximately 11 days of age ( approximately day 0 of the study ). each room was identical in layout and consisted of stacked individual stainless steel cages with heated and filtered air supplied separately to each isolation unit . each room had separate heat and ventilation , thereby preventing cross - contamination of air between rooms . animals were housed in two different buildings at the second study site . group 9 ( the strict negative control group ) was housed separately in a converted finisher building and groups 3 - 8 were housed in converted nursery building . each group was housed in a separate pen ( 1 . 1 - 12 pigs per pen ) and each pen provided approximately 3 . 0 square feet per pig . each pen was on an elevated deck with plastic slatted floors . a pit below the pens served as a holding tank for excrement and waste . each building had its own separate heating and ventilation systems , with little likelihood of cross - contamination of air between buildings . at the first study site , piglets were fed a specially formulated milk ration from birth to approximately 3 weeks of age . all piglets were consuming solid , special mixed ration by day 19 ( approximately 4½ weeks of age ). at the second study site , all piglets were fed a custom non - medicated commercial mix ration appropriate for their age and weight , ad libitum . wafer at both study sites was also available ad libitum . all test pigs were treated with vitamin e on day − 2 , with iron injections on day − 1 and with naxcel ® ( 1 . 0 ml , 1m , in alternating hams ) on days 16 , 17 , 18 and 19 . in addition . pig no . 52 ( group 9 ) was treated with an iron injection on day 3 , pig 45 ( group 6 ) was treated with an iron injection on day 11 , pig no . 69 ( group 8 ) was treated with naxcel ® on day 6 , pig no . 74 ( group 3 ) was treated with dexamethazone and penicillin on day 14 , and pig no . 51 ( group 1 ) was treated with dexamethazone and penicillin on day 13 and with naxcel ® on day 14 for various health reasons . while at both study sites , pigs were under veterinary care . animal health examinations were conducted on day 0 and were recorded on the health examination record form . all animals were in good health and nutritional status before vaccination as determined by observation on day 0 . all test animals were observed to be in good health and nutritional status prior to challenge . carcasses and tissues were disposed of by rendering . final disposition of study animals was records on the animal disposition record . on day 0 , pigs assigned to groups 1 - 6 received 1 . 0 ml of pcv2 vaccines 1 - 6 , respectively , 1m in the left neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × ½ ″ needle . pigs assigned to group 7 received 2 . 0 ml of pcv2 vaccine no . 7 im in the left neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × ½ needle . on day 14 , pigs assigned to group 7 received 2 . 0 ml of pcv2 vaccine no . 7 im in the right neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × w needle . on day 21 all test pigs received 2 . 0 ml of klh / icfa im in the right ham region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . on day 27 all test pigs received 2 . 0 ml of klh / icfa in the left ham region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . on day 24 , pigs assigned to groups 1 - 8 received 1 . 0 ml of pcv2 isuvdl challenge material ( 5 . 11 logic tcid 50 / ml ) 1m in the left neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . an additional 1 . 0 ml of the same material was administered 1n to each pig ( 0 . 5 ml per nostril ) using a sterile 3 . 0 ml luer - lock syringe and nasal canula . test pigs were observed daily for overall health and adverse events on day − 4 and from day 0 to day 19 . observations were recorded on the clinical observation record . all test pigs were observed from day 0 to day 7 , and group 7 was further observed from day 14 to 21 , for injection site reactions . average daily weight gain was determined by weighing each pig on a calibrated scale on days − 3 , 24 and 49 , or on the day that a pig was found dead after challenge . body weights were recorded on the body weight form . day 3 body weights were utilized to block pigs prior to randomization . day 24 and day 49 weight data was utilized to determine the average daily weight gain ( adwg ) for each pig during these time points . for pigs that died after challenge and before day 49 , the adwg was adjusted to represent the adwg from day 24 to the day of death . in order to determine pcv2 serology , venous whole blood was collected from each piglet from the orbital venous sinus on days − 3 and 1 . 4 , for each piglet , blood was collected from the orbital venous sinus by inserting a sterile capillary tube into the medial canthus of one of the eyes and draining approximately 3 . 0 ml of whole blood into a 4 . 0 ml serum separator tube ( sst ). on days 24 , 31 , and 49 , venous whole blood from each pig was collected from the anterior vena cava using a sterile 18 g × 1½ ″ vacutainer needle ( becton dickinson and company , franklin lakes , n . j . ), a vacutainer needle holder and a 13 ml sst . blood collections at each time point were recorded on the sample collection record . blood in each sst was allowed to clot , each sst was then spun down and the serum harvested . harvested serum was transferred to a sterile snap tube and stored at − 70 ± 10 ° c . until tested at a later date . serum samples were tested for the presence of pcv2 antibodies by bivi - r & amp ; d personnel . pigs were observed once daily from day 20 to day 49 for clinical symptoms and clinical observations were recorded on the clinical observation record . to test for pcv2 nasal shedding , on days 24 , 25 , and then every other odd numbered study day up to and including day 49 , a sterile dacron swab was inserted intra nasally into either the left or right nostril of each pig ( one swab per pig ) as aseptically as possible , swished around for a few seconds and then removed . each swab was then placed into a single sterile snap - cap tube containing 1 . 0 ml of emem media with 2 % ifbs , 500 units / ml of penicillin , 500 μg / ml of streptomycin and 2 . 5 μg / ml of fungizone . the swab was broken off in the tube , and the snap tube was sealed and appropriately labeled with animal number , study number , date of collection , study day and “ nasal swab .” sealed snap tubes were stored at − 40 ± 10 ° c . until transported overnight on ice to bivi - st . joseph . nasal swab collections were recorded on the nasal swab sample collection form . bivi - r & amp ; d conducted quantitative virus isolation ( vi ) testing for pcv2 on nasal swab samples . the results were expressed in log 10 values . a value of 1 . 3 logs or less was considered negative and any value greater than 1 . 3 logs was considered positive . pigs that died ( nos . 28 , 52 , 56 , 69 , 82 , and 93 ) at the first study site were necropsied to the level necessary to determine a diagnosis . gross lesions were recorded and no tissues were retained from these pigs . at the second study site , pigs that died prior to day 49 ( nos . 45 , 23 , 58 , 35 ), pigs found dead on day 49 prior to euthanasia ( nos . 2 , 43 ) and pigs euthanized on day 49 were necropsied . any gross lesions were noted and the percentages of lung lobes with lesions were recorded on the necropsy report form . from each of the 103 pigs necropsied at the second study site , a tissue sample of tonsil , lung , heart , liver , mesenteric lymph node , kidney and inguinal lymph node was placed into a single container with buffered 10 % formalin ; while another tissue sample from the same aforementioned organs was placed into a whirl - pak ( m - tech diagnostics ltd ., thelwall , uk ) and each whirl - pak was placed on ice . each container was properly labeled . sample collections were recorded on the necropsy report form . afterwards , formalin - fixed tissue samples and a diagnostic request form were submitted for ihc testing . ihc testing was conducted in accordance with standard isu laboratory procedures for receiving samples , sample and slide preparation , and staining techniques . fresh tissues in whirl - paks were shipped with ice packs to the study monitor for storage (− 70 °± 10 ° c .) and possible future use . formalin - fixed tissues were examined by a pathologist for detection of pcv2 by ihc and scored using the following scoring system : 0 = none ; 1 = scant positive staining , few sites ; 2 = moderate positive staining , multiple sites ; and 3 = abundant positive staining , diffuse throughout the tissue . due to the fact that the pathologist could not positively differentiate inguinal ln from mesenteric ln , results for these tissues were simply labeled as lymph node and the score given the highest score for each of the two tissues per animal . results for this example are given below . it is noted that one pig from group 9 died before day 0 , and 5 more pigs died post - vaccination ( 1 pig from group 4 ; 1 pig from group 6 ; 2 pigs from group 8 ; and 1 pig from group 9 ). post - mortem examination indicated all six died due to underlying infections that were not associated with vaccination or pmws . additionally , no adverse events or injection site reactions were noted with any groups . average daily weight gain ( adwg ) results are presented below in table 6 , group 9 , the strict negative control group , had the highest adwg ( 1 . 06 ± 0 . 17 lbs / day ), followed by group 5 ( 0 . 94 ± 0 . 22 lbs / day ), which received one dose of 8 μg of rorf2 . group 3 , which received one dose of 4 μg of vorf2 , had the lowest adwg ( 0 . 49 ± 0 . 21 lbs / day ), followed by group 7 ( 0 . 50 ± 0 . 15 lbs / day ), which received 2 doses of killed vaccine pcv2 serology results are presented below in table 7 . all nine groups were seronegative for pcv2 on day − 3 . on day 14 , groups receiving vorf2 vaccines had the highest titers , which ranged from 187 . 5 to 529 . 2 . pigs receiving killed viral vaccine had the next highest titers , followed by the groups receiving rorf2 vaccines . groups 8 and 9 remained seronegative at this time . on day 24 and day 31 , pigs receiving vorf2 vaccines continued to demonstrate a strong serological response , followed closely by the group that received two doses of a killed viral vaccine . pigs receiving rorf2 vaccines were slower to respond serologically and groups 8 and 9 continued to remain seronegative . on day 49 , pigs receiving vorf2 vaccine , 2 doses of the killed viral vaccine and the lowest dose of rorf2 demonstrated the strongest serological responses . pigs receiving 16 μg and 8 μg of rorf2 vaccines had slightly higher ifa titers than challenge controls . group 9 on day 49 demonstrated a strong serological response . the results from the post - challenge clinical observations are presented below in table 8 . this summary of results includes observations for abnormal behavior , abnormal respiration , cough and diarrhea . table 9 includes the results from the summary of group overall incidence of clinical symptoms and table 10 includes results from the summary of group mortality rates post - challenge . the most common clinical symptom noted in this study was abnormal behavior , which was scored as mild to severe lethargy . pigs receiving the 2 lower doses of vorf2 , pigs receiving 16 μg of rorf2 and pigs receiving 2 doses of kv vaccine had incidence rates of ≧ 27 . 3 %. pigs receiving 8 μg of rorf2 and the strict negative control group had no abnormal behavior . none of the pigs in this study demonstrated any abnormal respiration . coughing was noted frequently in all groups ( 0 to 25 %), as was diarrhea ( 0 - 20 %). none of the clinical symptoms noted were pathognomic for pmws . the overall incidence of clinical symptoms varied between groups . groups receiving any of the vorf2 vaccines , the group receiving 16 μg of rorf2 , the group receiving 2 doses of kv vaccine and the challenge control group had the highest incidence of overall clinical symptoms (≧ 36 . 4 %). the strict negative control group , the group receiving 8 μg of rorf2 and the group receiving 4 μg of rorf2 had overall incidence rates of clinical symptoms of 0 %, 8 . 3 % and 9 . 1 %, respectively . overall mortality rates between groups varied as well . the group receiving 2 doses of kv vaccine had the highest mortality rate ( 16 . 7 %); while groups that received 4 μg of vorf2 , 16 μg of rorf2 , or 8 μg of rorf2 and the strict negative control group all had 0 % mortality rates . pcv2 nasal shedding results are presented below in table 11 . following challenge on day 24 , 1 pig in group 7 began shedding pcv2 on day 27 . none of the other groups experienced shedding until day 33 . the bulk of nasal shedding was noted from day 35 to day 45 . groups receiving any of the three vorf2 vaccines and groups receiving either 4 or 8 μg of rorf2 had the lowest incidence of nasal shedding of pcv2 (≦ 9 . 1 %). the challenge control group ( group 8 ) had the highest shedding rate ( 80 %), followed by the strict , negative control group ( group 9 ), which had an incidence rate of 63 . 6 %. the summary of group incidence of icterus . group incidence of gastric ulcers , group mean lung lesion scores , and group incidence of lung lesions are shown below in table 12 . six pigs died at the first test site during the post - vaccination phase of the study ( group 4 . n = 1 : group 6 , n = 1 ; group 8 , n = 2 ; group 9 , n = 2 ). four out of six pigs had fibrinous lesions in one or more body cavities , one pig ( group 6 ) had lesions consistent with clostridial disease , and one pig ( group 9 ) had no gross lesions . none of the pigs that died during the post - vaccination phased of the study had lesions consistent with pmws . pigs that died post - challenge and pigs euthanized on day 49 were necropsied . at necropsy , icterus and gastric ulcers were not present in any group . with regard to mean % lung lesions , group 9 had lowest mean % lung lesions ( 0 %), followed by group 1 with 0 . 40 ± 0 . 50 % and group 5 with 0 . 68 ± 1 . 15 %. groups 2 , 3 , 7 and 8 had the highest mean % lung lesions (≧ 7 . 27 %). each of these four groups contained one pig with % lung lesions ≧ 71 . 5 %, which skewed the results higher for these four groups . with the exception of group 9 with 0 % lung lesions noted , the remaining 8 groups had ≦ 36 % lung lesions . almost all lung lesions noted were described as red / purple and consolidated . the summary of group ihc positive incidence results are shown in table 13 . group 1 ( vorf2 - 16 μg ) and group 5 ( rorf2 - 8 μg ) had the lowest rate of ihc positive results ( 16 . 7 %), group 8 ( challenge controls ) and group 9 ( strict negative controls ) had the highest rate of ihc positive results , 90 % and 90 . 9 %, respectively . post - challenge , group 5 , which received one dose of 8 μg of rorf2 antigen , outperformed the other 6 vaccine groups . group 5 had the highest adwg ( 0 . 94 ± 0 . 22 lbs / day ), the lowest incidence of abnormal behavior ( 0 %), the second lowest incidence of cough ( 8 . 3 %), the lowest incidence of overall clinical symptoms ( 8 . 3 %), the lowest mortality rate ( 0 %), the lowest rate of nasal shedding of pcv2 ( 8 . 3 %), the second lowest rate for mean % lung lesions ( 0 . 68 ± 1 . 15 %) and the lowest incidence rate for positive tissues ( 16 . 7 %). groups receiving various levels of rorf2 antigen overall outperformed groups receiving various levels of vorf2 and the group receiving 2 doses of killed whole cell pcv2 vaccine performed the worst . tables 14 and 15 contain summaries of group post - challenge data . results of this study indicate that all further vaccine efforts should focus on a rorf2 vaccine . overall , nasal shedding of pcv2 was detected post - challenge and vaccination with a pcv2 vaccine resulted in a reduction of shedding , immunohistochemistry of selected lymphoid tissues also served as a good parameter for vaccine efficacy , whereas large differences in adwg , clinical symptoms , and gross lesions were not detected between groups . this study was complicated by the fact that extraneous pcv2 was introduced at some point during the study , as evidenced by nasal shedding of pcv2 , pcv2 seroconversion and positive ihc tissues in group 9 , the strict negative control group . seven pcv2 vaccines were evaluated in this study , which included three different dose levels of vorf2 antigen administered once on day 0 , three different dose levels of rorf2 antigen administered once on day 0 and one dose level of killed whole cell pcv2 vaccine administered on day 0 and day 14 . overall , group 5 , which received 1 dose of vaccine containing 8 μg of rorf2 antigen , had the best results . group 5 had the highest adwg , the lowest incidence of abnormal behavior , the lowest incidence of abnormal respiration , the second lowest incidence of cough , the lowest incidence of overall clinical symptoms , the lowest mortality rate , the lowest rate of nasal shedding of pcv2 , the second lowest rate for mean % lung lesions and the lowest incidence rate for positive ihc tissues . interestingly , group 4 , which received a higher dose of rorf2 antigen than group 5 , did not perform as well or better than group 5 . group 4 had a slightly lower adwg , a higher incidence of abnormal behavior , a higher incidence of overall clinical symptoms , a higher rate of nasal shedding of pcv2 , a higher mean % lung lesions , and a higher rate for positive ihc tissues than group 5 . statistical analysis , which may have indicated that the differences between these two groups were not statistically significant , was not conducted on these data , but there was an observed trend that group 4 did not perform as well as group 5 . post - vaccination , 6 pigs died at the first study site . four of the six pigs were from group 8 or group 9 , which received no vaccine . none of the six pigs demonstrated lesions consistent with pmws , no adverse events were reported and overall , all seven vaccines appeared to be safe when administered to pigs approximately 11 days of age . during the post - vaccination phase of the study , pigs receiving either of three dose levels of vorf2 vaccine or killed whole cell vaccine had the highest ifat levels , while group 5 had the lowest ifat levels just prior to challenge , of the vaccine groups . although not formally proven , the predominant route of transmission of pcv2 to young swine shortly after weaning is believed to be by oronasal direct contact and an efficacious vaccine that reduces nasal shedding of pcv2 in a production setting would help control the spread of infection . groups receiving one of three vorf2 antigen levels and the group receiving 8 μg of rorf2 had the lowest incidence rate of nasal shedding of pcv2 ( 8 . 3 %). expectedly , the challenge control group had the highest incidence rate of nasal shedding ( 80 %). gross lesions in pigs with pmws secondary to pcv2 infection typically consist of generalized lymphadenopathy in combination with one or a multiple of the following : ( 1 ) interstitial pneumonia with interlobular edema , ( 2 ) cutaneous pallor or icterus , ( 3 ) mottled atrophic livers , ( 4 ) gastric ulcers and ( 5 ) nephritis . at necropsy , icterus , hepatitis , nephritis , and gastric ulcers were not noted in any groups and lymphadenopathy was not specifically examined for . the mean % lung lesion scores varied between groups . the group receiving 16 μg of vorf2 antigen had the lowest mean % lung lesion score ( 0 . 40 ± 0 . 50 %), followed by the group that received 8 μg of rorf2 ( 0 . 68 ± 1 . 15 %). as expected , the challenge control group had the highest mean % lung lesion score ( 9 . 88 ± 29 . 2 %). in all four groups , the mean % lung lesion scores were elevated due to one pig in each of these groups that had very high lung lesion scores . most of the lung lesions were described as red / purple and consolidated . typically , lung lesions associated with pmws are described as tan and non - collapsible with interlobular edema . the lung lesions noted in this study were either not associated with pcv2 infection or a second pulmonary infectious agent may have been present . within the context of this study , the % lung lesion scores probably do not reflect a true measure of the amount of lung infection due to pcv2 . other researchers have demonstrated a direct correlation between the presence of pcv2 antigen , by ihc and histopathology . histopathology on select tissues was not conducted with this study . group 1 ( 16 μg of orf2 ) and group 5 ( 8 μg of rorf2 ) had the lowest incidence rate of pigs positive for pcv2 antigen ( 8 . 3 %), while group 9 ( the strict negative control group — 90 . 9 %) and group 8 ( the challenge control group — 90 . 0 %) had the highest incidence rates for pigs positive for pcv2 antigen . due to the non - subjective nature of this test , ihc results are probably one of the best parameters to judge vaccine efficacy on . thus , in one aspect of the present invention , the minimum portective dosage ( mpd ) of a 1 ml / l dose recombinant product with extracted pcv2 orf2 ( rorf2 ) antigen in the cdcd pig model in the face of a pcv2 challenge was determined . of the three groups that received varying levels of rorf2 antigen , group 5 ( 8 μg of rorf2 antigen ) clearly had the highest level of protection . group 5 either had the best results or was tied for the most favorable results with regard to all of the parameters examined . when group 5 was compared with the other six vaccine groups post - challenge , group 5 had the highest adwg ( 0 . 94 ± 0 . 22 lbs / day ), the lowest incidence of abnormal behavior ( 0 %), the second lowest incidence of cough ( 8 . 3 %), the lowest incidence of overall clinical symptoms ( 8 . 3 %), the lowest mortality rate ( 0 %), the lowest rate of nasal shedding of pcv2 ( 8 . 3 %), the second lowest rate for mean % lung lesions ( 0 . 68 ± 1 . 15 %) and the lowest incidence rate for positive ihc tissues ( 16 . 7 %). in another aspect of the present invention , the mpd of a 1 ml / l dose conventional product that is partially purified pcv2 orf2 ( vorf2 ) antigen in the cdcd pig model in the face of a pcv2 challenge was determined . of the three groups that received varying levels of vorf2 antigen . group 1 ( 16 μg of vorf2 ) had the highest level of protection . group 1 outperformed groups 2 and 3 with respect to adwg , mean % lung lesions , and ihc . groups 1 and 2 ( 8 μg of vorf2 antigen ) performed equally with respect to overall incidence of clinical symptoms , group 3 ( 4 μg of vorf2 antigen ) had the lowest mortality rate , and all three groups performed equally with respect to nasal shedding . overall , vorf vaccines did not perform as well as rorf vaccines . in yet another aspect of the present invention , the efficacy of a maximum dose of a 2 ml / 2 dose conventional killed pcv2 vaccine in the cdcd pig model in the face of a pcv2 challenge was determined . of the seven vaccines evaluated in this study , the killed whole cell pcv2 vaccine performed the worst . piglets receiving two doses of killed whole cell pcv2 vaccine had the lowest adwg , the second highest rate of abnormal behavior ( 58 . 3 %), the second highest overall incidence of clinical symptoms ( 58 . 3 %), the highest mortality rate ( 16 . 7 %), the second highest , incidence of nasal shedding ( 41 . 7 %), highest mean % lung lesions ( 9 . 88 ± 29 . 2 %), a high incidence of lung lesions noted ( 75 %) and a moderate ihc incidence rate in tissues ( 41 . 7 %). however , it was still effective at invoking an immune response . in still another aspect of the present invention , nasal shedding of pcv2 was assessed as an efficacy parameter and the previous pcv2 efficacy parameters from previous studies were reconfirmed . results from this study indicate that nasal shedding of pcv2 occurs following intra nasal challenge and that pcv2 vaccines reduce nasal shedding of pcv2 post - challenge . furthermore , results from this study and reports in the literature indicate that ihc should continue to be evaluated in future pcv2 vaccine trials as well . some additional conclusions arising from this study are that lymphadenopathy is one of the hallmarks of pmws . another one of the hallmarks of pmws is lymphoid depletion and multinucleated / giant histiocytes . additionally , no adverse events or injection site reactions were noted for any of the 7 pcv2 vaccines and all 7 pcv2 vaccines appeared to be safe when administered to young pigs . this example tests the efficacy of eight pcv2 candidate vaccines and reconfirms pcv2 challenge parameters from earlier challenge studies following exposure to a virulent strain of pcv2 . one hundred and fifty ( 150 ) cesarean derived colostrum deprived ( cdcd ) piglets , 6 - 16 days of age , were blocked by weight and randomly divided into 10 groups of equal size . table 16 sets forth the general study design for this example . the vaccine formulation given to each group was as follows . pcv2 vaccine no . 1 , administered at 1 × 2 ml dose to group 1 , was a high dose ( 16 μg / 2 ml dose ) of inactivated recombinant orf2 antigen adjuvanted with ims 1314 ( 16 μg rorf2 — ims 1314 ). pcv2 vaccine no . 2 , administered at 1 × 2 ml dose to group 2 , was a high dose ( 16 ug / 2 ml dose ) of a partially purified vido r - 1 generated pcv2 orf2 antigen adjuvanted with carbopol ( 16 ug vorf2 — carbopol ). pcv2 vaccine no . 3 , administered at 1 × 2 ml dose to group 3 , was a high dose ( 16 ug / 2 ml dose ) of inactivated recombinant orf2 antigen adjuvanted with carbopol ( 16 ug rorf2 — carbopol ). pcv2 vaccine no . 4 , administered at 1 × 1 ml dose to group 4 , was a high dose ( 16 ug / 1 ml dose ) of a partially purified vido r - 1 generated pcv2 orf2 antigen adjuvanted with carbopol ( 16 ug vorf2 — carbopol ). vaccine no . 5 , administered at 1 × 2 ml dose to group 5 , was a 4 ug / 2 ml dose of an inactivated recombinant orf2 antigen adjuvanted with carbopol ( 4 ug rorf2 — carbopol ). pcv2 vaccine no . 6 , administered at 1 × 2 ml dose to group 6 , was a 1 ug / 2 ml dose of an inactivated recombinant orf2 antigen adjuvanted with carbopol ( 1 ug rorf2 — carbopol ). pcv2 vaccine no . 7 , administered at 1 × 2 ml dose to group 7 , was a low dose ( 0 . 25 ug / 2 ml dose ) of inactivated recombinant orf2 antigen adjuvanted with carbopol ( 0 . 25 ug rorf2 — carbopol ). pcv2 vaccine no . 8 , administered at 1 × 2 ml dose to group 8 , was a high dose ( pre - inactivation titer & gt ; 8 . 0 log / 2 ml dose ) inactivated conventional killed vido r - 1 generated pcv2 struve antigen adjuvanted with carbopol (& gt ; 8 . 0 log kv — carbopol ). on day 0 , groups 1 - 8 were treated with their assigned vaccines . groups 1 - 3 and 5 - 8 received boosters of their respective vaccines again on day 14 . the effectiveness of a single dose of 16 μg of vorf2 - carbopol was tested on group 4 which did not receive a booster on day 14 . piglets were observed for adverse events and injection site reactions following both vaccinations . on day 21 the piglets were moved to a second study site where groups 1 - 9 were group housed in one building and group 10 was housed in a separate building . all pigs received keyhole limpet hemocyanin emulsified with incomplete freund &# 39 ; s adjuvant ( klh / icfa ) on days 22 and 28 . on day 25 , groups 1 - 9 were challenged with approximately 4 logs of virulent pcv2 virus . by day 46 , very few deaths had occurred in the challenge control group . in an attempt to immunostimulate the pigs and increase the virulence of the pcv2 challenge material , all groups were treated with ingelvac ® prrsv mlv ( porcine reproductive and respiratory vaccine , modified live virus ) on day 46 . pre - and post - challenge blood samples were collected for pcv2 serology . post - challenge , body weight data for determination of average daily weight gain ( adwg ) and observations of clinical signs were collected . on day 50 , all surviving pigs were necropsied , gross lesions were recorded , lungs were scored for pathology , and selected tissues were preserved in formalin for examination by immunohistochemistry ( ihc ) for detection of pcv2 antigen at a later date . this was a partially - blind vaccination - challenge feasibility study conducted in cdcd pigs , 6 to 16 days of age on day 0 . to be included in the study , pcv2 ifa titers of sows were ≦ 1 : 1000 . additionally , the serologic status of sows were from a known prrs - negative herd . sixteen ( 16 ) sows were tested for pcv2 serological status and all sixteen ( 16 ) had a pcv2 titer of ≦ 1000 and were transferred to the first study site . one hundred fifty ( 150 ) piglets were delivered by cesarean section surgeries and were available for this study on . day − 3 . on day − 3 , 150 cdcd pigs at the first study site were weighed , identified with ear tags , blocked by weight and randomly assigned to 1 of 10 groups , as set forth above in table 16 . blood samples were collected from all pigs . if any test animal meeting the inclusion criteria was enrolled in the study and was later excluded for any reason , the investigator and monitor consulted in order to determine the use of data collected from the animal in the final analysis . the date of which enrolled piglets were excluded and the reason for exclusion was documented . no sows meeting the inclusion criteria selected for the study and transported to the first study site were excluded . no piglets were excluded from the study , and no test animals were removed from the study prior to termination . table 17 describes the time frames for the key activities of this example . following completion of the in - life phase of the study , formalin fixed tissues were examined by immunohistochemistry ( ihc ) for detection of pcv2 antigen by a pathologist , blood samples were evaluated for pcv2 serology , and average daily weight gain ( adwg ) was determined from day 25 to day 50 . animals were housed at the first study site in individual cages in seven rooms from birth to approximately 11 days of age ( approximately day 0 of the study ). each room was identical in layout and consisted of stacked individual stainless steel cages with heated and filtered air supplied separately to each isolation unit . each room had separate heat and ventilation , thereby preventing cross - contamination of air between rooms . animals were housed in two different buildings at the second study site . group 10 ( the strict negative control group ) was housed separately in a converted nursery building and groups 1 - 9 were housed in a converted farrowing building . each group was housed in a separate pen ( 14 - 15 pigs per pen ) and each pen provided approximately 2 . 3 square feet per pig . groups 2 , 4 and 8 were penned in three adjacent pens on one side of the alleyway and groups 1 , 3 , 5 , 6 , 7 , and 9 were penned in six adjacent pens on the other side of the alleyway . the group separation was due to concern by the study monitor that vaccines administered to groups 2 , 4 , and 8 had not been fully inactivated . each pen was on an elevated deck with plastic slatted , floors . a pit below the pens served as a holding tank for excrement and waste . each building had its own separate heating and ventilation systems , with little likelihood of cross - contamination of air between buildings . at the first study site , piglets were fed a specially formulated milk ration from birth to approximately 3 weeks of age . all piglets were consuming solid , special mixed ration by day 21 ( approximately 4½ weeks of age ). at the second study site , all piglets were fed a custom non - medicated commercial mix ration appropriate for their age and weight , ad libitum . water at both study sites was also available ad libitum . all test pigs were treated with 1 . 0 ml of naxcel ®, 1m , in alternating hams on days 19 , 20 , and 21 . in addition . pig no . 11 ( group 1 ) was treated with 0 . 5 ml , of naxcel ® 1m on day 10 . pig no . 13 ( group 10 ) was treated with 1 ml of penicillin and 1 ml of predef ® 2 × on day 10 , pig no . 4 ( group 9 ) was treated with 1 . 0 ml of naxcel ® 1m on day 11 , and pigs 1 ( group 1 ), 4 and 11 were each treated with 1 . 0 ml of naxcel ® on day 14 for various health reasons . while at both study sites , pigs were under veterinary care . animal health examinations were conducted on day − 3 and were recorded on the health examination record form . all animals were in good health and nutritional status before vaccination as determined by observation on day 0 . all test animals were observed to be in good health and nutritional status prior to challenge . carcasses and tissues were disposed of by rendering . final disposition of study animals was recorded on the animal disposition record . on days 0 and 14 , pigs assigned to groups 1 - 3 and 5 - 8 received 2 . 0 ml of assigned pcv2 vaccines 1 - 4 , respectively , 1m in the right and left neck region , respectively , using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × w needle . pigs assigned to group 4 received 1 . 0 ml of pcv2 vaccine no . 2 , 1m in the right neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × ½ ″ needle on day 0 only . on day 22 all test pigs received 2 . 0 ml , of klh / icfa 1m in the left neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . on day 28 ail test pigs received 2 . 0 ml , of klh / icfa in the right ham region using a sterile 3 . 0 ml , luer - lock syringe and a sterile 20 g × 1 ″ needle . on day 25 , pigs assigned to groups 1 - 9 received 1 . 0 ml of pcv2 isuvdl challenge material ( 3 . 98 log 10 tcid 50 / ml ) 1m in the right neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . an additional 1 . 0 ml of the same material was administered 1n to each pig ( 0 . 5 ml per nostril ) using a sterile 3 . 0 ml luer - lock syringe and nasal canula . on day 46 , all test pigs received 2 . 0 ml ingelvac ® prrs mlv , 1m , in the right neck region using a sterile 3 . 0 ml luer - lock syringe and a sterile 20 g × 1 ″ needle . the prrsv mlv was administered in an attempt to increase virulence of the pcv2 challenge material . test pigs were observed daily for overall health and adverse events on day − 3 and from day 0 to day 21 . each of the pigs was scored for normal or abnormal behavior , respiration or cough . observations were recorded on the clinical observation record . all test pigs were observed from day 0 to day 7 , and group 7 was further observed from day 14 to 21 , for injection site reactions . average daily weight gain was determined by weighing each pig on a calibrated scale on days − 3 , 25 and 50 , or on the day that a pig was found dead after challenge . body weights were recorded on the body weight form . day − 3 body weights were utilized to block pigs prior to randomization . day 25 and day 50 weight data was utilized to determine the average daily weight gam ( adwg ) for each pig during these time points . for pigs that died after challenge and before day 50 , the adwg was adjusted to represent the adwg from day 25 to the day of death . in order to determine pcv2 serology , venous whole blood was collected from each piglet from the orbital venous sinus on days − 3 and 14 . for each piglet , blood was collected from the orbital venous sinus by inserting a sterile capillary tube into the medial canthus of one of the eyes and draining approximately 3 . 0 ml , of whole blood into a 4 . 0 ml . serum separator tube ( sst ). on days 25 , 32 , and 50 , venous whole blood from each pig was collected from the anterior vena cava using a sterile 20 g × 1½ ″ vacutainer ® needle ( becton dickinson and company , franklin lakes , n . j . ), a vaccutainer ® needle holder and a 13 ml sst . blood collections at each time point were recorded on the sample collection record . blood in each sst was allowed to clot , each sst was then spun down and the serum harvested . harvested serum was transferred to a sterile snap tube and stored at − 70 ± 10 ° c . until tested at a later date . serum samples were tested for the presence of pcv2 antibodies by bivi - r & amp ; d personnel . pigs were observed once daily from day 22 to day 50 for clinical symptoms and scored for normal or abnormal behavior , respiration or cough . clinical observations were recorded on the clinical observation record . pigs nos . 46 ( group 1 ) and 98 ( groups 9 ) died at the first study site . both of these deaths were categorized as bleeding deaths and necropsies were not conducted on these two pigs . at the second study site , pigs that died after challenge and prior to day 50 , and pigs euthanized on day 50 , were necropsied . any gross lesions were noted and the percentages of lung lobes with lesions were recorded on the necropsy report form . from each of the pigs necropsied at the second study site , a tissue sample of tonsil , lung , heart , and mesenteric lymph node was placed into a single container with buffered 10 % formalin : while another tissue sample from the same aforementioned organs was placed into a whirl - pak ® ( m - tech diagnostics ltd ., thelwall , uk ) and each whirl - pak ® was placed on ice . each container was properly labeled . sample collections were recorded on the necropsy report form . afterwards , formalin - fixed tissue samples and a diagnostic request form were submitted for ihc testing . ihc testing was conducted in accordance with standard laboratory procedures for receiving samples , sample and slide preparation , and staining techniques . fresh tissues in whirl - paks ® were shipped with ice packs to the study monitor for storage (− 70 °± 10 ° c .) and possible future use . formalin - fixed tissues were examined by a pathologist for detection of pcv2 by ihc and scored using the following scoring system : 0 = none ; 1 = scant positive staining , few sites ; 2 = moderate positive staining , multiple sites ; and 3 = abundant positive staining , diffuse throughout the tissue . for analytical purposes , a score of 0 was considered “ negative ,” and a score of greater than 0 was considered “ positive .” results for this example are given below . it is noted that pigs no . 46 and 98 died on days 14 and 25 respectively . these deaths were categorized as bleeding deaths . pig no . 11 ( group 1 ) was panting with rapid respiration on day 15 . otherwise , all pigs were normal for behavior , respiration and cough during this observation period and no systemic adverse events were noted with any groups . no injection site reactions were noted following vaccination on day 0 . following vaccination on day 14 , seven ( 7 ) out of fourteen ( 14 ) group 1 pigs ( 50 . 0 %) had swelling with a score of “ 2 ” on day 15 . four ( 4 ) out of fourteen ( 14 ) group 1 ( 28 . 6 %) still had a swelling of “ 2 ” on day 16 . none of the other groups experienced injection site reactions following either vaccination . average daily weight gain ( adwg ) results are presented below in table 18 . pigs no . 46 and 98 that died from bleeding were excluded from group results . group 4 , which received one dose of 16 ug vorf2 — carbopol had the highest adwg ( 1 . 16 ± 0 . 26 lbs / day ), followed by groups 1 , 2 , 3 , 5 , 6 , and 10 which had adwgs that ranged from 1 . 07 ± 0 . 23 lbs / day to 1 . 11 ± 0 . 26 lbs / day . group 9 had the lowest adwg ( 0 . 88 ± 0 . 29 lbs / day ), followed by groups 8 and 7 , which had adwgs of 0 . 93 ± 0 . 33 lbs / day and 0 . 99 ± 0 . 44 lbs / day , respectively . pvc2 serology results are presented below in table 19 . all ten ( 10 ) groups were seronegative for pcv2 on day − 3 . on day 14 , pcv2 titers remained low for all ten ( 10 ) groups ( range of 50 - 113 ). on day 25 , group 8 , which received the whole cell killed virus vaccine , had the highest pcv2 titer ( 4617 ), followed by group 2 , which received 16 ug vorf2 — carbopol , group 4 , which received as single dose of 16 ug vorf2 — carbopol , and group 3 , which received 16 ug rorf2 — carbopol which had titers of 2507 , 1920 and 1503 respectively . on day 32 ( one week post challenge ), titers for groups 1 - 6 and group 8 ranged from 2360 to 7619 ; while groups 7 ( 0 . 25 ug rorf2 — carbopol ), 9 ( challenge control ), and 10 ( strict negative control ) had titers of 382 , 129 and 78 respectively . on day 50 ( day of necropsy ), all ten ( 10 ) groups demonstrated high pcv2 titers (≧ 1257 ). on days 25 , 32 , and 50 , group 3 , which received two doses of 16 ug rorf2 - carbopol had higher antibody titers than group 1 , which received two doses of 16 ug rorf2 — ims 1314 . on days 25 , 32 and 50 , group 2 , which received two doses of 16 ug vorf2 had higher titers than group 4 , which received only one does of the same vaccine . groups 3 , 5 , 6 , 7 , which received decreasing levels of rorf2 — carbopol , of 16 , 4 , 1 , and 0 . 25 ug respectively , demonstrated correspondingly decreasing antibody titers on days 25 and 32 . the results from the post - challenge clinical observations are presented below . table includes observations for abnormal behavior , abnormal respiration , cough and diarrhea . table 21 includes the results from the summary of group overall incidence of clinical symptoms and table 22 includes results from the summary of group mortality rates post - challenge . the incidence of abnormal behavior , respiration and cough post - challenge were low in pigs receiving 16 ug rorf2 - ims 1314 ( group 1 ), 16 ug rorf2 - carbopol ( group 3 ), 1 ug rorf2 - carbopol ( group 6 ), 0 . 25 ug rorf2 - carbopol ( group 7 ), and in pigs in the challenge control group ( group 9 ). the incidence of abnormal behavior respiration and cough post - challenge was zero in pigs receiving 16 ug vorf2 - carbopol ( group 2 ), a single dose of 16 ug vorf2 - carbopol ( group 4 ), 4 ug rorf2 - carbopol ( group 5 ), & gt ; 8 log kv - carbopol ( group 8 ), and in pigs in the strict negative control group ( group 10 ). the overall incidence of clinical symptoms varied between groups . pigs receiving 16 ug vorf2 - carbopol ( group 2 ), a single dose of 16 ug vorf2 - carbopol ( group 4 ), and pigs in the strict negative control group ( group 10 ) had incidence rates of 0 %; pigs receiving 16 ug rorf2 - carbopol ( group 3 ), and 1 ug rorf2 - carbopol ( group 6 ) had incidence rates of 6 . 7 %; pigs receiving 16 ug rorf2 - ims 1314 ( group 1 ) had an overall incidence rate of 7 . 1 %; pigs receiving 4 ug rorf2 - carbopol ( group 5 ), 0 . 25 ug rorf2 - carbopol ( group 7 ), and & gt ; 8 log kv vaccine had incidence rates of 13 . 3 %; and pigs in the challenge control group ( group 9 ) had an incidence rate of 14 . 3 %. overall mortality rates between groups varied as well . group 8 , which received 2 doses of kv vaccine had the highest mortality rate of 20 . 0 %; followed by group 9 , the challenge control group , and group 7 , which received 0 . 25 ug rorf2 - carbopol and had mortality rates of 14 . 3 % and 13 . 3 % respectively . group 4 , which received one dose of 16 ug orf2 - carbopol had a 6 . 7 % mortality rate . all of the other groups , 1 , 2 , 3 , 5 , 6 , and 10 had a 0 % mortality rate . the summary of group mean percentage lung lesions and tentative diagnosis is given below in table 23 . group 9 , the challenge control group , had the highest percentage lung lesions with a mean of 10 . 81 ± 23 . 27 %, followed by group 7 , which received 0 . 25 ug rorf2 - carbopol and had a mean of 6 . 57 ± 24 . 74 %, group 5 , which received 4 ug rorf2 - carbopol and had a mean of 2 . 88 ± 8 . 88 %, and group 8 , which received the kv vaccine and had a mean of 2 . 01 ± 4 . 98 %. the remaining six ( 6 ) groups had lower mean percentage lung lesions that ranged from 0 . 11 ± 0 . 38 % to 0 . 90 ± 0 . 15 %. tentative diagnosis of pneumonia varied among the groups . group 3 , which received two doses of 16 ug rorf2 - carbopol had the lowest tentative diagnosis of pneumonia , with 13 . 3 %. group 9 , the challenge control group , had 50 % of the group tentatively diagnosed with pneumonia , followed by group 10 , the strict negative control group and group 2 , which received two doses of 16 ug vorf2 - carbopol , with 46 . 7 % of 40 % respectively , tentatively diagnosed with pneumonia . groups 1 , 2 , 3 , 5 , 9 , and 10 had 0 % of the group tentatively diagnosed as pcv2 infected ; while group 8 , which received two doses if kv vaccine , had the highest group rate of tentative diagnosis of pcv2 infection , which 20 %. group 7 , which received two doses of 0 . 25 ug rorf2 - carbopol , and group 4 , which received one dose of 16 ug vorf2 - carbopol had tentative group diagnoses of pcv2 infection in 13 . 3 % and 6 . 7 % of each group , respectively . gastric ulcers were only diagnosed in one pig in group 7 ( 6 . 7 %); while the other 9 groups remained free of gastric ulcers . the summary of group ihc positive incidence results are shown below in table 24 , group 1 ( 16 ug rorf2 — ims 1314 ) had the lowest group rate of ihc positive results with 0 % of the pigs positive for pcv2 , followed by group 2 ( 16 ug vorf2 — carbopol ) and group 4 ( single dose 16 ug vorf2 carbopol ), which had group ihc rates of 6 . 7 % and 13 . 3 % respectively . group 9 , the challenge control group , had the highest ihc positive incidence rate with 100 % of the pigs positive for pcv2 , followed by group 10 , the strict negative control group , and group 8 ( kv vaccine ), with 93 . 3 % and 80 % of the pigs positive for pcv2 , respectively . seven pcv2 vaccines were evaluated in this example , which included a high dose ( 16 μg ) of rorf2 antigen adjuvanted with ims 13 . 14 administered twice , a high dose ( 16 μg ) of vorf2 antigen adjuvanted with carbopol administered once to one group of pigs and twice to a second group of pigs , a high dose ( 16 μg ) of rorf2 antigen adjuvanted with carbopol administered twice , a 4 μg dose of rorf2 antigen adjuvanted with carbopol administered twice , a 1 μg dose of rorf2 antigen adjuvanted with carbopol administered twice , a low dose ( 0 . 25 μg ) of rorf2 antigen adjuvanted with carbopol administered twice , and a high dose (& gt ; 8 log ) of killed whole cell pcv2 vaccine adjuvanted with carbopol . overall , group 1 , which received two doses of 16 μg rorf2 - ims 1314 , performed slightly better than groups 2 through 7 , which received vaccines containing various levels of either vorf2 or rorf2 antigen adjuvanted with carbopol and much better than group 8 , which received two doses of killed whole cell pcv2 vaccine . group 1 had the third highest adwg ( 1 . 80 ± 0 . 30 lbs / day ), the lowest incidence of abnormal behavior ( 0 %), the lowest incidence of abnormal respiration ( 0 %), a low incidence of cough ( 7 . 1 %), a low incidence of overall clinical symptoms ( 7 . 1 %), was tied with three other groups for the lowest mortality rate ( 0 %), the second lowest rate for mean % lung lesions ( 0 . 15 ± 0 . 34 %), the second lowest rate for pneumonia ( 21 . 4 %) and the lowest incidence rate for positive ihc tissues ( 0 %). group 1 was , however , the only group in which injection site reactions were noted , which included 50 % of the vaccinates 1 day after the second vaccination . the other vaccines administered to groups 2 through 7 performed better than the killed vaccine and nearly as well as the vaccine administered to group 1 . group 8 , which received two doses of killed pcv2 vaccine adjuvanted with carbopol , had the worst set of results for any vaccine group . group 8 had the lowest adwg ( 0 . 93 ± 0 . 33 lbs / day ), the second highest rate of abnormal behavior ( 6 . 7 %), the highest rate of abnormal respiration ( 6 . 7 %), was tied with three other groups for the highest overall incidence rate of clinical symptoms ( 13 . 3 %), had the highest mortality rate of all groups ( 20 %), and had the highest positive ihc rate ( 80 %) of any vaccine group . there was concern that the killed whole cell pcv2 vaccine may not have been fully inactivated prior to administration to group 8 , which may explain this group &# 39 ; s poor results . unfortunately , definitive data was not available to confirm this concern . overall in the context of this example , a conventional killed pcv2 vaccine did not aid in the reduction of pcv2 associated disease . as previously mentioned , no adverse events were associated with the test vaccines with exception of the vaccine adjuvanted with ims 1314 . injection site reactions were noted in 50 . 0 % of the pigs 1 day after the second vaccination with the vaccine formulated with ims 1314 and in 28 . 6 % of the pigs 2 days after the second vaccination . no reactions were noted in any pigs receiving carbopol adjuvanted vaccines . any further studies that include pigs vaccinated with ims 1314 adjuvanted vaccines should continue to closely monitor pigs for injection site reactions . all pigs were sero - negative for pcv2 on day − 3 and only group 2 had a titer above 100 on day 14 . on day 25 ( day of challenge ). group 8 had the highest pcv2 antibody titer ( 4619 ), followed by group 2 ( 2507 ). with the exception of groups 7 , 9 and 10 , all groups demonstrated a strong antibody response by day 32 . by day 50 , all groups including groups 7 , 9 and 10 demonstrated a strong antibody response . one of the hallmarks of late stage pcv2 infection and subsequent pmws development is growth retardation in weaned pigs , and in severe cases , weight loss is noted . average daily weight gain of groups is a quantitative method of demonstrating growth retardation or weight loss . in this example , there was not a large difference in adwg between groups . group 8 had the lowest adwg of 0 . 88 ± 0 . 29 lbs / day , while group 4 had the highest adwg of 1 . 16 ± 0 . 26 lb / day . within the context of thus study there was not a sufficient difference between groups to base future vaccine efficacy on adwg . in addition to weight loss — dyspnea , lethargy , pallor of the skin and sometimes icterus are clinical symptoms associated with pmws . in this example , abnormal behavior and abnormal respiration and cough were noted infrequently for each group . as evidenced in this study , this challenge model and challenge strain do not result in overwhelming clinical symptoms and this is not a strong parameter on which to base vaccine efficacy . overall , mortality rates were not high in this example and the lack of a high mortality rate in the challenge control group limits this parameter on which to base vaccine efficacy . prior to day 46 , groups 4 and 7 each had one out of fifteen pigs die . group 9 had two out of fourteen pigs die and group 8 had three out of fifteen pigs die . due to the fact that group 9 , the challenge control group was not demonstrating pcv2 clinical symptoms and only two deaths had occurred in this group by day 46 , porcine respiratory and reproductive syndrome virus ( prrsv ) mlv vaccine was administered to all pigs on day 46 . earlier studies had utilized ingelvac ® prrs mlv as an immunostimulant to exasperate pcv 2 - associated pmws disease and mortality rates were higher in these earlier studies . two deaths occurred shortly after administering the prrs vaccine on day 46 — group 4 had one death on day 46 and group 7 had one death on day 47 — which were probably not associated with the administration of the prrs vaccine . by day 50 , group 8 , which received two doses of killed vaccine , had the highest mortality rate ( 20 %), followed by group 9 ( challenge control ) and group 7 ( 0 . 25 ug rorf2 — carbopol ), with mortality rates of 14 . 3 % and 13 . 3 % respectively . overall , administration of the prrs vaccine to the challenge model late in the post - challenge observation phase of this example did not significantly increase mortality rates . gross lesions in pigs with pmws secondary to pcv2 infection typically consist of generalized lymphadenopathy in combination with one or more of the following : ( 1 ) interstitial pneumonia with interlobular edema , ( 2 ) cutaneous pallor or icterus , ( 3 ) mottled atrophic livers , ( 4 ) gastric ulcers and ( 5 ) nephritis . at necropsy ( day 50 ), icterus , hepatitis , and nephritis were not noted in any groups . a gastric ulcer was noted in one group 7 pig , but lymphadenopathy was not specifically examined for . based on the presence of lesions that were consistent with pcv2 infection , three groups had at least one pig tentatively diagnosed with pcv2 ( pmws ). group 8 , which received two doses of killed vaccine , had 20 % tentatively diagnosed with pcv2 , while group 7 and group 4 had 13 . 3 % and 6 . 7 %, respectively , tentatively diagnosed with pcv2 . the mean % lung lesion scores varied between groups at necropsy . groups 1 , 2 , 3 , 4 , 6 and 10 had low % lung lesion scores that ranged from 0 . 11 ± 0 . 38 % to 0 . 90 ± 0 . 15 %. as expected , group 9 , the challenge control group , had the highest mean % lung lesion score ( 10 . 81 ± 23 . 27 %). in four groups , the mean % lung lesion scores were elevated due to one to three pigs in each of these groups having very high lung lesion scores . the lung lesions were red / purple and consolidated . typically , lung lesions associated with pmws are described as tan , non - collapsible with interlobular edema . the lung lesions noted in this study were either not associated with pcv2 infection or a second pulmonary infectious agent may have been present . within the context of this study , the % lung lesion scores probably do not reflect a true measure of the amount of lung infection due to pcv2 . likewise , tentative diagnosis of pneumonia may have been over - utilized as well . any pigs with lung lesions , some as small as 0 . 10 % were listed with a tentative diagnosis of pneumonia . in this example , there was no sufficient difference between groups with respect to gross lesions and % lung lesions on which to base vaccine efficacy . ihc results showed the largest differences between groups . group 1 ( 16 μg rorf2 — ims 13 . 14 ) had the lowest positive ihc results for pcv2 antigen ( 0 %); while groups 9 and had the highest positive ihc results with incidence rates of 100 % and 93 . 3 % respectively . groups 3 , 5 , 6 and 7 , which received 16 , 4 , 1 or 0 . 25 μg of rorf2 antigen , respectively , adjuvanted with carbopol , had ihc positive rates of 20 %, 20 %, 40 % and 46 . 7 %, respectively . group 2 , which received two doses of 16 μg vorf2 adjuvanted with carbopol had an ihc positive rate of 6 . 7 %, while group 4 which received only one dose of the same vaccine , had an ihc positive rate of 13 . 3 %. due to the objective nature of this test and the fact that ihc results correlated with expected results , ihc testing is probably one of the best parameters on which to base vaccine efficacy . thus in one aspect of the present invention , the minimum protective dosage ( mpd ) of pcv2 rorf2 antigen adjuvanted with carbopol in the cdcd pig model in the face of a pcv2 challenge is determined groups 3 , 5 , 6 and 7 each received two doses of rorf2 antigen adjuvanted with carbopol , but the level of rorf2 antigen varied for each group . groups 3 , 5 , 6 and 7 each received 16 , 4 , 1 or 0 . 25 μg of rorf2 antigen respectively . in general , decreasing the level of rorf2 antigen decreased pcv2 antibody titers , and increased the mortality rate , mean % lung lesions and the incidence of ihc positive tissues . of the lour groups receiving varying levels of rorf2 — carbopol , groups 3 and 5 , which received two doses of 16 or 4 μg of rorf2 antigen , respectively , each had an ihc positive rate of only 20 %, and each had similar antibody titers . overall , based on ihc positive results , the minimum protective dosage of rorf2 antigen administered twice is approximately 4 μg . in another aspect of the present invention , the antigenicity of recombinant ( rorf2 ) and vido r - 1 ( vorf2 ) pcv2 antigens were assessed . group 2 received two doses of 16 μg vorf2 and group 3 received two doses of 16 μg rorf2 , both vaccines were adjuvanted with carbopol . both vaccines were found to be safe and both had 0 % mortality rate . group 2 had a pcv2 antibody titer of 2507 on day 25 , while group 3 had a pcv2 antibody titer of 1503 . group 3 had a lower mean % lung lesion score than group 2 ( 0 . 11 ± 0 . 38 % vs . 0 . 90 ± 0 . 15 %), but group 2 had a lower ihc positive incidence rate that group 3 ( 6 . 7 % vs . 20 %). overall , both vaccines had similar antigenicity , but vorf2 was associated with slightly better ihc results . in yet another aspect , of the present invention , the suitability of two different adjuvants ( carbopol and ims 1314 ) was determined . groups 1 and 3 both received two doses of vaccine containing 16 ug of rorf2 antigen , but group 1 received the antigen adjuvanted with ims 1314 while group 3 received the antigen adjuvanted with carbopol . both groups had essentially the same adwg , essentially the same incidence of clinical signs post - challenge , the same mortality rate , and essentially the same mean % lung lesions ; but group 1 had an ihc positive rate of 0 % while group 3 had an ihc positive rate of 20 %. however , group 3 , which received the vaccine adjuvanted with carbopol had higher ifat pcv2 titers on days 25 , 32 and 50 than group 1 , which received the vaccine adjuvanted with ims 1314 . overall , although the pcv2 vaccine adjuvanted with ims 1314 did provide better ihc results , it did not provide overwhelmingly better protection from pcv2 infection and did induce injection site reaction . whereas the pcv2 vaccine adjuvanted with carbopol performed neatly as well as the ims 1314 adjuvanted vaccine , but was not associated with any adverse events . in still another aspect of the present invention , the feasibility of pcv2 orf2 as a 1 ml , 1 dose product was determined . groups 2 and 4 both received 16 μg of vorf2 vaccine adjuvanted with carbopol on day 0 , but group 2 received a second dose on day 14 . group 4 had a slightly higher adwg and a lower mean % lung lesions than group 2 , but group 2 had higher ifat pcv2 titers on day 25 , 32 and 50 , and a slightly lower incidence rate of ihc positive tissues . all other results for these two groups were similar . overall , one dose of vorf2 adjuvanted with carbopol performed similar to two doses of the same vaccine .

an improved method for recovering the protein expressed by open reading frame 2 from porcine circovirus type 2 is provided . also provided is recombinant pcv2 orf2 protein , and immunogenic compositions comprising pcv2 orf2 protein . moreover , multivalent combination vaccines are provided which include an immunological agent effective for reducing the incidence of or lessening the severity of pcv2 infection , preferably pcv2 orf2 protein , or an immunogenic composition comprising pcv2 orf2 protein , and at least one immunogenic active component of another disease - causing organism in swine .

the present art is normally intended for use with human patients , as well as various veterinary applications . for simplicity , this combined human or animal use will be referred to as use in mammals , although of course such devices could also be used in appropriate non - mammal animals such as birds , reptiles , and amphibians , etc ., as appropriate . it should also be understood that although the examples of cutting unwanted plaque deposits in arteries are used throughout this disclosure , the actual invention may be used for a broader variety of applications , including removing tumors , getting biopsies , etc . in arteries , veins , and any other tubular or roughly tubular body lumen . for brevity , non - proximally driven rotating cutter catheters will usually be referred to in the specification as distal driven designs . however it should be understood that wherever appropriate , alternative non - proximally driven designs such as circumference driven designs are also included in this general description . nomenclature : the handle end of the catheter is the proximal location , and the nose cone tip of the catheter is the distal location . fig1 shows an overview of the device . the device typically consists of an operator handle ( 101 ) which remains outside the body . the handle may optionally contain a battery , and a motor ( 102 ) which may provides torque for a rotary cutter , and additionally one or more optional control switches ( 103 ). the catheter also has a long narrow tube ( shaft ) ( 104 ), and the cutting atherectomy head ( 105 ). the catheter tube or shaft ( 104 ) will typically consist of a flexible tube , which is often hollow and capable of passing a guide wire , as well as optionally other materials such as drugs and contrast materials , control wires , drive shafts , sensors , sensor fibers or wires , ultrasonic signals , and the like . in some embodiments , the hollow tube may contain a shaft or hollow shaft capable of transmitting torque from a motor mounted in the handle ( 102 ) to a rotary cutter ( 106 ) mounted in the atherectomy head . this rotary cutter ( 106 ) will usually be exposed to the outside environment through a window ( 107 ). the relative positions of the rotary cutter ( 106 ) and the window ( 107 ) may optionally be controlled by the operator , and optionally the cutter may be moved relative to the window edge to open or close the window ( exposing or hiding the circular cutter ) under operator control . torque may be communicated to the rotary cutter ( 106 ) by a variety of means so long as these means to not obscure either the window or the hollow space in the tube on the side of the catheter proximal to the window . some of these torque ( rotary motion ) imparting means include indirect , off - axis , mechanical gearing or other means ( 108 ). in other embodiments , the catheter tube ( 104 ) may transmit electrical power , pressure , or chemicals capable of driving an electric motor , turbine , or chemical motor which can be mounted in the atherectomy head . the head will also usually contain a flexible or moveable nose cone region or nose region ( 109 ), which in some embodiments may be connected to the rigid body of the head by one or more hinge pins or other means . this flexible nose - cone region will be capable of being deformed by the operator from a straight to a bent position so that the nose , by pressing against one wall of a body lumen , will generate an opposite force that will tend to move the cutter ( 106 ) and window ( 107 ) against an opposite wall of a body lumen , thus enabling the cutter to cut material from selected zones of a body lumen under operator control . the catheter &# 39 ; s nose ( 109 ) usually has a tapered or conical a traumatic design intended to allow the catheter head to easily migrate through arteries . it may be composed of softer materials , and may additionally have an internal coiled spring or other means to allow the tip to bend somewhat as needed to migrate through torturous arteries and other body lumen structures . fig2 a shows a close - up of the cutting atherectomy head ( 105 ). the head will typically consist of a hollow body ( 201 ) connected to the catheter tube ( 104 ), and a tapered nose , ( 109 ) usually connected to the front ( distal portion ) of the hollow body by at least one hinge ( 202 ). the head ( 105 ) will additionally consist of at least a window ( 107 ) and rotating cutting wheel ( 106 ). the unit may also optionally have holes or ports ( 203 ), ( 204 ), ( 205 ) and appropriate inner hollow spaces for accommodating an optional guide wire . this optional guide wire helps the operator thread the catheter head through torturous arteries or other body lumens , and will be discussed in more detail in fig4 . as previously discussed , prior art atherectomy catheter designs taught proximally driven rotating cutting wheel designs . that is , the rotating wheel would ( 106 ) would under previous art have been directly coupled to a drive shaft coming from catheter tube ( 104 ) by a coupling mechanism aligned with the axis of wheel ( 106 ). the prior art proximal - drive teaching had certain advantages . it was compatible with simple and robust designs , and also minimized the cross - section ( width ) of the catheter head , which was again desirable because this helped the head migrate through torturous artery channels . the prior art proximal drive design also allowed large amounts of torque to be communicated through the drive shaft to the cutting wheel by rotation , and also allowed the relative angle of the cutting wheel to be adjusted in the catheter head by transverse motion of the rotating shaft relative to the outer catheter sheath . thus an operator could , by transverse motion of the catheter &# 39 ; s inner rotating shaft , both communicate rotation to the cutting head , and also adjust the cutting head &# 39 ; s relative orientation to catheter head windows ( opening and closing the window , for example ) or alternatively , in fixed window designs , adjust the angle of the cutting head or control to what extent the cutting head protrudes out through a catheter window . however , as previously discussed , the prior art proximal design had one big drawback . the drawback was that proximal drive rotary shaft and coupling mechanism occupied essentially all of the hollow space ( 206 ) in the inside of the catheter head ( i . e . proximal to the window ( 107 ) and cutter ( 106 ). as a result , in prior art designs , the only space that was available to store cutter shavings ( typically plaque shavings ) was in the hollow nosecone ( 109 ). unfortunately this hollow nosecone , which needed to be tapered in order to pass easily through arteries , typically had very limited internal volume and storage capacity . examples of such proximally driven cutters that store plaque shavings in the distal side in a conical nose include the previously discussed silverhawk device . as previously discussed , this prior art device , although very functional , filled up quickly with shavings . when this happened , the device had to be stopped , removed from the body , the contents of the nose removed , and then reinserted into the body and threaded to the correct region again . as previously discussed , this was undesirable because it extended the length of procedures , and was burdensome for the physician and patient . as previously discussed , by departing from the mechanically simpler proximally driven designs of prior art , and instead moving to a mechanically more complex non - proximally driven design ( such as a distally driven or circumference driven design ), the substantially larger space ( 206 ) on the proximal side of the cutter wheel ( 106 ) can now be opened up and used to store plaque shavings . although due to the higher complexity , previous designs taught away from such configurations , this more complex design is justified by the subsequent savings in catheter cleaning time and effort . whereas earlier designs , due to limited nosecone plaque storage space ( 109 ), could potentially waste hours of physician and patient times through tedious multiple removal and cleaning steps , these wasted hours can now be reduced or eliminated . the additional time can be used to do a more complete job of plaque removal as needed . given the extremely small diameter available to catheters , however , this alternative design poses many challenges . either the rotating cutting wheel needs to be coupled to its rotational power source by an indirect linkage , or alternatively the cutting wheel needs to be powered from the distal end . various types of indirect linkage are possible , and the present invention is not intended to be limited to any one means . in one embodiment of the invention , the mechanism may involve indirectly coup ling the cutting wheel ( 106 ) to the torque or rotation transmitting catheter drive shaft from the catheter tube ( 104 ) by an indirect gearing means so that torque is transmitted from the drive shaft to the outer diameter of the cutting wheel from the distal direction . in one example , a rotating drive shaft from the flexible catheter tube ( 104 ) turns a first axial aligned gear ( 210 ) which , through one or more transfer gears ( 211 ), transfers power to an off - axial drive shaft ( 212 ). this off - axial drive shaft ( 212 ), typically will be connected closely to the main body of the catheter head ( 201 ) by a coupling mechanism ( not shown ) that allows the drive shaft to rotate . off - axial drive shaft ( 212 ) then transfers power to the rotating cutter ( 106 ) by a second gearing mechanism ( 213 ). many other mechanisms are also possible , and these are discussed in more detail in fig5 . a second advantage of the present invention &# 39 ; s distal side driven design over the earlier proximal driven art is that the distal driven design allows the cutter wheel ( 106 ) to be mounted on a carriage mechanism ( not shown ) so that it can also be used to open and close the window ( 107 ) as directed by the operator . this can allow the cutter wheel to be gradually closed by the operator , so as to allow simultaneously shearing off and trapping any dangling plaque that still may be attached to the side of an artery wall . as per the earlier silverhawk catheter designs , usually , the angle of the present art catheter &# 39 ; s nose ( 109 ), relative to the rest of the catheter head body ( 201 ), will be under the control of the operator so as to act to press the cutting wheel against the target plaque with the desired degree of pressure . as per the earlier silverhawk catheter design , plaque cutting can be facilitated by deflecting the cutting wheel ( 106 ) so that it protrudes slightly through the window ( 107 ). this way the exposed tip of the cutting wheel may freely shave away stiff regions of exposed plaque that might not otherwise bend to extend inside the catheter window . this deflection may be achieved by a cam mechanism ( not shown ). cam mechanisms of this type were previously taught by applications ser . nos . 10 / 896 , 741 ; 10 / 288 , 559 ; 10 / 027 , 418 , the contents of which are incorporated herein by reference . the rotating cutting wheel may have sharp edges composed of tungsten carbide and the like . in other configurations , a wheel need not be used , and instead an alternate cutting device such as laser , radio frequency electrodes , ultrasonic vibrating knives , may be used . in still other configurations , a cutting wheel can have its cutting effectiveness enhanced by coupling its rotary cutting action with laser , radio frequency electrodes , ultrasonic vibration , and the like as needed . device dimensions : typically the catheter cutting head ( 201 ) will have a diameter between about 1 to 2 . 2 millimeters . the cutting window ( 107 ) will typically have a length of about 1 . 2 to 2 . 5 millimeters . in embodiments where the cutting wheel contains a cam or other orientation control mechanism that allows the wheel to extend slightly outside the window , the wheel orientation control mechanism may allow the wheel to at least temporarily be locked into a position that allows the cutting outer edge of the wheel to extend about 0 . 025 to 0 . 64 mm outside the cutting window . this allows the operator to move the catheter head along the target region of plaque , and shave off a long thin portion of this plaque while doing so . the cutting wheel ( 106 ) will typically have a diameter of about 1 . 14 mm , and may have a straight edge , a beveled edge ( which allows removal of plaque without damaging the underlying artery lumen ), or a fluted edge depending upon the needs of the specific application . usually the cutting wheel will be mounted on a shuttle or cam mechanism to allow the operator to adjust the protrusion of the wheel from the window , or alternatively the angle of the wheel or even the location of the wheel relative to the window opening ( causing the window to be open , partially closed , or fully closed by the wheel ). the cutting wheel will typically rotate at speeds appreciably faster than 100 rotations per minute ( rpm ), preferably about 8 , 000 rotations per minute ( rpm ). the cutting edge of the blades may be optionally hardened by an appropriate coating , such as me - 92 , tungsten carbide , or other suitable materials as taught by u . s . pat . nos . 4 , 771 , 774 ; 5 , 242 , 460 ; 5 , 312 , 425 ; 5 , 431 , 673 ; and 5 , 674 , 232 , the contents of which are incorporated herein by reference . as previously discussed , the action of blade can be facilitated by ultrasonic vibration , laser cutting , radio frequency electrodes , and the like . if this option is elected , appropriate mechanisms ( i . e . a piezoelectric ultrasonic vibrator , laser diode or optical fiber , electrodes , etc .) may also be provided in the catheter head to drive the blade as needed . if the action of the ultrasonic , laser , or electrode cutter is sufficiently robust enough as to make it a spinning blade unnecessary , then the blade may either not be spun up , or the blade rotary mechanism may be omitted , or a non - rotating blade may be used . in many embodiments , it will be useful to allow the location and orientation of the catheter head ( 201 ), nose ( 109 ), and cutting window / wheel region ( 106 / 107 ) to be identified by x - ray fluoroscopy by constructing these regions out of suitable combinations of translucent and radio opaque materials , thus , for example , enabling the region distal to the cutting head to be distinguished from the region proximal to the cutting head . in addition to fluoroscopy localization , other modalities , such as light ( optical ) and sonic ( ultrasonic ) localization methods may also be used . here orientation may be facilitated by running a fiber optic strand through the catheter ( 104 ) ( not shown ) to an appropriate location on the catheter head , and determining the location and orientation of the head by optical means . alternatively an ultrasonic transducer or pickup may be incorporated into the catheter head . typically the flexible outer catheter tube ( 104 ) between the handle ( 101 ) and the head ( 105 ) will have a length between 50 cm and 200 cm , a diameter between 1 french ( 0 . 33 mm ) and 12 french ( 4 mm ), and will usually be between 3 french ( 4 mm ) and 9 french ( 3 mm ) in diameter . the catheter body will often be made from extruded organic polymers such as polyvinylchloride , polyurethane , polyester , polytetrafluoroethylene ( ptfe ), silicon rubber , or similar materials . the catheter body may be reinforced as needed with wires , coils , or filaments as needed to give the body additional strength and to control rigidity and pushabiliy . portions of the catheter head ( 105 ) ( distal region of the catheter ) will often be rigid or partially rigid , and can be made from materials such as metals , hard plastics , composite materials , niti steel ( optionally coated with titanium nitride , tantalum , me - 92 ® or diamonds . usually stainless steel or platinum / iridium will be used . the length of the middle portion of the catheter head may often vary between about 5 to 35 mm ( 201 ), and will usually be between about 10 to 25 mm , however alternative lengths ( longer or shorter ) may also be used . as previously discussed , the extreme distal end of the catheter head ( the nose ) ( 109 ) will usually be made to be both flexible and a traumatic so as to allow the catheter to be threaded through arteries , veins , or other body lumens with maximum ease and minimum trauma . because , in this design , the nose is no longer used to store plaque , this nose design may be optimized to accommodate the distal drive mechanism and also optimized to allow easy passage of the catheter through arteries . in some cases , the distal tip will have an inner coil construction to maximize flexibility . the distance between the rigid part of the catheter head and the distal end tip of the flexible catheter nose will typically be between 10 and 30 mm , but may vary as needs dictate . fig2 b shows the catheter head with the catheter nose cone ( 109 ) in the angled , drooped or bent configuration . typically this nose angle will be adjustable by the operator , either through a cam mechanism ( not shown ) coupled through the catheter tube ( 104 ) to the operator handle ( 101 ), or through selection of materials with appropriate rigidity / elasticity and bendability so that the operator may adjust the nose angle to an appropriate level by pulling or pushing on the catheter handle ( 101 ) and tube ( 104 ). fig2 b shows that in this configuration , nose cone ( 109 ) is bent relative to body ( 201 ). this bending is a simple way to effectively increase the cross sectional area of the catheter , and is used to force the cutting edge of the catheter against the appropriate target zone . in the confines of a narrow body lumen such as an artery , nose cone ( 109 ) is deflected until it contacts a body lumen wall ( i . e . the opposite wall of the artery ). this pushes ( or “ urges ”) cutting window ( 107 ) and cutter ( 106 ) in the opposite direction . if appropriately directed , this will push , force , or urge the cutter against the appropriate target zone ( usually a region of the artery occluded or partially occluded with plaque ). once the cutter is in proper position , with the correct amount of “ force ” or “ push ” dialed in by the angle of the nose deflection , the catheter can then be moved by the operator , shaving away unwanted plaque material . fig3 shows a diagram of the catheter head of the present invention cutting plaque ( 301 ) from an artery wall ( 302 ). in this configuration , the catheter &# 39 ; s nose ( 109 ) has been deflected at enough of an angle to contact the opposite artery wall ( 303 ). the cutting wheel ( 106 ) has been forced up against the plaque ( 301 ) and has already cut away a section of this plaque ( 304 ). a dangling region of plaque ( 305 ) is entering the hollow catheter body ( 206 ) through the window ( 107 ). here , the operator controls the speed and extent of plaque removal by using control ( 101 ) to partially retract the catheter head over the plaque by pulling on catheter tube ( 104 ), while wheel ( 106 ) is spinning and exposed to the plaque through window ( 107 ). excess plaque ( 306 ) is stored in the hollow region of the catheter head ( 206 ). the drawing is not to scale , in actuality ; the available storage space ( 206 ) will typically be substantially larger than the storage space of nosecone ( 109 ). often , it may be advantageous to use a guidewire as a type of monorail to quickly direct catheters to the correct target zones . usually such guidewires will have diameters between about 0 . 010 ″ and 0 . 032 ″, usually around 0 . 014 ″. when this option is desired , the catheter may be designed to be compatible with guidewire use . fig4 shows one possible way in which the catheter of the present invention may work with a guide wire . in this example , guidewire ( 401 ) is threaded up through hollow catheter tube ( 104 ). in order to allow the head &# 39 ; s cutting mechanism to operate freely and without risk of entanglement from a guide wire , it may be useful to have the guide wire exit from the main catheter tube through a first proximal exit port on the head ( 203 ), thus skipping the storage area ( 206 ) window ( 107 ) and plaque cutting ( 106 ) regions of the head . in this configuration , the guide wire would then typically reenter the nose cone ( 109 ) at opening ( 204 ), travel through the nose end of the head for a short distance , and then finally exit the head again through a third exit port or opening ( 205 ), often located near the tip of the catheter &# 39 ; s nose ( 109 ) at the extreme distal end of the catheter in some embodiments , it may also be desirable to protect the portion or portions of the guidewire that is briefly external to the catheter head ( 402 ) by a guidewire tube / lumen or a telescoping guidewire tube / lumen ( 403 ). such guidewire protection lumens may have a length between about 2 and 14 cm , or even longer as needed to accommodate longer heads with higher plaque storage volumes . this telescoping guidewire lumen protects both the guidewire and the patient &# 39 ; s artery linings from inadvertent excessive pressure while the catheter head traverses narrow arteries , and also insures that the guidewire never comes into contact with window ( 107 ) or cutter ( 106 ). in some embodiments , the telescoping guidewire lumen may serve a secondary purpose by also acting as a means to transmit torque ( 212 ) from a rotating shaft in the catheter tube ( 104 ) to the cutting wheel ( 106 ) as previously shown and discussed in fig2 a . this dual - action role ( guidewire protection / torque transmission ) helps to minimize the cross section area of the catheter head when an off - axis drive mechanism is used . in still another embodiment , lumen ( 403 )/ drive shaft ( 212 ) can consist of one or more nested hollow tubes so that an inner tube may rotate and conduct torque to drive wheel ( 106 ), yet the outerpart of the lumen may be substantially stationary as to avoid tangling with a body lumen . the guide wire may still progress through the hollow inner core of this nested structure . many other combinations of drive mechanisms , catheter configurations , and sensor configurations are also possible , and some of these are shown in fig5 a and 5b . as shown in fig5 a , the rotary cutter ( 106 ) does not necessarily have to be coupled to a rotating shaft of any sort from catheter tube ( 104 ). rather , the rotary cutter may be adequately driven from the distal end of the catheter by means of a small electric motor or turbine ( 501 ). this motor or turbine may in turn derive power from catheter tube ( 104 ) and in some embodiments handle ( 101 ) as well by appropriate wires or miniature pressure or chemical tubes ( not shown ) progressing up catheter tube ( 104 ). as shown in fig5 b , in some embodiments , the catheter head ( 105 ) may additionally have various imaging or positional sensors , such as ultrasound transducer arrays , optical fibers , coherence tomography devices , infrared sensors , directional ultrasonic sensors , etc . mounted on the catheter head or nose region ( 502 ), ( 503 ). in one embodiment , the orientation of the sensor or sensors may be directed by the operator to give information as to the status of the plaque and / or artery of or other body lumen that is facing the cutting window of the catheter . this can allow the operator to determine if the catheter is in the proper orientation relative to its intended target . examples of such sensors were described in more detail in application ser . no . 10 / 421 , 980 , the contents of which are incorporated herein by reference . fig5 b also shows yet another embodiment in which the plaque storage container ( 506 ) is extended to now also include some of the hollow core of the catheter tube itself ( 104 ). with this configuration , handle ( 101 ) may be hooked up to a suction or cleaning device , as needed , to give the catheter a near infinite ability to accommodate plaque shavings . with this configuration , the catheter need never be removed from the body until the complete plaque removal task is accomplished .

the present invention is an atherectomy catheter with a rotary cutting knife that is driven from the distal or side direction . the catheter collects plaque shavings in a hollow collection chamber mounted in between the rotary cutting knife and the main catheter tubing . in contrast to prior art designs , which utilized nose mounted plaque collection chambers , the present design is able to store a substantially larger volume of removed plaque , thus increasing the length of time and amount of plaque removal that can be accomplished before the catheter must be removed from the body and cleaned . this decreases medical procedure time , allows for more complete and careful plaque removal , and reduces the burden on the patient and physician .

the embodiments of the invention and the various features and advantageous details thereof are explained more fully with reference to the non - limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description . it should be noted that the features illustrated in the drawings are not necessarily drawn to scale . descriptions of well - known components and processing techniques are omitted so as to not unnecessarily obscure the embodiments of the invention . the examples used herein are intended merely to facilitate an understanding of ways in which the embodiments of the invention may be practiced and to further enable those of skilled in the art to practice the embodiments of the invention . accordingly , the examples should not be construed as limiting the scope of the embodiments of the invention . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the full scope of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . it will be understood that , although the terms first , second , etc . may be used herein to describe various elements , components , beams , layers and / or sections , these elements , components , beams , layers and / or sections should not be limited by these terms . for example , when referring first and second beams , these terms are only used to distinguish one beam from another . thus , a first beam discussed below could be termed a second beam without departing from the teachings of the present invention . embodiments of the present invention are described herein with reference to cross - section illustrations that are schematic illustrations of idealized embodiments of the present invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the present invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . for example , a region or object illustrated as a rectangular will , typically , have tapered , rounded or curved features . thus , the regions illustrated in the figures are schematic in nature and their shapes are not intended to illustrate the precise shape of a region of a device and are not intended to limit the scope of the present invention . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . as illustrated in fig1 , the invention may be , for example , performed using an acousto - optic tunable filter ( aotf ) 12 that uses radio waves to filter white light into different colors of diffracted light . as illustrated in fig2 , the aotf 12 device is made up of a specially cut birefringent crystal prism on which a thin plate piezoelectric transducer 16 is bonded on one side of the crystal and an acoustic absorber 17 on the opposite facet . when a radio frequency wave is applied to this transducer , it generates an ultrasonic wave which travels through the crystal and gets absorbed at the other end by the acoustic absorber . the traveling sound wave in the crystal acts like a grating and light gets diffracted in an anisotropic diffraction process . as shown in fig1 , the hyperspectral imaging system 10 comprises lenses 11 a , b to collimate the light beam , an acousto - optic tunable filter 12 , a lens 14 and a single color diffracted light camera 15 . although a camera is shown in fig1 , a charge coupled devices ( ccd ) operating as a spatially integrated detector could be used without departing from the spirit of the invention . any array of detectors that covers an area or any detector that scans an area may be used in place of a ccd . although lenses 11 a , 11 b and 14 have been described above , one of ordinary skill in the art would appreciate that the lenses could be omitted and / or replaces by suitable optical devices which provide for the focusing or redirecting of light such as prisms and the like . there are two types of acousto - optic tunable filters ( aotf ): collinear and non collinear . in a non collinear filter , incident and diffracted light and acoustic beams do not travel in the same direction while in a collinear filter all these beams travel in the same direction . as depicted in fig2 , for a white light collimated incident beam that is incident normal to the input facet of a noncollinear aotf filter , in general there are three beams that come out of the crystal , two diffracted beams ( 1 and 2 ) and a zero order beam ( as depicted by beams 303 , 305 and 307 , respectively , in fig3 ). for a white light collimated incident beam that is incident normal to the input facet of a noncollinear filter , in general there are three beams that come out of the crystal . these include two diffracted beams at specific angles with respect to the incident beam with orthogonal polarization at a specific wavelength corresponding to the applied radio frequency and the third beam called the zero - order beam contain all the light except the amount that was diffracted at the particular optical wavelengths . as depicted in fig2 , the two diffracted beams are at specific angles with respect to the incident beam with orthogonal polarization at a specific wavelength corresponding to the applied radio frequency . the zero order beam contains the light remaining after the amount that was diffracted at the particular optical wavelengths . in the case of a collinear filter where there is only one diffracted beam , a polarizer before the filter and an analyzer after the filter are used to separate the incident light and the zero order beam from the diffracted beam . the diffracted optical wavelength is inversely proportional to the applied radio frequency . the wavelength of the diffracted light can be changed by changing the applied radio frequency . acousto - optic tunable filters ( aotf ) using teo 2 crystal are available commercially covering wavelengths from 400 to 800 nm . the advantage of using such filters instead of traditional dispersive elements such as gratings and prism is that they can generate a full two dimensional scene at a specific wavelength at one time without using any motion . also , wavelength can be changed in either a sequential or random manner . another advantage of using such filters is fast speed ; up to 100000 spectral frames per second can be generated . a third advantage is that no moving parts are involved and a robust system can be developed . a fourth advantage is that the frequency change operation can be done remotely . a fifth advantage is that spectral images can be captured only at desired wavelengths instead of generating hundreds of spectral scenes to fill the image cube . other hyperspectral imagers using liquid crystal tunable filter , fabry perot tunable filters , diffractive optical lens and other techniques can also be used . the light source 2 can be a white light source such as a lamp or sunlight . as depicted in fig1 , a preferred embodiment utilizes a fiber - optic coupled light as a source and an acousto optic tunable filter 12 to image different optical colors in the visible wavelength region . the acousto - optic tunable filter may be fabricated in single crystal of tellurium dioxide . two plano - convex lenses 11 a and 11 b are used to form a collimated beam . the spectral scene is imaged on a commercial ccd camera 15 that is connected to a frame grabber to digitize the analog output of the camera . the digitized image is stored on a computer or image processor . the operation of the acousto - optic tunable filter ( aotf ) 12 and camera 15 may be automated . the radio frequency signal applied to the imager is also controlled from the same software as the imager . an aotf imager used in conjunction with the principles of the present invention operates over the visible to near - infrared ( vnir ) region from 400 to 800 nm . it has a 10 nm spectral resolution at 600 nm . each spectral image is acquired with two retardation values from the liquid crystal variable retarder corresponding to the horizontal and vertical incident polarizations of light . the system ( as shown in fig5 ) comprises a tellurium dioxide ( teo 2 ) noncollinear aotf , two irises ( i 1 , i 2 ), two plano - convex lenses l 1 , l 2 , two plane mirrors ( m 1 , m 2 ) mounted on adjustable tilt plates , an electronically tunable liquid crystal variable retarder ( lcvr ) 13 , one camera lens 14 and one ccd camera 15 . an optional computer 30 may be used to control the assembly and for storage of images . as an example , the camera 15 may be a commercial ccd camera such as the watec model 902 with 1 ″ camera lens . the applied rf signal is obtained from a computer - controlled rf controller and the lcvr applied voltage is obtained from an lcvr controller which may also be controlled from a computer 30 . as an example , the liquid crystal variable retarder ( lcvr ), used to change incident polarization , can collect both spectral and polarization signatures under computer control and may have a range of 400 - 800 nm , passband 10 nm @ 600 nm , a weight of less than 5 lb , and a size of approximately 8 × 6 × 4 inch . further descriptive material is found in n . gupta , et al ., “ acousto - optic tunable filter based visible - to near - infrared spectropolarimetric imager ,” opt . eng . 41 , 1033 - 1038 ( 2002 )), hereby incorporated by reference . the utilized aotf 12 was essentially a real - time programmable solid - state no - moving - parts optical device which performs both filtering and dispersing operations ( see n . gupta , “ acousto - optic tunable filters ,” opt . photon . news 8 , 23 - 27 ( 1997 ) and m . s . gottlieb , “ design and fabrication of acousto - optic devices ,” chap . 4 in designing and fabrication of acousto - optic devices , a . goutzoulis and d . pape , eds ., pp . 197 - 283 , marcel dekker , new york : ( 1994 )). an aotf is fabricated as a specially cut prism in a single crystal of birefringent material which is transparent in the spectral region of interest and has a low acoustic absorption . the crystal is specially cut based on a wide angle bragg diffraction geometry and both its input and output facets are antireflection coated . the crystal geometry is chosen such that the incident optical beam direction is perpendicular to the input facet . a piezoelectric transducer is bonded on one side of the crystal and an acoustic absorber is applied to the opposite side of the transducer . when a radio frequency ( rf ) signal is applied to the piezoelectric transducer , it converts it into an acoustic shear beam that propagates inside the crystal and sets up regions of high and low densities within the crystal . the propagating acoustic beam is absorbed by the acoustic absorber when it traverses through the crystal . thus a moving phase grating is set up inside the crystal whose period is given by the wavelength of the acoustic wave in the crystal . this grating can be erased by removing the applied rf or the period of the grating is changed by changing the frequency of the applied rf signal . the light source can be a white light source such a lamp or sunlight . when white light is incident on the input facet of the crystal , it passes only a selected narrow band with the center wavelength inversely proportional to the frequency of the applied rf signal based on principle of conservation of momentum . in other words , the crystal acts as a narrow bandpass filter that can be used to pass light with a single wavelength . owing to conservation of energy , the frequency of the diffracted light is doppler shifted , but this frequency shift is insignificant and can be ignored ( the frequency of the incident light is a few million times greater than the frequency of the ultrasonic beam ). such an interaction between light and sound is known as inhomogenous bragg diffraction . the time it takes for the acoustic beam to propagate from the transducer to the absorber is the time it takes to change the passband of the filter . most aotfs used in spectral imaging applications use a noncollinear geometry in designing an aotf cell which uses a wide angle bragg interaction geometry based on the symmetry properties of the anisotropic crystal under consideration . fig3 is a schematic diagram of a preferred embodiment of a hyperspectral scene generation system 10 a comprising a light source , an optic system 204 , a tunable dispersive device 12 ( comprising a noncollinear acousto - optic tunable filter with a transducer 16 and absorber 17 ), a tuning system 21 that controls the tuning of the dispersive device 12 through a transducer 16 , a lens 14 , and a display system 15 . the light source may be a fiber - optic coupled broadband light as a source . as an example , an acoustooptic tunable filter 12 may be utilized to image different optical colors in the visible wavelength region . the acoustooptic tunable filter 12 may be fabricated in single crystal of tellurium dioxide . two plano - convex lenses may be used to form a collimated beam . the spectral scene is imaged on a commercial ccd camera that is connected to a frame grabber to digitize the analog output of the camera . the digitized image may be stored on a computer 30 . the operation of the acousto - optic tunable filter and camera are automated and / or may be controlled by a computer 30 . the radio frequency signal applied to the imager may also be controlled from the same software as the imager , optionally contained on computer 30 . as depicted in fig3 , the imager shown uses one of the diffracted beams and blocks the undiffracted beams . the other diffracted beam may be blocked as well as shown by the dotted block . for aotf tuning , diffracted wavelength λ 0 depends on crystal birefringence , acoustic velocity , angle of light incidence , and applied radio frequency ; related as follows : spectral resolution depends on diffracted wavelength , length of acousto - optic interaction , birefringence , and angle of light incidence , related as follows : optionally , the light source can comprise a two - dimensional broadband light source , which covers the electromagnetic spectrum from ultraviolet ( uv ) to infrared ( ir ). in some embodiments , a light source can be used where only a portion of the uv to ir range is covered or a different electromagnetic range is covered . the light source 202 can be a white light source . other configurations for the light source 202 can be used , including a 2 - d resistor array of elements , where each element can be heated under individual control to emit infrared light , a micro - mirror device with a 2 - d structure , where each mirror can be controlled separately , or light emitting diodes . regardless of the light source embodiment used , each of the light sources may be operated with or without computer control . for example , if you utilize three light sources having wavelengths of approximately 540 , 560 and roughly 580 ( 577 nm ), the illumination could be accomplished to compare returns and analyze the subject as to whether the subject is oxygenated or deoxygenated . the optic system 204 may comprise one or more filters and lenses . the optic system 204 receives the light from the light source 202 , and in one embodiment , collimates the received light . the collimated beam of light is filtered and provided to the dispersive device 12 . in some embodiments , non - collimated beams may be generated and processed . the dispersive device 12 is coupled to the tuning system 214 through a transducer 16 . the transducer 216 may be , for example , a thin plate piezoelectric transducer . the tuning system 214 provides an adjustable radio frequency ( rf ) signal to the transducer 216 , which converts the signal to sound waves . the sound waves cause dispersion of the collimated beam provided by the optic system 204 , resulting in the production of beams of light at distinct wavelengths . the tuning system 21 may comprise a computer or other processing device , control software , and / or an rf generator . through application of an adjustable rf signal to the transducer 16 coupled to the dispersive device 12 , the wavelength of the spectral image of the scene generated on the display system 15 can be changed . in other words , all the radio frequency change operations can be done seamlessly under computer control , locally or from a remote location . in some embodiments , manual adjustment can be used in addition to or in lieu of automatic control . further , in response to either manual input or in response to instructions from control software , the tuning system 14 can provide sequential changes or random changes ( or a combination of both ) to the frequency signal . in one embodiment , the dispersive device 12 comprises a non - collinear , acousto - optic tunable spectral filter . the dispersive device 12 may also comprise an aperture , among other elements . other dispersive devices that are tunable and produce regions of high and low density ( e . g ., compression and rarefaction ) to produce a grating ( e . g ., phase grating ) effect based on the tuning signal can be used to obtain images of full 2 - d spectral scenes , including liquid crystal light filters , fabry - perot interferometers , michaelson interferometers , or diffractive optical lenses , among other devices . the light output from the dispersive device 12 at a distinct wavelength passes through the lens 14 ( e . g ., an iris lens ) and is imaged onto and / or in the display system 15 . the display system 15 may comprise a projection screen , video monitor , computer , and / or a 2 - d detector array ( e . g ., as provided in a camera ). for example , the display system 15 may comprise a charge - coupled device ( ccd ) camera and a computer . the ccd camera may be coupled to a frame grabber to digitize the analog output of the camera , and the digitized images can be stored on a computer . the operation of the dispersive device 12 and / or display system 15 may be manually operated or automated , or a combination of both forms of control . it will be understood that the hyperspectral scene generation system 10 a illustrated in fig3 provides an overview of an exemplary embodiment of a hyperspectral scene projection / generation system 10 a , and in some embodiments may include fewer , greater , and / or different components . in the preferred embodiment depicted in fig5 , a compact , portable , agile spectropolarimetric vnir imager was used with an aotf 12 for the light dispersive element in combination with lcvr 13 for polarization selection and a ccd camera to cover the spectral range of operation . the imager was used to carry out some passive imaging experiments using a human subject to evaluate the imaging capabilities in detecting oxygenated versus deoxygenated blood by constricting the blood flow —( i ) in a finger by wrapping a tight rubber band around the finger and ( ii ) in the lower arm by using a pressure cuff on the upper arm . the subject was located approximately two meters away from the imager . after collecting an image cube and analyzing it using hyperspectral image processing software , the effects of skin deoxygenation was observed both in the constricted finger and the arm . the imager was used in a passive mode from 400 to 800 nm with a 10 - nm interval to acquire spectral images at 41 bands with polarization settings of 0 ° and 90 ° at each wavelength corresponding to the horizontal and the vertical polarizations of the reflected light from a human hand and arm illuminated by an ordinary white light source . although 41 bands were selected , any number of bands could be utilized depending upon the circumstances and accuracy desired . the hand and arm were located two meters from the camera . two separate experiments were performed : first for imaging the hand with the index finger constricted by a rubber band wrapped around it and the second for imaging the lower arm when the upper arm was constricted by a pressure cuff . the spectral analysis was performed using envi ( registered trademark ), but one of ordinary skill in the art would readily appreciate that other procedures could be utilized with comparable results . for each imaged object two separate image cubes each with 41 bands were obtained corresponding to the two orthogonal polarizations of the light reflected from the illuminated object . a diffuse white board was also imaged and was used to normalize the data . the spectral plots clearly showed the two peaks corresponding to the oxygenated skin for the unconstructed finger due to oxyhemoglobin ( corresponding to 540 and 577 nm ) and the single peak due to deoxyhemoglobin ( corresponding to 559 nm ) for the constricted index finger and the lower arm . an ordinary white light source was used to illuminate the objects and the images were collected from a distance of two meters with no prior sample preparation ; the results showed the effect of oxygenation and deoxygenation for a live human subject . higher image contrast can be achieved by using both spectral and polarization signatures . spectral features arise due to the material properties of objects , as a result of the emission , reflection , and absorption of light . the polarization features arise from the physical nature of the object including surface roughness and subsurface scattering . using a hyperspectral imager , one can acquire an image cube that consists of a number of spectral images of the same scene taken at a number of narrow spectral bands . spectral signatures from each pixel can be easily extracted and used to obtain the characteristic spectral signatures of different materials that make up objects and backgrounds in the scene or subject of interest . fig2 and 3 show the propagation of light and sound waves in a noncollinear aotf cell . the filter design is based on the consideration that for a spectral imaging instrument and a fairly broad bandpass is needed and a large linear as well as angular aperture such that there is a substantial light throughput . in fig2 , the filtering operation of a noncollinear aotf is shown with the transducer and absorber . when unpolarized white light is incident on the input facet , it gets diffracted by the traveling grating set up in the crystal by the acoustic wave . the two orthogonally polarized diffracted light beams 1 and 2 at a wavelength inversely proportional to the applied rf , are coming out at an angle to the incident beam . the zero order beams contain all wavelengths except the one that was diffracted by the traveling grating . the period of the traveling grating is given by the wavelength of the acoustic wave in the crystal and can be changed by changing the applied rf . only one of the diffracted beams is used for imaging by blocking the rest of the beams . an aotf imager designed in accordance with the principles of the present invention uses the concept that for an unpolarized incident light , a noncollinear aotf has two diffracted beams , along with two orthogonally polarized undiffracted beams that contain all the incident wavelengths minus the one that is diffracted . the advantages of an aotf include light weight , compact , electronic tuning , lack of moving parts , low drive power , rapid tuning and scanning ( 100 , 000 frames / sec ), high spectral resolution , broad tuning range , rf - driven and remote control operation ; sequential or random or multi wavelength access ; and polarization separation . a preferred embodiment imager design uses one of the diffracted beams and blocks the other diffracted beam as well as the undiffracted beams as shown in fig2 . diffracted wavelength depends on crystal birefringence , acoustic velocity , angle of light incidence , and applied radio frequency : the tuning relationship and the spectral resolution for a noncollinear filter , using wide - angle diffraction geometry , can be approximated by the following two equations . in the first equation , diffracted wavelength depends on crystal birefringence , acoustic velocity , angle of light incidence , and applied radio frequency . in the second equation , spectral resolution depends on diffracted wavelength , length of acousto - optic interaction , birefringence , and angle of light incidence . λ 0 = δ ⁢ ⁢ nv f a ⁡ [ sin 2 ⁢ 2 ⁢ θ i + sin 4 ⁢ θ i ] 1 / 2 ( 1 ) δ ⁢ ⁢ λ λ 0 = 0 . 9 ⁢ λ 0 l ⁢ ⁢ δ ⁢ ⁢ n ⁢ ⁢ sin 2 ⁢ θ i ≡ 1 r ( 2 ) where λ 0 is the diffracted optical wavelength , δn is the birefringence of the material ( difference of two refractive indices ), v is the acoustic velocity in the material , fa is the applied rf signal ( same as the acoustic frequency ), θ 1 is the optical angle of incidence with respect to the crystal optic axis , l is the length of ao interaction in the crystal ( same as the length of the transducer ), δλ is the optical passband , and r is the spectral resolution . it is clear from eq . ( 1 ) that the optical wavelength can be changed by changing applied rf because λ 0 increases as fa decreases or vice versa . to obtain polarization information , as shown in fig5 , a spectrally tunable commercial lcvr 13 is placed in front of the aotf , and uses two retardance values corresponding to the horizontal and vertical polarizations for each diffracted wavelength . the tuning of such a retarder is done by changing the applied voltage . an lcvr is a device that is made of a thin layer of a nematic liquid crystal between two parallel glass windows spaced a few microns apart . the retardance or the phase shift between the two orthogonally linearly polarized components of transmitted light by lcvr is obtained by applying a low voltage waveform to the liquid crystal layer . see , “ stokes polarimetry using liquid crystal variable retarders ,” meadowlark optics , inc . ( 2005 ). url http :// www . meadowlark . com , hereby incorporated by reference as though fully rewritten herein . the specifications of the lcvr may be , for example , a nematic lc thin film , with a range 0 . 4 - 1 . 8 mm . variable retardance can be obtained by varying the applied voltage . a graph of the retardance as a function of voltage is shown in fig8 . for each wavelength , two different values of voltage are used corresponding to zero and quarter wave retardances to obtain images with two orthogonal polarizations . the values of these two retardances vary as a function of wavelength and corresponding plots can be obtained from the vendor . a preferred embodiment atof assembly may optionally comprise a small black box mounted on a tripod as depicted in fig9 . as depicted in fig5 , the light from the scene is first incident on the first iris which defines the angular aperture of the aotf . next , the light passes through an lcvr where a retardance is applied to it as discussed above . the light transmitted from the lcvr is next imaged inside the aotf cell by the first plano convex lens and after the aotf only one of the two diffracted beams from the aotf is imaged on the ccd camera using the combination of the second plano convex lens , second iris 12 and the camera lens . the two plane mirrors m 1 and m 2 are mounted on the tilt plates that are used to fold the optical path in order for the optical package to fit inside a small box . by tuning the filtered wavelength over the entire tuning range , two separate hyperspectral image cubes can be acquired corresponding to the two orthogonal polarizations . since both the retarder and the aotf are tuned electronically , no moving parts are involved , and the imager is adaptive and robust as compared to other traditional hyperspectral imagers . the applied radio frequency ( rf ) signal for the lcvr is obtained from a computer - controlled rf controller and the lcvr applied voltage is obtained from an lcvr controller which is also controlled from a computer . the specifications of the acousto optic filter ( aotf ) imager are given in table 1 below . the present invention may be utilized to find out if a person &# 39 ; s blood is oxygenated or deoxygenated by using remotely captured hyperspectral images of a person &# 39 ; s arm or other body parts by using an acousto - optic based hyperspectral imager operating from 400 to 800 nm . the light from a fiber optic coupled source is illuminated on a person &# 39 ; s body part and then spectral images are captured using an automated hyperspectral imager . in order to recreate a deoxygenated arm , the arm or the other body part is put under pressure to reduce the oxygen level in the blood and spectral images are captured . a diffuse white board sitting at the same position as the arm or other body part is then imaged with same illumination . hyperspectral image cubes were generated using a commercial hyperspectral software package and spectrum of a point on the arm was extracted and normalized using the spectrum from the white board . this effectively cancels out the spectral response of the light source and the imager . when the spectrum from the arm under pressure are examined , it clearly shows that the blood is deoxygenated while similar data from the arm under normal condition shows that the blood is oxygenated . the same or similar procedure could be useful in a hostile or battlefield scenario to remotely determine if an individual is alive or dead without touching his or her body to determine his pulse . this would avoid others from exposure to chemical and biological agents if the person in question was exposed to them in a hostile environment . experiments were conducted to assess the ability of a preferred embodiment spectropolarimetric imager with respect to measurement of oxygen saturation ( so 2 ) in the skin . two spectral imaging experiments were carried out to obtain image cubes using a vnir imager to image ( i ) a hand and ( ii ) arm of a human subject located two meters away from the imager . also recorded were image cubes of a diffuse white board to normalize the images obtained from the hand and arm . in a first experiment an ordinary white light lamp source was used to illuminate the hand of a volunteer . passively imaged diffuse reflection from live human subject skin was conducted at a range of 2 meters using ordinary unpolarized white light source . in the first experiment , a rubber band was tied on the index finger of the individual to interrupt the flow of oxygenated blood to that area . in the second experiment with the arm , a pressure cuff was applied to the upper arm of the subject that was also illuminated by the same white light source as in the first experiment and the forearm and hand were imaged . images were recorded from 400 nm to 800 nm with a 10 nm spectral interval . images were acquired before and after ˜ 5 minute blood constriction . two separate image cubes each with 41 spectral images corresponding to two orthogonal polarizations were recorded for each object . the wavelength was changed by varying the applied rf between 50 and 120 mhz to correspond to the desired optical wavelength range . the rf signal power used was less than 1 . 0 w . each spectral image was recorded with two orthogonal polarizations of the light incident on the imager . both the rf synthesizer and the lcvr were controlled using a personal computer . the ccd output was captured and digitized using a frame grabber and stored on the computer hard drive . the size of each stored image was 640 × 480 pixels . a custom designed graphical user interface was used for a seamless operation of the imager . some examples of the spectropolarimetric images obtained with an imager constructed with the principles of the present invention and used in the experiment are presented . fig1 illustrates how images of a hand and arm can be collected with rubber band on the index finger were collected . shown in fig1 are three spectral images collected with horizontal polarization . the top of fig1 shows three examples of reflected spectral images ( taken using light having wavelengths of approximately 540 nm , 560 nm and 580 nm ) of a human hand ( collected with rubber band on the index finger ) and the bottom shows similar images ( taken using light having wavelengths of approximately 540 nm , 560 nm and 580 nm ) for lower arm collected with horizontal polarization . the wavelength dependence of the skin reflectance may be analyzed using a computer program such as envi ( trademark ). two regions of interest ( 30 × 30 pixels each ) were selected on a constricted finger and on an un - constricted finger . absorbance in each location was calculated after normalizing the skin values by our reflectance standard ( white board ) using eq 3 . typical results for the finger experiment are illustrated in fig1 . the absorbance spectrum on the unconstructed finger is typical of oxygenated hemoglobin with two visible peaks at 540 nm and 577 nm . for the constricted finger these peaks have disappeared and are replaced by a large peak centered around 559 nm . fig1 through 16 are graphical illustration of the mean of regions of interest captured on a constricted finger and on an unconstricted finger ( circles ). the data was normalized by the respective 420 nm value for both curves . oxygen saturation in both regions of interest was calculated using an algorithm first proposed by n . kollias , a h baqer , “ quantitative assessment of uv - induced pigmentation and erythema ,” photodermatol . 1988 ; 5 , pp . 53 - 60 , ( hereby incorporated by reference ) which takes into account the effect of melanin absorption by subtracting its contribution from the general data skin pigmentation is approximated as the slope of a fitted straight line between the values of absorbance at 620 nm and 720 nm , the absorbance curve of melanin decreasing monotonically between 600 and 750 nm . oxygen saturation is calculated by using tabulated absorption curves of oxygenated and deoxygenated hemoglobin to fit the experimental data in the range 550 to 580 nm . oxygen saturation in the un - constricted finger was close to 60 % while in the constricted finger values around 1 % were obtained . these values agree with the one obtained by other groups with different experimental techniques and algorithms as discussed in n . kollias , a h baqer , “ quantitative assessment of uv - induced pigmentation and erythema ,” photodermatol . 1988 ; 5 , pp . 53 - 60 , and m . p . siegel , y . l . kim , h . k . roy , r . k . wali , v . backman , “ assessment of blood supply in superficial tissue by polarization - gated eleastic light - scattering spectroscopy ,” 45 , appl . optics , 2006 , both of which are hereby incorporated by reference . skin oxygen saturation is expected to vary between 50 % and 70 % due to the spatial micro non - uniformity of so 2 ( oxygen saturation ) in the skin layers . values collected on the forearm yielded similar results , so 2 was ˜ 50 % before the pressure cuff was put in place and plummeted to 0 % after a few minutes of vasoconstriction . since the light source was unpolarized , no polarization gating was obtained from the reflected images . a compact , portable , agile spectropolarimetric vnir imager was used with an aotf for the light dispersive element in combination with lcvr for polarization selection and a ccd camera to cover the spectral range of operation . this imager was used in a passive mode from 400 to 800 nm with a 10 - nm interval to acquire spectral images at 41 bands with polarization settings of 0 ° and 90 ° at each wavelength corresponding to the horizontal and the vertical polarizations of the reflected light from a human hand and arm illuminated by an ordinary white light source . the hand and arm were located two meters from the camera . however , other distances could be utilized without departing from the spirit of the invention . two separate experiments were performed : first for imaging the hand with the index finger constricted by a rubber band wrapped around it and the second for imaging the lower arm when the upper arm was constricted by a pressure cuff . the spectral analysis was performed using matlab . for each imaged object two separate image cubes each with 41 bands were obtained corresponding to the two orthogonal polarizations of the light reflected from the illuminated object . a diffuse white board was also imaged and was used to normalize the data . the spectral plots clearly showed the two peaks corresponding to the oxygenated skin for the unconstructed finger due to oxyhemoglobin ( corresponding to 540 and 577 nm ) and the single peak due to deoxyhemoglobin ( corresponding to 559 nm ) for the constricted index finger and the lower arm . considering that an ordinary white light source was used to illuminate the objects and the images were collected from a distance of two meter with no prior sample preparation , these results are rather remarkable in showing the effect of oxygenation and deoxygenation for a live human subject . further work may provide enhanced sensitivity . based on the results , it should be noted that a prototype aotf - based imager which was developed for military applications provides a useful tool for data acquisition for biomedical applications in either hyperspectral or spectropolarimetric modes because such imagers are compact and agile with no - moving parts and have automated operation and are easy to use . fig1 illustrates image acquisition and analysis using a preferred embodiment of the present invention comprising the steps of collecting spectral images at same polarization , form an image cube using the spectral images ; extract a spectral profile across the cube , and obtaining normalized absorbance wrt reference . as shown at the bottom right of fig1 , oxygenated blood contained a “ valley ” in the graphical representation which correlates to the absorption by oxygen in the blood at the given wavelength . experiments were conducted and video / photographs taken to produce spectral images in each image cube from 800 to 400 nm of constricted human body components ; the left image being a hand with a constricted finger and the right image being a constricted arm with a pressure cuff . for example , a video of 41 sequential frames could be used to produce an image “ cube ” with 41 frames , as schematically shown in fig1 . fig1 depicts skin analysis conducted in accordance with the principles of the present invention . as seen in the graph in fig1 , the unconstricted finger gives typical two visible peaks at 540 nm and 577 nm corresponding to oxygenated hemoglobin . the constricted finger has a large peak centered around 559 nm corresponding to deoxyhemoglobin . similar results were obtained for constricted arm . oxygen saturation in the unconstricted finger was close to 60 % and 1 % for the constricted finger using kollias algorithm , similar results obtained for arm . no polarization gating was observed due to the use of unpolarized light . as seen in fig1 , the procedure entailed the steps of extracting the spectral profiles , computing equation 3 ( also shown in fig1 ): a = - log 10 ⁡ ( r skin r board ) fig1 is a graphical presentation illustrating a normalized spectral absorbance showing a comparison of constricted / restricted and nonconstricted / unrestricted finger skin with the absorbance spectrum for an unconstricted finger typical of oxygenated hemoglobin having 2 visible peaks at 540 nm and 577 nm . for a constricted finger these peaks disappear , and a single large peak centered @ 559 nm for deoxyhemoglobin appears . fig1 is a graphical illustration representing spectra ( with horizontal polarization ) obtained from image cubes in which absorbance is plotted as a function of wavelength of light in nanometers . the portion indicative of oxygenated blood is circled . the data shown was not normalized with absorbance value at 420 nm . fig1 is a graphical illustration representing deoxygenated blood ( obtained using a rubber banded index finger ) with a spectral plot obtained from image cubes in which absorbance is plotted as a function of wavelength of light in nanometers ( with horizontal polarization ). the data is not normalized with absorbance value at 420 nm . fig1 is a graphical illustration representing deoxygenated blood ( obtained using a lower arm ) with a spectral plot obtained from image cubes in which absorbance is plotted as a function of wavelength of light in nanometers ( with horizontal polarization ). the data is not normalized with absorbance value at 420 nm . although the preferred embodiments were discussed in relation to determining oxygen content , other chemicals could be detected using the principles of the present invention . for example , for oxygen satuaration ( so 2 ) measurement , using the algorithm described in kollias et al ., the effect of melanin can be “ subtracted ” by fitting the curve is between 620 - 720 nm . the so 2 may then be calculated by fitting a curve between 550 and 580 nm . the so 2 value obtained for unconstricted finger was a 60 % so 2 value , while for constricted finger the value was 1 %. similar comparison values can be obtained using the forearm . as stated in the foregoing , the present invention is directed to the detection of elements and / or chemicals such as an oxygen deficiency in the blood or hypoxia in a subject body . causative factors such as drowning , strangling , choking , suffocation , cardiac arrest , head trauma , and carbon monoxide poisoning can create conditions leading to cerebral hypoxia , which can lead to coma , seizures , and even brain death . similarly , carbon monoxide and cyanide poisoning may lead to histotoxic hypoxia , which is the inability of body tissues to use oxygen . also , certain narcotics will prevent oxygen use by the tissues . the present invention may be used to monitor , screen , or detect the lack of the presence of oxygen in body tissue of subject individuals which may be indicative of poisoning , chemicals , or certain narcotic usage . for a more detailed example of screening systems , see u . s . pat . no . 7 , 141 , 786 , hereby incorporated by reference . moreover , the invention is particularly suitable for persons or subjects with injuries , such as gangrene , whether the individual would be subjected to a great deal of pain if subjected to contemporary diagnostic instruments . since the present invention may be operated at a distance from the subject &# 39 ; s skin , no pain would be encountered . the invention may prove useful in the analysis of bruises on the body which are otherwise not visible which appear when comparing spectral images taken at two orthogonal polarizations . for example , such analysis could prove useful when a coroner wants to asses whether or not a baby has been badly bruised . such bruises may become evident only when the subject is imaged by a modified form of the invention utilizing light . the polarization difference image would provide the shape of the bruise for discernment as to the cause of the bruise . in addition , the present invention could prove useful in the cosmetic industry for the analysis of make - up products ; particularly in conjunction with a polarization varying embodiment of the present invention . for example , using polarized light , light which is reflected from the surface contains information about the different contours ; i . e . bruises . in analyzing the effectiveness of make - up cosmetics , spectral and polarization may also enhance the effectiveness of the analysis of the cosmetic products . it should be emphasized that the above - described embodiments are merely possible examples of implementations . many variations and modifications may be made to the above - described embodiments . all such modifications and variations are intended to be included herein within the scope of the disclosure and protected by the following claims . the term “ processor ” or “ computer ” as used herein includes multiprocessors , computers , supercomputers , data processor , laptops , signal processors , personal computers , notebook computers , and / or any component which processes data . the term “ image generator ” as used herein includes a “ processor ” or “ computer ” which generate images and / or any element or component , including components within a processor , which generate images , including a display , screen or monitor . the abbreviation rf or rf is used for radio frequency or a radio frequency signal . the terminology “ chemical ” as used herein means solid , liquid , or gas and includes substances , additives , stimulants , narcotics , agents , toxins , and / or reagents . the term “ subject ” as used herein means a human , animal , organ , body part , skin , non - plant organisms , or animal biological matter . as used in the following claims , the terminology “ images ” or “ spectral images ” relates to the information collected by hyperspectral sensors as a set of “ images ” with each image representing a range of the electromagnetic spectrum , also known as a spectral band . as used herein the terminology “ image cube ” or “ hyperspectral image cube ” refers to the combination of “ hyperspectral images ” to form a hyperspectral cube for processing and analysis . as used herein , the terminology so 2 means oxygen saturation ( not sulfur dioxide ).

a method of detecting oxygen and / or chemical content in a subject , comprising generating at least one spectral image of the subject ; generating at least one spectral image of a reference object ; comparing spectrum from the subject image to the reference image to thereby reveal the relative oxygen content of the subject . a system for determining the level of oxygenation of the blood of a subject body part comprising : a hyperspectral image generator for generating a plurality of spectral images ; an image capture device for capturing the spectral images ; a processor for generating hyperspectral image cubes such that the spectrum of the body part is extracted and normalized using the spectrum from the reference object to cancel out the spectral response of the light source and the imager ; said processor comparing spectral from a subject image to reference images to thereby reveal the relative oxygen content of the subject .

generally , as shown in fig1 the decorative garment is designated by the numeral 12 and is seen to be composed of a sheet of fabric 14 which is rectangular in shape and which has a cutout 16 in the central zone of it . the cutout is bounded by a pocket defining structure 18 , see also fig4 . within this pocket defining peripheral structure about the cutout , there is provided a drawstring 118 which may be , either , of elastic or non - elastic material . in the preferred embodiment , the drawstring is not of elastic material . also , end portions of drawstring 118 extend outwardly from an opening in the pocket for manipulation thereof . extending outwardly from the cutout there are two pairs of opposing wing zones or portions . in the embodiment shown in fig1 these wing portions are designated by the numerals 20 and 21 in the case of the first pair and , in the case of the second pair , these are designated by the numerals 24 and 26 . it is seen that the pairs of wing zones are perpendicular to one another . this is indicated by an imaginary line through the center 28 of the garment and the center of each pair of right angularly arranged wing portions . these imaginary centerlines are designated by the numerals 29 and 30 and define lines of symmetry . in other words , the decorative garment is symmetrical with respect to these centerlines through the wing portions . in a preferred embodiment , the distance around the periphery of the central cutout is about 44 inches . this is so that the garment may be positioned over the head and / or shoulders of a user , or , indeed , about the waist of a user . in use , the garment is capable of being worn in a wide variety of styles . for example , it mauy be worn if rolled upon itself into a string as a belt or sash . additionally , it may be worn as a cape , an overskirt , or in various ways over the shoulders of a wearer . it can also be utilized as a halter and generaly has a wide variety of optional uses whereby a wearer can adapt it for the particular type of garment preferred . also as set forth in greater detail in fig5 the garment can be converted and / or used as a drape for other objects . the fabric is preferably highly decorative and may be of silk or hand - painted . it will be noted that there are no seams except at the center which provides a flowing garment capable of being draped or gathered into a wide variety of styles . in the preferred embodiment , the overall longitudinal dimension of the garment is about 6 foot while the transverse dimension is between 3 and 5 feet . referring now to fig2 there is shown a similar garment 12 &# 39 ; which differs from that previously described only in that the central cutout 16 &# 39 ; is oval . referring to the embodiment shown in fig3 the sheet is of cruciform and preferably has an oval central opening . in this embodiment , the sheet 112 is provided with the oval opening 114 which is bounded by the pocket structure 116 in which there is a drawstring 118 . the first pair of wing portions is designated by the numerals 120 and 122 while the second pair of wing portions are designated by the numerals 124 and 126 . it is seen , once again , that a centerline through the center of the cutout and through the wing portions defines a line of symmetry with respect to each of the pairs of wing portions . as shown in fig4 the pocket structure 18 about the cutout may be composed of the edge 130 . the cutout is folded back upon itself and stitched together as by the seam 132 so that the drawstring 134 may be captivated therein with the ends thereof extending outwardly through a suitable opening , not shown , for tightening the drawstring as also shown in fig3 . fig5 is directed to yet another embodiment of the present invention wherein the garment 12 is converted into a decorative drape positionable over various portions of a lampand / or lamp / table combination generally indicated as 100 . in this embodiment , any of the structural configurations of the garment as appears in fig1 or 3 can be utilized by draping such garment now generally indicated as 12 &# 34 ; over a lampshade structure 102 such that the central orifice 18 substantially surrounds and engages the preferred upper periphery of the shade structure 102 in the manner shown in fig5 . the remainder or the body portion including both wing zones can then hang , due to gravity , along the outer surface of the shade 102 and to a certain extent or length therebeyond as generally indicated as 104 . alternately , a table portion of the lamp structure 100 now being generally indicated as 106 could have its underportion covered by the convertible garment / drape 12 &# 34 ; wherein the cutout portion 18 surrounds a periphery of a horizontal platform or table surface 108 and extends downwardly therefrom in surrounding relation to any type of base used to support the planar table 108 on the floor or like supporting surface . it should be readily apparent therefore that the versatility of the garment 12 &# 39 ;, 12 &# 34 ;, 112 , and 12 &# 34 ; is increased due to the convertibility of the garment into a decorative drape for various objects or pieces of furniture as demonstrated in fig5 . it is thus seen that there has been provided a simple , inexpensive , highly versatile decorative structure which can be worn as a garment in a wide variety of styles and which is either stored when not in use or used as a drape as demonstrated in the embodiment of fig5 . while the instant invention has been shown and described in what is considered to be three practical and preferred embodiments , it is recognized that departures may be made within the spirit and scope of the claims which follow and this invention is therefore not to be limited except as set forth in the claims within the doctrine of equivalents .

a decorative garment comprising a sheet of fabric having a central opening therein sized for passage of the head , shoulders , or waist of a wearer . there is pocket structure about the cutout to accommodate a drawstring so that the size of the cutout may be varied . the garment is adapted to be draped over the body in a wide variety of fashions .

the invention resides in a methods and apparatus for providing nutrients to an intervertebral disc situated between the endplates of upper and lower vertebra . according to the method , a passageway is formed into the disc space . the process further includes the steps of placing a cannulated element in the passageway , and providing one or more substances beneficial to the intervertebral disc through the cannulated element . in the preferred embodiment , the cannulated elements take the form of porous stents which extend through the vertebral endplates . the endplate stents according to the invention may be used to feed the disc cells within the disc naturally , and / or cells transplanted into the disc . in one application , transplanted disc tissue is placed around the disc stents at the time the disc tissue is added to the disc . alternatively , the cells are grown in culture around the stents . in this way , the stents may support the growth of larger colonies of cells in cell culture . given that colonies of cells grown in culture can reach a critical size where the cells in the center of the group can become deprived of nutrition , the stents would provide a channel for nutrients to the cells in the center of the colony . in the embodiments involving the transplantation of biologic material in the form of nucleus pulposis cells or other tissues , live cells or tissues are harvested from a human or animal donor and introduced into the disc being treated . the harvested biologic materials are preferably kept viable until placed into the disc being treated . the harvested biologic materials may be introduced into the disc using any suitable transfer technique , including the formation of a passageway through the annulus fibrosis and the use of a needle and syringe or small cannula . alternatively the step of transplanting may include percutaneously or laparoscopically injecting the cells or tissues into the disc being treated . the invention may further include the use of an optional reservoir filled with therapeutic materials to aid the disc cells . for example , a refillable reservoir may be filled with cell - culture nutrients and placed in an accessible location under the skin of the flank . other applicable therapeutic substances include , growth factors , differentiation factors , hydrogels , polymers , antibiotics , anti - inflammatory medications , or immunosuppressive medications . if a transplanted nucleus pulposis is utilized , it is preferably harvested from a live human , though recently deceased human or animal donors may alternatively be used . depending upon the extent of the harvest , the recipient may function at least in part as a donor , or the tissues from others , including fetal or embryo sources , may be used , preferably having a familial relationship to minimize or avoid the need for immunosuppressive substances . guidelines for tissue procurement including surgical technique of removal , number of hours between death of the donor and tissue procurement , and testing of the donor for infectious disease , are well described in the literature . similarly , the guidelines for storage of living tissues are well known to those skilled in the art . the text “ organ preservation for transplantation ” by karow and pego , 1981 , describes such methods . briefly , the tissue storage method must maintain cell viability and preserve sterility . examples of present storage methods include : refrigeration , refrigeration with tissue culture medium such as : hemolyzed serum , autologous serum , medium 199 with 5 % dextran ( mccarey - kaufman medium ), medium 199 with chondroitin sulfate , medium 199 supplemented with inorganic salts , short chain fatty acids , and / or ketone bodies , and cryopreservation techniques , among others . details are provided in u . s . pat . nos . 4 , 695 , 536 and 4 , 873 , 186 , the entire contents of which are incorporated herein by reference . to minimize exposure to the recipient &# 39 ; s immune system , the harvested nucleus pulposis is preferably inserted through a small hole in the annulus fibrosis using a blunttipped needle or cannula forced through the laminae . upon withdraw of the needle , after injecting the transplanted nucleus pulposis , the separated fibers of the lamella return to their normal position , thereby sealing the annulus . the annulus fibrosis is thicker in the anterior and lateral portion of the disc . thus , the needle would preferably be inserted into the anterior or lateral portion of the disc . those skilled in the art will realize the needle could be directed into the lateral portion of the disc percutaneously with fluourscopic guidance and into the anterior portion of the disc laparoscopically . the host nucleus pulposis may be morselized to allow insertion into the disc through a small cannula or needle . the increased surface area of the nucleus pulposis after morsellization may also aid diffusion of nutrients and wastes products to and from transplanted disc cells . alternatively large sections of the transplanted nucleus pulposis could be added to the disc if the annular defect was sealed after transplantation . the transplanted nucleus is preferably added to the patient &# 39 ; s nucleus pulposis . alternatively , the patient &# 39 ; s nucleus could be removed with standard techniques ( enzymatically ( chymopapain ) or with the aid of a laser , suction device , shaver , or other surgical instrument ). if the nucleus is removed the hole in the annulus should be small and sealed to prevent the ingrowth of vascular tissue . vascular ingrowth could lead to a graft versus host reaction . additional therapeutic substances could be added to the transplanted nucleus . for example , resorbable culture medium , tissue growth or differentiation factors ( recombinant generated morphogenetic proteins , pdgf , tgf - β , egf / tgf - α , igf - i , βfgf ), hydrogels , absorbable or nonresorbable synthetic or natural polymers ( collagen , fibrin , polyglycolic acid , polylactic acid , polytetrafluoroethylene , etc . ), antibiotics , antiinflammatory medication , immunosuppressive medications , etc . could be beneficial .

an intervertebral disc is treated by providing supplemental nutrition to increase viability and longevity . in the preferred embodiment , the invention uses one or more porous stents that function to irrigate the disc space . the stents provide channels for diffusion of fluids and nutrients from the vertebral endplates . the stents may extend across the vertebral endplates to facilitate the transfer of nutrients and oxygen from the vertebral bodies .

other objects and advantages of the present invention will become apparent from the following description and accompanying drawings . fig1 aa illustrates a preferred embodiment of the present invention and shows the components that this embodiment comprise of . it include a device 1000 that can be operatively coupled to any existing or contemplated medical or home use treatment device 1010 to prevent exposure of eyes or other sensitive skin 1020 or tissue to dangerous exposures of energy , 1030 . the device comprise a member 1040 , that extends at least partially into the path of the emitted treatment energy and prevents the emission of such energy unless the area about to be exposed to said emitted energy exert a physical force on the member , 1040 . the physical force must be strong enough to cause a discomfort to injury - prone locations , 1020 such as , for example , eye , injured skin , injured tissue , or pain - sensitive parts of the body . preferably the member may be coupled to a foot 1050 , the foot exert a blunt force on said target tissue or eye 1020 but such a force or pressure i not capable of causing injury to said target tissue or eye . the member 1040 is coupled to a circuit 1060 , said circuit is operationally coupled to an emitter , 1070 . the activity of the emitter is coupled to the movement of the member 1040 . the emitter may carry its own power source or may be couple to a power supply or a battery power source or wall power outlet 1065 . the member 1040 may have a hole in its foot 1045 through which the energy or 1030 or a carrier of mechanical energy such as a needle 1030 may pass towards the skin . the member 1030 is pushed by the force exerted on it by the skin 1020 , it may face a resistance force exerted by a spring 1075 to control its motion . the motion of the member 1040 may , for example , cause a lever 1080 to activate a motion sensor 1085 operationally coupled to a circuit 1060 or a mechanical trigger 1060 that is couple to the activity of the emitter 1070 , thereby causing the emitter 1070 to emit energy 1030 a preferred embodiment of present invention comprise a device that can be operatively coupled to any existing or contemplated medical or home use treatment device to prevent exposure of eyes or other sensitive skin or tissue to dangerous exposures of energy . the device comprise a member that extends at least partially into the path of the emitted treatment energy and prevents the emission of such energy unless the area about to be exposed to said emitted energy exert a physical force on said member . said physical force must be strong enough to cause discomfort to injury - prone locations such as , for example , eye , injured skin , injured tissue , or pain - sensitive parts of the body . additionally and preferably , the present invention comprises systems , devices and methods in which a device has an emitter that emits a first energy along a path , a member that extends at least partially into the path and a circuit couples activity of the emitter with movement of the first member . in an alternative preferred embodiment of the present invention , the present invention comprises systems , devices and methods in which a device has an emitter that emits a first energy along a path , a member that extends at least partially into the path and a mechanical coupler that couples activity of the emitter with movement of the first member . all suitable emitters are contemplated , including coherent and incoherent energy sources , visible and non - visible wavelengths , and those that emit electromagnetic and / or other energy . of particular interest are flashlamps , because they are inexpensive , and their energy is difficult to focus to a spot size that is likely to lead to retinal injury . emitters are preferred that have energy density of less than 30 j / cm 2 , more preferably less than 20 j / cm 2 , more preferably less than 10 j / cm 2 , more preferably yet less than about 3 j / cm 2 and most preferably less than 1 . 5 j / cm 2 . on the other hand , devices are contemplated that will be used for treatment of skin , and especially devices that can emit energies sufficient to cause damage to a retina of an eye . this includes , for example , laser hair removal treatment , laser skin rejuvenation , laser removal of tattoos , light treatment for acne , light treatment for hair reduction , laser or light treatment for removal of vascular lesions , and heat treatment for acne . the member can have any desired size or shape , provided that the member can still serve as a interrupter not allowing the device to emit energy unless the member has been modified by the location targeted for treatment in a way that would cause discomfort to injury - prone locations such as , for example , eye , injured skin , injured tissue , or pain - sensitive parts of the body . for robustness , the member preferably has a length of no greater than 3 , 4 , 5 , 6 , 7 , 8 , 9 , or 10 mm , depending in part upon the type of material , cross - section . there can be multiple members , which can operate independently from one another , or mechanically coupled in some way , for example by being coupled to a common foot . for example , the entire treatment window through which the energy pass to the target can serve as a member where the window , for example , has to be mechanically disturbed or pressed before energy can be emitted . alternatively multiple independent members can operate independently . this mode of operation is useful in making it difficult for an inexperienced user ( for example a child ) to press all multiple members at the same time . if the device is designed so that energy is emitted only if all members position has to be modified simultaneously ( for example , all members has to pushed in by at least 2 mm ) then only a flat surface such as a target surface appropriate for treatment can cause such activation . the eye would be too sensitive to the touch . a child trying to push the multiple members with his fingers would find it difficult to coordinate such a multiple push without also at least partially blocking the beam . the circuit preferably precludes the emitter from emitting the energy unless the first member is depressed . the amount of depression can be less then 5 mm and preferably less than 3 . 5 mm and most preferably less than 2 mm . an aiming beam is also contemplated , preferably one having a lower energy density , and / or a different wavelength from the main emitted energy . said aiming beam can be on when the device is turn on and operate independently of the member that control the activation of the main beam because the aiming beam energy is substantially less powerful than the treatment energy that is designed to operate at power level sufficient for surgical or therapeutic purposes or at power levels designed to achieve tissue modifications or cosmetic improvements . the invention also contemplates a second member so that the device control circuit also couples activity of the emitter with movement of a second member . the characteristics of the second member can be similar to that of the first member described above . the invention also contemplates the possibility of the first and second members are coupled to a common foot . if both members are coupled to the common foot a better stability of operation may be obtained . 13 . the device of claim 1 , wherein the first member includes an expanded portion that absorbs at least 30 % of the first energy . the invention also contemplates the device discussed above with the first member being cooled to protect the surface of the treatment target , for example the surface of the skin . if the surface of the skin is subject to high treatment energy , the first member may be cooled so that when it is in contact with the skin it keep it cooled . for example , the surface of the skin may be cooled below 10 degrees c ., and preferably below 5 degrees c . and most preferably below 3 degrees c . in this embodiment the cooling element can be any cooled component capable of serving as a first member as described above but also cooled to so that upon contact with the skin it will absorb some of the skin temperature . for example , said first member can be passively cooled in a refrigerator or a freezer and brought to the desired temperature so it can bring the surface of the skin down to the temperatures described above . alternatively and preferably , said first member can also be actively cooled . the invention also contemplates using the first member of the device discussed above to incorporate an active cooling element capable of cooling the skin upon contact . in this embodiment , the cooling element can , for example , be made of similar material to those used in thermoelectric coolers ( tec ) and incorporated into the first member . the cooling element can , for example , be made of tec so it also serves the function of the first member as described above . the cooling element can further comprise active cooling element that actively cools the first member for example , a circulating coolant such as freon - like gases can be used to circulate inside said member to actively cool first member . the invention further contemplates incorporating the member of the device as a cooling element that has sufficient cooling capacity such that when the energy is applied at an energy density of at least 15 j / cm 2 to a skin having an epidermal - dermal junction , the junction remains below 50 degrees c . the invention further contemplates that that when the energy is applied at an energy density of at least 10 j / cm 2 , and more preferably at an energy density of at least 5 j / cm 2 and most preferably at an energy density of at least 1 . 5 j / cm 2 to a skin having an epidermal - dermal junction , the junction remains below 50 degrees c . the invention further contemplate that the cooling element is activated at a predetermined time subsequent to a detected movement of the first member . the amount of movement and required force on the member should be similar or greater to that required to activate the energy source . thus , preferably , an activation of the energy source , also activates the cooling element . most preferably , the movement of the first member as described above , should activate the cooling element prior to the activation of the energy source and the emission of energy . for example , the activation of the cooling element subsequent to the detection of movement of the first member should precede the activation of the energy source by about 1 second , and more preferably by about 0 . 2 seconds and more preferably yet by about 0 . 1 second and most preferably by about 0 . 05 second . the invention further contemplates that the first member includes a fluid path through which a fluid is dispensed . for example , the foot of the first member can be hollow and contain , for example , a therapeutic fluid such as benzyl peroxide for the treatment of acne . alternatively and also preferably , the fluid may be , for example , antibiotic for reduction of bacteria , or ala compound to be followed up by a light dosage for a photodynamic therapy ( pdt ) treatment . most preferably the fluid can , for example , contain vitamin and minerals , or nutrient to nourish the skin or hydrate the skin . the fluid path within the member can be designed , for example , to include a series of perforation at the foot of said first member , said perforations are blocked by , for example , a membrane or a thin film that can be actively coupled to the device circuit so that the membrane or thin film are removed and allow flow of the fluid through the perforations and onto the skin surface upon detection of the movement of the first membrane . preferably the invention also contemplates that the first membrane that include a fluid path through which fluid can be dispensed includes a foot , wherein the surface of the foot of the first membrane is rough or contain shaper edges , for example edges that protrude beyond said foot surface from about 0 . 01 mm to 0 . 6 mm . such a design will allow the foot to remove some of the skin upper layers as it contacts and moved across the skin surface , thus enhancing the delivery of the fluid contained within the first member or within the device across the surface of the skin and into the skin . in a preferred embodiment the invention further contemplates that the first member includes a resistive heating element that allow heating of the surface of the skin . the resistive heating element may include a resistor capable of heating the surface of the skin to less than about 400 degrees centigrade , and preferably to less than about 300 degrees centigrade and more 200 degree centigrade , and more preferably yet to 150 degrees centigrade and most preferably to less than about 75 degrees centigrade . preferably , the resistive heating element within the first member heat surface for a time duration of about 3 minutes , more preferably to a time duration of about 2 minutes , more preferably yet for a time duration of about 1 minutes , alternatively and also preferably for a time duration of about 1 minute or less , more preferably yet to a time duration of about 200 ms , and most preferably to a time duration of about 20 ms or less . preferably , the resistive heating element within the first member also include an insulating layer distal to the heating element . said insulating layer may be composed of teflon or polycarbonate or other suitable insulating element . alternatively and preferably said insulating layer may also be transparent to the device energy , for example , made of polycarbonate , glass , or clear plastic . alternatively and preferably , the insulating layer may be transparent to the device energy , electrically insulating but allow some heat conduction for example , made of sapphire . from a method perspective the invention contemplate a method for treatment of skin ailment wherein energy is applied to a targeted surface but said energy is allowed to interact with the surface only if a step of disturbing a member actively coupled to the circuit that triggers the emission of the energy , takes place first . in this preferred embodiment takes the following steps : aiming the energy generating source at the target area . bring the energy generating source to the vicinity of the target area , allow a first member probe to interact with the target area , the interaction step then generate a feedback signal to the energy source that at a pretty determine level , for example , if the first member experience a force sufficient to , upon contact , cause discomfort to a human eye or injured area of the target skin , allow the final step of energy emission direct to the target area on the skin to take place . in yet another preferred embodiment , the device the first member also prevent the device from contacting the targeted material . alternatively and preferably said first member prevents the device from coming into a direct contact with the skin . this is important to avoid overheating of the skin if the window or lens allowing the energy to emerge from the device and into the targeted skin tissue become over heated as it is used to treat the skin ailment . thus even without being cooled , possible heated device transfer of thermal energy is minimized due to first member preventing the device from coming into a direct contact with the skin . the present invention also comprise a device that can be operatively coupled to any existing or contemplated medical or home use treatment device to prevent exposure of eyes or other sensitive skin or tissue to any form of dangerous or unsafe mechanical energy , for example , first member can be inserted in the mechanical energy carrier path , for example a needle , vacuum suction , dermabrasion , microdermabrasion , or a blunt mechanical energy carrier , to prevent activation of said mechanical energy carrier unless first member is moved to a predetermined level . thus first member may for example , be actively coupled to mechanical energy carrier so it is not activated unless the first member is depressed by less then 5 mm with a force that is sufficient to cause discomfort to the eye or injured tissue . alternatively and preferably , said first member may have to be pressed by less than 2 mm and most preferably less than 1 mm . in yet further elaboration of this preferred embodiment , first member may be coupled to a foot . the foot is designed to contact the targeted skin . when the device is pressed again the targeted skin as described above , the emitted energy or mechanical energy carrier ( for example a needle ) is activated and pass through an opening in the foot to impact the skin . the pressure of said first member and the foot it is couple too is sufficient to reduce the amount of pain caused by said energy or mechanical energy carrier ( for example a needle ) as it impact the skin or target tissue . for example , the pressure the first member and the foot it is couple to preferably exert a pressure on the skin that is sufficient from stopping blood flow to the skin in order for said energy source to be activated . in a further preferred embodiment of the present invention the circuit precluded the emitter from emitting the energy unless the first member is depressed by a force sufficient to reduce blood circulation in the skin above the mid - reticular dermis . in an additional preferred embodiment of the present invention , the device include an energy carrier for example a needle and the circuit in the device preclude the needle from moving toward the skin unless first member is depressed by a force sufficient to reduce blood circulation in the skin above the mid - reticular dermis . in an alternative preferred embodiment of the present invention , the present invention comprises systems , devices and methods in which a device has an emitter that emits a first energy along a path , a member that extends at least partially into the path and a mechanical coupler that couples activity of the emitter with movement of the first member in a preferred embodiment the circuit or mechanical coupler precluded the emitter from emitting the energy unless the first member is depressed by a force sufficient to reduce the sensation of pain . additionally and preferably , a method for treating tissue with energy is described , the method comprises : directing the output of an energy emitter towards a tissue ; extending a first member at least partially into the path the energy would follow between the energy source output and the target ; coupling the activity of the energy with the movement of the first member . the device described herein utilize light energy , heat energy , or a combination of the two for selective surface heating that allows the user to achieve temporary pore enlargements for cleaning of the skin pores and expulsion of unwanted debris and undesired substance filling the pores , thus reducing the size of unseemly pores and enhancing the health and appearance of the skin . the method also contemplates thermal energy and light energy deposition into the skin to allow selective injury to the upper layers of the skin and new more elastic collagen production . the devise described herein is also designed to allow treatment of the skin more effective with possibly with lower doses of rejuvenating agents . the controlled damage to the epidermis and upper layers of the dermis , that result in new collagen production , and “ top and bottom ” action via the use of a combined optothermal action through enhanced absorption due to a heating element at the top or action of an absorbing substance at the top and optothermal light to thermal energy conversion throughout the target skin volume . the present invention describes a safety device that can be attached to any laser , light or energy based therapeutic device . it can also be attached to any energy emitting diagnostic or imaging devices if the emitted energy pauses danger to the eyes or to sensitive tissue or skin on a human or animal body that can be damaged . the invention described herein can also be attached to any mechanical or thermal or other medical device that can , upon contact with the eye or sensitive tissue pose danger or cause damage to said eye or sensitive tissue or skin area . a compact hand held device that can be safely used by adolescents and adults wishing to improve the texture and appearance of their skin and to minimize the appearance of acne , blemished skin , or fine wrinkles . it is an object of the present invention to provide a device and method for treating skin conditions , reducing the appearance of fine lines and wrinkles , and clearing skin from blemishes and pigmented spots . another object of the invention is the reduction , management and control of hair on the surface of the skin . another object of the present invention is to provide a hand held device that can be used safely to treat with light or heat or both a controlled amount of tissue and in particular to achieve one or more of the following : skin tissue to allow skin rejuvenation , hair removal , hair reduction , hair management , fine line reduction , collagen regeneration without collateral damage or excess damage adjacent tissue while enhancing skin condition and appearance . in one embodiment , the present invention comprises a hand held device with an on / off switch and a button that allow the device to emit pulsed energy to treat the tissue in contact with the device . in this embodiment , to ensure that the device is activated only when it is in contact with the skin , one or more protruding guards ( pg ) extends in front of the treatment head and allow activation of the device only when all the pg are fully pressed to a predetermined level . this feature is specifically designed to ensure that the device is not activated when placed in front of the eye or other sensitive skin or tissue locations . for example if the device is placed in front of the eye , the protruding plastic or metal guards ( or any other material from which we make the pg ) will cause the eye to close instinctively . the idea is that the pressure or contact in particular mechanical contact of a rigid physical object with the eye or sore or damaged skin or tissue , would cause a sensation of pain or discomfort , would cause the treated person to jerk away or remove or object to the contact . if the device can be activated only after a firm contact and mechanical pressure has been established between the device &# 39 ; s pgs and the target tissue , the patient or person subject to the intended treatment would not willfully or unconsciously allow the device to be activated and the treatment to proceed , thus the treatment subject or patient will not allow damage to such sensitive target area to occur . obviously the aim of the device is to treat the skin not the eye . but if one is not wise enough to avoid aiming the device into the eyes , the device will not fire and not emit its energy ( thermal or optical , or otherwise ) unless it is in close contact against the skin and the pg pushing against it . obviously sensitive locations like the eye will instinctively close to avoid the touch . also areas with skin burns or skin ailment will become uncomfortable under contact with the pg , and one will not want to push the pg against these skin locations , and certainly not push very hard at these locations , thus not allowing the activation of the device . when it is placed on a healthy tissue , the plurality of pgs are pressed in and the device is allowed to fire . a battery within the device powers a circuit board and drives a short pulse of current through a resistor to allow the generation of a heat pulse . the thin film resistor heats up with sufficient energy to cause skin rejuvenation and induced a biological response improving the appearance of the skin . typical energy delivery time duration is less than about 3 sec . optical and thermo - optical energy are responsible for tissue targeting although chemical processes ( such as pdt ) as well as optical or thermal induced mechanical processes . optical , thermal , chemical or mechanical responses in the tissue induced by a flash lamps or thermal energy generator together with a protruding guards that allow activation only in tissue safe areas a biological response that enhances skin appearance . the total heat energy transferred is low enough to prevent burns , typically less than 50 j / cm 2 and for most applications less than 10 j / cm 2 . for consumer applications an energy density of less than 2 j / cm 2 is contemplated and preferably less than 1 j / cm 2 . in another embodiment , of the present invention an electrical energy source is used to generate thermal pulses of energy . in yet another embodiment an optical absorbing layer that is heated by flash lamps within the device is used to create thermal pulses . the flash lamps are fired by a short discharge , which produces broadband light . such light can be filtered to produce specific absorption and specific tissue effects such as photothermolysis . depending on the desired final temperature of the optical absorbing layer one or multiple flash lamps can be fired simultaneously to combine their light under a single reflectors directing the light into the target skin . alternatively , lamps can be fired in sequence to result in broader longer pulse duration of energy . again , thermal conduction transfers the heat to the skin and causes a biological response that enlarges pores to enhance product or medicine delivery , clears acne , induce rejuvenation of the skin , and produce new collagen . the total heat transferred is low enough to prevent burns , typically less than 50 j / cm 2 and for most applications less than 5 j / cm 2 . in this embodiment , the absorbing layer can be designed to allow some light to be transmitted . for example , blue or uv light could be transmitted to interact directly with tissue and kill bacteria directly . one object of the present invention is to provide a device and method for treating acne as well as inserting and removing material from the skin . to accomplish this the invention contemplates in a preferred embodiment heating up the top layer of the skin so it expends . the expansion of the skin or a portion thereof , ( for example the top layers of the skin such as the epidermis , epidermis and dermis and epidermis and a portion of the dermis ) causes a relative displacement of every point on the skin with respect to an adjacent point . such an expansion , similar to the expansion of a balloon or the theory of the expanding universe , results in enlargement of pores and breakup of intercellular , and interlocking substance plugging pores or opening on the skin , and in increased skin porosity . note that unlike prior art that used to heat up the skin for the purpose of ablation , or natural occurring heating of the skin through hot baths or hot compresses , sunlight or space heaters , the heating of the skin contemplated by the present invention is design for the purpose of achieving sufficient heating of the top layers of the skin so that its expansion result in pore opening and increase skin porosity but not in damage to underlying viable tissue or irreversible damage to the skin or ablation or removal of skin components . expanding universe model ( eum ) for treatment of skin conditions and acne : fig1 a illustrates such an expansion of the skin ; the increased of distance between each and every adjacent point on the skin surface and the resulting opening of pores and other surface skin structures . in the figure , a preferred embodiment of the desired effect contemplated by the invention is described and the way to achieve this effect is also described in the following preferred embodiment . in fig1 a , 1 a 1 and 1 a 11 are schematic representation of the dermis and epidermis respectively . the locations on the surface of the epidermis , locations 1 a 17 , 1 a 12 , and 1 a 15 are separated , for example by , for example , 5 mm on the surface of the epidermis . if for example rapid heating of the skin is achieved by , for example , an electric , electromagnetic , light , or microwave heating of the skin , the skin will expand rapidly , like a balloon to the dimensions shown in the left side of the arrow , dimensions shown in 1 a 10 and 1 a 110 , for the dermis and epidermis respectively . the spots 1 a 17 , 1 a 12 , and 1 a 15 will now be further apart , for example , separated by a linear distance of , for example , 10 mm . the new locations are represented by 1 a 170 , 1 a 120 , and 1 a 150 . clearly , if the locations 1 a 17 , and 1 a 12 for example represent the initial position of two opposite ends of the pores , the new locations 1 a 120 and 1 a 170 represent an expanded pore whose diameter is now about twice as large and thus its surface opening is 4 times as large . note that to relieve liquid pressure due to sebum build up even a few microns of increased pore opening diameter will suffice . similarly , an increased in the pore opening diameter of only a few microns is sufficient to allow the enhanced penetration of liquid or fluids into the epidermis in to even to the dermis . the object of the present invention is to provide a device and method for treating hair and various skin conditions and ailments . for example , the device may be used for hair removal or reduction of hair follicle counts , treatment of psoriasis , acne , ( active acne , pimples , or scars ) reduction of wrinkles , fine lines , skin lesions , and / or general improvement in the appearance of the skin . another object of the present invention is to provide a device that can be used safely to treat a tissue without undesirable injuries to the skin . one of the features of the present invention is a mechanism to ensure that only healthy and indented tissue targets are treated . for example , both in the professional office ( physicians , dermatologists , plastic surgeon , aesthetician , hair dressers , cosmetologists , nurses , ob : gyn ) and for consumer use , there is an important need to ensure that no light or other form of energy would be applied to sensitive targets such as the eyes , or tissue and skin sites that are sensitive or injured . the present invention provide for such a mechanism . by utilizing a protruding guards or protruding arms that control the activation of the energy source , the protruding arms can prevent firing of the energy source unless they are ( all or part of them ) physically depressed to a certain level . the idea is that a sensitive target like the eye or the surface of the eye will not support that kind of mechanical pressure by the protruding guards ( pg ). furthermore , the eyelids instinctively shut or close when in contact , or even when approached by a mechanical object . such pg can be made of transparent material to minimize light energy source in the case of light energy use ( lasers , ipl , flash lamps , leds , or other light sources ) such pg can be made of cooled components or cooling parts to also serve to protect the epidermis from injury . for example they can be made of peltier cooler / thermoelectric cooler ( tec ) so that they can cool the surface of the skin as they make contact . the polarity of the peltier coolants can be quickly reversed so that these pg can be used alone or in combination with light or lasers , or rf or microwave sources , to heat and treat the surface of the skin or tissue . in a preferred embodiment the energy from the device is not able to be applied unless and until the pg are depressed to a predetermined level . the requirement of depressing the pgs is important for at least two reasons : the eye or sensitive or injured area of the skin or tissue , will not tolerate the contact and thus no activation of the energy source is possible and no injury will result the contact and depression of the pg require the output window to be spatially in close physical proximity to the skin or tissue surface or whatever the target is . this , in the case of light , lasers or any other em energy or thermal energy or radiative energy source , means that the energy is not spread over a large surface area but is directed and intercepted quickly with the intended target surface . in fig1 a hand held home use hair treatment device generally includes a flash lamp 100 is powered by a battery 110 or a power plug 120 which charges a capacitor 130 . the lamp 100 is willfully triggered and controlled through the use of a control board 140 and an activator switch 150 . the lamp 100 ( or any other energy source ) is housed in the consol 10 and its operation is also controlled by plurality of guards 30 . the protruding guards are protruding out of side of the device 10 facing the skin or the human body . the guards 30 are connected to the controller of the lamps and do not allow the lamp to fire unless they are all depressed to at least a predetermined depth . for example the predetermined depth can be such that the lamp is in close enough proximity to the target tissue or skin so that most of the light from the lamp 100 can not escape sideways and is only directed forward towards the skin . the energy source 100 can be laser or light source , flash lamps , led , rf , microwave , any kind of electromagnetic ( em ) energy source , any kind of radiative em , energy source , thermal energy source , or thermal cooling source ( negative or out of the target area flow of energy ) energy source . only when all protruding guards 30 are full depressed can the flash lamp fire . this arrangement prevents accidental firing of the lamp into the eye . the protruding guards 30 can be made of transparent material such as , for example , plastic or glass . the idea is that a protruding guards ( pi ) array 30 will ensure that the eye is closed prior and before firing of the lamp . fig2 shows the same device as in fig1 except that the protruding guards ( pg ) 30 are made of transparent material to minimize intercept of energy . by making the protruding guard 30 from transparent material , the energy from the source can travel with minimal interruption , minimal scattering and minimal absorption down the path towards the skin or target material . the pg 30 may also be made of substance capable of cooling the surface with which it is in contact so allow protection of the epidermis , further energy control , energy removal from the target tissue or surface being treated . the pg 30 may also be made of both transparent substance which is also capable of cooling the surface with which it is in contact so allow protection of the epidermis , further energy control , energy removal from the target tissue or surface being treated fig3 shows the same apparatus as in fig1 except that instead of a plurality of protruding guards pg only one is being used , 30 . the protruding guard can have all kind of desired properties : it may be made of cooling ( active or passive cooling ) so as it is pressed against the skin it also cools . it may be made of transparent material to allow more energy to get into the skin . it may be made of substance or mechanism capable of heating or energizing the skin or delivery energy into the skin . it may be made of absorbing material so that as it is being pressed against the skin it also absorbs energy generated by a light or lasers or any other em radiative energy source to absorb the energy and conduct it further into the treated surface or targeted surface . a predetermined “ press level ” i . e . the amount of physical depression in of the protruding guards pg in the direction of the arrow , can be determined and built into the device . fig3 also shows such a pre - determined depression of the pg , 301 , before they allow activation of the device . such a displacement in the pg extension out of the treatment head surface 305 can be built into the device to prevent firing before the device is brought to such predetermined proximity to the surface of the target area . the pg can also have a maximum “ collapse distance ” or press - distance where the pg can then prevent a contact closer than the predetermined level . the above descriptions and illustrations are only by way of example and are not to be taken as limiting the invention in any manner . one skilled in the art can substitute known equivalents for the structures and means described . the full scope and definition of the invention , therefore , is set forth in the appended claims . fig4 also shows the device contemplated by the present invention with the inclusion of a spring loading 309 to ensure that the protruding guards ( pg ) return to their un - depressed position once the device is removed from contact with the skin . it also shows the skin 312 in beginning to make contact with the pg in its initial extended position . specification and further preferred embodiments of various components of device with pg in further embodiment the invention contemplates a device for reducing the presence of hair on the body , the device may comprise a light source , laser source , or any other source of electromagnetic energy , or other form of energy directing its energy towards the surface of the skin , a plurality of protruding guards extending from the device surface towards the skin surface , the protruding guards do not allow energy source activation unless they are pressed to a predetermined level so that the entire device is sure to be in close proximity to the surface of the skin and the protruding guards are in contact and apply pressure to the surface to be exposed to the source energy , in a preferred embodiment the device above may further comprise a cleaner to clean the target area on the surface of the skin , a an substance capable of absorbing at lease some of the energy of the hand held light source , a massager or substance driver capable of massaging the substance on the target area of the skin or driving at least some of the substance into the skin , a cleaner capable of cleaning the target area on the surface of the skin a light activator capable of activating the handheld compact light source in further preferred embodiment the device above may further comprise a conditioner - containing component capable of applying conditioning creams , lotions , or any other substance to enhance the skin appearance and condition . in a preferred embodiment the invention also contemplates a method for reducing the presence of hair on the body , the device comprising : removing the hair from the target area on the surface of the skin targeted for treatment , cleaning the target area on the surface of the skin applying to the target area of the skin a substance capable of absorbing at lease some of the energy from a handheld light source , massaging the substance on the target area of the skin cleaning the target area on the surface of the skin , activating the light source from the handheld light source in a preferred embodiment the method above further comprises a substance capable of enhancing the skin condition and enhancing the skin appearance . in a preferred embodiment the device above may further comprise wherein the light source is a flash lamp . in a preferred embodiment the device above may further comprise at least some of the absorbing substance is allowed to remain on the surface of the skin and is not cleaned off . in a preferred embodiment the device above may further comprise a massager which is an instrument capable of generating mechanical vibration in a preferred embodiment the device above may further comprise the massager above which is capable of generating mechanical vibration or function as an ultrasound source of energy . in a preferred embodiment the device above may further comprise the massager or substance driver mentioned above which is also a thermal element capable of heating the skin to a predetermined temperature range and a predetermined range of lengths of time . in a preferred embodiment the device above may further comprise the massager or substance driver which is an opto - thermal element . in a preferred embodiment the device above may further comprise the opto - thermal driver element which us a hand - held light source energy which absorbed by a layer of substance or a film capable of absorbing the light energy . in a preferred embodiment the method discussed above may further comprise an absorbing substance which is driven into the skin by a mechanical massager or an ultrasound . the method of the preferred embodiment contemplated above may further comprise the absorbing substance being driven into the skin by opto - thermal means . this preferred embodiment may further comprise the absorbing substance being driven into the skin by placing a high absorbing film in contact with the skin and illuminating the high absorbing substance with a light source . preferred embodiment may further contemplate the absorbing substance being driven into the skin by thermally heating the surface area . alternatively and preferably the method of the present invention may contemplates the absorbing substance is driven into the skin by heating the skin area to a predetermined temperature range and a predetermined time duration . in a preferred embodiment the contemplate a device for controlling hair growth comprising : an optical element with variable power levels , at least one light source , a circuit to deliver a fixed amount of energy to the plurality of light sources , means to activate and trigger circuit . the device further contemplates the circuit capable of delivering a predetermined amount of energy to the plurality of light source also allows the user to adjust the light source power level such that no permanent damage or alteration occur to any living tissue in the target skin . the invention further contemplates a device for reducing the presence of hair on the skin , the device comprising : a handheld compact light source . a circuit to deliver a predetermined amount of energy to the light source , a trigger to activate and trigger the circuit . in a preferred embodiment device above would have a flash lamp as a light source of energy or an led as a light source of energy . a preferred embodiment may also contemplates an applicator capable of applying a substance which is capable of absorbing at least some of the light source energy prior to light activation . furthermore , the applicator capable of applying a substance which is both absorbing at least some of the light energy and thermally conduct the absorbed energy down the hair shaft . in yet another preferred embodiment shown in fig5 the device for treatment of skin conditions and hair treatment incorporating a treatment head . the device includes a plurality of windows 500 for the sources radiation or energy to flow therethrough onto the skin surface . the treatment head also incorporate a frame 510 to mount the window into the treatment head body 505 . a plurality of protruding guards ( pg ) 515 is made of rods 520 . the rods 510 can be made of metals , for example , aluminum or stainless still , or plastics , for example polycarbonates ( such as the commercial brand lexan ), or teflon , and preferably made of biocompatible material . the protruding guards are connected to a contact base 525 , which can be made wider than the rods to make for a lower pressure on the skin ( since pressure is force over area and the area of the foot plate ca be made larger ) and a more comfortable contact . in a preferred embodiment , the invention contemplate using protruding guards in the following locations on the device output tip . these locations are shown in fig6 . the protruding guards , 610 can be mounted in around the window 500 as shown by the triangles , 610 , ( for example in the middle of window 500 , as shown by the triangles 610 ), or even to form a shield around the window 500 , ( the shield is shown by 510 ), wherein the shield 510 , plays the double role of both interlocking and preventing operation of the device unless the shield , 510 is fully pressed to a predetermined level , and , shielding and preventing radiation from coming out through the side of the window ( i . e . so that all radiation is directed into the target skin and substantially other radiation is prevented from leaking or propagating sideways into the eye or other unwanted directions ). alternatively additional protruding guards ( pgs ), 620 can be placed around the window . fig7 shows another preferred embodiment for the protruding guards contemplated by the invention . the pg can be mounted with coiled springs 710 , or spring loaded mount so that the springs push back on the pg when the pg are pushed by the contact with the skin . this allows the pg to be ready for the next use as soon as the treatment head is lifted off the surface of the skin and the pg is ready for the next use . an example of a possible preferred embodiment of the interlocking that prevents the energy source ( for example , a plurality of flash lamps , 730 ), from firing , is also shown in fig7 . when the pg 515 , are pushed back by the pressure generated from a contact with the skin , they force a lever 737 to push a switch 740 that close a circuit 745 . the closed circuit in turn , allows the discharge current to flow from a plurality of capacitors 750 to the energy source , 730 , for example , the plurality of flash lamps , 730 . in a preferred embodiment shown in fig8 at least one protruding guard , pg , 630 is positioned in the light or radiation pathway 735 , the pg 630 must make a firm contact with the skin so that unless it is pressed to a predetermined level the light or energy source can not be activated . in a preferred embodiment at least one protruding guard , pg , 630 is positioned in the light or radiation pathway 735 , the pg 630 must make a firm contact with the skin so that unless it is pressed to a predetermined level and create a minimum of pressure on the skin , eye , tissue , or any target material it is in contact with the light or energy source can not be activated . the pressure exerted on the eye , skin or any target material must be at least of sufficient magnitude to cause discomfort in the , eye , skin or tissue if it injured , suffer from lack or damaged epidermis , or is susceptible to injury . also , the pressure at the target material must be at least of sufficient magnitude to cause discomfort in the eye , if it is place over the eye or in the vicinity of the eye or tissue if it injured , to create a response of wanting to close the eye , to create a response of wanting to remove the object form the eye , or both . in a preferred embodiment shown in fig9 , the entire window 910 serve as a protruding guard by being capable of being pushed into the device . the whole window is physically pushed inward by a pressure greater than that required to cause pain on sensitive skin or to trigger eye lead closing reflex . the lamp 933 or any other energy source in the device 920 will not fire unless the window is pushed to a predetermined level . alternatively , a film or filter 943 in front of the window may serve as a protruding guard if we require that such a film or filter will be pushed into a full contact with the window before the device energy source can be activated . alternatively and preferably the window or lens 1080 may be made with compartments 1083 , containing fluid to be dispensed during operation of the device to apply topical fluid to the target skin . in another preferred embodiment shown in fig1 the invention contemplates a device which is capable of first delivering a product through the epidermal and possibly also through the dermal barrier and then activating the delivered product when the has film has been removed and a does of light is delivered to the tissue in a subsequent step . for example , the preferred embodiment shown in fig1 illustrates the delivery of a substance capable of retarding hair growth and then delivering a dose of light to activate the substance and enable the action of the substance reducing hair growth . this is shown in fig1 : in this preferred embodiment , a substance capable of promoting hair growth ( for example , minoxidil ( brand name : rogaine )) may be applied to the surface of the skin and then delivered with the enhanced action of the present invention optothermal delivery device . alternatively and also preferably a hair growth prevention compound or medicine such as those used in photodynamic therapy ( pdt ) and light combination hair reduction therapy ( for example a compound such as those known as ala ) may be applied topically to the surface of the skin and then may be applied to the surface of the skin and then delivered with the enhanced action of the present invention optothermal delivery device . as described elsewhere in the specifications , the rapid loading of thermal energy at the surface of the skin results in the expending universe skin treatment model ( eustm ). the eustm allow the pores and other skin openings ( for example inter - cellular spaces ) to expand and open thus allowing enhanced products , compounds , or medicine delivery into the target tissue or organs ( for example , hair roots or hair papilla or hair matrix feeding the hair follicles ). alternatively and preferably , the present invention contemplates also delivering substance capable of modifying or damaging the function of other targets in the skin such as sebaceous glands or fat tissue cells , or any other organ or tissue under the skin surface we desire to modify . as shown in fig1 , subsequent to the delivery phase , the tip on the device may be changed to a transparent or partially or fully transmitting tip , capable of transmitting the energy or light itself into the skin . the device is activated to deliver a dose of light or other form of energy that is capable of activating the delivered substance in order thereby retarding or eliminating hair growth or modifying the function of the targeted tissue or organs under the skin . the sequence of action , device and method are shown in fig1 . as the figure shows , a substance capable of enhancing the retardation of the hair growth 1010 , is applied to the skin surface , 1020 , the device contemplated by the present invention , 1000 , equipped with an opto - thermal delivery head , 1030 . the opto - thermal delivery head 1030 is capable of converting input energy , preferably , but not limited to electromagnetic energy , into heat , the heat energy result in rapid energy deposition of energy into the skin surface 1020 and expansion of the skin surface 1020 , the thermal energy , subsequently , allow the hair growth retarding substance 1010 to better penetrate the surface of the skin 1020 and enter into the epidermis and dermis 1040 . fig1 shows the next step in such a preferred embodiment , wherein the opto - thermal delivery head 1030 , is removed , the light 1033 or electromagnetic ( em ) energy 1033 from the energy source is allowed to penetrate the skin 1040 , where the substance capable of retarding hair growth 1010 , has now penetrated deeper into the skin 1040 , and into the vicinity of the hair follicles 1055 . the light or em energy then either activate the hair growth retarding substance , 1010 , or enhance hair growth retarding effects of the light or em energy itself or , both ( i . e . the light or em energy both help retard hair growth , and enhances the effect of the hair growth retarding substance ). in yet another preferred embodiment a layer of substance such as hair wax is used to cover the surface of the skin including the hair on the skin surface . the hair is then pulled out of the skin in the process , removing the substance that is covering the surface of the skin ( for example a layer of wax ) from the vicinity of the hair follicle opening . in a preferred embodiment , the layer of substance covering the surface , for example wax , may also be highly reflective . when the hair is pulled out of the follicles , it removes with it some of the substance or was leaves a relatively absorbing regions so that when light or energy is directed to the surface of the skin , most of the energy is reflected from most of the regions of the skin and only energy or light impinging on the regions in the vicinity of the removed hair follicles , where the reflective substance has been removed , is absorbed by the skin , penetrate the skin and propagate further down the skin towards the targeted tissue or organ such as hair papillae , hair roots , or sebaceous glands . the purpose of the following preferred embodiment of a device is to allow an efficient consumable , consumable intermediate element that allows conversion of energy from a low cost source of energy , into one tailored for use in dermatology and in treatment of skin conditions . fig1 shows in a preferred embodiment the components of the device to accomplish such energy conversion . it include an intermediate medium , for example a plastic window or glass slide 1220 with thickness ranging form about ¼ of an inch to about 1 mil ( about 20 micrometer ) and preferably with thickness ranging from about 1 / 64 of an inch to 1 / 32 of an inch . the slide can be made of mylar , polycarbonate , or glass , and preferably from a material that is substantially transparent to electromagnetic radiation in the range of from about 350 nm to about 3 micrometer and preferably in the range of about 400 nm to about 1200 nm , but blocks out harmful uv radiation . for example , a substrate of polycarbonate material may be used . a further elaboration of the present invention contemplates a third layer , 1225 , of high absorbing substance deposited onto the window layer 1220 . the high absorbing layer can be made of metallic substance machined or modified to absorb at least some of the radiation in the range of from about 350 nm to about 3 micrometer and preferably in the range of about 400 nm to about 1200 nm , such substance may also consist a layer of black pink , china ink , indochin green , or any other substance capable of absorbing the radiation in the range . it may also consist of roughing a metallic surface or etching a metallic surface so it traps light and absorbs it , or it may consist of roughing the substrate window 1220 and then painting it or coating it with carbon based absorbing substance , absorbing paint , or any other film or layer of high absorbing substance . a further elaboration of the present invention , contemplates a third layer , 1227 , of high reflective or metallic substance deposited on top of the substance of high absorption layer 1225 . the layer , 1227 , place on top of the layer of high absorption 1225 place on top of the window substrate 1220 , is layer of substance capable of reflecting the radiating energy from the energy source , 1229 may be placed . such a substance may consist of a layer of metallic substance . such a layer of metal substance may , for example , be a layer of aluminum foil , a gold foil , a copper foil , or other metallic layers . such a layer 1227 , may also be deposited by vapor deposition of metal , galvanic methods , painting of metallic or other reflective compound to the window substrate , or other methods , known in the art and familiar to a person with common skill in the art , to allow adherence or contact or attachment of the metallic layer 1227 to the substance of high absorption and to the window substrate material 1220 . such a layer of metallic material 1227 may serve two purposes , one to reflect any unwanted radiation away from the skin , and two , to even out the distribution of thermal energy across the treatment area . in further embodiment , a series of opening of a predetermined pattern are made in the layers 1225 , and 1227 so that energy from the source , 1229 may be allowed to travel through the window 1220 and the various subsequent layers 1225 , 1227 to the target skin to create the desired therapeutic effects , for example , skin rejuvenation and skin healing , treatment of scars and acne scars , and treatment and prevention of active acne . the sequence of layers between the energy source 1229 and the surface of the skin , 1233 is : a window substrate layer , 1220 , a substance of high absorption , 1225 , a substance of high reflection or a metallic substance layer 1227 , and a the series of holes or opening made through the layers 1227 and 1225 as represented by the holes , 1230 , the holes 1230 are holes in every layer 1227 , 1225 , except for the window substrate 1220 . in a further preferred embodiment , an opto - thermal coupler for flash lamp acne treatment device is treatment . we abbreviate it with : otc - ipot , or : opto - thermal coupler - intense pulse opto thermal wand otc - ipotw . in one preferred embodiment , slices of clear plastic windows , for example , polycarbonate material , or high temperature plastic ( i . e . a plastic that is capable of withstanding transient temperatures of up to about 1000 degree c . and preferably temperature of up to 370 degree c . or at the very minimum window material plastic capable of withstanding a temperature of at least over 200 degree c .) may be used as a window material to allow transfer of the energy from the energy source in the enclosure to the targeted material or skin . fig1 shows some of the features of and layer of such opto - thermal converter window . the window side facing the energy source , 1305 remain clear thus allowing energy and in particular optical or light energy to travel through it . a layer of high absorbing material 1315 is laid on top of the opposite end of the transparent window and a layer of high thermally conducting material such as aluminum foil or metal vapor deposition 1325 , is laid upon the layer of high absorbing substance 1315 . the layer of conducting substance 1325 can cover the entire window surface are or just a portion of it the aluminum foil ( normal or heavy duty ) machine / sanded and coated with absorbing black , glued to it and would range in thickness from 0 . 1 micrometer to as much as a mm and preferably from about 3 micrometer to about 200 micrometer . the layer of high absorbing substance 1315 can have similar dimensions except that its thickness can range from about 0 . 01 micrometer to as much as about 300 micrometer and preferably from 1 micrometer to 50 micrometer . optionally a plurality of holes are placed across each and every layer ( as a drilled column ) 1318 to allow some energy , electromagnetic ( em ) energy , light , or other radiating energy , to propagate through the windows and the sequence of layers to the skin or target surface . fig1 shows another preferred embodiment illustrating a method and apparatus for mounting an opto - thermal converter loading of onto a handpiece or a handheld device designed for converting source energy , preferably light or electromagnetic ( em ) energy , into thermal energy for treatment of targeted surface , skin , tissue , and skin ailment treatment and conditioning . the device includes , as described above , an energy source 1410 contained in the handpiece , the output window 1420 , a slide or filter made of glass , plastic , polycarbonate or other material , an source energy - thermal energy converter 1430 whose components are described above in relation to fig1 . the assembly 1430 has a notch in it , 1435 to allow it to be pushed against a clamp , 1440 , for example a piece of bent metal anchored on one side to the window 1420 or enclosure 1450 , and capable of exerting elastic pressure if its other end is lifted from its deformed position . when the slide or converted assembly 1430 is pushed with its notch 1435 into and under the clamp 1440 , is can then be held in place against the window 1420 . further , the an interlock 1460 can be inserted under the clamp 1440 or in other locations , so that when pushed by the edge of the notch 1435 in the converter assembly 1430 activation of the energy source 1410 is possible only if the converter assembly is pushed fully into and under the clamp 1440 , so that no energy is allowed to be emitted nor is the energy source 1410 activated unless the converter assembly 1430 is pushed fully in and placed properly over the window 1420 . optionally a layer of absorbing substance 1470 or substance capable of absorbing the energy of the source 1410 , followed by a layer or a coat of conducting material 1480 such as aluminum or copper foil , a layer of conducting metal such as vapor metal deposit is deposited or coated over the layer of substance capable of absorbing the energy source ( scaes ), 1470 . optionally the two layers 1470 and 1480 has holes or opening 1490 in them to allow at least some of the sources energy to propagate unperturbed or possibly filtered , into the target material or skin 1495 . finally the arrow , 1497 illustrate the direction of that the opto - thermal converter assembly 1430 should be pushed in order to slide under clamp 1440 and to fully press the interlock 1460 to allow activation of the energy source 1410 . fig1 shows another illustration of the way an opto - thermal converter or opto - thermal coupler assembly may be assembled and used with a spring - laded holder or clamp equipped with an interlock . here , a window 1515 is attached to the frame of the box 1510 to allow energy to come out from the energy source 1503 . the optothermal coupler or optothermal converter assembly 1505 is pushed in the direction indicated by the arrow 1525 under a clamp or a holder 1530 which can be made of a spring loaded or a metal clamp with elasticity so it can push down against the lower lip of the opto - thermal assembly 1505 notch , to hold it down and fixed in place . an interlock 1535 , can then be pushed by the lower lip of the optothermal converter assembly to ensure activation of the source only when the optothermal converter assembly is fully in lace and secured against the window . 1515 . fig1 shows another preferred embodiment for the design front opto - thermal coupler to be mounted on top of window 1630 in the enclosure . as shown in the figure a layer of supporting frame 1610 is attached by means , for example , of a double sided tape or velcro ® hooks and loops , 1620 into the frame 1605 or window 1630 . on top of the frame a layer , 1623 of substance capable of absorbing energy or em radiation is placed to be contacted with the targeted material or skin or tissue to be treated . on top of the layer of high absorbing substance a layer of conducting material can be placed . optionally holes in the layers of conducting material and high absorbing materials 1623 can be made to allow a pattern of direct energy , em energy or light from the energy source 1640 to emerge and contact the target material or skin or tissue directly . 1612 shows an alternative support frame for the optothermal converter film 1623 , the support frame 1612 has more holes or openings and more support structures and support lines in its frame . fig1 b shows a top view of one possible configuration of the frame 1610 and layer of high absorbing substance 1623 . the support frame height can possibly be between about . about . 0 . 0001 mm to about 3 cm , and preferably between about 50 micrometer and 1 mm . the film absorbing layer height can be from about 0 . 1 micrometer to about 2 mm and preferably between about 5 micrometer and 500 micrometer . ( where 1 mil is about 25 micrometer ). the high absorbing layer can be placed on a high temperature plastic , paper , tracking paper , a thin film or aluminum covered with absorbe , tracing paper . the thin film can be sanded or sand blasted or roughened to allow better adherence . 1612 shows an alternative structure of the support frame that could be used according to the teaching of the present invention . the use of a high conductive layer on top of the high absorbing layer in the opto - thermal converter assembly often can generate a hotter more energize opto - thermal converter with a more efficient conversation of the source energy into thermal energy . the reason it such a high conducting layer , for example , a layer of metal , or for example a layer of thin aluminum foil or a copper foil , each such foils of thicknesses from about 1 micrometer to about 1 mm an preferably from about 10 micrometer to about 150 micrometer , for example , foils such as those ready available for commercial use in the supermarkets , drug store etc . for example , regular kitchen use aluminum foil or “ heavy duty ” aluminum foil the apparent better heating of the high absorbing substance ( has ) coated aluminum foil or other metal foil , may be because if only has layer is used , some source energy , or em energy or light energy may leaks through the has layer into the skin , wherein with the metal or good conductor method , it does not . hence light bounces in the small cavity ( between the reflecting material coated reflector over the lamp , and the opto - thermal converter ), until fully absorb by the absorbing layer then rapidly conducted to the skin . yet another preferred embodiment is shown in fig1 . here , in this embodiment , the layer l 3 is now a transparent window ( from about 300 nm to 1400 hm ), the has coat layer is l 2 and a layer l 1 is made of aluminum ( or other conducting metal or conducting or insulation material layer l 1 ) is on top l 1 . the window l 3 has a cavity drilled in it where the holder h 1 ( spring loaded with fastener f 1 , to fasten to the box surface ) can be mounted . the whole assembly slide in the direction of the arrow μl to be mounted and held by the holder h 1 . alternatively , the layer l 3 can be a lamination over the has , and over the aluminum metal layer . alternatively , the layer l 3 can be a thin glass or transmitting plastic . where the light go through and into the has and aluminum . with the interlock / counter you can have no light while the otc is not in . and count how many times it is being put in . layer 1 ( l 1 ) can be aluminum , or a high temp plastic , or any other metal or conducting or insulating material . layer 2 is high absorbing . p 1 shows possible patterns . configurations : 1 ) a thin layer of 10 - 40 um aluminum coated with has . this allows rapid and uniform heating — generating a step function of heating = temporal heating profile . 2 ) a plastic layer with l 2 being has . this allows slower heating , slower — mellower diffusion profile . 3 ) with various holes shapes , that is a plurality of holes or perforations of various shapes in the layer of absorbing and reflecting or high conducting materials . holes are in aluminum , in has layer , in plastic , or a combination thereof . in yet another preferred embodiment shown in fig1 the reflector assembly for an energy source , preferably a flash lamp of the type use in flash photography such as disposable cameras or digital cameras , or possibly with up to about 3 to 10 times as much optical energy as those and preferably with a lamp up to about twice as long but with energy up to 2 to 4 times as much as those in disposable cameras . a simple flash lamp such as those used in disposable camera is used along with a window with metallic coating and high absorbing substance . the window can have the following dimension where , l is of course determine by the length of the window and is of about 0 . 5 cm to 2 cm and preferably 1 . 5 cm . the width , w , should be from about 0 . 2 cm to about 2 . 5 cm and preferably about 1 cm wide . the height of the reflector , h , ( for example an aluminum reflector ) can be from about 0 . 2 cm to about 4 cm and preferably about 1 cm . yet another preferred embodiment is shown in fig1 . here a method for reducing body fat and minimally invasive skin rejuvenation or face lift , or body shaping is illustrated . the method or device contemplated are as follows . an energy source , preferably a light source , a laser , an rf source or an electric heater source , is delivered into the tissue with small protruding probes . here an energy source 1940 deliver energy to probes 1950 which intern deliver the energy to the tissue , or skin , or target material , most often to the dermis 1920 or fat layer 1910 below the dermis . in a preferred embodiment of this method , the energy source deliver light or em energy or laser energy , or visible laser energy . in such a preferred embodiment , the probes , 1950 a hollow and contain optical fiber , for example capable of delivering laser energy . in a further elaboration of a preferred embodiment , such laser energy delivered from the source 1940 through the probes 1950 is of a visible or near ir wavelengths . in this embodiment , the probes or ducts are hollow tubes , for example , syringes and are capable of delivering energy and also a substance of high absorption ( has ) liquid or fluid stored in a container next to the energy source , 1960 . the substance of has contained in the container 1960 is then delivered to a point in front of the fibers or probes 1950 . preferably , such has can also be labeled with fluoresce material or radioactive label or other labeled that can be viewed with imaging systems ( imaging systems such as ultrasound , ct , pet , x - rays , cat scan , florescence imaging , oct = optical coherent topography or variation of oct , such as polarization sensitive oct , florescence detection , opto - acoustics detection , ir or thermal imaging or any other imaging system known to those skilled in the art . deposition of the such has fluid or liquid from the reservoir 1960 in the tissue , skin , fat or other target material can then be monitored with the above mentioned , imaging methods or other possible imaging methods known to those skilled in the arts , and the extent of the has or high absorbing liquid can be viewed and monitored . for example , spot of has 1975 can be created in front of the has delivery 1965 . the spot can be monitored with the above mentioned imaging system or simply decided upon by the determining how much has fluid to deliver though the tube 1965 . subsequent to the delivery of the has from the reservoir 1960 to the targeted region , the energy source can be activated and upon being absorbed my the has 1975 , damage to the targeted stained , or labeled , area can be achieved . for example , a carbon based liquid can be delivered or a pdt type material , or any other absorber can be delivered to the fat layer 1910 and subsequently a dose of light , for example a visible laser light , or incoherent broad band light , or light from superluminescent diode , can be delivered to the tissue are labeled by the has through an optical fiber or other energy delivery means such as hollow waveguide , metal tubes , or other light , em energy or other energy delivery means . a sufficient amount of light energy dosage or energy density , delivered for a sufficient amount of time can achieve irreversible damage or other type of damage to allow removal or denaturation or other effect on the tissue , fat or skin to reduce the amount of fat , achieve controlled coagulation , or other desired biological effect such as fat reduction , skin rejuvenation , selective destruction of cancer tumor or benign tumors or benign growths , or other desired effects . the amount of energy and energy dosage and energy delivered time parameters necessary to achieve such tissue effects has been studied and documented and are well known to those skilled in the art . yet another embodiment contemplate the deposition of nano - particles 1975 capable of enhancing absorption in front of the light delivery conduits or optical fiber and then , subsequently , delivering the light dose . for example gold nano - particles are capable of enhancing the absorption of the environment they are deposited in , thus , depositing gold particle in a tissue or fat layer to be targeted for destruction , or to be changed sufficiently so that it can be removed by artificial or natural means , or by the body own mechanism of removing denatured or altered tissue . thus the nano - particles can be imaged to pinpoint the location and extent of the targeted volume prior to activation of the source energy or light , and then possibly utilized to create specially localized absorption in the target tissue by the dose of light launched from the optical conduits or optical fibers . in a similar way , a method for treating wrinkles is also contemplated by the present invention . in a preferred embodiment , the device and method described by fig1 are used to create selective damage to muscle tissue responsible for wrinkles caused by muscular activity such as frown lines . in this embodiment , the method described above in connection with fig1 is used to cause temporarily or permanent damage or paralysis to the muscle responsible for the wrinkles , frown line , thus resolving the frown line or wrinkles or other deformation of the skin or tissue . in this case , the method works substantially in the same as described above for destruction or reduction of fat layers or tissue , except that in this case , the layer 1910 represent a muscle tissue to be temporarily destroyed or paralyzed or permanently destroyed or paralyzed . fig2 shows the diffusion of light emanating ( a scatter “ ball ” of photons diffusing propagating through the tissue ) or exiting from the optical fiber or conduit 1950 and propagating through the tissue . if the wavelength of the light is not naturally substantially well absorbed by the tissue , the absorbing enhancing substance 1975 may be used to enhance absorption and define ( by the extent of the occurrence of the absorbing enhancing substance ) the spatial extent of the interaction . for examples , windows with thicknesses as listed below may be used : 1 ) a window with thickness of 1 - 4 mil = 25 to 100 um . the window may have the high absorbing substance ( has ) on the window side facing the skin . the window may have with has applied to an aluminum layer which is glued or attached to a glass layer or a glass window such as a cover slip where in the glass is facing the light or energy source , and the aluminum is in contact with the skin 2 ) with a glass slide where the aluminum is with larger thermal mass . need to image thermal with 2 to 5 layers semi infinite medium . 3 ) a window made of aluminum with holes patterned into the aluminum layer 4 ) a window or treatment tip made of aluminum with an absorber pattern painted or applied to certain spots on the side of the aluminum window or treatment tip facing the energy source or light source . various contemplated advantages include : efficacy for treating acne and skin conditions ; safety while treating acne and skin condition and preventing acne ; and how the method and device work . the device itself may comprise among other things , a hand held home use hair treatment device . a low power flash lamp 100 is powered by a battery 110 or a power plug 120 which charges a capacitor 130 . the lamp 100 is willfully triggered and controlled through the use of a control board 140 and an activator switch 150 . the lamp 100 ( or any other energy source ) is housed in the consol 10 and its operation is also controlled by plurality of guards 30 . the protruding guards are protruding out of side of the device 10 facing the skin or the human body . the guards 30 are connected to the control of the lamps and do not allow the lamp to fire unless they are all depressed to at least a certain depth . for example the depth is such that most of the light from the lamp 100 can not escape sideways and is only directed forward towards the skin . the energy source 100 can be laser or light source , flash lamps , led , rf , microwave , any kind of electromagnetic ( em ) energy source , any kind of radiative em , energy source , thermal energy source , or thermal cooling source ( negative or out of the target area flow of energy ) energy source . only when all protruding guards 30 are full depressed can the flash lamp fire . this arrangement prevents accidental firing of the lamp into the eye . the protruding guards 30 can be made of transparent material such as , for example , plastic or glass . the idea is that a protruding guards ( pi ) array 30 will ensure that the eye is closed prior and before firing of the lamp . fig2 shows the same device as in fig1 except that the protruding guards ( pg ) 30 are made of transparent material to minimize intercept of energy . the pg 30 may also be made of substance capable of cooling the surface with which it is in contact so allow protection of the epidermis , further energy control , energy removal from the target tissue or surface being treated . fig3 shows the same apparatus as in fig1 except that instead of a plurality of protruding guards pg only one is being used , 30 . the protruding guard can have all kind of desired properties : it may be made of cooling ( active or passive cooling ) so as it is pressed against the skin it also cools . it may be made of transparent material to allow more energy to get into the skin . it may be made of substance or mechanism capable of heating or energizing the skin or delivery energy into the skin . it may be made of absorbing material so that as it is being pressed against the skin it also absorbs energy generated by a light or lasers or any other em radiative energy source to absorb the energy and conduct it further into the treated surface or targeted surface . a predetermined “ press level ” i . e . the amount of physical depression in of the protruding guards pg in the direction of the arrow , can be determined and built into the device . fig3 also shows such a pre - determined depression of the pg , 301 , before they allow activation of the device . such a displacement in the pg extension out of the treatment head surface 305 can be built into the device to prevent firing before the device is brought to such predetermined proximity to the surface of the target area . the pg can also have a maximum “ collapse distance ” or press - distance where the pg can then prevent a contact closer than the predetermined level . the above descriptions and illustrations are only by way of example and are not to be taken as limiting the invention in any manner . one skilled in the art can substitute known equivalents for the structures and means described . the full scope and definition of the invention , therefore , is set forth in the following claims .

the present invention relates to the fields of energy - tissue interaction and medical treatment . the invention also relates to a device for enhancing the surgical operations . the device also improves treatment , efficacy , and safety of procedures involving the application of energy to various organs , tissue , in animals and in treating the human body .

fig1 through 3 illustrate a first preferred embodiment of the present invention characterized by a condom 10 that is similar to various condoms that are sold in the market today , and who &# 39 ; s description and composition are well known in the art . the condom 10 is shown in the “ rolled - up ” condition looking down from above in fig1 . in the compact or rolled - up condition , the material that forms the body of the condom is collected in a circumferential ring 12 , leaving an exposed top portion 14 . as can be seen in fig2 , a reservoir tip 29 is located on the distal end of the condom 10 . in the condom 10 of the present invention , a separate , self - contained , u - shaped packet 20 is affixed to the top portion 14 of the condom 10 . the u - shaped packet 20 may be affixed by a biocompatible adhesive , heat melt , or other suitable mechanical attachment method , or pre manufactured as a multi - part ‘ to be assembled ’ condom set , or as a single compartmentalized condom , that will ensure that the packet 20 will remain affixed to the condom 10 throughout the act . the packet 20 may be sold separately from the condom 10 to be attached to the users condom of choice , or it may be sold as a condom with packet , multi - part set , or as pre manufactured compartmentalized single condom units . manufacturing issues of latex condoms may make it more desirable to have a two - piece arrangement that are assembled prior to use , where the packet 20 is placed over the condom 10 with a quick acting biocompatible adhesive just prior to intercourse . although the packet can take various shapes , the preferred shape is a u - shaped configuration that includes a semi - spherical upper surface and has an underside that includes a void to accommodate the condom &# 39 ; s reservoir tip . the lubricant containing packet can be prepared to release the contained fluid in various ways , although the most efficient is simply pricking the upper surface with a needle or pin 32 . other means for releasing the lubricant include a small tab 25 that seals the upper surface of the packet 20 . the tab 25 can be pulled back prior to penetration , revealing a small hole 30 that allows lubricant inside the packet 20 to slowly leak out as the penis penetrates the body lumen . the hole 30 formed when the tab 25 is pulled back is correctly sized , so that the lubricant will be emitted slowly and continuously over the course of the act of intercourse , providing continuing lubrication during the act . further , the lubrication will be dispensed inside the body cavity as opposed to outside the cavity , where it can be sheared off during penetration . in this manner , the condom 10 of the present invention lubricates the body lumen in a manner similar to the body &# 39 ; s own lubrication system . additionally , when the packet is pierced , a tiny amount of lubricant can begin to leak out providing lubricant at the entrance of the body lumen upon penetration , and continue to release lubricant well within the body lumen , as described . an ordinary pin 32 ( see fig3 ) or a pin type object can be enclosed with the product , and can be used to prick the packet 20 to create a small seepage hole 30 a through which the lubricant can leak out , or the packet 20 can have one or more small pin holes that are covered by a small piece of tape or removable cover ( not shown ). the packet 20 may be sold as a separate item that is placed on the condom of the user &# 39 ; s choice , either before unfurling the condom or after the condom is placed on the penis . in this example , the packet 20 will include a multipurpose adhesive that can reliably affix to latex , lubricated , non - lubricated , natural materials such as sheep skin or the like . the adhesive should be safe and bio - compatible so as not to cause irritation or damage to the involved tissues . a vegetable gum might be an example of a safe biocompatible adhesive . moreover , the packet 20 can be filled with various lubricants that are known in the art . as shown in fig4 , the packet 20 creates a void as it emits the lubricant until the packet 20 is depleted . typically condoms include a reservoir tip 29 to collect semen that is ejaculated . the condom &# 39 ; s reservoir tip in the present invention can thus replace the void created by the empty packet once the lubricant is expelled therefrom . this exchange allows the condom 10 of the present invention to create virtually no more space than existing condoms while adding a unique and beneficial lubrication function . in this manner , the condom of the present invention is an advance in the art . the embodiments just described and depicted in the accompanying drawings are not intended to be limited , but rather exemplary of the modes and uses of the present invention . it is to be understood that various modifications and alternate uses are envisioned , and the present invention is intended to encompass all such modifications and alternate uses as would be understood by one of ordinary skill in the art .

a condom that includes a lubrication packet affixed thereto , the lubrication packet occupying a space that coincides with a fluid receptacle . the packet is filled with lubricant and the integrity of the packet is breached prior to intercourse , releasing the lubricant inside the body lumen over a period of time . once the packet is substantially depleted , a void created by the depleted packet can be used by the receptacle .

fig1 - 4 show a preferred embodiment of the apparatus of the present invention designated generally by the numeral 10 . grilling rack 10 is in the form of a two part frame 11 which can be metallic ( e . g ., aluminum or stainless steel ). frame 11 has a lower section 12 and an upper section 13 . upper section 13 is a removable plate that can be perforated or apertured . the upper section or plate 13 can be in the form of a perforated plate that can be removed from the lower section 12 by lifting the upper section 13 upwardly . lower section 12 has a corrugated bottom panel 20 ( see fig2 - 4 ) that has troughs 21 and peaks 22 ( see fig2 - 3 ). bottom panel 20 can be of a mesh material ( e . g ., stainless steel mesh ) or of solid plate metal ( e . g ., stainless steel ). lower section 12 can be generally rectangular , providing side walls 14 , 15 and end walls 16 , 17 . each end wall 16 , 17 can be provided with a handle . end wall 16 has a handle 23 . end wall 17 has a handle 24 . each trough 21 and peak 22 is connected with an inclined panel 25 . ( see fig4 .) while multiple troughs 21 are shown , a single trough 21 could be provided on an elongated lower section 12 having a single row of openings 19 in an upper section 13 ( as an alternate embodiment ). the upper section or plate 13 nests within the side walls 14 , 15 and end walls 16 , 17 and rests upon the plurality of peaks 22 of corrugated bottom panel 20 ( see fig1 - 3 ). the lower section 12 can be of welded metal construction including troughs 21 which can be formed of sections of angle members , flanged members or the like that are welded together . alternatively , a single sheet of material can be corrugated to the shape of lower section 12 using a stamp or die . each trough 21 has a trough 21 lower end 26 that is centered upon the center 27 of an opening 19 as seen by referring to reference line 28 in fig3 . in this fashion , when an elongated food item ( such as an elongated pepper 18 ) is placed in an opening 19 , the lower end of the pepper 18 also registers in the v - shaped trough 21 and more particularly in the lower most portion 26 thereof ( see fig3 ). when grilling stuffed elongated peppers ( e . g ., a jalapeno ), the upper section or plate 13 is placed upon the lower section 12 ( see fig1 - 3 ). notice in fig3 that the center 27 of each opening 19 is vertically aligned with the lowest end 26 of a trough 21 as indicated by the dotted reference line 28 in fig3 . lower end 29 of pepper 18 rests in lower end 26 of trough 21 . circular edge 30 that defines each opening 19 engages and supports pepper 18 in between its upper end 39 and lower end 29 as seen in fig2 - 3 . upper section or plate 13 is shown having an array of openings 19 . in fig1 - 2 , there are seven rows of openings 19 , six openings 19 in each row . however , more or fewer rows can be provided . each row can provide any selected number of openings 19 . in fig5 - 8 , an alternate version of the grilling rack is designated by the numeral 10 a in fig5 - 6 and 8 and numeral 10 b in fig7 . for the racks 10 a - 10 b , there is no upper section or plate 13 . in fig5 , and 8 , the rack 10 a includes a pair of cylinders or cylindrically shaped members or receptacles 31 . each cylinder 31 has an open top 32 and an interior 33 for holding a vegetable or other food item or a container of seasoning such as an opened can 34 of any selected beverage . rack 10 b in fig7 provides only cylinder 31 . each receptacle 31 is attached to corrugated bottom panel 20 . receptacle 31 can be placed anywhere on the rack 10 a . panel 20 can be a single sheet of corrugated material or a plurality of tapered or v - shaped members welded together . corrugated panel 20 can have handles 23 , 24 connected thereto ( e . g ., welded ). the present invention provides an improved grilling rack apparatus that enables a user to cook many food items including elongated peppers that have been stuffed with a filler or filling . for the embodiment of fig4 - 8 , food item 35 such as poultry can be supported upon ( e . g . skewered ) a cylinder 31 that contains flavoring ( e . g . opened can 34 of any selected liquid or spices or vegetables ). arrow 36 in fig8 illustrates placement of can 34 within interior 33 of cylinder 31 via open top 32 . a food item 35 such as a chicken can be placed over ( e . g ., skewered ) the combination of opened can 34 and cylinder 31 as indicated by arrows 37 in fig8 . such final position of the food item ( e . g ., poultry carcass , chicken , etc .) is designated as 38 in fig8 wherein the can 34 ( or other spice or flavoring ) occupies interior 33 of cylinder / receptacle 31 and the food item 35 is skewered over both cylinder 31 and the contained can 34 or spice or flavoring . receptacle 31 can be placed anywhere on the rack 10 b . fig9 - 11 show the food dispensing funnel , plunger , push rod . fig1 - 14 show the method of the present invention . in fig1 there is a food stuffing apparatus , designated generally by the numeral 40 . food stuffing apparatus 40 includes a receptacle or funnel 41 that can contain a volume of a selected food stuffing 58 ( e . g ., rice or cheese or meat based stuffing or dressing ). receptacle 41 can be of metallic ( e . g ., stainless steel ) or plastic ( e . g ., any food grade plastic ) construction . this food stuffing or dressing 58 can be added to interior 53 of receptacle 41 via an open top 44 at upper end portion 43 . the receptacle 41 has upper end portion 43 and lower end portion 45 . tapered portion 47 joins upper end portion 43 to lower end portion 45 . ( see fig9 .) upper end portion 43 can include a circular rim or edge 56 . a dispensing outlet opening 46 is provided at lower end portion 45 . receptacle 41 can be manually supported and manipulated using handle 42 which is attached to the outer surface of receptacle 41 at attachments 54 , 55 . ( see fig9 .) plunger 48 has head 49 with lower end portion 50 . head 49 has a circular , generally flat end surface 51 . plunger 48 has a handle 57 attached at joint 52 to plunger head 49 . head 49 can be generally cylindrically shaped or can have a taper as shown in fig1 . outlet opening 46 has a circular configuration that closely matches the size and shape of end surface 51 of plunger 48 . outlet opening 46 can be of the same diameter or slightly larger in diameter than plunger 48 surface 51 . head 49 is preferably of a food grade plastic or metal material . handle 57 can be of wood , plastic or metal . fig1 - 14 illustrate more particularly the method of the present invention . in fig1 - 14 , there can be seen an array 67 of peppers 18 placed in grilling rack 10 . as shown in the fig1 - 8 and as discussed in the preceding , corresponding text , the grilling rack 10 has a lower section 12 , upper section 13 , a plurality of openings 19 and a corrugated bottom panel 20 . each pepper 18 is first cut using a knife to form a transverse cut 63 and a pepper opening 64 through which food stuffing can enter the pepper cavity 65 . the cavity 65 extends between pepper opening 64 and lower end 66 as shown in fig1 and 13 . after each pepper 18 is cut to provide the pepper opening 64 and to expose cavity 65 , the pepper 18 is placed on rack 10 with opening 64 facing up as shown in fig1 . once each of the openings 19 of rack 10 is fitted with a pepper 18 as shown in fig1 , a user fills each pepper 18 cavity 65 with food stuffing 58 of the user &# 39 ; s choice . during the filling of each pepper 18 cavity 65 with food stuffing 58 , a user positions one hand 61 to hold the handle 42 of receptacle or funnel 41 . the user grasps plunger 48 with the other hand 60 as shown in fig1 . an up and down movement of the plunger 48 relative to the receptacle 41 forces the stuffing 58 through the cylindrically shaped channel 62 at lower end portion 45 of receptacle 41 . fig1 illustrates a downward movement of plunger 48 as indicated by arrow 59 wherein stuffing 58 is pushed by plunger head 49 through lower end 45 , through channel 62 , and into pepper 18 cavity 65 . note in fig1 that the lower end portion 45 of receptacle 41 is sized and shaped to fit inside of pepper 18 lower end of cavity 66 . the external diameter of lower end portion 45 at dispensing outlet opening 46 is preferably about the same diameter or is a smaller diameter when compared to the diameter of pepper opening 64 . this arrangement can be seen in fig1 and 13 . by using the method of the present invention , a user can prepare an entire array 67 of peppers upon grilling rack 10 for placement in a cooking device , oven , barbeque pit , or the like . the method of the present invention enables an entire array 67 of peppers to be supported in a position that places the lower end portion of the pepper in trough 21 of grilling rack 10 while orienting the transversely cut pepper opening 64 upwardly . in this fashion , the opening 64 easily receives lower end portion 45 and opening 46 of receptacle 41 as shown in fig1 . the user raises and lowers the plunger 48 repeatedly to push food stuffing into cylindrically shaped channel 62 and then into cavity 65 until the pepper 18 cavity 65 is filled with stuffing as shown in fig1 and 13 . in fig1 , most of the peppers 18 have been stuffed with food stuffing 58 . a final row at 68 shows six peppers 18 that have not yet been filled with food stuffing 58 . once the user fills the cavity 65 of each pepper 18 , the array 67 of peppers supported upon rack 10 are placed in heat transfer contact with a selected cooking device , smoker , camp fire , barbeque pit , oven or the like . the following is a list of parts and materials suitable for use in the present invention : all measurements disclosed herein are at standard temperature and pressure , at sea level on earth , unless indicated otherwise . all materials used or intended to be used in a human being are biocompatible , unless indicated otherwise . the foregoing embodiments are presented by way of example only ; the scope of the present invention is to be limited only by the following claims .

a food grilling rack provides a frame defined by a plurality of connected side walls forming a closed geometric shape . the frame includes a lower corrugated sheet that provides multiple troughs , each trough having a lowest portion . the lower sheet is attached to at least some of the side walls . an upper sheet is supported above the lower sheet . there are a plurality of openings in the upper sheet , each opening being vertically aligned with a lowest portion of a trough . a food stuffing apparatus provides a receptacle having an interior , an upper end portion with a larger opening and a lower end portion with a smaller opening , and a tapering portion in between the upper and lower end portions . a plunger is provided having a head , a lower end portion with a shaft having a lower pushing surface and a joint , joining the head to the shaft .

fig1 a depicts an anterior / posterior radiograph of an arthritic hip joint and fig1 b depicts a lateral x - ray of an arthritic hip joint . the pelvic bone ( 1 ) represents the superior portion of the hip joint , the femur ( 10 ) represents the inferior portion of the hip joint , and the femoral head ( 20 ) rotates in the acetabulum ( 25 ). fig2 depicts an example of a femoral component ( 27 ) with a collar ( 28 ). the femoral component is also known as a femoral stem or femoral prosthesis . the collar desirably prevents the femoral prosthesis from subsiding down the femoral canal because the collar rests of the calcar osteotomy ( femoral neck cut ) and prevents further translation of the femoral prosthesis once the collar contacts the femoral osteotomy . fig3 a and 3 b depicts ap and lateral radiographs of a typical hip replacement . the acetabular component ( 30 ) has been implanted into the acetabulum . the femoral component or stem ( 50 ) has been implanted down the femoral canal to the desired level . the prosthetic femoral head ( 40 ) has been attached to the femoral component ( 50 ) and articulates with the acetabular component ( 30 ). the femoral stem has a collar ( 60 ), which rest against the femoral calcar bone ( 70 ). fig4 a depicts an ap view of a femoral guide ( 80 ) that references a substantial portion of the proximal femoral bone , such as either the anterior or posterior femoral neck . the guide could be patient specific or generic . as part of a pre - operative plan , the surgeon could use non - invasive imaging data or other information to determine his intended surgical approach to the hip joint , and this intended approach would determine whether the femoral guide would reference predominately the anterior femoral neck or posterior femoral neck . in both situations , the femoral guide could reference a significant portion of the superior and inferior femoral neck and femoral head ( 20 ) as well . the femoral guide ( 80 ) could contain a drill sleeve ( 110 ) that would accept a drill bit ( 130 ) that could form an anterior to posterior ( ap ) hole ( 120 ) in the femoral bone at the intersection of the vertical femoral cut guide ( 90 ) and the calcar femoral cut guide ( 100 ). this ap hole ( 120 ) could later be used to ensure the femoral broach and prosthesis were implanted in the proper location . after the surgeon drilled this ap hole ( 120 ), they could likely leave the drill bit in the bone and then use the vertical cut guide ( 90 ) and the calcar cut guide ( 100 ) in the femoral guide to make the appropriate osteotomy in the femoral bone . the drill bit could ensure that the saw blade did not extend beyond the intended osteotomy site , which could help prevent greater trochanter fractures from the saw blade extended beyond the intended osteotomy . alternatively , the surgeon could drill the ap hole and then remove this femoral guide ( 80 ) and insert a different femoral guide ( not shown ) that had a cylinder that fit inside this ap hole and a saw guide that rested on the surface of the femoral bone to guide a saw blade to make the calcar and vertical cuts . this alternative approach could include features ( not shown ) to create an improved fixation of the saw guide to the bone to prevent the saw guide from moving while the saw cut the bone . this alternative approach could also drill a second hole in the femoral neck or head for the main purpose of provided the saw guide with additional stability . the femoral head ( 20 ) could then be removed from the femur . the femoral guide could include one or more patient specific soft tissue protectors ( such as those disclosed in u . s . utility patent application ser . no . 14 / 059 , 372 , filed on oct . 21 , 2013 , and u . s . provisional patent application no . 61 / 716 , 571 , filed on oct . 21 , 2012 , the disclosures of which are incorporated herein by reference in their entireties ) along the intended path of the calcar osteotomy and superior femoral neck to desirably prevent the saw blade from inadvertently extended beyond the bone and cutting the hip capsule . the saw blade could be allowed to contact the patient specific soft tissue protector once the saw blade left the femoral bone , instead of the soft tissue surrounding the hip joint . fig5 a depicts a view of a femoral guide ( 80 ) superimposed on the radiograph . the femoral guide ( 80 ) is shown referencing a large portion of the anterior femoral neck . the ap drill sleeve ( 110 ) is shown extending away from and attached to the femoral guide ( 80 ). the height of the drill sleeve ( 110 ) could be patient specific such that the length of the drill bit ( 130 ) minus the height of the drill sleeve ( 110 ) would equal the width of the femoral neck . the drill bit ( 130 ) would therefore drill through the femoral neck and desirably stop immediately after the drill bit went through the opposite cortex when the head of the drill bit contacted the drill sleeve . the drill bit could be any diameter , but in various embodiments would likely be around 3 - 5 mm in diameter . fig5 b depicts a view of a proximal femur after the ap hole ( 120 ) has been drilled and the femoral guide removed . the purposed vertical femoral osteotomy or cut ( 90 ) and the calcar femoral osteotomy or cut ( 100 ) are shown with the marked line , but the cuts have not been performed yet . fig6 a and 6 b depict the femoral bone ( 10 ) after the femoral neck osteotomy has been performed and the femoral head removed . the anterior to posterior ( ap ) hole ( 120 ) is shown at the intersection of the calcar osteotomy ( 100 ) and the vertical osteotomy ( 90 ) ( see fig5 b ). this ap hole could be located anywhere along the calcar osteotomy and does not necessarily have to be located at the intersection . in this embodiment , this ap hole ( 120 ) will be utilized , at least in part , to ensure that the surgeon inserts the broach and femoral prosthesis in the correct anteversion , varus / valgus angle , and depth . because the femoral head and neck have been removed , the medial and superior portions of the ap hole have been removed and the ap hole can accept an anterior to posterior ( ap ) bar ( 140 ) of the broach or prosthesis as they are inserted down the femoral canal . the femoral neck osteotomy surface ( 121 ), and the femoral periosteal surface ( 122 ) and the femoral endosteal surface ( 123 ) are depicted at the level of the femoral neck osteotomy . fig7 a depicts an exemplary femoral broach ( 130 ) inserted into the femur ( 10 ) to prepare or machine the bone to accept the femoral prosthesis . if desired , the femoral broach could include an ap bar ( 140 ) that extended a few millimeters in the anterior and posterior direction away from the broach much like a collar . this ap bar is shown in a more lateral position than a traditional collar , but could be located anywhere along the osteotomy . this ap bar would desirably be a similar diameter as the ap hole ( 120 ) and the drill bit ( 130 ). the broach and / or prosthesis would desirably be in the appropriate position when the anterior and posterior portions of the ap bar ( 140 ) aligned with the anterior and posterior portions of the ap hole ( 120 ). if the surgeon tried to change the femoral anteversion , then the ap bar would desirably no longer key into the ap hole ( 120 ). if the surgeon inserted the broach in a varus position , then the ap bar ( 140 ) could be medially to the ap hole ( 120 ); the surgeon could realize this mistake and remove more bone from the lateral proximal femur to get the broach out of a varus position and into the correct position . the ap bar ( 140 ) on the broach could be removable or elevated on the broach handle so that smaller broaches could be impacted further down the femoral canal to prepare for the next larger broach size . broaches smaller than the intended prosthetic size can typically extended down into the femoral canal a few millimeters below the osteotomy level . the ap bar ( 140 ) could be temporarily removed to allow these small broaches to fully prepare the femoral canal . the ap bar could also be removed so that the surgeon could knowingly change the anteversion of the femoral broach ( and calculate the degree of change ) if the intra - operative information suggested a change was needed . fig7 b depicts the broach without an ap bar . in this alternative embodiment , the surgeon could also simply rely on a visual marker ( 145 ) on the broach , without any type of ap bar , to inform the surgeon about whether the implanted broach position corresponded with the intended broach position . this visual marker shown in fig7 b can be a hollow cylinder ( 145 ) in the anterior to posterior direction . when the hollow cylinder lined up with the ap hole ( 120 ), the surgeon would know the broach was in the correct position regarding the anteversion , varus / valgus , and depth . this hollow cylinder could be limited to just the cross sectional area of the broach so that the hollow cylinder would not interfere with the broach extending below the osteotomy level . the broach could therefore be impacted to its desired level based on the contact between the broach and the medullary canal and endosteal surface . the visual marker ( 145 ) would desirably not prevent or interfere with the broach reaching its appropriate and / or desired position . if desired , the hollow cylinder could accept a drill bit so the surgeon could prepare this ap hole for the final prosthesis if there was a difference between the first ap hole preparation and the hollow cylinder of the broach . this preparation might be necessary if the surgeon implanted the broach further down the canal than the pre - operative plan predicted or if the surgeon deliberately or accidentally changed the anteversion or varus / valgus position of the broach relative to the plan . the femoral broach could include various additional support features , including the use of a collar feature having vertical sides that desirably contact the periosteal bone ( 122 ) to ensure that the broach was implanted in the femoral bone in the correct anteversion . the surgeon could also insert a patient specific cap on the femoral neck osteotomy surface ( 121 ) that referenced the ap holes ( 120 ). this patient specific cap could narrow the width of the proximal femoral canal and help guide the broach into the correct anteversion . the broach could also have vertical markings along the anterior and posterior surface of the broach so the surgeon could align these markings with the ap hole ( 120 ) as the broach was inserted into the femoral canal to ensure the implanted femoral anteversion matched the planned femoral anteversion . fig8 a and 8 b depicts an exemplary femoral prosthesis ( 150 ) implanted into the femur ( 10 ) with an additional collar feature ( 160 & amp ; 180 ) extending over the femoral neck osteotomy ( 121 ) and contacting the periosteal surface ( 122 ) of the exterior surface of the femoral neck . the collar feature could be patient specific , modular , or just come in multiple sizes . if the collar feature was patient specific , then the shape and size of the collar could be based off the pre - operative scan and manufactured as a continuous part of the femoral prosthesis to intimately fit the proximal femur . if the collar feature was modular , the surgeon would make a determination during the surgery as to the correct shape and size of the collar based on how the broach fit the bone . the surgeon could then attach a modular collar with the appropriate size to femoral prosthesis before or after it was implanted into the femoral canal . lastly , the device manufacture could offer the implant with multiple different size collars ( i . e . small , medium and large ) and allow the surgeon to select the most appropriate sized collar during the surgery . the collar feature could have a flat horizontal portion ( 160 ) that could contact the femoral neck osteotomy ( 121 ) and vertical portions ( 180 ) that could contact the endosteal ( 123 ) and / or periosteal ( 122 ) surfaces of the femoral calcar and neck . the collar feature could extend over the neck osteotomy ( 121 ) and down the exterior ( 122 ) and interior surfaces ( 123 ) of the anterior and posterior femoral neck . the flat horizontal portion ( 160 ) of the collar feature could intimately contact the neck osteotomy . the axial force from vertical loading of the hip joint could be transmitted across the horizontal portion of the collar to the femoral osteotomy surface ( 121 ). the horizontal portion ( 160 ) could be the same shape as the cross sectional thickness of the proximal bone at the osteotomy to prevent soft tissue impingement from an oversized collar . the vertical portion ( 180 ) of the collar feature could intimately contact the periosteal surface ( 122 ) of the anterior and posterior femoral neck and calcar . the torsion force between the femoral prosthesis and the femoral bone primarily comes from the moment arm of the femoral head being loaded away from the axis of the femoral prosthesis . in various embodiments , this torsion force could be transmitted through the vertical portions of the collar feature to the periosteal and endosteal surfaces of the femoral neck . when torsion stress is applied between the femoral prosthesis and the femoral bone , a traditional prosthesis will typically push on just one side ( anterior or posterior ) of the endosteal bone . the various embodiments disclosed herein , including the various features described herein , provide an improved prosthesis with collar features that can push on the endosteal surface on one side ( i . e . anterior ) and the periosteal surface of the other side ( i . e . posterior ). this improved torsion stability could prevent implant loosening , intra - operative fracture , and postoperative fracture . fig8 c depicts the ap bar ( 170 ) on the femoral prosthesis keying into the ap hole ( 120 ) in the femoral bone to ensure that the femoral prosthesis ( 150 ) was in the correct anteversion , varus / valgus orientation and depth . the ap bar could be modular such that the femoral prosthesis could have a hole or similar attachment device in the prosthesis . the surgeon could select a length for the anterior and posterior portion of the ap bar based on how far the femoral broach was from the anterior and posterior periosteal surfaces of the proximal femur . the surgeon could then screw the 2 bars into the femoral prosthesis . in various alternative embodiments , the femoral prosthesis could just have a single hole so the 2 bars could be placed through the femoral prosthesis and screw into each other . the cross section of the bar and the hole in the femoral prosthesis could be round to allow for rotation , or could be provided in non - round ( i . e ., oval , triangular , square or other configurations — with corresponding unique spacing arrangements ) to prevent and / or inhibit unwanted rotation . the femoral prosthesis could include one or more collar features , one or more collar features in combinations with the ap bar ( fig8 a and 8 b ), or just the ap bar ( fig8 c ). the collar feature could be continuous and connected with the ap bar or could comprise a separate tab that was not connected to the ap bar . if the collar feature did not attach to the ap bar , the ap bar ( 170 ) could have a vertical wall ( 175 ) on each of the anterior and posterior end of the bar that would extend in the inferior direction and contact the periosteal ( 122 ) surface of the anterior and posterior femoral neck . the vertical wall of the collar feature could alternatively start at the anterior bar and extend medially around the calcar and then continue around to the posterior bar as shown in fig8 b . both the vertical and horizontal portions of the collar feature could be continuous around the entire femoral neck osteotomy or just small tabs in certain areas to allow better visualization of the contact between the collar and the femoral bone . traditional non - collared femoral prosthesis load the endosteal surface of the proximal femoral bone and create hoop stresses in the proximal femur when the femoral prosthesis is driven into the bone during implanting the prosthesis or weight bearing . a femoral prosthesis with a generic “ collar ” design loads the endosteal surface ( 123 ) of the proximal femoral bone and the osteotomy surface ( 121 ). the femoral prosthesis described here , in combination with the vertical portion of the collar feature , desirably allows the prosthesis to load the periosteal surface of the proximal femur as well as the endosteal surface and the osteotomy surface . loading the periosteal surface can help counteract and / or negate the hoop stresses that are generated from loading the endosteal bone . this periosteal loading would desirably generate compressive forces in the proximal femur instead of tensile forces ( hoop stresses ). the material properties of bone are much stronger in compression than tension , so loading the periosteal surface could decrease femoral calcar fractures . fig8 a also depicts two suture holes ( 190 ) in the anterior and posterior portion of the collar . these suture holes could vary in number and be used to reattach the posterior or anterior hip capsule back to the femoral bone . these suture holes could also be used to reattach the greater trochanter if a trochanter fracture occurred during the surgery . fig9 a , 9 b , and 9 c depict ap and lateral views of another exemplary collar feature on an exemplary femoral prosthesis . the horizontal portion ( 160 ) and vertical portion ( 180 ) of the collar feature are shown . the ap bar ( 170 ) is shown . fig9 b depicts the exterior vertical collar ( 200 ) that can be positioned to contact the periosteal surface ( 122 ) of the proximal femur and the interior vertical collar ( 210 ) that desirably contacts the endosteal surface ( 123 ) of the proximal femur . the vertical wall in fig9 b is desirably parallel with the axis of the prosthesis . fig9 c depicts an exterior vertical collar ( 215 ) that is divergent to the axis of the prosthesis , which desirably allows for easier insertion of the prosthesis over the femoral neck osteotomy . this divergent wall could also load the periosteum of the proximal femur and neglect the hoop stresses that are typically generated from the normal prosthesis loading of the endosteal surface of the proximal femur . this arrangement also reduces and / or negates the need for a cerclage wire or other reinforcing arrangement on the proximal femur , as surgeons will occasionally place a cerclage wire around the proximal femur to counteract the hoop stresses on the bone associated with implanting the prosthesis in much the same way as this divergent wall could . it should be understood that the collar features could be formed in a wide variety of shapes and / or configurations , including shapes and / or features that match and / or substantially conform , to varying degrees , to the underlying anatomy that they contact . for example , the collar features could comprise a hemispherical dome , an oval - shaped dome , a triangular box , a square or virtually any other shape that accomplished some or all of the features of the present invention . in various embodiments , the bone - contacting surface ( s ) of the collar feature may be non - round and / or irregularly curved and / or otherwise shaped , so as to desirably reduce , prevent and / or inhibit rotation of the implant and / or preferentially load the periosteal bone to varying degrees ( instead of the endosteal side of the bone ). it should also be understood that , where the collar feature and prosthesis are modular and / or separately formed , the collar feature could include a circular , non - circular and / or irregularly shaped opening formed therein to accommodate the femoral prosthesis . fig1 a , 10 b , and 10 c depict cross - sectional views of a standard flat calcar reamer ( 220 ), of a reverse domed - shaped calcar reamer ( 250 ), and of a hemispherical or domed shaped calcar reamer ( 260 ). flat calcar reamers are well known in the art . the male portion ( 230 ) of the femoral broach ( 70 ) slides into the female portion ( 240 ) of the flat calcar reamer . the flat calcar reamer can rotate around the male portion and remove the necessary femoral bone to make a flat osteotomy surface ( 121 ) that maximizes contact between a flat collar and the femoral bone . fig1 b depicts a cross - sectional view of a reverse domed - shaped reamer that could rotate around the male portion of the broach and desirably remove an amount of femoral bone to create a dome shaped osteotomy surface to maximize contact between a reverse dome shaped collar and the femoral bone . if desired , the curvature of the reamer ( i . e ., modifying the proximal femur ) could be slightly flatter than the curvature of the associated collar feature , which could facilitate the collar contacting the outside edge ( i . e ., periosteal edge ) of the bone and loading the bone from the “ outside - in .” fig1 c depicts a cross - sectional view of a hemisphere shaped reamer ( 260 ) that could rotate around the male portion of the broach and remove the necessary femoral bone to create a reverse dome ( i . e ., a hemispherical dome ) shaped osteotomy surface that maximizes contact between a hemispherical shaped collar and the femoral bone . the advantage of a dome shaped or reverse dome shaped osteotomy surface can be that axial compression of the implant and bone will desirably increase the contact between the collar and the bone . the torsion stability of the implant could also be improved by this arrangement . the anterior to posterior and medial to lateral stability of the implant could also be improved . the reverse dome shaped osteotomy in fig1 b with the dome shaped collar could also help minimize hoop stress from the femoral component loading the femoral canal . the dome shaped collar could help transform the tensile forces ( i . e ., hoop stresses ) into compressive forces , and thereby help prevent calcar fractures that can be seen with implanting a standard femoral prosthesis or loading the femoral prosthesis during weight bearing movement . the vertical portion of the patient specific collar could also help minimize hoop stresses in a manner similar to the cerclage wire does when it is wrapped around the proximal femoral bone , but without the need for such an additional adjunct to the surgery . if desired , the transitional spacing between the horizontal and vertical exterior surfaces of the collar could be rounded to prevent soft tissue impingement . the drawings and text above refer to the implantation of a femoral component into a femoral bone for descriptive purposes only . similar principles such as those described above could apply to other joints like the knee , ankle , feet , shoulder , elbow , back and wrist , with various modifications to account for anatomical and loading differences . for example , the sutures holes ( 190 ) in the vertical portions of the collar , shown in fig8 , could be applied to an implant for the shoulder joint to allow for a repair of the rotator cuff tendons ( supraspinatus , subscapularis , and / or anterior capsule ). the entire disclosure of each of the publications , patent documents , and other references referred to herein is incorporated herein by reference in its entirety for all purposes to the same extent as if each individual source were individually denoted as being incorporated by reference . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein . scope of the invention is thus intended to include all changes that come within the meaning and range of equivalency of the descriptions provided herein . many of the aspects and advantages of the present invention may be more clearly understood and appreciated by reference to the accompanying drawings . the accompanying drawings are incorporated herein and form a part of the specification , illustrating embodiments of the present invention and together with the description , disclose the principles of the invention . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the disclosure herein .

disclosed are systems , methods , devices and surgical techniques for joint arthroplasty , including implant components that facilitate the position and implantation of a hip replacement using cutting guides and various femoral implant arrangements .

the present invention is particularly adapted to employment with a conventional syringe 11 as shown in fig1 . the syringe 11 includes a barrel 12 within which there is disposed a longitudinally movable plunger or piston 13 that may be manually operated by withdrawal to draw a fluid into the barrel at a front opening and by depression to expel fluid from the front of the barrel . conventional practice provides a disposable mounting unit 16 which is adapted for removable attachment to the forward end of the syringe barrel 12 . the unit 16 conventionally carries a hollow needle 17 extending axially forward therefrom and communicating with the front end of the syringe barrel . it will be appreciated that the retraction of the plunger 13 in the syringe 11 will produce a suction at the needle 17 so as to draw a fluid contacted by the needle 17 into the barrel of the syringe . subsequently , physical depression of the plunger 13 in the barrel 12 of the syringe 11 will cause a fluid disposed in such barrel to be forced outwardly therefrom through the adapter 16 and thence through the needle attached thereto . conventional operation of an injection or hypodermic syringe provides for loading or filling thereof by drawing a fluid therein through the needle , as described above . it has long been recognized that fluid drawn into a syringe may possibly contain contaminants which may thus be drawn into the syringe and subsequently discharged through the syringe needle into an intravenous ( iv ) solution , for example . injection of contaminants of any type or kind into an iv solution and thus eventually into the blood stream , for example , is at least injurious and may prove to be fatal . the present invention precludes this possibility with apparatus that is quite inexpensive and even more importantly is operated in exactly the same manner as conventional syringes so that the likelihood or even possibility of human error or laxness will not reduce the effectiveness of the invention . referring again to the drawing , there will be seen to be shown in fig2 and 3 a preferred embodiment of the present invention incorporated in the adapter 16 . the adapter 16 includes a housing or body 21 having a small diameter aperture or bore 22 extending therein from the front end of the adapter and dimensioned to receive and retain the rear end of the hollow needle 17 . within the body 21 the bore 22 branches into two relatively parallel passages 23 and 24 which extend to a rear opening 26 in the housing . a hollow cylindrical portion 27 extends from the rear of the housing 21 with the opening 26 conically expanding through this portion to receive a hollow conical forward extension 28 of the syringe barrel 12 . the adapter and syringe are removably joined by this mating conical or tapered connection which is commonly termed a lure lock . alternative connections may be made ; however , the one shown and described is conventional and is commonly employed by those employing disposable needles with syringes . the adapter of the present invention provides one passage 23 for drawing fluid into the syringe and a second passage 24 for ejecting fluid from the syringe . this directed flow is herein achieved by providing a one - way or check valve 31 in the passage 23 wherein such valve admits of fluid flow only into the syringe barrel and positively prevents fluid flow in the opposite direction through the passage 23 . in the passage 24 there is also provided a one - way check valve 32 which admits of fluid flow out of the syringe barrel but positively prevents fluid flow into the syringe . in accordance with the present invention there is also provided a fluid filter 33 in one of the adapter passages 23 or 24 and the filter is shown to be preferably disposed in passage 24 on the syringe side of the valve 32 . by the illustrated location of the filter 33 maximum protection is afforded by the present invention , inasmuch as any and all fluid forced into the needle from the syringe must then pass through the filter for removal of any contaminants . this filter location will be seen to provide for removal even of contaminants that might have resided in the syringe barrel before the fluid was drawn therein for ejection . the valves 31 and 32 may be formed as shown in fig3 and referring to valve 31 , it will be seen to be comprised as a disc 41 disposed in an expanded portion 42 of the passage 23 and normally resting against an annular shoulder 43 between the expanded portion 42 of the passage and a portion 44 of lesser diameter . the larger or expanded portion 42 of the passage extends from the rear opening 26 to the shoulder 43 and the small portion 44 extends therefrom to the front bore 22 in the adapter body 21 . the disc 41 is mounted to pivot or bend away from the shoulder 43 as indicated , for example , in fig4 . one part of the edge or periphery of the disc is secured to the wall of the passage portion 42 or to the shoulder 43 and the disc may be flexible to bend , as shown . the disc 41 normally seats against the shoulder 43 so as to close the passage 23 as illustrated in fig3 . any pressure exerted to the left on the disc 41 as shown in fig2 i . e ., away from the syringe end of the adapter , will only more tightly seal the disc 41 against the shoulder 43 . on the other hand a suction applied to the right side of the disc 41 as shown in fig2 as by retraction of a syringe plunger , will cause the disc 41 to pivot or bend away from the shoulder 43 to admit fluid flow through the valve 31 . the other valve 32 may be likewise formed by a disc 51 disposed in an expanded portion 52 of the passage 24 communicating with the needle bore 22 and normally disposed in sealing engagement with a shoulder 53 about the inner end of the expanded portion 52 and a smaller portion 54 of the passage 24 extending into communication with the rear opening 26 . the valve 32 is operable to pass a fluid under pressure from the syringe 11 to the needle 17 as by deflection or pivoting of the disc 51 and to positively prevent fluid flow in the opposite direction . it will be appreciated that the one - way valves of the present invention may be formed in a variety of different ways and the illustrated and described structure is only exemplary although advantageous . it is also possible to form the adapter housing in a variety of different ways and from various different materials . the preferred embodiment of the invention illustrated is formed of a plastic material that may , for example , be molded as separate halves and joined together after valve disc insertion . operation of the present invention is quite clear from the foregoing description of the elements of a preferred embodiment of the invention . there are , however , illustrated in fig4 and 5 the operations of the present invention during filling or loading of a syringe equipped with the present invention , and discharge of fluid therefrom as by injection of a medicament into a bottle containing an iv solution , for example . fig4 shows the position and relation of elements hereof during the drawing of fluid into a syringe , as from an ampule 61 that has had the top thereof broken off in conventional manner to provide access to the fluid therein . such an ampule may inadvertently contain small shards of glass from breaking the top therefrom , for example . suction in the passage 23 produced by drawing the plunger 13 rearwardly in the syringe 11 causes the disc 41 of the valve 31 to be deflected or pivoted away from the shoulder or valve seat 43 , as shown in fig4 to open the passage 23 to the flow of fluid from the ampule into the syringe . this fluid flow is indicated by the arrows in fig4 and it will be seen that the aforementioned suction serves to even more tightly seal the valve 32 in the passage 24 so that no fluid can traverse this passage . discharge of a fluid from a syringe equipped with the present invention is illustrated in fig5 wherein the plunger 13 of the syringe is being forced into the barrel as indicated by the large arrow and fluid pressure is thus being exerted in the upper ends of the adapter passages 23 and 24 . pressure applied above valve 31 in passage 23 will tightly seal the valve disc 41 against the shoulder or valve seat 43 . pressure applied above valve 32 in passage 24 will pivot or deflect the disc 51 of the valve 32 away from the shoulder or valve seat 53 to open this passage for the discharge of fluid therethrough to and thence through the needle 17 . fluid forced under pressure through adapter passage 24 must pass through the filter 33 which removes any and substantially all foreign particles from the fluid . the filter 33 may be comprised of a wide variety of different porous materials through which a fluid may be forced and which has the property of entrapping and retaining solids that may be carried by the fluid forced therethrough . it will be appreciated that the material of filter 33 need not be provided as a dimensionally stable element nor need the filter have any particular structural properties other than the general capability of filling the entire cross section of the passage 24 in order to insure that all fluid discharged from the syringe is , in fact , filtered . the filter 33 may , for example , be comprised simply of a fibrous material such as cotton or cellulosic material &# 34 ; stuffed &# 34 ; into the passage 24 and generally the filter may be most easily inserted in the upper portion 54 of the passage 24 , as shown . the present invention , as described above , will be seen to provide a simple but highly effective system for preventing the injection of impurities or foreign bodies into an iv solution or a human being , for example . in fig5 the syringe needle 17 is shown to be inserted into an iv bottle 66 through a diaphragm 67 disposed across the top thereof as an example , and the needle might also be inserted into the body of a person . even a minute particle entrained in the fluid injected into the body of a person may be seriously injurious or even fatal , and the present invention positively precludes this occurrence . of further importance is the certainty of use and proper operation of the present invention to thus insure attainment of the desired result despite the presence of human error and resistance to change . although relatively trained personnel normally are employed to fill injection syringes with fluids and to inject fluids with such syringes , it is well known that the human being is resistant to change and is prone to error in executing normal operations wherein minor changes from normal may be required . these problems are now existent in the field of the present invention wherein prior art devices intended to produce the same or similar results as the present invention fail to do so because of the human factor . failure to take certain actions or to make certain necessary adjustments or the like may and in fact does result in failure to properly filter fluids injected into iv solutions , for example in doctors &# 39 ; offices and hospitals . the present invention , on the other hand , is entirely &# 34 ; invisible &# 34 ; to the user . a technician , pharmacist , vocational nurse , registered nurse or even a medical doctor may fail to follow particular deviations in long established procedures which would ensure complete filtration of all fluids injected with prior art devices . the present invention ensures complete filtration without the operator in any way deviating from normal or standard operating procedures and in fact without any discernible change of equipment so that the operator &# 34 ; automatically &# 34 ; produces the proper results . it is indeed a practical and highly useful result that is achieved by the present invention . the present invention has been illustrated and described with respect to a particular preferred embodiment hereof ; however , it is not intended to limit the invention to the precise terms of description or details of illustration , for it will be apparent to those skilled in the art that numerous variations and modifications may be made within the spirit and scope of the invention .

a simple device which attaches to an injection syringe for preventing possible contaminants in a fluid drawn into the syringe from being expelled therefrom into an intravenous solution , for example . the device hereof is simply comprised as a needle holder adapted for removable attachment to a syringe barrel for accepting the flow of a liquid into the syringe during loading of same and which automatically filters such liquid dispensed from the syringe through the needle .

in order to identify selectively purified tanshinone compound containing extracts from the root of a salvia spp , a number of alternative methodologies were examined . initially , a super critical fluid extraction ( scfe ) and an ethyl acetate extraction ( eae ) were conducted : put the pulverized dry raw material of salvia miltiorrhiza into the sce - co2 extractor . set up the pressure at 20 mpa and temperature at 45 degree c . add 30 % ( relative to the raw material ) ethanol ( 95 %) as the entrainer to the system . set the flow rate at 1 ml / min and continuously extract for 60 min . the dark red crystal obtained was code numbered sme - 1 . the eae methodology used is that set out with reference to fig1 . the danshen raw material ( 50 g ) is crushed and subjected to an ethanol extraction with 95 % ethanol ( added to four times volume ) and left for about 1 hour . the process was repeated 3 times and the solvent extracts combined . any residue was subjected to a water extraction ( added to four times volume ) and left for about an hour . repeat twice . the ethanol extract underwent a percolation extraction in which the extract was dissolved in 15 ml of water and extracted with petroleum ether . the process was repeated three times adding 15 ml of water each time . the water fraction was then extracted with ethyl acetate ( 15 ml ), and the process repeated three times . the resulting ethyl acetate fraction is referred to generally as sme - 2 . the resulting extracts were tested for their antimicrobial activity by the national institute for the control of pharmaceutical and biological products ( nicpbp ), national center for drug resistance of bacteria beijing , pr china . the extracts were tested for antimicrobial activity against 401 strains , over 95 % of which were clinical isolates with drug resistance including 41 strains of mrsa and 17 strains of mrcns . a high activity against gram - positive bacteria , and a low activity against gram - negative bacteria with a strong selective antibacterial action . the samples had a strong action against staphylococcus aureus and staphylococcus epidermidis . the information and numbers of the tested strains are listed in table 1 and the mic50 value and range for the important strains are listed in table 2 . 1 mg of dihydrotanshinone , 1 mg of cryptotanshinone , 1 mg of tanshinone , and 2 mg of tanshinone iia , put them all into a 10 ml flask , add 8 ml of the mixed solution of methanol - methylene dichloride ( 9 : 1 ), ultrasound for 5 minutes , add the methanol - methylene dichloride ( 9 : 1 ) solution to volume , shake thoroughly and allow to stand . measure appropriate amount of bc - sme 1 ( co 2 extract ) and bc - sme 2 ( ethyl acetate extract ) respectively , put them into two 10 ml flasks , add 8 ml of the methanol - methylene dichloride ( 9 : 1 ) solution , dissolve with ultrasound , add the methanol - methylene dichloride ( 9 : 1 ) solution to volume , shaking and filter . the subsequent filtrate was taken as a sample solution . measure precisely 5 μl of each of the reference solution and the sample solution . carry out the hplc as described above . according to the two gradient conditions mentioned above , the peaks of the different tanshinone indicators achieved baseline separation . gradient 2 was used due to the advantage of a shorter detection time , and the saving of solution . the hplc fingerprints of the referent samples are shown in fig2 a and fig2 b ( under the different gradient conditions ) and those of the two extracts are shown with reference to fig3 a and 3 b ( bc sme i ) and fig4 a and 4 b ( bc sme ii ). from left to right the peaks are : the content assay for the samples is given in table 5 below . ( gradient 1 was used for the content assay .) from the hplc content assay , it was found that the total tanshinone content was 48 . 5 % in bc - sme 1 , much higher than that in bc - sme 2 . this result can explain the dissolvability difference of the two samples in polar solvents . the content of tanshinone iia was as high as 39 . 40 % in bc - sme 1 , but the antibacterial activity level was low . the contents of dihydrotanshinone and cryptotanshinone in bc - sme 2 were higher than those in bc - sme 1 , so it is presumed that the better antibacterial activity level of bc - sme 2 is due to the presence of these compounds . all supplied by national institute for the control of pharmaceutical and biological products . methanol : chromatographic pure ( us fisher ), water : re - distilled , and the rest was analytical pure . take 15 mg each of bc - sme 1 and bc - sme 2 , add 10 ml of the methanol - methylene dichloride ( 9 : 1 ) mixture , dissolve with ultrasound and filter . take 1 mg each of dihydrotanshinone , cryptotanshinone , tanshinone i and tanshinone iia , add 2 ml of the methanol — methylene dichloride ( 9 : 1 ) mixture respectively for the mixed solution standards . following the tlc method ( chinese pharmacopoia 2005 version vol . i appendix vi b ) take 50 of each the test solutions , together with 3 μl each of the above - mentioned mixed solution standards , place them respectively on the same silica gel g plate , using petroleum ether — tetrahydrofuran — methanol ( 10 : 2 : 1 ) as the developing system , examine under the sunlight . put the sample drops on the same silica gel g plate with the reference drops . the spots corresponding to the reference compounds showed the same color at the same positions . the tlc experiment was repeated three times . the results are shown in fig5 a , 5 b and 5 c lane 1 : sme - 1 , lane 2 : sme - 2 and lane : reference compounds . reading bottom to top these are : from the experimental results under these chromatographic conditions , the separation of the mixed reference compounds and samples of the tanshinone compounds were very good , and the clear spots of the reference compounds could be seen in the samples of bc - sme 1 and bc - sme 2 . tanshinone compounds are lipid - soluble , so a high concentration ethanol ( 95 % ethanol ) was used as an extraction medium . a comparison between reflux and percolation extraction was made with a view to determining if a commercially scalable process giving a higher yield rate of cryptotanshinone and reduced impurity could be attained . soak 70 g of danshen raw material in 95 % ethanol for 12 hours and extract with 12 times its volume of 95 % ethanol . the colature was collected and the ethanol recovered . the resulting extract was then dried with a vacuum concentrator and weighed . 40 mg of the dry solid extract was weighed and put it into a 50 ml volumeteric flask , dissolved with the mobile phase solution , diluted to volume , filtered and analysed with hplc . reflux 70 g of danshen raw material with 6 times its own volume of 95 % ethanol twice , for 1 . 5 hours on each occasion . the ethanol was recovered and the extract dried with a vacuum concentrator and weighed . 40 mg of the dry solid extract was placed into a 50 ml volumeteric flask ; dissolved with the mobile phase solution , filtered and analysed with hplc . the results showed that the extraction by using the percolation methods can raise the content and the conversion rate of cryptotanshinone but its yield rate was lower than that with the reflux methods . the different percolation methods selected , the yield rates , and the content and conversion rates of the extracts produced by the two different methods are set out in table 6 below . from the results it can be seen that percolation results in a significantly greater content ( on a mg / g of extract basis ) than reflux . furthermore it is advantageous in that it uses simple equipment , is safe to operate , and is energy efficient . the extraction at room temperature also reduces damage to the active components , which are heat and light sensitive , and easily degraded . in order to optimize the process parameters of percolation extraction an orthogonal test was carried out and the conversion rate of cryptotanshinone used as an investigation indicator . an orthogonal test was designed to determine what factors might influence the conversion rate of cryptotanshinone . ( a ) solvent consumption , ( b ) soaking time , and ( c ) outflow velocity . the conversion rate of cryptotanshinone was selected as the investigation indicator ; analysis was carried out by using direct - vision methods and analysis of variance ( anova ). measure 9 portions , 70 g each of the crude powder of danshen raw material . each portion was soaked respectively in an appropriate quantity of 95 % ethanol for half an hour . carry out the percolation under the conditions set out in table 7 . the respective solutions were collected and dried with vacuum concentration . the ethanol was recovered from each resulting solution and the extracts were dried under vacuum at 60 ° c ., and weighed . 40 mg of dried extract was weighed into a 50 ml volumetric flask , dissolved into the mobile phase solution to volume , and filtered . the solutions were used for hplc analysis . from the analysis of variance ( anova ), three factors affected the conversion rate of cryptotanshinone ; the 3 influence degrees were a & gt ; c & gt ; b . the optimization grouping was a2b3c2 , that is , in the conditions of 95 % ethanol of 12 folds its volume , soaking for 24 hours , outflow velocity : 15 ml / min based on the results of the orthogonal test , three validation tests were carried out for the optimized process . the results are illustrated in table 9 the applicant sought a methodology to selectively enhance the content of tanoshinone compounds in the extract and the methodology in this example demonstrates a process which , in the first instance increases the content of tanoshines approximately two fold but significantly increases the relative content of cryptotanoshinone content by an even greater factor . this is particular advantageous from a pharmaceutical activity perspective . the process is illustrated in fig6 and comprises the following steps : 1 . extract danshen raw material with 95 % ethanol with percolation and concentrate using vacuum drying ; select 106 . 5 g of clean raw material and crush to a powder . soak in an appropriate quantity of 95 % ethanol for 24 hours , distribute it well into the percolator , and extract with percolation with a flow rate of 15 ml / min . collect the colature of 12 times the raw material , i . e . 1280 ml . recover the ethanol under vacuum . vacuum dry at 70 ° c . to get the final extract , 10 . 2 g . the final percolation extract of danshen was given a batch number — sl0601 . take the final extract of danshen mentioned in 5 . 1 . 1 above , add 100 ml water and extract it with 150 ml ethyl acetate twice ; combine the two ethyl acetate solutions and dehydrate . wash it with 100 ml and 50 ml water respectively and dehydrate . concentrate the ethyl acetate extract under vacuum to obtain 5 . 765 g of a solid extract which was given a batch number — yy0601 . measure 2 . 0022 g of danshen ethyl acetate extract ( as 5 . 1 . 2 ), dissolve it with acetone , mix it fully with silica gel and remove the solvent . apply the sample to a silica gel column , elute with petroleum ether — acetone in different proportions . collect 50 ml eluate in each fraction each fraction was applied on silica gel tlc plates , and petroleum ether — acetone was used as the developing system . examination was under natural sunlight . the tlc fingerprints are shown in fig7 based on the tlc result a number of consecutive fractions were merged as follows : 2nd and 3rd ; 5th to 8th ; 10th to 13th ; 14th and 5th ; 16th to 18th ; 19th to 21st ; 23rd and 24th ; 25th and 26th ; 28th to 30th ; 31st to 34th ; 35th and 36th . the resulting 20 new fractions were analyzed with silical gel tlc and the results are shown in fig8 . the fractions showing the highest contents of cryptotanshinone and dihydrotanshinone , i . e . the 7th to the 13th samples , were combineed as “ purified tanshinones ” ( 0 . 420 g ). this purified tanshinone containing compound extract was given a batch number : jz0601 . the ethyl acetate extract of danshen ( lane 1 ), the purified tanshinones ( lane 2 ) and the mixed tanshinone standards were examined with silica gel tlc . the tlc fingerprint is shown in fig9 . the compounds from bottom to top are respectively : the chromatographic conditions were as described in 3 . 1 . 3 above ( table 3 gradient 1 ). danshen percolation extract , sl0601 , danshen ethyl acetate extract , yy0601 , and purified tanshinones , jz0601 , were additionally subjected to hplc chromatographic analysis as described in 3 . 1 . danshen percolation extract 50 . 8 mg , danshen ethyl acetate extract 19 . 3 mg and purified tanshinones 11 . 9 mg , put them into a 10 ml volumetric flask respectively ; add 8 ml of the methanol - methylene dichloride ( 9 : 1 ) solution , dissolve with ultrasonication , add the methanol — methylene dichloride ( 9 : 1 ) solution to volume , shake thoroughly and filter . carry out hplc analysis . the resulting hplc fingerprints are shown in fig1 a to 10 d . : fig1 a is an hplc chromatogram of a percolation extract under conditions as set out in table 3 ( gradient 1 ) ( sl0601 ); fig1 b is an hplc chromatogram of a ethyl acetate purified extract under conditions as set out in table 3 ( gradient 1 ) ( yy0601 ); fig1 c is an hplc chromatogram of a silica gel purified extract under conditions as set out in table 3 ( gradient 1 ) ( jz0601 ); and the comparator fig1 d is an hplc chromatogram of reference compounds under conditions as set out in table 3 ( gradient 1 ). the content of each compound from hplc analysis is shown in table 11 . silica gel column chromatography was demonstrated to be an effective method for purifying cryptotanshinone . the content of cryptotanshinone rose significantly to eliminate the non - active compounds from the ethyl acetate extraction . this purified tanshinones fraction was further studied for its antibacterial activity . test lab : national institute for the control of pharmaceutical and biological products ( nicpbp ), national center for drug resistance of bacteria beijing , pr china . 1 . place 6 . 40 mg of the sample into a 50 ml volumetric flask and add 15 ml dmf solution ( n , n - dimethylformamide ) 2 . ultrasonicate for 10 minutes . 3 . add 15 ml of water to dilute the solution and ultrasonicate immediately for 5 minutes . 4 . add water to the volume and shake well , then ultrasonicate for another 5 minutes to obtain the testing solution of 0 . 128 mg / ml ( 30 % dmf concentration ). 107 strains collected and kept by national monitoring center for antibiotic resistant bacterial ( china ) were used to test the activity . the strains were evaluated with the phoenix - 100 automated microbiology system . the testing strains included : 87 strains of staphylococcus aureus ( sa ) including 52 strains of methicillin resistant sa ( mrsa ) and 35 strains of methicillin susceptible sa ( mssa ); 23 strains of coagulase - negative staphylococci ( cns ) ( mrcns 4 and mscns19 ); and 7 strains of streptococcus ( 5 strains of streptococcus pneumoniae ). a microtitre broth dilution method ( mh broth , oxoid ltd uk ) was used in the testing . the minimum inhibitory concentrations ( mics ) of flucloxacillin / ampicillin on the isolated strains were tested based on the methods described on america clsi / nccls antimicrobial susceptibility testing ( ast ) ( 2006 ) 1 . the mic of penicillin against staphylococcus aureus , ( atcc 29213 ) and streptococcus pneumoniae ( atcc49619 ) were conformed to clsunccls ( 2006 ). 2 . the mics of jz0601 against staphylococcus and streptococcus were as set out in tables 12 . jz0601 showed good activity against staphylococcus including methicillin susceptible and resistant strains , as well as streptococcus , particularly streptococcus pneumoniae . the mics of jz0601 on all strains are as set out in tables 13 - 16 : the above data demonstrates the benefits of using an extract which is not only characterized by its high tanoshinone compounds content but more particularly one with enhanced levels of particularly cryptotanoshinone . however , the methodology described to obtain this highly purified extract was not suitable for scale up and accordingly an alternative scalable methodology had to be developed . this is described below : the preferred commercial scale production process for obtaining a selectively purified tanshinone compounds containing extract from the root of salvia spp , and more particularly one specifically enriched in cryptotanshinone , is set out with reference to fig1 2 . soak it with a sufficient volume of high concentration , typically 95 %, ethanol for a time sufficient to solubilise the desired compounds , typically 24 hours ; 3 . place the material into a percolator and extract using a percolation method ; 4 . collect the ethanol solution with , typically , 12 times volume of its raw material at the desired percolation speed , preferably , 15 ml · min - 1 ; 5 . concentrate the liquid extract under vacuum and recover the ethanol to obtain the ethanol extract . 1 . dissolve the ethanol extract with about 10 times of water , the yield rate is about 40 % and the content of the total tanshinones is about 20 %. 3 . dissolve the precipitates with 60 % ethanol and place the material onto an ab - 8 macroporous resin column . 4 . elute with 60 % ethanol and dispose of the fraction 5 . elute with 70 % ethanol to obtain the selectively purified fraction containing tanshinones . the resulting purified extract has a specification as set out in table 17 inject 5 μl each of both the test solution and the reference solution respectively into an hplc column and run . the profile for the extract is illustrated in fig1 and compared to the reference sample fig1 from this the four tanshinones were calculated to be 42 . 89 % of the extract , calculated as : dihydrotanshinone ( 3 . 65 %), cryptotanshinone ( 18 . 95 %), tanshinone i ( 3 . 82 %), and tanshinone iia ( 16 . 47 %) to evaluate the in vitro activity of a selectively purified tanshinone compounds containing extract against the anaerobic bacteria propionibacterium acnes ( p . acnes ). a selectively purified tanshinone compounds containing extract was added to wells containing p . acnes ( atcc 6919 ; 1 × 10 4 to 5 × 10 5 cfu / ml ) in culture , grown under controlled conditions ( reinforced clostridial medium , 37 ° c .). final inoculum concentration was determined by reference to a standard optical density curve and adjusted as necessary . wells were incubated for 48 hours at 37 ° c . and examined for growth of culture . wells were scored positive (+) for inhibition of growth , or negative (−) for no effect on growth . eight different concentrations ranging from 0 . 03 μg / ml - 100 μg / ml were screened . ampicillin was run at a concentration of 0 . 1 μg / ml as a positive control . mic and mbc were calculated . the extract was tested at half - log concentrations of 0 . 03 μg / ml to 100 μg / ml for potential bactericidal activity against p . acnes . from this , a minimum inhibitory concentration ( mic ) of 10 μg / ml was determined , and a minimum bactericidal concentration ( mbc ) of 30 μg / ml was calculated . the results are shown in table 18 . this experiment was conducted to test for the rapid development of resistance in staphylococcus aureus in the presence of sub - inhibitory doses of the active extract . oxford staphylococcus aureus ( nctc 6571 ) and 3 clinical isolates of mrsa were tested , t3 , 102 and mrsa 99 . all clinical strains were from the royal london , st bartholomew &# 39 ; s or newham hospitals in london . each strain had been identified as an mrsa . the standard method using dmf was used . manufacturer &# 39 ; s method using dmf where the solution was unfiltered prior to use . solution — 640 mg / 1 was added to 3 ml dmf , sonicated in a sonic water bath then made up to 10 ml with water as per instructions . high concentrations of organisms ( 10 7 cfu / m1 − 1 ) were grown in sub — inhibitory concentrations 0 , 2 and 8 mg l − 1 of the active extract . mics had been determined previously as 16 mg l −‘ . organisms were sub - cultured into fresh active extract media at day 4 and again at day 7 . mics were checked weekly using standard methods . subcultures were carried out in triplicate . no change in mic was observed over the 3 week test period . no growth indicates the mic level . three mrsa clinical isolates have been tested and control strain oxford staphylococcus aureus tables 19 , 20 , 21 and 22 . table 23 shows the comparative development of resistance with ciprofloxicin and table 24 for gentamicin . there was no development of resistance for the active extract or gentamicin . the mics to ciprofloxacin increased after 2 weeks treatment . the extract is active against mrsa at inhibitory levels of 16 mg l − 1 and above . there was no change in the mic level over the test period for the strains tested . no rapid development of resistance occurred and the test period was beyond that used by boos m . et al . ( in vitro development of resistance to six quinolones in streptococcus pneumoniae , streptococcus pyogenes , and staphylococcus aureus . antimicrob . agents chemother . 45 , 938 - 942 ) to demonstrate a seven fold increase in resistance to quinilones within 10 days . 9 . 0 experiment to determine activity of pyn 6 in a gel formulation a number of different gel formulations containing extracts of the invention were prepared and tested on clinical mrsa isolates to determine the suitability of the active extract for topical delivery . agar diffusion tests ( based on bsac standard methods ) were used to compare the relative activity of different gels against mrsa . zones of inhibition around each 100 μl sample were compared . pyn6 was prepared by dissolving in dmf and then water , final concentration 500 mg / l . fig1 illustrates graphically of the effect of pyn6 in water and in gel formulations against 10 different strains of mrsa all gels showed activity at a level of 500 mg / l . all were comparable to the activity of 500 mg / l pyn6 in water . pyn6 works in gel or water formulation and has potential as a topical antimicrobial against mrsa . 10 . 0 experiment to determine activity of pyn 6 against individual compounds minimum inhibitory and minimum bactericidal activities ( mic and mbc ) of pyn6 were determined for 2 strains of mrsa using standard microtitre well methods . mics were determined by measuring growth over 201us using spectroscopy at 490 nm . mbcs were determined by subculture from these microtitre plates onto solid media after 20 hrs and determining survival of bacteria grown in the presence of pyn6 . test 1 mic and mbc comparing pyn6 to a , b , c and d against mrsa 98 test 2 mic and mbc comparing pyn6 to a , b , c and d against mrsa 2 the results demonstrate that pyn 6 an extract enriched in cryptotashinone and dyhydrotashinone ( compared to tashinone i and iia - table 5 ) performed very effectively .

the present invention relates to a selectively purified tanshinone compounds containing extract from the root of a salvia spp comprising cryptotanshinone , dihydrotanshinone , tanshinone i , and tanshinone iia . it comprises at least 15 %, by weight of the said identified tanshinone compounds and at least 4 % by weight , of cryptotanshinone . the extract and formulations thereof have been found to exhibit excellent anti - microbial properties against , in particular mrsa .

in the following detailed description , reference is made to the accompanying drawings . the drawings forms a part of this invention disclosure and show , by way of illustration , specific embodiments in which the invention , as claimed , may be practiced . the invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . as will be appreciated by those of skill in the art , the present invention may be embodied in methods and devices . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . embodiments of hose test adapters according to the present invention are designed for use in connection with protective mask leak test apparatus such as the joint forces tda - 99m or tda - 99b , or similar . a simplified schematic of a portable protective mask leakage test apparatus 200 is shown in fig3 . mask test apparatus 200 provides leak and serviceability testing of a variety of sizes and types of negative pressure chemical , biological and radiological protective masks without requiring an operator to actually don the mask . leak testing of a mask essentially involves removing the gas canister from the mask , plugging the mask canister port and outlet valve , and affixing the mask by its own harness to points of attachment on test apparatus 200 so that it fits snugly over a face - shaped headform 204 . an inflatable bladder 208 of headform 204 engages the faceseal on the mask and simulates the seal characteristics of the face of a user . if the mask is equipped with an air hose , the canister is removed from the hose end and the hose end is attached to a hose test port 212 on the test apparatus 200 via a threaded adapter 214 . after the mask has been thusly secured , a slight vacuum is applied through headform 204 to the interior of the mask . test apparatus 200 then monitors for leaks in the mask and any attached hose while the operator performs a number of test challenges . however , since the entire mask - hose system must be tested , isolating faults or leaks in the air hose assembly is very difficult . mask test apparatus 200 is equipped with two headforms 204 to accommodate masks of different sizes . the headforms 204 are push - fit mounted to a headform mounting pedestal 202 on test apparatus 200 . pedestal 202 and headform 204 are joined at an interface that includes four push - fit o - ring sealed pressure couplings ( not shown ). one such pressure coupling communicates a source of negative air pressure to a head test port 210 in the top of headform 204 . mask test apparatus 200 delivers negative air pressure to the mask under test through head test port 210 while the mask is probed for leaks . fig1 shows a side sectional view of a preferred exemplary embodiment of an air hose test adapter ( hose test adapter ) 100 according to the present invention . hose test adapter 100 is configured to adapt a standard nato threaded male pneumatic fitting used for attachment of a nato threaded mask end fitting 152 of flexible air hose 150 into head test port 210 of mask test apparatus 200 . hose test adapter 100 comprises a body having a first end 102 with a first opening 104 and a second end 106 with a second opening 108 and a passage 107 between the first opening 104 and second opening 108 to enable air to flow through . first end 102 provides a cap shaped nato threaded receptacle 110 that engages a standard male nato threaded air hose coupling . an annular seal 118 such as a standard m - 45 canister / air hose gasket is disposed in threaded receptacle 110 to prevent leakage of air . the outside surface of receptacle 110 preferably has a knurled surface 111 to aid in gripping hose test adapter 100 . second end 106 of hose test adapter 100 provides a tubular stem 112 that extends outwardly from the back of receptacle 110 and terminates at a tip 113 that is preferably chamfered to facilitate insertion of stem 112 into head test port 210 . the external diameter of stem 112 is preferably 0 . 710 inches , dimensioned for snug push - fit coupling into head test port 210 . the internal diameter of stem 112 is at least 0 . 325 inches throughout to provide unrestricted air flow through the hose to be tested . a pair of o - rings seals 114 , or similar circumferential pneumatic seals , are disposed in 0 . 12 inch radial grooves 115 near tip 113 . the first groove is located 0 . 15 inches from tip 113 and the second 0 . 55 from tip 113 . while a single o - ring seal may be employed , dual o - ring seals 114 provide an added measure of assurance that air will not leak from head test port 210 . a radial flange 116 approximately 0 . 25 inch thick and 0 . 975 inch in diameter is positioned 0 . 710 inch from tip 113 to prevent over - insertion of stem 112 into head test port 210 . stem 112 extends from the axis of rotation of receptacle 110 at an angle of approximately 45 degrees so that air hose 150 is oriented at approximately the same angle as when it is attached to a mask . the body of hose test adapter 100 is of unitary construction and preferably formed by an injection molding process from zytel 77g33l or similar hard plastic material . operation of a preferred embodiment according to the present invention is substantially as follows . headform 204 is mounted to mask test apparatus 200 . chamfered end 113 of stem 112 of hose test adapter 100 is inserted into head test port 210 of headform 204 . male nato threaded mask end fitting 152 of air hose assembly 150 is threaded securely into receptacle 110 of hose test adapter 100 . the canister end fitting 154 of air hose assembly 150 is connected via threaded adapter 214 into hose test port 212 . as in a mask test , a predetermined negative air pressure is delivered by mask test apparatus 200 to bead test port 210 . test apparatus 200 then monitors for leaks in air hose assembly 150 while the operator performs a number of test challenges . as has been shown , embodiments according to the present invention provide effective and efficient systems , methods and devices for adapting a standard mask testing apparatus to perform leak testing of mask air hose assemblies independently of the mask systems to which they may be attached . embodiments according to the present invention simplify detection and isolation of mask air hose assembly leaks and increase confidence in test procedures and in protective mask systems generally . various modifications to the described embodiments may be made without departing from the spirit and scope of the claimed invention . accordingly , other embodiments are within the scope of the invention , which is limited only by the following claims .

the invention relates to devices and methods for adapting a standard protective mask test apparatus to perform leak testing of a mask air hose assembly as an independent equipment component , i . e ., independent of the mask - hose system .

the present invention consists of a solid fulvestrant composition showing improved solubility characteristics with respect to the solubility of the solid active principle . the problem of solubility of fulvestrant , as described in u . s . pat . no . 6 , 774 , 122 , in a solution of castor oil and at least one alcohol is solved by the addition of a non - aqueous ester - type solvent miscible with castor oil . the present invention provides a new solution to this technical problem , not by addition of a solvent , but by obtaining dried solid fulvestrant , preferably through a lyophilization process , and preferably amorphous . lyophilization is a drying process , in which the solvent or suspension medium are crystallized at low temperatures and then sublimated directly from solid state to vapor state ( 1 ). the problem we encountered was that fulvestrant is practically insoluble in water ( 3 ) and that the overwhelming majority of lyophilizates of pharmaceutical solutions are lyophilized from simple aqueous solutions ( 2 ). given that fulvestrant is practically insoluble in water , it cannot be used as a lyophilization solvent . we have solved this technical problem , among others , by means of lyophilization with organic solvents or using solvent - non - solvent systems . the use of organic solvents in the lyophilization is not found in the state - of - the - art ( 4 ), and additionally the scientist should keep in mind that the use of organic co - solvent / water systems may cause a myriad of problems ( 2 ). we have developed processes for lyophilizing fulvestrant employing pure organic solvents such as acetic acid , dimethylsufoxide and tert - butanol , and in addition solvent - non - solvent systems consisting of organic solvents and water as non - solvent , for example , acetic acid : water , ethanol : water , tert - butanol : water . the lyophilized solid pharmaceutical compositions of fulvestrant of the present invention have solubility characteristics which are not observed for the solid pharmaceutical active principle . this improved solubility makes it suitable to be used as a pharmaceutical product of rapid dissolution but with no need of using benzyl benzoate as a solvent for castor oil . the lyophilizate should be reconstituted within a reasonable period , typically of less than 2 minutes ( 5 ); if reconstitution time is excessive , that is , more than 3 minutes , the user may get impatient or frustrated ( 6 ). we have compared dissolution time of a fulvestrant lyophilizate to a pharmaceutical active comprising solid fulvestrant and found that the fulvestrant lyophilizate is dissolved in less than 2 minutes , whereas the pharmaceutical active of solid fulvestrant required more than 60 minutes . this comparison was performed by dissolving fulvestrant at a concentration of 50 mg / ml , using a solvent comprising castor oil and benzyl benzoate - free alcohol mixtures . another important fact of the present invention is that when carrying out the methods of manufacturing lyophilizates there was no variation in purity associated to the active principle used in the same , and this consideration is made keeping in mind that the method of usp 34 monograph on fulvestrant is used for determining related compounds . furthermore , it should be noted that there was no degradation either during the process of reconstituting lyophilizates , using a solvent comprising castor oil and benzyl benzoate - free alcohol mixtures . the lyophilizate and its reconstituted form meet the required impurity values established in the ich guidelines for impurities in final products , thus allowing for using this product as an injectable medicament which , given the characteristics of solvents and active principle and that it is administered intramuscularly or subcutaneously , could be used as a sustained - release product of fulvestrant . herein , the term solid refers to non - liquid states , or solutions , but to lyophilization powders or plugs , either in a crystalline or amorphous state . another object of the present invention is a kit comprising two containers , one containing the solid fulvestrant , preferably lyophilized and amorphous , of the present invention and the other containing the solubilizing composition of the present invention . in a first embodiment of the kit , it comprises the containers and a syringe . in a second embodiment , it comprises a prefilled syringe containing said two containers . in a third alternative of said containers , syringe and transfer system , said transfer system connects both containers with the syringe . this third option turned out to be the most efficient , as demonstrated in the examples . the needle - free transfer system allowed for transferring the solvent to the syringe , from the syringe to the lyophilizate and then the reconstituted form to the syringe , rapidly and with a minimum effort . furthermore , the risk of injuries to health workers due to needle manipulation , as well as product contamination , are reduced to a minimum because the solvent vial - transfer system - lyophilized vial system is a closed system . thus , another object of the present invention is the use of a transfer system for connecting the containers containing the solubilizing composition , the container containing the solid fulvestrant of the present invention and a syringe . another object of the present invention is a process for obtaining the composition of claim 1 comprising the following steps of : a . dissolving the active pharmaceutical principle fulvestrant in a lyophilization solvent selected from the group consisting of acetic acid , dimethylsulfoxide , tert - butanol and mixtures thereof , where preferably said solid composition containing less than 0 . 5 % organic solvents is obtained ; further , lyophilization comprises cooling the product obtained in step a to at least − 20 c for at least 5 hours , working under a pressure higher than 500 mtorr . after this time has elapsed , the pressure is lowered to below 500 mtorr . after at least 3 hours , heating of the system is started with a difference of at least 5 ° c . between two consecutive temperatures , the heating being ramp - or step - wise and each step being of an extension of at least 3 hours . the final temperature of the system comprises from 0 to 50 ° c . to a 100 ml beaker , fitted with a magnetic stirrer , 35 ml glacial acetic acid , merck lot k 36685863 , is added . the beaker is placed on an ika model ms2 minishaker magnetic stirrer plate . seven hundred mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . stirring of acetic acid is started and fulvestrant is slowly added which is rapidly dissolved . after all fulvestrant was added stirring is continued for 5 minutes . after this time has elapsed , stirring is stopped and the solution is dosed using a 5000 ul eppendorf research micropipette into 50 ml schott type i glass vials , with a 12 . 5 ml volume . vials are pre - capped with helvoet pharma bromobutyl lyophilization stoppers and lyophilized using a virtis advantage lyophilizer . the lyophilization cycle is shown in table 1 . once the lyophilization process is completed , vials are capped and crimped with aluminum seals . the lyophilizate thus obtained has a very good aspect . titer and purity of one lyophilizate vial are analyzed by hplc , and compared to scinopharm fulvestrant used in the manufacture of the lyophilizate . hplc determinations were carried out on a waters hplc system with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph on fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. a physical characterization of a sample of lyophilized fulvestrant was performed . the physical characterization was made by x - ray diffraction , differential scanning calorimetry and thermogravimetric assays . the x - ray assay was carried out in a philips x &# 39 ; pert with a pw3710 unity using cukα radiation = 1 . 54 a . records were obtained in the range of 3 °& lt ; 2θ & lt ; 40 °. a step of 0 . 02 ° in 2θ was used with a time counting of 2 seconds per step . fig5 shows a diffraction diagram of the sample which has a typical diffraction pattern corresponding to an amorphous sample . the differential scanning calorimetry assay was performed with a shimadzu dsc 60 . a sample of 2 . 29 mg was placed on an aluminum sampleholder , and heated at 10 ° c ./ min from room temperature to 200 ° c . work was carried out under n 2 with a flow of 30 ml / min the thermogravimetric assay was performed with a shimadzu tg 50 . the sample was placed in an aluminum sampleholder . it was heated from room temperature to 400 ° c . with heating rate of 10 ° c ./ min , under dry air flow of 40 ml / min fig6 shows a differential scanning calorimetry diagram and a thermogravimetric diagram . an endothermic signal characterized by an onset temperature to = 49 +/− 1 ° c . and an enthalpy variation of 11 +/− 2 j / g was observed , which as may be appreciated in the thermogravimetric diagram does not correspond to mass loss . this lyophilizate was made with scinopharm fulvestrant . a comparison of diffraction diagrams of the starting material , diagram 1 , and the lyophilizate , diagram 5 , shows that during the lyophilization process there was a transformation or change of the crystalline state of fulvestrant from crystalline , the state of the starting material , to amorphous , the state of the lyophilized material . when comparing the results of the thermal study of scinopharm and sicor fulvestrant , it is concluded that the melting point of fulvestrant is 102 +/− 2 ° c . and the enthalpy of fusion is 50 +/− 4 j / g . the lyophilizate has an endothermic signal characterized by an onset temperature to = 49 +/− 1 ° c . and an enthalpy variation of 11 +/− 2 j / g , which is different from the crystalline fulvestrant used for manufacturing the lyophilizate . to a 10 ml beaker , fitted with a magnetic stirrer , 2 . 5 ml of tert - butanol tedia lot # 904088 was added and then heated to 30 ° c . the beaker was placed on an ika ms2 minishaker magnetic stirring plate , establishing plate conditions of agitation at 400 to 600 rpm and a temperature of 30 ° c . forty - nine mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . fulvestrant is slowly added . after all fulvestrant was added stirring is continued for 5 minutes a clear solution was obtained . after this time , stirring is stopped and with using a 5 ml syringe and needle ( darling ) the solution is dosed into an 11 ml type i glass vial from nuova ompi . the vial is pre - capped with a helvoet pharma bromobutyl lyophilization stopper and lyophilized using a virtis advantage lyophilizator . the lyophilization cycle is shown in table 2 . once the cycle is completed , vials are withdrawn from the lyophilizator , canned and crimped with aluminum seals . the lyophilizate thus obtained has a very good aspect . titer and purity of the lyophilizate is analyzed by hplc , and compared to scinopharm fulvestrant used in the manufacture of the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph on fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. a physical characterization of a sample of lyophilized fulvestrant was performed . the physical characterization was made by x - ray diffraction , differential scanning calorimetry and thermogravimetric assays . the x - ray assay was carried out in a philips x &# 39 ; pert with a pw3710 unity using cukα radiation = 1 . 54 a . records were obtained in the range of 3 °& lt ; 2θ & lt ; 40 °. a step of 0 . 02 ° in 2θ was used with a time counting of 2 seconds per step . fig7 shows a diffraction diagram of the sample which has a typical diffraction pattern corresponding to an amorphous sample . the differential scanning calorimetry assay was performed with a shimadzu dsc 60 . a sample of 3 . 10 mg was placed on an aluminum sampleholder , and heated at 10 ° c ./ min from room temperature to 200 ° c . work was carried out under n 2 with a flow of 30 ml / min the thermogravimetric assay was performed with a shimadzu tg 50 . the sample was placed in an aluminum sampleholder . it was heated from room temperature to 400 ° c . with heating rate of 10 ° c ./ min , under dry air flow of 40 ml / min fig8 shows a differential scanning calorimetry diagram and a thermogravimetric diagram . thermal signals were observed between room temperature and 70 ° c ., probably associated with the mass loss detected by thermogravimetry . other thermal signals were observed from 70 ° c . to 90 ° c . which apparently did not correspond to mass loss . this lyophilizate was made with scinopharm fulvestrant . a comparison of diffraction diagrams of the starting material , diagram 1 , and the lyophilizate , diagram 7 , shows that during the lyophilization process there was a transformation or change of the crystalline state of fulvestrant from crystalline , the state of the starting material , to amorphous , the state of the lyophilized material . when comparing the results of the thermal study of scinopharm and sicor fulvestrant , it is concluded that the melting point of fulvestrant is 102 +/− 2 ° c . and the enthalpy of fusion is 50 +/− 4 j / g . the lyophilizate does not show the endothermic signals which are characteristic of phase change phenomena . to a 50 ml beaker , fitted with a magnetic stirrer , 12 . 5 ml dimethylsulfoxide malinckroff lot # 904088 was added with the aid of a 5000 ul eppendorf research micropipette . the beaker was placed on an ika ms2 minishaker magnetic stirring plate , establishing plate conditions of agitation at 400 to 600 rpm . two hundred and fifty mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . fulvestrant is slowly added . after all fulvestrant was added stirring is continued for 5 minutes a clear solution was obtained . after this time , stirring is stopped and with using a 5 ml syringe and needle ( darling ) the solution is dosed into a 50 ml type i glass vial from schott . the vial is pre - capped with a helvoet pharma bromobutyl lyophilization stopper and lyophilized using a virtis advantage lyophilizator . the lyophilization cycle is shown in table 3 . once the cycle is completed , vials are withdrawn from the lyophilizator , capped and crimped with aluminum seals . fulvestrant is slowly added . after all fulvestrant was added stirring is continued for 5 minutes a clear solution was obtained . then , with the aid of a 5000 ul eppendorf research micropipette , 1 ml of water was added , and after 2 minutes additional 1 ml water was added . after the addition of water the solution is transformed into a suspension . stirring is stopped and with the aid of a 5 ml syringe and needle ( darling ) the solution is dosed into an 11 ml type i glass vial from nuova ompi . the vial is pre - capped with a helvoet pharma bromobutyl lyophilization stopper and lyophilized using a virtis advantage lyophilizator . the lyophilization cycle is shown in table 4 . once the cycle is completed , vials are withdrawn from the lyophilizator , capped and crimped with aluminum seals . the aspect of the lyophilizate thus obtained is not good . titer and purity of the lyophilizate is analyzed by hplc , and compared to scinopharm fulvestrant used in the manufacture of the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph for fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. lyophilization of fulvestrant from acetic acid and water at a ratio of 1 : 1 by volume to a 5 ml beaker , fitted with a magnetic stirrer , 1 ml glacial acetic acid , merck lot k 36685863 was added with the aid of a 5000 ul eppendorf research micropipette . the beaker was placed on an ika ms2 minishaker magnetic stirring plate , establishing plate conditions of agitation at 200 to 300 rpm . forty - nine mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . fulvestrant is slowly added . after all fulvestrant was added stirring is continued for 5 minutes a clear solution was obtained . then , with the aid of a 5000 ul eppendorf research micropipette , 1 ml of water was added . after the addition of water the solution is transformed into a suspension . stirring is stopped and with the aid of a 5 ml syringe and needle ( darling ) the solution is dosed into an 11 ml type i glass vial from nuova ompi . the vial is pre - capped with a helvoet pharma bromobutyl lyophilization stopper and lyophilized using a virtis advantage lyophilizator . the lyophilization cycle is shown in table 5 . once the cycle is completed , vials are withdrawn from the lyophilizator , capped and crimped with aluminum seals . the lyophilizate thus obtained has a good aspect . titer and purity of the lyophilizate is analyzed by hplc , and compared to scinopharm fulvestrant used in the manufacture of the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph for fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. lyophilization of fulvestrant from ethanol and water at a ratio of 1 : 2 by volume to a 5 ml beaker , fitted with a magnetic stirrer , 0 . 5 ml baker anhydrous ethanol is added with the aid of a 1000 ul eppendorf research micropipette . the beaker was placed on an ika ms2 minishaker magnetic stirring plate , establishing plate conditions of agitation at 200 to 300 rpm . forty - nine mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . fulvestrant is slowly added . after all fulvestrant was added stirring is continued for 5 minutes a clear solution was obtained . then , with the aid of a 5000 ul eppendorf research micropipette , 1 ml of water is added . after the addition of water the solution is transformed into a suspension . stirring is stopped and with the aid of a 5 ml syringe and needle ( darling ) the solution is dosed into an 11 ml type i glass vial from nuova ompi . the vial is pre - capped with a helvoet pharma bromobutyl lyophilization stopper and lyophilized using a virtis advantage lyophilizator . the lyophilization cycle is shown in table 6 . once the cycle is completed , vials are withdrawn from the lyophilizator , capped and crimped with aluminum seals . the lyophilizate thus obtained has a good aspect . titer and purity of the lyophilizate is analyzed by hplc , and compared to scinopharm fulvestrant used in the manufacture of the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph for fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. a 50 ml schott , type i , glass vial is placed on an ohaus adventurer balance . then , 3 . 12 g merck ethanol , 4 . 17 g sigma - aldrich benzyl alcohol and 12 . 70 g sigma - aldrich castor oil are added . with the aid of a 1000 ul eppendorf research micropipette , 5 ml of the previously prepared solvent was added into an 11 ml nuova ompi type i of glass vial . the vial is capped with a solution s - additive plug from westpharma and crimped with an aluminum seal . the process for reconstituting a vial of lyophilizate of example 1 with the solvent of said example , using a needle - less transfer system transfer device 20 / 20 w / 150 mic filter sterile from westpharma , fig9 , is as follows : 1 . seals are removed from the containers ( vials ) containing the solid fulvestrant composition of the invention and the solubilizing composition . 2 . the cover of the package containing the transfer system is removed . 3 . the transfer system is placed on the top of the vial containing the solvent and the cap is pierced using one of the punches of the transfer system . 4 . the vial with solvent is inverted together with the transfer device . 5 . the transfer system is placed on top of the vial containing the lyophilizate and the cap is pierced using the free punch of the transfer system . 6 . the protecting cover of the syringe of the transfer system is removed . 7 . the protecting cover of the 10 ml darling syringe is removed , and the syringe is introduced into the luer lock of the transfer system . 8 . the valve of the transfer system is mounted to remove the solvent , which is extracted with the syringe . 9 . the transfer system valve is turned to connect the syringe and the lyophilizate . 10 . the complete content of the syringe is discharged into the lyophilizate vial . 11 . after the reconstituted solution is formed , the transfer system is turned 180 degrees to withdraw this solution with the aid of a syringe . using a sper scientific timer , it was determined that less than 90 seconds were required for reconstituting the lyophilizate . using a 50 ml schott type i glass vial , 250 mg scinopharm fulvestrant lot # 70850aa003 are weighed . with the aid of a 10 ml darling syringe and needle , 5 ml of the solvent of example 7 are extracted and added to the vial containing scinopharm api fulvestrant . it was determined that more than 60 minutes were required to completely dissolve fulvestrant in the solvent using a sper scientific timer . titer and purity of the reconstituted fulvestrant of example 7 are analyzed by hplc , and compared to scinopharm fulvestrant as used for manufacturing the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph for fulvestrant . the titer of the lyophilizate was the same as that of scinopharm fulvestrant , 99 . 2 %. fulvestrant and lyophilizate total impurities were 0 . 1 %. stability test of the fulvestrant solution in acetic acid during 6 hours at room temperature to a 10 ml beaker , fitted with a magnetic stirrer , 2 . 5 ml glacial acetic acid , merck lot k 36685863 , is added . the beaker is placed on an ika model ms2 minishaker magnetic stirrer plate . fifty mg fulvestrant from scinopharm , lot # 70850aa003 were weighed using an ohaus model adventurer balance . stirring of acetic acid is started and fulvestrant is slowly added which is rapidly dissolved . after all fulvestrant was added stirring is continued for 5 minutes . stirring is stopped and the solution is left at room temperature for 6 hours , then dissolution is analyzed in terms of titer and purity by hplc , and compared to scinopharm fulvestrant as used for manufacturing the lyophilizate . hplc determinations were carried out on an hplc waters with a waters 1525 binary pump , waters 717 autosampler , and a waters 2996 diode array detector ; the hplc column used for determining titer and purity is an agilent eclipse xdb - c8 3 . 5u 4 . 6 × 150 rapid res column ; the chromatographic method corresponds to us pharmacopeia ( usp , 34 ( 2011 )) monograph for fulvestrant . the titer of the solution was 99 . 2 %, the same as the one of scinopharm fulvestrant , i . e . 99 . 2 %. fulvestrant and lyophilizate total impurities in the solution were 0 . 1 %. the sample of fulvestrant to be analyzed was manufactured by scinopharm , lot # 70850aa003 . the physical characterization was made by x - ray diffraction , differential scanning calorimetry and thermogravimetric assays . the x - ray assay was carried out in a philips x &# 39 ; pert with a pw3710 unity using cukα radiation = 1 . 54 a . records were obtained in the range of 3 °& lt ; 2θ & lt ; 40 °. a step of 0 . 02 ° in 2θ was used with a time counting of 2 seconds per step . fig1 shows a diffraction diagram of the sample which has a typical diffraction pattern corresponding to a crystalline sample . the differential scanning calorimetry assay was performed with a shimadzu dsc 60 . a sample of 1 . 68 mg was placed on an aluminum sampleholder , and heated at 10 ° c ./ min from room temperature to 200 ° c . work was carried out under n 2 with a flow of 30 ml / min the thermogravimetric assay was performed with a shimadzu tg 50 . the sample was placed in an aluminum sampleholder . it was heated from room temperature to 400 ° c . with heating rate of 10 ° c ./ min , under dry air flow of 40 ml / min fig2 shows a differential scanning calorimetry diagram and a thermogravimetric diagram . an endothermic signal characterized by an onset temperature to = 49 +/− 1 ° c . and an enthalpy variation of 11 +/− 2 j / g was observed , which as may be appreciated in the thermogravimetric diagram does not correspond to mass loss and presumably corresponds to the melting point , which confirms that the crystalline state of fulvestrant is a crystal . the sample of fulvestrant to be analyzed was manufactured by sicor , lot # 4233500210c . the physical characterization was made by x - ray diffraction , differential scanning calorimetry and thermogravimetric assays . the x - ray assay was carried out in a philips x &# 39 ; pert with a pw3710 unity using cukα radiation = 1 . 54 a . records were obtained in the range of 3 °& lt ; 2θ & lt ; 40 °. a step of 0 . 02 ° in 2θ was used with a time counting of 2 seconds per step . fig3 shows a diffraction diagram of the sample which has a typical diffraction pattern corresponding to a crystalline sample . the differential scanning calorimetry assay was performed with a shimadzu dsc 60 . a sample of 2 . 82 mg was placed on an aluminum sampleholder , and heated at 10 ° c ./ min from room temperature to 200 ° c . work was carried out under n 2 with a flow of 30 ml / min . the thermogravimetric assay was performed with a shimadzu tg 50 . the sample was placed in an aluminum sampleholder . it was heated from room temperature to 400 ° c . with heating rate of 10 ° c ./ min , under dry air flow of 40 ml / min fig4 shows a differential scanning calorimetry diagram and a thermogravimetric diagram . an endothermic signal characterized by an onset temperature to = 103 +/− 1 ° c . and an enthalpy variation of 49 +/− 2 j / g was observed , which as may be appreciated in the thermogravimetric diagram does not correspond to mass loss and presumably corresponds to the melting point , which confirms that the crystalline state of fulvestrant is a crystal . it may be appreciated upon comparing the results of scinopharm and sicor fulvestrant that the x - ray diffraction diagram , the melting point and fusion enthalpy are very similar . syringeability and injectability of different solvents using needles and using a transfer system syringeability and injectability are key parameters for the design of parenteral products . the first term refers to the ability of the injectable to readily pass through a needle when transferred from one vial to another ; the second term refers to the ability to be injected . the syringeability includes factors such as easy extraction , obstruction and foam formation as well as precision of metered doses . the injectability includes the pressure or force required for the injection , flow uniformity and non - obstruction ( 13 ). the syringeability of the solvent and the reconstituted solution of example 7 were assayed using 3 systems : the first system consisted of a 10 ml darling syringe , with 23 g needles , the second system employed a 10 ml darling syringe , with 18 g needles , both needles had a length of 3 . 8 cm , and the last one was the transfer system described in example 7 . the assay consisted in extracting the solvent describe in example 7 , injecting it in the lyophilizate vial , reconstituting the lyophilizate and extracting it from the vial containing it . when the solvent extraction assay was carried out with the syringe and 23 g needle system we discovered that no solvent could be extracted . this is due to the high viscosity of the solvent and the high caliper of the syringe . therefore it was decided to use a syringe with lower needle caliper , i . e . having a greater diameter hole of the needle , performing the assay with an 18 g needle . but the result was the same as before , nothing could be extracted . the selection of a 23 g needle is supported by the fact that the reconstituted fulvestrant , like the original product faslodex , is administered intramuscularly . according to reference ( 14 ), needles comprising from 21 to 23 g and with a length from 2 . 5 cm to 3 . 8 cm should be used for intramuscular injections ; a 23 g needle is used for the original product , faslodex . the use of a transfer system , another object of the present invention , allowed for passing solvent to the syringe , from the syringe to the reconstitution vial and from the latter to the syringe almost immediately and with no need to exert any force . 2 d . l . teagarden , d . s . baker , practical aspects of lyophilization using non - aqueous co - solvent systems ; european journal of pharmaceutical sciences , 15 , 115 - 133 , 2002 . 4 l . rey , j . may ; freeze drying / lyophilization of pharmaceutical and biological products , 3 edition ; informa healthcare ; p . 25 , 2010 . 5 l . rey , j . may : freeze drying / lyophilization of pharmaceutical and biological products , 3 edition ; informa healthcare , p . 325 , 2010 . 6 t . a . jennings : lyophilization introduction and basic principles ; informa healthcare , p . 428 , 2008 . 11 david e . alonso et al . : understanding the behavior of amorphous pharmaceutical systems during dissolution ; pharmaceutical research , 27 , 4 , 2010 12 sharad b . murdande et al . : solubility advantage of amorphous pharmaceuticals : ii ; application of quantitative thermodynamic relationships for prediction of solubility enhancement in structural diverse insoluble pharmaceuticals ; pharmaceutical research , 27 , 2704 - 2714 , 2010 . 13 f . cilurzo et al . ; injectability evaluation : an open issue ; aaps pharmscitech 07 / 005 / 2011 .

the invention relates to a solid pharmaceutical composition comprising solid amorphous fulvestrant , said composition being formulated in combination with a solubilizing composition . the invention also relates to a method for preparing said composition and a kit including the composition .

identical element or elements of identical function are shown with the same reference characters in all the figures . the diagrams in the figures are schematic and not necessarily to scale . without restricting its generality , the computed tomography device 11 is only examined below to the extent that this is deemed necessary for an understanding of the invention . the computed tomography device 11 shown in fig4 has a gantry 12 with a stationary part 13 and a part 14 that can be rotated about a system axis 15 . in the present exemplary embodiment of the invention the rotatable part 14 has an x - ray system , which comprises an x - ray radiation source 16 and an x - ray radiation detector 17 , which are disposed opposite one another on the rotatable part 14 . during operation of the computed tomography device 11 x - ray radiation 18 is emitted from the x - ray radiation source 16 in the direction of the x - ray radiation detector 17 , penetrates a measurement object and is detected by the x - ray radiation detector 17 in the form of measurement data or measurement signals . the computed tomography device 11 also has a patient couch 19 to support a patient p to be examined . the patient couch 19 comprises a couch base 20 , on which a patient support plate 21 provided to actually support the patient p is disposed . the patient support plate 21 can be moved relative to the couch base 20 in the direction of the system axis 15 in such a manner that it can be introduced , together with the patient p , into the opening 22 of the gantry 12 for the recording of 2d x - ray projections of the patient p , e . g . during a spiral scan . the computational processing of the 2d x - ray projections recorded using the x - ray system and the reconstruction of slice images , 3d images or a 3d data record based on the measurement data or measurement signals of the 2d x - ray projections take place using a schematically illustrated image computer 23 of the computed tomography device 11 . the computed tomography device 11 also has a computing unit 24 , which can be and is used to execute computing programs to operate and control the computed tomography device 11 . the computing unit 24 does not have to be configured as a separate computing unit 24 here but can also be integrated in the computed tomography device 11 . in the present exemplary embodiment of the invention a computing program 25 is loaded into the computing unit 24 , which implements the inventive method for performing a dynamic ct examination on a patient p . the computing program 25 here represents a specific operating mode for the computed tomography device 11 and can be loaded into the computing unit 24 from a portable data medium , for example from a cd 26 or memory stick , or even from a server 27 via a network 28 , which may be a public or internal clinic or hospital network . for a dynamic ct examination of the patient p according to the invention , for example for a dynamic ct examination of the body region of the patient p containing the liver using contrast agent , in the present exemplary embodiment of the invention a diaphragm 30 is assigned to the x - ray radiation source 16 , the diaphragm 30 having two diaphragm elements or diaphragm blades 31 and 32 , which can be moved in the two directions of the system axis 15 . the movement of the diaphragm blades 31 , 32 can be brought about by one or more electric drives ( not shown ), which are activated at least indirectly by the computing unit 25 . during the dynamic ct examination of the body region of the patient p containing the liver , a scan region s is first defined in the direction of the system axis 15 , in which x - ray projections of the body region of the patient p are recorded from different directions over approx . 50 seconds . the scan region s , when viewed in the direction of the system axis 15 , is larger than the width b of the x - ray radiation detector 17 . in order to be able to record x - ray projections from the entire scan region s periodically , the patient support plate 21 must be moved forward and back periodically between a first end position e 1pl and a second end position e 2pl . if in this process the x - ray radiation detector 17 were covered continuously over its entire width b when viewed in the direction of the system axis 15 by the x - ray radiation beam 18 originating from the x - ray radiation source 16 , a relatively high dose of x - ray radiation would be applied to the patient p in the central body section of the body region to be scanned or examined , since a sort of over - scanning would take place there , without being able to use the additional information usefully . for this reason the diaphragm elements 31 , 32 of the diaphragm 30 are moved by a program controller counter to the patient support plate 21 in the direction of the system axis 15 from a first end position e 1diaphragm into a second end position e 2diaphragm . the diaphragm blades 31 , 32 here have a selectable opening width w when viewed in the direction of the system axis 15 , so that , when it strikes the x - ray radiation detector 17 , when viewed in the direction of the system axis 15 , the x - ray radiation beam 18 originating from the x - ray radiation source 16 only covers part of the detector surface of the x - ray radiation detector 17 . as the diaphragm blades 31 , 32 are being moved and x - ray projections are being recorded , the opening width w remains constant . the patient support plate 21 and the diaphragm blades 31 , 32 are moved by a program controller in opposite directions relative to one another so that , as the patient support plate 21 is being moved from its first end position e 1pl into its second end position e 2pl and at the same time the diaphragm blades 31 , 32 are being moved from their first end position e 1diaphragm into their second end position e 2diaphragm , the x - ray radiation beam 18 covers the x - ray radiation detector 17 completely when viewed in the direction of the system axis 15 . to this end the movement speeds for the patient support plate 21 and the diaphragm blades 31 , 32 should be selected or set correspondingly inter alia as a function of the size of the scan region s , the opening width w of the diaphragm blades 31 , 32 and the width b of the x - ray radiation detector 17 when viewed in the direction of the system axis 15 . these settings are assisted by the computing program 25 , which preferably also has a graphical user interface , which can be displayed on the display apparatus of the computing unit 24 . in the present exemplary embodiment of the invention the x - ray radiation source 16 is an x - ray tube 16 with a spring focus . in the present exemplary embodiment of the invention the x - ray tube 16 has two focuses f 1 and f 2 offset in the direction of the system axis 15 . this makes it possible , as the diaphragm blades 31 , 32 are being moved in the direction of the system axis 15 , to move the respectively active focus , used to generate x - ray radiation , likewise in the direction of the system axis 15 , in order to be able to generate an appropriate x - ray radiation beam 18 for the scan . the sequence of the dynamic ct examination is illustrated in fig5 to 8 for four time points of a periodic movement . fig5 shows the initial situation , in which the patient support plate 21 is in its first end position e 1pl and the diaphragm blades 31 , 32 are in their first end position e 1diaphragm . in the present exemplary embodiment of the invention the opening width w of the diaphragm blades 31 , 32 is selected so that approximately a quarter of the detector surface of the x - ray radiation detector 17 is covered by the x - ray radiation beam 18 originating from the focus f 1 of the x - ray tube 16 . therefore with this configuration only part of the body region of the patient p to be scanned is penetrated by the x - ray radiation beam 18 . the patient support plate 21 is now moved first in the direction of the arrow a and the diaphragm blades 31 , 32 are moved in the opposite direction at the same time in the direction of the arrow b . fig6 shows the arrangement from fig5 at a time point , when the patient support plate 17 has been moved a little in the direction of the arrow a and the diaphragm blades have been moved a little in the direction of the arrow b . fig7 shows the arrangement from fig5 at a time point when the change from focus f 1 to focus f 2 has taken place , so that the focus follows the movement of the diaphragm blades 31 , 32 . fig8 shows the arrangement from fig5 at a time point when the patient support plate 17 has reached its end position e 2pl and the diaphragm blades 31 , 32 have reached their end position e 2diaphragm . the end position e 2pl is also the reversal point for the movement of the patient support plate 17 , which now moves in the direction of the arrow b . the end position e 2diaphragm is correspondingly the reversal point for the movement of the diaphragm blades 31 , 32 , which now move in the direction of the arrow a , therefore once again counter to the patient support plate 21 . to this extent the sequence is now reversed ( see also fig8 to fig5 ). the end positions e 1pi and e 1diaphragm also represent reversal points for the movements . while the patient support plate 21 and the diaphragm blades are moved forward and back periodically between their end positions , x - ray projections of the body region of the patient p to be examined are recorded continuously with the rotatable part 14 rotating about the patient p , from which projections slice images are preferably reconstructed with the aid of the image computer 23 . since the slice images generally follow one another in time , the liver can be displayed in different phases produced by the contrast agent , as described above . it can be seen from fig5 to 8 that as a result of the inventive method no over - scanning takes place in the central body region of the body region of the patient p to be examined or scanned , so that a smaller dose of x - ray radiation is applied to the patient p than with a scan , in which only the patient support plate is moved periodically between its end positions with the x - ray radiation detector being covered completely with each x - ray projection ( see also fig3 ). the dose profile d shown in fig9 is also more homogeneous . the simultaneous movement of patient support plate 21 and diaphragm blades 31 , 32 also means that a higher scan speed is achieved than with the movement of the patient support plate 21 alone . also , to achieve the same scan speed as with the method in which only the patient support plate is moved , the speed of the patient support plate can be reduced as a result of the opposing movement of the diaphragm blades , so that the patient is also exposed to slower acceleration speeds to reach the respective speed . since the movement and positioning of the diaphragm blades can take place very quickly , dynamically triggered heart recordings are also possibly with the inventive method . for these the patient is moved forward and back with the patient support plate between two end positions according to his / her heart rate . if variations occur in the patient &# 39 ; s heart rate , which , due to the inertia of the patient support plate , cannot be compensated for by a corresponding change in the movement speed of the patient support plate , the movement speed of the diaphragm blades is matched to the changed heart rate instead , in order to achieve the desired triggering during the recording of x - ray projections . it is clear from this that the movement speeds of the patient support plate and the diaphragm blades do not have to be constant but can vary or be matched to the recording situation . in contrast to the described exemplary embodiment of the invention the focus of the x - ray radiation source does not necessarily have to be a spring focus . the x - ray radiation source can therefore also have just one stationary focus . the described embodiment of the invention should generally only be considered to be exemplary . in particular settings such as the opening width of the diaphragm blades , the scan region , etc . can also be selected differently . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .

in a computed tomography apparatus and operating method , a radiation source and radiation detector are rotated around a system axis , and a patient support plate and diaphragm elements of a diaphragm associated with the x - ray source are also movable in the direction of the system axis . movement of the patient support plate and the diaphragm plates between respective end positions is coordinated during a dynamic computed tomography examination of a subject so as to reduce and homogenize the dose of x - ray radiation to which the subject is exposed during the examination .

an embodiment of the present invention will be explained by referring to the drawings in detail below . fig1 shows an embodiment of a pachinko machine for which an electronic display device and a game board according to the present invention are used , in a front view thereof . in fig1 a reference numeral 1 denotes the frame of the game machine , and a reference numeral 2 denotes a variable display unit of a liquid crystal display disposed on the back of the game board 3 of the pachinko machine . here , the area of the liquid crystal display screen occupies most of the area of the game board 3 , and a picture 18 is generated by a display on the liquid crystal display . the removable game board 3 is installed in front of the liquid crystal display . the base board is constituted of a sufficiently transparent board material which is an acrylic panel here to avoid disturbing the liquid crystal display when viewing it from the front . fig2 shows a cross - sectional side view of the game machine in fig1 wherein a reference numeral 13 denotes a front glass panel , a reference numeral 14 denotes an electronic control board housing , and a reference numeral 15 denotes a start - up winning ball detector . a guide rail 4 , nails 5 , a rotary pinwheel 6 , a start - up winning port 7 , a jackpot port 8 , and other winning ports 10 are arranged on the front side of the game board 3 , while a winning ball guide 9 is arranged on the back . it is effective to constitute them with a transparent material so as to provide them with transparency . the transparent board 3 is installed on the game board 1 in an easily removable fashion such as with screws or by insertion so that it can be easily replaced . although not shown , the game board 3 is arranged with electrical wiring for turning indicators 12 on or off , a drive unit for opening and closing the jackpot port 8 , and its electrical wiring , which are connected to an electronic control board in the electronic control board housing 14 through a connector 16 . the wiring is led to the surrounding nontransparent region by a transparent electrode consisting of ito . referring to fig1 a pachinko ball 17 projected by a ball projector ( not shown ) travels along the guide rail 4 , bumps against or is guided by the nails 5 and the pinwheels 6 while dropping , and , if it enters in the winning port 7 , becomes a winning ball . the winning ball is guided to the winning ball guide 9 , and detected by the start - up winning ball detector 15 ( fig2 ). the detection is converted to an electric signal , which is then input to the electronic control board ( not shown ) in the electronic control board housing 14 ( fig2 ) as an input signal . upon receipt of the signal , a cpu on the electronic control board determines various decisions to control the display screen of the liquid crystal display which constitutes the variable display unit 2 , opening or closing operations of the jackpot port 8 on the game board 3 , and turning the indicator 12 on or off . here , if no ball enters in the start - up winning port 7 for three minutes , the displayed flower 18 starts fading . in addition , a missed ball is returned through a reject port 11 . infrared sensors ( not shown ) are installed around the game board so that the position of the pachinko ball can be detected with a 10 × 10 matrix within the traveling range of the ball . here , it is arranged so that , when a pachinko ball enters in the start - up winning port 7 , a character ( not shown ) displayed on the variable display unit chases the ball dropping on the game board surface . it can be used to detect whether or not a ball enters in the winning port with the sensor . in such a case , it may have a structure that the ball pass through the winning port as is without providing the winning ball guide 9 . with such an arrangement , it becomes possible to avoid a situation such that the display on the variable display unit is hidden by the winning ball guide . it may be also possible to provide a function for detecting the ball on the winning port itself . according to the present invention , the front surface of the variable display unit of the game machine can be utilized as the ball moving region so that there is no limitation on the size of variable display unit and an electronic display device with a large screen can be used for the front surface of the variable display unit of the game machine . as a result , the amount of displayed information is significantly increased so that it becomes possible to provide more variety with the contents of the display and to increase the degree of freedom . thus , in turn , it becomes possible to provide new possibilities and fascination with the pachinko machine or pinball machine . furthermore , it becomes possible to vary the display on the variable display unit and the details of the game such as the number of prize balls according to the movement or speed of a ball passing over the transparent area by detecting the presence of the balls passing over the transparent area . in addition , the updating of pachinko machines can be performed simply by changing the display data for the electronic display device with a large screen on the variable display unit , which can be performed by replacing the electronic control board , and / or by replacing the transparent game board . therefore , the waste produced in the updating of the game machines is only the electronic control board and / or the transparent game board so that waste can be significantly reduced . furthermore , the ease of replacement also reduces the time and cost required for replacement .

a game machine is provided in which the effective area for the game is not restricted even if the display area of the variable display unit is increased . the game machine comprises a variable display unit having an electronic display device , and a transparent area arranged with nails , decorations such as pinwheels , and a winning port which area is provided in front of the variable display unit .

although it is well established that mutations in the nod2 gene increase susceptibility to crohn &# 39 ; s disease , the role of nod2 in the pathogenesis of crohn &# 39 ; s disease heretofore was elusive . variants in nod2 result in deficient intestinal intestinal expression of α - defensins and excessive secretion of il - 1β , causing increased inflammation . thus , reduced intestinal expression of human α - defensins cause the over - production of il - 1β in patients with inflammatory complications . lipopolysaccharide ( lps ) activated , 35 s - methionine - labeled human monocytes treated with human α - defensins hnp - 1 or hd - 5 in the presence and absence of atp were examined . media and cell - associated fractions were harvested separately and il - 1β was recovered from each by immunoprecipitation . the resulting immuno - precipitates were analyzed by sds - page and autoradiography . referring now to fig2 , in the absence of atp , lps activated monocytes released about 10 % of 35 s - methionine - labeled proil - 1β ( 31 kda ) into the media , but no mature ( 17 kda ) il - 1β was detected . as expected , addition of atp to the lps - activated monocyte culture led to the release of 90 % of newly synthesized proil - 1β from the cell and more than 90 % of the proil - 1β was processed to mature il - 1β and detected in the media . surprisingly , the release of proil - 1β from the lps - activated monocyte culture was completely blocked by the addition of 10 ug / ml of hd - 5 , see fig2 . as further demonstrated in fig2 , 20 ug / ml of hnp - 1 was also sufficient to block proil - 1β production . further analysis demonstrated that of physiological concentrations of 5 ug to 100 ug / ml , both hnp - 1 and hd - 5 blocked atp mediated proil - 1β release in a dose dependant manner . of course , blocking proil - 1β prevents the production and release of mature il - 1β proteins . however , hnp - 1 and hd - 5 does not appear to affect the processing of proil - 1β after it is released extracellularly . thus , if lps - activated human monocytes are first treated with atp , and then subsequently treated with α - defensins , some proil - 1β may escape extracellularly and be processed into mature il - 1β . fig3 demonstrates this phenomenon . fig3 also demonstrates that both hnp - 1 and hd - 5 blocked atp mediated proil - 1β release in a dose dependant manner . the inventors further investigated the role of α - defensins in il - 1β maturation in a murine model of colitis . after administration of 4 % dextran sulfate sulfate sodium ( dss ) in drinking water for 7 days to induce colitis , all mmp - 7 knockout mice , which lack the mature intestinal α - defensins , died of severe intestinal inflammation and loss of body weight . conversely , all wild - type control mice survived with only mild colitis and loss of body weight . thus , α - defensins function as a negative regulator of the posttranslational processing and release of il - 1β . in addition to their antimicrobial activity , α - defensins play an important role in inflammation by controlling the production of il - 1β . accordingly the following therapeutic approaches are effective to reduce inflammation and tissue destruction . a pharmaceutical composition for therapeutic supplementation of a metabolic pathway to reduce inflammation by blocking il - 1β release is desirable . the pharmaceutical composition may comprise a human α - defensin in a therapeutically effective amount , or an amide , ester or salt thereof and a pharmaceutically effective carrier . pharmaceutically effective carriers include any and all solvents , disburse media , coatings , anti - bacterial and anti - fungal agents , isotonic and absorption delaying agents , and the like compatible with pharmaceutical administration . the use of media agents for pharmaceutically active substances is well known in the art . preferably , the pharmaceutical composition is orally administered ; however the pharmaceutical composition may be injected or administered in any other manner suitable to effectively reduce inflammation . the pharmaceutical composition has an inhibiting action on the release of interleukin - 1β through the supplementation of the human α - defensins in a therapeutically effective amount . in one embodiment of the invention , the human α - defensin is human neutrophil defensin 1 ( hnp - 1 ). in another embodiment , the human α - defensin is human α - defensin 5 ( hd - 5 ). however , it is contemplated that many human α - defensins produced by neutrophils or by paneth cells may be effective to reduce inflammation when present in a pharmaceutically acceptable manner . the isolation and purification of natural defensin peptides are well described in the scientific and patent literature . in particular , such methods are described in u . s . pat . nos . 5 , 242 , 902 ; 4 , 543 , 252 ; 4 , 659 , 692 ; and 4 , 705 , 777 the subject matter of which are hereby incorporated by reference . the present application also contemplates the method for treating inflammation in mammalian tissues . in the method , a human α - defensin is administered to a mammal in an amount effective to inhibit the post transitional processing release of interleukin - 1β . the administration is preferably accomplished by injecting or orally administering a pharmaceutical composition to the mammal , however , it is contemplated that any other well - known methods of administering proteins to a mammal may be utilized . as noted above , the α - defensin that is administered is human neutrophil defensin 1 ( hnp - 1 ) in one embodiment and human α - defensin 5 ( hd - 5 ) in another embodiment . however , any α - defensin produced by neutrophils or paneth cells that is effective to inhibit post transational processing is release of interleukin - 1β is contemplated as being within the scope of this method . preferably , the method for treating inflammation is carried out on a human ; however any type of mammal may be subject of the administration . the subject matter of the present application is further illustrated by the following examples which in no way should be construed as being further limiting . contents of all cited references and patents cited throughout this application hereby expressly incorporated by reference . peripheral blood monocytes where isolated from healthy volunteers and patients with inflammatory bowel disease and suspended in monocyte maintenance medium ( rpmi 1640 medium , 5 % fbs 25 mm hepes and 1 % pen / strep ). blood samples from healthy volunteers were collected at the auburn university medical clinic under an approved protocol . blood samples from inflammatory bowel disease patients were provided by dr . w . park mcgehee of of internal medicine associates of opelika , ala ., u . s . a . monocytes were first primed with lipopolysaccharides ( lps ). monocytes were allowed to adhere for two hours , after which medium supernatants were discarded . attached cells were rinsed twice with maintenance medium and incubated in 1 ml of maintenance medium overnight at 37 ° c . in a 5 % co 2 environment . the following morning lps was added to some walls to achieve a final concentration of 10 ng / ml and the cultures were activated for two hours at 37 ° c . the media was then removed and 1 ml of fresh medium ( rpmi 1640 containing 1 % fvs 25 mm hepes and 5 mm nahco 3 ) was added to each well . these lps - activated monocytes where then treated with atp and subsequently , monocytes were selectively treated with α - defensins for interleukin - 1β post transitional processing and release studies . human α - defensin hnp - 1 was obtained from peptide international of louisville , ky ., u . s . a . recombinant human α - defensin hd - 5 was provided by dr . edith porter of california state university , los angeles , u . s . a . the quality of the synthetic peptides were verified by their anti - bacterial activity . synthetic human α - defensin hnp - 1 was further purified by hplc and compared to the natural hnp - 1 by acid - urea page . lps - activated human monocytes were treated with 0 , 1 , 10 and 100 micrograms at 37 ° c . for three hours . it was also treated with 2 mm atp for il - 1β maturation . supernatants were then collected after a 5 minute centrifugation in microphage tubes . the concentration of mature il - 1β and the supernatants was quantified by elisa ( r & amp ; d systems ). because the elisa is reported by the manufacturer to recognize both pro and mature il - 1β species , presence of proil - 1β and mature il - 1β in the supernatant and cell lysates was also determined by western blot analysis . briefly , proteins were precipitated from the supernatants by addition of trichloroacetic acid ( tca : 7 . 5 % final concentration ) and cholic acid ( 0 . 1 % final concentration ) to each sample . the percipate proteins were washed twice with 100 % acetone to extract residual tca and dissolved in 0 . 1 ml of sds - page sampled buffer . the cells where then washed once with pbs and lysed into 0 . 2 ml of lysis washed once with pbs and lysed into 0 . 2 ml of lysis buffer ( 25 mm hepes 300 mm nacl 1 . 5 mm mgcl 2 , 0 . 2 mm edta , 1 % triton x - 100 , 2 mg / ml leupeptin and 10 mg / ml pmf ). cell lysates and tsa precipitated proteins from the supernatants where then subjected to 12 % sds - page gels and then transferred to pvdv membranes for western blot analysis . il - 1β was probed with goat anti - il - 1β antibody and detected with the rabbit anti - goat igg - horesradish peroxidase conjugate . as demonstrated in fig2 , hd - 5 and hnp - 1 operate to inhibit the production of proil - 1β for lps activated human monocytes . column 1 , labeled “ lps only ” demonstrates that 4 million cell equivalents activated with 20 ng / ml of lps and incubated for two hours produces proil - 1β proteins . column 2 (“ atp 2 mm ”) demonstrates that four million cell equivalents are activated with 20 ng / ml lps and further activated with 2 mm of atp incubated for 3 hours produces less proil - 1β and significant amount of mature il - 1β protein . column 3 (“ atp + ice inhibitor ”) contains a control inhibitor ( yvad - cmk , 100 μm ) for the atp saturation path and , as demonstrated therein , 4 million cell equivalents treated with 20 ng / ml of lps and further treated with atp and with the ci inhibitor produces a substantial amount of proil - 1β , but no mature il - 1β proteins . columns 4 , 5 and 6 all demonstrate the effect of increasing an amount of hd - 5 on 4 million cell equivalents activated with lps . as demonstrated in columns 4 , 5 , 6 , no proil - 1β nor any mature il - 1β proteins were expressed . columns 7 , 8 , and 9 demonstrate the effect of hnp - 1 on il - 1β expression . when 4 million cell equivalents are activated with 10 ng / ml of lps and incubated for 2 hours and then treated with 20 mg / ml of hnp - 1 , some proil - 1β was displayed , but no mature il - 1β was demonstrated . the increase of 20 - 50 mg , represented by columns 8 and 9 demonstrate that no proil - 1β and no mature il - 1β proteins were produced . fig3 demonstrates that human α - defensins block the release of proil - 1β from atp stimulated human monocytes . lps - activated , 35 s - methionine / cysteine - labeled human monocytes were treated with 1 mm atp with or without hnp - 1 or hd - 5 for 3 hours . media were harvested separately . il - 1β was recovered by immunoprecipitation . the resulting immunoprecipitates were analyzed by sds - page and autoradiography . as demonstrated in fig3 , column 1 , when atp alone is used to treat human monocytes , a substantial amount of both proil - 1β and mature il - 1β is produced . columns 2 - 4 demonstrate that when 20 - 100 μg / ml of hnp - 1 are added to atp activated cells , no proil - 1β is released and mature il - 1β is inhibited in a dose dependant manner . likewise , columns 5 and 6 demonstrate that that when 20 and 100 μg / ml of hd - 1 are added to atp activated human monocytes , no proil - 1β is released and mature il - 1β is inhibited in a dose dependant manner . since the α - defensins inhibit the release of proil - 1β in a dose dependant manner , the amount of proil - 1β that escapes extracellularly to mature into mature il - 1β is also reduced in a dose dependant manner . as aforementioned , hnp - 1 and hd - 5 does not appear to affect the processing of proil - 1β after it is released extracellularly . accordingly , the results of the experiments confirm that both hnp - 1 and hd - 5 block atp mediated proil - 1β release in a dose dependant manner , and substantially completely block proil - 1β and mature il - 1β in lps activated cells . thus , α - defensins are a key inhibitor of interleukin - 1β release and have a substantial effect on reducing inflammation when used in a pharmaceutical composition or method of administering to a mammal . those skilled in the art will recognize , or will be able to ascertain using no more than routine experimentation , many equivalents to the specified embodiments of the invention disclosed herein . such equivalents are intended to be encompassed by the following claims that particularly point out and distinctly claim the subject matter regarded as the invention .

human α - defensins are inhibitors of interleukin - 1β post transitional processing and release . interleukin - 1β is a key cytokine involved in the initiation and amplification of the inflammatory process , including the inflammation of diseases such as crohn &# 39 ; s disease and ulcerative colitis . particularly , human neutrophil defensin - 1 produced mainly by neutrophils , and human α - defensin 5 produced by paneth cells has been found to block interleukin - 1β post transitional processing and release . thus , a pharmaceutical composition and method for treating inflammation in the mammalian tissues is herein disclosed . the pharmaceutical composition is a therapeutic supplementation of a metabolic pathway to reduce inflammation comprising a human α - defensins in a therapeutically effective amount or an amide , ester or salt thereof and a pharmaceutically effective carrier . the method for treating inflammation in mammalian tissues includes administering a human α - defensins to a mammal in an amount effective to inhibit the post translational processing and release of interleukin - 1β .

the formulation of this invention can be prepared by the following manner . amosulalol hydrochloride is mixed well with an excipient which may be selected from those usually used and after adding thereto a solution or a suspension of an entero - soluble material in water or an organic solvent , the resultant mixture is granulated . in this case , the entero - soluble material may be directly added to the aforesaid mixture of amosulalol and after adding thereto a binder which may be selected from those usually used , the resultant mixture may be granulated . also , in the case of using a pharmaceutically acceptable organic acid in this invention , the organic acid may be added to the aforesaid mixture followed by granulation . furthermore , the granules thus obtained may be formed into tablets by means of a tableting machine and coating may be applied to these tablets for the prevention of bitterness and the improvement of the appearance . examples of the entero - soluble material which is used in this invention are a methacrylic acid - ethyl acrylate copolymer ( e . g ., eudragit l30d - 55 , trade name made by rohm and haas company , a copolymer of methacrylic acid and ethyl acrylate ( 1 : 1 ) having a molecular weight of about 250 , 000 ), a methacrylic acid . methyl methacrylate copolymer ( e . g ., eudragit l100 , trade name , made by rohm and haas company , a copolymer of methacrylic acid and methyl methacrylate ( 1 : 1 ) having a molecular weight of 135 , 000 or eudragit s100 , a copolymer of methacrylic acid and methyl methacrylate ( 1 : 2 ) having a molecular weight of about 135 , 000 ), hydroxypropylmethyl cellulose phthalate ( the japan pharmacopoeia , the 10th revision ), cellulose acetate phthalate ( the japan pharmacopoeia , the 10th revision ), shellac ( the japan pharmacopoeia , the 10th revision ), and the like . these entero - soluble materials are dissolved at a ph higher than a specific value . for example , eudragit l30d - 55 is dissolved at a ph higher than about 5 . 5 , eudragit l100 at a ph higher than about 6 . 0 , and eudragit s100 at a ph higher than about 7 . 0 . by properly selecting the entero - soluble material , the medicament can be absorbed at each different portion in the intestines , thus the long acting characteristics can be controlled . among the above - described entero - soluble materials , methacrylic acid - ethyl acrylate copolymers can be dissolved in water as a solvent and hence in this case the granulation is easy as compared to the case of using an organic solvent and also this case is safe and economical . in addition , a methacyrlic acid - ethyl acrylate copolymer ( eudragit l30d - 55 ) is commercially available in the form of usually an aqueous 30 % dispersion . the entero - soluble material is used in a content of 5 to 50 % by weight of the total weight of the formulation of this invention and the content of 10 to 30 % by weight is particularly preferred . examples of the pharmaceutically acceptable organic acids which are used in this invention are citric acid ( the japan pharmacopoeia , the 10th revision ), tartaric acid ( the japan pharmacopoeia , the 10th revision ), and the like . the purpose of using the organic acid is to improve the solubility of amosulalol hydrochloride at a high ph region ( in particular , about 7 . 5 which is one of the ph values of a physiological saline solution ), whereby the bio - availability of amosulalol hydrochloride is increased . the content of the pharmaceutically acceptable organic acid is 1 to 30 % by weight of the total weight of the product but is , in particular , preferably 5 to 20 % by weight . in this invention , excipients , lubricants , binders , and the like , which are usually used for conventional formulations can be used without particular restrictions . examples of the excipients are lactose , starch , calcium hydrogenphosphate , silicic anhydride , and the like ; examples of the lubricants are magnesium stearate , talc , and the like ; and examples of the binders are hydroxypropyl cellulose , starch , and the like . there is no particular restriction on the the amounts of these additives and the amounts of them may be properly selected according to the purpose of using them . then , the present invention will be further explained by the following examples but is not limited thereby in any way . in a fluidized bed / granulator were placed 500 g of amosulalol hydrochloride and 500 g of lactose and the products sufficiently mixed . to the mixture was sprayed an aqueous dispersion of a methacrylic acid - ethyl acrylate copolymer ( eudragit l30d - 55 ) in an amount of 240 g as a solid component and granules were formed from the mixture by mean of a fluidized bed granulator . after drying the granules thus obtained for 4 hours at 40 ° c ., 6 g of magnesium stearate was added to the granules and the mixture was formed into tablets by means of an ordinary tableting machine . each of the formulation of this invention ( containing 50 mg of amosulalol hydrochloride ) and a conventional formulation ( containing 25 mg of amosulalol ) containing no entero - soluble material was orally administrated to each healthy adult man once a day by a crossover method with wash - out period of one week . in the case of using the tablets of this invention , the amosulalol hydrochloride concentration in the plasma was measured by a high pressure liquid chromatographic analysis after 1 , 2 , 3 , 4 , 6 , 8 , 10 , 12 and 24 hours since the administration , while in the case of using the conventional tablets , the amosulalol hydrochloride concentration in the plasma was measured by the same manner as above after 1 , 2 , 3 , 4 , 6 , 8 , 10 and 12 hours since the administration . the results are shown in fig1 . as shown in the figure , it can be seen that by the administration of the formulation of this invention once a day , the concentration of amosulalol hydrochloride in the plasma can be sufficiently prolonged as compared to the case of using the conventional formulation . in a fluidized bed dryer were mixed 200 g of amosulalol hydrochloride , 50 g of silicic anhydride and 30 g of hydroxypropyl cellulose and after spraying thereto a solution prepared by dissolving 20 g of citric acid in an aqueous dispersion of a methacrylic acid - ethyl acrylate copolymer ( eudragit l30d - 55 ), granules were produced from the mixture using a fluidized bed granulator . to the granules thus formed was added 1 . 6 g of magnesium stearate and the mixture was formed into tablets by means of an ordinary tableting machine . by the method as performed on the product in example 1 , the amosulalol hydrochloride concentration in the plasma was compared between the case of using the formulation of this invention and the case of using the conventional formulation using beagle dogs . the results are shown in fig2 . as shown in fig2 it can be seen that in the case of using the formulation of this invention , the concentration of amosulalol hydrochloride in the plasma can be sufficiently prolonged as compared to the case of using the conventional formulation . in a vertical mixer were mixed 200 g of amosulalol hydrochloride , 30 g of citric acid and 60 g of hydroxy propylmethyl cellulose phthalate ( hp - 55 , trade name ) and after adding gradually thereto 64 g of an aqueous solution of 10 % hydroxypropyl cellulose under stirring , granules were formed from the mixture . after drying granules thus formed for 4 hours at 40 ° c ., 1 . 6 g of magnesium stearate was added to the granules and the resultant mixture was formed into tablets by means of a tableting machine . by the method as performed on the product in example 1 , the amosulalol hydrochloride concentration in the plasma was compared between the case of using the formulation of this invention and the case of using an aqueous 1 % amosulalol hydrochloride in beagle dogs . the results are shown in fig3 . as shown in fig3 it can be seen that in the case of using the formulation of this invention , the concentration of amosulalol in the plasma can be sufficiently prolonged as compared to the case of using the aqueous solution of amosulalol .

long acting formulations of amosulalol hydrochloride are provided , wherein the frequency of administering the hypotensive agent is minimized and wherein such formulations are prepared by compounding amosulalol hydrochloride with an enterosoluble material and optionally the inclusion of an organic acid .

fig1 is a perspective view of a feed support , generally indicated at 10 , according to one embodiment of the invention , and fig2 and 3 are top plan and side elevational views , respectively , of the feed support 10 . the feed support 10 includes a generally vertical support member 12 , mounted at the top center of which is an attachment plate 14 . the support member 12 of the illustrated embodiment is a cylindrical member that may , for example , be comprised of a section of heavy metal pipe , although the support member may have any outer or cross - sectional shape in other embodiments of the invention . in a typical installation , the lower end 16 of the support member 12 would be driven into the ground or permanently fixed to a stable , immobile base structure so as to provide support and stability for the feed support 12 . if hollow , the interior of the support member 12 may be configured to accept an adapter to allow it to be attached to a base . the support member 12 may have , for example , a length of about 1 foot . the attachment plate 14 is generally circular , although it may have essentially any shape , and may be comprised of , for example , an aluminum or steel plate . as shown , the plate 14 is fixedly attached to the upper end of the support member 12 . in one embodiment , the attachment plate 14 may have a diameter of about 1 . 5 feet . as will be described below in more detail , in some embodiments , particularly if the support member 12 is hollow , the attachment plate 14 may have a hole at its center , thus providing a continuous , open channel through the support member 12 and attachment plate 14 . arrayed around the perimeter of the attachment plate 14 are a number of extending arm assemblies 18 . each of the arm assemblies 18 is attached to the attachment plate 14 such that it can pivot between an extended position depicted in fig1 - 3 and a retracted , stowed position that will be described in more detail below . more particularly , a plurality of u - shaped brackets 20 are fixed to the attachment plate 14 . the upwardly - extending portions of each bracket 20 have a pair of aligned holes , and a bolt 22 passes through both the bracket 20 and the corresponding arm assembly 18 , acting as a generally horizontal axis of rotation and mounting the arm assembly 18 for rotation on the attachment plate 14 . as those of skill in the art will appreciate , positioned as they are on the upper surface of the attachment plate 14 , the brackets 20 provide an angular range of motion of approximately 90 ° to the extending arm assemblies 18 . in other embodiments , rather than being attached to the upper surface of the attachment plate 14 , the brackets 20 may be welded or otherwise fixed to the circumferential side edge of the attachment plate 14 , which would provide an angular range of motion of 180 ° or greater for the extending arm assemblies 18 . fixing the arm assemblies 18 to the side edge of the attachment plate 14 may also allow a reduction in the diameter of the attachment plate 14 , for example , from about 18 inches to about 16 inches . in the illustrated embodiment , there are twelve arm assemblies 18 mounted on the attachment plate 14 , although there may be more or fewer arm assemblies 18 in other embodiments . as will be described below in more detail , each of the arm assemblies 18 is a telescoping structure that can take essentially any length within a defined range . in the illustrated embodiment , the fully extended length of an arm assembly 18 may be slightly less than four feet , although any lengths , and particularly any lengths that work with a bale ring , may be used . the minimum length of an arm assembly 18 in the illustrated embodiment may be slightly more than two feet . the arm assemblies 18 telescope , and each may be adjusted to its own arbitrary length , irrespective of the lengths of the other arm assemblies 18 . fig4 is a cross - sectional view of the feed support 10 taken through line 4 - 4 of fig2 , illustrating , among other features , the internal arrangement of two of the arm assemblies 18 . as shown in fig4 , each arm assembly 18 includes a primary arm section 24 and a secondary arm section 26 . both the primary and secondary arm sections 24 , 26 are comprised of square tubing , and the two sections 24 , 26 are dimensioned such that the secondary arm sections 26 fit and slide within the primary arm sections 24 , giving the arm assemblies 18 as a whole the ability to telescope . while the secondary arm sections 26 can slide , the primary arm sections 24 , for their part , are mounted for rotation on the attachment plate 14 by the brackets 20 and bolts 22 , as was described above . although the arm assemblies 24 , 26 are comprised of square tubing , those components may be comprised of round tubing , rectangular tubing , or tubing of other shapes in other embodiments . additionally , although the secondary arm sections 26 rest within the primary arm sections 24 in the illustrated embodiment , that need not be the case in all embodiments . instead , the primary arm sections 24 may rest within the secondary arm sections 26 . in other words , it is not critical which of the two arm sections 24 , 26 is male and which is female . fig5 is a perspective view of the feed support 10 with its arm assemblies 18 in a folded , stored configuration . in the folded , stored configuration illustrated in fig5 , each of the arm assemblies is folded upward 90 ° with respect to the position illustrated in fig4 , such that the arm assemblies 18 extend perpendicular to the attachment plate 14 . additionally , the secondary arm sections 26 are fully retracted within the primary arm sections 24 . the folded , stored configuration of the feed support 10 allows the feed support to be easily shipped and easily handled prior to installation and use . it also allows the feed support 10 to be easily removed from one bale ring , if necessary , and placed in another . in some embodiments , the feed support 10 may include structure to retain the arm assemblies 18 in the folded , stored configuration or the extended configuration shown in fig4 . for example , the arm assemblies 18 may include additional sets of holes through which pins can be inserted to retain the primary and secondary arm sections 24 , 26 in the extended and retracted positions . fig6 is a perspective view of a feed support 10 as installed within a bale ring 50 . the feed support 10 is situated within the bale ring 50 such that its support member 12 is at approximately the center of the bale ring 50 . the height of the support member 12 gives the attachment plate 14 and arm assemblies 18 a height off the ground of approximately 6 - 12 inches when the feed support 10 is installed . as shown in fig6 , the arm assemblies 18 are extended such that the ends 28 of the secondary arms 26 are connected to upright members 52 of the bale ring 50 . because of the telescoping nature of the arm assemblies 18 , the feed support 10 may be used with bale rings 50 having a variety of different diameters . as shown in fig6 , the upright members 52 of the bale ring 50 carry engaging structure to engage the ends 28 of the secondary arm section 26 . in the illustrated embodiment , the engaging structure comprises a u - shaped engaging bracket 54 mounted on each upright member 52 . a bolt 56 passes through aligned holes in the brackets and in the secondary arm sections to secure the arm assemblies 18 to the bale ring 50 . the attachment of the arm assemblies 18 to the bale ring 50 distributes the load of any feed , such as a bale of hay , that may be supported by the arm assemblies 18 , and may help to prevent the arm assemblies 18 from bending under what would otherwise be a cantilevered load . however , it should be understood that in some embodiments , attachment of the arm assemblies 18 to the bale ring 50 may be optional . whether the arm assemblies 18 are attached to the bale ring 50 or not will generally depend on the weight of feed that is to be supported by the arm assemblies 18 , the mechanical properties and load carrying capacity of the arm assemblies 18 , the structural integrity and load carrying capacity of the bale ring 50 , and other conventional factors . moreover , when the arm assemblies 18 are attached to the bale ring 50 , that attachment may be made in any way ; the engaging structures 54 , 56 illustrated in fig6 are but one example . in some embodiments , for example , the secondary arm sections 26 may have forked ends similar to the brackets 54 , such that the arm assemblies 18 may be attached to the bale ring 50 simply by drilling appropriately located holes in the upright members 52 and inserting a bolt or pin through the aligned forked ends and the corresponding upright members . more generally , when cooperating engaging structures are used to attach the arm assemblies 18 to the bale ring 50 , either piece 18 , 50 may carry the male engaging structure and either piece 18 , 50 may carry the female engaging structure . which piece 18 , 50 carries which structure may depend , in part , on whether it is possible or convenient to modify the bale ring 50 ; if it is not possible or convenient to modify the bale ring 50 to any great extent , then the more complex engaging structure may be carried by , or form a part of , the ends 28 of the secondary arm structures 26 . of course , where attachment of the arm assemblies 18 and the bale ring 50 is desired , that attachment may be by any means known in the art ; the structures illustrated in fig6 and described above are but a few examples . in other embodiments , the arm assemblies 18 may be attached to the bale ring 50 by clamping , welding , or any other means . additionally , the feed support 10 and its arm assemblies 18 may be attached to any part of the bale ring 50 ; for example , the arm assemblies may be attached to one of the circumferential rings of the bale ring 50 , instead of the upright members 52 . once installed as shown in fig6 , structures may be laid over the extended arm assemblies 18 so as to provide a more contiguous support surface for feed . for example , sheet metal , plastic panels , or chain mesh may be laid over the installed feed support 10 and its arm assemblies 18 to ensure that feed can be supported between the arm assemblies 18 . any material laid over the arm assemblies 18 may be secured to the arm assemblies , to the attachment plate , or to both structures by clamping , bolting , tying , or any other conventional technique . fig7 is a top plan view of a feed support 10 installed in a bale ring 100 , illustrating an advantage of the feed support 10 . specifically , the bale ring 100 is dented out - of - round on one side . however , the feed support 10 can still fit within and be used inside of the bale ring 100 . in order to do so , one simply retracts the secondary arm sections 26 to accommodate the new position of the sidewall of the bale ring 100 , as shown in fig6 . thus , the three arm assemblies 18 that extend into the dented portion of the bale ring 100 are simply shorter than the other arm assemblies 18 . in fig1 - 7 the feed support 10 was used in a fixed position within a bale ring . however , in other embodiments of the invention , feed supports may be used as bale ring movers . fig8 is a side elevational view of a bale ring mover - feed support , generally indicated at 200 , according to another embodiment . as compared with the feed support 10 , the bale ring mover - feed support 200 has a hollow support member 202 and an attachment plate 204 with an opening 206 . the hollow support member 202 and attachment plate 204 with an opening 206 allow a tractor 208 with a hay spear 210 to pick up the bale ring mover - feed support 200 . as shown in the view of fig8 , the bale ring mover - feed support 200 is mounted within a bale ring 212 , and the tractor 208 has used its spear 210 to pick up the assembly 200 , 212 . in practice , the assembly 200 , 212 may be picked up on its side , oriented vertically as in fig1 - 7 , or in any other position that can be accessed by the tractor 208 and its hay spear 210 . any hay or other animal feed that may be present within the bale ring 212 may also be picked up and moved with the assembly 200 , 212 . in some embodiments , an entire bale of hay could be positioned within the assembly 200 , 212 and picked up by the tractor 208 along with the assembly 200 , 212 , although in most embodiments , operators will pick up only the empty or substantially empty assembly 200 , 212 as a means of relocating the bale ring 212 . fig9 is a top plan view of another embodiment of a feed support , generally indicated at 300 . in the feed support 300 , a plurality of arm assemblies 302 are attached to the circumferential side edge 304 of the attachment plate 306 by u - brackets 308 , as was described briefly above . additionally , the attachment plate 306 has a central opening 310 . in the above description , certain dimensions and exemplary materials for the components have been given . the height , width , diameter , thickness , materials , and mechanical properties of the various components may differ from embodiment to embodiment and installation to installation . generally , the materials of which a component is made and its dimensions will depend on factors such as the weight of the feed that is to be supported , the type of animals that are to feed , the strength , rigidity , and other properties of the bale ring with which the feed support 10 or bale ring mover - feed support 200 is to be used , and any other conventional factors . while the invention has been described with respect to certain embodiments , the description is intended to be exemplary , rather than limiting . modifications and changes may be made within the scope of the invention , which is defined by the appended claims .

a feed support for use with a bale ring , a system for feeding animals , and systems and methods for moving bale rings are disclosed . the feed support has a generally vertical support member , an attachment plate , and a plurality of telescoping arm assemblies that are mounted on the attachment plate for rotation . as mounted , the telescoping arm assemblies can rotate between an operational position in which they are generally horizontal and radiate outwardly from the attachment plate and a stored position , in which they extend perpendicular to the attachment plate . the arm assemblies have primary sections and secondary sections that are mounted within the primary sections for sliding , telescoping movement . ends of the secondary arm sections may carry engaging structure for attaching to the bale ring . the feed support may allow the bale ring to be picked up and moved with a tractor or other equipment .

the present invention provides both devices and methods of employing said devices for regulating ph . this is accomplished by preparing a mixture of an alkaline , acidic or buffering substance with a biodegradable polymer , and preparing an implantable device with the mixture . the mixture may also include a pharmacologically active agent . the invention also provides methods for preparing such devices , as well as methods of using these devices to enhance the biocompatibility of an implantable device over clinically useful periods of time . these and other aspects of the invention will be illustrated in the following examples . however , these examples are intended to illustrate specific embodiments of the present invention only . those skilled in this field will recognize that modifications could be made to the disclosed methods and that other applications would remain within the scope of the present invention . the present example describes the incorporation of materials with a basic nature ( ph & gt ; 7 . 0 ) in implants fabricated from polymers or copolymers belonging to the family of polylactic and polyglycolic acids . this idea can be implemented in several ways , one of which is described below : a solution of a 50 : 50 pla - pga copolymer was prepared in acetone . alternatively , methylene chloride or chloroform may be used to prepare the polymer . the polymer was then precipitated in ethanol . alternatively , the polymer may be precipitated in methanol or other alcohol . the precipitate was extracted and the basic salt ( 30 percent by volume with respect to polymer ) is then rolled / kneaded into the polymer . the polymer was then packed into a mold and dried under heat and vacuum to yield the implant . upon degradation in vivo or in vitro , the pla and pga polymers in the implant will release lactic and glycolic acids . simultaneously , the basic salt will dissolve in the surrounding media and neutralize the acids in the vicinity of the implants . in these implants , the ph - controlling material is evenly distributed throughout the device . methods for preparing these implants constitute still another aspect of the invention . the present example provides an in vitro study offset of changes ( particularly decreases ) in ph surrounding a biodegradable polymer provided by incorporation of salts with a basic nature within the implants . biodegradable implants were fabricated using a 50 : 50 pla - pga copolymer with inherent viscosity of 0 . 71 dl / gm and weight average molecular weight of 53 kd . these implants were divided into 4 groups : a control group , and 3 test groups corresponding to 3 basic salts : calcium carbonate ( cc ), sodium bicarbonate ( sb ), and calcium hydroxyapatite ( ch ). each of these groups were further subdivided into four sets corresponding to test periods of 0 , 3 , 6 , and 9 weeks . for fabrication the polymer was dissolved in acetone and precipitated in ethanol . next , the reagent quality salts ( 30 % v / v ) were added to the gummy polymer and the polymer - salt composite was packed into molds , and placed under 25 mtorr vacuum at room temperature for curing . the control specimens did not contain any salts . prior to testing , the mass of each specimen was recorded . next , each specimen of the 3 , 6 , and 9 week sets was immersed in 10 ml of distilled water and maintained at 37 ° c . the ph of the water was monitored every 2 days . at the end of each test period , the specimens were removed , dried in a vacuum for 72 hours and then analyzed for changes in mass , molecular weight , mechanical properties , and surface morphology . the molecular weight of the polymer was estimated using gel permeation chromatography . the mechanical properties of the specimens were measured under creep conditions using an automated indentation apparatus . the ph of the water of the control specimens remained relatively constant up to 3 . 5 weeks followed by a rapid decrease until approximately 7 weeks ( fig2 ). the sb specimens exhibited only a small decrease in ph up to 5 . 5 weeks . however , between 5 . 5 and 7 weeks there was a significant decrease in ph followed by a relatively constant value thereafter . the ch specimens displayed a linear decrease in ph up to 9 weeks . the cc specimens exhibited an approximately linear but small decrease in ph over the entire test period . as shown in table i , the sb specimens exhibited the maximum mass loss at 3 weeks . however , at 9 weeks the difference between the control and sb specimens was not significant ( fig4 ). all the sets exhibited virtually a 100 % decrease in molecular weight at 9 weeks even though they underwent different degrees of loss at 3 weeks . the control and ch specimens exhibited an increase in stiffness at 3 weeks . however , the stiffness of sb specimens decreased over this same period of time . based on gross morphology observations , sb specimens exhibited significant swelling compared to control specimens . significant swelling was also observed in cc specimens . table i______________________________________percent loss in mass and molecular weightweek cc ch sb control______________________________________3 2 . 24 ± 0 . 6 / 8 . 28 ± 1 . 6 / 27 . 7 ± 4 . 2 / 4 . 84 ± 0 . 13 / 7 . 0 . 2 ± 4 . 9 34 . 9 ± 2 . 6 58 . 3 ± 2 . 4 60 . 64 ± 6 . 286 34 . 7 ± 9 . 6 / 78 . 7 ± 9 . 2 / 71 . 7 ± 6 . 4 / 55 . 05 ± 6 . 39 / 92 . 1 ± 1 . 5 99 ± 0 . 1 95 . 8 ± 1 . 1 99 . 09 88 . 9 ± 10 / 82 . 5 ± 2 . 8 / 97 . 4 ± 1 . 9 / 99 . 5 ± 0 . 01 / 100 99 ± 0 . 1 100 99 . 0 ± 0 . 02______________________________________ % mass loss /% molecular weight loss ; mean ± s . d . the results demonstrated that all 3 salts investigated in this study were successful in controlling the decrease in ph due to the acidic degradation products of the copolymer . at 9 weeks the cc group exhibited an average ph of 6 . 3 compared to 3 . 0 for the control group . implants containing cc maintained the ph value between 7 . 4 - 6 . 3 throughout the degradation process of the pla - pga copolymer until complete degradation was achieved . implants with ch and sb controlled the ph values between 6 . 9 - 4 . 3 and 8 . 2 - 4 . 5 respectively . thus , the results of this study show that a decrease in ph in the vicinity of pla - pga implants can be effectively controlled by incorporating basic salts . thus , the deleterious effects of such implants reported by other researchers related to a decrease in ph may be offset using the presently disclosed techniques . it is well known that the fabrication process for preparing porous polymeric devices ( e . g ., pla - pga ) often results in the formation of a relatively impermeable and non - porous outer covering or &# 34 ; skin &# 34 ;. while this &# 34 ; skin &# 34 ; does not destroy the internally porous structure , it creates a problem because it impedes to varying degrees the passage of fluids and other substances into and out of the porous internal structure of the polymer . thus , it is desirable to devise a fabrication process that achieves a uniformly porous and permeable implant . according to the presently described technique , enhanced surface porosity may be achieved by removing all or a portion of the non - porous &# 34 ; skin &# 34 ;. a new method to increase the surface porosity of porous devices treated or created with polymeric materials has been designed . this is particularly important in the context of the present invention , as the biodegradable polymeric devices will more readily adapt to and control against ph shifts in the environment where surface porosity is maximized . in the present example , a 50 : 50 pla - pga porous implant was prepared as defined in example 1 . the polymer included an alkaline ph controlling substance , sodium bicarbonate . in the formation of such devices , a &# 34 ; skin &# 34 ; forms at the polymer surface . using a mechanical device devised by the inventors , a quick and consistent removal of the skin was achieved . in one embodiment , the mechanical device is a circular punch with a sharp cutting edge . all of the skin of a rod - like polymeric cylinder was effectively removed by slicing the skin away . the surface porosity of the polymeric implant prepared according to the present invention is dramatically improved by removing the outer layer , or skin , from the polymer implant . the porous outer surface will result in enhanced ingress of fluids into the implant , thus resulting in better release of the buffering agents . it is also expected that body fluids ( e . g ., vascular supplies , marrow , synovial fluid ) will be able to enter the implant much more expediently and thus provide the repair sites with migrating cells ( e . g ., mesenchymal stem cells , chondrocytes , osteoblasts ) or nutrients necessary for tissue ingrowth into the porous implant . in some biodegradable devices , depending on the polymer used for fabrication , the release of acidic by - products occurs in significant quantities only after an initial incubation period . it would be preferable to provide a mechanism for the release of an alkaline agent ( s ) in an amount that would prevent sudden changes in ph that would occur as a consequence , such as through the release of matching amounts of said alkaline agent ( s ) at the same or similar rates . such would provide an implantable device having ph control over a clinically useful period of time . in order to achieve an appropriate release rate of an alkaline agent , the alkaline agents may be incorporated in the implant in layers . for example , each layer of alkaline agent would be overlaid by a layer of the biodegradable polymer , alternating alkaline agent layer , polymer layer , etc . as each layer degrades , the alkaline or other ph - controlling substance is released , thus controlling against an overly acidic ph surrounding the implant over an extended period of time . any variety of configurations of the layered polymeric implant may be created using this technique and tailored for the particular application desired . for example , a base amount of a ph controlling substance may be included in polymeric layers closest the core of an implant , with succeeding layers containing either progressively lower or higher amounts of the ph controlling substance . although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be obvious that certain changes and modifications may be practiced within the scope of the claims . the references listed below are incorporated herein by reference to the extent they supplement , explain , provide a background for or teach methodology , techniques and / or compositions employed herein . 2 . suganuma , j . and alexander , h . ( 1993 ), j . appl . biomaterials , 4 : 13 - 27 . 3 . daniels et al . ( 1992 ), proc . orthop . res . soc ., pg . 88 . 4 . taylor et al . ( 1994 ), &# 34 ; six bioadsorbaliler polymers / in vitro acute toxicity of accumulated degradated materials ,&# 34 ; j . appl . &# 39 ; d bio . materials , 5 : 151 - 157 . 5 . tencer et al . ( 1986 ), &# 34 ; bone ingrowth into polymer coated porous synthetic coralline hydroxyapatite ,&# 34 ; ieee / engineering in med . and biol . soc ., annual conference , pp . 1668 - 1671 . 6 . fong , j . w ., u . s . pat . no . 4 , 479 , 911 , oct . 30 , 1984 , &# 34 ; process for preparation of microspheres and modification of release rate of core material ; mixing alkalinity agent with polymer - core - solvent system .&# 34 ; 7 . kampner s . l ., u . s . pat . no . 4 , 990 , 161 , ( 1991 ) &# 34 ; bone implant with resorbable stem has biodegradable anchor with exterior surface to engage interior of bone canal .&# 34 ; 8 . allemann et al . ( 1993 ), &# 34 ; in vitro extended - release properties of drug - loaded poly ( dl - lactic acid ) nanoparticles produced by a salting - out procedure ,&# 34 ; pharm . res ., 10 : 12 . 9 . younes et al . ( 1988 ), &# 34 ; biodegradable pela block copolymers : in vitro degradation and tissue reaction ,&# 34 ; bimater . artif . cells artif . organs , 16 ( 4 ): 705 - 719 . 10 . mariette et al . ( 1993 ), &# 34 ; release of the grf29nh2 analog of human grf44nh2 from a pla / ga matrix ,&# 34 ; j . control release , 24 ( 1 - 3 ): 237 - 246 . 11 . vasenius et al . ( 1992 ), &# 34 ; do intramedullary rods of self - reinforced poly - l - lactide or poly - dl / l - lactide cause lactic acid acidosis in rabbits ?&# 34 ; clin . mater . 10 ( 4 ): 213 - 218 . 12 . gilding and reed ( l979 ), &# 34 ; biodegradable polymers for use in surgery - polyglycolic / poly ( lactic acid ) homo - and copolymers ,&# 34 ; polymer , 20 : 1459 - 1464 .

the invention discloses ph - controlling devices that comprise a biodegradable polymer and a ph - controlling substance , particularly an alkaline , acidic or buffering agent . by way of example , such alkaline agents include calcium carbonate and sodium bicarbonate . methods of preparing such devices are also described . methods for enhancing biocompatibility of an implantable device are also provided , as neutralizing alkaline materials are released at a rate that offsets changes in ph typically observed as polymers degrade to various acidic or alkaline by - products . by way of example , biodegradable polymers include pla , pga , polycaprolactone , copolymers thereof , or mixtures thereof . a new technique is also disclosed to increase the surface porosity of porous implants which have a tendency to form relatively impermeable coverings . this technique entails the use of mechanical means to remove at least part of said covering , thus increasing the implant &# 39 ; s surface porosity and permeability .

in the discussion hereinbelow of the preferred embodiments , the following abbreviations and symbols are used : also , as used herein , the term qt or qt signal , embraces both the qrs ( depolarization ) portion and t wave ( repolarization ) portion of the ventricular signal , either spontaneous or evoked by pacing . thus , the term qt signal also includes the interval between the qrs and t wave portions , as well as other parameters including slope , integral of the signal , time derivative , etc . the term “ recent ” is used in reference to stored data representative of collected qt properties , e . g ., as in histogram form illustrated by the preferred embodiment . the term “ long qt syndrome ” is used in the same manner as the literature on the subject , and refers to conditions which generate into rapid arrhythmias such as tdp and other ventricular arrhythmias . referring now to fig1 there is shown a block diagram illustrating the primary components of a pacemaker system in accordance with this invention . a ventricular pulse generator 15 is controlled under control block 20 to generate ventricular pacing pulses , which are delivered to the patient &# 39 ; s heart through lead 16 l through to ventricular electrodes 16 e . likewise , for a dual chamber pacemaker , atrial pulse generator 18 also is controlled by block 20 , and generates atrial pace pulses which are delivered through lead 19 l to atrial electrodes 19 e . the signals sensed at the ventricular electrodes are amplified at qrs circuitry 24 and t wave sense circuitry 26 , respecctively , the outputs of which are connected to signal processing block 27 , and then transferred to control block 20 . likewise , signals sensed in the atrium by atrial electrode or electrodes 19 e are amplified at p wave sense circuitry 25 processed at block 27 , and connected back to control block 20 . as discussed further below , block 27 preferably is dedicated dsp hardware . control block 20 , in the preferred embodiment , contains a microprocessor , and is in two - way connection with suitable memory 21 . as discussed hereinbelow , the logic steps taken in the practice of this invention are preferably handled by software . also shown in fig1 is a sensor or sensors 28 , which can be used for rate control in a known manner ; the qt interval obtained from the signals outputted by sense circuits 24 and 26 can also be used for rate control . a program receiver ( and transmitter ) 29 is used to receive program instructions from an external programmer , which are downloaded through control block 20 . in the context of this invention , the analysis of qt data , discussed in detail hereinbelow , can be changed by downloading one or more replacement routines . this may be desirable , e . g ., in a case where experience has shown that for the patient involved , one or another of the qt parameters should be weighted differently . referring now to fig2 there is shown a flow diagram which illustrates the “ long qt ” routine together with other functions carried out cyclically in sensing and a pacing . in a preferred embodiment , decision rates are determined cyclically , as shown at 35 . these include phys_rate ( which is a measure of the patient &# 39 ; s natural rate ), and the dynamic pacing limit ( dpl ), which is coupled to phys_rate and sets the normal escape interval for pacing . see u . s . pat . no . 5 , 247 , 930 , incorporated herein by reference . long qt routine 39 is represented by blocks 50 - 53 set forth in fig3 and is the overall routine for analyzing qt and ves data and determining whether intervention pacing is called for , and if so , how to adjust the intervention rate . as is observed in the discussion below of the details of the routine for determining intervention therapy , the routine may call for intervention therapy based on determination of a long qt interval as such , but may also call for such therapy where the qt interval is not necessarily deemed “ long ”, but other changes in the qt signal are observed . the remainder of fig2 represents cyclical event detection and response , i . e ., handling by the pacemaker in response to a given event . in the event of an atrial sense ( as ) at block 40 , the pacemaker goes to the as - handling routine 45 , where the sense signal is analyzed for determination of the next step , whether the atrial signal can be tracked . the values of aa_int ( which represents current rate ) and va_int are saved at 36 . following this , the routine goes back to event detection block 40 and awaits a ventricular event . if the atrial escape interval has timed out , the pacemaker goes to routine 46 ( ap_handling ) where an atrial pace pulse is delivered . if a ventricular sense has been detected , the pacemaker goes to block 43 and handles the vs . likewise , if the ventricular escape interval ( v_esc ) has timed out , the pacemaker goes to block 41 and delivers a ventricular pace pulse ( vp ). following either ventricular event , at 37 values of vv_int and av_int are saved . when a t - wave is sensed , the pacemaker does ts_handling at 44 , and t_wave processing at 47 . the processing is suitably done by dsp , and results in storage of qt signal data from which the analysis carried out in the long qt routine is done . this data includes qt_int data and t - wave data . referring now to fig3 there is shown a flow diagram which represents the four main routines of the long qt routine 39 . at time of implant , the pacemaker is in an acute state , as seen at 49 . consequently , the acute learning phase is entered at 50 . during the acute learning phase 50 , the pacemaker accumulates data concerning the qt signal , which is used to build up profiles for subsequent use in monitoring for a malignant arrhythmia . there is insufficient time for a long learning period , and consequently the “ acute learning phase ” is carried out only for acute measuring of the normal or standard properties of the qt signal parameters that are used , which is done preferably in - hospital tests . when the pacemaker is ready to proceed from the acute phase , it may be programmed to go directly to the learning phase 51 each cycle . referring to block 51 , this routine is run cyclically to update qt data . thus , the properties of the preselected parameters of the qt signal which are used for detecting tdp , are continuously adapted , so that changes can be detected . following this , at routine 52 , the pacemaker determines whether tdp preventive pacing therapy is indicated , and if so , how to adjust the intervention pacing rate . at routine 53 , the determined intervention rate is checked to make sure that it is within appropriate limits . after this , the pacemaker leaves the long qt overall routine and goes to perform the sense - pace functions as discussed above in fig2 . referring now to fig4 a , 4 b , 4 c and 4 d , there are shown flow diagrams representing details of the learning phase routine 51 . fig4 a is a top level flow diagram of routine 51 . at 60 the recently acquired qt data is utilized to update a rate - qt histogram . as seen in fig4 b , the first step is to determine the appropriate rate_bin . thus , in accumulating histogram data , the data is compiled in respective bins representing respective rate ranges . when updating the rate - qt histogram , the first step undertaken at 64 is to determine the appropriate rate bin , corresponding to the rate as was stored at block 48 . then , at 65 , the routine examines the current value of qt_int , compared to the mean value for the rate_bin that is being examined . if the absolute value of this difference is greater than two times the standard deviation ( sd ), the measures are not used to update the bins , and the routine exits . if this difference is less than or equal to 2 * sd , the routine goes to 66 , where the pacemaker calculates and updates the value of the mean qt_int for the rate_bin which is involved . then , at 67 , the sd qt_int is calculated and updated for the rate_bin . referring back to routine 61 of fig4 a , the pacemaker updates the rate - qt dispersion histogram . this involves updating histogram data which compiles values of qt dispersion for different rate bins . qt dispersion , or qtd , is measured to reflect the difference between local maxima and minima values of the qt interval , and is associated with increased risk of ventricular tachycardia and sudden cardiac death . qt dispersion is a reflection of refractory dispersion . qt dispersion is suitably obtained by obtaining templates of the qrs ( depolarization ) and t wave ( repolarization ) portions of the qrs signal . in obtaining such templates , the wave signal data is suitably placed in the digital form in block 27 ; obtaining wave form templates is well known in the art and any suitable hardware or software arrangement can be used in this invention . differences of the respective wave form amplitudes along successive time increments are determined by subtraction of the wave form amplitude values , and the differences are integrated over the time domain . in a preferred embodiment , the template generation and template difference calculations are performed by dedicated hardware . see the further discussion below of template generation in connection with fig7 . however , any combination of hardware and software can be utilized . after determination of qt dispersion , at 71 the appropriate rate bin is determined , and then at 72 the absolute difference of the current value of qt dispersion and the mean value for the selected rate_bin is compared to 2 * sd . if this value is greater than 2 * sd , the routine exits . if the difference value is less than or equal to 2 * sd , the routine goes to 73 and updates the mean qt dispersion for the current rate_bin ; and at 74 the sd qt dispersion is updated for the rate bin . returning to block 62 of fig4 a , the pacemaker updates the 2qt / 2t histogram . the specific steps of this histogram updating are set forth in fig4 d . the current value of 2qt / 2t is determined at 80 , and the appropriate qt_bin is determined at 81 . the same steps are carried out mutatis mutandis , at 82 , 83 and 84 . it is to be noted that other properties , e . g ., t - wave amplitude , can be processed in the same manner . referring now to fig5 a , there is shown a detailed flow diagram for determining preventive pacing therapy . at 100 , the variable “ intervention_δ ” is set equal to 0 . this variable is computed each cycle , following updating of the data in the learning phase to provide a basis for determining whether intervention pacing is to be carried out . next , at blocks 101 , 102 and 104 , incremental rate - qtδ ; qt - dispersionδ ; and 2qt / 2t ) are determined , as shown in fig5 b , 5 c and 5 d respectively . in fig5 b , rate - qt ) is entered at 120 . at 121 , the current rate bin is determined , and at 122 the absolute value of qt_int - rate_bin_mean is compared to 2 * sd . if the difference value is not greater than 2 * sd , the routine exits . if it is greater , it goes to 123 where the pacemaker determines whether qt_int has been greater than qt_int_mean by more than 2 * sd during x a cycles out of the last y a cycles . if yes , then at 124 intervention_δ is incremented by a predetermined value ir a . if the answer at 123 is no , the intervention_δ is not increased , meaning that the qt_int as a property does not yet contribute to a possible intervention . referring to fig5 c , the same steps mutatis mutandis are taken at blocks 125 , 126 , 127 , 128 and 129 , resulting in possible further increase in intervention_δ by the predetermined value ir b , if the conditions at 127 and 128 are met . thus , if the change in dispersion corresponding to the applicable rate bin has been sufficient to meet the criteria , then the value of intervention_δ is increased by the value of ir b . referring now to fig5 d , the same steps are taken mutatis mutandis for the property 2qt / 2t at blocks 130 - 134 . thus , if the difference between mqt / mt and the prior mean value of the appropriate qt bin is greater than 2 * sd ( at 132 ) and this has been the case for x c out of y c prior cycles ( at 133 ), then intervention_δ is incremented by the predetermined value ir c . it is noted that the values ir a , ir b , and ir c can be programmed in accordance with observed characteristics of the patient , so as to give each optimum weighting . referring back to fig5 a , following determination of the changes to intervention_δ , at 105 it is determined whether there has been a ves . if no , the routine exits with intervention_ ) unchanged . however , if there has been a ves , at 106 it is determined whether this is the only ves out of the last y d cycles . if yes , the routine goes to 107 and it determines whether intervention_δ is already greater than 0 . if yes , the routine goes to 113 and doubles the value of intervention_δ , to reflect the significance of a ves occurrence . if the answer at 106 is no , indicating that there have been other ves events during the last y d cycles , the routine goes to 110 and determines whether intervention_δ is greater than a predetermined threshold . if no , then at 111 intervention_ ) is set to a minimum value ; if yes , the routine skips to 112 and determines whether there have been ves events in more than a predetermined number x e out of the last y e cycles . if no , the routine goes to 113 and doubles the value of intervention_δ . however , if yes , the routine goes to 114 and sets intervention_δ to a maximum value . referring now to fig6 there is shown a routine for determining rate limits for the intervention rate . at 140 , it is determined whether the current intervention rate is greater than the phys_rate . if yes , the routine goes to block 141 and determines whether the intervention_δ is greater than 0 . if no , suggesting an absence of an indication of indication of tdp , at 142 intervention rate is decremented by predetermined drift factor . however , if yes at 141 , the routine goes to 143 and increments intervention rate by the determined value of intervention_δ . going back to block 140 , if intervention rate is equal to or less than phys_rate , the routine branches to 145 and determines whether intervention_δ is greater than 0 . if no , intervention rate is set at the current pacing rate , or dynamic pacing rate ( dpl ). however , if intervention_δ is greater than 0 , the routine goes to 148 and sets the intervention rate to phys_rate + intervention_δ . thus , the intervention rate is adjusted depending upon where it currently is with respect to the patient &# 39 ; s physiological rate , and depending upon the qt signal analysis carried out in tdp pacing therapy routine . still referring to fig6 at 150 it is determined whether the calculated intervention_rate is greater than the upper pacing limit ( upl ). if yes , it is limited to upl at 151 . at 152 , the escape rate is set to correspond to the intervention_rate . at 154 , it is determined whether the escape interval is less than qt_int + 40 . the reason for this is that if a large rate jump is required , qt interval may still be so large that the intervention pace pulse may be delivered during the t wave . for this reason , the esc_int is limited to the value of qt_int plus a predetermined value , e . g ., 40 ms . it is to be noted that when the qt interval shortens because of the intervention_rate increase , then the escape rate can be increased further accordingly . there is thus disclosed a pacemaker system and method for systematically analyzing signal data so as to determine if there has been a ves , and if the qt signal has properties indicative of changing conditions which suggest tdp or another dangerous ventricular arrhythmia . the preferred embodiment has been illustrated wherein three such qt properties are utilized , along with ves . however , it is within the scope of this invention to incorporate n routines for analysis of n properties of the qt signal , and a determination of an intervention rate based upon appropriate weighting of each of the n properties . as noted , t - wave amplitude data can be processed and used in the determination . it is to be noticed further that in the illustrated preferred embodiment , the occurrence of a ves event is utilized to increment the intervention rate ; and the frequency of recent ves events is used in determining the amount of change in intervention rate . referring now to fig7 there is shown a flow diagram of steps taken in accordance with a vt prevention feature of this invention . the vt prevention feature is directed to detecting conditions during patient awakening that suggest the onset of vt . this feature can be incorporated instead of the long qt syndrome feature , or in addition . at 240 , a routine is run for determining the patient awakening period . any criteria can be used for determining “ awakening ”; reference is made to u . s . pat . no . 5 , 861 , 011 , and incorporated herein by reference . at 241 the pacemaker determines whether the patient is in fact in the awakening period . if no , at 244 the intervention state is deactivated , and at 245 the pacemaker goes into the learning phase , the details of which are set forth in the connection with fig8 . if the patient is in the awakening period , the pacemaker goes on to process current information concerning the depolarization ( qrs ) and repolarization ( t wave ) waveforms . at 247 , the pacemaker obtains the depolarization template for the current cycle , and compares it to the depolarization template which was generated during the learning phase . the difference is computed and stored as δ 1 . likewise , at step 248 , the pacemaker gets the current repolarization template and compares it with the stored repolarization template from the learning phase , and generates a δ 2 , which is representative of the difference . then , at block 249 , the pacemaker goes through a ves analysis , to obtain a measure ( ) δ 3 ) of whether there has been a ventricular extra systole , and how close the coupling interval was to the patient &# 39 ; s mean qt interval . the ves analysis is set forth in particular detail in fig9 . following this , the pacemaker goes to block 250 , and determines whether intervention is indicated , based upon data gathered and generated at blocks 247 , 248 , and 249 above . the determine intervention routine is set forth in detail at fig1 . still referring to fig7 at block 254 , the pacemaker determines whether intervention has been activated . if no , the routine exits , and the pacemaker continues to set the pacing escape intervals in a normal way . however , if yes , the routine branches to block 255 , and determines whether the variable d is equal to or greater than a predetermined threshold . d is calculated in the determine intervention routine 250 , and represents a summation of the respective δ values calculated at blocks 247 , 248 , which are representative of refractoriness dispersion ; and also the δ value calculated at 249 , which represents the presence of a dangerous ves . the calculation of d is discussed in more detail in connection with fig1 . if d is equal to or greater than threshold , at 257 the pacemaker determines whether the intervention rate remains less than the maximum intervention rate . if yes , intervention rate is incremented at 258 ; if no , intervention rate is at its maximum allowable value and the routine exits . if , at 255 , d is not up to threshold , then at 260 it is determined whether the intervention rate is higher than the minimum intervention rate . if yes , at 261 intervention rate is decremented by subtracting a programmable drift value ; if no , the intervention rate is as low as is allowed , and the routine exits . referring now to fig8 there is shown a flow diagram of the learning phase routine 245 , in accordance with this invention . as discussed in connection with fig7 this phase is entered when the patient is not in the awakening period . at 262 , the pacemaker calculates a variables δ 1 which constitutes the depolarization template then stored in memory , minus the current depolarization template for the just detected r wave . in obtaining a template , the wave signal data is placed into digital form by an a - d converter , which is part of the function provided by signal processor block 27 . obtaining waveform templates is well known in the art , and any suitable hardware or software arrangement can be used in this invention . in a preferred embodiment , digital samples are obtained representing the waveform amplitude along successive time increments , from the beginning of the wave to the end , and are stored . in determining the δ difference , the respective waveform amplitude values are subtracted , and the difference is integrated over the time domain . in a preferred embodiment , the template generation and template difference calculations are performed by dedicated hardware , as shown at 27 . however , any combination of hardware and software can be utilized . next , at 264 , it is determined whether the ) 1 value is small . the reason for making this determination is that large variations during the learning phase suggest that the signal is not stable enough to be a reference during the awakening period . consequently , if the deviation found at 264 is statistically small ( indicating stability ), at 266 a weighting factor w 1 is increased ; if the deviation is not statistically small , then at 268 the w 1 is decreased . these weighting factors are utilized in the subsequent determination of intervention in routine 250 . next , at block 270 , the depolarization template is adapted so as to be changed toward the most recently detected depolarization template . this can be done , e . g ., by matching the minimum values and slopes of the depolarization template and the new qrs wave , and adjusting each sample of the template incrementally toward the samples of the new qrs . the functions are suitably carried out by the microprocessor of block 20 . still referring to fig8 blocks 271 , 272 and 274 - 276 represent corresponding steps for the repolarization template , which reflects the sensed t wave . at 271 , the deviation δ 2 is determined , by subtracting the just obtained repolarization wave from the stored repolarization template . at 272 , it is determined whether the deviation is small , representing a stable signal . if yes , weighting factor w 2 is increased at 274 ; if no , w 2 is decreased at 275 . the repolarization template is then adapted and stored at 276 . referring now to fig9 there is shown a flow diagram of the routine 249 for carrying out ves analysis . this is done because vt is often initiated or preceded by one or more ventricular extra - systoles if the patient heart rate is low enough and the coupling interval is critical , i . e ., ves occurs near or in the vulnerable phase . in this situation likewise , intervention may be indicated , so the pacemaker of this invention collects ves data which is included in the determine intervention routine . at block 282 , it is determined whether there has been a ves . if no , the routine branches to block 283 , and sets δ 3 ( the deviation value corresponding to ves analysis ) to zero . however , if there has been a ves , then it has to be determined how critical the ves is deemed . at 285 , the pacemaker compares the coupling interval ( the interval from the prior r wave to the δves to the current qt interval . if the coupling interval minus the current qt interval is less than or equal to a stored critical phase value , then the ves is deemed very critical , and at 290 δ 3 is given a weighted very_critical value . however , if the answer at 285 is no , then the routine goes to 286 and determines whether there have been a predetermined number n ves occurrences in the last m intervals , where n and m are programmable numbers . if yes , the ves occurrence is deemed critical , and at block 287 δ 3 is given a weighted critical value which is somewhat less than the very_critical value . if the answer at 286 is no , at 288 δ 3 is given a low_critical weighting . at routine 249 , the values assigned to δ 3 include the weighting factor , such that the stored deviation is assumed to be accompanied by a weighting factor of 1 for the calculation which is carried out at block 277 . referring now to fig1 , there is shown a flow diagram of the determined intervention routine 250 . at step 277 , the pacemaker determines the total deviation d , which is calculated by taking the sum of all the separate deviations , each multiplied by its respective weighting factor w . in the preferred embodiment as illustrated , there are three different deviations determined , so the summation is from i = 1 to i = 3 . thus , each cycle the summation constitutes δ 1 multiplied by the current value of w 1 ; δ 2 multiplied by the current value of w 2 , and the determined value of δ 3 , where the weighting factor is 1 since the value of δ 3 has already been calculated to reflect appropriate weighting . at 278 , it is determined whether the current value d is greater than or equal to threshold . if no , intervention is not indicated and the routine exits . however , if d is greater than or equal to the programmed threshold , then intervention is activated at step 280 , suitably by setting a flag to store the fact that intervention has been activated . as seen in fig7 once intervention has been activated , it is not deactivated until the awakening period is over , at which time the pacemaker proceeds to block 244 and deactivates intervention . as per the above discussion of fig7 if d drops below threshold when intervention is activated , the intervention rate is decremented toward a lower limit . recapitulating with respect to the vt prevention routine which is carried out during awakening , and referring to fig7 it is seen that during normal periods outside of the awakening period , both daytime and nighttime , the pacemaker is continually adapting the depolarization and repolarization templates in the learning phase . when the patient is in the awakening period , data represented by deviation values δ 1 , δ 2 and δ 3 are obtained at blocks 247 , 248 and 249 respectively . whenever , during the awakening period , the cumulative sum of the deviations exceeds a predetermined threshold , intervention is activated , and the intervention mode is maintained throughout the awakening period . of course , if the deviation values , which represent refractory dispersion , become small , then the intervention rate drifts down to a lower rate limit , such that there effectively is no overdrive intervention . however , as long as the wave variability remains high , the intervention rate will be maintained so as to provide overdrive pacing calculated to prevent ventricular tachycardia . it is noted that while three separate deviation measurements are illustrated in the preferred embodiments , additional data can be collected , and weighted accordingly . additionally , each weighting factor can be programmed to vary within predetermined limits , so that weighting can be adapted in terms of known patient history . there have been disclosed several embodiments for prevention of ventricular arrhythmias , in particular , by detecting long qt syndrome and by determining when the patient is vulnerable to vt during awakening . the embodiments of this invention use ves data , qt data , or ves and qt data for determining the onset of a dangerous arrhythmia , and for determining overdrive pacing rate .

there is provided a pacemaker system which includes intervention for overdriving the patient &# 39 ; s natural heart rate in the event of a sensed incipient ventricular arrhythmia condition , and particularly torsades de pointes . the pacemaker continually acquires qt signals and analyzes them for respective properties , updating statistical information relating to the properties . in a preferred embodiment , the pacemaker analyzes qt interval , qt dispersion , time derivative of the qt interval , and / or t - wave amplitude and determines an intervention for pacing therapy based upon changes to these properties . the pacemaker also monitors premature ventricular beats and generates data representative of such occurrences , which data is used alone or in combination with qt data in determining whether intervention is indicated , for adjusting the intervention pacing rate . there is thus provided a systematic approach for monitoring relevant data so as to reliably determine when intervention pacing therapy is needed , and for adjusting the intervention pacing rate .

with reference now to the drawings , the overall grill assembly is shown in fig1 and referenced generally by numeral 10 . the grill assembly comprises a food support 12 to which is fixed the post engagement means shown as handle holder 16 . a handle 14 is hingedly attached to the handle holder and a slider post 18 extends through an engagement opening 40 in the handle holder . an attachment bracket 20 is secured to the end of the slider post for releasably connecting the post to a heat source fixture 46 . the food support consists of a grill frame 22 made of angle iron stock comprising an upright leg 23 and a right angle support leg 25 . the grill frame may be formed into a round or polygonal shape . as shown , the frame is bent into a hexagonal shape creating an interior area within which is placed a grillwork 24 . the grillwork is cut to rest upon support leg 25 . it may be fixed to the support leg or may be loose and removable for cleaning and replacement . the grillwork and frame are constructed of known fireproof materials such as metal , ceramics or glazed heat resistant structures . the grillwork structure may comprise expanded metal grating , parallel bars or rigid wire mesh . the handle holder 16 is generally u - shaped in cross - section comprising a base plate 60 from which extend opposing side flanges 62 , 64 . the holder has a grill end 28 and an opposing outer end 31 . the grill end is fixed at an angle alpha to upright leg 23 of the grill frame 22 by welding or fastening means known in the art . the angle alpha between the grillwork plane and base plate plane is related to the size of engagement opening 40 and the diameter of slider post 18 . the objective is to have the grillwork horizontal when the handle holder is in a locked position as shown in fig5 . thus , the angle beta will be less than 90 °. if the difference between the post diameter and engagement opening is larger , the angle beta between the post and base plate will be less . angle alpha will also be less . if there is less difference , angles alpha and beta will be larger . the preferred range for alpha is 110 - 170 °. the preferred range for beta is 45 - 85 °. as shown in fig2 the handle holder 16 includes an engagement opening 40 for allowing the slider post 18 to pass through . in the preferred embodiment , the opening is square but could have a round outline 40a as shown in fig1 c and 1d and / or a polygonal shape as shown in fig1 . the inner edges 43 of the opening function as a locking means for releasably securing the grill to the post at selected vertical and radial positions . the minimum distance between opposing inner edges must be slightly larger than the diameter of the slider post . also , the weight of the food support 12 must be greater than the weight of the handle 14 . therefore , once the inner edges grip respective surfaces of the slider post , gravity will cause the handle holder to pivot downwardly about the grip contact points in the direction of the food support . a significant advantage of the frictional engagement system is the ability to securely lock the cooking assembly in place without the use of set screws , post notches , cams , pins and related means . this is possible because there is always at least two gravity - induced contacts that occur per placement of the cooking assembly . as depicted in fig1 b , the slider post is divided into two half segments extending along its longitudinal extent on opposing sides of a median line m , m . the front half 19 is defined as the exterior surfaces on the half segment closest to the food support . the back half 21 comprises the exterior surfaces of the post rearward of the median line . therefore , when the handle holder comes to a secured downwardly inclined position , the handle holder inner edges will be in engagement with at least one friction engagement point in the front half surface 19 of the slider post and at least one friction engagement point in the back half surface 21 . these engagements occur simultaneously when the food support is in an operative position . it can also be seen that more weight on the grillwork will cause more leverage and edge engagement force against the slider post . the slider post may have a round or polygonal cross - section . as shown in fig1 d , post 18a has a hexagonal cross - section and the engagement opening 40a is circular . most importantly , the post must provide a sufficient amount of exterior surface for creating an effective frictional engagement with the aforementioned inner edges 43 . as such , the post diameter will relate to the size and shape of engagement opening 40 . in general , the diameter will be slightly less than the shortest distance between opposing inner edges of the engagement opening . as shown in fig1 the post is a solid cylindrical shaft . it could also be tubular . its length should be sufficient to provide a full range of vertical height adjustments for the grill above a heat source . the bottom end of the slider post is fixed to an attachment bracket 20 . the bracket , in turn , provides a releasable connection to a heat source containment means such as the heat source fixture 46 depicted in phantom in fig1 . the bracket has a j - shaped outline comprising an upper plate 42 having opposing side edges . from one side edge extends an abutment plate 44 . from the opposing side edge extends an offset plate 45 . although the bracket could have a u - shape , a more stable connection results when the abutment plate is longer than the offset plate . it will also be appreciated that the upper plate has a width that is sufficient to space - apart the opposing plates a distance which is adequate to accommodate a variety of heat source fixtures . the bracket includes fastening means for providing a strong releasable connection to the upper edge structure of a heat source fixture . the upper edge structure is shown in phantom by reference 47 in fig1 and 4 . the fastened means includes at least one threaded fastener for operatively engaging corresponding threaded openings in the bracket . as shown , the fastening means comprises two threaded eyebolts 50 , 50 extending through respective threaded apertures in offset plate 45 . the eyebolts are spaced apart and extend through the lower portion of the offset plate . in the embodiment shown in fig3 the bracket 20 is placed over edge structure 47 with the offset plate on the outside of the structure and the abutment plate on the inside . the bracket is lowered until the top of the edge structure engages the upper plate underside . both eyebolts are then rotated until their free ends contact the edge structure outer face 49 . rotation of the bolts is continued until abutment plate 44 is drawn tightly against the edge structure inner surface 51 . to insure the eyebolts do not become loosened , a fastener locking means may be provided . this comprises a jam nut / lock washer combination shown by reference 48 . other means such as plastic grommets , keys , pins and thread - lock preparations could also be used . in the embodiment shown in fig4 the entire bracket is positioned outside the edge structure so that abutment plate 44 is directly adjacent outer face 49 . in this version , the abutment plate midportion is provided with fastener openings 53 . edge structure 47 is provided with corresponding wall apertures 57 . the apertures are sized to permit the threaded fasteners , shown as eyebolts 50 , 50 , to pass through the edge structure thickness and extend beyond inner surface 51 . with the above arrangement , the original jam nut / lock washer combinations are first threaded onto respective eyebolts . the eyebolts are then passed through the respective wall apertures 57 and abutment plate fastener openings 53 . a second jam nut / lock washer combination 55 is rotated about each free end of the eyebolts until the abutment plate is drawn tightly against edge structure outer face 49 . a very stable connection occurs which is most commonly utilized when a homemade vessel constitutes the heat source fixture . the handle comprises an elongated rigid structure which is sized to accommodate grasping with a user &# 39 ; s hand . preferably , it may include heat insulative materials . it is attached to connector end portion 29 of the holder and is generally aligned coextensively with base plate 60 . it can be fixed to the plate by welding or fastening means known in the art . however , to effect collapsibility and compact storage , the handle is preferably hingably attached to the base plate . for this purpose , the connector end portions 29 of side flanges 62 , 64 are provided with hinge openings . each hinge opening is offset inwardly from the holder outer end 31 for a purpose to be hereinafter described . as best shown in fig1 the basic handle structure comprises a rod 38 bent into an elongated u - shape . the free outer end portions of the rod are flared outwardly in opposite directions to form hinge parts 34 , 35 . each hinge part extends through a corresponding hinge opening in the side flanges of handle holder 16 . this connection forms a hinge joint whereby the handle can rotate outwardly from the handle into an operative position as illustrated in fig1 . when the handle holder is separated from slider post 18 , the handle may be rotated over the handle holder and against the grill for compact storage . to facilitate grasping the handle and avoid excessive heat , rod 38 may include a heat insulative means such as a non - heat conductive sleeve , wrap or encasement of plastic , cloth or wood . as shown in fig1 and 1a , a major portion of the space between the bent rod 38 is provided with a heat insulative wood insert 39 . the insert is connected to the rod by a peripheral groove 41 . corresponding portions of the rod engage the groove for a secure frictional engagement . although the insert shown has flat upper and lower surfaces , it could be rounded or contoured to better fit a user &# 39 ; s hand . additionally , other means for insert attachment could be mechanical fasteners or adhesives . it will be appreciated that the gravity induced engagement means of the invention permits an infinite variety of grillwork positions . prior to cooking , the handle / grillwork structure can be lifted off the post and transported to a food preparation area for loading with items to be heated . during the heating process , the grillwork can be rotated around the post longitudinal axis and away from the heat source to apply seasoning or to slow the cooking rate . to help insure that the grillwork remains stationary during cooking , the invention provides an optional tilt constraint means for releasably securing the grillwork in the desired location . the constraint means consists of a locking tab 54 and a thumbscrew 56 . the locking tab is attached to the underside of base plate 60 between engagement opening 40 and holder outer end 31 . the locking tab includes an inclined flange 58 that extends downward from plate 60 at an angle such that it will be about parallel to slider post 18 when the grillwork is horizontal as shown in fig5 . the thumbscrew extends through a threaded opening in flange 58 when the grillwork is located in the desired position , the thumbscrew is rotated until its terminal end engages the slider post . this engagement provides an affirmative abutment wedge between the handle holder and post . therefore , accidental uplifting of the grillwork and disengagement of the cooking assembly from the slider post is prevented . fig5 shows the cooking assembly in a normal operating configuration with grillwork 24 in a horizontal position . upon unscrewing thumb screw 56 away from the post and moving the handle down as shown by arrow a in fig6 the handle holder will tilt up as shown by arrow b and inner edges 43 will become released from engagement with the post . this permits free movement of the cooking assembly about the post . when the cooking process is completed , the cooking assembly is tilted up as shown in fig6 and removed from the slider post . the grillwork may then be cleaned at a convenient location away from the heat source . subsequently , the handle is rotated over the handle holder and against the grillwork . the eyebolts of the attachment bracket are loosened and the support assembly is removed from the heat source fixture . it is then placed adjacent the cooking assembly for compact storage . while the invention has been described with respect to preferred embodiments , it will be clear to those skilled in the art that modifications and improvements may be made to the invention without departing from the spirit and scope of the invention . therefore , the invention is not to be limited by the specific illustrative embodiments , but only by the scope of the appended claims .

an outdoor portable grill is provided having a cooking assembly comprising a food support , a handle for the food support and a handle holder interconnecting the food support with the handle . a support assembly is also provided comprising a upstanding slider post extending from an attachment bracket . the attachment bracket is used to secure the post to an outdoor heat source fixture such as a campground grill or fire pit ring . the handle holder is provided with an engagement opening having multiple inner edges that engage corresponding surfaces on the slider post . the weight of the food support causes the edges to frictionally engage the post exterior . this action allows the food support to be locked into an infinite variety of vertical and radial positions . the handle is pivotally attached to the handle holder for enabling the handle to be rotated against the food support for compact storage . the slider post attachment bracket includes eyebolts for tightly drawing the bracket against the edge structure of a heat source fixture . alternatively , the eyebolts may extend through corresponding openings in the heat source fixture and allow the bracket to be secured to be fixture exterior .

referring now to the drawings and particularly to fig1 a chimney fire extinguishing apparatus according to the present invention is seen generally at 10 to be mounted on the upper exposed end of a chimney liner 12 which forms a portion of a conventional masonry chimney 14 . while the liner 12 in fig1 is represented as a conventional ceramic / clay liner such as is required by code regulations for conventional masonry chimney structures , it is to be understood that the present apparatus 10 can be configured to mate with metal liners as well as other liners and chimney structures other than as explicitly shown in fig1 the depiction of fig1 simply being for purposes of illustration . the appparatus 10 can be seen to include a cap 16 which is substantially identical to caps which are presently employed to cover chimney structures from the elements as well as to prevent entry of foreign matter into the chimney . the cap 16 is provided with the usual upper cover 18 and has wire side walls 20 which allow gas and material flow through the chimney . use of the wire side walls 20 , with appropriate spacing between the wires forming said walls 20 , can advantageously act to prevent the passage of cinders during a chimney fire . in many chimney fires , burning cinders emanating from the chimney land on the roof of the structure and initiate additional combustion which accounts for substantial damage . while the present apparatus 10 could be fitted to the upper end of the chimney which is not fitted with a liner such as the liner 12 , it should be understood that the present apparatus 10 is structured to fit over a liner and is not intended for use without a liner . building codes rightfully require the use of liners in chimney structures due in part to the fact that liners act to prevent air leakage through chimney walls which can cause a chimney fire or increase the likelihood of the occurrence of a chimney fire . referring now to fig1 through 4 in particular , the apparatus 10 is seen to be comprised of a tubular housing 22 which is substantially square in cross - section and which may have rounded corners as are best seen in fig4 . it should be understood that the tubular housing 22 can have cross - sections other than as shown and have 90 ° corners or the like depending upon design choice . the particular configuration shown is chosen primarily to mate with the usual contours of a chimney liner such as the liner 12 and to provide a cross - sectional area of the housing 22 which is as close as practical to the cross - sectional area of the liner 12 . the tubular housing 22 is preferably formed of a metal such as aluminum , tin or the like or which is otherwise treated to resist the influence of the elements to which the apparatus 10 is exposed . the tubular housing 22 has an upper section 24 and a lower section 26 , the lower section being substantially received within the liner 12 and extending thereinto to a distance which typically constitutes over half the length of the tubular housing 22 . although for purposes of illustration , the walls of the lower section 26 are seen to be spaced from the inner walls of the liner 12 . in practice , this fitting is made as flush as is practical in order to provide an effective passageway for combustion gases and the like to move upwardly through the liner 12 and then through the tubular housing 22 . a collar 28 which is u - shaped in section is attached to the tubular housing 22 about the periphery thereof by means of rivets 30 or similar attachment means , the collar 28 acting to fit over upper edges of the liner 12 to mount the apparatus 10 in place on the liner 12 . those portions of the tubular housing 22 which are &# 34 ; below &# 34 ; the collar 28 constitute the lower section 26 while those portions of the tubular housing 22 which lie &# 34 ; above &# 34 ; the collar 28 constitute the upper section 24 of said tubular housing 22 . the upper section 24 of the housing 22 is preferably covered with insulation 32 which can be held in place by a cover 34 formed of weather - resistant metal . the insulation 32 , which is optional , acts to maintain somewhat higher temperatures within the upper section 24 of the apparatus 10 such that operation of the apparatus 10 is not inhibited by extremely cold temperatures . in most climate zones , temperatures do not reach sufficiently low levels as to cause a freezing up of moving parts operable within the apparatus 10 and thus the insulation 32 is not necessary to an effective functioning of the invention under usual circumstances . the cap 16 , referred to primarily relative to fig1 is seen in fig2 to be mountable to the upper end of the tubular housing 22 and can be attached to the cover 34 , or in the absence of the insulation 32 and thus the cover 34 , directly to the uppermost end of the tubular housing 22 , by means of screws or other fasteners ( not shown ). as best seen in fig1 and 2 , an indentation 36 is formed substantially within the surface of the upper section 24 of the housing 22 , the indentation 36 extending diagonally across two opposite sides of the tubular housing 22 and horizontally across the two other opposite sides of said housing 22 . in essence , the indentation 36 is continuous and substantially circumscribes a rectangular form though with corners which conform in shape to corners of the housing 22 . inner wall surfaces of the indentation 36 provide contact surfaces or lips 38 and 40 , the lip 38 being the uppermost surface of the indentation 36 &# 34 ; above &# 34 ; the location of a pivot bar 42 and the lip 40 being a contact surface formed of the lowermost portions of the indentation 36 &# 34 ; below &# 34 ; the pivot bar 42 . the pivot bar 42 , as best seen in fig2 and 7 , is mounted for pivotal movement between the two sides of the tubular housing 22 on which the indentation 36 is disposed diagonally . the pivot bar 42 can be seen to be mounted slightly &# 34 ; below &# 34 ; the center of the diagonal portion of the indentation 36 on each opposite side wall of said housing 22 . as is best seen in fig7 the pivot bar 42 is mounted at each end by conventional washers 44 and cotter key 46 . the pivot bar 42 , as best seen in fig1 - 3 , 5 and 7 , extends externally of the tubular housing 22 at a right angle for a length sufficient to extend to the farmost corner of the housing 22 whereupon the bar 42 again turns at a right angle and extends along essentially the full side wall of the tubular housing 22 before doubling back at an angle of 180 ° for a length substantially equal again to the side wall of the housing 22 . this exterior portion 48 of the pivot bar 42 effectively comprises a balancing weight which acts to pivot the pivot bar 42 in a clockwise direction as seen fig5 when no other constraints hold the pivot bar 42 . as is best seen in fig2 and 5 , the pivot bar 42 has fastened to it an air flow restriction plate 50 which has an uppermost section 52 and a lowermost section 54 , the sections 52 and 54 being parallel to each other but out of plane due to formation of the plate 50 in a tight s - curve at the juncture of said plate 50 and of the pivot bar 42 . the plate 50 is joined to the pivot bar 42 by means of screws 56 or similar fasteners . the air flow restriction plate 50 is sized and shaped to form essentially a full blockage of the channel defined by the tubular housing 22 when the plate 50 is in the position shown in fig5 . when in the position shown in fig5 edge portions of the uppermost section 52 of the plate 50 bias downwardly against the lip 38 of the indentation 36 while the peripheral edges of the lowermost section 54 of the plate 50 bias upwardly against the lip 40 of the indentation 36 . the plate 50 is held in the position shown in fig5 by virtue of the weight provided by the external portion 48 of the pivot bar 42 as described above . it is to be understood that the weight represented by the exterior portion 48 can be otherwise provided . however , the exterior portion 48 is conveniently formed and is easily observed visually from externally of the apparatus 10 and the chimney 14 so that it can be readily determined that the apparatus 10 is in an operable position . the uppermost section 52 of the air flow restriction plate 50 can be seen particularly in fig3 to be greater in area than the lowermost section 54 , a difference of approximately 10 % being preferred . the function of this size difference between the sections 52 and 54 of the plate 50 will be described in detail hereinafter . referring now primarily to fig2 and 4 , the apparatus 10 is seen in a &# 34 ; set &# 34 ; position wherein the air flow restriction plate 50 is disposed in a substantially vertical orientation and held in this orientation by means of fusible element , the element 58 being best seen in fig6 . an aperture 60 formed near the lower end of the section 54 of the plate 50 has a yoke 62 held therein , an aperture 64 being formed in an oppositely facing wall of the housing 22 and further having a yoke 66 held therein , loop portion 68 of the yokes 62 and 64 extending toward each other when the plate 50 is in the vertical position as shown . the fusible element 58 is formed of a plug 70 of fusible material such as is well known in the art , the plug 70 being solid not only at ordinary environmental temperatures but also at temperatures existing in upper sections of a chimney during the burning of usual fires in a fireplace serviced by the chimney . the plug 70 has u - shaped connector 72 extending oppositely therefrom , the connector 72 having outer legs 74 which fit into the loop portion 68 of the yoke 62 and 66 , thereby to hold the air flow restriction plate 50 in a vertical orientation as shown particularly in fig2 and 4 . in this &# 34 ; set &# 34 ; position , the normal flow of gaseous and other products of combustion are free to flow upwardly through the liner 12 and the tubular housing 22 such that the chimney 14 functions normally . in this &# 34 ; set &# 34 ; position , the exterior portion 48 of the pivot bar 42 is seen to be located in an upward position against outer walls of the apparatus 10 and can be so observed to be in this position from externally of the chimney 14 . thus , the existence of a &# 34 ; set &# 34 ; condition is readily observed without the need for the inconvenience of looking up into a chimney from the fireplace or looking down into the chimney from an unsafe position on top of a building . referring now to fig5 a representation of the operation of the apparatus 10 is provided under conditions such as would occur during the first instants of a chimney fire , such a fire burning with sufficient intensity to cause a virtually immediate melting of the plug 70 so as to disconnect the connector 72 and thus allow the air flow restriction plate 50 to be pivoted by the pivot bar 42 to the position as shown in fig5 whereby the uppermost section 52 of the plate 50 impinges against the lip 38 and the lowermost section 54 of the plate 50 impinges against the lip 40 of the indentation 36 as noted above . the weight of the exterior portion 48 of the pivot bar 42 acts to maintain the air flow restriction plate 50 in position such that air flow through the liner 12 and thus the chimney 14 is restricted to the point that insufficient oxygen is available for combustion . the fire in the chimney 14 which caused actuation of the apparatus is thus starved of oxygen and is extinguished . as is best seen in fig5 it will be noted that a portion of the expanding gas moving through the liner 12 and thus through the tubular housing 22 causes a &# 34 ; lifting &# 34 ; pressure against the uppermost section 52 while a portion of the expanding gases causes a &# 34 ; closing &# 34 ; pressure against the lowermost section 54 . the weight provided by the exterior portion 48 as aforesaid also produces a force which acts to hold the plate 50 in a blocking position . however , the greater surface area of the uppermost section 52 relative to the area of the lowermost section 54 provides a degree of &# 34 ; lifting &# 34 ; pressure of approximately 10 % relative to the &# 34 ; closing &# 34 ; pressure exerted on the section 54 . the existence of this slightly greater &# 34 ; lifting &# 34 ; pressure allows the plate 50 to be intermittently displaced in an angular fashion about the pivot bar 42 such that pressure can be relieved in essentially a &# 34 ; burping &# 34 ; fashion to prevent a &# 34 ; backing up &# 34 ; of smoke and the like into the interior of the building in which the chimney is installed , thereby acting to reduce smoke damage while still extinguishing a fire within the chimney 14 . the weight provided by the exterior portion 48 or the equivalent is not critical but is chosen to be sufficient to readily close the plate 50 but to allow intermittently large pressure buildups within the chimney 14 to be relieved for the purposes noted . the exterior portion 48 of the bar 42 can be seen to comprise approximately two 8 - inch lengths of approximately 1 / 2 - inch bar stock , this weight along with the remaining exterior portion of the bar 42 being sufficient to operate in the manner indicated . the fusible element 58 can be formed conventionally of lead or other fusible metals such as is well known in the art . the fusible element 58 can be formed other than is shown and described herein , it being possible to form the element 58 from a single length of fusible material without the requirement for the connector 72 , as an example . elemental lead and common lead alloys are seen to have appropriate melting points so as to be operable to melt under conditions which occur during a chimney fire . it is to be understood that the present apparatus 10 can be configured other than as explicitly described herein yet remain within the intended scope of the invention . for example , the present apparatus is described as being used on a chimney which serves a fireplace . however , the apparatus can be used in association with a chimney structure operable with a woodburning stove or any woodburning apparatus useful within the confines of a building and which is vented to ambient by means of a chimney or flue . further , the present apparatus 10 can be readily caused to operate an audible alarm or other alarm such as is represented schematically at 100 in fig1 . the alarm 100 is intended to provide a clear warning of the existence of a condition requiring attention and can be caused to operate an actuation of the apparatus 10 . while the structure herein described is preferred , variations can occur and it is apparent to those skilled in the art that , given the above teachings , variations are possible and that the scope of the invention is defined appropriately according to the recitation of the appended claims .

apparatus capable of fitting over the upper exposed end of a chimney liner and operable in the event of a chimney fire to extinguish the fire , the invention can be fitted to existing chimney structures without alteration of the chimney or liner structure . the present apparatus includes an air flow restriction plate which is held in a position allowing free flow through the chimney in normal use situations , the plate being held in place by a heat fusible element . the extremely high temperatures existing during even the first moments of a chimney fire cause melting of the fusible element and therefore closing of the air flow restriction plate to restrict air flow through the chimney and thereby quickly extinguish combustion .

embodiments of the invention provide techniques for conditioning and or exercising the lower leg extremity , with a dorsiflexion motion apparatus . the apparatus utilizes an engineered resistive tension band with angular displacement movement for health , fitness and or rehabilitation . the dorsiflexion apparatus provides a device for runners , sports enthusiasts and athletes by conditioning the lower leg extremity and rehabilitating injuries including shin splints as a preferred method over drugs and other non - conventional remedies available on the market today . the apparatus is made of a minimum amount of primary components , these components are assembled with minimum effort and the apparatus is lightweight , portable for home , office and or travel . in referring to fig1 , an apparatus 10 includes a base 11 , support arm 12 and resistive band 13 as assembled . the base 11 , configured to a size of a length and width to accommodate a range of a foot sizes from a child to an adult . the sizes accommodate a width , length and height as indicated by anatomical charts . an adult male foot the largest , an adult women foot the mid - size and a child or teen the smallest . the base 11 , is approximately seven inches wide to eighteen inches in overall length in one configuration , assembled with a pivoting support arm 12 , received by the base approximately eleven inches long in overall length . the anatomical foot is divided into three planes , a transverse , frontal , and sagittal . the apparatus is sized to accomodate a foot size of a child to an adult . variations in measurements may be considered reasonable within plus or minus one inch tolerances . the smallest size would be most desirable for transport and travel , and the largest size may accommodate more options such as a counter and or commercial grade apparatus products . the base 11 , further comprising a pair of parallel receiving slots 14 to receive a support arm 12 , at a pivot point designated within the body of the base 11 . the base 11 configured to a minimum overall height , preferably less than two inches and greater than one half an inch allowing the support arm 12 to engage and pivot inside the base 11 . the base 11 , comprising a trough or recessed area 15 , preferably in the front end of the base to receive a front portion of a foot or shoe , without raising the support arm 12 or preloading the resistive band 13 . the base 11 configured with a slip resistant pad or component 16 , located on the bottom surface of the base 11 to prevent movement of the apparatus . the base 11 , comprising an optional texture 17 on the top surface for added comfort or additional slip resistance while in contact of the sole of a foot or shoe . the base 11 , configured with an optional ramp 17 , to raise the support arm 12 to a desired angle for ease of inserting a foot . the angle can be selectable or fixed at a preferred 10 degree or greater angle . the angular motion of the apparatus support arm is desirable to move in an angular displacement of 20 or more degrees . the ramp 17 can also be configured to prevent damage to the arm or base when a force is applied to the top surface of the apparatus assembly . the ramp 17 can be configured on the two opposite sides of the base 11 top surfaces in the proximity of the end of the support arm 12 , wherein the ramp is configured to contact and provide a solid base for the support arm 12 . the support arm 12 is held approximately ten degrees or more from the base allowing a foot to be positioned into the apparatus without loading the resistive band 13 . the resistive band 13 is guided within a radiused slot 19 and configured to move along the external surface of the base 11 and extend when tension is placed on the band 13 from the support arm 12 pivoted in a dorsiflexion motion ( dorsiflexion lower leg - moving the foot about the ankle pivoting the toes and foot back towards the shin ) with the apparatus . the resistive band 13 is made of multiple strands of an elastomer material 99 or like resilient material , covered with a shell or sleeve of plastic or fabric like material 98 . the resistive band 13 is preferably round in diameter , configured to be wrapped about the ends 18 of the support arm 12 and guided through a radiused slot 19 on the base 11 forming a loop or one piece resistive resilient band . the resistive band 13 can be configured with different materials to provide different tensions , or different colors and or markings to identify different tensions , features or styles . the resistive band 13 in one configuration may comprise of fifteen strands of elastic at a specified outside diameter enabling fifteen to sixteen pounds of resistive displacement and at another configuration of twenty strands of elastic at a similar specified outside diameter increasing the resistive force to about twenty four pounds displacement . it may be desired to increase or reduce the number of strands , or increase or reduce the diameter of the resilient material to offer various levels of tension on the apparatus . the materials can be can be single elastic , multiple strand elastic , metal spring steel , helical extension coil spring with looped ends and other similar type resistive tension type materials . the materials are preferable covered with a sleeve of fabric or plastic like material configured to slide or move along a surface . the sleeve may be color coordinated to coincide with a specific tension or linear displacement of the resistive band 13 . referring to fig2 , a support arm 12 comprising a u shaped body , having a foot engaging end 20 , and an opposite base engaging end 21 , 22 , wherein the opposite base engaging end 21 , 22 are coupled to the base 11 as shown in fig1 . the support arm 12 comprising of a “ c ” shape or hook like end 23 , and configured to be assemble and pivot within base 11 as shown in fig1 . when assembled the support arm 12 is rotated 90 degrees so the hook like end “ c ” shape or hook like end 23 can assemble onto the pin 24 on the flat sides on the diameter pin 24 , the support arm can then rotate to lock into position and pivot about the pin 24 . a support arm 12 , further comprising a support arc 25 about the foot engaging end 20 within the u shaped body , sized to accommodate an arch of the topside foot surface of a child to an adult . the support arc 25 , defined as a differentiable curve in two planes having a minimum width and depth to accommodate the top arch of a foot . the support arm 12 may also be configured to have a pad 26 to provide comfort to the engaging foot wherein the pad 26 is mounted to the bottom side of the support arm 12 foot engaging end 20 . a support arm 12 , may have an optional printing or logo 27 on the top surface and or be combined with a pad , co - injection or over molded elastomeric material ( such as tpe thermo plastic elastomer , or tpr thermo plastic rubber ) bonded to or with a secondary material or component such at the support arm 12 . printing , secondary components and or over molding are optional choices for features , branding and or styling the apparatus . referring to fig3 , a base 11 , comprising a length and width to receive a foot size from a child to an adult , and further configured with a pair of parallel receiving slots 14 , configured to receive a support arm 12 as shown in fig2 . the parallel receiving slots 14 , configured with a pin 24 configured to engage a support arm 12 “ c ” hook like end 23 at a desired angle , and when rotated the support arm 12 locks securely onto the base 11 . base 11 is further comprises radiused slots 19 , designed to receive a resistive band 13 through one side of the base 11 and guided through the bottom up through the opposite side of base 11 . the radiused slot 19 preferably formed in a parallel pair , to each other starting from the top surface of base 11 , through a portion of the overall height 28 , of base 11 . a ramp 29 , extending from the base 11 at the end of the parallel receiving slots 14 , configured to provide added support of the support arm 12 , with in the assembled apparatus from an excessive load and or to maintain an optional preferred angle of 10 degrees or more . the ramp 29 provides a surface area for the support arm 12 to engage and allows the support arm 12 to be held at a desired angle to insert a foot or shoe into the apparatus without pre - loading the resistive bands 13 as shown in fig1 . the ramp 29 , can be extended through the base 11 , channel or slot 19 further extending support to a second component a support arm 12 that is coupled to the apparatus and prevent breakage . a slip resistant component 30 , fixed to the bottom side of base 11 to help prevent movement while the apparatus is in use . the slip resistant component 30 , made of rubber like material ( i . e . rubber , edpm , sbr , other like non slip materials , non - marking , grommets , tape with adhesive backing and or over molded plastic ). referring to fig4 , an apparatus 10 , including a base 11 , a support arm 12 configured to receive a foot size from a child to an adult . the apparatus 10 , having a base 11 , with a recessed slotted area 19 , configured to a position 31 and 32 , about the front end of the base 11 , wherein the recessed slotted area is stepped and cut away at two different positions and or relative heights 31 , 32 to accommodate a resistive band and allow equal resistive force transferred to the support arm 12 when the apparatus is in use . the recessed slotted areas 31 , 32 , are configured onto both sides of the base 11 parallel and symmetrical in shape . the recessed slotted heights 31 , 32 are also configured with full radii edges to allow the resistive band to move within the recessed slots when the apparatus is in use and the resistive band 13 as shown in fig1 . is loaded . a ramp 29 , extending from the base 11 top surface area , about the mid - section of the base 11 , towards the front end of the base 11 . the ramp 29 , configured to raise the support arm 12 , to a desired angle of about ten degrees or more , allowing a foot to be inserted without pre - loading the apparatus or moving the support arm 12 to insert a foot . the ramp 29 can extend parallel along a length of the support arm 12 . the ramp 29 offers both stability and surface area for a load applied to the support arm 12 transferred to the base 11 and reduces the load on the pivoting end of the assembly . referring to fig5 , in one configuration a resistive band 13 , comprising an elastic material 31 , a sleeve 32 , and a desired length 33 , coupled with a fastening device 34 to form a loop assembly . the resistive band 13 can be configured with a single strand of elastic material , and or multiple strands of elastic material . the resistive band 13 , can be a single molded part design , and or an assembly of multiple components . the properties of the material such as the material itself including modulus of elasticity , diameter of the elastic strand , stiffness , and or number of strands can provide various desirable tensions that may be applied to the apparatus assembly . a resistive band 13 , with elastic properties having a number of strands such as fifteen strands 35 may be desirable for lower resistance , and a resistive band having a number of strands such as twenty or more 36 may have a higher resistance and more desirable for a different consumer . the resistive band 13 in one configuration may comprise of fifteen strands of elastic at a specified outside diameter of 3 / 16 ″ enabling approximately sixteen pounds of resistive angular displacement over a span of two to three inches and in another configuration of eighteen strands of elastic at a similar specified outside diameter of 3 / 16 ″ resulting in approximately twenty one pounds of resistive angular displacement over a span of two to three inches and twenty strands of elastic at a similar specified outside diameter increasing the resistive force to about twenty four pounds displacement over a span of two to three inches . it may be desired to increase or reduce the number of strands , or increase or reduce the diameter of the resilient material to offer various levels of tension on the apparatus . the size of the elastic strand , and the number or strands may be designated for a variety of applications for example a desirable resistive band of 3 / 16 ″ ( 5 mm ) diameter sleeve with fifteen strands of elastic material at approximately 0 . 035 ″ diameter strand provides a resistive load of less than that of a 20 strand material of 0 . 035 ″ single strand of elastic material . the sleeve 32 , made of a plastic or fabric like material to provide a sliding component onto the surface area of the base wherein the elastic internal to the cover is slip resistant , but the cover material or the sleeve 32 is required to move or slide on the base 11 surface area allowing the apparatus to function with tension on the elastic material , but also stretch in the elastic covered by the sleeve 32 . the sleeve 32 material can be nylon , polypropylene or like plastic and or fabric material . it is desired to have a sleeve 32 , made of a material that slides easily such as nylon , polypropylene or other like materials for uniform movement about the outer surface of the base 11 . the force and displacement can be configured in one optional design with a lower number of elastic strands such as a fifteen strand with a resistive force of about one and half pounds over one inch displacement , and two and half pounds over three inches and three and half pounds over six inches . a higher number of strands such as a twenty strand elastic cord may result in a resistive force of three pounds over one inch and four pounds over three inches and six pounds over six inch displacement . if the sleeve 32 did not move , the tension from the elastic material alone would not provide sufficient movement or extension of the resistive band 13 for dorsiflexion movement of the lower leg extremity . a combination of the physical properties of the material , number of strands within the resistive band 13 and the ability for movement between the resistive band 13 and the base 11 is desired for optimum performance of the apparatus . an alternative design , a spring made of metal configured with a sleeve 32 can be provide another resistive embodiment for the proposed invention . the combination of elastic material extending in combination with the sleeve 32 movement enables the apparatus to extend in synchronous cycles or movement with minimum wear on the device . in referring to fig6 , a base 11 , comprising a pin like features 35 configured to a circular pin with two flat parallel surfaces 37 a double “ d ” configuration 36 . the pair of circular cross section pin like features 35 with two flats 37 extending from within the base 11 configured to receive the support arm 12 . the pin like feature 35 , is coupled to a “ c ” hook like feature 38 extending from an end of the support arm 12 , wherein the hook like feature 38 can be rotated to engage the pin like feature 35 onto a shape 36 with two flats 37 between the “ c ” hook 38 . the hook like feature 38 is then rotated to lock onto the pin like feature 35 within the base 11 . the two design features enable the parts to be manufactured with minimum number of components and easy to assemble without tools . a resistive band guide 39 is configured to the base 11 bottom , comprising of a detail to guide the resistive band from one edge 40 to the opposite edge 41 of the base . the guide enables the resistive band 13 ( as shown in one previous embodiment fig1 ) to follow a path with no resistance to movement and allows the resistive band to move as desired when the apparatus is in use . an optional feature , a resistive band storage feature 42 , is configured to the base 11 , having a protrusion from the base wherein a resistive band can be wrapped or stored . the apparatus may also be optionally configured with a handle , markings , and or engravings for instructions or use . it should be understood that the proceeding is a detailed description of one embodiment of the invention described within this specification and numerous changes to the disclosed embodiment can be made in accordance with the disclosures herein without departing from the spirit and scope of the invention .

an apparatus comprising a base , support and resistive band to provide consumers a method for conditioning , preventing or rehabilitating injuries from running , sports and fitness activities .

referring specifically to fig1 - 4 which illustrate the overall arrangement of a preferred embodiment which has been successfully operated , a cabinet defines an outer oven cavity 10 as well as a housing for motors , controls , and the like . the cabinet is rectangular in cross - section , of greater height than width , and has a length at least as great as its height . the cabinet is formed of a front wall 12 including a hinged normally closed door 13 ( with a locking latch mechanism later described ) providing access to the interior of cavity 10 , a rear wall 14 , a top 15 , side walls 16 , and a bottom 18 which is elevated above the lower edges of the front , rear and side walls to form a lower equipment compartment 20 . it will be noted that the side walls are rectangular , vertically elongated , and the front and rear walls are at least as long as the height of the side walls . in a preferred embodiment intended for restaurant kitchen use , the depth of the oven , e . g . the length of the side walls , is approximately 32 inches ( 81 . 28 cm .) to fit on a typical kitchen counter . the height of the entire cabinet is about 32 inches , and the side - to - side width is about 18 inches ( 456 . 72 cm .). these dimensions are stated solely by way of example , and without any limitation as to shape or size of an oven constructed according to the invention . in the preferred embodiment the side , top and bottom walls , and the door , are actually a composite insulated construction of several panels together with insulation and air space . thus , as shown particularly in fig2 and 3 , the rear wall 14 , top 15 and side walls 16 comprise inner panels 14a , 15a , 16a , a layer of insulation 14b , 15b , 16b , intermediate panels 14c , 15c , 16c which surround the insulation , and outer panels 14d , 15d , 16d spaced from the intermediate panels to define a cooling air passage or jacket 19 which opens into lower compartment 20 . similarly , door 13 has inner , intermediate , and outer panels containing insulation and an air space therewithin . bottom 18 also has multiple panels 18a , 18b and intermediate insulation . provision is made ( later described ) for circulation of cooling air between panels 18c and 18d . adjacent front wall 12 there is an inlet chute 22 extending from the exterior of the cabinet through the left side wall 16 and an outlet chute 23 extending to the exterior of the same side wall for guiding cooked food portions out of the cabinet the outlet of chute 23 is normally open , but may be closed by a swinging cover plate or door 23d ( manually operated ) if the oven includes a self - cleaning features as later described . a pair of cooking and conveying chambers 24a and 24b each include a perforate cylindrical wall 25 having a longitudinal axis 26 ( fig4 ) having an inlet end 27 and an outlet end 28 . within each cooking chamber 24 there is a conveying means in the form of an inlet baffle or plate 30 extending across the inlet end 27 and having a central opening 32 for receiving food portions to be cooked . from the periphery of baffle 30 there extends a plurality of ribs or angle bars 34 ( fig3 and 4 ) which in turn are attached to the edge portion of a helical conveying member 35 which extends from baffle 30 along the interior of said cylindrical wall to the outlet end 28 . the helical member 35 projects inward part way toward the central or longitudinal axis of cylindrical wall 25 , defining an open central passage 36 and a surrounding carrying passage 38 of helical configuration extending to the outlet end 28 of each cooking chamber 24a and 24b . the entire structure of the cooking chambers is preferably constructed of stainless steel or some equivalent material which will withstand heat in excess of 400 ° f . ( 204 . 4 ° c .) and which can be cleansed according to health code standards . the connected baffle 30 , member 35 and bars 34 may be provided as a separable unit which fits closely within the cylindrical wall 25 and which will tighten securely therein as the parts are heated in normal use . when cooled , this unit may be pulled from the outer cylindrical wall for cleaning or repair purposes two pairs of supporting and driving shafts 40a 40b and 42a , 42b are supported in bearings 44a extending through the rear wall and forward bearings 44b carried in bracket mounted to the inner wall panels of the oven cavity . these shafts are in parallel spaced relation to each other lengthwise of oven cavity 10 , at upper and lower levels therein , for holding cooking chambers 24a and 24b , respectively , in cradle - like fashion it should be noted ( fig2 ) that the two chambers 24a and 24b are supported with their longitudinal axes horizontal and offset from a vertical lengthwise plane through cavity 10 , thus reducing the overall vertical dimension of the unit , and also shortening the recirculating air paths as later described precise horizontal support of the cooking chambers is not essential , provided the functions of conveying and tumbling of the food products are achieved , however an arrangement as shown , with the axes of the chambers horizontal , does provide greater ease of construction and servicing of the oven . each of the shafts includes front and rear rollers 45 , fixed to the shafts , which actually contact the outer surfaces of the cylindrical walls 25 , for example near their inlet and outlet ends . in the embodiment illustrated , toothed drive rollers 46 on the shafts 40a and 42a ( see fig2 and 3 ) interact with the perforations in the walls 25 for a positive drive , although friction drive of the chambers 24a and 24b may be suitable rotation of the shafts thus imparts rotating motion to the cooking chambers about their longitudinal axes , yet allows those chambers readily to be removed from the oven cavity for cleaning , maintenance , etc . at the bottom of the oven cavity 10 , resting on bottom panel 18a , is a crumb tray 48 which will collect debris such as bits of material which may work their way through the openings in chambers 24a , 24b . this tray can be easily removed to dispose of such debris . a drive means ( fig3 ) to rotate the shafts ( and thus the cooking chambers ) in synchronism is provided by sprockets 50 fixed to each shaft , in the space between the intermediate rear wall panel 14 c and the outer panel . a chain 52 extends around these sprockets and around a driving sprocket 54 on a variable speed drive motor 55 mounted in compartment 20 as previously described thus , each cooking chamber rests on the supporting and driving shafts , and it is possible to reach into the oven cavity 10 and simply lift the cooking chambers 25 out of the unit . to locate the rotatable cooking chambers , and to relieve the drive mechanism of end - wise thrust forces , retaining rollers 56 are mounted to engage the front and rear edges of the cylindrical cooking chambers . adjacent the rear wall 14 , these rollers are simply supported on fixed brackets 57 ; adjacent the front , brackets 57a are pivotally supported , and held in their normal position with the rollers engaging the edge of the cylinders 25a and 25b , by suitable detents ( not shown ). a transfer chute 58 - within cavity 10 extends from the outlet end of the upper cooking chamber 25a to the inlet end of the lower cooking chamber 25b , to guide food portions from the upper to the lower chamber . a cooking air supply manifold 60 is located extending lengthwise along a lower portion of the right side wall inner panel 16a , and occupies approximately the lower two - thirds of the space between wall panel 16a and the lower cooking chamber 24b , extending into proximity with a lower quadrant of the upper cooking chamber 24a ( see fig2 ). manifold 60 has slot - like outlets 62 and 64 ( see fig1 ) directed against the outer surfaces of chambers 24a and 24b respectively , to direct heated air against the cylindrical walls 25 and through the perforations therein directly into and around the food portions contained in the cooking chambers . a heating means 65 , for example elongated electrical heating elements , is supported in air supply manifold 60 and extends most of the length of such manifold , to assure an ample supply of evenly heated air for the oven . motor driven blowers 68 are mounted in the bottom compartment 20 and have their respective outlets connected into the manifold 60 , so as to induce air flow over the heater 65 and through the manifold outlet slots 62 and 64 internal baffles or partitions ( not shown ) ay be located within manifoid 60 as needed to assist in distributing the air flow , as desired , to the respective outlets 62 and 64 . across cavity 10 there is a return air duct 70 , also extending approximately the full length of the oven cavity , and connected by a return air manifold 72 to the inlets of the blowers 68 . a filter 75 is removably mounted in the inward facing wall 70a of the return air duct , to pass and filter the recirculated air which is drawn therethrough by the blowers . the relationship of these ducts , manifolds , and the resultant forced convection air path , is illustrated in fig6 . door 13 is provided with a conventional handle and latch mechanism 77 having a thumb - operated release button 78 . a spring - urged latch cooperates with a keeper on the door frame ( not shown ) to hold the door closed in normal operation , and to allow it to be released for opening , primarily for servicing / cleaning operations . in the self - cleaning mode ( if used ) later described , the release button 78 is interlocked against manual operation , to lock the door during periods when elevated temperatures exist for cleaning purposes . the door 13 need not be opened during normal cooking operations , since food portions are loaded into inlet chute 22 , from whence they proceed to the upper cooking chamber 24a . the door is typically opened when it is desired to empty crumb tray 48 or to remove the cylindrical cooking chambers 24a , 24b for cleaning or repair . it should be noted that these chambers may be suitably dimensioned to fit in the wash chamber of a typical commercial ware washing machine , so they may be removed by lifting them off the supporting - driving shafts 40a , 40b and 42a , 42b and out the opened door 13 , for cleansing in such a machine . a unit such as that described so far has been successfully operated to cook a substantial variety of food products it has been found best to maintain an oven cavity temperature in the order of 420 ° to 430 ° f . ( 215 . 5 ° c . to 221 . 1 ° c .) and to vary the rotational speed of the cooking chambers from about 0 . 25 rev ./ min . to about 2 re ./ min . in such unit the cooking chambers have a diameter of 10 inches ( 25 . 4 cm . ), a length of 20 inches ( 50 . 8 cm . ), and the helical member 35 is constructed with a lead of 4 inches ( 10 . 16 cm . ), in other words the spacing of parts of member 35 lengthwise of the chamber at a given longitudinal line is 4 inches . the optional feeder mechanism 80 , shown in fig4 and 5 , provides for regularly - timed deposit of units or groups of food portions into the upper cylinder 25a . the feeder includes a housing 82 having a cylindrical cavity 83 with a bottom opening ( approximately square ) 85 which opens into the inlet chute 22 . within cavity 83 there is a power driven three - cavity rotor member 87 which is releasably coupled to a stub shaft 88 supported in housing 82 . each of the rotor member cavities 90 can receive a desired quantity ( one or more food portions ) which will drop through chute 22 into chamber 25a . the rotor member 87 is driven by a bevel gear set ( not shown ) from an auxiliary drive shaft 92 housed in a tubular extension 93 of the feeder housing 82 . shaft 92 is coupled through a universal joint 94 to a short drive shaft 95 which is connected to a sprocket 96 ( fig4 ) by an electrically actuatable clutch 97 . sprocket 96 is in turn connected via chain 98 to a sprocket set 99 driven from chain 52 . thus , the feeder , if used , is rotated in synchronism with the rotational drive of the cooking chambers . also shown in fig3 is a cooling fan 100 which is mounted in , and forces air through , the lower part of rear panel 14a forming the back of compartment 20 . thus , cooling air is forced over the blowers 68 and other components housed in compartment 20 , and flows upward between the intermediate and outer wall panels to assist in lowering the temperature of the outer panels . fig7 illustrates a typical control circuit for the oven described herein . the electrical power supply is shown as lines l1 , l2 and l3 ; 240 v ac is available across lines l1 and l3 and line l2 is the common . fuses f1 , f2 and f3 are located to protect against overload in the electrical heater elements 65 . lines l1 and l3 are connected across the primary winding of a control circuit transformer t , and in parallel with the primary winding are connected the motors of the two air circulating ( convection ) blowers 68 . a fuse f4 in line l1 protects against overload in these blower motors or the transformer primary side . the secondary winding of transformer t supplies unregulated 120v ac to the various control circuits , relays , and to the oven chamber drive motor 55 , the clutch 97 in the power drive shaft to the feeder mechanism 80 , and cooling blower 100 . a fuse f5 and manually operated power switch ps control the overall supply of electrical power to this circuit . thus closing switch ps illuminates the on indicator lamp , actuates cooling blower 100 , and applies power to the control units tp1 , tp2 , tp3 and tp4 which are solid - state temperature responsive controls ( e . g . electronic thermostats ) driving circuit controlling switches tps - 1 , tps - 2 , tps - 3 and tps - 4 . switch tps - 1 is normally closed and opens when its control unit senses a temperature in excess of 500 ° f . in the oven cavity . switch tps - 2 is normally closed , and will open when its control unit senses a preselected oven cavity temperature , in other words this controller and switch function as the cooking temperature regulator for the oven . switch tps - 3 is normally closed and opens when its control unit senses an oven cavity temperature in excess of 1000 ° f ., during the pyrolitic cleaning function switch tps - 4 is normally closed and opens when the oven cavity temperature exceeds 600 ° f . ; it is used , as later explained , to keep the door 13 locked when the temperature exceeds that value . a function selector switch fs has three different switch parts , fs - 1 which is the &# 34 ; cook &# 34 ; cycle selection , fs - 2 which is the &# 34 ; clean &# 34 ; cycle selection , and fs - 3 which is the &# 34 ; cool down &# 34 ; cycle selection . these three switches are interlocked , mechanically or electronically , such that only one can be effective . thus , the operator can select one of these three functions to the exclusion of the others . there are also a number of normally open mechanically closed switches which provide interlocks that require a certain placement of various parts of the oven . switch ds requires that the door 13 be closed before power can be applied to any of the control circuits which initiate one of the three functions . switch ct is closed only when the crumb tray 48 is properly in position in the oven cavity . switch ft is closed only when air filter 75 is properly in position . switch is - 1 is a normally open switch which is closed when the door 23d at the outlet chute 23 is closed . switch is2 is closed when door 13 is closed or in the closed / locked position for cleaning , and open when door 13 is open . a speed controller sc provides power to the motor 55 and also controls its rotational speed , which in turn varies the rotational speed of cooking chambers 24a and 24b . a dc power supply cv provides power to energize clutch 97 in the auxiliary drive to the feeder mechanism . a normally open interlock switch sf is closed only when the feed housing 82 is properly mounted , so otherwise the drive to the feed mechanism is interrupted at clutch 97 . when the oven has been powered up , switch fs is set to the &# 34 ; cook &# 34 ; function , fs1 is closed , and the control unit tp - 2 is set to the desired cooking temperature ; it is assumed that air filter 75 and crumb tray 48 are in position , and the main door 13 is closed , but the outlet cover door 23d is open . the on indicator will be energized showing power is applied to the oven . since switch fs is in the &# 34 ; cook &# 34 ; position , the cook indicator also will be energized , and will remain so unless the control unit tp1 senses oven temperature in excess of 500 ° f . and opens its switch tps1 . power also will be applied through switch tps2 of the temperature controller and switches ct and ft , to the coil of contactor relay k1 and the heat indicator which is wired in parallel with that coil . this results in closing contacts k1a - k1c , applying power to the heater means ( coils ) 65 . since switch fs2 is in the position shown ( it transfers only when the &# 34 ; clean cyle &# 34 ; is selected ), power is also supplied to coil k2 of the blower motor relay , its contacts k2a and k2b are closed , and flow of convection air begins in the oven cavity . power is also applied to the speed control sc , which in turn powers motor 55 to rotate at the chosen speed , and if the feed housing is in place , switch sf is closed and clutch 97 is energized to drive the feeder mechanism rotor 87 . when the heat indicator first extinguishes , as the controller tp2 opens its switch tps2 at the selected temperature , this is an indication that the oven is heated to the desired temperature and product can now be fed into the feed mechanism ( or manually into the inlet 22 if the feed mechanism is not used ). residence time of food product in the oven will be determined by the speed selected for motor 55 . moving the selector switch to the &# 34 ; cool down &# 34 ; mode opens fs1 and closes fs3 . this deenergises the heater control contactor k1 , actuates the cool down indicator , and leaves the blowers 68 operating and the drive motor 55 running while the oven cools . the end of this period can be determined by an operator , at which time the switch ps is opened to remove power from the entire control circuit , stopping the blowers and drive motor . to actuate the &# 34 ; cleaning &# 34 ; mode , for pyrolytic cleaning of the oven , switch fs is moved to the &# 34 ; clean &# 34 ; position and fs2 transfers to its normally open contact . the crumb tray 48 is removed and switch ct transfers to its normally open contact . also , the door 23d is closed across the outlet opening , closing interlock switch is1 , and thus placing the heater control relay coil under the control of the high temperature controller switch tps3 and a timer switch ail . the temperature limit switch tps4 is closed , assuming oven temperature below 600 ° f ., and the door lock solenoid dl is energized to lock the latching mechanism 77 for door 13 in the closed position so long as the oven temperature remains above 600 ° f . during a cleaning cycle , tps4 is open and closing door interlock switch is2 cannot energize the door lock solenoid dl to permit the door to be unlocked and opened . power is applied through fs2 and is1 to the clean indicator , to the driver tm of a cleaning period timer ( e . g . two hour time out ), and to the coil of an interrupter type relay k3 which , when energized , will close its contacts k3a for a short period , then open them , then reclose . the contacts k3a are wired into the circuit for powering the coil of blower relay k2 , and the timer contacts tm1 are wired in series with switch tps3 , interlock switch is1 , and the selector switch fs2 . therefore , the blowers 68 will be cycled on and off during the cleaning cycle , and that cycle will last for the timer duration . the temperature controller switch tps3 functions as an over temperature safety to prevent heating above a preselected upper cleaning temperature , for example 1000 ° f . when the timer completes its period , power to the heater contactor relay coil k1 is interrupted , the heaters turn off , but the blowers continue to cycle and the motor 55 continues to rotates chambers 24a and 24b it should be noted that during the self cleaning cycle , the cooling fan 100 continues to operate and to move cooling air through inter - wall space of the oven cabinet . while the method herein described , and the forms of apparatus for carrying this method into effect constitute preferred embodiments of this invention , it is to be understood that the invention is not limited to this precise method and forms of apparatus , and that changes may be made in either without departing from the scope of the invention , which is defined in the appended claims .

a self - cleaning continuous cooking oven is provided which is capable of rapidly cooking different foodstuffs with a recirculated hot air . the oven has a cabinet defining said oven cavity , an inlet chute for food portions to be cooked , and an outlet chute for cooked food portions . these chutes may be sealed during an oven cleaning cycle . within the cavity there is a rotatable cooking chamber including a cylindrical wall having a longitudinal axis and having an inlet end and an outlet end . a conveying member extends along and projects inward from the interior of the cylindrical wall defining a food carrying passage extending to the outlet end of said cooking chamber , and food passed into the inlet chute progresses through the chamber and exits via the outlet chute means rotatably supporting said cooking chamber in said oven cavity with said inlet end adjacent said inlet chute and said outlet end discharging to said outlet chute . a recirculating blower and a heater supplies a forced flow of heated air into said cooking chamber and onto food portions therein , and a drive rotates the cooking chamber at a predetermined speed . a cycle control operates the oven in cooking and self - cleaning modes . in the self - cleaning mode the heater is operated at a temperature sufficiently high to assure pyrolytic cleaning of soil from interior exposed parts of the oven cavity and the cooking chamber , and also actuates the drive for the cooking chamber during a cleaning mode .

the present invention may be further understood with reference to the following description and to the appended drawings , wherein like elements are referred to with the same reference numerals . the present invention relates to devices and methods for treating obesity specifically , by partially filling a gastric space . more specifically , the present invention relates to the insertion and removal of gastric space filling devices which has previously proven difficult . the methods and devices according to the present invention provide devices and methods for more easily deploying and removing space filling devices from the stomach and the upper gi tract . that is , after a predetermined time period has elapsed during which physical limiting of caloric intake is desired , it is preferable to remove the gastric filler from the stomach . however , removal of known gastric fillers has proven difficult for a variety of reasons . embodiments according to the invention also provide novel space filling technologies and products that may be used as gastric fillers or as fillers in other body spaces designed to facilitate the insertion and removal procedures . an exemplary gastric filler according to a first embodiment of the invention includes a gastric bubble formed with an integrated deflation and retrieval mechanism simplifying removal of the bubble after the desired treatment period has elapsed . the gastric bubble comprises a shell - like body formed of a polymeric wall including a failure zone pre - formed in the wall during a molding or other manufacturing operation as , for example , a weakening groove or indentation . the body may be a single filling volume or a series of filling volumes that are either independently or simultaneously fillable . as will be described in more detail below , during removal , the wall is torn along the weakening groove by the removal force , such that the balloon unwinds into an elongated strip that can be easily removed trans - orally . the gastric bubble may be inflated through a self sealing valve mechanism that seals itself when an inflation device ( e . g ., an inflation tube or catheter ) is withdrawn from the valve . the valve may comprise any self sealing valve known to those skilled in the art , such as a basketball valve , a duckbill valve , etc . the bubble may be inflated using air or , alternatively , an inert gas or mixture of gases of predetermined density . in another embodiment , the bubble may be self expanded through a chemical and / or physical reaction with contents of the stomach . for example , the bubble may be inserted in an unexpanded state and upon delivery , may enter an expanded state by absorbing stomach fluids . fig1 shows an exemplary embodiment of a gastric balloon 100 including an outer wall 104 with a failure zone formed as a groove 106 extending around the wall 104 in a spiral . those skilled in the art will understand that the failure zone is formed so that a strength of the wall 104 in this area is reduced with respect to the rest of the wall 104 ( e . g ., by thinning this portion of the wall ) so that , when subject to a predetermined stress , the wall 104 will separate along the groove 106 . a tag with a loop 102 , or other retrieval element , is connected to one end of the gastric balloon 100 so that it may be grasped and pulled by the physician with a grasping instrument , for example , under direct visualization using an endoscope to apply the predetermined stress to the failure zone . when it is desired to remove the gastric balloon 100 from a portion of the gi tract into which it has been inserted , the user locates the tag 102 ( e . g ., under direct visualization via an endoscope ) and manipulates a grasping device to apply tension to the balloon 100 to cause an initial break of the material forming the wall 104 along the groove 106 . as the application of tension is continued , the wall 104 unravels into a long piece of tape 110 which is removed as the grasping device is withdrawn through the esophagus and the mouth or which is drawn with the grasping device into the working channel of the endoscope which is then withdrawn trans - orally . in the exemplary embodiment shown in fig1 , the balloon 100 has a substantially spherical shape . however , other embodiments may include other geometries , such as cones , cylinders , elliptical shapes , etc . as shown in fig2 , a gastric balloon 200 according to a second embodiment of the invention includes a net or bag 204 which , after insertion into a desired portion of the gi tract ( e . g ., the stomach ), is filled with a filler material until the balloon 200 takes up a desired volume . the filler material preferably comprises string or a similar material easily inserted into and removed from the gi tract via the mouth . the net 204 includes a tether end 202 which is coupled to the filler material to facilitate grasping by a retrieval device inserted via an endoscope for removal of the filler material from the body . the net 204 may be formed as a porous netting or a fluid / gas barrier depending on a degree of desired interactivity between the stomach contents and the balloon 200 . a higher degree of porosity may result in faster transport of materials through the stomach while a lower porosity may impede material transport . the net 204 may include one or more preformed failure zones . for example , the net 204 may be woven or crocheted so as to unravel when pulled . in some embodiments , portions of the net 204 and / or the filler material may be biodegradable or dissolvable . for instance , the net 204 may be dissolvable by application of a solvent , a dissolving solution or heat , or may be designed to dissolve after a predetermined period of time after exposure to stomach fluids ( e . g ., three months ). once the net 204 is dissolved or manually broken , the filler material may be exposed to the same or another dissolving agent , and may be absorbed or passed through the digestive system . the filler material in this exemplary filler balloon 200 is formed as a length of string 206 coupled to the tether end 202 . the string 206 is inserted into the net 204 via an opening 212 after the bag 204 has been placed in the stomach or other desired location within the gi tract . as an alternative to or in addition to the string 206 , other filler materials , such as hydrogels , beads , absorbable elements , etc ., may be used to give the desired volume to the net 204 . the filler material may also have a specified geometry that facilitates deployment , filling or removal of the balloon 200 . exemplary geometries include dimpled or porous surfaces and variable sized or shaped elements . both the string 206 and the bag net 204 may be inserted using endoscopic instruments and procedures allowing the trans - oral insertion and removal of these gastric filling devices to be accomplished easily and rapidly . as described above , the string - like filler material may be grasped at one end , such as by an end 210 attached to the tether 202 , and pulled out through the esophagus and the mouth . the bag or net 204 , once deflated by removing the filler material , may then be pulled out through the esophagus and mouth in the same manner described above for the string - like filler material . the string 206 may also be coupled to the bag 204 to facilitate removal of the bag 204 after the string 206 is removed . thus , removal of both the string 206 and the bag 204 may be performed in a single step . in another embodiment , the tether 202 may comprise a ripcord coupled to the bag 204 . that is , the tether 202 may perform a tearing or opening function . in an embodiment where the bag 204 comprises multiple filling volumes , the tether 202 may separate the multiple volumes and / or individually open or tear each volume separately as would be understood by those skilled in the art . in a different embodiment according to the invention , the gastric fill material comprises a stand - alone filling device placed within the stomach without a constraining element such as a net or a bag . the filling device may comprise any shape that provides a desired filling characteristic . for example , the filling device may be shaped to fill a portion of the antrum ( e . g ., tapered , conical , etc . ), thereby slowing gastric emptying . exemplary filling device shapes include open coils , s - ribbons , stars , shapes with wide and / or irregular cross - sections , etc . the filling device may be formed of any biocompatible elastic material , such as stainless steel , platinum , titanium , a polymer , etc . in another embodiment , the filling device may comprise a shape memory material such as nitinol and other materials used in the manufacture of embolic coils for treating aneurisms . the filling device may be inserted or removed through a working channel of an endoscope / delivery tube in a substantially low profile and deformed using any combination of mechanical , electrical or chemical techniques . alternatively , the filling device may be delivered while wrapped around an exterior of the endoscope / delivery tube . in some embodiments , the filling device may be deformed using electricity , temperature change , a physical or chemical reaction ( e . g ., absorption of fluids ), manual manipulation , etc . the deformation may be in multiple dimensions ( e . g ., three - dimensional expansion , two - dimensional torsion , etc .). in some embodiments , the deformation may be reversible so that the filling device may be withdrawn while maintaining the low profile . in another embodiment , the stand - alone filling device may be formed of an interwoven material comprising a three - dimensional mesh or nest . a weaving pattern may be selected to facilitate insertion and removal of the filling device , or to regulate the transport of material through the stomach . the mesh may be woven into any number of shapes , such as those described above with reference to the stand - alone device ( e . g ., cones , stars , irregular patterns , curved patterns , etc .). fig3 shows an exemplary embodiment of a gastric filling device 300 comprising a coil 310 which is deployed into the stomach 302 via an endoscope or other tubular device inserted through the mouth and esophagus 304 . the lower esophageal sphincter (“ les ”) and the esophagus 304 are protected from damage or irritation by maintaining the coil 310 within the working channel of an endoscope during insertion and removal of the coil 310 therethrough . additionally , some patients may have feeding tubes , such as a percutaneous endoscopic gastrostomy ( peg ) tube placed through an oral cavity or percutaneously ( e . g ., through an abdominal stoma ). in such instances , the feeding tube may function as a delivery and / or removal device for the filling device 300 . the coil 310 may be formed of a shape memory material . as would be understood by those skilled in the art , the shape memory properties of the coil 310 allow the coil 310 to be maintained in a substantially straight shape during insertion through the working channel of the endoscope with the material reverting to a memorized coil shape after deployment within the stomach 302 . thus , the substantially straight shape facilitates trans - oral insertion while the shape memory properties of the coil 310 allow it to expand to a pre - selected shape and volume without the need for a separate constraining device such as the bag , net or bubbles described above . as with the above - described embodiments , the operative shape and volume are selected so that , when in a desired position within the stomach 302 , the volume taken and / or the stimulation applied to the wall of the stomach 302 enhances feelings of satiety . for example , the material of the coil 310 may be formed to take the form of a sphere or other hollow shell geometry after it has been deployed in the stomach 302 . after completion of the treatment , the coil 310 may be returned to its substantially straight shape to be removed by , for example , grasping a proximal end of the coil 310 and drawing the coil into the working channel of an endoscope . the force of pulling into the endoscope causes the coil 310 to straighten . alternatively , in other embodiments , the shape change may be caused by a stimulus such as an electrical signal , a chemical or physical reaction ( e . g ., absorption of fluid ), etc . in another embodiment , the coil 310 may be formed of an elastic material without shape memory , but with sufficient malleability so as to retain shape after being manually deformed . alternatively , the elastic material may be biased towards the straight , low profile configuration , deforming to accommodate a natural curvature of the stomach wall . the embodiments of the gastric filler according to the invention described above may be deployed and retrieved using conventional techniques , such as endoscopic procedures . however , improved devices to manipulate the gastric filling devices are within the scope of the invention . the improved methods and devices may be used in conjunction with the gastric filling devices described above , as well as with conventional gastric balloons and bubbles used for the treatment of obesity . in one exemplary embodiment , access to the stomach of a patient may be provided by a catheter placed through the esophagus . a stent - like device is inserted through the catheter trans - orally in a compact configuration , such as folded unto itself . once placed in the stomach , the device opens up like a stent , and takes up a selected volume within the stomach . this gives to the patient a feeling of satiety or fullness , so that less food is ingested . for example , the catheter may be a aaa stent - graft marketed by trivascular and boston scientific corporation , of natick , mass . the stent may comprise any number of shapes , including a cylinder , a ball and a torpedo . the stent is free floating in the stomach and may be sized to produce a desired amount of satiety . in another exemplary embodiment , the delivery and retrieval system used for a gastric filling device utilizes a flexible overtube inserted into the gi tract and advanced until a distal end reaches a desired position within the stomach . at this point , a shape of the overtube may be locked so that forces applied to the overtube via devices inserted and / or withdrawn therethrough are absorbed by the overtube itself without being transferred to the surrounding tissue . alternatively , the overtube may remain in an unlocked , flexible configuration so long as the overtube is maintained in the desired position . as shown in fig4 , an exemplary locking overtube 400 includes a distal end 402 which is inserted trans - orally through the esophagus into the stomach . the overtube 400 comprises a lumen 404 extending its entire length to an opening formed in the distal end 402 . a liner is passed through the lumen 404 and out of the opening in the distal end 404 to provide access to the stomach . the body 406 of the overtube 400 has a flexible configuration in which it is free to bend and change shape to simplify insertion through the gi tract . the shape locking mechanism may consist of a series of nested rings linked together via one or more cables and locked into position by tightening the cables . the overtube 400 includes a controller 410 actuated by the user to change the configuration of the body 406 between the locked and flexible configurations . in the locked configuration the overtube 400 withstands torsional and axial loads ( e . g ., those applied thereto as instruments are inserted through and withdrawn from the lumen ) without changing shape . the locked overtube 400 provides a stable platform through which the gastric filling material may be inserted or removed , as the locked configuration maintains the distal end 402 in a substantially constant position within the stomach as forces are applied therethrough to remove the filler material . alternatively , an overtube for use in conjunction with the invention may include all of the elements of the includes overtube 400 except for the shape locking mechanism and controller described to provide a passive , stable platform through which the gastric filling material may be inserted or removed . the present invention has been described with reference to specific exemplary embodiments . those skilled in the art will understand that changes may be made in details , particularly in matters of shape , size , material and arrangement of parts . accordingly , various modifications and changes may be made to the embodiments . the specifications and drawings are , therefore , to be regarded in an illustrative rather than a restrictive sense .

an obesity treatment device comprises a filament filler material movable between a substantially straight insertion / removal configuration and an operative configuration in which the filament extends along a predetermined curve to occupy a selected volume within the stomach and a retrieval device connected to a proximal end of the filler material facilitating grasping and withdrawal of the filler material . a method of treating obesity , comprises inserting to a desired position within the gi tract a filament filler in a substantially straight configuration and moving the filler into an operative configuration in which the filler curves along a predetermined path to define a desired volume in combination with , after a predetermined treatment period has elapsed , collapsing the filler into the substantially straight configuration for trans - oral removal .

in the drawings , like numerals indicate like elements throughout . certain terminology is used herein for convenience only and is not to be taken as a limitation on the present invention . the embodiments illustrated below are not intended to be exhaustive or to limit the invention to the precise form disclosed . these embodiments are chosen and described to best explain the principle of the invention and its application and practical use and to enable others skilled in the art to best utilize the invention . a fluid conveying conduit according to a first embodiment of the invention is designated generally by the reference numeral 10 , as shown in fig1 . the fluid conveying conduit 10 comprises a conduit body 12 which defines a medical tube for administering fluids . the conduit body 12 includes three luminescent markers 14 . each luminescent marker 14 includes an elongate , luminescent rib 16 which extends along the length of the conduit body 12 . each elongate rib 16 includes a luminescent pigment ( not shown ). in a preferred embodiment the luminescent pigment is a phosphorescent pigment . a particularly preferred phosphorescent pigment is alkaline earth metal silicate aluminate . in the embodiment shown , all three elongate ribs 16 lie adjacent to an inner surface 18 of the conduit body 12 , as shown in fig4 . the elongate ribs 16 are equally spaced from one another around the inner surface 18 of the conduit . in other embodiments , of the invention one or more elongate ribs 16 may lie adjacent to an outer surface 20 of the conduit body 12 . in addition , other embodiments of the invention may include different numbers and arrangements of elongate ribs 16 . furthermore , different shapes of cross - sectional profile are also possible . in a low light condition , i . e . typically less than 1 lumen , each elongate rib 16 emits light so as to render the conduit visible to a user or carer . each elongate rib 16 is able to emit visible light for many hours without the need for an external power source . in the embodiment shown in fig1 , the entire conduit body 12 is transparent which means a user or carer is able to see the contents of the conduit 10 . one type of polymer from which it is convenient to make the conduit body 12 is pvc . in other embodiments , not shown , the conduit body 12 may include one or more dyes or secondary pigments so as to emit or reflect incident light in a predetermined range of wavelengths . in this way it is possible to provide a translucent conduit body 12 which has a predetermined tint , so as to provide a visible indication of what fluid is being administered by the tube 10 . a desirable level of translucency , or tinting , is 5 % as this provides a suitable visible indication while still allowing the contents of the conduit 10 to be seen . the luminescent pigment in one or more elongate ribs 16 may also include one or more dyes or secondary pigments . in such embodiments , each elongate rib 16 , in use , emits light of a particular colour . this provides a visible indication of what fluid is being administered by the conduit 10 in a low light condition . a fluid conveying conduit according to a second embodiment of the invention is designated generally by the reference numeral 30 . the second fluid conveying conduit 30 shares many features with the first fluid conveying conduit 10 . these common features are designated by the same reference numerals . the second fluid conveying conduit 30 includes an opaque conduit body 12 which defines a medical tube , and has three elongate ribs 16 integrally moulded therewith . each elongate rib 16 extends along the length of the conduit body 12 . the conduit body 12 and each elongate rib 16 includes a luminescent pigment ( not shown ). consequently , in a low light condition , the whole conduit 30 emits light so as to render it visible . a fluid conveying conduit according to a third embodiment of the invention is designated generally by the reference numeral 40 . the third fluid conveying conduit 40 shares many features with the first and second fluid conveying conduits 10 , 30 . these common features are designated by the same reference numerals . the third medical tube 40 includes a conduit body 12 which defines a medical tube , and may be transparent , translucent or opaque . an ink 42 which includes a luminescent pigment ( not shown ) lies on the outer surface 20 of the conduit body 12 . the ink 42 is arranged as a graphic symbol which assists a user or carer in identifying the fluid being carried by the conduit 40 . in the example shown , the graphic “ o 2 ” is printed on the outer surface 20 . other embodiments may include different graphics and / or arrangements of ink 42 . in a low light condition , the ink 42 glows , thereby allowing a user or carer to see the conduit 40 as well as readily identify the contents , i . e . oxygen . a fluid conveying conduit according to a fourth embodiment of the invention is designated generally by the reference numeral 50 . the fourth fluid conveying conduit 50 shares many features with the first , second and third fluid conveying conduits 10 , 30 , 40 . these common features are designated by the same reference numerals . the fourth medical tube 50 includes a conduit body 12 which defines a medical tube , and is transparent . in other embodiments , the conduit body 12 may be translucent or opaque . the conduit body 12 includes two luminescent markers 14 , each of which includes an elongate , luminescent band 52 , 54 that lies within the conduit body 12 and extends along the length thereof , as shown in fig5 . each elongate band 52 , 54 includes a luminescent pigment ( not shown ). the cross - sectional shape of each elongate band 52 , 54 may differ from that shown in fig5 . for example , in other embodiments the or each elongate band 52 , 54 could have a circular , oval , elliptical , oblong or square cross - sectional shape . a first elongate band 52 lies completely within the conduit body 12 , whereas one portion of a second elongate band 54 is coterminous with the outer surface 20 of the conduit body 12 . in a low light condition , each of the elongate bands 52 , 54 emits light along substantially the entire length of the conduit body 12 , thereby rendering the whole length of conduit 50 visible . a fluid conveying conduit according to a fifth embodiment of the invention ( not shown ) has a conduit body 12 which defines a medical tube , and includes an antimicrobial additive . in this way the fourth conduit is also able to inhibit the spread of infection within a medical facility or home . whilst the examples described above relate to medical tubing , it is envisaged that the invention could be applied to other fluid conveying conduits such as hoses and pipes .

a fluid - containing conduit including at least one luminescent marker whereby the fluid - containing conduit is visible in a low light condition . the marker may be in the form of one or more elongate ribs containing luminescent material along interior wall surface , or may be elongate luminescent bands adjacent the exterior wall of the conduit , or may be indicia containing luminescent material such as ink .

the following examples describe preparation of comparative reaction products ( crp ) for ( a ) germall ® 115 ( 1 : 1 . 5 ); at low caustic levels ; and ( b ) at high caustic levels ; and ( c ) germall ® ii ( 1 : 4 ), low caustic and ( d ) high caustic ; and invention reaction products ( irp ) germall ® iii ( 1 : 3 ), ( a ) laboratory and ( b ) commercial runs , with only enough caustic to neutralize the formic acid present in the formalin solution . [ 0013 ] ( 1 : 1 . 5 ) allantoin 15 . 8 g ( 0 . 1 mole ) formalin ( 37 %) 12 . 2 g ( 0 . 15 mole ) water 28 . 5 ml the above mixture was refluxed for one hour to form a clear solution . [ 0015 ] ( 1 : 1 . 5 ) allantoin 600 g ( 3 . 8 mole ) formalin ( 37 %) 450 g ( 5 . 5 mole ) sodium hydroxide 123 g refluxed for one hour to form a clear solution . concentrated acetic acid was added to adjust the ph to 4 . 0 . removed water to give a white powder . [ 0017 ] ( 1 : 4 ) allantoin 1053 g ( 6 . 66 mole ) formalin ( 37 %) 2160 g ( 26 . 64 mole ) the white suspension was heated to 85 ° c . and held for an additional hour ; upon cooling a clear solution was obtained . removed water under reduced pressure to give a white powder . [ 0019 ] ( 1 : 4 ) allantoin 158 . 1 g ( 1 . 0 mole ) formalin ( 37 %) 324 . 2 g ( 3 . 99 mole ) sodium hydroxide 10 % 32 . 0 g ( 0 . 08 mole ) refluxed at 85 ° c . for one hour . the clear colorless solution obtained was dried under reduced pressure to give solid white powder residue . a . niger c . albican atcc 9642 test solutions attc1023 ( for 3 days ) 0 . 3 % germall ® 115 + + ( exs . a / b ) 0 . 3 % germall ® — — ii ( exs . c / d ) [ 0023 ] ( 1 : 3 ) allantoin 1616 g ( 10 . 23 mole ) formalin lm *( 37 %) 2488 g ( 30 . 68 mole ) sodium hydroxide 50 % 24 g mixed and heated at 60 ° c . for 3 hours to give a clear solution . the ph of the product was adjusted to 7 . 2 with the sodium hydroxide solution to neutralize formic acid in formalin ® and the solution was spray dried to give a free - flowing , white powder . [ 0026 ] ( 1 : 3 ) allantoin . wet cake 2095 lbs ( 10 . 23 mole ) formalin lm ( 37 %) 2488 lbs ( 30 . 68 mole ) sodium hydroxide 50 % 23 . 6 lbs ph 6 . 5 - 7 . 0 reaction temp 40 - 60 ° c . the resultant mixture then was further reacted at 85 ° c . for 3 hours to give a clear solution at ph 7 . 2 . the solution was spray dried to remove water and other volatile by - products to give a free - flowing , white powder . a study was conducted to determine the level of methylene diol in the reaction products versus the number of equivalents of formaldehyde added during formation . these results are based on quantitative 13c - nmr analysis and summarized in table 1 below . [ 0029 ] table 2 bioactivity of germall ® compounds invention exs . preservative organism static cidal irp - germall ® staph aureus 300 ppm 1250 ppm iii ( 1 : 3 ) e . coli 300 ppm 1250 ppm p . aeruginosa 300 ppm 600 ppm b . cepacia 150 ppm 300 ppm c . albicans & gt ; 5000 ppm — a . niger 2500 ppm 2500 ppm crp - germall ® staph aureus 300 ppm 1250 ppm ii ( 1 : 4 ) e . coli 600 ppm 1250 ppm p . aeruginosa 600 ppm 1250 ppm b . cepacia 150 ppm 600 ppm c . albicans 5000 ppm & gt ; 5000 ppm a . niger 2500 ppm 2500 ppm crp - germall ® staph aureus 1250 ppm 2500 ppm 115 ( 1 : 1 . 5 ) e . coli 1250 ppm 2500 ppm p . aeruginosa 1250 ppm 2500 ppm b . cepacia 600 ppm 1250 ppm c . albicans & gt ; 5000 ppm a . niger 5000 ppm 5000 ppm the purpose of this test procedure is to screen experimental compounds for anti - microbial activity . the measurement of the lowest effective concentration of an anti - microbial or anti - microbial blend is important for recommending use concentrations . the mic test is an in vitro tube dilution procedure used to identify effective concentrations of anti - microbials . in this test , the experimental compound is diluted by serial concentrations into nutrient culture media . test organisms are then inoculated into the anti - microbial solutions . if the experimental compound is effective , there is no growth observed in the test dilution tubes and they are clear . if the experimental compound is not effective , the test dilution tubes are cloudy , indicating growth . this test will determine static as well as cidal activity concentrations . 4 . media : trypticase soy broth ( bbl 11043 ) and aoac letheen broth ( bbl 10914 ) 5 . test organisms : staphylococcus aureus atcc 6538 , escherichia coli atcc 8739 , pseudomonas aeruginosa atcc 9027 , burkholderia cepacia atcc 25416 , candida albicans atcc 10231 , and aspergillus niger atcc 16404 . 1 . antimicrobial stock solutions are prepared at predetermined concentrations ( i . e ., 10 % through 0 . 07 %) depending on the test material . serial doubling dilutions are made as follows . each culture tube contains 5 mis of trypticase soy broth . five mis of the stock solution are added to the first tube and vortexed . 5 mis are then removed and placed into the second tube , ( and so on , until the last tube ). at the final test concentration , 5 mis of the broth / antimicrobial mixture is decanted out . 2 . the test organisms are prepared as with any organism inoculum ( mlm 100 - 3 , mlm 100 - 4 , and mlm 100 - 5 ). a saline suspension of each organism is prepared . the bacterial organisms and the yeast are a standardized at a concentration of 1 × 10 6 cfu / ml . the mold inoculum is approximately 1 × 10 5 cfu / ml . 3 . inoculate each culture tube with 0 . 10 mls of organism inoculum and vortex . 4 . incubate bacterial tubes for 24 hours at 35 ° c . incubate yeast or mold tubes for 48 hours at 25 ° c . read for growth ; turbid tubes for bacteria and yeast ; mold clearly visible tubes . this is the minimum inhibitory concentration ( static activity ). 5 . after the tubes are read , transfer all “ clear ” tubes and the first cloudy ( growth ) tube into letheen broth containing neutralizers . incubate the letheen broth tubes for 48 hours at the bacterial or fungal incubation temperatures . read for growth ; turbid tubes for bacteria and yeast ; mold clearly visible in mold tubes . this is the cidal activity concentration . the cidal activity of an anti - microbial can be rapidly screened by means of a mic test before further evaluation tests , such as longer preservative efficacy tests , are performed . this test is a tube serial dilution procedure limited only by the water solubility of the material . where anti - microbial materials are slightly insoluble , leaving the tsb broth turbid , a procedure modification can be made . tubes are incubated for 24 hours ( bacteria ) or 48 hours ( fungi ) but instead of transfer to letheen broth , the tsb tubes are streaked onto letheen agar . the agar plates are then incubated appropriately and then read for absence or presence of growth . depending on the degree of insolubility , a measure of cidal activity may be the only parameter measured . anti - microbial neutralization is important in this screening test . letheen broth or agar contains neutralizers but if these do not neutralize the anti - microbial adequately , others can be added . these are to be determined prior to testing . aseptic technique is important in any microbiological procedure . all functional operations are performed under the laminar flow hood with use of sterile pipettes , tubes and media to eliminate cross - contamination . surface sanitizers ( i . e ., alcohol ) are used on the work surface before and after each operation . ample time is allowed for recirculation of air within the sterile chamber of the hood . the bioactivity data show particular effectiveness against the organism cepacia b . ( cidal = 300 ppm vs . 600 ppm and 1250 ppm for germall ® ii and germall ® 115 , respectively ). however , if desired , even broader spectrum antibacterial activity can be achieved by combination products with the invention composition whose formulations are given below . [ 0053 ] combination blends ( by weight ) ( 1 ) germall ® iii 20 - 30 % mp - methyl paraben 8 - 12 % pp - propyl paraben 2 - 4 % pg - propylene glycol q . s . 100 ( 2 ) germall ® iii 40 - 45 % ipbc - iodopropynyl butyl carbamate 0 . 5 - 5 % pg - propylene glycol qs 100 ( 3 ) germall ® iii 98 . 5 - 99 . 5 % ipbc - iodopropynyl butyl carbamate 0 . 5 - 1 . 5 % ( powder ) a typical cosmetic emulsion was prepared for microbiological challenge testing and predetermined admixtures of a methylol compound and ipbc were added at various use levels . the emulsion thus prepared had the following composition : nonionic emulsion ( unpreserved control ) phase ingredient % wt . a water 69 . 80 a carbomer 10 . 00 b octyl palmitate 5 . 00 b cetearyl alcohol and ceteareth - 20 2 . 00 b glyceryl stearate and laureth - 23 2 . 50 b mineral oil 5 . 00 c triethanolamine ( 99 %) 0 . 20 d preservative 0 . 00 e hydrolyzed collagen 0 . 50 e water 5 . 00 total 100 . 00 standard screening emulsions % wt . phase a stearic acid 5 . 00 mineral oil 2 . 50 cetyl alcohol 1 . 00 lareth - 5 and ceteth - 5 and 0 . 50 oleth - 5 and steareth - 5 glycerol monostearate and 1 . 50 polyoxyethylene stearate phase b deionized water 88 . 0 triethanolamine 99 % 1 . 00 citric acid 30 % aqueous solution 0 . 60 preservative admixture qs to prepare the emulsion , phases a and b were heated separately to 75 °- 80 ° c . phase a then was added to phase b with mixing . the mixture then was cooled to 55 ″- 60 ° c . at this point the desired amount of the preservative admixture was added and the product was cooled to 50 ° c . while stirring . the citric acid solution then was added to adjust the ph and the mixture was stirred until a temperature of 30 ° c . was reached . the challenge tests were carried out using the following microorganisms : sa , ecoli , psa , pc , an and can , in this manner . 50 g aliquots of the test emulsion containing various amounts of the preservative admixture were inoculated with approximately 10 7 - 10 8 of the challenge organisms . the test samples then were stirred to disperse the challenge inoculum . the samples were incubated and assayed at 48 hours , 7 , 14 , 21 and 28 days . the assays were performed on 1 g of the test sample by serially diluting 10 1 to 10 6 of the original concentration . the plating medium for bacteria was letheen agar and for fungi it was low ph mycophil agar with tween 20 . each plated sample was incubated for 48 hours at 37 ° c . for bacteria , 5 days at 25 ° c . for mold , and 3 days at 25 ° c . for fungi . after incubation , readings of the number of colonies per milliliter ( cfu / ml ) were made . at 21 days the test product was reinoculated with half of the original inoculum . the data is presented in tables 3 - 11 below . [ 0064 ] table 3 comparison of activity of germall iii to germall ii and 115 ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days germall ii 1000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 160 , 000 78 , 000 63 , 000 260 , 000 210 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 1000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 160 , 000 380 , 000 380 , 000 810 , 000 640 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall 115 2000 ppm sa 3000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 490 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 230 , 000 2 , 000 , 000 650 , 000 1 , 500 , 000 1 , 200 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 2000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 150 9 , 600 48 , 900 490 , 000 210 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 2000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 6000 195 , 000 460 , 000 690 , 000 1 , 070 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa 2 , 100 , 000 57 , 000 90 & lt ; 10 68 , 000 ec 37 , 000 96 , 000 96 , 000 43 , 000 790 , 000 psa 70 4600 500 10 , 100 170 , 000 bc 2 , 100 , 000 860 , 000 1 , 520 , 000 3 , 520 , 000 & gt ; 10 e6 can 1 , 100 , 000 168 , 000 67 , 000 270 , 000 460 , 000 an 700 , 000 56 , 000 44 , 000 190 , 000 320 , 000 [ 0065 ] table 4 comparison of activity of germall iii to germall ii and 115 ( nonionic emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days germall iii 2000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 820 , 000 1 , 680 , 000 1 , 350 , 000 700 , 000 & gt ; 1e6 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 2000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 320 , 000 720 , 000 650 , 000 730 , 000 & gt ; 1e6 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall 115 2000 ppm sa 1 , 500 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 52 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & gt ; 1e6 & gt ; 1e6 & gt ; 1e6 700 , 000 & gt ; 1e6 an & lt ; 10 20 390 370 & gt ; 1e4 germall iii 4000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 24 , 000 & gt ; 1e6 & gt ; 1e6 730 , 000 & gt ; 1e6 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 4000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 50 10 , 000 620 , 000 460 , 000 & gt ; 1e6 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall 115 4000 ppm sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 1 , 500 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 1 , 060 , 000 1 , 000 , 000 & gt ; 1e6 & gt ; 1e6 & gt ; 1e6 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa & gt ; 1e6 6 , 300 & gt ; 1e4 & lt ; 10 & gt ; 1e4 ec & gt ; 1e6 900 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 20 , 000 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 500 , 000 510 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0066 ] table 5 comparison of activity of germall iii to germall ii and 115 ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days germall iii 250 ppm sa 69 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 11 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc 200 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 430 , 000 120 , 000 70 , 000 150 , 000 850 , 000 an 100 , 000 200 70 40 1 , 300 germall ii 250 ppm sa 55 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 5500 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 290 , 000 170 , 000 71 , 000 46 , 000 680 , 000 an 50 , 000 & lt ; 10 & lt ; 10 & lt ; 10 100 germall 115 250 ppm sa 117 , 000 30 & lt ; 10 & lt ; 10 1 , 500 ec 40 , 000 20 & lt ; 10 & lt ; 10 3600 psa & lt ; 10 320 & gt ; 1e4 & gt ; 1e6 & gt ; 1e6 bc 11 , 000 & gt ; 1e6 & gt ; 1e6 & gt ; 1e6 & gt ; 1e6 can 1 , 090 , 000 270 , 000 1 , 120 , 000 770 , 000 & gt ; 1e6 an 90 , 000 20 , 000 20 , 000 29 , 000 300 , 000 germall iii 500 ppm sa 38 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 18 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 100 , 000 210 , 000 310 , 000 270 , 000 & gt ; 1e6 an 9000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 500 ppm sa 17 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 610 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 170 , 000 100 , 000 90 , 000 320 , 000 930 , 000 an 40 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall 115 500 ppm sa 140 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec 24 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 290 , 000 760 , 000 790 , 000 1 , 210 , 000 & gt ; 1e6 an 130 , 000 1 , 000 40 290 80 , 000 unpreserved 0 sa & gt ; 1e6 34 , 000 6 , 800 20 & gt ; 1e4 ec 18 , 000 4 , 900 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 50 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can 970 , 000 270 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 150 , 000 280 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0067 ] table 6 comparison of activity of germall plus and germall iii / ipbc ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days germall plus sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 1980 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 20 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 1980 sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 20 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 100 germall iii 1960 sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 40 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved sa 580 , 000 3200 180 & lt ; 10 & gt ; 1e4 ec 5 , 200 70 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 18 , 000 40 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can & gt ; 1e6 200 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 210 , 000 270 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0068 ] table 7 comparison of activity of liquid germall plus and germall iii / ipbc - liq ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days liqgermplus sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 790 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 8 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liqgermplus sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 1580 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 20 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 100 germall iii 790 sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 26 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 1580 sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 20 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa 580 , 000 3200 180 & lt ; 10 & gt ; 1e4 ec 5200 70 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 18 , 000 40 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can & gt ; 1e6 200 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 210 , 000 270 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0069 ] table 8 comparison of activity of germall plus and germall iii / ipbc ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days germall plus sa 42 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 495 ec 40 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 5 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 48 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an 100 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall plus sa 300 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 990 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 495 sa 46 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 5 ec 25 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 11 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 990 sa 24 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 10 ec 1 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa 19 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & gt ; 1e6 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 2 , 500 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 490 sa 23 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 10 ec 900 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa 18 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & gt ; 1e6 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 2800 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 980 sa 2 , 700 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 20 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa & gt ; 1e6 54 , 000 4 , 400 20 & gt ; 1e4 ec 80 , 000 67 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 2 , 000 4200 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can 990 , 000 320 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 380 , 000 170 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0070 ] table 9 comparison of activity of liquid germall plus and germall 111 / 0 . 5 % or 0 . 8 % ipbc ( screening emulsion ) organ - preservative conc . ism 48 hrs 7 days 14 days 21 days 28 days liqgermplus sa 110 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 195 ec 2 , 600 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 2 . 5 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 240 , 000 120 & lt ; 10 & lt ; 10 & gt ; 1e4 an 230 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liqgermplus sa 2 , 800 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall ii 390 ec 1100 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 5 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 11 , 000 & lt ; 10 & lt ; 10 & lt ; 10 20 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 100 germall iii 195 sa 260 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 2 . 5 ec 4 , 300 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 150 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & gt ; 1e4 an 200 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 390 sa 170 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 5 ec 2 , 500 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 50 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & gt ; 1e4 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 195 sa 70 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 4 ec 1400 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 41 , 000 & lt ; 10 & lt ; 10 & lt ; 10 40 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germall iii 390 sa 76 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ipbc 8 ec 3 , 400 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 liquid psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 14 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa & gt ; 1e6 54 , 000 4 , 400 20 & gt ; 1e4 ec 80 , 000 67 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 2 , 000 4200 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can 990 , 000 320 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 380 , 000 170 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0071 ] table 10 comparison of activity of germaben ii and germaben iii ( screening emulsion ) use organ - preservative level ism 8 hrs 7 days 14 days 21 days 28 days germaben ii 0 . 30 % sa 480 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 20 , 000 100 2 , 600 380 , 000 380 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germaben ii 0 . 75 % sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 100 germaben iii 0 . 30 % sa 7 , 000 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 14 , 000 120 & gt ; 1e4 470 , 000 190 , 000 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germaben iii 0 . 75 % sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 5 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 unpreserved 0 sa & gt ; 1e6 46 , 000 & gt ; 1e4 60 & gt ; 1e4 ec & gt ; 1e6 170 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 psa 690 24000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 bc & gt ; 1e6 & gt ; 1e6 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 can 440 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 an 87 , 000 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 & gt ; 1e4 [ 0072 ] table 11 comparison of activity of germaben iie and germaben iiie ( screening emulsion ) use organ - preservative level ism 48 hrs 7 days 14 days 21 days 28 days germaben iie 0 . 30 % sa 580 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 1 , 600 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germaben iie 0 . 75 % sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germaben iiie 0 . 30 % sa 270 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can 4 , 000 & lt ; 10 & lt ; 10 & lt ; 10 90 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 germaben iiie 0 . 75 % sa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 ec & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 psa & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 bc & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 can & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 an & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 & lt ; 10 the 28 day challenge results reported in tables 3 - 11 above demonstrate the effectiveness of the preservative composition of the invention in a use emulsion composition against a wide range of bacteria and fungi organisms . while the invention has been described with particular reference to certain embodiments thereof , it will be understood that changes and modifications may be made which are within the skill of the art . accordingly , it is intended to be bound only by the following claims , in which :

this invention relates to a reaction product of allantoin and formaldehyde made in a molar ratio of about 1 : 2 . 75 - 1 : 3 . 25 , preferably 1 : 3 , respectively , preferably under controlled ph and temperature conditions , which product contains free formaldehyde , and methylene diol of about 580 - 1385 ppm , preferably at a ph of 7 . 2 , with advantageous long - lasting , anti - microbial properties , particularly against the organism b . cepacia , and in combination products with parabens and iodopropynyl butyl carbamate .

during an infectious event , the hcv genome is first translated into a precursor polyprotein of about 3000 amino acids . this polyprotein then undergoes post - translational cleavages to give various precursors and mature viral proteins . the structural proteins of hcv are located in the n - terminal region of the polyprotein . as shown in fig1 they are more particularly the capsid or core protein ( c ), and the envelope proteins e1 and e2 , which are present in the following order : nh2 - c - e1 - e2 . this portion is cleaved by the host cell proteases . the numbering of the amino acids of the polyprotein as well as of its derivatives , which is adopted here after , is that commonly used and in particular presented by choo et al ., pnas [ vol . 88 : p . 2451 ( 1991 )]. thus , the c protein corresponds to the amino acids at positions 1 to 191 of the polyprotein and the e1 protein to the amino acids at positions 192 to 380 . in the remainder of the text , it is appropriate to number the amino acids of the sequence of the e1 protein , from position 192 to position 380 , 381 , 382 or 383 . in the remainder of the text , for the sake of simplicity , reference is made solely to the c - terminal position 380 . the c protein derived from the direct cleavage of the polyprotein contains 191 amino acids . this c protein , also called c191 , may itself be truncated toward its c - terminal end by enzymatic cleavage to give a protein of 173 amino acids , called c173 . in the remainder of the text , the term “ c protein or polypeptide ” will preferably designate the c191 form . the c protein is a good vaccine candidate since it is of course a structural protein of the virus and since the region encoding this protein is relatively well conserved by the various hcv strains . it is known that a region of the c protein capable of generating a high antibody response corresponds to the first 120 amino acids ; the first 48 amino acids constituting the major antigenic domain . however , a major obstacle to its use as vaccine lies in the fact that this protein is capable of transactivating genes belonging to the host cell , in particular genes such as oncogenes , which may have , inter alia , the consequence of inducing a carcinogenesis event . indeed , it has in particular been shown that the c173 form was capable of translocation in the nucleus of the host cell and of transactivation . the region of the c protein responsible for the translocation in the nucleus and for the regulatory activity appears to be located in the n - terminal portion ( first 123 amino acids ). thus , the region of the c protein which is of interest from a vaccine point of view is , on the other hand , responsible for a toxic effect toward the host cell . to overcome this difficulty , a solution commonly envisaged in the scientific community would be to use a c191 protein whose cleavage site at position 173 / 174 would have been made inoperative by mutation . as will be seen below , such a protein nevertheless proves capable of regulatory activity , even if it is to a lesser degree . surprisingly , it has now been demonstrated that it was possible to abolish the regulatory activity of the c protein by modifying it and by combining it , under certain conditions , with the e1 protein . the present invention provides means for abolishing the regulatory activity by preventing the migration of the c protein into the nucleus . this migration no longer takes place in the presence of the e1 protein which possesses , inter alia , the property of becoming anchored in the cytoplasm , at the level of the endoplasmic reticulum , and which , unexpectedly , has the capacity to retain the c protein therein when certain conditions are met . the migration may be abolished by producing , for example , a fusion of the two proteins , cleavable or otherwise ; in the case where it is cleavable , the products generated should be capable of interacting with each other so that there is no leakage of one of them into the nucleus ; the complex formed by the product of cleavage being capable of becoming anchored in the cytoplasm . the equivalent of a cleavable peptide fusion is a mixture , in equimolar quantity , of the components constituting the fusion . ( a ) a first region corresponding to all or part of the c polypeptide of the hepatitis c virus ; and ( b ) a second region corresponding to all or part of the e1 polypeptide of said virus and , proves , as such or via its products of cleavage , incapable of regulatory activity toward one or more genes ; ( a ) of a first polypeptide containing a region which corresponds to all or part of the c polypeptide of hcv and ( b ) of a second polypeptide containing a region corresponding to all or part of the e1 polypeptide of hcv ; and which proves incapable of regulatory activity toward one or more genes ; or ( iii ) a dna molecule comprising a sequence encoding the polypeptide as described in ( i ) of the present claim , placed under the control of elements necessary for its expression in a mammalian cell ; and according to another aspect of the invention , the subject of the invention is also a method for the treatment or prevention of an infection induced by hcv according to which a pharmaceutical composition according to the invention is administered to a mammal , preferably a human , requiring such a treatment . “ polypeptide ” is understood to mean any chain of amino acids covalently linked to each other , regardless of the length of the chain and regardless of the post - translational modifications which may take place such as , for example , a lipidation . it is also possible to use the term protein interchangeably . “ c polypeptide of hcv ” is understood to mean in particular a c polypeptide which possesses the amino acid sequence as disclosed by choo et al . as well as any other c polypeptide obtained from any other strain and whose sequence could differ from that of choo et al . for example , it may represent the c polypeptides described by takeuchi k et al . [ nucleic acids research 18 : 4626 ( 1990 )], houghton m et al . [ hepatology 14 : 381 ( 1991 )], delisse et al . [ j . hepatology , 13 , suppl . 4 ( 1991 )], bukh j et al . [ pnas 91 : 8239 ( 1994 )] and hiroaki o et al . [ intervirology 37 : 68 ( 1994 )]. “ e1 polypeptide of hcv ” is understood to mean in particular an e1 polypeptide which possesses the amino acid sequence as disclosed by choo et al . as well as any other e1 polypeptide obtained from any other strain and whose sequence could differ from that of choo et al . for example , it may represent the e1 polypeptides described in hiroaki o et al . [ intervirology 37 : 68 ( 1994 )], grakoui et al . [ j . virol . 67 : 1385 ( 1993 )] and spaete et al . [ virology 188 : 819 ( 1992 )], matsumia et al . [ j . virol . 66 : 1425 ] or in kohara et al . [ j . gen . virol . 73 : 2313 ( 1992 )]. thus , the amino acid sequence of the c polypeptide and that of the e1 polypeptide of hcv may vary according to the viral strain , reflecting the phenomenon of allelic variance . for example , a virus is usually represented by a set of strains which differ from each other in minor allelic characteristics . a polypeptide which fulfills the same biological function in different strains may have an amino acid sequence which is not the same for all the strains . such an allelic variation is also found at the level of the dna . at the level of the amino acid sequence , the allelic differences may consist of one or more amino acid substitutions , deletions or additions which do not alter the biological function . as regards the polypeptide included in the pharmaceutical composition according to the invention , two cases must be envisaged : either the polypeptide is incapable of being cleaved by a protease in a mammalian cell , or it is susceptible to such a cleavage . when the polypeptide is incapable of being cleaved by a protease in a mammalian cell , it advantageously contains : ( a ) a first region corresponding at least to the portion of the c polypeptide of the hcv virus responsible for the regulatory activity of said c polypeptide toward one or more genes ; and ( b ) a second region corresponding at least to a portion of the e1 polypeptide of said virus responsible for the cytoplasmic anchorage of the e1 polypeptide . when the polypeptide is capable of being cleaved by a protease in a mammalian cell , it advantageously contains : ( a ) a first region corresponding at least to a portion of the c polypeptide of hcv responsible for the regulatory activity of said c polypeptide toward one or more genes and to the portion of said c polypeptide responsible for the interaction of said c polypeptide with the e1 polypeptide of said virus ; and ( b ) a second region corresponding at least to a portion of the e1 polypeptide of said virus responsible for the interaction of the e1 polypeptide with the c polypeptide of said virus and to a portion of the e1 polypeptide of said virus responsible for the cytoplasmic anchorage of the e1 polypeptide . “ portion of the c polypeptide of hcv responsible for the regulatory activity of said c polypeptide toward one or more genes ” is understood to mean in particular any portion of the c polypeptide of hcv capable of activating , transactivating or suppressing the transcription or the expression of any gene , according to any mechanism . this gene may be a eukaryotic gene , a viral gene , an oncogene or a protooncogene . a portion of the c polypeptide of hcv responsible for the regulatory activity of said polypeptide may in particular correspond to the amino acids at positions 38 to 43 , 58 to 64 , 66 to 71 , 6 to 23 , 39 to 74 , 99 to 102 , 101 to 121 , 101 to 122 , 58 to 121 , 1 to 120 , 1 to 121 , 1 to 122 , 1 to 123 or 1 to 173 . preferably , a portion of the c polypeptide of hcv responsible for the regulatory activity may be a portion of the c polypeptide ranging from the amino acid at position 1 to the amino acid in one of positions 48 to 191 . for this purpose , one of positions 48 to 191 may be for example position 119 , 120 , 121 , 123 and 173 . a portion of the c polypeptide of hcv responsible for the interaction of said c polypeptide with the e1 protein of hcv may in particular correspond to the amino acids at positions 151 to 173 or at positions 173 to 191 of the c polypeptide of hcv . a portion of the e1 polypeptide of hcv responsible for the cytoplasmic anchorage of the e1 polypeptide may be a hydrophobic domain of the e1 polypeptide . such hydrophobic domains are for example located at positions 262 to 291 , 370 to 380 and 330 to 380 of the e1 polypeptide . a portion of the e1 polypeptide of hcv responsible for the interaction of the c polypeptide with the e1 protein may be in particular the c - terminal domain of the e1 polypeptide , preferably the domain at positions 330 to 380 or at positions 370 to 380 . in a polypeptide useful for the purposes of the present invention , the first region may be located on the n - or c - terminal side of the polypeptide , advantageously on the n - terminal side ; likewise , the second region may be located on the c - or n - terminal side , advantageously on the c - terminal side . according to a preferred mode , the c - terminal end of the first region may be fused by peptide bonding to the n - terminal end of the second region . when the polypeptide contained in the pharmaceutical composition according to the invention comprises the region corresponding at least to the amino acids at positions 172 to 175 of the c polypeptide of hcv , this polypeptide advantageously contains a mutation making the cleavage site at position 173 / 174 inoperative . according to a preferred mode , such a mutation is a point mutation , carried out in one of positions 172 to 175 . it may be obtained , for example , by deletion , addition or substitution of one or more amino acids , in particular by deletion , addition or substitution of one or more amino acid at positions 172 to 175 . preferably the mutation will be produced by substitution of one or two amino acids ; a double mutation by substitution being most particularly preferred . according to a particular example , the residue naturally existing at position 173 ( serine ) may be in particular substituted by the methionine residue and the residue naturally existing at position 173 ( phenylalanine ) may be substituted in particular by the leucine residue . in general , it is within the capability of persons skilled in the art to produce one or more mutations capable of making inoperative the cleavage site at position 173 / 174 of the c polypeptide of hcv . when the polypeptide contained in the pharmaceutical composition according to the invention comprises the region corresponding at least to the amino acids at positions 190 to 193 of the hcv polyprotein , this polypeptide advantageously contains a mutation making inoperative the cleavage site at position 191 / 192 of the hcv polyprotein . according to a preferred mode , such a mutation is a point mutation produced in one of positions 190 to 193 . it may be obtained , for example , by deletion , addition or substitution of one or more amino acids , in particular by deletion , addition or substitution of one or more amino acids at positions 190 to 193 . preferably , the mutation will be produced by substitution of one or two amino acids , a double mutation by substitution being most particularly preferred . according to a specific example , the residue naturally existing at position 191 ( alanine ) may in particular be substituted by the valine residue and the residue naturally existing at position 192 ( tyrosine ) may in particular be substituted by the asparagine residue . in general , it is within the capability of persons skilled in the art to produce one or more mutations capable of making inoperative the cleavage site at position 191 / 192 . when the polypeptide useful for the purposes of the present invention comprises both the region corresponding at least to amino acids 190 to 193 of the hcv polyprotein and the region corresponding at least to amino acids 172 to 175 of the c polypeptide of hcv , only one of the two cleavage sites 191 / 192 and 173 / 174 can be made inoperative , preferably both will be made inoperative . when only the site 173 / 174 is made inoperative , the polypeptide is capable of being cleaved and in this particular case , it is necessary that this polypeptide possesses a first region which corresponds , inter alia , to the portion of the c polypeptide responsible for the interaction of said polypeptide with the e1 polypeptide and a second region which corresponds , inter alia , to the portion of the e1 polypeptide responsible for the interaction of said polypeptide with the c polypeptide . when a polypeptide useful for the purposes of the present invention is incapable of being cleaved by a protease , it may contain a cleavage site on the condition , however , that this cleavage site is not functional . for example , in the particular case of a polypeptide consisting of the c191 polypeptide fused with the e1 polypeptide and containing a mutation making inoperative the cleavage site at position 191 / 192 , the cleavage site at position 173 / 174 may not be mutated ; however , it will not be , or will be only slightly , functional , insofar as the cleavage at position 191 / 192 is no longer possible . indeed , it is known that the cleavage at position 191 / 192 must be carried out for the cleavage at position 173 / 174 to take place . according to a specific mode , a polypeptide useful for the purposes of the present invention is incapable of being cleaved by a protease and contains : ( a ) a first region which substantially corresponds to the domain of the c polypeptide ranging from the amino acid at position 1 to the amino acid in one of positions 120 to 173 , and ( b ) a second region which substantially corresponds to a domain of the e1 polypeptide containing at least one hydrophobic region , for example to the domain of the e1 polypeptide ranging from the amino acid at position 192 to the amino acid at position 380 , or from the amino acid at position 330 to the amino acid at position 380 , or from the amino acid at position 260 to the amino acid at position 290 , or from the amino acid at position 260 to the amino acid at position 380 . according to another particular mode , a polypeptide useful for the purposes of the present invention is incapable of being cleaved by a protease and contains : ( a ) a first region which substantially corresponds to the domain of the c polypeptide ranging from the amino acid at position 1 to the amino acid in one of positions 120 to 191 , and ( b ) a second region which substantially corresponds to a domain of the e1 polypeptide containing at least one hydrophobic region , for example to the domain of the e1 polypeptide ranging from the amino acid at position 192 to the amino acid at position 380 , or from the amino acid at position 330 to the amino acid at position 380 , or from the amino acid at position 260 to the amino acid at position 290 , or from the amino acid at position 260 to the amino acid at position 380 ; on the condition that said polypeptide does not contain a cleavage site 191 / 192 or alternatively when the cleavage site is reconstituted , then a mutation is introduced in order to make it inoperative . advantageously , the first region of the polypeptide useful for the purposes of the present invention corresponds to the amino acids at positions 1 to 191 of the c polypeptide of hcv and / or the second region of this polypeptide corresponds at least to the amino acids at positions 192 to 380 of the e1 polypeptide or hcv . in a particularly preferred manner , the first and second regions are as defined above in this same paragraph , the amino acid at position 191 being fused by peptide bonding to the amino acid at position 192 . according to a particular mode , the polypeptide consists of the first and second regions as defined above in this same paragraph . when the polypeptide useful for the purposes of the present invention is as described in the preceding paragraph , it imperatively contains a mutation making inoperative the cleavage site at position 191 / 192 or at position 173 / 174 . preferably , the two cleavage sites are made inoperative . a mixture useful for the purposes of the present invention advantageously comprises : ( a ) a first polypeptide containing a region which corresponds at least to the portion of the c polypeptide of the hcv virus responsible for the regulatory activity of said c polypeptide toward one or more genes and to the portion of said c polypeptide responsible for the interaction of said c polypeptide with the e1 polypeptide of said virus , and ( b ) a second polypeptide containing a region corresponding to a portion of the e1 polypeptide of said virus responsible for the interaction of the e1 polypeptide with the c polypeptide of said virus and to a portion of the e1 polypeptide of said virus responsible for the cytoplasmic anchorage of the e1 polypeptide . the portions of the c and e1 polypeptides responsible for the properties listed in points ( a ) and ( b ) of the preceding paragraph may be as described above for the fusion polypeptide . preferably , the first polypeptide of the mixture contains and in a most particularly preferred manner consists of a region corresponding to the amino acids at positions 1 to 191 of the c polypeptide ( c191 ) of hcv . in the latter case , the cleavage site at position 173 / 174 must be made inoperative by mutation . this mutation may be produced as described above for the fusion polypeptide . preferably , the second polypeptide of the mixture contains and in a most particularly preferred manner consists of a region corresponding to the amino acids at positions 192 to 380 of the e1 polypeptide of hcv . for the purposes of the present invention , a dna molecule may be a simple linear dna fragment , or alternatively a plasmid or alternatively a viral vector such as a pox vector . a polypeptide , a mixture or a molecule of dna as described in the present application are of a most special interest when they are used for the manufacture of a medicament intended for the treatment or prevention of infections induced by hcv . they are in particular useful in the immunotherapy of infections induced by hcv , most particularly a dna molecule . finally , the invention relates to a method for inducing an immune response toward hcv in a mammal , according to which an immunologically effective quantity of a composition according to the invention is administered to said mammal in order to develop an immune response . the invention also relates to a method for the prevention or treatment of an infection induced by hcv , according to which a prophylactically or therapeutically effective quantity of a composition according to the invention is administered to an individual . the methods and the pharmaceutical compositions according to the invention can treat or prevent hcv infections and consequently hepatic diseases associated with such infections . they are in particular persistent chronic hepatitis , active chronic hepatitis , cirrhosis of the liver and hepatocarcinomas . a composition according to the invention may be administered by any conventional route used in the field of vaccines , in particular by the parenteral ( e . g . subcutaneous , intradermal , intramuscular , intravenous or intraperitoneal ) route . the choice of the route of administration depends on a number of parameters such as the nature of the active principle , polypeptide or dna molecule , the adjuvant combined with the polypeptide or with the dna molecule . a composition according to the invention may comprise , in addition to a polypeptide or a mixture of polypeptides useful for the purposes of the present invention , at least one other hcv antigen such as the e2 protein or alternatively such as a nonstructural protein ns1 , ns2 , ns3 , ns4 or ns5 , or a subunit , fragment , homolog , mutant or derivative of these antigens . a polypeptide , a mixture or a molecule of dna useful for the purposes of the present invention may be formulated in or with liposomes , preferably neutral or anionic liposomes , microspheres iscoms or virus - like particles ( vlps ), in order to promote the screening of the protein or of the polypeptide or to increase the immune response . persons skilled in the art have these compounds available without difficulty ; for example see liposomes : a practical approach . rrc new ed , irl press ( 1990 ). adjuvants other than liposomes may also be used . a large number are known to persons skilled in the art . such adjuvants are identified by references below : for parenteral administration , there may be mentioned in particular aluminum compounds such as aluminum hydroxide , aluminum phosphate and aluminum hydroxyphosphate . the antigen may be absorbed or precipitated on an aluminum compound according to standard methods . other adjuvants useful for parenteral administration include in particular polyphosphazene ( wo 95 / 2415 ), dc - chol ( 3 - beta -[ n -( n ′, n ′- dimethylaminomethane ) carbamoyl ] cholesterol ) ( u . s . pat . no . 5 , 283 , 185 and wo 96 / 14831 ), qs - 21 ( wo 88 / 9336 ) and ribi from immunochem ( hamilton , mont .). the administration may take place in a single dose or in a dose repeated once or several times after a certain period . the appropriate dosage varies according to various parameters , for example the individual treated ( adult or child ), the vaccinal antigen itself , the mode and frequency of administration , the presence or absence of adjuvant and , if present , the type of adjuvant and the desired effect ( e . g . protection or treatment ), as will be determined by persons skilled in the art . a composition according to the invention may be manufactured conventionally . in particular , a polypeptide , a mixture or a molecule of dna contained in the composition according to the invention is combined with a pharmaceutically acceptable diluent or carrier , e . g . water or a saline solution such as phosphate - buffered saline ( pbs ). in general , the diluent or the carrier is selected on the basis of the mode and route of administration and of standard pharmaceutical practices . pharmaceutically acceptable diluents and carriers as well as all that is necessary for their use in pharmaceutical formulations are described in remington &# 39 ; s pharmaceutical sciences , a standard reference text in this field and in usp / np . the constructs called prc / e1 , prc / ce1m1 , prc / ce1m2 and prc / ce1m1m2 ( also call prc / ce1dm ), prc / c191m1 and prc / c173 , which are used below in example 2 , have been described in : liu q et al ., j . virol . 71 : 657 ( 1997 ). the inserts used are represented in fig2 . all the constructs are produced in the vector prc which is obtained from invitrogen ( ref : v780 - 20 ). the vector prc carries the ampicillin gene and allows the expression of inserts under the control of a cmv promoter . mutations called m1 and m2 are present in the constructs prc / c191m1 , prc / ce1m1 , prc / ce1m2 and prc / ce1m1m2 . they were generated by site - directed mutagenesis performed by pcr . the mutation called m1 corresponds to the replacement of the amino acids serine 173 and phe 174 of the c protein with the amino acids methionine and leucine , respectively . the mutation called m2 corresponds to the replacement of the amino acids alanine 191 and tyrosine 192 of the ce1 protein with the amino acids valine and asparagine , respectively . the plasmids expressing the reporter genes for luciferase and for β - galactosidase were constructed by modifying the vector puc 18 ( appligene ; ref : 161131 ). the expression of the genes is under the control of the immediate - early promoter 1 ( ie1 ) of the human cmv . sequences derived from the 3 ′ region of the bovine gene for the growth hormone were moreover added in the 3 ′ of the genes in order to stabilize the mrnas . these plasmids carry more than one ampicillin gene . cho - k1 cells ( atcc ccl 61 ) were stored in α - mem medium [ nature 230 : 310 ( 1971 )], supplemented with 10 % foetal calf serum ( fcs ) ( hyclone , ref : a1115 - l ) and 20 % dimethyl sulfoxide ( dmso ) in liquid nitrogen . these cells are cultured under humid atmosphere at 37 ° c . with 5 % co 2 and 95 % air . to carry out subcultures , the medium removed and the cellular lawn is rinsed with 5 ml of phosphate buffer ( pbs ). the supernatant is then removed before addition of 1 . 5 ml of trypsine per 75 cm 2 flask ( trypsine at 0 . 025 %). after incubating for 10 min in an incubator at 37 ° c ., the reaction is stopped by addition of 10 ml of α - mem medium containing 10 % fcs . the cells are counted on a malassez cell after a one - half dilution in 0 . 02 % trypan blue . 5 × 10 5 cells are then inoculated into dishes 6 cm in diameter with complete medium . the cho cells are then cotransfected with one of the recombinant plasmids ( phcv ) described above and a reporter plasmid ( pcmv ) which contains either the β - galactosidase gene under the control of the cmv promoter ( pcmv β - gal ) or the luciferase gene under the control of the cmv promoter ( pcmv luc ). for that , 5 μg of dna ( 4 . 5 μg of plasmid phcv / 0 . 5 μg of plasmid pcmv ) are diluted in 500 μl of opti - mem medium ( gibco ), and mixed with 14 μl of lipofectamine diluted in 500 μl of the same medium . the two solutions are mixed and incubated for 20 min at room temperature in order to allow the formation of the dna - liposome complexes . the dna liposome mixture diluted with 2 ml of opti - mem is then added to the cells after removing the culture medium and rinsing in pbs . after incubating for 5 hours , the medium is again changed and 48 h after the transfection , it is then possible to test for the transient expression of the recombinant genes . the transfected cells are lysed with the aid of the reagent “ luciferase cell culture lysis reagent ” ( promega , luciferase assay system ). 100 μl of substrate are added to 100 μl of cell supernatant , directly by the bioluminometer injector ( lumat lb / 9501 / 16 from berthold ) which measures the quantity of light emitted ( relative light units ) for 10 seconds . the quantity of light emitted is then converted to nanograms of proteins per ml of cell lysate , by comparing with a standard curve established with the aid of purified luciferase . the results , which are presented in fig2 show that a point mutation at the amino acid 191 in the construct ce1m2 abolishes the transactivating effect . a point mutation at the amino acid 173 ( in the construct ce1m1 ) abolishes the transactivating effect only in the case where c is fused with e1 . a double mutation at the amino acids 173 and 191 abolishes the transactivating effect . the teachings of all the articles , patents , and patent applications cited herein are incorporated by reference in their entirety . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .

the invention concerns a pharmaceutical composition for treating or preventing c hepatitis , induced infections , which in a preferred embodiment , comprises a main active principle , a fusion polypeptide , including the hcv capsid polypeptide and polypeptide coat and in which at least one cleavage site 173 / 174 and 191 / 192 has been made inoperative by mutation ; an equimolar mixture of the c191 polypeptide of which the cleavage site 173 / 174 has been made inoperative and of the e1 polypeptide ; or a dna molecule coding for this fusion polypeptide . products to are characterized in that the c191 element is incapable of regulating the functioning of the genes , in particular of causing them to interact . such a composition can also include any form equivalent to the products described above .

fig1 and 2 illustrate a drug delivery system 100 according to an exemplary embodiment . drug delivery system 100 includes a drug delivery device 102 , a remote controller 104 and an optional processing station 106 . drug delivery device 102 is configured to transmit and receive data to and from remote controller 104 by , for example , radio frequency communication 108 . drug delivery device 102 may also function as a stand - alone device with its own built in controller . in one embodiment , drug delivery device 102 is an insulin infusion device and remote controller 104 is a hand - held blood glucose metering system . in such an embodiment , data transmitted from drug delivery device 102 to remote controller 104 may include insulin delivery data . data transmitted from remote controller 104 to drug delivery device 102 may include glucose test results and a food database to aid in calculating the amount of insulin to be delivered by drug delivery device 102 . in another embodiment ( not shown ), remote controller 104 is a continuous metering system for detecting glucose in blood or interstitial fluid . drug delivery device 102 may also be configured for bi - directional wireless communication with processing station through , for example , an infrared signal 110 . remote controller 104 and processing station 106 may be configured for bi - directional wired communication through , for example , a universal serial bus ( usb ) cable 112 . processing station 106 may be used , for example , to download upgraded software to drug delivery device 102 and to process information from drug delivery device 102 . examples of processing station 106 may include , but are not limited to , a personal or networked computer , a personal digital assistant or a mobile telephone . referring to fig2 , drug delivery device 102 includes processing electronics 114 including a central processing unit and memory elements for storing control programs and operation data , a radio frequency module 116 for sending and receiving communication signals ( i . e ., messages ) to / from remote controller 104 , a display 118 for providing operational information to the user , a plurality of navigational buttons 120 for the user to input information , a battery 122 for providing power to the system , an alarm 124 for providing feedback to the user , a vibrator 126 for providing feedback to the user , a drug delivery mechanism 128 ( e . g . an insulin pump and drive mechanism ) for forcing a drug from a drug reservoir 130 ( e . g ., an insulin cartridge ) through a side port 132 connected to an infusion set 134 and into the body of the user . as illustrated in fig3 , drug delivery device 102 further includes a first housing 136 , a second housing 138 , a backlight button 140 , an up button 142 , a drug reservoir cap 144 , a first primary vent 146 , a bolus button 148 , a down button 150 , a battery cap 152 with a second primary vent 154 , an ok button 156 and a display cover 158 . first housing 136 and second housing 138 are typically formed from a durable plastic material . referring to fig4 , 5 and 6 , first housing 136 is nested at least partially within second housing 138 and includes a grooved portion 159 that receives a tongue portion 160 of second housing 138 . first housing 136 houses drug reservoir 130 , drug delivery mechanism 128 , processing electronics 114 , battery 122 , and a transceiver 162 mounted on a first surface 163 of a circuit board 164 . drug reservoir 130 , drug delivery mechanism 128 with the electronics and battery 122 are each encased in sealed compartments in first housing 136 . in one embodiment , a drug delivery mechanism / electronics compartment 166 of drug delivery device 102 is located between a drug reservoir compartment 168 and a battery compartment 170 . located on a distal end 172 of first housing 136 , circuit board 164 is connected to a gear plate 174 in drug delivery mechanism 128 and is operatively connected to the main circuit board of drug delivery device 102 through a board connector 176 ( see fig4 and 5 ). transceiver 162 is also operatively connected to an antenna 178 in second housing 138 by at least one spring connector 180 ( e . g ., a pogo pin ). at least one spring connector 180 allows for ease of assembly of drug dispensing device . together , transceiver 162 mounted on circuit board 164 and antenna 178 form radio frequency module 116 ( see fig7 ). second housing 138 also includes vibrator 126 operatively connected to battery 122 by , for example , a spring clip 186 ( see fig6 ). referring to fig7 , 8 a and 8 b , antenna 178 includes a substrate 188 , a conductive trace 190 ( i . e ., the resonating portion ), and a signal feed region 192 . trace 190 is electrically connected to a first conductive pad 194 in signal feed region 192 at or adjacent to a first end 196 of substrate 188 . substrate 188 provides a support for trace 190 and is manufactured from a dielectric material or a flexible material . for example , a small fiberglass - based printed circuit board may be used . other examples of materials that may be used for substrate 188 include , but are not limited to , fr4 plastic , phenolic material and fiberglass reinforced teflon . the use of a thin substrate 188 provides the advantage of being deformable and easily mounted in place . trace 190 is formed from a conductive material such as , for example copper , brass , aluminum , silver or gold . trace 190 may be deposited onto substrate 188 using a technique known to those skilled in the art such as , but not limited to , photo - etching of a conductive material on a dielectric or insulated substrate , plating of a conductive material on a substrate , or adhering a conductive material , such as a thin plate of metal , on a substrate with adhesive . the length of trace 190 primarily determines the resonant frequency of antenna 178 . trace 190 is sized appropriately for a particular operating frequency . traces 190 used to form the antenna 178 are deposited to provide a conductive element that is approximately ¼ an effective wavelength ( λ ) for the frequency of interest . those skilled in the art will readily recognize the benefits of making the length slightly greater or less than λ / 4 , for purposes of matching the impedance to corresponding transmit or receive circuitry . in addition , connecting elements such as exposed cables , wires , or the spring connector 180 contribute to the overall length of antenna 178 , and are taken into account when choosing the dimensions of trace 190 . where antenna 178 is used with a wireless device capable of communicating at more than one frequency , the length of trace 190 is based on the relationship of the frequencies . that is , multiple frequencies can be accommodated provided they are related by fractions of a wavelength . for example , the λ / 4 length for one frequency corresponds to 3λ / 4 or λ / 2 for the second frequency . the width of trace 190 is less than a wavelength in the dielectric substrate material so that higher - order modes will not be excited . in the embodiment shown in fig7 and 8b , width of trace 190 is between about 0 . 5 to 2 . 0 millimeters , typically about 1 . 5 millimeters . in the subject invention , the length and width of trace 190 is sized so that antenna 178 is capable of receiving and transmitting signals having a frequency range between about 850 mhz and about 950 mhz . in one embodiment , antenna 178 may transmit and receive signals in the frequency range between about 869 . 70 mhz and about 870 mhz . in another embodiment , antenna 178 may transmit and receive signals in the frequency range between about 902 mhz and about 928 mhz . in another illustrative embodiment , the antenna 178 may transmit and / or receive at a first and second frequency range at the same time . illustratively , the first frequency range may comprise wavelengths of between about 869 . 70 mhz and about 870 mhz and the second frequency range may comprise wavelengths of between about 902 mhz and about 928 mhz the thickness of trace 190 is usually on the order of a small fraction of the wavelength , in order to minimize or prevent transverse currents or modes , and to maintain a minimal antenna 178 size ( i . e ., thickness ). the selected value is based on the bandwidth over which antenna 178 must operate . the total length of trace 190 is approximately λ / 4 , but it should be noted that trace 190 may be folded , bent , or otherwise redirected , to extend back along the direction it came so that the overall antenna 178 size is reduced . as shown in fig8 b , trace 190 extends along the length and edge of substrate 188 such that it is redirected back toward first conductive pad 194 . this allows antenna 178 to have a shorter overall length . the thin conductor dimensions combined with a relatively thin support substrate 188 and λ / 4 total length allows a reduction in the overall size of antenna 178 compared to conventional strip or patch antennas , making it more desirable for use in portable medical devices . in one embodiment , the length of antenna 178 is about 41 millimeters and the widest portion of antenna 178 is about 13 millimeters . as illustrated in fig7 and 8b , a first conductive pad 194 is positioned in signal feed region 192 and electrically coupled or connected to trace 190 . generally , first conductive pad 194 and trace 190 are formed from the same material , possibly as a single unified body or structure , using the same manufacturing technique , although this is not required . first conductive pad 194 simply needs to make good electrical contact with trace 190 for purposes of signal transfer without adversely impacting antenna impedance or performance . in the antenna embodiment illustrated in fig7 , 8 a and 8 b , which is a planar inverted - f antenna , trace 190 faces away from transceiver 162 such that substrate 188 is positioned between trace 190 and transceiver 162 . in this situation , first conductive pad 194 is positioned on the side of substrate 188 that does not readily accept a signal directly from transceiver 162 . thus , as shown in fig8 a , a second conductive pad 198 may be used on the opposing side of substrate 188 and conductive vias ( not shown ) may be used to transfer signals through substrate 188 . the use of first conductive pad 194 and second conductive pad 198 allows antenna 178 to be installed and operated in a manner that provides for convenient electrical connection and signal transfer through the at least one spring connector 180 ( e . g ., pogo pins ). this simplifies construction and manufacture of drug delivery device 102 by eliminating the need for manual installation of specialized connectors , or having to manually insert antenna 178 within a contact structure . to assemble radio frequency module , first housing 136 and second housing 138 are simply snap - fitted together ( e . g . tongue portion 160 of second housing 138 is fit into grooved portion 159 of first housing 136 ). to ensure a watertight fit , first housing 136 and second housing 138 may then be adhered together by adhesive . having spring connectors also eliminates the need for a separate antenna housing that would be attached ( e . g ., glued ) to drug delivery device 102 in an additional manufacturing step . because a separately attached antenna housing is not needed , a possible source of water ingress is eliminated . antenna 178 is mounted in drug delivery device 102 adjacent to transceiver 162 and is placed substantially parallel to the ground plane provided by circuit board 164 . second conductive pad 198 is positioned adjacent to and electrically coupled to circuit board 164 using at least one spring connector 180 . at least one spring connector 180 is mounted on circuit board 164 by , for example , soldering or conductive adhesives . as illustrated in fig7 and 9a , at least one spring connector 180 may be mounted near a first end 200 of circuit board 164 . at least one spring connector 180 may also be mounted near a first edge 202 of circuit board 164 or near a second edge 204 of circuit board 164 , depending on where antenna 178 is located in drug delivery device 102 ( see fig9 b and 9c ). generally , a distance d 1 between two spring connectors 180 is between about 2 . 5 millimeters and about 4 millimeters . a distance d 2 from two spring connectors to an edge of circuit board 164 parallel to a line through two spring connectors 180 is between about 1 . 5 millimeters and about 5 millimeters . a distance d 3 from a spring connector to an edge of circuit board 164 perpendicular to a line through two spring connectors 180 is between about 5 millimeters and about 13 millimeters . at least one spring connector 180 is electrically connected on one end to appropriate conductors or conductive vias to transfer signals to and from circuit board 164 . the other end of at least one spring connector 180 is generally free floating and extends from circuit board 164 toward contact pad of antenna 178 . at least one spring connector 180 may be formed from a metallic material such as copper or brass . as illustrated in fig4 and 6 , antenna 178 is sized to occupy the entire inner surface of a distal end of second housing 138 to maximize the signal transmitted and received . antenna 178 may be located on any inner surface of drug delivery device 102 as long as the signal transmitted and received is not blocked . in one embodiment , the location and size are such that the signal range of antenna 178 is about 3 meters when drug delivery device 102 is not held in the user &# 39 ; s hand and is about 1 meter when drug delivery device 102 is held in the user &# 39 ; s hand . the thickness of antenna 178 is such that length of drug delivery device 102 is kept to a minimum . in one embodiment , the thickness of antenna 178 is between about 0 . 6 and about 0 . 8 millimeters , typically about 0 . 76 millimeters , and the length of drug delivery device 102 is between about 7 and 9 centimeters , typically about 8 centimeters . at least one protrusion 206 on an inner surface of second housing 138 protrudes through at least one hole 208 in substrate 188 of antenna 178 . at least one protrusion 206 positions vibrator 126 above antenna 178 such that vibration generated by vibrator 126 does not interfere significantly with signals transmitted and received by antenna 178 . in one embodiment , antenna 178 is located between about 4 millimeters and about 7 millimeters ( typically about 5 millimeters ) from the bottom edge of vibrator 126 . at least one protrusion 206 serves as a conduit for vibration to be transferred to second housing 138 . at least one protrusion 206 also serves as a simple mounting mechanism for positioning antenna 178 within distal end of second housing 138 of drug delivery device 102 . an optional nodule 209 on the inner surface of the distal end of second housing 138 may also aid in positioning antenna within drug delivery device 102 . nodule 209 may protrude through a substrate opening 210 in antenna 178 . a half cradle 211 formed from a plurality of ribs 212 in second housing 138 also supports vibrator 126 and transfers vibration radially from vibrator 126 to second housing 138 without interfering significantly with signals transmitted and received by antenna 178 . first housing 136 also includes a plurality of vents with water impermeable membranes to protect the internal components of drug delivery device 102 from water damage during such user activities as , for example , swimming . the water impermeable membranes are also air permeable to ensure rapid pressure equilibration between the interior of drug delivery device 102 and atmosphere that could cause unexpected and undesirable delivery of a drug to the user . a rapid pressure change may occur , for example , when a user flies in an airplane . referring to fig1 , first primary vent 146 is located in first housing 136 near drug reservoir cap 144 and vents the drug reservoir compartment to atmosphere through a first opening 214 into drug reservoir compartment 168 . first primary vent 146 vents drug reservoir compartment 168 to atmosphere to ensure that there is no differential pressure between drug reservoir compartment 168 and atmosphere , which could result in unwanted dispensing of the drug from drug reservoir 130 . second primary vent 154 is located in battery cap 152 and vents battery compartment 170 to atmosphere . second primary vent 154 prevents uncontrolled pressure build up of gas in battery compartment 170 . for example , hydrogen gas resulting from a chemical reaction in battery 122 may build up in battery compartment 170 . a first secondary vent 216 is located between drug reservoir compartment 168 and drug delivery mechanism / electronics compartment 166 to equalize pressure inside drug delivery device 102 . first secondary vent 216 vents the inside of drug delivery device 102 through a second opening 218 into drug reservoir compartment 168 ( see fig1 ). a second secondary vent 220 is located in distal end of battery compartment 170 , i . e ., near the positive terminal . second secondary vent 220 provides a vent between battery compartment 170 and the drug delivery mechanism / electronics compartment 166 to equalize pressure inside drug delivery device 102 . redundancy created by the presence of first primary vent 146 , second primary vent 154 , first secondary vent 216 and second secondary vent 220 ensures venting and pressure equilibration of all drug delivery device compartments ( i . e ., drug delivery mechanism / electronics 166 , drug reservoir compartment 168 and battery compartment 170 ), even during abnormal situations such as occlusion of any of the primary or secondary vents . the water impermeable membrane ( e . g , a hydrophobic membrane ) included in all the primary and secondary vents is selected such that the water entry pressure exceeds a fluid pressure at a selected depth , i . e ., the depth to which the membrane can reasonably expect to be exposed upon immersion in water . for example , in the case in which a test pressure of 5 . 2 pounds per square inch ( psi ) is requested ( i . e ., water pressure at a depth of 12 feet below the surface ), a selected water entry pressure of approximately 10 to 15 psi provides an exemplary design margin . exemplary membrane materials include , but are not limited to , emflon ® and mupor ® polytetrafluoroethylene ( ptfe ). while embodiments of the present invention have been shown and described herein , it will be obvious to those skilled in the art that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will now occur to those skilled in the art without departing from the invention . it should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention . it is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby .

disclosed is a medical infusion device , such as an externally worn insulin pump , capable of being in remote communication with a controller or data acquisition unit such as a blood glucose meter . the disclosed medical infusion device includes a dual frequency antenna to facilitate communication with the remote device and the antenna is mounted using a spring - design that inhibits transmission of vibration to the antenna .

referring to fig1 , the underside of drawer 102 is shown . undermount drawer slide clip mounting apparatus 100 is mounted on the underside of the drawer adjacent drawer face 104 . the front mounted location allows for easy adjustment by hand without disengaging the drawer from the drawer slide assembly . the drawer slide assembly is comprised of three slidingly engaged rails as is common in the art . drawer rail 106 is removably engaged with mounting apparatus 100 and slidingly engaged with intermediate rail 108 . intermediate rail 108 is slidingly engaged with cabinet rail 110 ( fig6 a and 6b ). cabinet rail 110 is mounted to the cabinet carcass with conventional mounting hardware such as wood screws . drawer rail 106 includes tab 114 and is further fitted with shoe 112 . tab 114 defines slot 115 . both shoe 112 and tab 114 are positioned on the front end of drawer rail 106 . referring to fig2 and 3 , undermount drawer slide clip mounting apparatus 100 is comprised of base 202 slidingly engaged with bonnet 204 . base 202 is a generally flat , rectangular plate rigidly mounted to the underside of the drawer with convention mounting hardware such as wood screws through holes 212 and 213 . base 202 includes ends 208 and 210 . end 208 is mounted adjacent drawer face 104 . end 208 includes holes 214 and 215 . hole 214 passes completely though base 202 while hole 215 may or may not pass completely through . recess 218 is a rectangular shaped cutout beneath hole 215 . saddles 226 and 227 project from base 202 near the longitudinal midpoint of base 202 . bridge 220 extends from end 208 adjacent hole 215 , projects along an edge of base 202 , and reconnects to base 202 adjacent saddle 227 forming block 234 . bridge 220 includes teeth 230 and recess 232 . spindle 240 is a threaded shaft with knob 242 adjacent collar 250 on one end and barrel 244 on the opposite end . spindle 240 has threaded section 246 flanked by two bare sections 248 and 249 . bare sections 248 and 249 are seated in saddles 226 and 227 respectively . collar 250 is adjacent saddle 226 . barrel 244 is adjacent saddle 227 . height adjuster 252 is adjustably engaged with base 202 at bridge 220 . height adjuster 252 is comprised of arms 254 and 256 extending generally parallel to each other from ramp 258 . opposite ramp 258 , arm 254 includes hook 260 . opposite ramp 258 , arm 256 includes teeth 262 adjacent extension 264 . teeth 262 are sized to engage teeth 230 and hook 260 is sized to engage recess 218 . lever arm 228 is generally elbow shaped and comprised of strike 238 on one end and trigger 239 on an opposite end . pivot hole 236 is displaced between the ends at the elbow bend . lever arm 228 is pivotally connected between base 202 and bonnet 204 with screw 207 through pivot hole 236 . bonnet 204 is a generally flat , rectangular plate slidingly engaged with base 202 . screws 206 and 207 affix bonnet 204 to base 202 through oblong holes 222 and 224 respectively . stanchions 310 and 312 extend from bonnet 204 . each stanchion includes a hole to receive screws 206 and 207 . the generally rectangular , hollow shape of box 313 forms channel 314 adjacent stanchion 312 . one side wall of box 313 includes gap 315 . block 316 is positioned adjacent stanchion 310 and includes threaded slot 322 . the threads of threaded slot 322 are sized to engage threaded section 246 of spindle 240 . arm 318 extends from bonnet 204 and further includes slot 320 . the longitudinal axes of channel 314 and threaded slot 322 are generally parallel to each other and generally perpendicular to the longitudinal axis of slot 320 . in the preferred embodiment , stanchions 310 and 312 , box 313 , block 316 , and arm 318 are all integrally formed with bonnet 204 . catch 330 is sized to be slidably engaged with channel 314 . catch 330 includes notch 332 adjacent angled edge 333 on a first end and spring 334 on an opposite end . disposed between the two ends of catch 330 is slot 336 . slot 336 is sized to accommodate strike 238 of lever arm 228 . referring additionally to fig4 and 5 , depth adjuster 270 is comprised of housing 272 fitted with cover 274 . housing 272 has a generally rectangular shaped , hollow body including pivot hole 294 . stanchions 297 and 298 extend from one side of housing 272 . stanchion 298 includes a hole sized to receive screw 308 . adjacent pivot hole 294 is rib 296 . partially surrounding pivot hole 294 and integrally formed into opposing sidewalls of housing 272 are arcuate guides 306 . cover 274 is a z - shaped , generally rectangular plate releasably fitted to housing 272 . cover 274 includes pivot hole 280 and arcuate slot 282 . adjacent arcuate slot 282 , cover 274 further includes an arcuate strip of teeth 291 . lever 276 includes axel 284 on a first end and teeth 290 adjacent extension 292 on its opposite end . teeth 290 are sized to engage teeth 291 . lever 276 is pivotally engaged with housing 272 and cover 274 by axel 284 through pivot holes 294 and 280 . surrounding axel 284 is collar 286 . collar 286 is sized to rotate freely between arcuate guides 306 and further includes teeth 288 . plunger 278 has a hollow , t - shaped body where face 302 is positioned along the top of the “ t ”. plunger 278 further includes slot 304 sized to accommodate rib 296 of housing 272 and teeth 300 sized to engage teeth 288 of lever 276 . depth adjuster 270 is rigidly connected to base 202 by screw 308 through hole 214 and the hole in stanchion 298 . stanchion 297 is fitted to hole 215 . in the preferred embodiment , components of undermount drawer slide clip mounting apparatus 100 including base 202 , bonnet 204 , lever arm 228 , spindle 240 , height adjuster 252 , depth adjuster 270 , and catch 330 are manufactured of a molded plastic such as polystyrene , pvc ( polyvinyl chloride ), or nylon . in use , clip mounting apparatus 100 is affixed to the underside of the drawer , adjacent drawer face 104 , with screws through holes 212 and 213 . to releasably clip the drawer to drawer rail 106 , lever arm 228 is pivoted about pivot hole 236 by applying a force to trigger 239 in a direction generally parallel to the bottom surface of the drawer towards the drawer slide assembly . trigger 239 is sized and shaped to be manipulated by hand without tools . strike 238 projects through gap 315 , abuts catch 330 within slot 336 , and slides catch 330 within channel 314 against the bias of spring 334 . tab 114 of drawer rail 106 is slidingly inserted into slot 320 and the front end of drawer rail 106 slides over ramp 258 on height adjuster 252 . trigger 239 is released allowing notch 332 to pass through slot 115 and under shoe 112 . angled edge 333 assists in the alignment of notch 332 with slot 115 . to adjust the vertical position of the drawer relative to the cabinet carcass , a force is applied to extension 264 in a direction towards the bottom of the drawer . teeth 262 are released from their engagement with teeth 230 . as long as teeth 262 and teeth 230 are disengaged , height adjuster 252 is free to slide relative to base 202 in a direction generally parallel with the opening and closing direction of the drawer . sliding height adjuster 252 towards drawer rail 106 causes the front end of drawer rail 106 to move up ramp 258 and thus the drawer in an upward direction relative to the cabinet carcass . sliding height adjuster away from drawer rail 106 causes the front end of drawer rail 106 to move down ramp 258 and thus the drawer in a downward direction relative to the cabinet carcass . hook 260 engaged with recess 218 limits the sliding movement of height adjuster 252 and prevents height adjuster 252 from becoming disengaged with base 202 . once the desired drawer height is reached , the force on extension 264 is released and teeth 262 reengage teeth 230 . to adjust the horizontal position of the drawer relative to the cabinet carcass , a rotational force is applied to spindle 240 via knob 242 . during rotation , the spindle &# 39 ; s horizontal position relative to base 202 is prevented from changing by barrel 244 abutting saddle 227 and collar 250 abutting saddle 226 . threaded section 246 interacts with threaded slot 322 . as spindle 240 rotates , bonnet 204 moves horizontally with respect to base 202 . drawer rail 106 is releasably clipped to bonnet 204 via arm 318 and slot 320 . once the desired horizontal position is reached , rotation of spindle 240 is stopped . as shown in fig6 a and 6b , when the drawer is in a closed position , cabinet rail 110 abuts face 302 on plunger 278 . the position of plunger 278 and thus face 302 determines the depth of the drawer relative to the cabinet carcass . to adjust the depth the drawer closes to relative to the cabinet carcass , plunger 278 is extended from or retracted within housing 272 . as plunger 278 extends from housing 272 , the closed position of the drawer relative to the cabinet carcass is extended further out of the cabinet carcass . to extend plunger 278 out of housing 272 , a force is applied to extension 292 to release teeth 290 from engagement with teeth 291 . once the teeth are disengaged , lever 276 is pivoted about pivot hole 280 via axel 284 . rotation of collar 286 is confined by arcuate guides 306 . teeth 288 engaged with teeth 300 convert the rotational movement of lever 276 into linear movement of plunger 278 . movement of extension 292 from point 340 to point 342 translates into extending plunger 278 from housing 272 resulting in a closed position where the position of the drawer relative to the cabinet carcass is extended further out of the cabinet carcass . movement of extension 292 from point 342 to point 340 translates into retracting plunger 278 back into housing 272 resulting in a closed position where the position of the drawer relative to the cabinet carcass is retracted , or less extended out of the cabinet carcass . once the desired depth is achieved , the force on extension 292 is removed and teeth 290 reengage with teeth 291 . it is understood that extension 292 may also be positioned anywhere between points 340 and 342 along arcuate slot 282 to effect different drawer closing depths . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept . it is understood , therefore , that this disclosure is not limited to the particular embodiments herein , but it is intended to cover modifications within the spirit and scope of the present disclosure as defined by the appended claims .

an undermount drawer slide mounting clip releasably attaches a drawer to a drawer rail assembly mounted in a cabinet carcass . the apparatus is capable of effecting positional adjustments of the drawer in three directions without removing the drawer from the cabinet carcass . the apparatus is comprised of a body slidingly engaged with a bonnet . a trigger pivotally connected between the body and the bonnet . a spring loaded catch slidable within the bonnet and acted on by the trigger to releasably attach the apparatus to a drawer rail assembly . a threaded spindle rotates within the base and adjusts the horizontal position of the drawer . a ramp adjustably connected to the base adjusts the vertical position of the drawer . a plunger extends from a housing connected to the body and is adjacent the drawer rail assembly . a lever pivotable within the housing moves the plunger and adjusts the depth of the drawer .

the following description focuses on how the invention , in its various embodiments , may be used with an apple . its use , however , is not limited only to an apple , and persons of ordinary skill and manual dexterity should have no trouble in applying the tool and the method of using it to any other suitable fruit or vegetable that does not have a large seed in its middle and has a firm flesh . as best understood with reference to fig1 , the user should choose an apple 100 of a size that will allow it to be held comfortably in his or her hand while it is to be smoked . for convenience , it may initially be held firmly on a steady support surface such as a tabletop or even one of the seated user &# 39 ; s knees ( not shown for simplicity ). the front or tip end 202 of a blade element 200 ( described below in greater detail ) is then forcibly penetrated into an upper portion of the apple in a direction indicated by arrow “ p 1 ” and then turned around that direction as indicated by curved arrow “ t 1 ” to effect a substantially cylindrical cut without irregularly tearing up either the skin or the flesh of the apple . obviously , the penetration and cutting will be easy if the blade edge is sharp . however , to avoid injury to either the user , or to his or her clothing if the tool is carried in a pocket , it is best to make the edge thin without making it sharp enough to inflict unintentional cuts or scratches . a blade element having a somewhat rounded tip and made of a metal such as stainless steel , with an edge thickness preferably not more that about 1 / 32 nd of an inch should be quite satisfactory . with a little manipulation of the blade element the flesh of the apple can be broken at the bottom of the cylindrical cut and a piece 102 removed as indicated by the sequential arrows “ r 1 ”. with a little experience , the user should be able to thus create a bowl 104 of suitable shape and size to contain and retain the desired quantity of smoking material , e . g ., pipe tobacco . fig5 shows other details in a larger perspective view of blade element 200 , particularly a pair of elongate edges 204 a , 204 b on opposite sides . these , as best seen in fig2 , serve as cutting edges to form a cylindrical blind bore 106 by forcible insertion of the tip end 202 , preferably in the axial plane of the apple on the opposite side relative to the bowl 104 , along a direction indicated by arrow “ p 2 ”, followed by a turning about that direction as indicated by arrow “ t 2 ”. with a little manipulation , the user can thus break out and extract a cylindrical piece 108 of the apple as indicated by sequential arrows “ r 2 ”. as best seen in fig7 , in cross - sectional view at transverse section vii - vii in fig5 , the shape and size of blade element 200 are selected to facilitate the formation of a correspondingly sized cylindrical blind bore 106 . bore 106 is preferably made of a diameter in the range of about 0 . 3 - 0 . 5 inch although this is not critical and may be freely selected by the user . blade element 200 if made of a metal can be modified with only a little effort to adjust the separation of edges 204 a , 204 b to determine the diameter of bore 106 . it may , alternatively , be made of any other stiff and durable plastics material , e . g ., nylon , or even a composite . at the proximate end of blade element 200 may be affixed a retention element 206 to facilitate movable joining thereat to other elements as described below . the specific structure of this portion of blade element 200 is not critical , and even a simple aperture at the proximate end of blade element 202 may suffice to serve this function . as best seen in fig6 , in the longitudinal cross - sectional view at section vi - vi in fig5 , the tip end 202 may be curved in slightly to facilitate the break - out of portion 108 of the apple to create blind bore 106 . this inward curve should also help in extraction and removal of portion 102 during creation of bowl 104 in the apple . as best seen in fig3 , an elongate pin element 300 , preferably securely connected movably to blade element 200 , is now employed to form a relatively small diameter hole 110 extending from the bottom of bowl 104 toward and into cylindrical bore 106 near its blind end . this establishes communication between bowl 104 and bore 106 . pin element 300 may conveniently be made of a length of wire preferably about ⅛ th inch in diameter with a looped end and a length of about 3 inches . alternatively , for connection with blade element 200 , pin element 300 may be provided with a retention element 302 . once the apple pipe has been made as described above , the user should inspect it to ensure that bowl 104 cleanly communicates with bore 106 via hole 108 . if there is excess juice released in bowl 104 it may tend to collect in the bottom and block opening 110 at the upper end of hole 108 . this may be remedied by inserting a folded piece of paper tissue into bowl 104 to suck away and remove the excess juice . opening 110 , being small , preferably about ⅛ inch across , eliminates the need to provide a screen or other means to ensure that the smoking material does not fall into hole 108 . also , if inspection reveals that there is inadequate flow of air ( and thus eventually of smoke ) because hole 108 does not cleanly communicate with bore 106 , the user may reinsert pin element 300 via opening 110 in a slightly different direction than was chosen for original hole 108 until the problem is corrected . inspection involves looking down both bore 106 and the new hole 108 individually . once the apple pipe has been prepared and inspected , a quantity of smoking material 400 may be pressed into bowl 104 and ignited , with suction applied to the open end 112 of bore 108 to promote combustion and extract smoke . as may be expected , flow of the smoke through the apple will cool the smoke , remove some of the tar from it , and entrain in the smoke some of the volatile constituents contained in the apple itself , i . e ., add apple flavor to the smoke . it should be possible to smoke the apple pipe for a reasonable period , and it may even be feasible to smoke it more than once over a day . when the smoking is over , unless the apple is very small , the user may even be able to eat some of the apple on opposite sides of the smoke passage . if a user wishes to create a relatively large bowl 104 , in another embodiment there is provided a scooping element 900 , best seen in fig9 and 12 , which has a thin elongate body 902 similar to that of pin element 300 and a slightly curved scoop end 904 a little wider than end 202 of blade element 200 . the desired relatively large bowl can be scooped out of the apple with scoop end 904 exactly as described above with regard to blade element end 202 , i . e ., by penetration and turning to cut out and extract portion 102 . the blade , pin and scoop elements , or just the first two of them , may be kept together for cooperative use on a regular key ring . however , if the user prefers , they may be held movably relative to each other within a cover 1000 by a rivet or screw 1002 . see fig1 and 11 . portions 1004 and 1006 of cover 1000 will cover the blade , pin and scoop elements when they are not in use . each of these elements can be easily rotated out of cover 1000 about rivet or screw 1002 as and when needed . a d - ring 1008 may be provided to permit retention of cover 1000 to a user &# 39 ; s key ring or belt for convenience in carrying the tool . use of a firm vegetable like a potato , instead of an apple , to make a pipe as described above should be a very similar experience except for any flavor the smoke may pick up during use of the resulting pipe . provided the penetration and edge portions of the blade and pin elements are thin or sharp enough the method of using the tool should be virtually the same . all obvious variations and modifications of the invention as disclosed herein are intended to be comprehended within the invention which is limited solely by the claims appended below .

a tool for forming a smoker &# 39 ; s pipe from a firm fruit or vegetable such as an apple or a potato has cooperating elements with which a user readily creates a bowl for retaining ignited smoking material , without the need for a screen , and a passage communicating with the bowl to allow drawing of cooled , flavored smoke through the selected fruit or vegetable .

the mode of operation of the preparations according to the invention thus consists in the hydrophilic active substance being gradually released from the wall of the capsule as the capsule or sweet is being consumed , and coating the teeth and gums . after the outer shell of the preparation according to the invention has been worn away , the hydrophilic active substance coating teeth and gums is fixed by the lipophilic active substance that is contained inside the preparation and released later than the hydrophilic substance . fluorine compounds that are suitable for the prevention of caries , are primarily suitable for consideration as hydrophilic active substances that are contained in the outer shell of the preparation according to the invention . such fluorine compounds are , for example , fluorides such as sodium fluoride and potassium fluoride , tin fluoride , organic fluorides such as long - chained aminofluorides , for example oleylaminofluoride , cetylaminofluoride or ethanolaminohydrofluoride , fluorosilicates , for example potassium hexafluorosilicate or sodium hexafluorosilicate , fluorophosphates such as ammonium , sodium , potassium , magnesium or calcium monofluorophosphosphate and / or fluorozirconates , for example sodium , potassium or tin fluorozirconate . the preferred proportion is between 0 . 05 and 1 . 0 % by weight of fluoride , calculated as fluorine , of the shell or otherwise total composition . antimicrobial substances that can prevent or at least reduce the formation of dental plaque caused by bacteria may also , or alternatively be present in the shell of the capsule . examples of such compounds are , in particular , 1 , 6 - bis ( p - chlorophenyldiguanido ) hexane , known by the trivial name &# 34 ; chlorhexidine &# 34 ;, which may be used in the form of its watersoluble salts such as digluconate , diacetate , dilactate or also the less readily soluble dihydrochloride ; 1 , 6 - di -( 2 - ethylhexyldiguanide ) hexane , known by the trivial name &# 34 ; alexidine &# 34 ;, similarly in the form of its water - soluble salts ; 1 , 6 - di -( benzyldiguanido ) hexane , p - chlorophenyl - diguanide or n 1 -( 4 - chlorobenzyl )- n 5 -( 2 , 4 - dichlorobenzyl ) diguanide similarly in the form of their soluble salts ; polymeric bis - guanides as sold , for example , under the trade name &# 34 ; vantocil &# 34 ;, and also other diguanides , for example those disclosed in u . s . pat . no . 3 , 183 , 230 . quaternary ammonium compounds are also suitable hydrophilic antimicrobial substances which may be used in the preparations of the invention . preferably 0 . 01 to 2 . 5 % by weight of the antimicrobial substances are used . another group of compounds which may be used in the shell of the preparations according to the invention comprises zinc compounds that are active in preventing dental plaque and tartar , such as zinc chloride , zinc phenolsulphonate , and zinc citrate , for example , in the form of its trihydrate , in a quantity between 0 . 01 and 2 . 5 % by weight calculated as zinc , of the preparation according to the invention . tartar inhibiting substances may be used in the preparations of the invention especially , for example , the various phosphonic acids and their water - soluble salts , for example ethane - 1 - hydroxy - 1 , 1 - diphosphonic acid , ethylenediaminotetraphosphonic acid , hexamethylenediaminotetraphosphonic acid ; complex - forming polycarboxylic acids , in particular citric acid and tartaric acid and their water - soluble salts . the proportion of such tartaric inhibiting substances may be 0 . 05 to 7 . 5 % by weight of the preparation according to the invention . the various cariostatically active water - soluble phosphates for example inorganic phosphates such as sodium trimetaphosphate , and organic phosphates , in particular phosphoric acid esters of polyhydric alcohols such as sodium or calcium glycerophosphate or calcium saccharose phosphate , may also be used as hydrophilic substances in the dental and oral hygiene preparations according to the invention , in the known suitable quantities . combinations of different odontologically active substances that are compatible with one another may also be used . the following are examples of expecially suitable lipophilic substances , released only after the outer shell has been conxumed , that may be used for filling the capsule or sweet according to the invention : natural and synthetic fats and waxes , for example edible fats , mono - and diglycerides , carnauba wax , candelilla wax , spermaceti , bees - wax , synthetic esters of long - chained fatty acids , such as isopropyl myristate , isopropyl stearate or isopropyl palmitate ; phospholipids , such as lecithin or cephalin , squalene or perhydrosqualene or synthetic substitutes for these ; abietic acid and salts thereof ; cholesterol , lanosterol ; fatty alcohols such as carnaubyl alcohol , ceryl alcohol , miricyl alcohol , miristyl alcohol , isostearyl alcohol , oleyl ricinol , undecylic acid and the corresponding long - chained fatty acids , the lipophilic salts thereof , for example castor oil fatty acid and sodium ricinoleate , and the esters thereof ; long - chained amines , such as cetylamine or stearylamine ; peptides , lipoproteins and lipoproteic acids , for example of the &# 34 ; lipacid &# 34 ; type , and also various silicon oils . the joint use of several lipophilic substances , if desired in solution , is also possible . the proportion of the lipophilic substances of the total composition is advantageously between 1 and 75 %, but is preferably between 5 and 50 % by weight . the manufacture of the capsules or sweets according to the invention is effected in the customary manner , as described , for example , in munzel - buchi - schultz , &# 34 ; galenische praktikum &# 34 ; ( 1959 ), wissenschaftliche verlagsgesellschaft mbh , stuttgart , pages 501 to 505 , or in ullmanns enzyklopadie der technische chemie , 3rd edition , vol . 4 , pages 12 to 15 and vol . 19 , pages 257 to 258 . the following examples provide a synopsis of dental and oral hygiene preparations combined according to the invention in capsule form or as filled sweets . filled gelatin capsules of the following composition were prepared in the customary manner : ______________________________________ ( a ) composition of the capsule shellgelatin 460 . 0 mgglycerin 120 . 0 mgsorbitol , 70 % strength 90 . 0 mgpeppermint oil 3 . 0 mgspearment oil 2 . 0 mgsaccharin sodium 2 . 3 mgsodium cyclamate 15 . 0 mgbenzoic acid 3 . 0 mgtitanium dioxide 1 . 0 mgblue food coloring 3 0 . 1 mgyellow food coloring 2 0 . 1 mg ( b ) composition of the fillingsilicon oil 400 . 0 mgxylite 700 . 0 mg______________________________________ ______________________________________ ( a ) composition of the capsule shellgelatin 520 . 0 mgglycerin 20 . 0 mgsorbitol 97 . 0 mgchlorhexidinediacetate 10 . 0 mgpeppermint oil 2 . 5 mgmenthol 2 . 3 mgsaccharin sodium 1 . 0 mgsodium cyclamate 10 . 0 mgsorbic acid 5 . 0 mgtitanium dioxide 2 . 0 mgred food coloring 4 0 . 2 mg ( b ) composition of the fillingsunflower oil 900 . 0 mgcetylamine 100 . 0 mg______________________________________ ______________________________________ ( a ) composition of the capsule shellgelatine 500 . 0 mgglycerin 100 . 0 mgsorbitol , 70 % strength 72 . 5 mgsodium fluoride 3 . 5 mgpeppermint oil 3 . 0 mgspearmint oil 2 . 0 mgsaccharin sodium 4 . 0 mgp - hydroxybenzoic acid ester 5 . 0 mgtitanium dioxide 2 . 0 mgchlorophyllin 3 . 0 mgsodium trimetaphosphate 5 . 0 mg ( b ) composition of the fillingmono - and diglycerides ofcoconut oil fatty acid 300 . 0 mglecithin 700 . 0 mg______________________________________ ______________________________________ ( a ) composition of the capsule shellgelatine 530 . 0 mgglycerin 70 . 0 mgsorbitol , 70 % strength 69 . 4 mgsodium monofluorophosphate 7 . 5 mgpeppermint oil 2 . 0 mgspearmint oil 2 . 0 mgsaccharin sodium 7 . 0 mgp - hydroxybenzoic acid ester 3 . 0 mgtitanium dioxide 2 . 0 mgblue food coloring 3 0 . 1 mg1 - hydroxyethane - 1 , 1 - di - phosphonic acid 5 . 0 mg ( b ) composition of the fillingcarnauba wax dissolved in 300 . 0 mgmiglyol 812 neutral oil 600 . 0 mg______________________________________ ______________________________________a sucking tablet with a center was composed as follows : ______________________________________ ( a ) composition of the tablet shellsorbitol ( e . g . karion hf3160 of the firm of merck ) 2 , 200 . 0 mgdicalcium glycerophosphate 200 . 0 mgmagnesium stearate 23 . 0 mgcetylbenzldimethylammoniumchloride 3 . 0 mgcitric acid 20 . 0 mgpeppermint essence 3 . 0 mgorange food coloring 2 1 . 0 mg ( b ) composition of the centersodium ricinoleate 75 . 0 mgsorbitol ( e . g . karion hf3160 of the firm of merck ) 100 . 0 mgpeppermint essence 2 . 0 mgpolyethyleneglycol 6000 23 . 0 mg______________________________________ as the foregoing illustrates the shell material carrying the hydrophilic , odontologically active substance may be a known gelatine or candy - type base which is itself water soluble .

disclosed is a dental hygiene preparation in the form of a filled capsule or a filled sweet comprising an outer shell containing a hydrophilic dental and / or oral hygiene substance and an inner core of a lipophilic substance .

the advantage of using double capacitors will be set forth herein in relation to an advantageous embodiment of the invention . here the advantages of the teaching according to the invention can be particularly clearly verified . if the efficiency is identified as the ratio of the delivered to the stored energy , it will be seen that the residual energy in the case of the parallel - serial connection only ever constitutes a quarter of that which is still stored on the individual capacitor . in the example with a tilt of 50 % the efficiency is 75 % in the case of the individual capacitor , whereas it is 93 . 75 % in the case of the two partial capacitors . the lower initial energy ( 80 %) is afforded by the lower residual energy ( 6 . 25 %) of the two partial capacitors . the individual capacitor needs 1 . 25 times the energy in order to achieve the same effect . heretofore the approach by way of the degree of utilization ( tilt ) in the calculation in equation ( 11 ) gave a relative ratio between c 1 and c 2 . if we ask which specific time constant rc 1 is concealed behind a 50 % tilt , attention is directed to table 1 at the end of this detailed description . specified therein for a tilt of 50 % is an rc 1 of between 6 . 4 and 6 . 6 ms , on average 6 . 5 ms , which with a defibrillation impedance of 50ω gives a preferred capacitance for the capacitor c 1 of 130 μf . the individual capacitor of the dual combination in accordance with equation ( 12 ) then has a capacitance of : in accordance with the invention therefore when settling for a time constant on the basis of a look - up table ( table 1 ) it is possible to determine the corresponding value for the pulse duration , tilt and efficiency for the individual capacitor . the partial capacitor corresponding thereto can then be ascertained with equation ( 11 ), for the parallel - serial use . this and the parameters resulting therefrom are summarized in table 1 from which it is possible to select the respective combination insofar as either the partial capacitor with an assumed load is predetermined , or a degree of efficiency which permits a large capacitor with at the same time a low voltage . in the foregoing example of the energy calculation for a 50 % tilt , it is possible to see that the levels of energy delivered are the same for both circuitry versions . that is due to the fact that the initial voltage and the mean voltage are equal for both versions . for a tilt of less than 50 %, the series connection of the partial capacitors during the residual discharge means that a higher voltage is produced than during the first phase so that the overall mean value of the voltage is higher with two capacitors . as it is not the delivered energy but the time integral in relation to voltage that is the crucial parameter in terms of defibrillation , the initial voltage can be reduced when using the double capacitors to the amount by which the voltage mean values increase . for tilts of greater than 50 %, the initial voltage in the case of the two - capacitor system will have to be set at a correspondingly higher level . the reduction in the capacitance of the two - capacitor system together with the increase in the mean voltage mean that the normalized stored energy ( nse2 ) of a two - capacitor system above an rc - value which governs the 50 % tilt extends markedly more shallowly than the curve for the one - capacitor system ( see fig1 ). the curve for the normalized stored energy ( nse1 ) of the one - capacitor system corresponds to the curve which is shown as fig8 in reference 4 from the background of the art , but which was there given with a normalized time constant . the normalized stored energy of the two - capacitor system ( nse2 ) is afforded by multiplication from the reduced capacitance ( 2c 2 / c 1 ), the mean voltage altered by voltage doubling ( mv1 / mv2 ) and the nse1 value of the one - capacitor system curve . the former simply arises out of equation ( 11 b ) by forming the ratio of 2c 2 to c 1 , and multiplying it by the square of the ratio of the mean values of the voltages ( mv1 : mv2 ) 2 and the corresponding value of nse1 ( see table 1 ). an example will illustrate this operating procedure . with a time constant rc 1 of 20 ms the tilt − 0 . 340 ( see table 1 ), and the normalized mean value of the voltage nmv1 = 0 . 818 , which also applies in regard to parallel discharge of the two c 2 - capacitors . the mean value of serial discharge is 0 . 72 ( this follows from discharge to half the value ) multiplied by double the exponential final value of ( 1 − tilt ) corresponding to 0 . 66 , that is to say 0 . 72 · 1 . 32 = 0 . 95 . that gives an overall weighted mean value nmv2 of ( 5 . 87 ms · 0 . 818 + 2 . 45 ms · 0 . 95 ): 8 . 32 ms = 0 . 857 ( duration of the parallel discharge = 5 . 87 ms , and that of the serial discharge = 2 . 45 ms , the overall duration = 8 . 32 ms ) which is 1 . 048 times higher than the mean value in the case of one - capacitor discharge . the initial voltage can be correspondingly lowered , which corresponds to a reduction in the stored energy to 0 . 911 . with equation ( 11 b ) and by analogy with ( 12 / 13 ), it is possible to calculate f or rc 1 = 20 ms an energy ratio e2 : e1 of 0 . 706 , which results in an overall reduction of 0 . 911 0 . 706 = 0 . 643 , or , to put that another way : the normalized stored energy of the one - capacitor system nse1 of 2 . 591 is reduced in the case of the two - capacitor system to an nse2 of 0 . 911 · 0 . 705 · 2 . 591 = 1 . 666 . for comparison : with a tilt of 50 % nse1 = 1 . 46 and nse2 = 1 . 17 ( see table 1 ). on the assumption that with a 50 % tilt with an rc 2 of 2 . 6 ms 10 j is required for defibrillation , the one - capacitor system with rc 1 of 6 . 5 ms would correspondingly require 12 . 5 j for the same effect . a two - capacitor system with a tilt of 34 % and an rc 2 of 7 . 06 ms would rise to 14 . 2 j and finally the one - capacitor system with rc 1 of 20 ms would rise to 22 . 1 j . the calculation once more demonstrates the finding that the pure energy information says nothing about the effectiveness thereof . in comparison with the example with a time constant of 20 ms , with an rc 1 of 10 ms the energy is reduced to only 0 . 966 (= 0 . 984 2 ) by virtue of the excessive increase in voltage , while as stated , with a 50 % tilt , there is no longer any difference as the mean voltage value is equal for both discharges . it follows therefrom that the new method fits in well in particular with the implementation of defibrillators with large capacitors and a correspondingly low voltage . investigations of three works ( references 5 - 7 ) in which the tilt was experimentally researched with a very low level of energy input showed that the energy with optimized tilt can actually be reduced to about 70 % in comparison with a tilt of 80 % ( in an experiment of 88 %). if consideration is further given to the reduction due to the two - capacitor system of for example 80 % for a 50 % tilt , then the highest mark of 30 j which was earlier established is reduced by the described two - capacitor systems to 0 . 8 · 0 . 7 · 30 j = 17 j with the same effectiveness . the maximum energy required would therefore fall still further if the capacitors were selected to be still smaller than the above - calculated 52 μf with a tilt of 50 %, which however involves increased voltages . thus for example a capacitor of 104 μf ( 2 · 52 μf ) requires just on 570 v in order to be charged up to the 17 j corresponding to the 30 j at an 80 % tilt value . therefore table 1 with the parameters nse1 and nse2 represents the required input in order to be able to effect defibrillation with the predetermined parameter ( this is generally the capacitor ) in comparison with the theoretically lowest delivered energy nde with an rc 1 of 2 . 36 ms ( in an 8 - digit calculation that value is to be unambiguously defined ). the input for nse1 or nse2 which can be read off as a function of the time constant rc 1 could also be interpreted as a reciprocal value which then can be interpreted as efficiency η in relation to the theoretical optimum . a horizontal line in graph 1 , that is to say a predetermined level of efficiency , demonstrates the possibility in relation to larger capacitors for the two - capacitor system or conversely it also shows that under some circumstances a one - capacitor system can be more worthwhile than a two - capacitor system beyond an rc 1 of 20 ms . a vertical line clearly shows the lower degree of input ( or higher efficiency ) if the two - capacitor system were embodied instead of the one - capacitor system . the time constant rc 2 associated with the vertical line rc 1 can be read off in table 1 . the depicted two - capacitor system always reduces its residual voltage u2 ( residue ) to half the value of the corresponding one - capacitor system u1 ( residue ). that means however that the new system can only supply half the voltage for a bi - phase pulse . in accordance with the current school of thought this is deemed to be detrimental as the second phase is attributed with a crucial action which in our view it does not enjoy . nonetheless discharge of the residual voltage of the two - capacitor system is advantageous , preferably if that again happens in parallel . that would counteract in particular “ over - stimulation in the proximity of the cardiac electrode ” ( reference 4 ). how the delivered energy nde1 of the one - capacitor system increases as a reference value with an increasing time constant ( lower curve ), how the stored energy nse1 of the one - capacitor system increases over - proportionally with the time constant ( upper curve ), how the stored energy of the two - capacitor system nse2 ( curve in the middle ) remains markedly below that of the one - capacitor system nse1 , particularly when large time constants are involved , and how far away we are from the theoretical minimum nde1 at rc 1 = 2 . 36 ms . while nse1 or nse2 represent the input which must be provided in relation to the theoretical minimum with a one - capacitor system or a two - capacitor system , the reciprocal η = 1 / nse1 and η 2 = 1 / nse2 corresponds to the efficiency in which both electrical and also physiological optimization is expressed and which relates to the theoretical minimum of the delivered energy nde1 with an rc 1 of 2 . 36 ms . [ 0085 ] fig2 is a representation of the discharge calculated with equation ( 12 ) at 50 % tilt for rc 1 and rc 2 . the rc 1 curve ends at t / rc = 0 . 9 ( in reality at 4 . 5 ms ) at a normalized voltage of 0 . 5 , while the exponential curvature can scarcely be perceived . that is also expressed in the mean normalized voltage nmv1 which at 0 . 721 is only slightly lower than the linear mean value at 0 . 75 . “ mean value ” means that the wedge part of the discharge curve above the mean value line is equal in terms of surface area to that beneath the discharge curve . more specifically , in the total of three discharge curves with rc 1 , 2 · rc 2 and ½ · rc 2 it will be apparent , which has been theoretically worked out with formula ( 7 ), that the mean value of the voltage depends only on the tilt and not on the time constant . in all three discharges the wedge compensation effect is very beautifully demonstrated by the one line at 0 . 721 . that affords the same normalized voltage for both discharge curves and thus the same physiological effectiveness . [ 0086 ] fig3 predetermines an rc 1 discharge at 70 % ( tilt then 30 %, rc 1 = 27 . 5 ms ). the curve ends at an t / rc of 0 . 94 ( in actual fact at 9 . 8 ms ). at 0 . 625 ( 6 . 6 ms in reality ) the discharge is terminated with 2 · rc 2 and voltage doubling to the normalized value of 1 . 4 begins . after 2 . 8 ms the discharge procedure with ½ · rc 1 has then occurred again at 0 . 7 , and the line nmv3 indicates the mean value which is 0 . 165 higher than that of the rc 1 curve . as a result the discharge with rc 2 and subsequent voltage doubling is physiologically more effective with the same initial voltage ( here 1 ). the effectiveness becomes the same if the initial voltage of the rc 2 curve is reduced to 94 % in relation to the rc 1 curve . in energy terms that denotes a reduction to 88 %. in this example however the efficiency 12 at 0 . 53 ( see table 1 ) is already very low , which again is already reached by an rc 1 discharge at approximately an rc 1 of 11 . 5 ms ( corresponding to a tilt of 41 %). it is not only possible to deduce that for each time constant rc 1 there is an individual optimum tilt , but also how great the chronaxie time is , which in the calculation forms the important value for normalization of the system of equations . with knowledge of the optimum tilt and the corresponding time constant it is possible to ascertain from table a of [ 4 ], at which tilt which normalized time constant v = rc / chronaxie occurs . the chronaxie in relation to defibrillation of implanted units is to be fixed approximately at : estimates show that this value may individually alter by ± 30 %, which however has a less than 20 % effect on the results or upon optimization . if there should be a chronaxie which is markedly different from 2 ms , for example due to other electrodes or other defibrillation modes , it is nonetheless possible to use the results in table 1 , it is only necessary to multiply all time values by the factor c : the time constant rc 1 in the first column arises out of multiplication of the value v in table a from reference 4 with the chronaxie in accordance with equation ( 16 ) of 2 ms . the pulse duration t1 in the second column is obtained like rc 1 from the value x in table a and chronaxie . the tilt was created in such a way that the first two columns in table a of ref . 4 were over - written with the new values for rc 1 and t1 . nmv1 is the mean value of the voltage as a function of rc 1 and during the pulse duration t1 . a calculation formula was already afforded with equation ( 3 ). in deriving that formula the expression t1 / rc 1 which occurs upon integration was replaced by the expression in [ u ( o ): u ( residue )]. the normalized mean voltage nmv1 in accordance with equation ( 7 ) is thereby dependent only on the tilt . the normalized delivered energy nde1 ( related to the minimum at rc 1 − 2 . 36 ms ) was obtained like tilt from table a of reference 4 . the efficiency eta from that table a was electrically defined as the ratio of delivered energy ( nde ) to stored energy ( nse ). the mode of operation of the method according to the invention is to be set forth in summarizing form once again hereinafter as follows : the normalized stored energy nse1 is defined by the quotient nde1 divided by eta . rc 2 is determined in accordance with equation ( 11 a ). t ( 2 ) ( time during the discharge of rc 2 ) is calculated from the combination of equations ( 5 ) and ( 8 ): t ( 3 ) ( time during the discharge of the series circuit to half the voltage value ) is determined in analogous fashion : nmv ( 2 ) is the mean voltage during the time t ( 2 ) corresponding to equation ( 7 ). nmv ( 3 ) is the mean voltage during t ( 3 ) which with the equations ( 5 ) and ( 7 ) having regard to discharge to half the value is calculated as follows : mv1 : mv2 is the quotient which characterizes the increase ( or reduction ) in voltage on the basis of the parallel - series circuit configuration . 2c 2 : c 1 indicates the reduction in the stored energy in the case of the two - capacitor system in comparison with the one - capacitor system . the reciprocal value of nse2 represents the efficiency η 2 which is related to the energy minimum nde1 at rc 1 = 2 . 36 ms . nse2 : nse1 is identical to the ratio of the efficiencies η 1 : η 2 and demonstrates the superiority of the two - capacitor system in particular in relation to a high rc 1 . ( in the same manner , as indicated previously , it is also possible to calculate systems with more than two capacitors ). accordingly the combination of theoretically well - founded pulse duration or tilt with the principle of voltage doubling by means of two capacitors affords a technical advance which can be used in various ways . measurement of the time constant during parallel or sequential discharge can thus be advantageously used to ascertain the corresponding tilt and to cause the pulse to cease when it is reached . that applies both in regard to the individual capacitors and also in regard to the serial connection thereof . it is thus best possible to do justice to any situation with an unknown defibrillation impedance . all calculations were based on the assumption that the chronaxie in the defibrillation procedure is 2 ms . if that value should be found to be incorrect , for example fluctuating by up to 30 %, the method of the invention would not be rendered ineffective as a result as as a consequence the tilt changes by less than 16 %. that affords the advantageous development of making the tilt which is so important in terms of the effectiveness of the method variable by up to 20 % by programming . the curve nse2 in fig1 demonstrates the input which is to be achieved with the two - capacitor system and which cannot be surpassed by any system known at the present day . the reciprocal of that value ( nse2 − 1 ) defines the efficiency η 2 which gives the defibrillator its name . this therefore means not one defibrillator but a family which is dimensioned in accordance with the equations ( 11 ) for the two - capacitor system and which is optimized in the inverse relationship to the equation ( 22 ): c 1 / 2c 2 = ratio of the capacitances of the one — and two - capacitor systems respectively , all values are set out in table 1 as a function of the time constant rc 1 for the range between 1 . 0 ms and 100 ms . for the comer points of a realistic range of between 2 . 5 ms and 20 ms the eta values read as follows : η 2 ( 2 . 5 ms )= 0 . 969 ( 3 % more energy necessary in comparison with the reference value nde1 ( 2 . 36 ms )), and η 2 ( 20 ms )= 0 . 60 , thus η 2 is higher by the factor of 1 . 56 than the reduction in input as shown in fig1 by virtue of two capacitors or the increase in efficiency ( as a reciprocal value of input ) η 2 is to be attributed exclusively to optimization of the pulse which in the case of a “ bi - phase ” pulse would correspond to the first phase . there is nothing against also discharging the residual voltage of the two - capacitor system as a second inverted phase , in which case that should preferably take place in the form of a parallel discharge . referring to fig4 an advantageous structural embodiment of the invention in the form of an implantable cardioverter defibrillator ( icd ) is shown in the form of a block circuit diagram . for operation thereof this embodiment thus also makes use of the method according to the invention . the block circuit diagram shows the co - operation in principle of the groups shown in the following figures . a defibrillator portion 1 produces the pulses which are to be delivered to the heart in a defibrillation phase and includes the energy source required for that purpose . the defibrillator portion 1 is connected to a control portion 2 containing the groups which establish the stimulation defibrillation times and determine the configuration in respect of time of the defibrillation pulses . a cardiac pacemaker portion 3 contains the usual functions of an implantable pacemaker and implements control in respect of time of the stimulation pulses which are necessary to maintain the normal cardiac activity in the bradycardia and tachycardia range . that also includes recognition of irregularities in cardiac activity from the intracardial electrocardiogram recorded by way of the implanted electrodes . the control portion 2 also has control over the pacemaker portion 3 so that in that way the functions thereof can also be remotely programmed and controlled in time - synchronized relationship with the behavior of the heart . the groups 1 through 3 are combined in a casing 4 which is represented symbolically by a broken line . the implanted portions which are disposed in the casing 4 are remotely controllable and remotely settable by a programming portion 5 from outside the body . in addition the configuration in respect of time of the cardiac events and the stimulation and defibrillation measures which are thereupon initiated is recorded in the control portion and if necessary can be transmitted by means of the programming portion to the exterior of the body and can there be evaluated by the doctor . [ 0121 ] fig5 shows in detail the functional components of the defibrillator portion 1 . in this case an energy source 11 which is in the form of a conventional battery serves as a power supply for this group . connected on the output side of the energy source 11 is a voltage transformer 12 which boosts the output voltage of the battery to a settable supply voltage u for charging up the subsequent capacitors c 1 and c 2 . the internal resistance of the voltage transformer 12 is such that charging - up of the capacitors c 1 and c 2 takes place in a suitably short period of time , after which in the situation requiring defibrillation it was activated by way of a suitable control line from the control portion 2 . the capacitors c 1 and c 2 can be connected by way of various switching elements s 11 through s 34 in various ways to the voltage transformer 12 on the one hand and the cardiac electrode 13 on the other hand , as is described in greater detail hereinafter . in this respect , activation of one or more of the switching elements s 11 through s 34 means that the switching element in question in switched into the conducting condition for a predetermined period of time . for the charging operation , the capacitors c 1 and c 2 are connected directly to the output of the voltage transformer 12 by activation of the switching elements s 11 and s 22 , so that the capacitors are charged up to their set initial voltage . in that case the charging operation is effected in a suitably short period of time according to the internal resistance of the voltage transformer . discharge of the energy stored in the capacitors c 1 and c 2 to the electrode 13 which is connected to the heart is effected either sequentially in respect of time by successive activation of the switching elements s 12 for c 1 and s 12 and s 24 for c 2 for two successive periods of time or by simultaneous activation of the corresponding switching elements in a single period of time . in this case , connection to the heart by way of the electrodes 13 is effected by activation of the switching elements s 31 and s 32 each in a first polarity . a further discharge configuration is afforded by a series connection of the capacitors c 1 and c 2 by activation of the switching elements s 22 and s 23 . in this case once again the switching elements s 31 and s 33 are activated for discharge in the first polarity . to reverse the discharge configurations for a possible residual discharge in the bi - phase mode of operation , the switching elements s 32 and s 34 are activated instead of the switching elements s 31 and s 33 . reference is now made to fig6 to describe the production of the controls signals , with the control portion 2 , which cause activation of the switching elements s 11 through s 34 for predetermined periods of time . the timer blocks shown in fig6 are respectively activated by a starting pulse by an input signal which is fed to the illustrated block from the left - hand side in the drawing . they respectively remain active for a predetermined period of time which is characteristic for the block and which can possibly be altered by way of external programming means ( programming portion 1 in fig1 ) and in that respect deliver a suitable control signal to the above - mentioned switching elements s 11 through s 34 of the defibrillator portion shown in fig5 . the signal connections in question leave the respective timer block upwardly in the drawing . after the expiry of the period of time which is characteristic of the respective timer block the timer blocks in question each output a control pulse which possibly serves for activation of a subsequent timer block . the corresponding signal paths leave the respective timer block towards the right in the drawing . when defibrillation is necessary , the timer block t 1 which determines the charging times of the capacitors c 1 and c 2 by means of control signals and the switching elements s 11 and s 22 is supplied with a suitable starting signal from a time control unit 21 which holds the supremacy in terms of time control . after charging is concluded that procedure is terminated by a suitable end signal to the timer block t 1 . the time duration of the charging procedure can possibly be set from the exterior , like also the charging voltage of the voltage transformer 12 in fig5 . the output signal of the timer block t 1 is fed to three and - gates 22 through 24 , to the further input of each of which passes a respective one of three control signals of the time control unit 21 , which select which of three subsequently connected timer blocks t 21 , t 22 or t 231 is activated by the output signal of the timer block t 1 . in this respect , the choice of the respective timer block determines which of three first discharge configurations is selected for the capacitors c 1 and c 2 . these are parallel discharge ( t 21 ), individual discharge ( t 22 ) and sequential discharge ( t 231 and t 232 ). in that way it is possible by means of the time control unit by virtue of external programming to establish which of the three first discharge configurations is adopted . in the case of the parallel discharge configuration being selected , the switching elements s 12 , s 22 , s 24 , s 31 and s 33 are activated by the time control unit t 21 . in contrast , in the case of the individual capacitor discharge configuration being selected , the switching elements s 12 , s 31 and s 33 are activated by the time control unit t 22 and , in the case of selection of the sequential discharge configuration , the switching elements s 12 , s 31 and s 33 are activated firstly — as in the above - mentioned case — by the time control unit t 231 . the control signals for termination of the signal output for the various timer blocks are produced by a control unit for discharge termination as indicated at 25 . that control unit determines the end of discharge of the capacitors c 1 and c 2 to provide for optimization in accordance with the invention of the discharge energy from the time constant arising in regard to discharge and the remaining residual discharge voltage which is ascertained in dependence thereon . ascertaining the discharge voltage in that way can be effected either by using a look - up table in the manner of table 1 in such a way that , after the time constant rc 1 has been ascertained the corresponding tilt value ( or that of the corresponding residual voltage ) is outputted , or that value is calculated on the basis of the specified relationships . to ascertain the appropriate operating parameters which are also used as an input parameter for the group 26 , the arrangement has a volt meter 26 which ascertains the current voltage at the electrodes 13 . the configuration of the voltage at the beginning of the discharge is taken — derived from the corresponding starting signal as the output signal of the time control block t 1 — with the beginning of the first phase of discharge of the capacitors c 1 and c 2 respectively , by means of a suitable group , to determine the time constant of the discharge procedure , which forms the product of the respective discharge capacitance and the resistance of the electrode 13 . the discharge voltage at which discharge is terminated depends on that time constant . that is effected with what is known as a look - up table in which the residual voltages at which the discharge is to be terminated in the respective phase are recorded in dependence on the ascertained time constant . that table is shown in greater detail as table 1 . when the voltage which is ascertained for the respective discharge configuration on the basis of the ascertained time constant is reached , a signal is delivered to the time control block which controls the discharge , that signal terminating the corresponding discharge time and possibly starting the next discharge phase by the appropriate control signal which indicates termination of the period of time in question . that is effected by activation of the subsequent time control block . in the case of sequential discharge , after discharge of the first capacitor c 1 to the ascertained discharge voltage , the second capacitor is discharged ( to the same discharge voltage ). for that purpose , the block t 232 is activated by the output signal of the block t 231 and activates the switching elements s 22 , s 24 , s 31 and s 33 . termination of that discharge phase again occurs when the predetermined discharge voltage is reached . in a corresponding fashion , a timer pulse starting a subsequent time control block is also supplied by the block t 232 . that is effected by the discharge voltage associated with the respectively ascertained time constant being ascertained from the control unit for the end of discharge as indicated at 25 , and being fed to the voltage comparator 28 through 30 associated with the respective discharge phase ( active time control block ). as soon as the current discharge voltage which is ascertained by the volt meter 26 reaches or falls below the value held in the respective voltage comparator , it delivers the control signal for terminating discharge in the respective phase . the output pulses of the time control blocks t 21 , t 22 and t 232 are combined together by way of an or - gate 31 . the output signal of that or - gate 31 serves for actuation of the subsequent time control blocks . in the normal case this is the time control block t 3 which triggers serial discharge of the two capacitors c 1 and c 2 by activation of the switching blocks s 22 , s 23 , s 31 and s 33 . that serial discharge can possibly also be omitted under certain circumstances . this is also established by the time constants determined with the group 27 . a selection block 32 determines the further discharge sequence by means of two and - gates 32 and 33 . in dependence on the output signal of the selection block which in turn is actuated by the control unit 25 for terminating discharge , the output signal of the or - gate 31 is passed either by way of the and - gate 33 to the time control block t 3 or by way of the and - gate 34 and a further or - gate 35 to the time control block t 4 . in the case of activation of the time control block t 3 the above - described serial discharge takes place while in the other situation parallel bi - phase residual discharge similarly takes by way of the time control block t 4 . in this respect the residual charge of the capacitors c 1 and c 2 is discharged after attainment of the respective end of the discharge procedure , at the threshold voltages in question , with a bi - phase voltage reversal . in this respect , the arrangement ascertains by way of the voltage comparator 30 when the output voltage at the electrodes has reached a residual voltage . that residual voltage is fixedly stored in the voltage comparator . in the other situation , more specifically when series discharge is skipped , activation of the time control block t 4 for activating bi - phase discharge is effected by way of the and - gate 34 on the basis of the corresponding output signal of the selection circuit 32 immediately after activation of one of the time control blocks t 21 , t 22 or t 232 . instead of the normalized residual voltage or the tilt , “ shut - down ” of the respective capacitor combination at the intended residual voltage can also be effected by means of a suitable time presetting which is respectively established starting from the initial voltage , on the basis of the ascertained time constant . the time control blocks shown in fig3 are then not each reset by an external control signal which marks the end of the respective period of time , but receive the remaining residual time ascertained as set forth hereinbefore , transmitted from the unit 25 . then , after expiry of the residual time , this being controlled by suitable timer means , delivery of the signal identifying the end of the respective period of time takes place for evaluation of the further control procedures towards the right in the drawing , as was described hereinbefore . the invention is not limited to the illustrated embodiments and in particular it is not bound to a configuration in just hardware or just software terms as the primary consideration is the described functionality , more specifically the described behavior of the system as a reaction to the input conditions set forth . in this respect the structure of timing members used can also serve as a starting point for the design of a suitable flowchart as a basis for control software , in which respect the procedures which are reproduced in parallelized mode only have to be edited in the manner of a flowchart with the corresponding logical links for serial processing . it therefore also immaterial whether the system is used as an implantable or external system or also as part of a larger overall system . thus the described functionality can also serve for example as an operating procedure for a system of higher order , and in particular in regard to ascertaining the respective operating parameters it is possible to make use with the same degree of success both of the respectively specified calculation methods and also look - up tables in which the stored values are each looked up and read off .

a defibrillator for atrium and / or ventricle having at least two capacitors which in the production of defibrillation pulses are discharged in at least two phases in succession in different configurations , wherein there are provided switching means which control the discharge in the at least two discharge phases in such a way that the mean value of their voltages is substantially equal and no voltages below the rheobase occur in any of the discharge phases , and a corresponding defibrillation method .

the present embodiment will be described in case the concept of chaos of the present invention is applied to a ` pachinko ` machine . fig1 is a schematic diagram showing the pachinko machine of the present embodiment . reference numeral 1 designates a ball shooting grip , and numeral 2 designates a playing board face , which is equipped therein with rewarding catchers 4 , 6 , 7 and 8 , a game indicator 5 , rewarding catchers 3 having functions to start the game unit , and a great - hit catcher 9 . the pachinko balls shot by the shooting machine are bounced in various directions to fly downward over the board face 2 by nails arranged in the board face 2 . when the pachinko ball lands in any of the rewarding catchers 3 , 4 , 6 , 7 and 8 , reward balls are supplied to a ball feed / reserve chute 12 . especially when a ball lands in the rewarding catcher 3 , the game unit is started in addition to the supply of reward balls . this game unit changes indications of three figures in the game indicator 5 and interrupts the changes after lapse of a predetermined time period . the game unit commands the opening of a control valve for the great - hit catcher 9 if a predetermined combination of figures is achieved at the interruption . if this special condition is attained , the great hit causes the pachinko machine to open the great - hit catcher 9 thereby to establish a situation in which the player takes an advantage of catching more pachinko balls . as shown in fig1 the pachinko machine is generally identical without any substantial change in appearance to those used in the prior art . fig4 is a flow chart for applying the concept of chaos of the present invention to the pachinko machine . the pulse wave data fetched from a sensor 40 for collecting the information of the player are converted into a chaos attractor by a numerical operator 41 . the chaos attractor thus converted is then compared with a predetermined defining condition of the chaos , and an index calculated by a calculator 42 from the ljapunov index indicating the degree of satisfying that condition is fed to a computer 43 for controlling the pachinko machine . the indication or information of this computer 43 is fed to changing means 44 for changing the content of the game . thus , this game content is changed according to the situation of the player at that time . the computer 43 may be fed with the data from the pachinko machine itself as other data . these data are enumerated by the reward data of balls to the rewarding catchers , the great - hit data of the game unit or the situation of the control valve of the great - hit catcher 9 . the computer 43 enables the pachinko machine to cope with the various situations by processing those data and sending the commands or data for the various changes to the changing means 44 . in the present embodiment , the chaos attractor obtained from the pulse waves of the player is utilized to change the responses for meeting the pachinko machine . in order to get informed about the psychosomatic state of the player , according to the present embodiment , the ball shooting grip 1 is equipped with a pulse wave sensor for measuring the pulse waves at the fingertip of the player . the ball shooting grip 1 is schematically shown in an enlarged scale in fig2 . this grip 1 can be turned to command the shot itself of the pachinko balls and the shooting intensity . the grip 1 is equipped at its outer circumference with a knob 20 having a function to aid the turning motion . the pachinko balls are usually shot by turning the grip 1 to the right . for this shooting action , the player actuates the grip 1 by applying his fingertip 22 to the lower side 21 of the knob 20 . thus , the pulse wave sensor 25 is fitted in that portion of the knob 20 , at which the fingertip 22 abuts against the lower side 21 . in the present embodiment , the pulse wave sensor is composed of an infrared - emitting diode and a photosensor so that the reflection of the infrared ray emitted from the diode may be sensed by the photosensor to acquire the information of the pulse waves of the player . in an alternative mode of embodiment , the knob of the grip is formed with a finger hole 24 , in which the pulse wave sensor 25 is fitted , as shown in fig3 . in this modification , the sensor can be held in complete contact with the fingertip so that the pulse waves of the player can be acquired more reliably . in another structure , the pulse wave sensor can be disposed in at least such a portion of the ball shooting grip as is grasped by the player . moreover , the sensor to be used should not be limited to that using the photo - coupler but can also utilize a pressure sensor . the pulse wave information thus achieved from the player is converted into the chaos attractor by the arithmetic operation means so that it is recognized as the chaos attractor information indicating the present psychosomatic state of the player . next , the chaos attractor recognized is compared with the chaos attractor which has already been classified and registered . then , the ljapunov number responding to a predetermined level is achieved by the arithmetic operating means so that the responses to be taken by the pachinko machine is changed according to that numerical value . the changes in the responses of the pachinko game and its machine will be specifically described in the following . if the prevailing psychosomatic state of the player is in an &# 34 ; unexcited &# 34 ; situation so that this situation is recognized through the arithmetic operator by arithmetically processing the data obtained from the aforementioned sensor , the rewarding catcher 6 , for example , other than the ordinary game unit starting chucker catcher 3 is set to a concurrent game unit starting chucker catcher . the game unit is also started when a pachinko ball lands in the reset rewarding catcher 6 . the subsequent responses are identical to the ordinary ones so that the great hit is rewarded if the specific combination is obtained among the figures . otherwise , a predetermined number of more balls are returned . thus , the psychosomatic state of the player obtained from the sensor mounted in the shooting grip is arithmetically processed to assign the game to the level under the predetermined condition , e . g ., the &# 34 ; unexcited &# 34 ; level as in this case . then , a command is issued to take a response different from that of the ordinary pachinko machine so that the gate unit can be unintentionally started to attract the interest of the player . in the present embodiment , the unexpected game is started by the pachinko machine so that the game can be changed from that of the ordinary pachinko to make variations . in the embodiment described above , the response of the pachinko game is changed in the game but should not be limited thereto . for example , the circumstances of the player such as the air conditioning , illuminations or musics can also be changed to prevent the player from losing his or her interest . the present embodiment is exemplified by applying the concept of chaos of the present invention to a rotary drum type game machine . if the prevailing psychosomatic state of the player is in the &# 34 ; excited &# 34 ; situation , this situation is recognized through the machine or the numerical operator by arithmetically processing the data obtained from the aforementioned sensor . then , the turning velocity of the rotary drum type game machine can be accelerated to make the player enthusiastic in the game so that he or she may be kept bot . moreover , the content of tho game each be changed by making the time period for the turning of the game machine to halt shorter than the ordinary one so that the player may see the game result earlier . the present embodiment is exemplified by applying the concept of chaos of the present invention to the facilities or a game parlor equipped with a plurality of game machines . specifically , the game parlor is usually arranged with a number of game machines in a block or matrix shape . these game machines are wholly or partially changed into those capable of grasping the prevailing psychosomatic states of the players . the data of these game machines are processed by another computer disposed in the game parlor to grasp the distribution of the games in specific psychosomatic situations . if the distribution of the &# 34 ; unexcited &# 34 ; players is grasped , for example , the kind of music to be served to the parlor is changed to provide the circumstances for the players to get &# 34 ; excited &# 34 ; or &# 34 ; thrilled &# 34 ;. this changing method can fit the prevailing situations of the players by changing the parlor entirely or partially according to the distribution of the players in a specific state . in all the three embodiments described above , the concept of chaos is applied , but this application should not be limitative . even if the application or the concept of chaos is impossible , the conditional level is determined in advance to classify the players so that the game machines can be given the change in the response like the case of applying the concept of chaos . in this modification , various responses can be achieved by changing the predetermined level and the kings of information from the players . according to the construction of the present invention , as has been described hereinbefore , it is possible to provide the contents and circumstances conforming to the prevailing psychosomatic situations of the players . moreover , the contents , responses and circumstances of the games can be changed according to the situations of the players so that the players can continue their interests in the games for a long time without any loss . the game contents are not limited to one pattern but can be changed according to the psychosomatic situations of the players or any of the levels predetermined by the players . thus , it is possible to realize a novel game stressed on the players .

a game machine enabled to make various responses by adding the psychosomatic state and emotion of the player as one of conditions for determining the responding manner . the psychosomatic state of the player is grasped to change the responses in accordance with the psychological state of the player by making use of both a chaos attractor obtained by numerically processing the information sampled from the player and the index indicating the degree how the chaos attractor matches the defining condition of the chaos .

the entire disclosure of u . s . patent application ser . no . 08 / 466 , 934 filed jun . 6 , 1995 is expressly incorporated by reference herein . turning now to fig3 the endovascular measuring apparatus 100 of the invention broadly includes a hollow plunger 102 , a wire stent 104 , a hollow sheath 106 , and a hollow inner catheter 108 attached to a hub 109 . the plunger 102 has a proximal end 110 with a first locking hemostasis valve 112 and a distal end 116 which is affixed to the proximal end 118 of the stent 104 . the hemostasis valve 112 includes an o - ring 113 , and a locking cap 114 . the lumen ( not shown ) of the hollow plunger 102 is dimensioned such that it can slide freely over the body of the hollow inner catheter 108 . the hollow inner catheter 108 serves as a guide for a guidewire 144 and as a tether to hold a soft flexible hollow dilator tip 148 in place at the distal end 146 of the catheter 108 . the tip 148 can be adjusted relative to the distal end 116 of the plunger 102 by sliding the inner catheter 108 within the plunger 102 . once the tip 148 is adjusted to accommodate the compressed stent 104 , the inner catheter 108 is locked into place by tightening the cap 114 onto a threaded portion 117 of the first locking hemostasis valve 112 . the cap 114 is effectively a locking mechanism which compresses the o - ring 113 , thereby fixing or locking the plunger 102 relative to the inner catheter 108 and the tip 148 . the body 120 of the plunger 102 contains a calibrated scale 122 having , e . g ., fifty major divisions 124 spaced at calibrated intervals . the scale 122 is calibrated to adjust for the longitudinal length contraction and diameter expansion experienced by the particular stent 104 when being decompressed ; i . e ., the ratio of the length of the stent when in the sheath to the length of the stent when uncompressed . the proximal end 118 of the wire stent 104 is affixed to the distal end 116 of the plunger 102 by any desirable means such as by heat fusing , insert molding , or gluing with epoxy . the body 128 of the wire stent 104 when uncompressed has a diameter larger than that of the plunger 102 and of the sheath 106 . the distal end 130 of the sheath 106 is open , and the sheath 106 has a diameter slightly larger than that of the body 122 of the plunger 102 so as to be translatable along the plunger body . the sheath 106 is further translatable over the stent 104 due to flexible and deformable characteristics of the stent 104 . it will be appreciated that when the sheath 106 is positioned over the wire stent 104 , the stent 104 contracts and elongates in a manner similar to that discussed in the background of the invention and shown at 132 . the proximal end 131 of the sheath 106 is attached to a second hemostasis valve 133 which is preferably provided with external threads 135 . a second threaded cap 138 containing a second compressible o - ring 140 is screwed onto the proximal end of a second locking hemostasis valve 133 . the second threaded cap 138 mates with the threads 135 of the second locking valve 133 to reversibly fasten the sheath 106 to the plunger 102 . the o - ring is used both to prevent inadvertent slippage of the sheath 106 relative to the plunger 102 by acting as a friction - locking mechanism , and to serve as a hemostasis valve during interventional surgical procedures . by pulling the first locking valve 112 away from the second locking valve 133 ( or pushing the sheath 106 relative to the plunger 102 ), the wire stent 104 can be pulled into the sheath 106 and compressed . conversely , by pushing the first locking valve 112 toward the second locking valve 133 ( or pulling the sheath 106 relative to the plunger 102 ), the distal end 126 of the wire stent 104 can be released and will expand towards its relaxed uncompressed configuration until ( and if ) constrained by the blood vessel in which it is being deployed . it will be appreciated that the second locking valve 133 can be positioned and will lock anywhere along the body 120 of the plunger 102 , thus providing the user with a means to control the length of stent 104 to be deployed . by reading the scale 122 at the location of the proximal - most end 142 of the second locking valve 133 , the length of stent required for deployment within the body cavity 202 at any given time can be determined . in particular , since the scale 122 is preferably calibrated to the ratio of the length of the stent 104 when compressed in the sheath 106 to the length of the stent 104 in its uncompressed state , the reading provided on the calibrated scale will inform the practitioner as to the length of uncompressed stent required to bridge any cavity in any path , regardless of the state that the stent will assume when deployed in the cavity . still referring to fig3 it is noted that both the first and second locking hemostasis valves 112 , 133 are preferably provided with flushing lines 115 , 137 . the lines 116 and 137 permit the spaces between the concentric hollow sheath 106 , hollow catheter 108 , and hollow plunger 102 to be flushed with heparinized saline during the insertion procedure . it is also seen that the hollow catheter 108 extends from the proximal hub 109 past the open distal end 126 of the stent 104 . the catheter 108 has an interior lumen ( not shown ) dimensioned for following a guide wire 144 into the body cavity 202 ( see fig4 ) of a patient . the distal end 146 of the catheter 108 is coupled to the hollow dilator tip 148 . the hollow catheter 108 and dilator tip 148 are capable of transporting a radiopaque contrast medium ( not shown ) used for fluoroscopic viewing . the plunger 102 and the sheath 106 of the apparatus 100 can be made from any durable biocompatible material such as nylon , polyurethane , teflon ®, polyester , pvc , polyethylene , polypropylene , etc ., or various combinations of the above , with or without radiopaque fillers such as barium sulfate or bismuth subcarbonate . the dilator tip 148 can be formed of the same materials as the plunger 102 and sheath 106 , but is preferably formed of a softer durometer material such as shore 80 a polyurethane or pebax nylon with a radiopaque filler or a radiopaque marking band . the measuring apparatus 100 of the invention can be made disposable or reusable . the lumen ( not shown ) of the inner catheter 108 or the annular space 150 between the sheath 106 and plunger 102 can be used to inject radiopaque contrast media into the vessel to assist in placement of the apparatus 100 as discussed above . the stent 104 material can be of the same material and of similar geometry as would be used in an evg , or it may be of a more radiopaque material such as tungsten , stainless steel , gold and the like . the apparatus 100 can be used in virtually any cavitous area of the body such as the urethra , esophagus , biliary duct , blood vessels , etc . or in any surgically made duct or shunt such as those made in the liver during transjugular intrahepatic portosystemic shunt procedures . referring now to fig4 - 7 , the apparatus 100 of the invention is seen with reference to the method of the invention . according to the method of the invention , the measuring apparatus 100 of the invention is initially placed in its fully axially extended position ( see fig4 ), with the sheath 106 covering the entire length of the wire stent 104 which is in turn fully compressed . in this configuration , the second locking valve 133 of the sheath 106 is at its furthest distance from the first locking valve 112 of the plunger 102 , and is aligned with the scale 122 such that the proximal most end 142 of the stop coincides with the “ 0 ” mark 204 on the scale 122 . the tip 148 is adjusted to fit into the sheath 106 by loosening the first locking valve 112 and pulling the inner hollow catheter 108 proximally such that the stepped proximal end 143 of the tip 148 fits into the sheath 106 and the distal end 116 of the plunger 102 abuts the proximal end 118 of the compressed stent 104 . tile distal end 206 of the guide wire 144 is located sufficiently past the body cavity 202 to allow proper placement of the measuring apparatus 100 . when positioning the measuring apparatus 100 , the distal ends of the stent 104 and sheath 106 should typically be located slightly past the distal neck 208 of the body cavity 202 in which the stent 100 is to be deployed ( see fig5 ). this is done to compensate for the tendency of the stent 104 to contract in length when going from its compressed configuration in the sheath 106 to its deployed configuration in the vessel 202 . it should be noted that the flexible hollow dilator tip 148 at the distal end 146 of the catheter 108 is radiopaque . thus , a user may monitor the progress and placement of the measuring apparatus 100 by means of a ti fluoroscope ( not shown ). once the measuring apparatus 100 is properly positioned within the body cavity 202 ( as in fig5 ), the sheath 106 is slowly retracted ( see fig6 ) by first loosening the cap 138 on the second locking valve 133 and then , while holding the plunger 102 stationary , pulling the sheath 106 backwards . as the sheath is retracted , the distal end 126 of the stent 104 is released and expands back towards its uncompressed configuration until it engages the distal neck 208 of the cavity 202 . it will be appreciated that , as the distal end 126 of the stent 104 has an at rest uncompressed diameter greater than the distal neck 208 diameter of the body cavity 202 , the distal end 126 of the stent exerts pressure on the distal neck 208 when it is deployed , causing the distal end 126 of the stent 104 to be locked into place . as mentioned above , the overall length of the stent 104 decreases when it goes from its compressed configuration to its less compressed deployed configuration . it is thus important that the user position the distal end 126 of the stent 104 sufficiently past the distal neck 208 of the body cavity 202 to compensate for this shrinkage . it will be noted , however , that should the practitioner discover after the sheath 106 has been retracted that the distal end 126 of the stent 104 is not positioned far enough into the distal neck 208 of the body cavity 202 , the practitioner need only re - extend the sheath 106 fully over the stent 104 and repeat the above steps of positioning . as indicated by fig7 the sheath 106 is further retracted until the user determines , via fluoroscopy , that the stent 104 is sufficiently deployed so as to bridge the length of the body cavity 202 . as shown in fig7 the length of stent 104 as retractably deployed must be slightly longer than the length of the body cavity 202 . in this manner , the proximal end 718 of the length of retractably deployed stent 104 and the distal end 126 of the stent are positioned respectively within the proximal and distal necks 210 , 208 of the body cavity 202 . once the desired length of stent 104 is retractably deployed , the proximal most end 142 of the second locking valve 133 is used as an indicator on the scale 122 of the plunger 102 . as discussed above , the scale 122 is calibrated such that the indicated number 702 represents the uncompressed length of stent needed to fully bridge the body cavity 202 . in this particular case , the scale 122 indicates 27 mm , signifying that a stent having an at rest , uncompressed length of 27 mm must be used to properly bridge the body cavity 202 which may be , e . g ., 20 mm long . once the measurement is taken , the sheath 106 is re - extended over the stent 104 ( as in fig5 ), thus re - compressing it , and the entire measuring apparatus 100 is withdrawn from the body cavity 202 and the patient . the stent 104 may then be detached from the measuring apparatus 100 by cutting it with , for example , scissors , or a new stent or covered stent ( not shown ) having the same properties and pitch angle as the stent 104 of the measuring apparatus 100 , and having an at rest uncompressed length equal to or proportional to the recorded measurement , may be obtained . in the above example , a 27 mm stent of the same diameter and geometry would thus be obtained . this stent is then inserted into the body cavity 202 for deployment via any known means in the art . as the measurement method of the invention has already determined the proper stent length , the user is only left with the task of properly placing the stent within the body cavity 202 . turning now to fig8 a second embodiment of the apparatus 300 of the invention is seen . in this embodiment , the stent 304 of the measuring apparatus 300 is coated with a microporous or non - porous elastomeric membrane . the apparatus 300 has particular advantageous use where the body cavity 301 has several branching vessels 302 , 303 and a saccular aneurysm 308 . with the measuring apparatus 300 deployed inside the body cavity 301 as shown , the organs and tissues ( not shown ) fed by the branch vessels 302 , 303 can be monitored to determine if they are suffering harmful effects as a result of the blocking of the branch vessels 302 , 303 caused by the non porous stent 304 . for example , if the branch vessels 302 , 303 were to represent arteries which nourish the spinal chord , the lower extremities of the patient can be tested and monitored to determine if blocking of these arteries causes paraplegia in the patient . should such a determination be made , the coated stent can either be cut shorter so as to not block the branch vessels , or the procedure terminated altogether . similarly , when proceeding to bridge an aortic aneurysm , the measuring apparatus can be used with a coated stent to determine whether there is a back flow from , for example , a lumbar artery into the aneurysm , which if not occluded can lead to rupture of the aneurysm . if a back flow is detected , interventional blockage of the lumbar artery with an occlusion device may be required prior to stenting the aorta . in accord with yet another aspect of the invention , a detachable hub and detachable hemostasis valve for use in conjunction with methods for loading and deploying a stent or stent - graft are seen in fig9 and 10 . in particular , a detachable hub 310 for use on the endovascular measuring apparatus 100 of fig3 - 8 ( in lieu of hub 109 ) is seen in fig9 having a cap 312 which screws onto threads 314 , an o - ring 316 , a lumen 317 , and a proximal handle 318 having a luer lock 320 capable of connection to a hemostasis valve or the like . the inner catheter 315 is fed through the lumen 317 of the detachable hub 310 and locked into place by tightening the cap 312 onto the threads 314 , thereby compressing the o - ring 316 . similarly , the detachable hemostasis valve 410 of fig1 is intended to replace the valve lock 112 of fig3 - 8 . the detachable hemostasis valve 410 includes a body portion 412 having proximal threads 414 and distal threads 416 , distal and proximal caps 418 , 420 , a lumen 422 , distal and proximal o - rings 424 , 426 , and a flush port 430 . the inner catheter 108 and plunger 120 pass through the lumen 422 , and when in place , the distal cap 420 can be tightened on the distal threads 416 to compress the distal o - ring 424 and lock the valve onto the plunger 120 . similarly , the proximal cap 418 can be tightened on the proximal threads 414 to compress the proximal o - ring 426 to lock onto the inner catheter 108 . the flush port 430 can be used to enable flushing of the annular space between the plunger 120 and the inner catheter 108 with , e . g ., heparinized saline . with the detachable hub 310 and lock 410 as provided in fig9 and 10 , the method of measuring a desired stent length can be carried out as described above with reference to fig3 - 8 . however , in accord with another aspect of the invention , after the measurement , the provided apparatus can be used for loading and deployment of the measured stent or stent - graft . in particular , after the desired stent length has been measured , the entire measuring apparatus is removed from the body of the patient . preferably , all lumens of the apparatus are then flushed with heparinized saline . the detachable hub 310 ( fig9 ) is then detached an removed , and the detachable lock 410 is detached and removed . with the hub 310 and lock 410 removed , the dilator tip 148 is grabbed an pulled distally , such that the inner catheter 108 is removed completely from the hollow plunger 120 . then , the stent 104 is pulled through and entirely out of the sheath 106 . using a waterproof , sterile , felt - tipped pen or the like , or any other desired mechanism , the stent of stent - graft 104 is marked to the desired length from its distal end 126 ( e , g ., 27 mm from the distal end of the stent ). with the stent marked , the proximal end of the plunger 102 , still connected to the stent 104 , is inserted into the sheath , and through the plunger lock 133 until the proximal end 120 of the plunger sticks out of the distal end of the sheath 106 ; i . e ., the plunger is inserted backwards through the sheath . the proximal end of the plunger sticking out to the distal end of the sheath is then pulled such that the stent or stent - graft 104 is pulled into the sheath and out of the distal end of the sheath to the mark . the stent 104 is then cut at , or just proximal to the marking such that the remaining stent ( with the marking ) with the plunger can be discarded , and the stent in the sheath properly loaded . with the sheath loaded , the introducer system is reassembled by inserting the catheter 108 through the sheath and stent , if desired , by providing a plunger to push out the stent or stent - graft 104 when properly located , and , if desired , by reattaching the hub 310 to the catheter , and the lock 410 to the plunger and catheter . it will be appreciated that the plunger utilized with the loaded sheath can be a new plunger used for deploying the stent 104 , or the remaining portion of the stent utilized in the initial measurements with the excess stent removed from the plunger . the loading and deployment method of the invention as set forth above have numerous advantages . it will be appreciated that since the stent is loaded by pulling the stent with the plunger , there is less opportunity for the stent wires to scrape and perforate the wall of the sheath . in addition , funnels usually required to load the stent are eliminate , and the stent loading operation is simple . further , the stent or stent - graft being utilized is the same unit which was used as the measuring devise , thereby rendering the system less expensive . there have been described and illustrated herein several embodiments of a tubular braided stent and a method of manufacturing the stent of the invention . while particular embodiments of the invention have been described , it is not intended that the invention be limited thereto , as it is intended that the invention be as broad in scope as the art will allow and that the specification be read likewise . thus , while particular stent designs have been disclosed for use with the apparatus of the invention , it will be appreciated that other designs may work as well . for example , while a stent having a homogeneous pitch angle throughout has been disclosed , a stent with a different body and end pitch angle can also be used as disclosed in copending u . s . patent application ser . no . 08 / 388 , 612 , or continuously varying hyperbaloidal stents can be used . furthermore while a particular mechanism for adjusting and locking the sheath relative to the plunger and a similar method for locking the plunger relative to the inner catheter has been disclosed , it will be understood that other mechanisms or no mechanisms may be used as well . also , while a particular type of scale has been disclosed , it will be recognized that any other suitable scales could be used . for example , although a metric scale has been disclosed , an english system scale or any other measurement system scale could also be used . in addition , although a scale has been disclosed printed along the plunger body , the scale may instead include electronic measuring means coupled to an lcd readout . furthermore , although the scale has been disclosed as having a particular calibration , any other calibration could be used . for example , although the scale has been calibrated to account for the contraction experienced by the stent when in an uncompressed configuration , the scale may be calibrated in any other fashion or may be uncalibrated . when uncalibrated , the practitioner can either conduct the necessary mathematics in order to determine the length of uncompressed stent to use , or can cut a stent in its compressed state in a sheath the same diameter as the sheath of the apparatus . in fact , if desired , no scale or calibration is necessarily required on the plunger , as the plunger can be marked by the practitioner during use , and measured afterwards . although this measuring apparatus has been described for use with a self - expanding stent of the wallsten or didcott configuration , it will be appreciated that the measuring apparatus can be calibrated for use with other devices such as balloon expandable palmaz or gianturco stents and the like . the apparatus may also be used to acquire exact measurements of body cavities for data collection and subsequent use for other procedures such as bypass surgery , electrophysical mapping , endoscopic surgery , etc . moreover , while a particular configuration for the dilator tip has been disclosed , it will be appreciated that other configurations or no dilator tip could be used as well . furthermore , while a particular monitoring means has been described for use with the apparatus , it will be understood that any monitoring means can be similarly used . in particular , while the monitoring means were described to be fluoroscopy , other means such as radioscopy and ct scans may also be used . in addition , while a particular method of measuring the deployment length of a stent in a body cavity using the apparatus of the invention has been disclosed , it will be understood by those skilled in the art that details may be altered without changing the nature of the method . it will therefore be appreciated by those skilled in the art that yet other modifications could be made to the provided apparatus and method of the invention without deviating from their spirit and scope as so claimed .

an apparatus and method are disclosed for measuring the desired length of a prosthetic device which is to be implanted in a body cavity of a patient . the apparatus generally includes a helically coiled stent formed of a resiliently - deformable material , a plunger which is connected to the proximal end of the stent , a sheath which slides over the plunger and stent when the plunger and sheath are used to insert and removably deploy the stent into the body cavity , and a scale for measuring an indication of the length of the stent once removably deployed in the body cavity . proximal movement of the sheath to partially deploy the stent causes a length to be indicated on the scale . according to the method of the invention , the helically coiled stent of the apparatus is placed and partially deployed within the body cavity by use of the plunger and sheath of the apparatus . once the stent bridges the body cavity , the scale of the apparatus is used to determine the length of the deployed stent . the apparatus is then removed from the body cavity , and a stent similar to the stent of the apparatus is cut to the length indicated on the scale . in a second embodiment of the apparatus and method , the stent of the measuring apparatus is substantially non - porous to allow occlusion of side vessels extending from the body cavity . the patient is then monitored for any ill effects resulting from the occlusion .

for the purposes of understanding the invention , reference will now be made to the embodiments illustrated in the drawings . it will be understood that no limitation of the scope of the invention is thereby intended . any alterations and further modifications in the described embodiments , and any further applications of the principles of the invention as described herein are contemplated as would normally occur to one skilled in the art to which the invention relates . fig1 - 8 depict one embodiment of the invention . the invented mouthguard 100 is composed of a base unit 102 and tether 104 . the base unit 102 is u - shaped to conform to a user &# 39 ; s mouth and the tether 104 extends from the front of the mouthguard . on the top surface , base unit 102 has a trough 112 running along the inside of the u - shape to fit the user &# 39 ; s upper teeth . in this embodiment , base unit 102 is comprised of three different portions : ( 1 ) a bottom tray 106 , ( 2 ) a top piece 108 and ( 3 ) a color insert 110 . the three components of the base unit are configured to fit together . the bottom tray 106 is u - shaped and will be sized to fit into the user &# 39 ; s mouth . the bottom tray 106 has a double outer wall 116 ( composed of inner wall 124 and outer wall 118 ) that can extend along the front of the mouthguard . if desirable , the double wall 116 can extend along the entire outside labial perimeter of the mouthguard , continuously or in sections . the inner and outer walls 124 , 118 are placed closed together so that a thin space or slot exists between the two in which the color insert 110 can be placed . the outer wall 118 of the double wall 116 has holes 122 that reveal the color insert 110 when it is placed in the slot 120 . the holes in this embodiment are in the shape of an “ x ” and an “ o ”, though the invention is not limited to these shapes . inner wall of the double wall has a “ trap door ” that encloses the slot to ensure that the color insert 110 is firmly set within the slot 120 . the trap door can be seen in detail in fig7 . fig7 is a cut - away depiction of the bottom tray 106 along lines a - a . as can be seen , outer wall 118 is a straight wall with holes 122 in it . inner wall 124 has a lip 126 that projects toward outer wall 118 . once the color strip is placed in the slot between the inner and outer walls , the projecting lip 126 will prevent the color insert from coming out of the slot . the location of projecting lip 126 is shown on inner wall , but it could easily be located on outer wall . top piece 108 is also in a u - shape to conform to the user &# 39 ; s mouth . top piece 108 can have the trough 112 on its upper surface and the bottom surface will conform to the upper surface of the bottom tray 106 . top piece 108 will also have a lip 114 that will come on top of the double wall 116 . lip 114 will help to seal the slot 120 and prevent color insert 110 from coming out of the slot 120 . a typical color tab / insert can be seen in fig9 . it is made of a firm yet malleable material , such as plastic or rubber , and can come in different forms , such as , but not limited to , stickers , decals , or just plain tabs . it can be of all various colors , but is not limited to a solid color as it may include patterns of different sorts as well . this provides an additional advantage over existing mouthguards . with the current molding process , it would be difficult , if not impossible , to incorporate elaborate patterns of any sort , let alone mass produce mouthguards with such patterns . for commercialization purposes , a multitude of different colored inserts can be inexpensively manufactured and packaged with a single mouthguard product . each component of base unit 102 can be easily manufactured using injection molding techniques . other techniques , such as extrusion blow molding , injection blow molding , compression molding , thermal forming or cast pour molding process lost core molding can also be used . bottom tray 106 can be composed of a relatively material that has some durability and flexibility , such as a thermoplastic elastomer ( tpe ). bottom tray 106 will be molded first . double wall 116 , slot 120 , holes 122 and lip 126 are all moldable features and mouthguard bottom tray 106 is easily removed from the mold . bottom tray 106 will be capable of accepting a second shot of a softer , pliable material , such as ethylene vinyl acetate (“ eva ”), on top of it to create top piece 108 during the injection molding process . in this process , the top piece will conform to the shape of the bottom tray 106 and the lip 114 can be shaped to cover both inner and outer walls 118 , 124 of the bottom tray 106 . color insert 110 can be easily manufactured in numerous colors and colored patterns to be included with the base unit 102 . it will be evident to one of skill in the art that any appropriate materials can be used for both the top and bottom pieces . to custom color the mouthguard , the user will choose the appropriately colored color insert 110 that corresponds to the team colors . in order to add the color insert 110 , the user must pull up the outer lip 114 of the top piece 108 and slide the insert into the slot 120 . the lip 114 will naturally return back to its original shape and cover both the tops of the inner and outer walls . alternatively , the color strip can be placed into the slot 120 through appropriate openings in the side or bottom of the mouthguard . after inserting the color insert 110 , the user will custom fit the mouthguard by boiling the mouthguard in water . this boiling process will soften the top piece 108 . afterwards , the mouthguard is placed in the user &# 39 ; s mouth and the user will bite down onto the mouthguard to conform the mouthguard to the teeth . after the mouthguard has cooled , the top piece 108 will be cured and fitted to the user &# 39 ; s teeth . in addition , the top piece 108 will be forced against the double wall 116 and on top of the double wall 116 to seal the slot closed . the configuration of the top piece 108 and the double wall 116 is best seen in fig8 . fig8 shows a cross - sectional view of the two components along line b - b . as can be seen in the detailed figure , the inner wall 124 and outer wall 118 are pressed against one another . this occurs , in part , from the pressure from the user biting down on the mouthguard during the customization process and the resilience of the top piece 108 after being cured through the boil and bite process . fig1 - 11 depict another embodiment that is a similar to the embodiment described above . similar to that embodiment , the mouthguard base unit 201 comprises a top piece 202 , a bottom tray 203 and color insert 204 . the bottom tray 203 has a single outer wall 207 instead of a double wall . single outer wall 207 has holes or revealed sections 206 in the front . top piece 202 has an indented section 210 in the front of it to accommodate the color insert 204 . color insert 204 will be placed in between the single outer wall 207 of bottom tray 203 and indented section 210 of the top piece 202 . during the customization process in which the mouthguard is boiled and custom fitted to the user &# 39 ; s teeth , the color insert will be secured in between the top piece and the bottom tray . fig1 - 14 depict another embodiment in which the top piece 302 does not completely overlay the bottom piece 303 . the top piece 302 only has an outer wall that ends in a lip 307 . only the front teeth come into contact with the top piece 302 at a bite portion 308 . the back teeth come into contact with the trough 304 of the bottom piece 303 . the bottom piece still has the holes 310 in the front of its outer wall 305 . the color insert can be seen through these holes 310 , as shown in fig1 . fig1 depicts another embodiment . unlike the embodiments described above , this embodiment is made of only one piece . similar to the bottom piece of the first embodiment , this mouthguard 401 has a double outer wall 402 and an inner wall 403 that form a trough 404 for the user &# 39 ; s teeth . the double wall 402 creates a slot 406 in which the color insert will fit . the outermost wall of the double wall 402 contains the holes 405 , and the color insert will be visible through these holes . fig1 depicts another embodiment that is similar to the previously described embodiment . in this embodiment , the slot 506 created by the double wall 502 extends all the way to the rear of the mouthguard 501 . this allows the option of adding holes all along the outer wall , in addition to the holes 505 in the front , and using a longer color insert to sit in the slot . the insert will then be visible through these additional holes all along the outer wall . fig1 depicts yet another embodiment that comprises just one piece 601 . it has an outer wall 602 and an inner wall 603 , forming a trough 604 for the user &# 39 ; s teeth . in the outer wall 602 , there is a removable section 605 that contains the holes 606 . this creates a recess or compartment 607 within the front wall of the mouthguard in which the color insert is to be placed . after the color insert is placed in the recess , the removable section is fit back into the recess , thereby firmly securing the color insert . fig1 depicts yet another embodiment that is made of only one piece 701 . the outer wall 702 has a slot 705 cut out in which the color insert 707 is inserted in from the side . the front of the outer wall 702 has holes 706 that penetrate to the back wall of the slot 705 . once the color insert 707 is inserted into the slot 705 , the color will be clearly visible . another means in which this invention can realize the advantage of mass production and easier customization by the user is to generally have a color strip attached to the outer surface of the labial wall of the mouthguard . this can be accomplished in a number of ways . two such ways are depicted in fig1 and 20 . again , like the embodiments described above , these two embodiments are made of only one piece . however , on the outer surface of the outer wall are protrusions 805 and 905 , respectively , on which the color tabs will be attached . these protrusions take the shapes of knobs 805 and ts 905 , respectively . with respect to the knobs 805 , the color tab 806 will have holes 807 to fit around the knobs , and that are spaced appropriately apart to allow the tab 806 to fit tightly against the face of the outer wall 802 . the ts 905 of the other embodiment perform a similar function of securing the color tab 906 to the body 901 . the color tab 906 will likely have to be of greater thickness than the tabs / inserts of the previous embodiments so that it may include the sister connections 907 to the t - shaped protrusions 905 . another means to accomplish this may be done by using a decal or sticker to stick to the front of the labial wall of the mouthguard , thereby eliminating the need for protrusions on the outer wall . the present invention may be embodied in other specific forms without departing from the spirit or general characteristics thereof ; therefore , the embodiments described herein are to be considered in all respects illustrative and not restrictive . the scope of the invention is to be indicated by the appended claims , rather than by the foregoing description .

this invention relates to a protective mouthguard for use by athletes that incorporates a color customizable feature , allowing users to customize the visible color of the mouthguard . the invented protective mouthguard has a u - shaped base that will fit inside of a user &# 39 ; s mouth . the front surface of the mouthguard can be visible when the mouthguard is worn by the user inside of his mouth . a colorable strip is placed inside a cavity in the front wall of the mouthguard and is visible through holes that are placed in the front wall .

a venturi tube , or venturi , usable in a deheading system embodying features of the invention is shown in fig2 . the venturi 16 is a restricted portion of a conduit 18 enclosing a fluid channel 19 conveying a shrimp - laden fluid along a fluid path 20 . the conduit has an open entrance end 22 and an opposite open exit end 23 downstream of the entrance end . an input portion 24 of the conduit extends downstream from the entrance end 22 and defines the fluid channel with a cross - sectional area a 1 . a transition portion 26 of the conduit extends downstream from the input portion 24 to the venturi 16 . the transition portion 26 defines a length of the fluid channel with a converging cross - sectional area formed by two pairs of converging parabolic walls : large walls 25 and small walls 27 . the venturi 16 has a cross - sectional area a 2 that is less than that of the input portion 24 . in the example of fig2 , the shape of the cross - sectional area a 2 of the venturi is rectangular , but may be other shapes , e . g ., elliptical or oval , having a minor axis 28 shorter than its major axis 29 . the venturi 16 extends downstream to an open end 30 . in fig2 , the venturi &# 39 ; s end 30 opens into a downstream transition portion 32 of the conduit defining a length of the fluid channel 19 diverging outward from the cross - sectional area a 2 of the venturi to a larger cross - sectional area of an output portion 34 of the conduit . in this example , the output portion 34 has the same cross - sectional area a 1 as the input portion 24 . thus , the conduit 18 in fig2 is reversible . but the downstream transitional portion 32 may be eliminated and replaced with a flat plate having an opening forming an end wall of the output portion 34 at the open end 30 of the venturi 16 . as shown in fig3 a - 3c , the transition portion of the conduit 18 may be gradual ( fig3 a with a 30 ° taper of the long parabolic walls 25 relative to the direction of the fluid path 20 and a long length ), sharp ( fig3 c with a 60 ° taper of the long parabolic walls 25 and a short length ), or intermediate ( fig3 b with a 45 ° taper of the long parabolic walls 25 and an intermediate length ). the sharp transition portion 26 of fig3 causes a more abrupt acceleration of the fluid through the channel than the longer tapers of fig3 a and 3b and is more useful for sturdier shrimp . as indicated by the convergence of streamlines 36 in the transition portion 26 of the conduit , the flow accelerates to a higher speed in the venturi 16 . the converging flow tends to orient the shrimp along the streamlines by minimizing the surface area broadside to the flow . the hydrodynamic forces caused by the rapid acceleration of the flow at the venturi and by the non - uniformity of the flow just upstream of the venturi is sufficient to detach heads from the shrimp . the major axis 29 of the venturi cross - sectional area a 2 is long enough to admit a major portion of , if not all , the length of a shrimp into the venturi without severe collisions with the interior walls of the conduit that could break the shrimp between segments . for this reason , the venturi of fig2 is especially useful for deheading fragile cold - water shrimp . one version of a complete deheading system 40 is shown in fig4 a and 4b . shrimp are conveyed out of a feed tank 42 by a conveyor belt 44 and dropped into a fluid - filled trough 46 . a food pump 48 draws shrimp - laden fluid from the trough 46 and pumps it into a conduit system 50 , which has two venturis 52 , 53 at spaced apart locations along its length . shrimp are deheaded in the venturis and conveyed by the fluid through the conduit system to a feed plenum 54 . the shrimp bodies and detached heads drop from the plenum onto a screen slide 56 . the fluid drains through the screen and into a tank 58 in fluid communication with the trough 46 . a perforated plate 60 between the tank and the trough prevents shrimp in the trough from entering the tank 58 . the food pump 48 is driven by a pump motor 62 . together , the pump and the motor form flow control means that controls the flow rate and the fluid speed through the conduit system . the deheading system shown in fig5 has five venturis 64 connected in series in a conduit system 66 . a food pump 68 induces a flow through the conduit system 66 . such a multiple - venturi system can be effective for deheading sturdy shrimp . the deheading system of fig6 adds fluid - pressure sensor 69 at sensor locations in the conduit system 66 , for example , at locations just upstream of the final four venturis 64 to measure the hydrodynamic force of the flow . the outputs 70 of the pressure sensors control valves 72 connected between a boost pump 74 and fluid lines 76 injecting fluid into the conduit system at injection locations 78 near the sensor locations , for example , to replace any leaked fluid and to maintain the fluid pressure along the length of the fluid channel . although the invention has been described in detail with respect to a few versions , other versions are possible . for example , if large - diameter conduit , such as ten - inch — diameter pipes instead of 4 - inch — diameter pipes , the cross - sectional area of the venturis could be circular or square because the diameter of the circular opening or the lengths of the sides of the square opening would be large enough to allow shrimp through without damaging collisions with the walls of the conduit . as another example , a complete system using only a single venturi may be sufficient to detach heads from the shrimp in some situations . so , as these suggestions suggest , the claims are not meant to be limited to the details of the exemplary embodiments .

apparatus and methods for deheading shrimp using the venturi effect . a shrimp - laden fluid is pumped through a conduit system and lined with one or more venturi tubes . the acceleration of the fluid through the venturis detaches the heads from the shrimp . the cross - sectional areas of the venturis each have a major axis and a shorter minor axis . the major axis is long enough to receive the majority of or all the length of a shrimp and minimize hard collisions with the entrance to the venturi that could damage the shrimp .

the present invention provides recombinantly produced pfs230 and fragments derived from the protein that are useful for inducing an immune response when injected into a human or other host animal . pfs230 and homologs in other plasmodium species can be used to block transmission of a number of parasites associated with malaria . four species of the genus plasmodium infect humans , p . vivax , p . ovale , p . malariae , and p . falciparum . in addition other plasmodium species infect other animals . for instance , p . gallinaceum is responsible for avian malaria . pfs230 is expressed by the parasite while it undergoes gametocytogenesis in the human host . this antigen has been identified on day 2 of gametocytogenesis and continues to be produced as the gametocyte is taken up by the mosquito in a blood meal and emerges from the erythrocyte in the mosquito midgut . once the parasite emerges from the erythrocyte , pfs230 is exposed on the surface of the parasite , and is thus in contact with the components of the bloodmeal including antibodies and complement . the 9 . 4 kb open reading frame of the nucleic acid encoding pfs230 predicts a protein with a molecular weight of 363 , 243 daltons . pfs230 exists in at least two forms , a 360 kda form that does not radiolabel with 125 i and a 125 i radiolabeled form isolated from surface labeled gametes . the labeled form when sized under reducing conditions migrates as a 310 , 000 molecular weight band . these results suggest that the full - length 360 kda protein is processed to a 310 kda protein that is expressed on the surface of the gamete . a prior art mab 1b3 has been reported to immunoprecipitate a 230 kda protein from radiolabeled surface proteins of newly formed gametes and zygotes . this monoclonal antibody was reported to recognize two proteins of 260 , 000 and 230 , 000 mr on western blots . quakyi , et al ., j . immunol . 139 : 4213 - 4217 ( 1987 ), which is incorporated herein by reference . evidence provided here shows that the protein encoded by the gene of the present invention is the same protein as that recognized by mab 1b3 . in particular , antisera raised against fusion proteins expressed from the nucleic acids of the invention recognized bands similar to those reported for pfs230 . the antisera also immunoprecipitates 125 i - labeled pfs230 and reacts with the surface of intact gametes as assayed by indirect immunofluorescence . seq . id . no . 2 is the deduced amino acid sequence of the 9 . 4 kb gene . the deduced amino acid sequence of pfs230 codes for a 363 kda polypeptide having five distinct characteristics : 1 ) consistent with pfs230 being a non - integral membrane protein ( kumar & amp ; wizel , mol . biochem . parasitol ., 53 : 113 - 120 ( 1992 )), there is a presumptive signal sequence at the amino - terminus , but no other predicted hydrophobic or transmembrane regions ; 2 ) starting at amino acid 280 , there are 25 contiguous e residues ; 3 ) beginning with amino acid 379 , a four amino acid ( e - e - v - g ) ( seq id no : 3 ) repeat is repeated tandemly 8 times followed by 4 copies of an eight amino acid ( e - e - v - g - e - e / g - e / v - g ) ( seq id no : 4 ) repeat ; 4 ) there are three regions of highly negative net charge , including amino acids 273 - 325 , which contain the 25 e residues , amino acids 1147 - 1205 , and amino acids 1604 - 1668 ; and 5 ) there are six copies of a seven cysteine motif with the consensus sequence . the pfs230 proteins of the invention may be recombinantly produced or may be purified from parasites isolated from infected host organisms . methods for purifying desired proteins are well known in the art and are not presented in detail here . for a review of standard techniques see , methods in enzymology , &# 34 ; guide to protein purification &# 34 ;, m . deutscher , ed . vol . 182 ( 1990 ), which is incorporated herein by reference . for instance , pfs230 or its homologs in other species can be purified using affinity chromatography , sds - page , and the like . another aspect of the present invention relates to the cloning and recombinant expression of pfs230 and its homologs . the recombinantly expressed polypeptides can be used in a number of ways . for instance , they can be used as transmission - blocking vaccines , as described below . the recombinantly produced proteins can also be used for raising antibodies or for t cell and b cell epitope mapping . in addition , oligonucleotides from the cloned genes can be used as probes to identify homologous polypeptides in other species . the invention relies on routine techniques in the field of recombinant genetics , well known to those of ordinary skill in the art . a basic text disclosing the general methods of use in this invention is sambrook et al ., molecular cloning , a laboratory manual , cold spring harbor publish ., cold spring harbor , n . y . 2nd ed . ( 1989 ), which is incorporated herein by reference . pfs230 was immunoaffinity purified using mab 1b3 as described in detail below . the isolated protein was then digested with trypsin . the tryptic peptides were separated by reverse phase hplc and three well resolved peptides were microsequenced . from this amino acid sequence degenerate oligonucleotide probes were used to screen a p . falciparum sexual stage cdna library . other methods for isolating genes encoding pfs230 and its homologs can also be used . for instance , the amino acid sequence of the n - terminus can be determined and degenerate oligonucleotide probes , designed to hybridize to the desired gene , are synthesized . amino acid sequencing is performed and oligonucleotide probes are synthesized according to standard techniques as described , for instance , in sambrook et al ., supra . oligonucleotide probes useful for identification of desired genes can also be prepared from conserved regions of related genes in other species . for instance , probes derived from a gene encoding pfs230 may be used to screen libraries for homologous genes from other parasites of interest . other methods include the detection of restriction fragment length polymorphisms ( rflp ) between wild type and mutant strains lacking a pfs230 polypeptide . amplification techniques , such as the polymerase chain reaction ( pcr ) can be used to amplify the desired nucleotide sequence . u . s . pat . nos . 4 , 683 , 195 and 4 , 683 , 202 describe this method . sequences amplified by pcr can be purified from agarose gels and cloned into an appropriate vector according to standard techniques . genomic or cdna libraries are prepared according to standard techniques as described , for instance , in sambrook , supra . to construct genomic libraries , large segments of genomic dna are generated by random fragmentation or restriction enzyme degradation and are ligated with vector dna to form concatemers that can be packaged into the appropriate vector . two kinds of vectors are commonly used for this purpose , bacteriophage lambda vectors and plasmids . to prepare cdna , mrna from the parasite of interest is first isolated . eukaryotic mrna has at its 3 &# 39 ; end a string of adenine nucleotide residues known as the poly - a tail . short chains of oligo d - t nucleotides are then hybridized with the poly - a tails and serve as a primer for the enzyme , reverse transcriptase . this enzyme uses rna as a template to synthesize a complementary dna ( cdna ) strand . a second dna strand is then synthesized using the first cdna strand as a template . linkers are added to the double - stranded cdna for insertion into a plasmid or phage vector for propagation in e . coli . identification of clones in either genomic or cdna libraries harboring the desired nucleic acid segments is performed by either nucleic acid hybridization or immunological detection of the encoded protein , if an expression vector is used . the bacterial colonies are then replica plated on solid support , such as nitrocellulose filters . the cells are lysed and probed with either oligonucleotide probes described above or with antibodies to the desired protein . standard transfection methods are used to produce prokaryotic , mammalian , yeast or insect cell lines which express large quantities of the pfs230 polypeptide , which is then purified using standard techniques . see , e . g ., colley et al ., j . biol . chem . 264 : 17619 - 17622 , 1989 ; and guide to protein purification , supra . the nucleotide sequences used to transfect the host cells can be modified to yield the pfs230 polypeptide or fragments thereof , with a variety of desired properties . for example , the polypeptides can vary from the naturally - occuring sequence at the primary structure level by amino acid , insertions , substitutions , deletions , and the like . these modifications can be used in a number of combinations to produce the final modified protein chain . the amino acid sequence variants can be prepared with various objectives in mind , including facilitating purification and preparation of the recombinant polypeptide . the modified polypeptides are also useful for modifying plasma half life , improving therapeutic efficacy , and lessening the severity or occurrence of side effects during therapeutic use . the amino acid sequence variants are usually predetermined variants not found in nature but exhibit the same immunogenic activity as naturally occurring pfs230 . for instance , immunogenically active fragments comprising about 6 to about 300 amino acids are typically used . shorter fragments comprising bout 100 to about 200 amino acids , preferably about 130 to about 160 , may also be used . for use as vaccines , immunologically active fragments are typically preferred so long as at least one epitope capable of eliciting transmission blocking antibodies remains . preferred polypeptide fragments of the invention include those comprising one or more of the six copies of the seven - cysteine motif noted above . other modifications include the addition of a membrane anchoring sequence to the expressed protein . such modifications allow the protein to be expressed on cell surfaces and thereby improve immunogenicity . in general , modifications of the sequences encoding the homologous polypeptides may be readily accomplished by a variety of well - known techniques , such as site - directed mutagenesis ( see , gillman and smith , gene 8 : 81 - 97 , 1979 ) and roberts , s . et al ., nature 328 : 731 - 734 , 1987 ). one of ordinary skill will appreciate that the effect of many mutations is difficult to predict . thus , most modifications are evaluated by routine screening in a suitable assay for the desired characteristic . for instance , the effect of various modifications on the ability of the polypeptide to elicit transmission blocking can be easily determined using the mosquito feeding assays , described in quakyi et al ., supra . in addition , changes in the immunological character of the polypeptide can be detected by an appropriate competitive binding assay . modifications of other properties such as redox or thermal stability , hydrophobicity , susceptibility to proteolysis , or the tendency to aggregate are all assayed according to standard techniques . the particular procedure used to introduce the genetic material into the host cell for expression of the pfs230 polypeptide is not particularly critical . any of the well known procedures for introducing foreign nucleotide sequences into host cells may be used . these include the use of calcium phosphate transfection , spheroplasts , electroporation , liposomes , microinjection , plasmid vectors , viral vectors and any of the other well known methods for introducing cloned genomic dna , cdna , synthetic dna or other foreign genetic material into a host cell ( see sambrook et al ., supra ). it is only necessary that the particular procedure utilized be capable of successfully introducing at least one gene into the host cell which is capable of expressing the gene . the particular vector used to transport the genetic information into the cell is also not particularly critical . any of the conventional vectors used for expression of recombinant proteins in prokaryotic and eukaryotic cells may be used . expression vectors for mammalian cells typically contain regulatory elements from eukaryotic viruses . sv40 vectors include psvt7 and pmt2 . vectors derived from bovine papilloma virus include pbv - 1mtha , and vectors derived from epstein bar virus include phebo , and p205 . other exemplary vectors include pre4 , pmsg , pav009 / a + , pmt010 / a + , pmamneo - 5 , bacculovirus pdsve , and any other vector allowing expression of proteins under the direction of the sv - 40 early promoter , sv - 40 later promoter , metallothionein promoter , murine mammary tumor virus promoter , rous sarcoma virus promoter , polyhedrin promoter , cytomegalovirus promoter , or other promoters shown effective for expression in eukaryotic cells . the expression vector typically contains a transcription unit or expression cassette that contains all the elements required for the expression of the pfs230 polypeptide dna in the host cells . a typical expression cassette contains a promoter operably linked to the dna sequence encoding a pfs230 polypeptide and signals required for efficient polyadenylation of the transcript . the term &# 34 ; operably linked &# 34 ; as used herein refers to linkage of a promoter upstream from a dna sequence such that the promoter mediates transcription of the dna sequence . the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting . as is known in the art , however , some variation in this distance can be accommodated without loss of promoter function . the dna sequence encoding the pfs230 polypeptide will typically be linked to a cleavable signal peptide sequence to promote secretion of the encoded protein by the transformed cell . additional elements of the cassette may include selectable markers , enhancers and , if genomic dna is used as the structural gene , introns with functional splice donor and acceptor sites . enhancer elements can stimulate transcription up to 1 , 000 fold from linked homologous or heterologous promoters . enhancers are active when placed downstream from the transcription initiation site . many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues . for example , the sv40 early gene enhancer is suitable for many cell types . other enhancer / promoter combinations that are suitable for the present invention include those derived from polyoma virus , human or murine cytomegalovirus , the long term repeat from various retroviruses such as murine leukemia virus , murine or rous sarcoma virus and hiv . see , enhancers and eukaryotic expression , cold spring harbor pres , cold spring harbor , n . y . 1983 , which is incorporated herein by reference . in addition to a promoter sequence , the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination . the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes . if the mrna encoded by the structural gene is to be efficiently translated , polyadenylation sequences are also commonly added to the vector construct . two distinct sequence elements are required for accurate and efficient polyadenylation : gu or u rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides , aauaaa , located 11 - 30 nucleotides upstream . termination and polyadenylation signals that are suitable for the present invention include those derived from sv40 , or a partial genomic copy of a gene already resident on the expression vector . efficient expression and secretion in yeast is conveniently obtained using expression vectors based on those disclosed in barr et al ., j . biol . chem . 263 : 16471 - 16478 , 1988 , or u . s . pat . no . 4 , 546 , 082 , which are incorporated herein by reference . in these vectors the desired sequences are linked to sequences encoding the yeast α - factor pheromone secretory signal / leader sequence . suitable promoters to use include the adh2 / gapdh hybrid promoter as described in cousens et al ., gene 61 : 265 - 275 ( 1987 ), which is incorporated herein by reference . yeast cell lines suitable for the present invention include bj 2168 ( berkeley yeast stock center ) as well as other commonly available lines . any of a number of other well known cells and cell lines can be used to express the polypeptides of the invention . for instance , prokaryotic cells such as e . coli can be used . eukaryotic cells include , chinese hamster ovary ( cho ) cells , cos cells , mouse l cells , mouse a9 cells , baby hamster kidney cells , c127 cells , pc8 cells , and insect cells . following the growth of the recombinant cells and expression of the pfs230 polypeptide , the culture medium is harvested for purification of the secreted protein . the media are typically clarified by centrifugation or filtration to remove cells and cell debris and the proteins are concentrated by adsorption to any suitable resin or by use of ammonium sulfate fractionation , polyethylene glycol precipitation , or by ultrafiltration . other routine means known in the art may be equally suitable . further purification of the pfs230 polypeptide can be accomplished by standard techniques , for example , affinity chromatography , ion exchange chromatography , sizing chromatography , his 6 tagging and ni - agarose chromatography ( as described in dobeli et al . mol . and biochem . parasit . 41 : 259 - 268 ( 1990 )), or other protein purification techniques to obtain homogeneity . the purified proteins are then used to produce pharmaceutical compositions , as described below . a further aspect of the invention includes antibodies against pfs230 or its homologous polypeptides . the antibodies are useful for blocking transmission of parasites . thus , antibodies can be used as therapeutic agents to block transmission . the multitude of techniques available to those skilled in the art for production and manipulation of various immunoglobulin molecules can be readily applied to block transmission . as used herein , the term &# 34 ; immunoglobulin &# 34 ; refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes . the recognized immunoglobulin genes include the kappa , lambda , alpha , gamma , delta , epsilon and mu constant region genes , as well as the myriad immunoglobulin variable region genes . immunoglobulins may exist in a variety of forms besides antibodies , including for example , fv , fab , and f ( ab ) 2 , as well as in single chains . for a general review of immunoglobulin structure and function see , fundamental immunology , 2d ed ., w . e . paul ed ., ravens press , new york , ( 1989 ) which is incorporated herein by reference . monoclonal antibodies which bind pfs230 can be produced by a variety of means . the production of non - human monoclonal antibodies , e . g ., murine , lagomorpha , equine , etc ., is well known and may be accomplished by , for example , immunizing the animal with a preparation containing pfs230 . antibody - producing cells obtained from the immunized animals are immortalized and screened , or screened first for the production antibodies which bind pfs230 and then immortalized . for a discussion of general procedures of monoclonal antibody production see harlow and lane , antibodies , a laboratory manual cold spring harbor publications , new york ( 1988 ), which is incorporated herein by reference . it may be desirable to transfer the antigen binding regions of the non - human antibodies , e . g ., the f ( ab &# 39 ;) 2 or hypervariable regions , to human constant regions ( fc ) or framework regions by recombinant dna techniques to produce substantially human molecules . such methods are generally known in the art and are described in , for example , u . s . pat . no . 4 , 816 , 397 , ep publications 173 , 494 and 239 , 400 , which are incorporated herein by reference . alternatively , one may isolate dna sequences which encode a human monoclonal antibody or portions thereof that specifically bind to pfs230 by screening a dna library from human b cells according to the general protocol outlined by huse et al ., science 246 : 1275 - 1281 ( 1989 ), incorporated herein by reference , and then cloning and amplifying the sequences which encode the antibody ( or binding fragment ) of the desired specificity . the pfs230 polypeptides of the present invention are also useful as prophylactics , or vaccines , for blocking transmission of malaria or other diseases caused by parasites . compositions containing the polypeptides are administered to a subject , giving rise to an anti - pfs230 polypeptide immune response . the pfs230 polypeptide - specific antibodies then block transmission of the parasite from the subject to the arthropod vector , preventing the parasite from completing its life cycle . an amount of prophylactic composition sufficient to result in blocking of transmission is defined to be an &# 34 ; immunologically effective dose .&# 34 ; the isolated nucleic acid sequence coding for pfs230 or its homologous polypeptides can also be used to transform viruses which transfect host cells in the susceptible organism . live attenuated viruses , such as vaccinia or adenovirus , are convenient alternatives for vaccines because they are inexpensive to produce and are easily transported and administered . vaccinia vectors and methods useful in immunization protocols are described in , e . g ., u . s . pat . no . 4 , 722 , 848 , incorporated herein by reference . suitable viruses for use in the present invention include , but are not limited to , pox viruses , such as , canarypox and cowpox viruses , and vaccinia viruses , alpha viruses , adenoviruses , and other animal viruses . the recombinant viruses can be produced by methods well known in the art : for example , using homologous recombination or ligating two plasmids together . a recombinant canarypox or cowpox virus can be made , for example , by inserting the gene encoding the pfs230 , immunologically active segment of pfs230 or other homologous polypeptide into a plasmid so that it is flanked with viral sequences on both sides . the gene is then inserted into the virus genome through homologous recombination . the recombinant virus of the present invention can be used to induce anti - pfs230 polypeptide antibodies in mammals , such as mice or humans . in addition , the recombinant virus can be used to produce the pfs230 polypeptides by infecting host cells which in turn express the polypeptide . the present invention also relates to host cells infected with the recombinant virus of the present invention . the host cells of the present invention are preferably eukaryotic , such as yeast cells , or mammalian , such as bsc - 1 cells . host cells infected with the recombinant virus express the pfs230 polypeptides on their cell surfaces . in addition , membrane extracts of the infected cells induce transmission blocking antibodies when used to inoculate or boost previously inoculated mammals . in the case of vaccinia virus ( for example , strain wr ), the sequence encoding the pfs230 polypeptides can be inserted into the viral genome by a number of methods including homologous recombination using a transfer vector , ptkgpt - ofis as described in kaslow et al ., science 252 : 1310 - 1313 , 1991 , which is incorporated herein by reference . the pfs230 polypeptides , or recombinant viruses of the present invention can be used in pharmaceutical and vaccine compositions that are useful for administration to mammals , particularly humans , to block transmission of a variety of infectious diseases . the compositions are suitable for single administrations or a series of administrations . when given as a series , inoculations subsequent to the initial administration are given to boost the immune response and are typically referred to as booster inoculations . suitable formulations are found in remington &# 39 ; s pharmaceutical sciences , mack publishing company , philadelphia , pa ., 17th ed . ( 1985 ), which is incorporated herein by reference . the pharmaceutical compositions of the invention are intended for parenteral or oral administration . preferably , the pharmaceutical compositions are administered parenterally , e . g ., subcutaneously , intradermally , or intramuscularly . thus , the invention provides compositions for parenteral administration that comprise a solution of the agents described above dissolved or suspended in an acceptable carrier , preferably an aqueous carrier . a variety of aqueous carriers may be used , e . g ., water , buffered water , 0 . 4 % saline , 0 . 3 % glycine , hyaluronic acid and the like . these compositions may be sterilized by conventional , well known sterilization techniques , or may be sterile filtered . the resulting aqueous solutions may be packaged for use as is , or lyophilized , the lyophilized preparation being combined with a sterile solution prior to administration . the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions , such as ph adjusting and buffering agents , tonicity adjusting agents , wetting agents and the like , for example , sodium acetate , sodium lactate , sodium chloride , potassium chloride , calcium chloride , sorbitan monolaurate , triethanolamine oleate , etc . for solid compositions , conventional nontoxic solid carriers may be used which include , for example , pharmaceutical grades of mannitol , lactose , starch , magnesium stearate , sodium saccharin , talcum , cellulose , glucose , sucrose , magnesium carbonate , and the like . for oral administration , a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients , such as those carriers previously listed , and generally 10 - 95 % of active ingredient and more preferably at a concentration of 25 %- 75 %. in therapeutic applications , pfs230 polypeptides or viruses of the invention are administered to a patient in an amount sufficient to prevent parasite development in the arthropod and thus block transmission of the disease . an amount adequate to accomplish this is defined as a &# 34 ; therapeutically effective dose .&# 34 ; amounts effective for this use will depend on , e . g ., the particular polypeptide or virus , the manner of administration , the weight and general state of health of the patient , and the judgment of the prescribing physician . the vaccines of the invention contain as an active ingredient an immunogenically effective amount of the pfs230 polypeptides or recombinant virus as described herein . useful carriers are well known in the art , and include , e . g ., thyroglobulin , albumins such as human serum albumin , tetanus toxoid , polyamino acids such as poly ( d - lysine : d - glutamic acid ), influenza , hepatitis b virus core protein , hepatitis b virus recombinant vaccine and the like . the vaccines can also contain a physiologically tolerable ( acceptable ) diluent such as water , phosphate buffered saline , or saline , and further typically include an adjuvant . adjuvants such as incomplete freund &# 39 ; s adjuvant , aluminum phosphate , aluminum hydroxide , or alum are materials well known in the art . in addition , the compositions can be administered in slow release particles as described in langer , science 249 : 1527 - 1533 ( 1990 ). vaccine compositions containing the polypeptides or viruses of the invention are administered to a patient to elicit a transmission - blocking immune response against the antigen and thus prevent spread of the disease through the arthropod vector . such an amount is defined as an &# 34 ; immunogenically effective dose .&# 34 ; in this use , the precise amounts again depend on the patient &# 39 ; s state of health and weight , the mode of administration , and the nature of the formulation , but generally range for the initial immunization ( that is for therapeutic or prophylactic administration ) from about 1 . 0 μg to about 1 mg of peptide for a 70 kg patient , followed by boosting dosages of from about 1 . 0 μg to about 100 μg of peptide pursuant to a boosting regimen over weeks to months . the following examples are offered by way of illustration , not by way of limitation . pfs230 was immunoaffinity purified using monoclonal 1b3 ( mab 1b3 ) ( quakyi , et al ., j . immunol ., 139 : 4213 - 4217 ( 1987 )). it was electroeluted from mab 1b3 - resin prepared as described in williamson , et al ., anal . biochem ., 206 : 359 - 362 ( 1992 ), reduced and alkylated , run in one lane of a 4 % gel and then transferred electrophoretically to nitrocellulose . the band corresponding to pfs230 was excised then digested in situ with trypsin . the tryptic peptides were separated by reverse phase hplc and three well resolved peptides were microsequenced . from this amino acid sequence degenerate oligonucleotide probes were designed utilizing p . falciparum codon bias and used to screen a p . falciparum sexual stage cdna library prepared according to standard techniques . fig1 shows the results of the samples from each of the purification steps which were size - fractionated on a 4 - 20 % sds - polyacrylamide gel and stained with coomassie blue . the lanes in gel are as follows : gamete / zygote extract before 1b3 - sepharose resin ( lane 1 ), proteins that did not bind to the 1b3 - sepharose resin ( lane 2 ), molecular weight standards ( amersham ) ( lane 3 ) and protein electroeluted from 1b3 - sepharose resin ( lane 4 ). the molecular weight ( mr × 10 3 ) is indicated on the left and the position of pfs230 is indicated on the right . oligonucleotide probes from each of the three tryptic peptides hybridized to a 4 . 4 kb insert of an isolated clone . sequencing revealed open reading frames at both the 5 &# 39 ; and 3 &# 39 ; ends of the 4 . 4 kb clone , therefore synthetic oligonucleotides probes corresponding to the ends were used to rescreen the library and obtain overlapping clones that extend the sequence . this process was continued until cdna clones covering the entire 9 . 4 kb open reading frame were isolated . the deduced amino acid sequence of the 9 . 4 kb gene ( seq . id . no . 2 ) contains all 3 tryptic peptides that were microsequenced . the pfs230 rna transcript is 12 . 5 kb and sexual stage - specific as shown in the northern analysis of p . falciparum rna in fig2 . equal amounts of rna were run in each lane ( 1 ) asexual , ( 2 ) gametocytes ( stage 2 & amp ; 3 ), and ( 3 ) zygotes / gametes ( 5 hours post emergence ). the blot was probed with the random - prime labeled 4 . 4 kb insert described above . the message is most abundant in gametocytes . with a long exposure of the northern a faint band can be seen in rna from 5 hour zygotes but there is no band with asexual rna . oligonucleotide probes from the extreme 5 &# 39 ; and 3 &# 39 ; ends of the orf hybridize to what appears to be the same transcript . the 9 . 4 kb open reading frame predicts a protein with a molecular weight of 363 , 243 kda , this is larger than the 260 , 000 and 230 , 000 mr reported for the proteins mab 1b3 recognizes by western blot . only the 230 , 000 band was shown to be radiolabeled when live gametes were surface - labeled with 125 i . since mab 1b3 does not react with reduced pfs230 it has been difficult to obtain an accurate molecular weight of the protein . quakyi , et al ., supra . prior art estimates of the size of the protein have been made with molecular weight standards having molecular weights less than 200 kda . to more accurately determine the molecular weight , radiolabeled pfs230 from surface labeled gametes was carefully sized under reducing conditions using molecular weight markers ranging from 100 , 000 to 500 , 000 . reduced 125 i labeled pfs230 migrated as a 310 , 000 molecular weight band ( fig3 ). to confirm that the cloned gene was indeed pfs230 , antibodies to a 2 . 0 - 2 . 2 kb section of the gene expressed in e . coli as fusions with maltose - binding protein ( rpfs230 / mbp - a e - b , described below ) were used to assay a western blot of triton x - 100 extracted p . falciparum gametes / zygotes . fig4 a and 4b show western blots of triton x - 100 extracted 125 i - surface - labeled gametes reacted with a 1 : 5 , 000 dilution of mpb antisera ( lane 1 ), rpfs230 / mbp - a antisera ( lane 2 ), and rpfs230 / mbp - b antisera ( lane 3 ). also shown is an autoradiograph of rpfs230 / mbp - b ( lane 4 ). when the extract was size - fractionated under nonreducing conditions the rpfs230 / mbp - a and - b antisera recognized bands of 325 , 000 kda and 275 , 000 kda , and under reducing conditions bands of 360 , 000 kda and 310 , 000 kda ( fig4 a and 4b , respectively . neither preimmune sera nor antisera to mbp alone reacted with any specific bands . the lower bands , under both reducing and nonreducing conditions comigrated with 125 i labeled pfs230 ( fig4 a and 4b ). this suggests that only the lower band was exposed on the surface of the gamete . possibly , the 360 , 000 protein is processed to a 310 , 000 form as it is moved to the surface of the gamete . to determine whether the rpfs230 / mbp antisera recognized the native ( nondenatured ) surface form of pfs230 , the antisera was used to immunoprecipitate radiolabeled pfs230 from a triton x - 100 extract of surface - labeled p . falciparum gametes / zygotes ( fig5 ). proteins immunoprecipitated by the following antibodies or antisera were loaded on the gel : mab 1b3 ( lane 1 ), rpfs230 / mbp a antisera ( lane 2 ), rpfs230 / mbp - b ( lane 3 ) and mbp antisera ( lane 4 ). the antibodies and antisera were incubated with a triton x - 100 extract of 125 - i surface labeled gametes and precipitated with protein a - sepharose as described above . the precipitated material was run out on a 4 - 20 % acrylamide gel . the radiolabeled bands were visualized by autoradiography . fig5 shows that 125 i - labeled pfs230 was precipitated by rpfs230 / mbp 1b antisera and monoclonal 1b3 but not mbp antisera . finally , an indirect immunofluorescence assay of intact gametes / zygotes was used to show that rpfs230 / mbp - a and b antisera recognized the surface of live gametes / zygotes ( fig6 a and 7a ). fig6 b and 7b , respectively , are the corresponding bright field image . fig8 a shows the results of the same experiment with mbp antisera . fig8 b is the corresponding bright field image . pfs230 open reading frame was pcr - amplified using a sense primer with a 5 &# 39 ; sma i site encoding amino acids 439 - 444 for rpfs230 / mbp - a or amino acids 2398 - 2405 for rpfs230 / mbp - b , and an antisense primer with a 3 &# 39 ; stop codon followed by a sal i site encoding amino acid 1127 - 1135 for rpfs230 / mbp - a or nucleotides 9607 - 9624 in the 3 &# 39 ; untranslated region for rpfs230 / mbp - b . gel - purified pcr products were ligated into stu i / sma i cut pih - 902 expression vector ( gift of paul riggs , new england biolabs ). iptg - induced rpfs230 - maltose binding protein fusion was purified from an extract of e . coli ( dh10b strain , brl ) on amylose resin and use to immumize nih outbred mice according to the method of rawlings , et al ., j . biol . chem ., 267 : 3976 - 3982 ( 1992 ). although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 4 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 9636 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( ix ) feature :( a ) name / key : cds ( b ) location : 149 .. 9556 ( xi ) sequence description : seq id no : 1 : tattttttttattttttttatttttttatttttttattatttttatttttttattttttt60tatttttttatttttatatttttatattttttttcttctaccattcttttatccttcttg120atcgtatatttttcttttcttttaataaatgaagaaaattataacgctgaag172metlyslysileilethrleulys15aatctattcctcattatcctggtatacatatttagcgagaaaaaagac220asnleupheleuileileleuvaltyrilepheserglulyslysasp101520ctgcgttgtaatgtgataaagggaaataatattaaggatgatgaagat268leuargcysasnvalilelysglyasnasnilelysaspaspgluasp25303540aagagattccacttattttattattcccacaacctttttaagacaccc316lysargphehisleuphetyrtyrserhisasnleuphelysthrpro455055gaaacaaaagaaaagaagaataaaaaggagtgcttttataaaaatggt364gluthrlysglulyslysasnlyslysglucysphetyrlysasngly606570ggtatttataatttatctaaagaaataaggatgagaaaggatacatcc412glyiletyrasnleuserlysgluileargmetarglysaspthrser758085gtaaaaataaaacaaagaacatgtccctttcataaagaaggaagttca460vallysilelysglnargthrcysprophehislysgluglyserser9095100tttgaaatgggttcaaagaatattacatgtttttatcctatcgtaggg508pheglumetglyserlysasnilethrcysphetyrproilevalgly105110115120aagaaggaaaggaaaacactggacacaattattataaaaaagaatgta556lyslysgluarglysthrleuaspthrileileilelyslysasnval125130135acaaatgatcatgttgttagtagtgatatgcattccaatgtacaagaa604thrasnasphisvalvalserseraspmethisserasnvalglnglu140145150aaaaatatgatattaataagaaatatagataaagaaaataaaaatgat652lysasnmetileleuileargasnileasplysgluasnlysasnasp155160165atacaaaatgttgaggaaaaaatacaaagggatacatacgaaaataaa700ileglnasnvalgluglulysileglnargaspthrtyrgluasnlys170175180gattatgaaagtgatgatacacttatagaatggtttgatgataataca748asptyrgluseraspaspthrleuileglutrppheaspaspasnthr185190195200aatgaagaaaactttttactaacttttttaaaaaggtgcttgatgaaa796asnglugluasnpheleuleuthrpheleulysargcysleumetlys205210215atattttcttcacccaaaagaaaaaaaactgtagtacaaaaaaaacat844ilepheserserprolysarglyslysthrvalvalglnlyslyshis220225230aagtctaatttttttataaacagttcgttgaaatatatatatatgtat892lysserasnphepheileasnserserleulystyriletyrmettyr235240245ttaaccccctcggatagctttaacctagtacgtcgaaacagaaatttg940leuthrproseraspserpheasnleuvalargargasnargasnleu250255260gatgaggaagacatgtcgcccagggataattttgtaatagatgatgag988aspglugluaspmetserproargaspasnphevalileaspaspglu265270275280gaagaagaggaggaggaagaagaagaggaagaggaagaagaggaagaa1036gluglugluglugluglugluglugluglugluglugluglugluglu285290295gaagaagaagaggaggaggaagaatatgatgattatgtttatgaagaa1084gluglugluglugluglugluglutyraspasptyrvaltyrgluglu300305310agtggggatgaaacagaagaacaattacaagaggaacatcaggaagaa1132serglyaspgluthrglugluglnleuglnglugluhisglngluglu315320325gtaggtgctgaatcttcagaagaaagttttaatgatgaggatgaagat1180valglyalagluserserglugluserpheasnaspgluaspgluasp330335340tctgtagaagcacgggatggagatatgataagagttgacgaatattat1228servalglualaargaspglyaspmetileargvalaspglutyrtyr345350355360gaagaccaagatggtgatacttatgatagtacaataaaaaatgaagat1276gluaspglnaspglyaspthrtyraspserthrilelysasngluasp365370375gtagatgaagaggtaggtgaagaggtaggtgaagaggtaggtgaagag1324valaspglugluvalglyglugluvalglyglugluvalglygluglu380385390gtaggtgaagaggtaggtgaagaggtaggtgaagaggtaggtgaagag1372valglyglugluvalglyglugluvalglyglugluvalglygluglu395400405gtaggtgaagaggtaggtgaagaagaaggtgaagaggtaggtgaaggg1420valglyglugluvalglygluglugluglyglugluvalglyglugly410415420gtaggtgaagaggtaggtgaagaagaaggtgaagaggtaggtgaagaa1468valglyglugluvalglygluglugluglyglugluvalglygluglu425430435440gaaggtgaatatgtagatgaaaaagaaaggcaaggtgaaatatatcca1516gluglyglutyrvalaspglulysgluargglnglygluiletyrpro445450455tttggtgatgaagaagaaaaagatgaaggtggagaaagttttacctat1564pheglyaspglugluglulysaspgluglyglygluserphethrtyr460465470gaaaagagcgaggttgataaaacagatttgtttaaatttatagaaggg1612glulyssergluvalasplysthraspleuphelyspheileglugly475480485ggtgaaggagatgatgtatataaagtggatggttccaaagttttatta1660glygluglyaspaspvaltyrlysvalaspglyserlysvalleuleu490495500gatgatgatacaattagtagagtatctaaaaaacatactgcacgagat1708aspaspaspthrileserargvalserlyslyshisthralaargasp505510515520ggtgaatatggtgaatatggtgaagctgtcgaagatggagaaaatgtt1756glyglutyrglyglutyrglyglualavalgluaspglygluasnval525530535ataaaaataattagaagtgtgttacaaagtggtgcattaccaagtgta1804ilelysileileargservalleuglnserglyalaleuproserval540545550ggtgttgatgagttagataaaatcgatttgtcatatgaaacaacagaa1852glyvalaspgluleuasplysileaspleusertyrgluthrthrglu555560565agtggagatactgctgtatccgaagattcatatgataaatatgcatct1900serglyaspthralavalsergluaspsertyrasplystyralaser570575580aataatacaaataaagaatacgtttgtgattttacagatcaattaaaa1948asnasnthrasnlysglutyrvalcysaspphethraspglnleulys585590595600ccaacagaaagtggtcctaaagtaaaaaaatgtgaagtaaaagttaat1996prothrgluserglyprolysvallyslyscysgluvallysvalasn605610615gagccattaataaaagtaaaaataatatgtccattaaaaggttctgta2044gluproleuilelysvallysileilecysproleulysglyserval620625630gaaaaattatatgataatatagaatatgtacctaaaaaaagcccatat2092glulysleutyraspasnileglutyrvalprolyslysserprotyr635640645gttgttttaacaaaagaggaaactaaactaaaggaaaaacttctctcg2140valvalleuthrlysglugluthrlysleulysglulysleuleuser650655660aaacttatttatggtttattaatatctccgacggttaacgaaaaggag2188lysleuiletyrglyleuleuileserprothrvalasnglulysglu665670675680aataattttaaagaaggtgttattgaatttactcttccccctgtggta2236asnasnphelysgluglyvalilegluphethrleuproprovalval685690695cacaaggcaacagtgttttattttatatgtgataattcaaaaacagaa2284hislysalathrvalphetyrpheilecysaspasnserlysthrglu700705710gatgataacaaaaaaggaaatagagggattgtagaagtgtatgtagaa2332aspaspasnlyslysglyasnargglyilevalgluvaltyrvalglu715720725ccatatggtaataaaattaatggatgtgctttcttggatgaagatgaa2380protyrglyasnlysileasnglycysalapheleuaspgluaspglu730735740gaagaagaaaaatatggtaatcaaattgaagaagatgaacataatgag2428glugluglulystyrglyasnglnileglugluaspgluhisasnglu745750755760aagataaaaatgaaaacattctttacccagaatatatataaaaaaaat2476lysilelysmetlysthrphephethrglnasniletyrlyslysasn765770775aatatatatccatgttatatgaaattatatagcggagatataggtggt2524asniletyrprocystyrmetlysleutyrserglyaspileglygly780785790attctatttcctaagaatataaaatcaacaacgtgttttgaagagatg2572ileleupheprolysasnilelysserthrthrcysphegluglumet795800805ataccttataataaagaaataaaatggaataaagaaaataaaagttta2620ileprotyrasnlysgluilelystrpasnlysgluasnlysserleu810815820ggtaacttagttaataattctgtagtatataataaagagatgaatgca2668glyasnleuvalasnasnservalvaltyrasnlysglumetasnala825830835840aaatattttaatgttcagtatgttcacattcctacaagttataaagat2716lystyrpheasnvalglntyrvalhisileprothrsertyrlysasp845850855acattaaatttattttgtagtattatattaaaagaagaggaaagtaat2764thrleuasnleuphecysserileileleulysgluglugluserasn860865870ttaatttctacttcttatttagtatatgtaagtattaatgaagaatta2812leuileserthrsertyrleuvaltyrvalserileasnglugluleu875880885aatttttcacttttcgatttttatgaatcatttgtacctataaaaaaa2860asnpheserleupheaspphetyrgluserphevalproilelyslys890895900accatacaagtagctcaaaagaatgtaaataataaagaacatgattat2908thrileglnvalalaglnlysasnvalasnasnlysgluhisasptyr905910915920acatgtgattttaccgataaattagataaaacggttccttctactgct2956thrcysaspphethrasplysleuasplysthrvalproserthrala925930935aatgggaagaaattatttatatgtagaaagcatttaaaagaatttgat3004asnglylyslysleupheilecysarglyshisleulysglupheasp940945950acatttaccttaaaatgtaatgttaataaaacacaatatccaaatatc3052thrphethrleulyscysasnvalasnlysthrglntyrproasnile955960965gagatatttcctaaaacattaaaagataaaaaggaagtattaaaatta3100gluilepheprolysthrleulysasplyslysgluvalleulysleu970975980gatcttgatatacaatatcaaatgtttagtaaattttttaaattcaat3148aspleuaspileglntyrglnmetpheserlysphephelyspheasn9859909951000acacagaatgcaaagtatttaaatttatatccatattatttaattttt3196thrglnasnalalystyrleuasnleutyrprotyrtyrleuilephe100510101015ccatttaatcatataggaaaaaaagaattaaaaaataatcctacatat3244propheasnhisileglylyslysgluleulysasnasnprothrtyr102010251030aaaaatcataaagatgtgaaatattttgagcaatcatctgtattatct3292lysasnhislysaspvallystyrphegluglnserservalleuser103510401045cccttatcttccgcagacagtttagggaaattattaaattttttagat3340proleuserseralaaspserleuglylysleuleuasnpheleuasp105010551060actcaagagacggtatgtcttacggaaaagataagatatttaaattta3388thrglngluthrvalcysleuthrglulysileargtyrleuasnleu1065107010751080agtatcaatgagttaggatctgataataatacattttctgtaacattt3436serileasngluleuglyseraspasnasnthrpheservalthrphe108510901095caggttccaccatatatagatattaaggaacctttttattttatgttt3484glnvalproprotyrileaspilelysgluprophetyrphemetphe110011051110ggttgtaataataataaaggtgaagggaatatcggaattgttgaatta3532glycysasnasnasnlysglygluglyasnileglyilevalgluleu111511201125ttaatatctaagcaagaagaaaagattaaaggatgtaatttccatgaa3580leuileserlysglngluglulysilelysglycysasnphehisglu113011351140tctaaattagattatttcaatgaaaacatttctagtgatacacatgaa3628serlysleuasptyrpheasngluasnileserseraspthrhisglu1145115011551160tgtacattgcatgcatatgaaaatgatataattggatttaattgttta3676cysthrleuhisalatyrgluasnaspileileglypheasncysleu116511701175gaaactactcatcctaatgaggttgaggttgaagttgaagatgctgaa3724gluthrthrhisproasngluvalgluvalgluvalgluaspalaglu118011851190atatatcttcaacctgagaattgttttaataatgtatataaaggattg3772iletyrleuglnprogluasncyspheasnasnvaltyrlysglyleu119512001205aattctgttgatattactactatattaaaaaatgcacaaacatataat3820asnservalaspilethrthrileleulysasnalaglnthrtyrasn121012151220ataaataataagaaaacacctacctttttaaaaattccaccatataat3868ileasnasnlyslysthrprothrpheleulysileproprotyrasn1225123012351240ttattagaagatgtcgaaattagttgccaatgtactattaaacaagtt3916leuleugluaspvalgluilesercysglncysthrilelysglnval124512501255gttaaaaaaataaaagttattataaccaaaaatgatacagtattatta3964vallyslysilelysvalileilethrlysasnaspthrvalleuleu126012651270aaaagagaagtgcaatctgagtctacattagatgataaaatatataaa4012lysarggluvalglnsergluserthrleuaspasplysiletyrlys127512801285tgtgaacatgaaaattttattaatccaagagtaaataaaacatttgat4060cysgluhisgluasnpheileasnproargvalasnlysthrpheasp129012951300gaaaatgtagaatatacatgtaatataaaaatagagaatttctttaat4108gluasnvalglutyrthrcysasnilelysilegluasnphepheasn1305131013151320tatattcaaatattttgtccagccaaagatcttggtatttataaaaat4156tyrileglnilephecysproalalysaspleuglyiletyrlysasn132513301335atacaaatgtattatgatattgtaaaaccaacaagagtaccacaattt4204ileglnmettyrtyraspilevallysprothrargvalproglnphe134013451350aaaaaatttaataatgaagaattacataaattaattcctaattcagaa4252lyslyspheasnasnglugluleuhislysleuileproasnserglu135513601365atgttacataaaacaaaagaaatgttaattttatataatgaagaaaaa4300metleuhislysthrlysglumetleuileleutyrasngluglulys137013751380gtggatctattacatttttatgtattcttaccaatatatataaaagac4348valaspleuleuhisphetyrvalpheleuproiletyrilelysasp1385139013951400atatatgaattcaatatagtatgtgataattcaaaaacaatgtggaaa4396iletyrglupheasnilevalcysaspasnserlysthrmettrplys140514101415aatcaattaggaggaaaagttatatatcatattactgtttcaaaaaga4444asnglnleuglyglylysvaliletyrhisilethrvalserlysarg142014251430gagcagaaagtaaaaggttgttcatttgataatgaacatgcacatatg4492gluglnlysvallysglycysserpheaspasngluhisalahismet143514401445tttagttataataaaactaatgtaaaaaattgtattatagatgctaaa4540phesertyrasnlysthrasnvallysasncysileileaspalalys145014551460cctaaagatttgataggtttcgtttgtccctctggtaccttaaaatta4588prolysaspleuileglyphevalcysproserglythrleulysleu1465147014751480acaaattgttttaaagatgcaatagtacatacaaatttaacaaatatt4636thrasncysphelysaspalailevalhisthrasnleuthrasnile148514901495aatggtatactttatttaaaaaataatttggctaactttacatataaa4684asnglyileleutyrleulysasnasnleualaasnphethrtyrlys150015051510catcaatttaattatatggaaataccagctttaatggataatgatata4732hisglnpheasntyrmetgluileproalaleumetaspasnaspile151515201525tcatttaaatgtatatgtgttgatttaaaaaaaaaaaaatataatgtc4780serphelyscysilecysvalaspleulyslyslyslystyrasnval153015351540aaatcaccattaggacctaaagttttacgtgctctttataaaaaatta4828lysserproleuglyprolysvalleuargalaleutyrlyslysleu1545155015551560aatataaaatttgataattatgttactggcactgatcaaaataaatat4876asnilelyspheaspasntyrvalthrglythraspglnasnlystyr156515701575cttatgacatatatggatttacatttatctcataaacgtaattattta4924leumetthrtyrmetaspleuhisleuserhislysargasntyrleu158015851590aaggaattatttcatgatttaggtaaaaaaaaaccagcagatacagat4972lysgluleuphehisaspleuglylyslyslysproalaaspthrasp159516001605gctaaccctgaatctattatcgaatctttaagtattaatgaatctaat5020alaasnprogluserileilegluserleuserileasngluserasn161016151620gaatctggaccttttccaaccggggatgtagatgcagaacatttaata5068gluserglypropheprothrglyaspvalaspalagluhisleuile1625163016351640ttagaaggatatgatacatgggaaagtttatatgatgaacaattagaa5116leugluglytyraspthrtrpgluserleutyraspgluglnleuglu164516501655gaagttatatataatgatattgaatctttagaattaaaagatattgaa5164gluvaliletyrasnaspilegluserleugluleulysaspileglu166016651670caatatgttttacaagttaatttaaaagctccaaaattaatgatgtct5212glntyrvalleuglnvalasnleulysalaprolysleumetmetser167516801685gctcaaattcataataatagacatgtatgtgatttctcaaaaaataat5260alaglnilehisasnasnarghisvalcysasppheserlysasnasn169016951700ttaattgtaccagaatcattaaaaaaaaaagaagagcttggtggtaat5308leuilevalprogluserleulyslyslysglugluleuglyglyasn1705171017151720ccagtaaatattcattgttatgcattattaaaacctttagatacatta5356provalasnilehiscystyralaleuleulysproleuaspthrleu172517301735tatgtaaaatgtcctacatcaaaagataattatgaagctgctaaagta5404tyrvallyscysprothrserlysaspasntyrglualaalalysval174017451750aacatatctgaaaacgacaatgaatatgagttacaagttatatcatta5452asnilesergluasnaspasnglutyrgluleuglnvalileserleu175517601765atcgaaaaaagatttcataattttgagacgttagaatcgaagaaacct5500ileglulysargphehisasnphegluthrleugluserlyslyspro177017751780ggaaatggagatgtagtagtacataatggtgttgtagatactggacct5548glyasnglyaspvalvalvalhisasnglyvalvalaspthrglypro1785179017951800gtattagataacagtacatttgaaaaatattttaaaaatataaaaata5596valleuaspasnserthrpheglulystyrphelysasnilelysile180518101815aaaccagataaattttttgagaaagttataaatgaatatgatgatact5644lysproasplysphepheglulysvalileasnglutyraspaspthr182018251830gaagaagaaaaagatttagaaagtatattacctggggctattgttagt5692glugluglulysaspleugluserileleuproglyalailevalser183518401845cctatgaaagttttaaaaaaaaaggatccttttacatcatatgctgct5740prometlysvalleulyslyslysaspprophethrsertyralaala185018551860tttgttgttccaccaattgttcccaaagatttacattttaaagtagaa5788phevalvalproproilevalprolysaspleuhisphelysvalglu1865187018751880tgtaataatacagaatataaagatgaaaatcaatatataagtggatat5836cysasnasnthrglutyrlysaspgluasnglntyrileserglytyr188518901895aatggtataatacatattgatatatcaaatagtaataggaaaattaat5884asnglyileilehisileaspileserasnserasnarglysileasn190019051910ggatgtgatttctctacgaacaatagttctattttaacatccagtgta5932glycysasppheserthrasnasnserserileleuthrserserval191519201925aaattagtaaatggagaaactaaaaattgtgaaataaatataaataat5980lysleuvalasnglygluthrlysasncysgluileasnileasnasn193019351940aatgaagtatttggtatcatatgtgataatgaaacaaatttagatcca6028asngluvalpheglyileilecysaspasngluthrasnleuasppro1945195019551960gaaaaatgttttcatgaaatatatagtaaagataataaaactgtaaaa6076glulyscysphehisgluiletyrserlysaspasnlysthrvallys196519701975aaatttcgtgaagttatacctaatatagatatattctcattacataat6124lysphearggluvalileproasnileaspilepheserleuhisasn198019851990tctaataagaaaaaagttgcatatgctaaagtacctttagattatatt6172serasnlyslyslysvalalatyralalysvalproleuasptyrile199520002005aataaattattattttcttgttcatgtaaaacatcacatactaataca6220asnlysleuleuphesercyssercyslysthrserhisthrasnthr201020152020ataggtaccatgaaagttactctaaataaagatgaaaaagaagaagaa6268ileglythrmetlysvalthrleuasnlysaspglulysglugluglu2025203020352040gattttaaaacagctcaaggtattaaacataataatgtacatttatgt6316aspphelysthralaglnglyilelyshisasnasnvalhisleucys204520502055aatttctttgataatcctgaattaacatttgataataataaaatagtt6364asnphepheaspasnprogluleuthrpheaspasnasnlysileval206020652070ttatgtaaaatcgatgcagaactgttctcagaagtaattatacaatta6412leucyslysileaspalagluleuphesergluvalileileglnleu207520802085ccaatatttggaacaaagaatgtagaagaaggagtacaaaatgaagaa6460proilepheglythrlysasnvalglugluglyvalglnasngluglu209020952100tataaaaaattttcattaaaaccatcattagtttttgatgataacaat6508tyrlyslyspheserleulysproserleuvalpheaspaspasnasn2105211021152120aatgatattaaagttataggaaaagaaaaaaatgaagtatctattagt6556asnaspilelysvalileglylysglulysasngluvalserileser212521302135ttagctttgaaaggggtttatggaaatcgaatttttacttttgataaa6604leualaleulysglyvaltyrglyasnargilephethrpheasplys214021452150aatggaaaaaaaggagaaggaattagtttttttatacctccaataaaa6652asnglylyslysglygluglyileserphepheileproproilelys215521602165caagatacagatttaaaatttataattaatgaaacaatagataattca6700glnaspthraspleulyspheileileasngluthrileaspasnser217021752180aatattaaacaaagaggattaatatatatttttgttaggaaaaatgta6748asnilelysglnargglyleuiletyrilephevalarglysasnval2185219021952200tcagaaaattcatttaaattatgtgatttcacaacaggttcgacttca6796sergluasnserphelysleucysaspphethrthrglyserthrser220522102215ttaatggaattaaatagtcaagtaaaagaaaaaaagtgcactgttaaa6844leumetgluleuasnserglnvallysglulyslyscysthrvallys222022252230attaaaaaaggagatatttttggattgaaatgtcctaaaggttttgct6892ilelyslysglyaspilepheglyleulyscysprolysglypheala223522402245atatttccacaagcatgttttagtaatgttttattagaatattataaa6940ilepheproglnalacyspheserasnvalleuleuglutyrtyrlys225022552260agtgattatgaagatagtgaacatattaattattatattcataaagat6988serasptyrgluaspsergluhisileasntyrtyrilehislysasp2265227022752280aaaaaatataatttaaaacctaaagatgttattgaattaatggatgaa7036lyslystyrasnleulysprolysaspvalilegluleumetaspglu228522902295aattttagagaattacaaaatatacaacaatatacaggaatatcaaat7084asnphearggluleuglnasnileglnglntyrthrglyileserasn230023052310attacagatgtgttacatttcaaaaattttaatttaggtaatctacca7132ilethraspvalleuhisphelysasnpheasnleuglyasnleupro231523202325ttaaattttaaaaatcattattctacagcatatgctaaagtaccagat7180leuasnphelysasnhistyrserthralatyralalysvalproasp233023352340acctttaattctattattaacttctcatgtaattgttataatccagaa7228thrpheasnserileileasnphesercysasncystyrasnproglu2345235023552360aaacatgtatatggtactatgcaagttgagtctgataatcgaaatttt7276lyshisvaltyrglythrmetglnvalgluseraspasnargasnphe236523702375gataatattaaaaaaaatgaaaatgttataaaaaatttccttttacct7324aspasnilelyslysasngluasnvalilelysasnpheleuleupro238023852390aatatagaaaaatatgcactactattagatgatgaagaaagacaaaaa7372asnileglulystyralaleuleuleuaspaspglugluargglnlys239524002405aaaataaaacaacaacaagaagaagaacaacaagaacaaatattaaaa7420lysilelysglnglnglngluglugluglnglngluglnileleulys241024152420gatcaagatgatagattaagcagacatgatgattataataaaaatcat7468aspglnaspaspargleuserarghisaspasptyrasnlysasnhis2425243024352440acatatatactatatgattcaaatgaacatatatgtgattatgaaaaa7516thrtyrileleutyraspserasngluhisilecysasptyrglulys244524502455aatgaatcactcatatcaacattacctaatgatacaaaaaaaatacaa7564asngluserleuileserthrleuproasnaspthrlyslysilegln246024652470aaaagtatctgtaaaattaatgcaaaagcattagatgttgttacaatt7612lysserilecyslysileasnalalysalaleuaspvalvalthrile247524802485aaatgtcctcatacaaaaaattttacgcctaaagattattttcctaat7660lyscysprohisthrlysasnphethrprolysasptyrpheproasn249024952500tcttcattaataactaatgataaaaaaattgtgattacttttgataag7708serserleuilethrasnasplyslysilevalilethrpheasplys2505251025152520aaaaattttgttacttatatagatcctacaaaaaaaacattttctttg7756lysasnphevalthrtyrileaspprothrlyslysthrpheserleu252525302535aaagatatatatatacaaagtttttatggtgtttctcttgatcatctt7804lysaspiletyrileglnserphetyrglyvalserleuasphisleu254025452550aatcaaataaaaaaaatacatgaagaatgggatgatgtacatttattt7852asnglnilelyslysilehisgluglutrpaspaspvalhisleuphe255525602565tatcctcctcataatgtattacataatgttgtacttaataatcatata7900tyrproprohisasnvalleuhisasnvalvalleuasnasnhisile257025752580gtcaacttatcatctgcattagaaggagtcttatttatgaaatcaaaa7948valasnleuserseralaleugluglyvalleuphemetlysserlys2585259025952600gttactggagatgaaacagctacaaaaaaaaacactacactaccaact7996valthrglyaspgluthralathrlyslysasnthrthrleuprothr260526102615gatggtgtatcaagtattttaattccaccatatgtaaaggaagatata8044aspglyvalserserileleuileproprotyrvallysgluaspile262026252630acatttcatcttttttgtgggaaatctacaacaaaaaaaccaaacaaa8092thrphehisleuphecysglylysserthrthrlyslysproasnlys263526402645aagaacacatctcttgcacttattcatatacatatatcatcaaacaga8140lysasnthrserleualaleuilehisilehisileserserasnarg265026552660aatattattcatggatgtgatttcttatatttagaaaatcaaacaaat8188asnileilehisglycysasppheleutyrleugluasnglnthrasn2665267026752680gatgctattagtaataataataataattcatattctatatttacacat8236aspalaileserasnasnasnasnasnsertyrserilephethrhis268526902695aataaaaatacagagaataatctaatatgtgatatatctttaattcca8284asnlysasnthrgluasnasnleuilecysaspileserleuilepro270027052710aaaactgttataggaattaaatgtcctaataaaaaattaaatccacaa8332lysthrvalileglyilelyscysproasnlyslysleuasnprogln271527202725acatgttttgatgaagtgtattatgttaaacaagaagatgtaccttcg8380thrcyspheaspgluvaltyrtyrvallysglngluaspvalproser273027352740aaaactataacagctgataaatataatacatttagtaaagacaaaata8428lysthrilethralaasplystyrasnthrpheserlysasplysile2745275027552760ggaaatatattaaaaaatgcaatctctattaataatccagatgaaaag8476glyasnileleulysasnalaileserileasnasnproaspglulys276527702775gataatacatatacttatttaatattaccagaaaaatttgaagaagaa8524aspasnthrtyrthrtyrleuileleuproglulyspheglugluglu278027852790ttaatcgataccaaaaaagttttagcttgtacatgtgataataaatat8572leuileaspthrlyslysvalleualacysthrcysaspasnlystyr279528002805ataatacatatgaaaatagaaaaaagtacaatggataaaataaaaata8620ileilehismetlysileglulysserthrmetasplysilelysile281028152820gatgaaaaaaaaacaattggtaaagatatatgtaaatatgatgttact8668aspglulyslysthrileglylysaspilecyslystyraspvalthr2825283028352840actaaagttgctacttgtgaaattattgatacaattgattcgtctgta8716thrlysvalalathrcysgluileileaspthrileaspserserval284528502855ttaaaagaacatcatacagtacattattctattacattatcaagatgg8764leulysgluhishisthrvalhistyrserilethrleuserargtrp286028652870gataaacttattattaaatatccaacaaatgagaaaacacatttcgaa8812asplysleuileilelystyrprothrasnglulysthrhispheglu287528802885aatttttttgttaatccttttaatttaaaagataaagttttatataat8860asnphephevalasnpropheasnleulysasplysvalleutyrasn289028952900tataataaaccaataaatatagaacatatcttaccaggagccattaca8908tyrasnlysproileasnilegluhisileleuproglyalailethr2905291029152920acagatatatatgataccagaacaaaaattaaacaatatatattaaga8956thraspiletyraspthrargthrlysilelysglntyrileleuarg292529302935attccaccatatgtacataaagatatacatttctcattagaatttaac9004ileproprotyrvalhislysaspilehispheserleuglupheasn294029452950aatagcctaagtttaacaaaacaaaatcaaaatattatttatggaaat9052asnserleuserleuthrlysglnasnglnasnileiletyrglyasn295529602965gtagccaaaatttttattcatataaatcaaggatataaagaaattcat9100valalalysilepheilehisileasnglnglytyrlysgluilehis297029752980ggatgtgatttcacaggaaaatattcccatttatttacatattcaaaa9148glycysaspphethrglylystyrserhisleuphethrtyrserlys2985299029953000aaacctttaccaaatgatgatgatatatgtaatgtaactataggtaat9196lysproleuproasnaspaspaspilecysasnvalthrileglyasn300530103015aatacattctcaggttttgcatgcttaagccattttgaattaaaacca9244asnthrpheserglyphealacysleuserhisphegluleulyspro302030253030aataactgcttctcatctgtttatgattataatgaagccaataaagtt9292asnasncyspheserservaltyrasptyrasnglualaasnlysval303530403045aaaaaattattcgatctatccacaaaagtagaattagaccatatcaaa9340lyslysleupheaspleuserthrlysvalgluleuasphisilelys305030553060caaaatacttcaggatatacactatcatatattatttttaataaagaa9388glnasnthrserglytyrthrleusertyrileilepheasnlysglu3065307030753080tccacaaaacttaaattctcatgtacatgctcatccaactattcaaat9436serthrlysleulysphesercysthrcysserserasntyrserasn308530903095tatactatacgaatcacatttgatcctaattatataatcccagaacct9484tyrthrileargilethrpheaspproasntyrileileproglupro310031053110caatcaagagccatcattaaatatgtagatctgcaagataaaaatttt9532glnserargalaileilelystyrvalaspleuglnasplysasnphe311531203125gcaaaatacttgagaaagctttaaatcgtaaataattaatcaaacatatat9583alalystyrleuarglysleu31303135ataatcaaaaggataatatattagaacacacatatatatgtaaaaaaaaaaaa9636 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 3135 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : protein ( xi ) sequence description : seq id no : 2 : metlyslysileilethrleulysasnleupheleuileileleuval151015tyrilepheserglulyslysaspleuargcysasnvalilelysgly202530asnasnilelysaspaspgluasplysargphehisleuphetyrtyr354045serhisasnleuphelysthrprogluthrlysglulyslysasnlys505560lysglucysphetyrlysasnglyglyiletyrasnleuserlysglu65707580ileargmetarglysaspthrservallysilelysglnargthrcys859095prophehislysgluglyserserpheglumetglyserlysasnile100105110thrcysphetyrproilevalglylyslysgluarglysthrleuasp115120125thrileileilelyslysasnvalthrasnasphisvalvalserser130135140aspmethisserasnvalglnglulysasnmetileleuileargasn145150155160ileasplysgluasnlysasnaspileglnasnvalgluglulysile165170175glnargaspthrtyrgluasnlysasptyrgluseraspaspthrleu180185190ileglutrppheaspaspasnthrasnglugluasnpheleuleuthr195200205pheleulysargcysleumetlysilepheserserprolysarglys210215220lysthrvalvalglnlyslyshislysserasnphepheileasnser225230235240serleulystyriletyrmettyrleuthrproseraspserpheasn245250255leuvalargargasnargasnleuaspglugluaspmetserproarg260265270aspasnphevalileaspaspglugluglugluglugluglugluglu275280285gluglugluglugluglugluglugluglugluglugluglugluglu290295300tyraspasptyrvaltyrglugluserglyaspgluthrgluglugln305310315320leuglnglugluhisglnglugluvalglyalaglusersergluglu325330335serpheasnaspgluaspgluaspservalglualaargaspglyasp340345350metileargvalaspglutyrtyrgluaspglnaspglyaspthrtyr355360365aspserthrilelysasngluaspvalaspglugluvalglygluglu370375380valglyglugluvalglyglugluvalglyglugluvalglygluglu385390395400valglyglugluvalglyglugluvalglyglugluvalglygluglu405410415gluglyglugluvalglygluglyvalglyglugluvalglygluglu420425430gluglyglugluvalglygluglugluglyglutyrvalaspglulys435440445gluargglnglygluiletyrpropheglyaspglugluglulysasp450455460gluglyglygluserphethrtyrglulyssergluvalasplysthr465470475480aspleuphelyspheilegluglyglygluglyaspaspvaltyrlys485490495valaspglyserlysvalleuleuaspaspaspthrileserargval500505510serlyslyshisthralaargaspglyglutyrglyglutyrglyglu515520525alavalgluaspglygluasnvalilelysileileargservalleu530535540glnserglyalaleuproservalglyvalaspgluleuasplysile545550555560aspleusertyrgluthrthrgluserglyaspthralavalserglu565570575aspsertyrasplystyralaserasnasnthrasnlysglutyrval580585590cysaspphethraspglnleulysprothrgluserglyprolysval595600605lyslyscysgluvallysvalasngluproleuilelysvallysile610615620ilecysproleulysglyservalglulysleutyraspasnileglu625630635640tyrvalprolyslysserprotyrvalvalleuthrlysglugluthr645650655lysleulysglulysleuleuserlysleuiletyrglyleuleuile660665670serprothrvalasnglulysgluasnasnphelysgluglyvalile675680685gluphethrleuproprovalvalhislysalathrvalphetyrphe690695700ilecysaspasnserlysthrgluaspaspasnlyslysglyasnarg705710715720glyilevalgluvaltyrvalgluprotyrglyasnlysileasngly725730735cysalapheleuaspgluaspgluglugluglulystyrglyasngln740745750ileglugluaspgluhisasnglulysilelysmetlysthrphephe755760765thrglnasniletyrlyslysasnasniletyrprocystyrmetlys770775780leutyrserglyaspileglyglyileleupheprolysasnilelys785790795800serthrthrcysphegluglumetileprotyrasnlysgluilelys805810815trpasnlysgluasnlysserleuglyasnleuvalasnasnserval820825830valtyrasnlysglumetasnalalystyrpheasnvalglntyrval835840845hisileprothrsertyrlysaspthrleuasnleuphecysserile850855860ileleulysgluglugluserasnleuileserthrsertyrleuval865870875880tyrvalserileasnglugluleuasnpheserleupheaspphetyr885890895gluserphevalproilelyslysthrileglnvalalaglnlysasn900905910valasnasnlysgluhisasptyrthrcysaspphethrasplysleu915920925asplysthrvalproserthralaasnglylyslysleupheilecys930935940arglyshisleulysglupheaspthrphethrleulyscysasnval945950955960asnlysthrglntyrproasnilegluilepheprolysthrleulys965970975asplyslysgluvalleulysleuaspleuaspileglntyrglnmet980985990pheserlysphephelyspheasnthrglnasnalalystyrleuasn99510001005leutyrprotyrtyrleuilephepropheasnhisileglylyslys101010151020gluleulysasnasnprothrtyrlysasnhislysaspvallystyr1025103010351040phegluglnserservalleuserproleuserseralaaspserleu104510501055glylysleuleuasnpheleuaspthrglngluthrvalcysleuthr106010651070glulysileargtyrleuasnleuserileasngluleuglyserasp107510801085asnasnthrpheservalthrpheglnvalproprotyrileaspile109010951100lysgluprophetyrphemetpheglycysasnasnasnlysglyglu1105111011151120glyasnileglyilevalgluleuleuileserlysglngluglulys112511301135ilelysglycysasnphehisgluserlysleuasptyrpheasnglu114011451150asnileserseraspthrhisglucysthrleuhisalatyrgluasn115511601165aspileileglypheasncysleugluthrthrhisproasngluval117011751180gluvalgluvalgluaspalagluiletyrleuglnprogluasncys1185119011951200pheasnasnvaltyrlysglyleuasnservalaspilethrthrile120512101215leulysasnalaglnthrtyrasnileasnasnlyslysthrprothr122012251230pheleulysileproprotyrasnleuleugluaspvalgluileser123512401245cysglncysthrilelysglnvalvallyslysilelysvalileile125012551260thrlysasnaspthrvalleuleulysarggluvalglnsergluser1265127012751280thrleuaspasplysiletyrlyscysgluhisgluasnpheileasn128512901295proargvalasnlysthrpheaspgluasnvalglutyrthrcysasn130013051310ilelysilegluasnphepheasntyrileglnilephecysproala131513201325lysaspleuglyiletyrlysasnileglnmettyrtyraspileval133013351340lysprothrargvalproglnphelyslyspheasnasnglugluleu1345135013551360hislysleuileproasnserglumetleuhislysthrlysglumet136513701375leuileleutyrasngluglulysvalaspleuleuhisphetyrval138013851390pheleuproiletyrilelysaspiletyrglupheasnilevalcys139514001405aspasnserlysthrmettrplysasnglnleuglyglylysvalile141014151420tyrhisilethrvalserlysarggluglnlysvallysglycysser1425143014351440pheaspasngluhisalahismetphesertyrasnlysthrasnval144514501455lysasncysileileaspalalysprolysaspleuileglypheval146014651470cysproserglythrleulysleuthrasncysphelysaspalaile147514801485valhisthrasnleuthrasnileasnglyileleutyrleulysasn149014951500asnleualaasnphethrtyrlyshisglnpheasntyrmetgluile1505151015151520proalaleumetaspasnaspileserphelyscysilecysvalasp152515301535leulyslyslyslystyrasnvallysserproleuglyprolysval154015451550leuargalaleutyrlyslysleuasnilelyspheaspasntyrval155515601565thrglythraspglnasnlystyrleumetthrtyrmetaspleuhis157015751580leuserhislysargasntyrleulysgluleuphehisaspleugly1585159015951600lyslyslysproalaaspthraspalaasnprogluserileileglu160516101615serleuserileasngluserasngluserglypropheprothrgly162016251630aspvalaspalagluhisleuileleugluglytyraspthrtrpglu163516401645serleutyraspgluglnleuglugluvaliletyrasnaspileglu165016551660serleugluleulysaspilegluglntyrvalleuglnvalasnleu1665167016751680lysalaprolysleumetmetseralaglnilehisasnasnarghis168516901695valcysasppheserlysasnasnleuilevalprogluserleulys170017051710lyslysglugluleuglyglyasnprovalasnilehiscystyrala171517201725leuleulysproleuaspthrleutyrvallyscysprothrserlys173017351740aspasntyrglualaalalysvalasnilesergluasnaspasnglu1745175017551760tyrgluleuglnvalileserleuileglulysargphehisasnphe176517701775gluthrleugluserlyslysproglyasnglyaspvalvalvalhis178017851790asnglyvalvalaspthrglyprovalleuaspasnserthrpheglu179518001805lystyrphelysasnilelysilelysproasplysphepheglulys181018151820valileasnglutyraspaspthrglugluglulysaspleugluser1825183018351840ileleuproglyalailevalserprometlysvalleulyslyslys184518501855aspprophethrsertyralaalaphevalvalproproilevalpro186018651870lysaspleuhisphelysvalglucysasnasnthrglutyrlysasp187518801885gluasnglntyrileserglytyrasnglyileilehisileaspile189018951900serasnserasnarglysileasnglycysasppheserthrasnasn1905191019151920serserileleuthrserservallysleuvalasnglygluthrlys192519301935asncysgluileasnileasnasnasngluvalpheglyileilecys194019451950aspasngluthrasnleuaspproglulyscysphehisgluiletyr195519601965serlysaspasnlysthrvallyslysphearggluvalileproasn197019751980ileaspilepheserleuhisasnserasnlyslyslysvalalatyr1985199019952000alalysvalproleuasptyrileasnlysleuleuphesercysser200520102015cyslysthrserhisthrasnthrileglythrmetlysvalthrleu202020252030asnlysaspglulysgluglugluaspphelysthralaglnglyile203520402045lyshisasnasnvalhisleucysasnphepheaspasnprogluleu205020552060thrpheaspasnasnlysilevalleucyslysileaspalagluleu2065207020752080phesergluvalileileglnleuproilepheglythrlysasnval208520902095glugluglyvalglnasngluglutyrlyslyspheserleulyspro210021052110serleuvalpheaspaspasnasnasnaspilelysvalileglylys211521202125glulysasngluvalserileserleualaleulysglyvaltyrgly213021352140asnargilephethrpheasplysasnglylyslysglygluglyile2145215021552160serphepheileproproilelysglnaspthraspleulyspheile216521702175ileasngluthrileaspasnserasnilelysglnargglyleuile218021852190tyrilephevalarglysasnvalsergluasnserphelysleucys219522002205aspphethrthrglyserthrserleumetgluleuasnserglnval221022152220lysglulyslyscysthrvallysilelyslysglyaspilephegly2225223022352240leulyscysprolysglyphealailepheproglnalacyspheser224522502255asnvalleuleuglutyrtyrlysserasptyrgluaspsergluhis226022652270ileasntyrtyrilehislysasplyslystyrasnleulysprolys227522802285aspvalilegluleumetaspgluasnphearggluleuglnasnile229022952300glnglntyrthrglyileserasnilethraspvalleuhisphelys2305231023152320asnpheasnleuglyasnleuproleuasnphelysasnhistyrser232523302335thralatyralalysvalproaspthrpheasnserileileasnphe234023452350sercysasncystyrasnproglulyshisvaltyrglythrmetgln235523602365valgluseraspasnargasnpheaspasnilelyslysasngluasn237023752380valilelysasnpheleuleuproasnileglulystyralaleuleu2385239023952400leuaspaspglugluargglnlyslysilelysglnglnglngluglu240524102415gluglnglngluglnileleulysaspglnaspaspargleuserarg242024252430hisaspasptyrasnlysasnhisthrtyrileleutyraspserasn243524402445gluhisilecysasptyrglulysasngluserleuileserthrleu245024552460proasnaspthrlyslysileglnlysserilecyslysileasnala2465247024752480lysalaleuaspvalvalthrilelyscysprohisthrlysasnphe248524902495thrprolysasptyrpheproasnserserleuilethrasnasplys250025052510lysilevalilethrpheasplyslysasnphevalthrtyrileasp251525202525prothrlyslysthrpheserleulysaspiletyrileglnserphe253025352540tyrglyvalserleuasphisleuasnglnilelyslysilehisglu2545255025552560glutrpaspaspvalhisleuphetyrproprohisasnvalleuhis256525702575asnvalvalleuasnasnhisilevalasnleuserseralaleuglu258025852590glyvalleuphemetlysserlysvalthrglyaspgluthralathr259526002605lyslysasnthrthrleuprothraspglyvalserserileleuile261026152620proprotyrvallysgluaspilethrphehisleuphecysglylys2625263026352640serthrthrlyslysproasnlyslysasnthrserleualaleuile264526502655hisilehisileserserasnargasnileilehisglycysaspphe266026652670leutyrleugluasnglnthrasnaspalaileserasnasnasnasn267526802685asnsertyrserilephethrhisasnlysasnthrgluasnasnleu269026952700ilecysaspileserleuileprolysthrvalileglyilelyscys2705271027152720proasnlyslysleuasnproglnthrcyspheaspgluvaltyrtyr272527302735vallysglngluaspvalproserlysthrilethralaasplystyr274027452750asnthrpheserlysasplysileglyasnileleulysasnalaile275527602765serileasnasnproaspglulysaspasnthrtyrthrtyrleuile277027752780leuproglulysphegluglugluleuileaspthrlyslysvalleu2785279027952800alacysthrcysaspasnlystyrileilehismetlysileglulys280528102815serthrmetasplysilelysileaspglulyslysthrileglylys282028252830aspilecyslystyraspvalthrthrlysvalalathrcysgluile283528402845ileaspthrileaspserservalleulysgluhishisthrvalhis285028552860tyrserilethrleuserargtrpasplysleuileilelystyrpro2865287028752880thrasnglulysthrhisphegluasnphephevalasnpropheasn288528902895leulysasplysvalleutyrasntyrasnlysproileasnileglu290029052910hisileleuproglyalailethrthraspiletyraspthrargthr291529202925lysilelysglntyrileleuargileproprotyrvalhislysasp293029352940ilehispheserleuglupheasnasnserleuserleuthrlysgln2945295029552960asnglnasnileiletyrglyasnvalalalysilepheilehisile296529702975asnglnglytyrlysgluilehisglycysaspphethrglylystyr298029852990serhisleuphethrtyrserlyslysproleuproasnaspaspasp299530003005ilecysasnvalthrileglyasnasnthrpheserglyphealacys301030153020leuserhisphegluleulysproasnasncyspheserservaltyr3025303030353040asptyrasnglualaasnlysvallyslysleupheaspleuserthr304530503055lysvalgluleuasphisilelysglnasnthrserglytyrthrleu306030653070sertyrileilepheasnlysgluserthrlysleulysphesercys307530803085thrcysserserasntyrserasntyrthrileargilethrpheasp309030953100proasntyrileileprogluproglnserargalaileilelystyr3105311031153120valaspleuglnasplysasnphealalystyrleuarglysleu312531303135 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 4 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( xi ) sequence description : seq id no : 3 : glugluvalgly ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 8 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( ix ) feature :( a ) name / key : modified - site ( b ) location : 6 ( d ) other information : / product =&# 34 ; other &# 34 ;/ note =&# 34 ; xaa = glu or gly &# 34 ;( ix ) feature :( a ) name / key : modified - site ( b ) location : 7 ( d ) other information : / product =&# 34 ; other &# 34 ;/ note =&# 34 ; xaa = glu or val &# 34 ;( xi ) sequence description : seq id no : 4 : glugluvalglygluxaaxaagly15__________________________________________________________________________

compositions comprising biologically pure pfs230 and nucleic acids which encode them are provided . the proteins can be used induce transmission blocking immune responses in susceptible hosts .

fig1 and 2 depict a stain removal kit 10 made in accordance with the present invention . fig1 shows the kit 10 assembled , as it would be carried in a pocket or purse , and fig2 shows the kit disassembled for use . as illustrated in fig2 , the kit 10 includes an elongated , cylindrical container 12 , an applicator tool 24 , and a cap 22 . the container 12 defines an internal cavity 14 , which has a single opening at its top end 16 . attached to its bottom end 20 is a soft , absorbent material 18 . the absorbent material 18 may be a sponge or a blotter , and this material 18 may be pre - moistened as part of the kit 10 , or moisture , such as clean water , may be added as needed during the cleaning process . the cap 22 fits over the absorbent material 18 and snaps , screws , or is otherwise releasably retained onto the bottom end 20 of the container 12 to protect the absorbent material 18 until such time as it is needed . in this embodiment , the container 12 and caps 22 , 32 serve as a housing , holding together all the components of the kit . the applicator tool 24 is an elongated member defining a stem 26 with a brush 28 at its bottom end 30 , and a cap 32 and a spatula 40 at its top end . the brush 28 includes a plurality of stiff bristles 36 ( see also fig3 ), which are used to apply a detergent or stain remover onto the stain and to work it into the fabric to dislodge the stain . the cap 32 has internal threads 32 a , and the container 12 has mating external threads 32 b , which allows the applicator tool 24 to be inserted into the container 12 with the bristles 36 down , and the cap 32 to be threaded into the container 12 . since the container 12 contains a detergent or stain remover , the cap 32 seals the container 12 , so it will not leak when it is being carried or stored . alternatively , the cap 32 may snap onto the container 12 or otherwise be secured in a known method that will not allow leakage of the cleaning material from inside the container 12 . since the absorbent material 18 is attached to the bottom of the container 20 , it is mounted by a mounting means that keeps it out of contact with the cleaning material that is inside the container as the cleaning material is being dispensed by the applicator brush 28 . when the cap 32 is installed at the top end 16 of the container 12 , the stem 26 and the brush 28 extend into the cavity 14 . inside the cavity 14 , a detergent or other stain removing material ( not shown ) is stored . the detergent or stain remover material is preferably in a liquid form , but it may be a solid , including various solid forms , such as a gel or powder , or it may be in other known forms as well . various types of stain dissolving materials are known , including detergents , soaps , various solvents , and so forth . in the event of a spill onto the person &# 39 ; s clothing or other fabric , such as an upholstered chair , the user may use the “ first aid ” stain removal kit to remove the stain from the fabric . first the spatula 40 may be used to scrape off any excess of the spilled material off of the fabric , being careful not to spread the stain any more than it already has spread . next , the cap 32 is removed , and the brush 28 is pulled out of the cavity 14 which also contains the stain remover material . the stain remover material then may be applied directly onto the stain , or the brush 28 may be used to apply it onto the stain . the stain remover material is then worked into the fabric with the aid of the stiff bristles 36 of the brush 28 , preferably with a rotary motion so as not to diffuse the stain . it may be advantageous to place a napkin , handkerchief , or other absorbent material on the other side of the fabric being cleaned to help draw the detergent / stain remover through the fabric , taking the stain with it . finally , the lower cap 22 is removed to expose the absorbent material 18 , which is then dabbed onto the fabric to finish removing the stain . the absorbent material 18 may be dry to aid in drawing out the detergent / stain remover , together with the stain , off of the fabric , or it may be pre - moistened ( or moisture such as clean water may be added to the absorbent material 18 ) to aid in cleaning off the stain from the fabric . in a preferred embodiment , the stain removal kit 10 may be made out of any suitable material , such a plastic , preferably measuring approximately between 2 and 3 inches in length by approximately one inch in diameter . the bristles 36 of the brush 28 are also preferably made of stiff plastic fibers with a length of less than 0 . 5 inches . the material of the container 12 may be any material suitable for the task , such as metal , glass , or plastic . the shape of the container may be other than cylindrical in nature , for instance , it may have a curved shape like that of a perfume bottle . fig4 depicts another embodiment of a stain removal kit 42 made in accordance with the present invention . this kit 42 is housed in a blister package 44 , to make it convenient to display and sell , for example , out of automated vending machines found in restrooms , rest stops , etc ., or hanging on a hook in a shop . ( of course , any of the kits shown here may be packaged for sale in an automated machine or for hanging on a hook , if desired .) this particular blister package is about three inches long , about 1 . 5 inches wide , and about ¼ - inch thick . the kit 42 includes two elongated members 46 , 48 . the first member 46 includes a stem 50 , with a stiff - bristled brush 52 at its first end and a cotton swab 54 at its second end . the second member 48 includes a stem 56 with a spatula or scraper tool 58 at its first end and a cotton swab 60 at its second end . preferably , one of the cotton swabs 54 or 60 is impregnated with stain remover , while the other swab is dry . the swab that is impregnated with stain removing material preferably has a distinct color , such as green or blue , to indicate that it contains the stain remover , while the other swab preferably is white or off - white , indicating that it does not contain the stain remover . the blister - pack packaging may provide a sufficient seal that the detergent - impregnated swab may be stored in a wet condition , or the stain remover - impregnated swab may be stored in a dry form which may be moistened by the user prior to use . to use this kit 42 , the user opens the packaging 44 and removes the tools 46 , 48 . the spatula 58 is used to remove excess spilled material off of the fabric . the cotton swab 54 or 60 , which is impregnated with the stain remover , is used to apply the stain remover to the stain , and the brush 52 is used to work the stain remover material into the fabric to dislodge the stain . again , a napkin , handkerchief , towelette , or other piece of absorbent material may be placed under the stained area to help draw the stain remover and the stain off of the fabric . such a towelette may be provided as part of the kit and be housed inside the blister pack 44 , if desired . finally , the other swab is used to remove the detergent and any remaining stain from the treated area . fig5 depicts another embodiment of a stain removal kit 62 made in accordance with the present invention . this kit 62 includes a carrying case 72 , similar to a lady &# 39 ; s compact for make - up , which serves as a housing to house the components of the kit . this carrying case 72 is approximately four inches long , two inches wide , and one - half inch thick . the carrying case 72 houses a double - tipped cotton swab 64 and a tool 67 having a spatula 66 at one end and a stiff - bristled brush 68 at the other end . the case 72 also defines an internal recess 71 , which holds a supply of dry stain remover 70 . the carrying case 72 includes a base 75 and a hinged lid 74 . the lid 74 has a first locking clasp portion 76 , and the base 75 has a second locking clasp portion 76 a , allowing the lid 74 and base 75 to be closed with a snap fit . the stain remover 70 is preferably in a soft , solid form , similar to solid under - arm deodorant or in a compacted powder form similar to compact make - up . one of the tips of the cotton swab 64 is used to apply the detergent / stain remover onto the stain , while the other tip is used for final clean - up and absorption of the materials in the treated area as discussed in reference to previous embodiments . fig6 and 7 depict another embodiment of a stain removal kit 80 made in accordance with the present invention . referring briefly to fig7 , this kit 80 includes a cylindrical container 82 , which houses the stain remover . the container 82 also houses the stiff - bristled brush 84 when the brush 84 is not in use . the brush 84 is attached to the lower end of a stem 88 , and a cap 86 is attached to the upper end . the cap 86 seals off the container 82 when the stem 88 and brush 84 are inside the container 82 and the cap 86 is threaded onto the neck 92 of the container 82 . a collar 90 fits over the container 82 . extensions 94 on the collar 90 define aligned through - openings 96 . a spatula 98 includes extensions 100 which are designed to straddle the extensions 94 of the collar 90 . holes 102 in the spatula extensions 100 align with the through - openings 96 in the collar extensions 94 to receive a hinge pin 104 , which pivotably secures the spatula 98 to the collar 90 . a sleeve 106 , made from an absorbent material , defines an interior cavity 108 , which is sized to substantially enclose the cylindrical container 82 . in this case , the container 82 and cap 86 serve as a housing , which contains or supports the elements of the kit . as may be appreciated from fig6 , the spatula 98 is normally in the stowed or retracted position ( shown in solid ), but may be swung to the extended position ( shown in phantom ) for use . similarly , the brush 84 is normally stowed inside the cylinder 82 , with the cap 86 sealing off the stain remover inside the cylinder 82 . during use , the cap 86 is unthreaded from the neck 92 of the container 82 so that the stain remover may be applied to the stain , either by pouring the stain remover directly onto the stain or by applying it with the brush 84 . the brush 84 then is used to scrub the affected area , and , finally , the absorbent - material sleeve 106 is used for final clean - up of the treated area . fig8 and 9 depict another embodiment of a stain removal kit 120 made in accordance with the present invention . as may be appreciated by comparing the fig8 and 9 against the fig1 and 2 , these embodiments 120 , 10 are very similar . the most significant difference is that the stain removal kit 120 includes an aerosol pump 122 to atomize the detergent stain remover directly onto the soiled area to be cleaned . the aerosol pump 122 includes a stem 124 which houses the plunger mechanism used to suction out the detergent stain remover out of the cylindrical container 126 , as is well known in the industry . the stiff - bristled brush 128 is attached to the end of the stem 124 . the through opening 130 ( see fig1 ) allows fluid communication of the detergent stain remover from the inside of the container 126 , through the stem 124 and to the aerosol pump 122 . a spatula 132 snaps over ( or is otherwise secured to ) the aerosol pump 122 to protect the pump 122 and prevent accidental pumping of the detergent / stain remover . as in the case of the first embodiment 10 , the lower cap 22 snaps over ( or is otherwise secured to ) the absorbent material 18 . to use this stain removal kit 120 , any excess stain is first removed using the spatula 132 . the spatula 132 is then removed from the kit 120 and the aerosol pump is used to atomize a fine spray of the detergent / stain remover directly onto the soiled area to be cleaned . the aerosol pump 122 is then removed from the container 126 to expose the stiff - bristled brush 128 , which is used to work the detergent / stain remover into the stain . the rest of the procedure is the same as has already been described with respect to the first embodiment 10 . it should be noted that an aerosol pump 122 is shown in fig9 and 10 . however , the detergent / stain remover could be packaged under pressure with a gaseous propellant for release as a spray of fine particles . in this instance , the brush 128 would be placed elsewhere so as to make it available for use without having to open the container 126 releasing its pressurized gaseous propellant . for example , the brush 128 could then be placed on the outside of the lower cap 22 . in the embodiment of fig2 , the means for dispensing the stain remover material includes opening the cap 32 and passing the stain remover material through the opening at the top end 16 of the housing 12 . as explained earlier , the stain remover material may be applied directly to the fabric or it may be carried through the opening and applied to the fabric by the brush . the mounting means for keeping the absorbent material 18 out of contact with the stain remover material as the stain remover material is being dispensed includes securing the absorbent material 18 to the outside of the housing 12 and enclosing it with the cover 22 . in the embodiment of fig4 , the means for dispensing the stain remover material from the housing includes opening the blister package housing 44 , removing the absorbent swab 54 or 60 that is impregnated with stain remover , and rubbing it onto the fabric . the mounting means which keeps the first absorbent material out of contact with the stain remover as it is being dispensed is mounting the other absorbent swab 54 or 60 that is not impregnated with stain remover on a separate elongated member 46 , 48 from the one that is impregnated with stain remover , so it is out of contact with the stain remover as the stain remover is being dispensed . in the embodiment of fig5 , the means for dispensing the stain remover from the housing includes opening the lid 74 , putting one of the tips of the cotton swab 64 into the stain remover 70 , then contacting the fabric with that tip . the mounting means for keeping the first absorbent material out of contact with the stain remover material as it is being dispensed is mounting the first absorbent material at the other end of the cotton swab 64 . in the embodiment of fig7 , the means for dispensing the stain remover material is the same as in the embodiment of fig2 . the mounting means for mounting the first absorbent material to keep it out of contact with the stain remover material as it is being applied is mounting the sleeve made of absorbent material 106 on the outside of the container 82 . in the embodiment of fig9 , the means for dispensing the stain remover material is the same as in the embodiment of fig2 , plus it includes a spray mechanism 122 . the mounting means for mounting the first absorbent material to keep it out of contact with the stain remover material as it is being dispensed is the same as in the embodiment of fig2 . while the embodiments described above show some examples of stain removal kits in accordance with the present invention , it will be obvious to those skilled in the art that various modifications may be made to these kits without departing from the scope of the present invention .

a portable stain removal kit for removing stains from fabrics , such as clothing or furniture , for use immediately after the mishap has occurred . the kit is intended to be small enough to be carried in a pocket or purse and includes a spatula , a stain removing material , a brush , and an absorbent material .

the first embodiment of the present invention will be described with reference to fig1 to 4 . fig1 is a diagram of a medical treatment device ( medical treatment system ) 1 according to the present embodiment . as illustrated in fig1 , the medical treatment device 1 includes a medical treatment tool ( hand - piece ) 2 . the medical treatment tool 2 has a longitudinal axis c . in this example , a first side in the direction of the longitudinal axis c is on a head side near the head of the medical treatment tool 2 ( a side of an arrow c 1 in fig1 ), and the side opposite to the side near the head is on a base side near the base of the medical treatment tool 2 ( a side of an arrow c 2 in fig1 ). the medical treatment tool 2 is detachably connected to a control device 3 through a cable 5 . the control device 3 is an energy control device , for example , that controls the supply of energy used for treatment to ( treatment energy ) to the medical treatment tool 2 . the medical treatment tool 2 includes a housing 6 including a head and a base . the housing 6 includes a housing body 7 extending along the longitudinal axis c , and a grip ( fixed handle ) 8 extending from the housing body 7 in the direction crossing the longitudinal axis c . a first end of the cable 5 is connected to the base portion of the housing body 7 . a handle ( movable handle ) 11 is rotatably attached to the housing 6 . the handle 11 rotates around an attachment position at which the handle 11 is attached to the housing 6 . this rotation allows the handle 11 to open and close with respect to the grip 8 of the housing 6 ( displaces the handle 11 ). in the present embodiment , the handle 11 is positioned on a head side near the head of the grip 8 so that the handle 11 opens and closes with respect to the grip 8 ( moves from and toward the grip 8 ) in roughly parallel to the longitudinal axis c . a rotating knob 12 is coupled to the head side of the housing body 7 . the rotating knob 12 is rotatable around the longitudinal axis c of the housing 6 . a sheath 13 is coupled to the housing 6 while being inserted from the head side into the rotating knob 12 and housing body 7 . an extension member ( probe ) 15 extends from the inside of the housing body 7 through the inside of the sheath 13 toward the head side . the head of the extension member 15 is provided with a first grasp unit ( treatment probe ) 16 . the extension member 15 is inserted into and penetrates the sheath 13 . the first grasp unit 16 protrudes from the head of the sheath 13 toward the head side . in the present embodiment , the extension member 15 is made of a material having high vibration transferability and thus capable of transferring ultrasonic vibration . a second grasp unit ( jaw ) 17 is rotatably attached to the head of the sheath 13 . the handle 11 opens or closes with respect to the grip 8 . this moves a movable pipe ( not illustrated ) extending between the sheath 13 and the extension member 15 along the longitudinal axis c . this rotates the second grasp unit 17 so that the second grasp unit 17 opens or closes with respect to the first grasp unit 16 . in the present embodiment , the first grasp unit 16 and the second grasp unit 17 form an end effector 18 that treats an object to be treated such as body tissue . the end effector 18 grasps the object to be treated between a pair of the grasp units 16 and 17 so as to treat the object to be treated . fig2 is an explanatory diagram of an electrical connection between the medical treatment tool 2 and the control device 3 , and a path of supply of energy used for treatment to the end effector 18 . as illustrated in fig1 and 2 , a vibration generation unit 21 extends in the housing body 7 along the longitudinal axis c . the vibration generation unit 21 is connected to a base side near the base of the extension member 15 in the housing body 7 . the vibration generation unit 21 is provided with a piezoelectric device ( not illustrated ) that converts electrical energy ( alternating current ) into ultrasonic vibration . the control device 3 includes one or more processors such as an energy source 25 that generates energy for treatment , and a control unit 26 that controls the energy source 25 . the energy source 25 includes , for example , a drive circuit ( not illustrated ) that converts direct current power from a battery or electricity from an outlet into electrical energy used for treatment . the control unit 26 includes , for example , a processor or an integrated circuit including a central processing unit ( cpu ) or an application specific integrated circuit ( asic ), and a storage medium such as a memory so as to control the whole medical treatment device 1 . note that , in the control unit 26 , for example , a processor can work as a level setting unit 27 configured to set a level ( energy level ) on each type of energy output from the energy source 25 , or can work as a measurement unit 28 ( a measurement circuit ) that can measure a predetermined parameter . the level setting unit 27 and measurement unit 28 perform some of processes that , for example , the processor performs . the control device 3 is provided also with an alarm 29 electrically connected to the control unit 26 . the alarm 29 is , for example , a bell that warns by generating a sound , a lamp that warns by producing light , or a display screen that displays warning . in this example , the alarm 29 is not necessarily placed in the control device 3 , and can be placed , for example , in the housing 6 of the medical treatment tool 2 . alternatively , warning can be displayed on the display screen of an endoscope ( not illustrated ) used together with the medical treatment device 1 . first ends of electrical lines 22 a and 22 b are connected to the vibration generation unit 21 . the electrical lines ( energy lines ) 22 a and 22 b extend through the insides of the housing 6 , cable 5 , and control device 3 . second ends of the electrical lines 22 a and 22 b are connected to the energy source 25 . the control by the control unit 26 outputs the electrical energy ( alternating current power ) that is to be converted into ultrasonic vibration from the energy source 25 through the electrical lines 22 a and 22 b , and the electrical energy output through the electrical lines 22 a and 22 b is supplied to the vibration generation unit 21 . the supply of the electrical energy to the vibration generation unit 21 generates ultrasonic vibration . then , the generated ultrasonic vibration is transmitted to the extension member 15 . the ultrasonic vibration is transmitted from the base side to head side of the extension member 15 . subsequently , the ultrasonic vibration is transmitted to the first grasp unit 16 of the end effector 18 . first ends of energy lines 23 a and 23 b are also connected to the energy source 25 . the energy line 23 a extends through the insides of the control device 3 , cable 5 , and housing 6 . a second end of the energy line 23 a is connected to the first grasp unit 16 . the energy line 23 b extends through the insides of the cable 5 , and housing 6 . a second end of the energy line 23 b is connected to the second grasp unit 17 . the control by the control unit 26 outputs high frequency energy ( high frequency electricity ) from the energy source 25 through the energy lines 23 a and 23 b . then , the high frequency energy is supplied through the energy line 23 a to the first grasp unit 16 and through the energy line 23 b to the second grasp unit 17 . the supply of the high frequency energy to the end effector 18 ( the first grasp unit 16 and second grasp unit 17 ) causes the first grasp unit 16 and second grasp unit 17 to function as electrodes of the high frequency energies with different electrical potentials each other . as illustrated in fig1 , operation buttons 31 a and 31 b are attached as operation members to the housing 6 . in the present embodiment , the operation buttons 31 a and 31 b are attached to a surface of a head 32 of the grip 8 , and placed at a portion of the head side of the housing 6 . the operation buttons 31 a and 31 b are placed on the side on which the grip 8 is positioned when the longitudinal axis c is centered , and placed nearer to the longitudinal axis c than a force application unit ( handle finger - put position ) 33 to which operation force is applied by operation for opening or closing the handle 11 with respect to the housing 6 . with each of the operation buttons 31 a and 31 b , operation for causing the medical treatment device 1 to function ( for example , to supply energy to the end effector 18 ) is input . in the present embodiment , the operation buttons 31 a and 31 b are momentary operation members and thus each of the operation buttons 31 a and 31 b is in the on state only while the operation is input ( only while the button is pressed ). thus , when the input of operation ( pressing the button ) is released , the operation buttons 31 a and 31 b is turned into an off state . as illustrated in fig2 , the inside of the housing 6 ( the inside of the grip 8 ) is provided with switches 35 a and 35 b . each of the switches 35 a and 35 b is switched between an opening state and a closing state in accordance with the operating state ( namely , the on state or off state ) input with the operation button ( one of 31 a and 31 b ) corresponding to each of the switches 35 a and 35 b . first ends of the detection signal lines ( first detection signal lines ) 36 a 1 and 36 a 2 are connected to the switch 35 a . the detection signal lines 36 a 1 and 36 a 2 extend through the insides of the housing 6 , cable 5 , and control device 3 . second ends of the detection signal lines 36 a 1 and 36 a 2 are connected to the control unit 26 . the detection signal lines 36 a 1 and 36 a 2 transmit a detection signal ( first detection signal ) indicating whether the switch 35 a opens or closes ( namely , indicating the operating state input with the operation button 31 a ) to the control unit 26 . then , the control unit 26 detects the operating state input with the operation button 31 a ( namely , whether the operation button 31 a is in the on state or the off state ) in accordance with the detection signal transmitted through the detection signal lines 36 a 1 and 36 a 2 . similarly , the switch 35 b is connected to the control unit 26 through the detection signal lines ( first detection signal lines ) 36 b 1 and 36 b 2 so that the detection signal lines 36 b 1 and 36 b 2 transmit a detection signal ( first detection signal ) indicating whether the switch 35 b opens or closes ( namely , the operating state input with the operation button 31 b ) to the control unit 26 . the control unit 26 detects the operating state input with the operation button 31 b ( namely , whether the operation button 31 b is in the on state or the off state ) in accordance with the detection signal transmitted through the detection signal lines 36 b 1 and 36 b 2 . as illustrated in fig1 , the housing 6 is provided with a selection button 41 as a selection member . in the present embodiment , the selection button 41 is placed on the grip 8 and exposed to the outside . the selection button 41 is placed at a portion facing an end of the width direction of the housing 6 ( in the direction perpendicular to the drawing paper of fig1 ) on the external surface of the housing 6 . the selection button 41 is placed nearer to the base side than the operation buttons 31 a and 31 b , and placed nearer to the longitudinal axis c than the force application unit 33 of the handle 11 . in this example , the selection button 41 can be a momentary selection member or can be an alternate selection member . when the selection button 41 is a momentary one , the selection button 41 is in the on state only while operation is input ( only while the selection button 41 is pressed ). on the other hand , when the selection button 41 is an alternate one , inputting operation input with the selection button 41 in the off state ( pressing the selection button 41 ) switches the selection button 41 into the on state . inputting operation input with the selection button 41 in the on state ( pressing the selection button 41 ) switches the selection button 41 into the off state . even when the input of operation ( pressing the selection button 41 ) is released , the selection button 41 is maintained to be in the off state . note that , when the selection button 41 is an alternate one , the housing 6 is provided with a state maintenance mechanism ( not illustrated ) that maintains the selection button 41 in the on state and the selection button 41 in the off state . as illustrated in fig2 , the inside of the housing 6 ( the inside of the grip 8 ) is provided with a switch 42 . the switch 42 is switched between the opening state and the closing state in accordance with the operating state input with the selection button 41 ( namely , whether the selection button 41 is in the on state or the off state ). first ends of the detection signal lines ( second detection signal lines ) 43 a and 43 b are connected to the switch 42 . the detection signal lines 43 a and 43 b extend through the insides of the housing 6 , cable 5 , and control device 3 . second ends of the detection signal lines 43 a and 43 b are connected to the control unit 26 . the detection signal lines 43 a and 43 b transmit a detection signal ( second detection signal ) indicating whether the switch 42 opens or closes ( namely , the operating state input with the selection button 41 ) to the control unit 26 . the control unit 26 detects the operating state input with the selection button 41 ( namely , whether the selection button 41 is in the on state or the off state ) in accordance with the detection signal transmitted through the detection signal lines 43 a and 43 b . note that an exemplary embodiment can be provided with a foot switch 34 as an operation input apparatus ( third input device ). in this example , the foot switch 34 is placed separately from the medical treatment tool 2 ( the housing 6 and end effector 18 ). with the foot switch 34 working as the operation input apparatus , operation for causing the medical treatment device 1 to function is input . the input of operation with the foot switch 34 is detected by the control unit 26 . next , the mechanisms and effects of the medical treatment tool 2 , control device 3 , and medical treatment device 1 according to the present embodiment will be described . fig3 is a flowchart of a process that the control unit 26 ( the control device 3 ) performs in accordance with the operating state input with the operation button ( first operation button ) 31 a . as illustrated in fig3 , while the control device 3 operates , the control unit 26 detects the operating state input with the selection button 41 ( namely , whether the selection button 41 is in the on state or the off state ) in accordance with the detection signal transmitted through the detection signal lines ( second detection signal lines ) 43 a and 43 b ( step s 101 ). when the selection button 41 is in the off state ( step s 101 — yes ), the control unit 26 detects the operating state input with the operation button 31 a in accordance with the detection signal transmitted through the detection signal lines ( first detection signal lines ) 36 a 1 and 36 a 2 , and detects whether the operation button 31 a is switched from the off state to the on state ( step s 102 ). when the operation button 31 a is switched to the on state ( step s 102 — yes ), the control unit 26 detects whether the selection button 41 is maintained to be in the off state ( step s 103 ), and detects whether a given period of time t 0 has elapsed since the operation button 31 a has been switched to the on state ( step s 104 ). in other words , the control unit 26 detects whether the selection button 41 is maintained to be in the off state until a given period of time t 0 has elapsed since the operation button 31 a has been switched to the on state in steps s 103 and s 104 . in this example , the control unit 26 sets the given period of time t 0 , for example , within a range between 0 . 05 and 1 seconds . note that , when the given period of time t 0 has not elapsed since the operation button 31 a has been switched to the on state in step s 104 ( step s 104 — no ), the process goes back to step s 102 . when the selection button 41 is maintained to be in the off state ( step s 103 — yes and s 104 — yes ) during the given period of time t 0 after the operation button 31 a is switched to the on state , the control unit 26 causes the medical treatment device 1 to function in the first mode ( step s 105 ). this causes the medical treatment device 1 to function in the first mode when the given period of time t 0 has elapsed after the operation button 31 a is switched from the off state to the on state while the selection button 41 is in the off state . in other words , the control unit 26 causes the medical treatment device 1 to function in the first mode in accordance with the fact that the operation button 31 a is in the on state when the selection button 41 is in the off state . in the present embodiment , by causing the medical treatment device 1 to function in the first mode , the control unit 26 supplies the electrical energy ( alternating current ) from the energy source 25 to the vibration generation unit 21 so as to transmit the ultrasonic vibration ( the first energy ) generated by the vibration generation unit 21 to the first grasp unit 16 of the end effector 18 . the control unit 26 causes the medical treatment device 1 to function in the first mode ( step s 105 ) as long as the operation button 31 a is maintained to be in the on state ( step s 106 — no ). in such a case , the medical treatment device 1 is maintained to be in the first mode regardless of the operating state input with the operation button ( second operation button ) 31 b . in other words , unless the operation button 31 a is switched from the on state to the off state , the medical treatment device 1 functions in the first mode even if the operation button 31 b is switched from the off state to the on state . when the operation button 31 a is switched from the on state to the off state ( step s 106 — yes ), the control unit 26 stops the output of energy from the energy source 25 ( step s 107 ) and thus the electrical energy is not supplied to the vibration generation unit 21 . the output of energy from the energy source 25 is stopped regardless of the operating state input with the operation button 31 b ( namely , whether the operation button 31 b is in the on state or the off state ). this stops the transmission of the ultrasonic vibration to the end effector 18 and stops the medical treatment device 1 from functioning . when the selection button 41 is switched to the on state ( step s 103 — no ) before the given period of time t 0 has elapsed since the operation button 31 a has been switched to the on state in step s 102 , the control unit 26 causes the alarm 29 to warn an error ( step s 108 ). meanwhile , the control unit 26 maintains the state in which the output of energy from the energy source 25 stops ( step s 109 ). this maintains the state in which the medical treatment device 1 is stopped from functioning . for example , the operator recognizes from the error warning of the alarm 29 that operation is not properly input with the operation button 31 a and the selection button 41 . when the selection button 41 is in the on state in step s 101 ( step s 101 — no ), the control unit 26 detects the operating state input with the operation button 31 a in accordance with the detection signal transmitted through the detection signal lines ( first detection signal lines ) 36 a 1 and 36 a 2 , and detects whether the operation button 31 a is switched from the off state to the on state ( step s 111 ). when the operation button 31 a is maintained to be in the off state ( step s 101 — no or step s 111 — no ), the control unit 26 maintains the state in which the output of energy from the energy source 25 is stopped ( step s 110 ) regardless of the operating state input with the selection button 41 ( in other words , whether the selection button 41 is in the on state or the off state ). this maintains the state in which the medical treatment device 1 is stopped from functioning in the process performed in accordance with the operating state input with the operation button 31 a unless the operation button 31 a is switched to the on state . when the selection button 41 is in the off state and the operation button 31 a is switched to the off state again before the given period of time t 0 has elapsed since the operation button 31 a has been switched to the on state ( step s 104 — no and s 102 — no ), the control unit 26 maintains the state in which the output of energy from the energy source 25 is stopped ( step s 110 ). when the selection button 41 is in the on state and the operation button 31 a is switched from the off state to the on state ( step s 101 — no and step s 111 — yes ), the control unit 26 causes the medical treatment device 1 to function in a second mode different from the first mode ( step s 112 ). thus , when the selection button 41 is in the on state and the operation button 31 a is switched from the off state to the on state , the medical treatment device 1 functions in the second mode . in other words , the control unit 26 causes the medical treatment device 1 to function in the second mode in accordance with the fact that the selection button 41 is in the on state and the operation button 31 a is in the on state . in the present embodiment , by causing the medical treatment device 1 to function in the second mode , the control unit 26 supplies the electrical energy ( alternating current ) from the energy source 25 to the vibration generation unit 21 and transmits the ultrasonic vibration ( first energy ) generated by the vibration generation unit 21 to the first grasp unit 16 of the end effector 18 , and transmits the high frequency energy ( second energy ) different from the ultrasonic vibration to the end effector 18 . as long as the operation button 31 a is maintained to be in the on state ( step s 113 — no ) and the selection button 41 is maintained to be in the on state ( step s 114 — no ), the control unit 26 causes the medical treatment device 1 to function in the second mode ( step s 112 ). in such a case , the medical treatment device 1 is maintained to be in the second mode regardless of the operating state of the operation button ( second operation button ) 31 b . in other words , as long as the operation button 31 a is not switched from the on state to the off state and the selection button 41 is not switched from the on state to the off state , the medical treatment device 1 functions in the second mode even if the operation button 31 b is switched from the off state to the on state . when the operation button 31 a is switched from the on state to the off state ( step s 113 — yes ), or when the selection button 41 is switched from the on state to the off state ( step s 114 — yes ), the control unit 26 stops the output of energy from the energy source 25 ( step s 115 ). this stops the supply of the electrical energy to the vibration generation unit 21 and thus stops the transmission of the ultrasonic vibration to the end effector 18 . this also stops the supply of the high frequency energy to the end effector 18 . in such a case , the output of energy from the energy source 25 is stopped regardless of the operating state input with the operation button 31 b ( in other words , whether the operation button 31 b is in the on state or the off state ). this stops the supply of energy to the end effector 18 , and stops the medical treatment device 1 from functioning . a process that the control unit 26 performs in accordance with the operating state input with the operation button ( second operation button ) 31 b is performed in a similar manner to the process performed in accordance with the operating state on the operation button ( first operation button ) 31 a ( see fig3 ). in other words , when the selection button 41 is in the off state and the operation button 31 b is switched from the off state to the on state , the control unit 26 detects whether the selection button 41 is maintained to be in the off state until the given period of time t 0 has elapsed since the operation button 31 b has been switched to the on state . when the selection button 41 is maintained to be in the off state until the given period of time t 0 has elapsed since the operation button 31 b has been switched to the on state , the control unit 26 causes the medical treatment device 1 to function in a third mode different from the first mode and the second mode . in other words , the control unit 26 causes the medical treatment device 1 to function in the third mode in accordance with the fact the selection button 41 is in the off state and the operation button 31 b is in the on state . in the present embodiment , by causing the medical treatment device 1 to function in the third mode , the control unit 26 supplies the high frequency energy to the end effector 18 . in this example , the high frequency energy is supplied in an appropriate amount , for an appropriate length of time , at an appropriate frequency for solidification . as long as the operation button 31 b is in the on state when the medical treatment device 1 functions in the third mode , the control unit 26 maintains the medical treatment device 1 in the third mode regardless of the operating state input with the operation button 31 a . when the operation button 31 b is switched to the off state , the control unit 26 stops the output of energy from the energy source 25 and stops the medical treatment device 1 from functioning regardless of the operation input with the operation button 31 a ( in other words , whether the operation button 31 a is in the on state or the off state ). when the selection button 41 is in the off state and the operation button 31 b is switched to the on state and the selection button 41 is switched from the off state to the on state before the given period of time t 0 has elapsed since the operation button 31 b has been switched to the on state , the control unit 26 warns an error and maintains the state in which the medical treatment device 1 is stopped from functioning . when the selection button 41 is in the on state and the operation button 31 b is switched from the off state to the on state , the control unit 26 causes the medical treatment device 1 to function in a fourth mode different from the first to third modes . in other words , the control unit 26 causes the medical treatment device 1 to function in the fourth mode in accordance with the fact that the selection button 41 is in the on state and the operation button 31 b is in the on state . in the present embodiment , by causing the medical treatment device 1 to function in the fourth mode , the control unit 26 supplies the same type of high frequency energy as the high frequency energy supplied in the third mode to the end effector 18 in a state in which the high frequency energy is supplied while at least one of the amount of the supplied high frequency energy , the length of time to supply the high frequency energy , and the frequency at which the high frequency energy is supplied is different from that in the third mode . at that time , the high frequency energy is supplied in an appropriate amount , for an appropriate length of time , at an appropriate frequency for sealing of a blood vessel . when the medical treatment device 1 functions in the fourth mode , the control unit 26 maintains the medical treatment device 1 in the fourth mode regardless of the operating state input with the operation button 31 a as long as the operation button 31 b is maintained to be in the on state and the selection button 41 is maintained to be in the on state . when the operation button 31 b is switched to the off state , or the selection button 41 is switched to off state , the control unit 26 stops the output of energy from the energy source 25 and stops the medical treatment device 1 from functioning regardless of the operating state input with the operation button 31 a ( in other words , whether the operation button 31 a is the on state or the off state ). as described above , when the operation button 31 a is in the on state , the detection signal ( the first detection signal ) indicating the operating state input with the operation button 31 a is transmitted through the detection signal lines 36 a 1 and 36 a 2 to the control unit 26 . this enables the control unit 26 to cause the medical treatment device 1 to function in a plurality of modes ( in the first mode or the second mode ). when the operation button 31 a is the on state , the detection signal ( the second detection signal ) indicating the operating state input with the selection button 41 ( whether the selection button 41 is in the on state or the off state ) is transmitted through the detection signal lines 43 a and 43 b to the control unit 26 . then , the control unit 26 selects ( determines ) a mode in which the medical treatment device 1 functions ( the first mode or the second mode ) from the modes in accordance with the transmitted detection signal ( the second detection signal ). similarly , when the operation button 31 b is in the on state , the detection signal ( the first detection signal ) indicating the operating state input with the operation button 31 b is transmitted through the detection signal lines 36 b 1 and 36 b 2 to the control unit 26 . this enables the control unit 26 to cause the medical treatment device 1 to function in a plurality of modes ( the third mode or the fourth mode ). when the operation button 31 b is the on state , the detection signal ( the second detection signal ) indicating the operating state input with the selection button 41 ( whether the selection button 41 is in the on state or the off state ) is transmitted through the detection signal lines 43 a and 43 b to the control unit 26 . then , the control unit 26 selects ( determines ) a mode in which the medical treatment device 1 functions ( the third mode or the fourth mode ) from the modes in accordance with the transmitted detection signal ( the second detection signal ). thus , in the present embodiment , only providing a selection button ( selection member ) 41 enables the control unit 26 to cause the medical treatment device 1 to function in a plurality of modes when each of the operation buttons ( the operation members ) 31 a and 31 b is in the on state by performing the process in accordance with the operating state input with the operation button 31 a illustrated in fig3 , and the process in a similar manner to the process illustrated in fig3 in accordance with the operating state input with the operation button 31 b . this enables the medical treatment device 1 to function in many modes even when the number of the operation buttons 31 a and 31 b is reduced . in the detection of the operating states input with the operation buttons 31 a and 31 b , and the selection button 41 , for example , when the selection button 41 is switched from the off state to the on state before the given period of time t 0 has elapsed since the operation button ( 31 a or 31 b ) has been switched to the on state , it is sometimes difficult to determine whether the operation button ( 31 a or 31 b ) and the selection button 41 are simultaneously in the on state . in the present embodiment , the process in accordance with the operating state input with the operation button 31 a illustrated in fig3 , and the process in a similar manner to the process illustrated in fig3 in accordance with the operating state input with the operation button 31 b are processed . by performing the processes , the control unit 26 warns an error when it is difficult to determine whether the operation button ( 31 a or 31 b ) and the selection button 41 are simultaneously in the on state . this warning effectively prevents the medical treatment device 1 from functioning in a mode that the operator does not intend . to treat an object to be treated using the medical treatment device 1 , the operator holds the housing 6 and the handle 11 and inserts the head of the sheath 13 and the end effector 18 , for example , into an abdominal cavity . the operator opens or closes the handle 11 with respect to the grip 8 while inserting the sheath 13 and the end effector 18 in a body cavity in order to open or close the grasp units 16 and 17 , rotate the rotating knob 12 around the longitudinal axis c in order to adjust the angle of the position of the end effector 18 around the longitudinal axis c . fig4 is a diagram of a state in which the operator holds the housing 6 and the handle 11 . as illustrated in fig4 , for example , when the operator holds the housing 6 and the handle 11 with the operator &# 39 ; s right hand h , the operator puts the grip 8 of the housing 6 between the operator &# 39 ; s thumb f 1 and palm p . the operator puts the operator &# 39 ; s ring finger f 4 and little finger f 5 ( or middle finger f 3 , ring finger f 4 , and little finger f 5 depending on the operator ) on the force application unit 33 of the handle 11 so as to apply operation force on the handle 11 using the operator &# 39 ; s ring finger f 4 and little finger f 5 ( or middle finger f 3 , ring finger f 4 , and little finger f 5 depending on the operator ) in order to close the handle 11 with respect to the grip 8 . the operator uses the operator &# 39 ; s index finger f 2 or middle finger f 3 to rotate the rotating knob 12 and input operation with each of the operation buttons 31 a and 31 b ( press each of the operation buttons 31 a and 31 b ). in the present embodiment , the selection button ( selection member ) 41 is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b on the outer surface of the housing 6 . this placement enables the operator to input operation with the selection button 41 ( to press the selection button 41 ) using the thumb f 1 while grasping the grip 8 between the thumb f 1 and the palm p . thus , the operator can switch the selection button 41 between on state and off state using the thumb f 1 . thus , the operator does not use the operator &# 39 ; s index finger f 2 , middle finger f 3 , ring finger f 4 , and little finger f 5 , which are used for at least one of operations for opening and closing the handle 11 , rotating the rotating knob 12 , and inputting operation with the operation buttons 31 a and 31 b , in order to input operation with the selection button 41 . thus , the operator does not need to change the positions and postures of the operator &# 39 ; s index finger f 2 , middle finger f 3 , ring finger f 4 and little finger f 5 in order to switch the selection button 41 between the on state and the off state in treatment , and does not need also to hold the housing 6 and the handle 11 again with the operator &# 39 ; s right hand h . this secures the operability for opening and closing the handle 11 , rotating the rotating knob 12 , and inputting operation with the operation buttons 31 a and 31 b , and secures also the operability for inputting operation with the selection button 41 . as described above , the present embodiment can provide the medical treatment device ( 1 ) that switches the modes in which the medical treatment device ( 1 ) functions in accordance with the operating state input with the selection member ( 41 ), and secures the operability of the operation members ( 31 a and 31 b ), and the selection member ( 41 ). note that , when the operation button 31 a is in the on state in the first embodiment , the medical treatment device 1 can function in the mode in which ultrasonic vibration is transmitted to the end effector 18 ( the first mode ) and in the mode in which ultrasonic vibration is transmitted and the high frequency energy is also supplied to the end effector 18 ( the second mode ) in accordance with the operating state input with the selection button 41 . however , the mode is not limited to the modes according to the first embodiment . similarly , when the operation button 31 b is in the on state , the medical treatment device 1 can function in the mode in which high frequency energy is supplied to the end effector 18 in an amount appropriate for solidification ( the third mode ) and in the mode in which high frequency energy is supplied to the end effector 18 in an amount appropriate for sealing of a blood vessel ( the fourth mode ) in accordance with the operating state input with the selection button 41 . however , the mode is not limited to the modes according to the first embodiment . fig5 is a diagram ( table ) of patterns of switching of the modes in which the medical treatment device 1 functions in accordance with the operating state input with the selection button 41 . when the operation button 31 a is in the on state in the first embodiment , the medical treatment device 1 functions in a pattern x 1 illustrated in fig5 in accordance with the operating state input with the selection button 41 . when the operation button 31 b is in the on state , the medical treatment device 1 functions in a pattern x 2 illustrated in fig5 in accordance with the operating state input with the selection button 41 . however , in an exemplary variation , the medical treatment device 1 functions in the pattern x 2 when the operation button 31 a is in the on state and the medical treatment device 1 functions in the pattern x 1 when the operation button 31 b is in the on state . in other words , the control unit 26 causes the medical treatment device 1 to function , for example , in one of patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection button 41 . the first embodiment is provided with two operation buttons 31 a and 31 b . however , the number of the operation buttons can be one , or three or more . in other word , at least an operation button ( 31 a or 31 b ) needs being provided . when one operation button is provided , the control unit 26 causes the medical treatment device 1 to function in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection button 41 . hereinafter , each of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 will be described . note that the patterns x 1 and x 2 have already described in the first embodiment , and thus the description will be omitted . in the pattern xa 1 , the medical treatment device 1 functions in a mode in which ultrasonic vibration is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is in the on state . the medical treatment device 1 functions in a mode in which the ultrasonic vibration and heat are transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . in this pattern , the end effector 18 is provided with a heating element ( not illustrated ) so that the electrical energy ( direct current power or alternating current power ) is supplied from the energy source 25 to the heating element . then , the heat generated by the heating element is transmitted to the end effector 18 . in the pattern xa 2 , the medical treatment device 1 functions in a mode in which high frequency energy is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is in the on state . the medical treatment device 1 functions in a mode in which heat is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . in the pattern x 3 , the medical treatment device 1 functions in a mode in which high frequency energy is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is in the on state . the medical treatment device 1 functions in a mode in which ultrasonic vibration is transmitted to the end effector 18 and water is conveyed near the end effector 18 through a water convey path ( not illustrated ) in accordance with the fact the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . in this pattern , a water convey source ( not illustrated ) that supplies water ( liquid ) through the water convey path is provided , and the control unit 26 controls the operation , for example , of a water convey pump of the water convey source . in each mode described in the pattern xa 3 , the function to supply high frequency energy to the end effector 18 is added to the functions of the mode corresponding to the pattern x 3 . alternatively , in the pattern x 4 , the medical treatment device 1 functions in a mode in which ultrasonic vibration is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is in the on state . the medical treatment device 1 functions in a mode in which ultrasonic vibration is transmitted to the end effector 18 and suction is performed from the periphery of the end effector 18 through a suction path ( not illustrated ) in accordance with the fact the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . in this pattern , a suction source ( not illustrated ) that perform suction through the suction path , and the control unit 26 controls the operation , for example , of a suction pump of the suction source . in each mode in the pattern xa 4 , the function to supply high frequency energy to the end effector 18 is added to the functions of the mode corresponding to the pattern x 4 . alternatively , in the pattern x 5 , the medical treatment device 1 functions in a mode in which ultrasonic vibration is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is in the on state . the medical treatment device 1 functions in a mode in which a different type of high frequency energy ( the second energy ) from the ultrasonic vibration ( the first energy ) is transmitted to the end effector 18 in accordance with the fact the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . instead of the supply of high frequency energy in the pattern x 5 , heat is transmitted to the end effector 18 in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern xa 5 . the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in the pattern x 5 is switched to the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern x 6 . the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern x 5 is switched to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in the pattern x 6 . similarly , the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in the pattern xa 5 is switched to the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern xa 6 . the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern xa 5 is switched to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in the pattern xa 6 . high frequency energy is supplied to the end effector 18 in each mode of the pattern x 7 instead of the transmission of ultrasonic vibration in the mode corresponding to the pattern x 3 . similarly , high frequency energy is supplied to the end effector 18 in each mode of the pattern x 8 instead of the transmission of ultrasonic vibration in the mode corresponding to the pattern x 4 . in a mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in the pattern x 9 , the output of energy from the energy source 25 is maintained as long as operation is input with the operation button ( 31 a or 31 b ). in other words , in a mode in which the medical treatment device 1 functions when the selection button 41 is in the off state , the supply of energy to the end effector 18 is maintained as long as the operation button ( 31 a or 31 b ) is maintained to be in the on state . when the mode is switched to a mode in which the medical treatment device 1 functions when the selection button 41 is in the on state , the output of energy is automatically stopped in accordance with the fact that a predetermined period of time t ′ 0 has elapsed since the start of the output of energy from the energy source 25 . in other words , in a mode in which the medical treatment device 1 functions when the selection button 41 is in the on state , the supply of energy to the end effector 18 is stopped when the predetermined period of time t ′ 0 has elapsed since the start of the output of energy even while the operation button ( 31 a or 31 b ) is maintained to be in the on state . even in such a case , however , the output of energy is started in accordance with the fact that the selection button 41 is in the on state and the operation button ( 31 a or 31 b ) is in the on state . note that , when ultrasonic vibration is transmitted as energy to the end effector 18 and the mode is switched to the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state , the output of energy can automatically be stopped in accordance with the fact that a predetermined period of time t ′ 1 has elapsed since the start of a phase locked loop control ( pll control ). an incision is detected based on a sound impedance z in a mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in the pattern xa 9 instead of stopping the output of energy after the predetermined period of time t ′ 0 has elapsed in the pattern x 9 . in this pattern , ultrasonic vibration is transmitted as energy to the end effector 18 so that the object to be treated that is grasped between the grasp units 16 and 17 is sectioned with the ultrasonic vibration . the control unit 26 chronologically detects , in the vibration generation unit 21 , the sound impedance z of the electrical energy ( alternating current power ) supplied to the vibration generation unit 21 . when the sound impedance z exceeds a set threshold zth , it is determined that the incision of the object to be treated is completed . when it is determined that the incision is completed , the control unit 26 notifies the operator of the completion of incision or the output of energy from the energy source 25 is automatically stopped . this prevents the ultrasonic vibration from wearing the end effector 18 after the completion of incision . in the pattern x 10 , the detection of an incision described in the pattern xa 9 is performed both in a mode in which the medical treatment device 1 functions when the selection button 41 is in the off state and in a mode in which the medical treatment device 1 functions when the selection button 41 is in the on state . however , in the pattern x 10 , the threshold zth is set at a high value in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state , and the threshold zth is set at a low value in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in comparison to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state . in the pattern x 11 , energy ( electrical energy ) to be supplied from the energy source 25 to the vibration generation unit 21 at a normal level is output so that ultrasonic vibration is transmitted to the end effector 18 in a mode in which the medical treatment device 1 functions when the selection button 41 is in the off state . the level at which the energy is output is lowered in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in comparison with the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state so that the amplitude of the ultrasonic vibration is reduced in the end effector 18 . in each of the patterns xa 11 to xc 11 , high frequency energy is output at a normal level from the energy source 25 in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state so that the high frequency energy is supplied to the end effector 18 . in each of the patterns xa 11 to xc 11 , the level at which the high frequency energy is output is lowered in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in comparison to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state . this causes the reduction in the high frequency electricity as the pattern xa 11 , or the reduction in the maximum value ( wave height ) of the high frequency voltage as the pattern xb 11 , or the reduction in the maximum value ( wave height ) of the high frequency current as the pattern xc 11 . in contrast to the pattern x 11 , the level at which the high frequency energy is output is increased in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in comparison to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state so that the amplitude of the ultrasonic vibration in the end effector 18 is increased in the pattern x 12 . in contrast to the patterns xa 11 to xc 11 , the level at which the high frequency energy is output is increased in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state in comparison to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state in each of the patterns xa 12 to xc 12 . this causes the increase in the high frequency electricity as the pattern xa 12 , the increase in the maximum value ( wave height ) of the high frequency voltage as the pattern xb 12 , or the increase in the maximum value ( wave height ) of the high frequency current as the pattern xc 12 . in the pattern x 13 , energy ( for example , high frequency energy , or the electrical energy to the vibration generation unit 21 ) is output from the energy source 25 at a level used for treatment in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state ( the first mode ) so that the energy to be used for treatment ( for example , high frequency energy or ultrasonic vibration ) is supplied to the end effector 18 . in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state ( the second mode ), the measurement unit 28 measures a predetermined parameter . when high frequency energy is supplied to the end effector 18 , the predetermined parameter to be measured can be , for example , the phase difference between the high frequency current and the high frequency voltage , the value of the high frequency current , the value of the high frequency voltage , or the chronological variations thereof . when the ultrasonic vibration is transmitted to the end effector 18 , the predetermined parameter to be measured can be , for example , the phase difference between the current and voltage of the electrical energy supplied to the vibration generation unit 21 , the value of current , the value of voltage , or the chronological variations thereof . when high frequency energy is supplied to the end effector 18 , an impedance z ′ of the object to be treated that is grasped between the grasp units 16 and 17 can be measured as the predetermined parameter . when the impedance z ′ of the object to be treated is measured as the predetermined parameter the object to be treated , the high frequency energy is output from the energy source 25 at a lower level than the level used for the treatment and the high frequency energy is supplied to the end effector 18 . in the first exemplary variation , the mode in which the medical treatment device 1 functions is switched as the illustrated pattern x 14 in accordance with the operating state input with the selection button 41 . fig6 is an explanatory diagram of a plurality of modes in which the medical treatment device 1 according to the present exemplary variation can function . as illustrated in fig5 and 6 , in the pattern x 14 , energy ( for example , high frequency energy , or the electrical energy to the vibration generation unit 21 ) is output at a set level from the energy source 25 so that energy used for treatment ( for example , high frequency energy or ultrasonic vibration ) is supplied to the end effector 18 in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state ( the first mode ). in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state ( the second mode ), the process performed by the level setting unit 27 of the control unit 26 changes the set level of the energy output from the energy source 25 . for example , in an exemplary embodiment illustrated in fig6 , ultrasonic vibration is transmitted to the end effector 18 when the mode is switched to a mode in which the medical treatment device 1 functions in accordance with the fact that the selection button 41 is in the off state and the operation button 31 a is in the on state . in this example , the energy source 25 supplies the electrical energy at a set level among the levels y 1 to y 3 of to the vibration generation unit 21 . in a mode in which the medical treatment device 1 functions in accordance with that fact that the selection button 41 is in the on state and the operation button 31 a is the on state , the control unit 26 changes the set level of the electrical energy supplied to the vibration generation unit 21 ( arrow a 1 , a 2 , or a 3 in fig6 ). in this example , only the level of the electrical energy is changed . the electrical energy is not output from the energy source 25 to the vibration generation unit 21 . in the exemplary embodiment illustrated in fig6 , high frequency energy is supplied to the end effector 18 when the mode is switched to the mode in which the medical treatment device 1 functions in accordance with the fact the selection button 41 is in the off state and the operation button 31 b is in the on state . in this example , the energy source 25 supplies the high frequency energy at a set level among the levels y ′ 1 to y ′ 3 to the end effector 18 . in a mode in which the medical treatment device 1 functions in accordance with the fact that the selection button 41 is in the on state and the operation button 31 b is the on state , the control unit 26 changes the set level of the high frequency energy supplied to the end effector ( arrow a ′ 1 , a ′ 2 , or a ′ 3 in fig6 ). in this example , only the set level of the high frequency energy is changed . the high frequency energy is not output from the energy source 25 to the end effector 18 . when the mode is switched in the pattern x 15 in an exemplary variation , energy ( for example , high frequency energy or the electrical energy to the vibration generation unit 21 ) is output at a level used for treatment from the energy source 25 so that the energy used for treatment ( for example , high frequency energy or ultrasonic vibration ) is supplied to the end effector 18 in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state ( the first mode ). the energy is supplied to the end effector 18 in a similar manner to the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state , and the handle 11 is electrically operated and closed in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state ( the second mode ). in this example , the inside of the housing 6 is provided with an electric motor ( not illustrated ) so that electrical energy ( drive electricity ) is supplied from the energy source 25 to the electric motor . this electricity drives the electric motor . driving the electric motor makes driving force act on the handle 11 so that the handle 11 is closed . the process in accordance with the operating state input with the operation button ( 31 a or 31 b ) is not limited to the process illustrated in fig3 and the process performed in a similar manner to fig3 . for example , when the selection button 41 is in the off state and the operation button ( 31 a or 31 b ) is switched to the on state ( step s 101 — yes and s 102 — yes in fig3 ) and the selection button 41 is switched from the off state to the on state before the given period of time t 0 has elapsed since the operation button ( 31 a or 31 b ) has been switched to the on state ( step s 103 — no in fig3 ), an error is warned and a state in which the medical treatment device 1 is stopped from functioning is maintained in the first embodiment . however , when the selection button 41 is switched from the off state to the on state before the given period of time t 0 has elapsed since the operation button ( 31 a or 31 b ) has been switched to the on state , it is determined in an exemplary variation that the operation button ( 31 a or 31 b ) and the selection button 41 are simultaneously in the on state . then , the control unit 26 causes the medical treatment device 1 to function in a mode in which the medical treatment device 1 functions in accordance with the fact that the operation button ( 31 a or 31 b ) and the selection button 41 are simultaneously in the on state ( for example , the second mode ). in an exemplary variation , as long as the control by the control unit 26 maintains the operation button ( 31 a or 31 b ) in the on state , the mode in which the medical treatment device 1 functions is not changed even when the operating state is switched with the selection button 41 ( the selection button 41 is switched between the on state and the off state ). to switch the mode in which the medical treatment device 1 functions in this example , it is necessary to switch the operation button ( 31 a or 31 b ) from the off state to the on state after the operating state input with the selection button 41 is switched while the operation button ( 31 a or 31 b ) is in the off state . in contrast , in another exemplary variation , the control by the control unit 26 switches the operating state input with the selection button 41 ( switches the selection button 41 between the on state and the off state ). this switching changes the mode in which the medical treatment device 1 functions even while the operation button ( 31 a or 31 b ) is in the on state . in the second exemplary variation , the mode in which the medical treatment device 1 functions is switched to the mode as the pattern x 16 illustrated in fig5 in accordance with the operating state input with the selection button 41 . in the pattern x 16 , the medical treatment device 1 operates in accordance with the operation input with the foot switch ( the operation input apparatus ) 34 in the mode in which the medical treatment device 1 functions when the selection button 41 is in the off state ( the first mode ). in other words , when the selection button 41 is in the off state , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 regardless of the operation input with the operation button ( 31 a or 31 b ) ( whether the operation button ( 31 a or 31 b ) is in the on state or the off state ). for example , when operation is input with the foot switch 34 , energy ( for example , high frequency energy , or the electrical energy to the vibration generation unit 21 ) is output from the energy source 25 so that the energy used for treatment ( for example , high frequency energy or ultrasonic vibration ) is supplied to the end effector 18 . on the other hand , in the pattern x 16 , the medical treatment device 1 operates in accordance with the operation input with the operation button ( the operation member ) 31 a or 31 b in the mode in which the medical treatment device 1 functions when the selection button 41 is in the on state ( the second mode ). in other words , when the selection button 41 is in the on state , the medical treatment device 1 operates in accordance with the operation input with the operation button ( 31 a or 31 b ) regardless of the operation input with the foot switch 34 . for example , when operation is input with the operation button 31 a , energy ( for example , high frequency energy , or the electrical energy to the vibration generation unit 21 ) is output from the energy source 25 so that the energy used for treatment ( for example , high frequency energy or ultrasonic vibration ) is supplied to the end effector 18 . fig7 is a diagram of the configuration to detect the operating state input with each of the operation buttons 31 a and 31 b , and the selection button 41 in the present exemplary variation . in the present exemplary variation , the operating state input with the operation button corresponding to each of the switches 35 a and 35 b ( the operation button 31 a or 31 b ) is detected in accordance with whether each of the switches 35 a and 35 b opens or closes , and the operating state input with the selection button 41 is detected in accordance with whether the switch 42 opens or closes . as illustrated in fig7 , in the present exemplary variation , the control unit 26 is connected to the switch 35 a through the detection signal line 45 a , and the control unit 26 is connected to the switch 35 b through the detection signal line 45 b . similarly , the control unit 26 is connected to the switch 42 through the detection signal line 45 c . in the present exemplary variation , the switches 35 a and 42 are electrically arranged in series each other and the switches 35 b and 42 are electrically arranged each other . the detection signal lines 45 a to 45 c are a first detection signal line that transmits a detection signal ( first detection signal ) indicating the operating state input with each of the operation buttons 31 a and 31 b to the control unit 26 , and are a second detection signal line that transmits a detection signal ( second detection signal ) indicating the operating state input with the selection button 41 to the control unit 26 . in the present exemplary variation , when both the operation button 31 a and the selection button 41 are in the on states , both the switches 35 a and 42 are closed and thus the detection current flows through the detection signal lines 45 a and 45 c . the flow of the detection current through the detection signal lines 45 a and 45 c switches the mode to a mode in which the medical treatment device 1 operates in accordance with the operation input with the operation button 31 a and , for example , energy used for treatment is transmitted to the end effector 18 in accordance with the operation input with the operation button 31 a . when the selection button 41 is in the off state , the detection current does not flow through the detection signal lines 45 a and 45 c even when the operation button 31 a is in the on state . thus , when the selection button 41 is in the off state , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 even when the operation button 31 a in the on state . accordingly , when the operation button 31 a and the selection button 41 are momentary ones , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 unless operation is simultaneously input with the operation button 31 a and the selection button 41 ( unless the operation button 31 a and the selection button 41 are simultaneously pressed ) even when the operation is input with the operation button 31 a ( the operation button 31 a is pressed ). in the present exemplary variation , when both the operation button 31 b and the selection button 41 are in the on states , both the switches 35 b and 42 are closed and thus the detection current flows through the detection signal lines 45 b and 45 c . the flow of the detection current through the detection signal lines 45 b and 45 c switches the mode to a mode in which the medical treatment device 1 operates in accordance with the operation input with the operation button 31 b and , for example , energy used for treatment is transmitted to the end effector 18 in accordance with the operation input with the operation button 31 b . when the selection button 41 is in the off state , the detection current does not flow through the detection signal lines 45 b and 45 c even when the operation button 31 b is in the on state . thus , when the selection button 41 is in the off state , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 even when the operation button 31 b is the on state . accordingly , when the operation button 31 b and the selection button 41 are momentary ones , the medical treatment device 1 operates in in accordance with the operation input with the foot switch 34 unless the operation is simultaneously input with the operation button 31 b and the selection button 41 ( unless the operation button 31 b and the selection button 41 are simultaneously pressed ) even when operation is input with the operation button 31 b ( even when the operation button 31 b is pressed ). fig8 is a diagram of the configuration to detect the operating state input with each of the operation buttons 31 a and 31 b in a third exemplary variation . in the present exemplary variation , the operating state input with the operation button corresponding to each of the switches 35 a and 35 b ( the operation button 31 a or 31 b ) is also detected in accordance with whether each of the switches 35 a and 35 b opens or closes . as illustrated in fig8 , in the present exemplary variation , the control unit 26 is connected to the switch 35 a through the detection signal line 46 a , and the control unit 26 is connected to the switch 35 b through the detection signal line 46 b . similarly , the control unit 26 is connected to the switches 35 a and 35 b through the detection signal line 46 c . the detection signal lines ( first detection signal lines ) 46 a to 46 c transmits a detection signal ( first detection signal ) indicating the operating state input with each of the operation buttons 31 a and 31 b to the control unit 26 . in the present exemplary variation , when the operation button 31 a is in the on state and the operation button 31 b is in the off state , the detection current flows through the detection signal lines 46 a and 46 b . when the operation button 31 a is in the off state and the operation button 31 b is in the on state , the detection current flows through the detection signal lines 46 b and 46 c . when both the operation buttons 31 a and 31 b are in the on states , the detection current flows through the detection signal lines 46 a and 46 b . thus , both when the selection button 41 is in the off state and when the selection button 41 is in the on state in the present exemplary variation , the medical treatment device 1 can function in three modes ; a mode in which only the operation button 31 a is in the on state , a mode in which only the operation button 31 b is in the on state , and a mode in which both the operation buttons 31 a and 31 b are in the on states . in other words , both when the selection button 41 is in the off state and when the selection button 41 is in the on state , the medical treatment device 1 can function in a larger number of modes than the number of the operation buttons 31 a and 31 b that are the operation members . in an exemplary embodiment , when the selection button 41 is in the on state and only the operation button 31 a is in the on state , ultrasonic vibration is supplied to the end effector 18 . alternatively , when the selection button 41 is in the on state and only the operation button 31 b is in the on state , high frequency energy is supplied to both the grasp units 16 and 17 of the end effector 18 so that a bipolar treatment by the high frequency energy is performed . alternatively , when the selection button 41 is in the on state and both the operation buttons 31 a and 31 b are in the on states , high frequency energy is supplied to only one of the grasp units 16 and 17 of the end effector 18 so that a mono - polar treatment by the high frequency energy is performed . in the embodiments , when the selection button 41 that is a selection member is an alternate button , the selection button 41 is maintained to be in both the on state and the off state . however , the selection member is not limited to the alternate button . for example , the external surface of the housing 6 is provided with a selection lever 41 a as the selection member in a fourth exemplary variation illustrated in fig9 to 11 . the selection lever 41 a is placed at a portion facing a first end of the housing 6 in the width direction of the housing 6 ( the direction perpendicular to the drawing papers of fig9 and fig1 ) on the external surface of the housing 6 . the external surface of the housing 6 is provided with a concavity 47 in the present exemplary variation so that the selection lever 41 a can rotate around a rotation shaft r 1 in the concavity 47 . the selection lever 41 a can rotate between an off state position ( the position illustrated in fig9 ) and an on state position ( the position illustrated in fig1 ). in the present exemplary variation , the selection lever 41 a is also placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . thus , the thumb f 1 can input operation with the selection lever 41 a ( can rotate the selection button 41 a ) while the grip 8 is grasped between the thumb f 1 and the palm p . the thumb f 1 switches the selection lever 41 a between the on state and the off state . in the present exemplary variation , the external surface of the housing 6 is provided with engagement protrusions 48 a and 48 b in the concavity 47 . an engagement groove 49 , which can be engaged with the engagement protrusions 48 a and 48 b , is formed on the selection lever 41 a . the engagement of the engagement groove 49 with the engagement protrusion 48 a fixes the selection lever 41 a on the off state position with respect to the housing 6 so that the selection lever 41 a that is the selection member is maintained to be in the off state . in other words , the engagement protrusion 48 a and the engagement groove 49 work as a state maintenance mechanism that maintains the selection lever 41 a in the off state . the engagement of the engagement groove 49 with the engagement protrusion 48 b fixes the selection lever 41 a on the on state position with respect to the housing 6 so that the selection lever 41 a that is the selection member is maintained to be in the on state . in other words , the engagement protrusion 48 b and the engagement groove 49 work as a state maintenance mechanism that maintains the selection lever 41 a in the on state . in a fifth exemplary variation illustrated in fig1 to 14 , the external surface of the housing 6 is provided with a selection slider 41 b as the selection member . the selection slider 41 b is placed at a portion facing a side opposite to the side on which the force application unit 33 is placed with respect to the longitudinal axis c ( the upper side of fig1 ) on the external surface of the housing 6 . in the present exemplary variation , the selection slider 41 b can move in the direction along the longitudinal axis c with respect to the housing 6 . moving the selection slider 41 b switches the selection slider 41 b between the off state ( the state illustrated in fig1 ) and the on state ( the state illustrated in fig1 ). in the present exemplary variation , the selection slider 41 b is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . thus , the thumb f 1 can input operation with the selection slider 41 b ( can move the selection slider 41 b ) while the grip 8 is grasped between the thumb f 1 and the palm p . the thumb f 1 switches the selection slider 41 b between the on state and the off state . in the present exemplary variation , the internal surface of the selection slider 41 b is provided with a groove 58 and a pressure unit 59 . as illustrated in fig1 , moving the selection slider 41 b to a position at which the switch 42 is inserted into the groove 58 prevents the selection slider 41 b from pressing the switch 42 . thus , the switch 42 is maintained to be in an opening state and the selection slider 41 b is maintained to be in the off state . in other words , the groove 58 works as a state maintenance mechanism that maintains the selection slider 41 b in the off state . when the selection slider 41 b is moved to a position at which the pressure unit 59 presses the switch 42 , the pressure by the pressure unit 59 maintains the switch 42 in a closing state . this maintains the selection slider 41 b in the on state . in other words , the pressure unit 59 works as a state maintenance mechanism that maintains the selection slider 41 b in the on state . in the embodiments described above , the selection member ( 41 , 41 a , or 41 b ) is placed on the external surface of the housing 6 . however , the placement is not limited to the embodiments . for example , in a sixth exemplary variation illustrated in fig1 , the inside of the housing 6 is provided with a selection switch 41 c including a switch 42 as the selection member . in the present exemplary variation , the selection switch 41 c is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . in the present exemplary variation , the selection switch 41 c is placed on a position at which the handle 11 can press the selection switch 41 c so that the handle 11 opens or closes with respect to the housing 6 . this opening or closing varies the pressure from the handle 11 on the selection switch 41 c . the variation in the pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the on state and the off state ( in other words , the variation switches the operating states input with the selection switch 41 c ). note that switching the operating states input with the selection switch 41 c switches the switch 42 between the opening and closing states . for example , when the selection switch 41 c is a momentary one , closing the handle 11 with respect to the grip 8 causes the handle 11 to press the selection switch 41 c so that the selection switch 41 c is switched to the on state . opening the handle 11 with respect to the grip 8 prevents the handle 11 from having contact with the selection switch 41 c so that the selection switch 41 c is switched to in the off state . in the present exemplary variation , the control unit 26 also causes the medical treatment device 1 to function , for example , in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection switch 41 c . in the present exemplary variation , the selection switch ( the selection member ) 41 c is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b in the housing 6 . thus , opening or closing the handle 11 with respect to the housing 6 can vary the pressure from the handle 11 on the selection switch 41 c . in other words , in the present exemplary variation , opening or closing the handle 11 simultaneously switches the selection switch 41 c between the on state and the off state . in the present exemplary variation , the housing 6 and the handle 11 are held as described in the first embodiment ( see fig4 ). thus , it is unnecessary in the present exemplary variation to change the positions and postures of the operator &# 39 ; s index finger f 2 , middle finger f 3 , ring finger f 4 , and little finger f 5 and to hold the housing 6 and the handle 11 again with the operator &# 39 ; s right hand h during the input of operation with the selection switch 41 c because opening or closing the handle 11 switches the operating states input with the selection switch 41 c . thus , in the present exemplary variation , the operability for opening and closing the handle 11 , rotating the rotating knob 12 , inputting operation with the operation buttons 31 a and 31 b is secured and the operability for inputting operation with the selection switch 41 c is also secured . in a seventh exemplary variation illustrated in fig1 and 17 , opening and closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the off state ( the state illustrated in fig1 ) and the on state ( the state illustrated in fig1 ). in the present exemplary variation , a movable tube 71 extends along the longitudinal axis c in the housing body 7 . the movable tube 71 moves together with a movable pipe ( not illustrated ) along the longitudinal axis c in response to the opening or closing of the handle 11 . a ring - shaped sliding member 72 is placed on the outer peripheral surface of the movable tube 71 . the handle 11 is coupled with the sliding member 72 in the housing body 7 . the sliding member 72 can move along the longitudinal axis c with respect to the movable tube 71 . a tube - shaped elastic member ( coil spring ) 73 is also placed on the outer peripheral surface of the movable tube 71 . a first end ( the head ) of the elastic member 73 is connected to the movable tube 71 and a second end ( the base ) of the elastic member 73 is connected to the sliding member 72 . in the present exemplary variation , closing the handle 11 with respect to the grip 8 when the selection switch 41 c that is the selection member is in the off state moves the movable tube 71 and the movable pipe toward the head side so that the grasp units 16 and 17 are closed . thus , the object to be treated is grasped between the grasp units 16 and 17 so that the object to be treated is compressed . when the object to be treated is compressed to some extent , the motion of the movable tube 71 and the movable pipe stops . further closing the handle 11 from that state moves the sliding member 72 toward the head side with respect to the movable tube 71 . this causes the elastic member 73 to contract . this contraction of the elastic member 73 increases the holding force between the grasp units 16 and 17 . in the present exemplary variation , the elastic member 73 contracts by a predetermined contraction amount ( a predetermined stroke ) or more . this contraction causes the handle 11 to press the selection switch 41 c ( the switch 42 ) and thus the selection switch 41 c is switched from the off state to the on state . thus , even when the handle 11 is closed , the selection switch 41 c is maintained to be in the off state unless the application of operation force in an amount more than or equal to a predetermined amount causes the elastic member 73 to contract by a predetermined contraction amount or more . thus , in the present exemplary variation , the selection switch 41 c is switched to the on state only when the object to be treated is grasped between the grasp units 16 and 17 and the force application unit 33 applies the operation force more than or equal to a predetermined amount of force and the handle 11 is closed . in an eighth exemplary variation illustrated in fig1 and 19 , opening or closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the off state ( the state illustrated in fig1 ) and the on state ( the state illustrated in fig1 ). in the present exemplary variation , the inside of the housing 6 is provided with a stopper 75 . the stopper 75 is fixed with respect to the housing 6 . in the present exemplary variation , closing the handle 11 with respect to the grip 8 when the selection switch 41 c that is the selection member is in the off state causes the handle 11 to have contact with the stopper 75 . further closing the handle 11 from that state causes the handle 11 to warp on the contact position with the stopper 75 as a fulcrum . in the present exemplary variation , the handle 11 warps by a predetermined warping amount or more after the handle 11 comes into contact with the stopper 75 . this warping causes the handle 11 to press the selection switch 41 c ( the switch 42 ), and thus switches the selection switch 41 c from the off state to the on state . thus , even when the handle 11 is closed , the selection switch 41 c is maintained to be in the off state unless the application of operation force in an amount more than or equal to a predetermined amount causes the handle 11 to warp by a predetermined warping amount or more . thus , similarly to the seventh exemplary variation , the selection switch 41 c is switched to the on state only when the object to be treated is grasped between the grasp units 16 and 17 and the force application unit 33 applies the operation force in an amount more than or equal to a predetermined amount and the handle 11 is closed in the present exemplary variation . in a ninth exemplary variation illustrated in fig2 and 21 , opening or closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the off state ( the state illustrated in fig2 ) and the on state ( the state illustrated in fig2 ). in the present exemplary variation , the inside of the housing 6 is provided with an elastic member 76 . the selection switch 41 c is attached on the elastic member 76 . in the present exemplary variation , closing the handle 11 with respect to the grip 8 when the selection switch 41 c that is the selection member is in the off state causes the handle 11 to have contact with the elastic member 76 . further closing the handle 11 from that state causes the elastic member 76 to contract . in the present exemplary variation , when the elastic member 76 contracts by a predetermined contraction amount or more , this contraction causes the handle 11 to press the selection switch 41 c ( the switch 42 ) and thus switches the selection switch 41 c from the off state to the on state . thus , even when the handle 11 is closed , the selection switch 41 c is maintained to be in the off state unless the application of operation force in an amount more than or equal to a predetermined amount causes the elastic member 76 to contract by a predetermined contraction amount or more . thus , similarly to the seventh exemplary variation and the eighth exemplary variation , the selection switch 41 c is switched to the on state only when the object to be treated is grasped between the grasp units 16 and 17 and the force application unit 33 applies the operation force in an amount more than or equal to a predetermined amount and the handle 11 is closed in the present exemplary variation . the tenth exemplary variation illustrated in fig2 and 23 is provided with a selection button 41 and a selection switch 41 c as selection members . in the present exemplary variation , the selection button 41 is provided nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . thus , the thumb f 1 can input operation with the selection button 41 ( can press the selection button 41 ) while the grip 8 is grasped between the thumb f 1 and the palm p . the thumb f 1 switches the selection button 41 between the on state and the off state . in the present exemplary variation , the selection switch 41 c is provided nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . opening or closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in pressure from the handle 11 to the selection switch 41 c switches the selection switch 41 c between the off state and the on state . fig2 is a diagram of the configuration to detect the operating state of each of the operation buttons 31 a and 31 b , the selection button 41 , and the selection switch 41 c in the present exemplary variation . in the present exemplary variation , the operating state input with the operation button corresponding to each of the switches 35 a and 35 b ( the operation button 31 a or 31 b ) is detected in accordance with whether each of the switches 35 a and 35 b opens or closes . furthermore , the operating state input with the selection button 41 is detected in accordance with whether the switch 42 a opens or closes and the operating state input with the selection switch 41 c is detected in accordance with whether the switch 42 b placed on the selection switch 41 c opens or closes in the present exemplary variation . as illustrated in fig2 , in the present exemplary variation , the control unit 26 is connected to the switches 35 a , 35 b , and 42 a through the detection signal line 77 a . the control unit 26 is connected to the switch 35 a through the detection signal line 77 b , and connected to the switch 35 b through the detection signal line 77 b . the control unit 26 is also connected to the switch 42 b through the detection signal line 77 c . in the present exemplary variation , the switches 42 a and 42 b are electrically arranged in series each other . the detection signal lines 77 a to 77 d are a first detection signal line that transmits a detection signal ( a first detection signal ) indicating the operating state input with each of the operation buttons 31 a and 31 b to the control unit 26 , and are a second detection signal line that transmits a detection signal ( a second detection signal ) indicating the operating state input with each of the selection button 41 and the selection switch 41 c to the control unit 26 . in the present exemplary variation , when both the selection button 41 and the selection switch 41 c are in the on states , both the switches 42 a and 42 b are closed so that the detection current flows through the detection signal lines 77 a and 77 d . the flow of the detection current through the detection signal lines 77 a and 77 d switches the mode from the mode in which both the selection buttons 41 and the selection switch 41 c in the off states . thus , even when both the selection button 41 and the selection switch 41 c are in the off states and one of the selection button 41 and the selection switch 41 c is switched to the on state ( even when one of the switch 42 a and 42 b is closed ), the detection current does not flow through the detection signal lines 77 a and 77 d and thus the mode is not switched . for example , in an exemplary embodiment , the mode is switched so that the medical treatment device 1 functions as the pattern x 16 illustrated in fig5 in accordance with the operating state input with each of the selection button 41 and the selection switch 41 c . in this example , when at least one of the selection button 41 and the selection switch 41 c is in the off state , the detection current does not flow through the detection signal lines 77 a and 77 d . thus , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 . for example , even when closing the handle 11 switches the selection switch 41 c to the on state , the medical treatment device 1 operates in accordance with the operation input with the foot switch 34 unless operation is simultaneously input with both the selection button 41 and the selection switch 41 c ( unless both the selection button 41 and the selection switch 41 c are simultaneously pressed ). thus , even when the selection switch 41 c is switched to the on state , the energy used for treatment ( for example , high frequency energy or ultrasonic vibration ) is not supplied to the end effector 18 in accordance with the operation input with the operation button ( 31 a or 31 b ) unless both the selection button 41 and the selection switch 41 c are in the on states . in the present exemplary variation , for example , when closing the handle 11 switches the selection switch 41 c to the on state , and operation is simultaneously input with both the selection button 41 and the selection switch 41 c ( both the selection button 41 and the selection switch 41 c are simultaneously pressed ), the mode is switched to the mode in which the medical treatment device 1 operates in accordance with the operation input with the operation buttons 31 a and 31 b . in the embodiments and variations , the handle 11 is placed on the head side of the grip 8 . however , as an eleventh exemplary variation illustrated in fig2 and 25 , the handle 11 can be placed on the base side of the grip 8 . in the present exemplary variation , the handle 11 also opens and closes in roughly parallel to the longitudinal axis c . the grip 8 includes a grip grasp unit ( grip finger - put position ) 51 . in the present exemplary variation , the operation buttons ( the operation members ) 31 a and 31 b are placed on the surface of the head 32 of the grip 8 and the operation buttons 31 a and 31 b are placed nearer to the longitudinal axis c than the grip grasp unit 51 . thus , the operation buttons 31 a and 31 b are placed at a portion on the head side of the housing 6 . in the present exemplary variation , the grip grasp unit 51 of the grip 8 is provided with a selection button ( the selection member ) 41 . in the present exemplary variation , the selection button 41 is exposed to the outside of the external surface of the housing 6 , and placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . in the present exemplary variation , the control unit 26 causes the medical treatment device 1 to function , for example , in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection button 41 . as illustrated in fig2 , for example , in a state in which an operator holds the housing 6 and the handle 11 with the operator &# 39 ; s right hand h , the operator &# 39 ; s middle finger f 3 , ring finger f 4 and little finger f 5 are put on the grip grasp unit 51 so that the grip 8 of the housing 6 is held . then , the thumb f 1 is put on the force application unit 33 of the handle 11 so that the thumb f 1 applies operation force on the handle 11 to close the handle 11 with respect to the grip 8 . the index finger f 2 performs the operation for rotating the rotating knob 12 and inputting operation with the operation buttons 31 a and 31 b ( pressing the operation buttons 31 a and 31 b ). in the present exemplary variation , the selection button ( the selection member ) 41 is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b on the external surface of the housing 6 , and is positioned on the grip grasp unit 51 . this enables the operator to input operation with the selection button 41 ( to press the selection button 41 ) using any one of the middle finger f 3 , ring finger f 4 , and little finger f 5 put on the grip grasp unit 51 of the grip 8 . the middle finger f 3 , ring finger f 4 , or little finger f 5 switches the selection button 41 between the on state and the off state . thus , the thumb f 1 and index finger f 2 used for at least one of the operations for opening or closing the handle 11 , for rotating the rotating knob 12 , and for inputting operation with the operation buttons 31 a and 31 b are not used for inputting operation with the selection button 41 . thus , it is unnecessary to change the positions and postures of the thumb f 1 and index finger f 2 and to hold the housing 6 and the handle 11 again with the right hand h in order to switch the selection button 41 between the on state and the off state . thus , in the present exemplary variation , the operability for opening or closing the handle 11 , for rotating the rotating knob 12 , and for inputting operation with the operation buttons 31 a and 31 b is secured and the operability for inputting operation with the selection button 41 is also secured . in a twelfth exemplary variation illustrated in fig2 , the base side of the grip 8 is provided with the handle 11 and the base surface 52 of the grip 8 is provided with the selection switch 41 c ( the switch 42 ). in the present exemplary variation , the selection switch 41 c is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b . then , the selection switch 41 c is exposed to the outside of the external surface of the housing 6 . in the present exemplary variation , the selection switch 41 c is placed at a position at which the handle 11 can press the selection switch 41 c so that opening or closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the on state and the off state ( in other words , the operating state input with the selection switch 41 c is switched ). in the present exemplary variation , the control unit 26 causes the medical treatment device 1 to function , for example , in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection switch 41 c . in the present exemplary variation , the selection switch ( the selection member ) 41 c is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b on the housing 6 , and placed on the base surface 52 of the grip 8 . thus , opening or closing the handle 11 with respect to the housing 6 can vary the pressure from the handle 11 on the selection switch 41 c . in other words , in the present exemplary variation , opening or closing the handle 11 immediately switches the selection switch 41 c between the on state and the off state . in the present exemplary variation , the housing 6 and the handle 11 are held as described in the eleventh exemplary variation ( see fig2 ). thus , it is unnecessary to change the positions and postures of the thumb f 1 and index finger f 2 and to hold the housing 6 and the handle 11 again with the right hand h in order to input operation with the selection switch 41 c because opening or closing the handle 11 immediately switches the selection switch 41 c between the on state and the off state . thus , in the present exemplary variation , the operability for opening and closing the handle 11 , for rotating the rotating knob 12 , and for inputting operation with the operation buttons 31 a and 31 b is secured and the operability for inputting operation with the selection switch 41 c is also secured . in the embodiments and variations , the handle 11 opens or closes in roughly parallel to the longitudinal axis c . for example , in a thirteenth exemplary variation as illustrated in fig2 and 28 , the handle 11 can open or close in a direction crossing ( roughly perpendicular to ) the longitudinal axis c . in the present exemplary variation , the housing 6 includes a housing body 7 extending along the longitudinal axis c , and a grip 8 extending from the housing body 7 in a direction crossing the longitudinal axis c . the handle 11 is placed opposite to the grip 8 while the longitudinal axis c is centered . the grip 8 includes a grip grasp unit ( the grip finger - put position ) 55 , and an inclined surface 56 placed nearer to the head side of the grip 8 than the grip grasp unit 55 . the inclined surface 56 faces the head side of the grip 8 . in the present exemplary variation , the operation buttons ( the operation members ) 31 a and 31 b are provided on the inclined surface 56 of the grip 8 . the operation buttons 31 a and 31 b are placed nearer to the head side of the grip 8 than the grip grasp unit 55 . thus , the operation buttons 31 a and 31 b are placed at a portion on the head side of the housing 6 . in the present exemplary variation , the grip grasp unit 55 of the grip 8 is provided with the selection button ( the selection member ) 41 . in the present exemplary variation , the selection button 41 is exposed to the outside of the external surface of the housing 6 and is placed nearer to the base side of the grip 8 than the operation buttons 31 a and 31 b . in the present exemplary variation , the control unit 26 causes the medical treatment device 1 to function , for example , in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state input with the selection button 41 . as illustrated in fig2 , for example , in the state in which the right hand h holds the housing 6 and the handle 11 , the middle finger f 3 , ring finger f 4 , and little finger f 5 are put on the grip grasp unit 55 so that the grip 8 of the housing 6 are held . the thumb f 1 is put on the force application unit 33 of the handle 11 so that the thumb f 1 applies operation force on the handle 11 to close the handle 11 with respect to the grip 8 . the index finger f 2 performs the operation for rotating the rotating knob 12 , or inputting operation with the operation buttons 31 a or 31 b ( pressing operation the operation buttons 31 a or 31 b ). in the present exemplary variation , the selection button ( the selection member ) 41 is placed near to the base side of the housing 6 than the operation buttons 31 a and 31 b on the external surface of the housing 6 , and placed on the grip grasp unit 55 . this enables the operator to input operation with the selection button 41 ( to press the selection button 41 ) using any one of the middle finger f 3 , ring finger f 4 , and little finger f 5 put on the grip grasp unit 55 of the grip 8 . the middle finger f 3 , ring finger f 4 and little finger f 5 switch the selection button 41 between the on state and the off state . thus , the thumb f 1 and index finger f 2 used for at least one of the operations for opening and closing the handle 11 , for rotating the rotating knob 12 , and for inputting operation with the operation buttons 31 a and 31 b are not used for inputting operation with the selection button 41 . thus , it is unnecessary to change the positions and postures of the thumb f 1 and index finger f 2 and to hold the housing 6 and the handle 11 again with the right hand h in order to switch the selection button 41 between the on state and off state in treatment . thus , in the present exemplary variation , the operability for opening and closing the handle 11 , for rotating the rotating knob 12 , and for inputting operation with the operation buttons 31 a and 31 b is secured and the operability for inputting operation with the selection button 41 is also secured . in a fourteenth exemplary variation illustrated in fig2 , the handle 11 opens and closes in a direction crossing ( roughly perpendicular to ) the longitudinal axis c , and a portion 57 facing the handle 11 on the external surface of the housing 6 is provided with the selection switch 41 c ( the switch 42 ). in the present exemplary variation , the selection switch 41 c is placed nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b ( the inclined surface 56 ). the selection switch 41 c is exposed to the outside of the external surface of the housing 6 . in the present exemplary variation , the selection switch 41 c is placed at a position at which the handle 11 can press the selection switch 41 c so that opening or closing the handle 11 with respect to the housing 6 varies the pressure from the handle 11 on the selection switch 41 c . the variation in the pressure from the handle 11 on the selection switch 41 c switches the selection switch 41 c between the on state and the off state ( in other words , the variation switches the operating states input with the selection switch 41 c ). in this exemplary variation , the control unit 26 causes the medical treatment device 1 to function , for example , in one of the patterns x 1 to x 16 , xa 1 to xa 6 , xa 9 , xa 11 to xc 11 , and xa 12 to xc 12 illustrated in fig5 in accordance with the operating state on the selection switch 41 c . in the present exemplary variation , the selection switch ( the selection member ) 41 c is placed near to the base side of the housing 6 than the operation buttons 31 a and 31 b on the housing 6 , and placed at a portion 57 facing the handle 11 on the external surface of the housing 6 . opening or closing the handle 11 with respect to the housing 6 can vary the pressure from the handle 11 on the selection switch 41 c . in other words , in the present exemplary variation , opening or closing the handle 11 immediately switches the selection switch 41 c between the on state and the off state . in the present exemplary variation , the housing 6 and the handle are held as described in the thirteenth exemplary variation ( see fig2 ). thus , because opening or closing the handle 11 immediately switches the selection switch 41 c between the on state and the off state in the present exemplary variation , it is unnecessary to change the positions and postures of the thumb f 1 and index finger f 2 and to hold the housing 6 and the handle 11 again with the right hand h in order to input operation with the selection switch 41 c . accordingly , in the present exemplary variation , the operability for opening and closing the handle 11 , rotating the rotating knob 12 , and inputting the operation buttons 31 a and 31 b is secured and the operability for inputting operation with the selection switch 41 c is also secured . in a fifteenth exemplary variation illustrated in fig3 to 31d , a lever 60 is rotatably attached to the housing 6 . similarly to the first embodiment , the handle 11 is placed nearer to the head side of the housing 6 than the grip 8 in the present exemplary variation . the handle 11 moves in roughly parallel to the longitudinal axis c . similarly to the first embodiment , the housing 6 is provided with the operation buttons ( the operation members ) 31 a and 31 b and the selection button ( the selection member ) 41 . in the present exemplary variation , the lever 60 rotates around a rotation axis r 2 that is roughly parallel to the width direction of the housing 6 ( the direction perpendicular to the drawing paper of fig3 ). the lever 60 rotates between a position at which the lever 60 can press the operation button 31 a ( the position indicated with a solid line in fig3 ) and a position at which the lever 60 can press the operation button 31 b ( the position indicated in a dashed line in fig3 ). note that the rotation axis r 2 of the lever 60 passes through a position nearer to the base side of the housing 6 than the operation buttons 31 a and 31 b and nearer to the head side of the housing 6 than the selection button 41 . the lever 60 includes a lever supporting shaft 61 through which the rotation axis r 2 passes , a first lever extension portion 62 extending from the lever supporting shaft 61 toward the head side of the housing 6 ( the side on which the operation buttons 31 a and 31 b are positioned ), and a second lever extension portion 63 extending from the lever supporting shaft 61 toward the base side of the housing 6 ( the side on which the selection button 41 is positioned ). in order to input operation with the operation button 31 a , rotating the lever 60 moves the first lever extension portion 62 to a position at which the first lever extension portion 62 can have contact with the operation button 31 a . meanwhile , the second lever extension portion 63 is positioned at a position at which the second lever extension portion 63 can have contact with the selection button 41 . in order to input operation with the operation button 31 b , rotating the lever 60 moves the first lever extension portion 62 to a position at which the first lever extension portion 62 can have contact with the operation button 31 b . meanwhile , the second lever extension portion 63 is positioned at a position at which the second lever extension portion 63 can have contact with the selection button 41 . as illustrated in fig3 a , even when the lever 60 is positioned at a position at which the lever 60 can have contact with the operation button ( 31 a or 31 b ) and the selection button 41 , the first lever extension portion 62 does not have contact with the operation button ( 31 a or 31 b ) and the second lever extension portion 63 does not have contact with the selection button 41 unless an external force ( the pressing force from the operator ) acts on the lever 60 . thus , in the state illustrated in fig3 a , operation is not input with the operation button ( 31 a or 31 b ) and the selection button 41 . for example , when the operation button ( 31 a or 31 b ) and the selection button 41 are momentary ones , the operation button ( 31 a or 31 b ) and the selection button 41 are in the off states . as illustrated in fig3 b , when the lever 60 is positioned at a position in which the lever 60 can have contact with the operation button ( 31 a or 31 b ) and the selection button 41 and an external force ( the pressing force from the operator ) acts on the first lever extension portion 62 ( the arrow τ 1 in fig3 b ), the first lever extension portion 62 has contact with the operation button ( 31 a or 31 b ). meanwhile , the second lever extension portion 63 does not have contact with the selection button 41 . thus , in the state illustrated in fig3 b , operation is input with the operation button ( 31 a or 31 b ) while operation is not input with the selection button 41 . thus , for example , when the operation button ( 31 a or 31 b ) and the selection button 41 are momentary ones , the operation button ( 31 a or 31 b ) is in the on state and the selection button 41 is in the off state . on the other hand , when an external force ( the pressing force from the operator ) acts on the second lever extension portion 63 ( the arrow τ 2 in fig3 c ) in a state in which the lever 60 is positioned at a position in which the lever 60 can have contact with the operation button ( 31 a or 31 b ) and the selection button 41 as illustrated in fig3 c , the second lever extension portion 63 has contact with the selection button 41 . meanwhile , the first lever extension portion 62 does not have contact with the operation button ( 31 a or 31 b ). thus , in the state as illustrated in fig3 c , operation is input with the selection button 41 and operation is not input with the operation button ( 31 a or 31 b ). thus , for example , when the operation button ( 31 a or 31 b ) and the selection button 41 are momentary ones , the selection button 41 is in the on state and the operation button selection button 41 is in the off state . when an external force ( the pressing force from the operator ) acts on the lever supporting shaft 61 ( the arrow t 3 in fig3 d ) in a state in which the lever 60 is positioned at a position at which the lever 60 can have contact with the operation button ( 31 a or 31 b ) and the selection button 41 as illustrated in fig3 d , the first lever extension portion 62 has contact with the operation button ( 31 a or 31 b ) and the second lever extension portion 63 has contact with the selection button 41 . thus , in the state illustrated in fig3 d , operation is input with the operation button ( 31 a or 31 b ) and operation is input with the selection button 31 . thus , for example , when the operation button ( 31 a or 31 b ) and the selection button 41 are momentary ones , the operation button ( 31 a or 31 b ) and the selection button 41 are in the on states . as described above , in the present exemplary variation , the provision of the lever 60 can makes it easy to simultaneously input operation with both the operation button ( 31 a or 31 b ) and the selection button 41 . an indicator ( not illustrated ) that indicates to the operator whether the selection member ( 41 , 41 a , 41 b , or 41 c ) is in the on state or the off state can be provided in an exemplary variation . the indicator can be provided on the medical treatment tool 2 ( for example , on the housing 6 ) or on the control device 3 . alternatively , the indicator can be provided separately from the medical treatment tool 2 and the control device 3 . the operation of the indicator is controlled , for example , by the control unit 26 . in an embodiment , the indicator is a light generation member such as an led that generates light when the selection member ( 41 , 41 a , 41 b , or 41 c ) in one of the on state or the off state . in another exemplary embodiment , the indicator is , for example , a protrusion or lever provided on the housing . in this example , the switching of the selection member ( 41 , 41 a , 41 b , or 41 c ) between the on state and the off state varies the protrusion amount of the protrusion or the orientation of the lever . in other words , the shape of the indicator varies . in another exemplary embodiment , a member that changes , for example , the texture when the selection member ( 41 , 41 a , 41 b , or 41 c ) is clicked , the stroke when the selection member ( 41 , 41 a , 41 b , or 41 c ) is switched , or the amount of force necessary to switch the selection member ( 41 , 41 a , 41 b , or 41 c ) is provided as the indicator . in this example , the switching of the selection member ( 41 , 41 a , 41 b , or 41 c ) between the on state and the off state varies the texture , stroke , or the amount of force . in the embodiments and variations , the medical treatment device ( 1 ) is provided with the housing ( 6 ) that includes the base and head and includes the housing body ( 7 ) extending along the longitudinal axis ( c ), the handle ( 11 ) capable of opening and closing with respect to the housing ( 6 ), the end effector ( 18 ) placed nearer to the head side of the medical treatment device ( 1 ) than the housing ( 6 ) and used to treat an object to be treated . a portion on the head side of the housing ( 6 ) is provided with the operation member ( 31 a or 31 b ), a portion nearer to the base side of the housing ( 6 ) than the operation member ( 31 a or 31 b ) is provided with the selection member ( 41 , 41 a , 41 b , 41 c , or 41 and 41 c ). operation for causing the medical treatment device ( 1 ) to function is input with the operation member ( 31 a or 31 b ). the operating state input with selection member ( 41 , 41 a , 41 b , 41 c , or 41 and 41 c ) is switched . the control unit ( 26 ) can cause the medical treatment device ( 1 ) to function in a plurality of modes and the control unit ( 26 ) detects the operating state input with the selection member ( 41 , 41 a , 41 b , 41 c , or 41 and 41 c ). then , the control unit ( 26 ) selects a mode in which the medical treatment device ( 1 ) functions from the modes in accordance with the result of detection of the operating state input with the selection member ( 41 , 41 a , 41 b , 41 c , or 41 and 41 c ). the configurations of the embodiments and variations can properly be changed or partially combined as long as the configuration includes the components described above . the embodiments and variations of the present invention have been described above . needless to say , the present invention is not limited to the embodiments and variations and can variously be changed without departing from the scope of the invention .

a control device having : one or more processors configured to : receive a first signal indicating one of a plurality of inputs of a first type received by a first input device ; receive a second signal indicating one of a plurality of inputs of a second type received by a second input device ; select a selected mode from one or more modes of a respective one or more treatment devices based on a combination of the first signal and the second signal ; and output a control signal for controlling the one or more treatment devices in accordance with the selected mode .

[ 0045 ] fig1 shows a system for analyzing biological tissues or organs in accordance with one embodiment of the invention . a transducer 100 contains a wave generator 105 for generating waves . the generated waves may be sonic waves or electromagnetic waves . the transducer also comprises an array of detectors 110 that detect reflected waves . a processor 115 is used to select the properties of the generated waves ( e . g . amplitude and wavelength ) via a signal 118 input to the wave generator 105 . the wave generator 105 is used to produce generated waves 120 that irradiate a tissue or organ 125 . waves 130 reflected by the organ or tissue 125 are detected by the detectors 110 in the transducer 105 . the wave detected by each detector is converted by the detector into an analog voltage dependent signal that is sampled by an analog to digital converter 140 . the digital samples 142 are then input to the processor 115 . the processor 115 calculates a phase for each sample based upon the signal 118 and stores the digital samples in a memory 135 in the form of complex raw data r ( x , y ). a second processor 145 is configured to receive the complex raw data r ( x , y ) from the memory 135 and process the complex raw data into an image i ( x , y ) as is known in the art . the image may be displayed on a display such as a crt 150 . in accordance with the invention , a third processor 155 is configured to analyze the tissue by processing either the raw data r ( x , y ) or the processed image data i ( x , y ). the results of the analysis may be displayed on a display such as the crt 160 . [ 0048 ] fig2 shows an ultrasound image i ( x , y ) of human ovary tissue from a healthy ovary ( a ) from a malignant ovarian tumor ( b ), and a benign ovarian tumor ( c ), as determined by histological examination of the tissues . ( e ) ( f ) and ( g ) show the fourier transform f ( y , ω )=∫ i ( x , y ) e iωx dx of a 30 × 30 pixel square from the image shown in ( a ) ( b ) and ( c ), respectively . the energy of each fourier transform was measured by evaluating the sum σ |∂ f /∂ y | over the range of 1 ≦ ω ≦ 28 and 34 ≦ ω ≦ 64 . the energy calculated for the normal tissue ( a , d ) was 3 , for the malignant tissue ( b , e ) 8 , and for the benign tissue , 3 . an analysis of 30 ovarian tissues showed that by this method of calculating energy , healthy ovarian tissues have an energy in the range of about 2 to 4 , while malignant ovarian tissues have an energy in the range of about 7 - 9 . ovarian tissues having a benign growth were indistinguishable from healthy ovarian tissues . the method of the invention may thus be used for identifying malignant tissues . other methods may be used for measuring energy may also be used in accordance with the invention such as calculating a volume under the fourier transform . [ 0049 ] fig3 shows a wavelet analysis of the three images i ( x , y ) shown in fig2 . the 30 × 30 pixel square from each image was input to the wavelet analysis software of the matlab ™ wavelet toolbox . the b - orthogonal filter was used with a decomposition level equal to 1 . the output of this software is four matrices known as the principle image coefficients ( a ), horizontal coefficients ( h ), vertical image coefficients ( v ) and the diagonal coefficients ( d ). fig3 shows the contour graph of the coefficients of the a matrix obtained for each image . the maximum of each contour graph was used as an index . the index of the malignant tissue is 204 , of the benign tissue 162 and the healthy tissue 90 . an analysis of 30 ovarian tissues showed that malignant tissues have indices 2 - 2 . 5 times those of healthy tissues . other indices maybe also used in accordance with the invention when using wavelet analysis such as the maximum coefficient in sum of the h , v , and d coefficient matrices . other filters may be used in accordance with the invention such as a mexican hat filter , as are known in the art . [ 0051 ] fig4 shows the results of an analysis of entropy in 60 images of ovaries . the state ( healthy , benign or malignant ) was determined for each ovary by histological methods . for each image , a 30 × 30 pixel square was selected and an entropy e was calculated for each square as follows . for each pixel i ( x , y ), a parameter a ( x , y ) was calculated a  ( x , y ) = 1 n  ∑  i  ( x , y ) - i  ( x ′ , y ′ )  2 was calculated , where the sum extends over all pixels ( x ′, y ′) in the square neighboring the pixel ( x , y ), and n is the number of pixels neighboring the pixel ( x , y ). the entropy was then calculated as the average of the a ( x , y ) over the entire square . as shown in fig4 images of healthy ovaries were found to have the lowest entropy ( in the range of 2 to 4 . 3 ). images from malignant ovaries have high entropies ( 6 . 9 - 8 . 3 ). images from benign tissues have intermediate to high values of entropy ( 4 . 9 - 8 . 3 ).

a method and system for assessing a spatial regularity of reflecting members in a tissue . the method comprises irradiating the tissue and detecting waves reflected by the tissue . one or more parameters are then calculated , based upon the reflected waves , indicative of a degree of spatial disorder of reflecting members in the tissue .

an embodiment of the present invention provides a method for processing a “ raw ” or filtered intracardiac signal , which may be unipolar or bipolar . typically the processing comprises fitting the intracardiac signal to a predetermined waveform , and deriving an annotation time of the signal from the fitted signal , rather than from the raw signal . typically , a unipolar signal is fitted to an equation representative of a single complete oscillation . a bipolar signal may be fitted to an equation representative of a difference of two single complete oscillations , typically separated by a temporal difference . in some embodiments the single complete oscillation corresponds to a differential of a gaussian function . an asymmetry factor may be applied to the differential , and in some embodiments the asymmetry factor corresponds to a gaussian function . the inventors have found that fitting raw or filtered signals to a predetermined equation , and measuring an annotation time from the fitted signals , reduces variation of the annotation times , as compared to annotation times determined directly from the raw or filtered signals . reference is now made to fig1 , which is a schematic illustration of an electrocardiograph ( ecg ) analysis system 20 , according to an embodiment of the present invention . system 20 receives at least one , and typically a plurality , of electrical signals from one or more electrodes positioned within an organ of a human patient . typically , the signals are received from a multiplicity of electrodes placed on one or more probes in the organ . for example , during an invasive procedure on a heart , a first probe with one or more electrodes may be positioned in a reference region of the heart , and used to sense a reference ecg signal from the region . a second probe having multiple electrodes may be used to detect and record other ecg signals from other regions of the heart . for simplicity and clarity , the following description , except where otherwise stated , assumes an investigative procedure that senses electrical signals from a heart 34 , using a single probe 24 . furthermore , a distal end 32 of the probe is assumed to have two substantially similar electrodes 22 a . 22 b . electrodes 22 a , 22 b , may be referred to herein as electrodes 22 . those having ordinary skill in the art will be able to adapt the description for multiple probes having one or more electrodes , as well as for signals produced by organs other than a heart . typically , probe 24 comprises a catheter which is inserted into the body of a subject 26 during a mapping procedure performed by a user 28 of system 20 . in the description herein user 28 is assumed , by way of example , to be a medical professional . during the procedure subject 26 is assumed to be attached to a grounding electrode 23 . in some embodiments , electrodes 29 may be attached to the skin of subject 26 , in the region of heart 34 . system 20 may be controlled by a system processor 40 , comprising a processing unit 42 communicating with a memory 44 . processor 40 is typically mounted in a console 46 , which comprises operating controls 38 . controls 38 typically include a pointing device 39 , such as a mouse or a trackball , that professional 28 uses to interact with the processor . the processor uses software , including a probe navigation module 30 and an ecg module 36 , stored in memory 44 , to operate system 20 . ecg module 36 comprises a reference ecg sub - module 37 and a map ecg sub - module 41 , whose functions are described below . results of the operations performed by processor 40 are presented to the professional on a display 48 , which typically presents a graphic user interface to the operator , a visual representation of the ecg signals sensed by electrodes 22 , and / or an image of heart 34 while it is being investigated . the software may be downloaded to processor 40 in electronic form , over a network , for example , or it may , alternatively or additionally , be provided and / or stored on non - transitory tangible media , such as magnetic , optical , or electronic memory . ecg module 36 is coupled to receive electrical signals from electrodes 22 . the module may also be coupled to receive signals from one or more of electrodes 29 . the ecg module is configured to analyze the signals and may present the results of the analysis in a standard ecg format , typically a graphical representation moving with time , on display 48 . probe navigation module 30 tracks sections of probe 24 while the probe is within subject 26 . the navigation module typically tracks both the location and orientation of distal end 32 of probe 24 , within the heart of subject 26 . in some embodiments module 30 tracks other sections of the probe . the navigation module may use any method for tracking probes known in the art . for example , module 30 may operate magnetic field transmitters in the vicinity of the subject , so that magnetic fields from the transmitters interact with tracking coils located in sections of the probe being tracked . the coils interacting with the magnetic fields generate signals which are transmitted to the module , and the module analyzes the signals to determine a location and orientation of the coils . ( for simplicity such coils and transmitters are not shown in fig1 .) the carto ® system produced by biosense webster , of diamond bar , calif ., uses such a tracking method . alternatively or additionally , navigation module 30 may track probe 24 by measuring impedances between electrode 23 , electrodes 29 and electrodes 22 , as well as the impedances to other electrodes which may be located on the probe . ( in this case electrodes 22 and / or electrodes 29 may provide both ecg and tracking signals .) the carto3 ® system produced by biosense webster uses both magnetic field transmitters and impedance measurements for tracking . fig2 shows schematic graphs of typical ecg signals processed by system 20 , according to an embodiment of the present invention . graphs 100 , 102 show exemplary potential vs . time plots of “ raw ” ( i . e ., unprocessed ) bipolar intracardiac ecg signals . the signals are assumed to be derived from the potential differences between electrode 22 a and electrode 22 b while the electrodes contact a wall of the heart . as is known in the art , intracardiac ecg signals are noisy , the noise typically being generated by a number of factors , such as line radiation , the proximity of other electrical equipment , and other electrical sources derived from patient 26 , such as patient muscular contraction ( apart from heart muscles ). the noise typically causes problems in making quantitative measurements of annotation times from the raw signals . for example , an annotation time , t p , comprising the time of the “ r ” peak of the signal , may be required , the time being measured from the onset of the signal . graph 100 illustrates that t p is measured to be approximately 30 ms , whereas graph 102 illustrates that t p is measured to be approximately 25 ms . as is illustrated in the graphs , the measured value of t p varies . as stated above , graphs 100 , 102 illustrate bipolar graphs generated by difference signals between electrode 22 a and 22 b . the signal on each electrode 22 a or 22 b , when measured relative to a common reference electrode , is a unipolar signal , so that the bipolar signal may be considered as a difference between two unipolar signals . the reference electrode may be any convenient electrode , such as grounding electrode 23 , and / or one or more of skin electrodes 29 , and / or one or more other electrodes in contact with the heart . fig3 and 4 show schematic graphs produced by equations used for fitting to ecg signals , according to embodiments of the present invention . embodiments of the present invention fit a predetermined equation to signals such as the ecg signals illustrated in fig2 . the equation corresponds to a predetermined oscillating waveform , typically a waveform that is in the form of a single complete oscillation , i . e ., a waveform that has beginning and end points that have a substantially zero signal level , and that encompasses all the electrical activity between the two points . typically , the graph of a single complete oscillation has a single local minimum and a single local maximum . the local maximum and local minimum may be separated by a single inflection . in some embodiments , and as exemplified herein , the predetermined equation fitted to the signals is derived from the first differential of a gaussian function , skewed by an asymmetry factor . thus , for unipolar ecg signals received from electrodes 22 a or 22 b , processor 40 fits an equation having the general form given by equation ( 1 ) below to the signals : where v unipolar ( t ) represents the varying unipolar potential signal measured at the electrode at a time t ; t i is a temporal displacement of the signal , with respect to the time t = 0 . t i corresponds to the time when an activation wave passes through the electrode position ; t s is a parameter defining an asymmetry of the signal ; and inspection of equation ( 1 ) shows that the asymmetry factor provided by the equation corresponds to a gaussian function . thus , equation ( 1 ) sums a gaussian function and a first differential of a gaussian function . in the description below , parameters t i1 , a 1 , t s1 , and w 1 , are also referred to collectively as the unipolar fitting parameters of equation ( 1 ). graphs 110 , 112 , and 114 ( fig3 ) illustrate the effects of values of parameters t s and w on the waveform generated by equation ( 1 ). for simplicity , the units of the ordinate and the abscissa of each graph are assumed to be arbitrary . as shown by graph 110 , for t s = 0 , the graph has two - fold symmetry , having a center of symmetry at ( 3 , 0 ). ( in other words , under a rotation of 180 ° in the plane of the graph the graph transforms into itself .) graph 112 shows that for a positive value of t s = 3 , the graph becomes asymmetric . the asymmetry increases with increasing t s . as shown by graph 114 , the value of w changes the overall width of the graph , so that increasing the value of w reduces the width . if the ecg signal is a bipolar signal , it may be assumed to be generated by the difference between a unipolar signal v unipolar ( t ) 1 on electrode 22 a and a unipolar signal v unipolar ( t ) 2 on electrode 22 b . for bipolar signals such as these the processor fits an equation ( 2 ), derived from equation ( 1 ), to the signal : where v bipolar ( t ) represents the varying bipolar potential signal measured at the electrode at a time t ; v unipolar ( t ) 1 , v unipolar ( t ) 2 , also termed v 1 and v 2 , are as defined above for equation ( 1 ); t i1 , t i2 are temporal displacements of v 1 , v 2 ; t s1 , t s2 define asymmetries of v 1 , v 2 ; and for a bipolar signal there is a temporal difference , δt i = t i1 − t i2 , equal to a difference between the temporal displacements of the two unipolar signals v unipolar ( t ) 1 and v unipolar ( t ) 2 . the temporal difference between the two unipolar signals is typically a function of the spatial separation of the two electrodes generating the bipolar signal , and of an electrode orientation relative to a propagation direction of the activation wave . thus , in the case of two electrodes , at least a component of the propagation direction of the activation wave may be determined from the temporal difference of the unipolar signals . it will be appreciated that for more than two electrodes , the temporal differences between the respective unipolar signals detected by the more than two electrodes , as well as the positions of the electrodes , typically allow multiple components of the propagation direction to be found . from the multiple components , the propagation direction ( not just a component ) of the activation wave may be estimated . in the description below , parameters t i1 , t i2 , a 1 , a 2 , t s1 , t s2 , and w 1 , w 2 are also referred to collectively as the bipolar fitting parameters of equation ( 2 ). graphs 120 , 122 , and 124 ( fig4 ) illustrate the application of equation ( 2 ). graphs 120 and 122 are graphs of two unipolar equations of voltage vs . time , respectively having temporal displacements ( in arbitrary units ) of t = 3 and t = 4 . 5 , and widths of 4 and 2 . graph 124 is the graph of the difference of the two expressions , illustrating a bipolar voltage vs . time function having a temporal difference of δt = 4 . 5 − 3 = 1 . 5 . generated intracardiac unipolar and bipolar signals depend , inter alia , on the positions of the electrodes used to measure the signals . the generated signals also depend on the condition of the heart being measured , i . e ., whether the heart is functioning in a healthy or unhealthy manner . if a heart is unhealthy because of a specific defect , it also produces standard intracardiac signals , different from those of a healthy heart ( similar differences may be used in diagnoses using skin ecg signals , i . e ., body surface signals ). in the case of a specific defect , the unhealthy heart generates standard deficient unipolar or bipolar signals , the deficiency in the signals being caused by the respective heart defect . fig5 is a flowchart 200 showing steps performed by processor 40 in analyzing intracardiac signals , according to an embodiment of the present invention . in the following description the signals are assumed to comprise bipolar signals . those having ordinary skill in the art will be able to adapt the description , mutatis mutandis , for unipolar signals . in an initial step 202 , professional 28 inserts probe 24 into heart 34 , so that electrodes 22 a and 22 b are in contact with a section of the heart wall . processor 40 acquires intracardiac bipolar ecg signals from the electrodes , each ecg signal comprising ordered pairs of potentials v and times t : {( v , t )}. in a heartbeat selection step 204 , one complete heartbeat is selected . thus , if the duration of the selected heartbeat is t , and the acquisition in step 202 is performed at a sample rate samplerate , there are approximately t / samplerate samples of bipolar signals in the selected heartbeat . in an analysis step 206 , the processor fits equation ( 2 ) to the selected heartbeat to derive a set of values of the fitting parameters of equation ( 2 ) that give a best fit to the selected heartbeat . in a comparison step 208 , the processor uses navigation module 30 to check if electrodes 22 a and 22 b are in the same position with respect to the heart . if the comparison returns a positive result , so that the electrodes are in the same position , then in an averaging step 210 the processor averages the fitting parameters for all the heartbeats at the position , to generate a set of averaged fitting parameters . the flowchart then continues at an annotation time step 212 . if the comparison returns a negative result , so that the electrodes have moved , then no averaging is performed , and the flowchart continues directly to step 212 . in annotation time step 212 , the fitting parameters derived either in step 210 ( if averaging has occurred ) or in step 206 ( if there has been no averaging ) are used to estimate an annotation time . the annotation time is a reference time of occurrence of a characteristic of the ecg signal . the annotation time may be defined with respect to the body surface ecg , or with respect to an intracardiac reference ecg , for example from a catheter placed in the coronary sinus . typical signal characteristics used to define the reference annotation time include , but are not limited to , the time at which the r - peak maximum of the qrs complex occurs , the time at which the minimum derivative of the qrs complex occurs , the time at which a center of energy of the complete signal occurs , or the time at which a first indication of the complete signal occurs . the reference annotation time is typically dependent on the position in the heart at which the signal is measured . definitions for the reference annotation times and their values are stored in reference ecg sub - module 37 . in a map building step 214 , the processor constructs a point of an electro - anatomical map of heart 34 . to construct the map point , the processor incorporates the difference of annotation times estimated in step 212 and the relevant reference annotation time ( stored in sub - module 37 ) into a map of the heart ( using navigation module 30 ) ( fig1 ). sub - module 41 is also used in this step . the repetition of steps 202 - 214 is indicated by a continuation condition 216 returning a positive result . if condition 216 returns a negative result , typically by professional 28 deciding to stop the mapping procedure of step 214 , the flowchart ends . as stated above , steps 202 - 214 can be typically performed for different situations comprising different positions of the electrodes in healthy hearts and in unhealthy hearts with known defects . fig6 shows schematic graphs illustrating the results of applying the methods described above , according to an embodiment of the present invention . intracardiac ecg signals were recorded from several different cases , to create a data pool . approximately 5 , 900 heartbeats were extracted from the data pool . all heartbeats were organized into eleven groups , each group containing a heartbeat with an amplitude less than a pre - determined threshold . the threshold is a measure of the noise of the signal , so that signals having lower thresholds have higher noise levels . for each heartbeat in a specific group the time of occurrence t rk of the r - peak maximum , and the time of occurrence t ck of the passing of the activation wave , were estimated . k is an index representing a number of the heartbeat being measured . t ck was estimated using a fitting analysis similar to that described for flowchart 200 , herein also referred to as a fit annotation method . the method for estimating t rk is also referred to herein as the maximum annotation method . where σ ( δt ) is a standard deviation of all δt values , and the expressions of equations ( 4 ) give a measure of the variability of the annotation times by the maximum annotation method or by the fit annotation method of heartbeats within a given group . a graph 300 plots the variability var r vs . the threshold of a group , and a graph 302 is a linear regression of graph 300 . a graph 310 plots the variability var c vs . the threshold of a group , and a graph 312 is a linear regression of graph 310 . by comparison of the two sets of graphs , it is apparent that for low values of the threshold , i . e ., for signals with high noise values , the variability of the signals processed according to methods described herein , i . e ., using the fit annotation method , is less than the variability of signals that have not been processed with these methods . it will be appreciated that the embodiments described above are cited by way of example , and that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove , as well as variations and modifications thereof which would occur to persons skilled in the art upon reading the foregoing description and which are not disclosed in the prior art .

a method for analyzing signals , including : sensing a time - varying intracardiac potential signal and finding a fit of the time - varying intracardiac potential signal to a predefined oscillating waveform . the method further includes estimating an annotation time of the signal responsive to the fit .

as shown in fig1 and 2 , a pet grooming comb 10 in accordance with a preferred embodiment of the present invention comprises a grip 20 , two decorative boards 30 and 32 , and a comb head 40 . the grip 20 has a housing 50 and a shaft 60 . the housing 50 has a head portion 52 , a body portion 54 , a first concavity 522 at each of top and bottom sides of the head portion 52 for accommodation of a user &# 39 ; s thumb or forefinger , a second concavity 542 at a top side of the body portion 54 , and a third concavity 544 at a bottom side of the body portion 54 . the housing 50 has an inner cambered surface 562 at an inner periphery thereof , and an inner plane 564 opposite to the inner cambered surface 562 , as shown in fig4 . further , the body portion 54 has a first outer through hole 546 penetrating through top and bottom sides of the body portion 54 in communication with the second concavity 542 and the third concavity 544 and the shaft hole , and two second outer through holes 548 penetrating through the top side of the body portion 54 in communication with the second concavity 542 and the shaft hole and located at places corresponding to two opposite sides of the first outer through hole 546 . in addition , a junction of the head portion 52 and the body portion 54 is inwardly shrunken to form two opposite inwardly curved surfaces 56 , and a plurality of anti - slip blocks 58 are spacedly provided at each of the curved surfaces 56 and arranged in a straight manner from the head portion 52 to the body portion 54 for providing a skidproof effect . the shaft 60 has an outer cambered surface 602 , an outer plane 604 opposite to the outer cambered surface 602 , an inner through hole 62 penetrating through top and bottom sides thereof , and two mounting holes 64 recessed from the top side thereof . the shaft 60 is inserted into the housing 50 in such a manner that the inner through hole 62 and the mounting holes 64 are respectively aligned with the first outer through hole 546 and the second outer through holes 548 , and the outer cambered surface 602 and the outer plane 604 are respectively abutted against the inner cambered surface 562 and the inner plane 564 , resulting in that the shaft 60 is not rotatable relative to the housing 50 randomly . further , the shaft 60 has eight first coupling portions 66 , which are recesses in this embodiment , equiangularly , spacedly and circularly arranged at a periphery thereof around a longitudinal axis of the shaft 60 . the decorative board 30 has a first post 302 inserted in the first outer through hole 546 of the housing 50 and the inner through hole 62 of the shaft 60 , and two second posts 304 respectively inserted in the second outer through holes 548 of the housing 50 , and the mounting holes 64 of the shaft 60 such that the decorative board 30 is accommodated in the second concavity 542 , as shown in fig2 and 5 . the decorative board 32 has a third post 322 inserted in the first post 302 of the decorative board 30 through the first outer through hole 546 and the inner through hole 62 such that the decorative board 32 is accommodated in the third concavity 544 , as shown in fig6 . as a result , the shaft 60 can not move along an axial direction of the housing 50 due to the engagement of the decorative boards 30 and 32 , and patterns or trademarks can be designed on the decorative boards 30 and 32 according to the user &# 39 ; s need . as shown in fig7 and 8 , the comb head 40 has a comb bar 42 and a comb plate 44 . the comb bar 42 has a first end 422 of a tubular form provided at an inner periphery thereof with a second coupling portion 46 , which is a protrusion in this embodiment and selectively insertable into one of the first coupling portions 66 , i . e ., recesses , of the shaft 60 such that the comb bar 42 can be set to one of eight angles relative to the grip 20 , as shown in fig3 and 10 , a second end 424 , and an insertion groove 426 extending from the second end 424 toward the first end 422 . the comb plate 44 has a base portion 441 , a block 48 at a distal end of the base portion 441 , two dots 482 respectively provided at two opposite sides of the base portion 441 and adjacent to the block 48 , and a plurality of teeth 443 rotatably mounted on the base portion 441 . the comb plate 44 is fitted to the comb bar 42 in such a way that the base portion 441 is inserted into the insertion groove 426 until the block 48 is abutted against the second end 424 of the comb bar 42 , and the dots 482 are stopped against a periphery of the insertion groove 426 . by the aforesaid design , when the user would like to adjust the angle of the comb head 40 relative to the grip 20 , the user can draw the comb bar 42 away from the shaft 60 of the grip 20 to make the second coupling portion 46 , i . e . protrusion , leave away from one of the first coupling portions 66 , i . e . recesses , and then reinsert the second coupling portion 46 , i . e . protrusion , of the comb bar 42 into another first coupling portion 66 , i . e . recess , of the shaft 60 of the grip 20 according to the user &# 39 ; s need , as shown in fig9 and 10 . as a result , the comb head 40 is rotatable and fixable to a specific angle relative to the grip 20 to enable the user to comb the pet &# 39 ; s hair effortlessly . further , when holding the grip 20 , the user can hold the body portion 54 of the housing 50 to exert a force or place a thumb or forefinger on either of the concavities 522 of the top and bottom sides of the head portion 52 of the housing 50 for enabling the user to operate the grip 20 more comfortably and effortlessly due to its ergonomic design . in addition , because of the 360 - degree rotatable teeth 443 , the pet &# 39 ; s hair won &# 39 ; t be knotted ; moreover , when the user would like to change different type of teeth 443 , the user can draw the base portion 441 of the comb plate 44 away from the insertion groove 426 of the comb bar 42 to detach the comb plate 44 from the comb bar 42 , and then insert a new comb plate , such as the comb plate denoted by reference numeral 70 in fig1 , that has different kind of teeth into the insertion groove 426 of the comb bar 42 . as shown in fig1 , the teeth 72 of the comb plate 70 each have a sphere 74 at a distal end thereof to increase the contact area between each one of the teeth 72 and the pet &# 39 ; s hair . fig1 shows another comb plate 90 that has double rows of tapered teeth 92 to prevent the pet &# 39 ; s hair from knotting . certainly , the pet grooming comb of the present invention can be made with various kinds of design on the basis of the spirit of the present invention . for example , the first concavity is not necessary to be formed on each of the top and bottom sides of the head portion . it can be formed on either of the top and bottom sides of the head portion . further , the body portion of the housing and the shaft can be respectively provided with one or more second outer through holes and mounting holes , or even the arrangement of the second outer through holes and the mounting holes can be eliminated . besides , the first coupling portions of the grip and the second coupling portion of the comb head can be exchanged but not limited to the above - mentioned embodiment . in other words , the first coupling portions can be designed to be provided at the comb bar of the comb head , and the second coupling portion can be designed to be provided at the shaft of the grip . further , the shaft can be eliminated if the recesses are directly formed on the periphery of the shaft hole of the housing . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .

a pet grooming comb includes a grip having a plurality of first coupling portions circularly arranged around a longitudinal axis thereof and a comb head having a plurality of teeth and a second coupling portion selectively coupled to one of the first coupling portions . thus , a user can adjust a setting angle of the comb head relative to the grip by means of the engagement of one of the first coupling portions of the grip with the second coupling portion of the comb head , thereby enhancing convenience of use .

the principles of the present invention are particularly useful when incorporated in a lithotripter , generally indicated at 1 in fig1 . the lithotripter 1 is composed of a first sub - housing 3 and a second sub - housing 5 , which are essentially rotationally symmetrical . the sub - housing 3 has an upper domed part 3a with a central opening 7 , which is covered by a coupling membrane 9 , which is over the opening . shockwave pulses generated in the lithotripter 1 will emerge through this opening 7 via the coupling membrane 9 into a patient 11 , which is to be treated . a lower , essentially annular part 3b of the first sub - housing 3 , is rotatably connected to the second sub - housing 5 by a plain cylindrical bearing 13 . the second sub - housing 5 includes a non - pivotable upper or first part 15 , which is fashioned as an annular member and whose outside surface is received by the part 3b to form the cylindrical bearing 13 . the sub - housing 5 has a pivotable pot - shaped or second part 17 , whose floor or base has an opening 18 on which a shockwave source 19 is secured . the shockwave source 19 can , preferably , be a shockwave tube , which is disclosed in greater detail in u . s . pat . no . 4 , 674 , 505 . the pivotable pot - shaped part 17 is pivotably mounted to tilt around a swivel axis 21 by a pair of trunnions 22 which , as illustrated , lie in the plane of the paper in fig1 . the exact arrangement of the swivel axis 21 shall be set forth in greater detail hereinafter . in order to achieve a water - tightness of the lithotripter housing 3 and 5 , the pivotable pot - shaped part 17 and the non - pivotable part 15 are interconnected to one another by an inwardly situated bellows 23 . given a pivot of the pot - shaped part 17 , one half of the bellows 23 will be compressed , while the other half is pulled or stretched apart . a filling of the housing parts 3 and 5 with a dielectric , such as , for example , water , is required for reasons of the shockwave propagation . the shockwave source 19 has a central axis z , which coincides with the central axis of a focussing means 25 , which is mounted in the housing parts 3 and 5 adjacent the membrane 9 . the focussing means 25 , as illustrated in the exemplary embodiment , is a biconcave lens . the convergent lens of the focussing means is arranged centrally relative to the central axis z and is mounted for displacement along the central axis z by displacement means 29 . to this end , the displacement means comprises , for example , three rotating rods 31 ( only one being shown for purposes of illustration in fig1 ) having threads , which rods are offset by an angle of 120 ° relative to one another . the threads are cut into the upper part of the revolving rod 31 , which is received in a lower part 31a of the revolving rod 31 . the lower rod 31a is mounted in the floor or base of the part 17 in a rotationally movable fashion . two respective locking rings 30 hold every rod 31 axially rigid with respect to the part 17 . to provide a seal for the rod , an o - ring 32 is situated in an annular channel which is formed in the part 31a between the locking rings 30 . the edges of the revolving threads 31 engage into the inside threads at an outer edge 27 of the lens or focussing means 25 . a uniform rotation of the three revolving threads 31 displaces the lens 25 along the central axis z and , thus , perpendicular to the shockwave emission surface formed by the membrane 9 . a gear wheel 34 is mounted on the ends of each of the three thread parts 31a to create this linear displacement . all three gear wheels 34 are driven by a common tooth belt ( not shown ), which is driven by a motor ( not shown ). the lens 25 has a focal point f , which , thus , remains on the central axis z during displacement . the heads 33a and 35a of the two ultrasound transmission and reception means 33 and 35 , respectively , are fashioned as sector scanners and are arranged on the edge 27 of the lens 25 with a relative offset to one another by a rigidly prescribed angle alpha with respect to the axis z . in the illustrated embodiment , the angle alpha amounts to 90 °. the first head 33a is shown in broken lines , since it is situated in front of the plane of the observation with respect to the cross section of fig1 . the scanning plane e1 of the first ultrasound transmission and reception apparatus 33 extends perpendicular to the plane of the paper and proceeds through the central axis z . the second scan plane e2 , which is produced by the second sector scanner or head 35a of the second ultrasound transmission and reception means lies in the plane of the paper and is illustrated by lines including dashes and three dots . the second scan plane e2 also extends through the axis z . the geometrical conditions for the scan planes e1 and e2 , which extend perpendicular to one another and both extend through the central axis z of the focussing means 25 , are rigidly prescribed . the ultrasonic heads 33a and 33b are illustrated as being inclined towards the focal point f and are accommodated in the periphery or at the edge 27 of the lens 25 and are , thus , firmly mounted therein . three or four reinforcements or bulges 37 ( only one is shown ) are provided on the part 3b of the first sub - housing 3 . each of these bulges has a bore 39 , which receives rods or members of a mounting means , which enable the lithotripter 1 to be moved into and out of engagement with the patient 11 . the process or method of locating the lithotripter 1 is illustrated in fig2 - 5 . fig2 illustrates a schematic plan view of the effective focussing means 25 , as well as the first sector scanner 33a with its first scan plane e1 in the plane x - z , and the second scanner head 35a with its second scan plane e2 , which is in the plane y - z . in order to pivot the second scan plane e2 around the swivel axis 21 of fig1 the y axis is provided with a symbolic swivel bearing 41 . the sector - shaped scan planes e1 and e2 can be viewed on a picture screen of the apparatus 33 or 35 . in broken lines , fig2 shows a constellation of the axis x &# 39 ;, y &# 39 ; and z &# 39 ;, wherein z &# 39 ; is identical to z of the lithotripter 1 relative to a calculus k in the inside of the patient 11 , as initially randomly derived when the lithotripter is coupled to the patient still undirected when first applied . the calculus or stone k lies at some location between the scan planes e1 &# 39 ; and e2 &# 39 ;, which are not yet aligned . as a first step for the exact location of the stone k in a lithotripter adjustment , the second sub - housing 5 is rotated around the central axis z with the assistance of the cylindrical bearing 13 upon entrainment of both the apparatuses 33 and 35 until the calculus or stone k appears in the first scan plane e1 of the first ultrasonic scanner head 33 . this corresponds to a solid line x , y axis in fig2 . for the sake of clarity , the apparatus 33 and 35 are shown outside of the lens 25 , however , in the present case , the overall arrangement of the lens 25 , with the heads 35a and 33a are all rotated together . with the stone or calculus k lying in the plane e1 , the apparatus will have the configuration or cross section illustrated in fig3 a . the picture screen image of the calculus k and the mixed - in focus f occurs , as illustrated in fig3 b . however , the scan plane e2 , which in fig3 a extends perpendicular to the plane of the paper through the axis z , still misses the calculus or stone k . the picture screen for the second sector scanner 35 , thus , does not yet show the calculus k . as illustrated in fig4 a , the next step is to pivot the shockwave source 19 and focussing means 25 , plus the rigidly connected ultrasound transmission and reception apparatuses 33 and 35 around the swivel axis 21 , which extends perpendicular to the plane of the paper from the position illustrated in broken lines to a position where the calculus k will lie in the plane e2 and will appear in the picture screen of the second sector scanner 35 . the swivel axis 21 is aligned so that the calculus or stone k simultaneously remains in the scan region of the first ultrasonic scanner 33a . this means that the axis 21 must be arranged to extend perpendicular to the central axis z and must also lie in the scan plane e2 of the second ultrasonic scanner head 35a , which is imaged as lying in the back side of the focussing means 25 . fig4 b is the image for the first sector scanner 33 with the position of the calculus k shown in broken lines before the pivoting and the position after pivoting is shown in bold lines . in fig4 c , the image for the sector scanner 35 illustrating the position of the calculi after the pivoting so that the calculi also lies in the plane e2 . after the second positioning step , which is the step of pivoting on the axis 21 , the lithotripter 1 is aligned so that the calculus or stone k lies on the central axis z and , thus , can be seen on both picture screens . the depth position of the calculus k on the central axis z , however , has not coincided with the focal point f of the focussing means 25 . the focal point f is now displaced towards the calculus k in a third adjustment step by turning the rotating threads or positioners 31 of the displacement means 29 . the focussing procedure is , thus , concluded and the first shockwave pulses can now be triggered to disintegrate the stone k . the displaceability of the focal point f , without having to modify the position of the coupling membrane 9 relative to the patient 11 is an advantage of the lithotripter of the present invention . the possibility of turning and / or swivelling the scanning planes e1 and e2 of the ultrasound scanners 33 and 35 , respectively , creates the possibility of undertaking a reliable positioning , even given complicated calculus positions , which occurs particularly with gall stones . in the above description , it is assumed that the calculus was in a fixed position . however , movement of the stone will occur because of breathing activities , and this movement is a continual appearance and disappearance in the two ultrasound images . the same , to a lesser degree , will also occur due to the heart activity . it is , therefore , advantageous when the registration of the ultrasound image respectively occurs in the same respiration and / or each ecg position at which the shockwave is likewise to be triggered . it is just as advantageous for the evaluation carried out by the attending physician when only these ultrasound images are displayed . in fig5 a common trigger mechanism or means 50 is provided for this purpose . this trigger mechanism is used both during the registration for the ultrasound images , as well as when triggering the shockwaves . to this end , a pickup or sensor 55 for the respiration and a pickup or sensor 57 for the heart activity ( ecg ) are arranged on the patient 11 , who is positioned on a patient supporting plate 51 . as illustrated , the plate 51 has an opening 53 , through which the lithotripter extends to apply the shockwaves to the patient . the output signal of the sensors 55 and 57 are supplied to correspondingly known evaluation devices or means 59 and 61 , respectively . the output signals of these evaluation devices or means are conducted in common to a trigger mechanism 50 in the present installation . it is adequate in many uses to only provide the one sensor 55 with its evaluation means or device 59 for supervising respiration and to omit the sensor , such as 57 , and its evaluation means 61 for heart activity . in a known way , the trigger mechanism 50 forms a trigger signal t from the supplied signals , and this trigger signal t is then supplied via a selective switch 63 , either to a trigger mechanism or starting means 65 for the shockwaves , or to an exposure starting means 67 for the ultrasound images . in the illustrated switch position , the shockwave supply or generator means 69 , which belongs to the shockwave source 19 , is driven with the trigger signal t . in the present case , the shockwave source 19 is shown as a known shockwave tube . in the other non - illustrated position of the switch 63 , the trigger signal t charges the exposure starting means or mechanism 67 for the ultrasound images of the two ultrasound scanners 33 and 35 . the echo signals picked up by the heads 33a or , respectively , 35a are portrayed on the picture screens ( not shown ) with the assistance of the apparatus or means 33 and 35 , respectively . according to the arrangement of fig5 the registration of the two ultrasound images respectively occurs in a respiratory position in which the shockwave will also be subsequently triggered . as explained , this can also apply to phase relationship of the heart activity . although various minor modifications may be suggested by those versed in the art , it should be understood that we wish to embody within the scope of the patent granted hereon all such modifications as reasonably and properly come within the scope of our contribution to the art .

a lithotripter for treating calculi has a housing formed by a first sub - housing with an opening with a membrane for contacting the patient , a second sub - housing composed of two parts with the first of the two parts forming a cylindrical bearing with the first sub - housing to allow rotation around an axis , a second part being mounted for pivotal movement on an axis extending perpendicular to the axis of rotation . the second housing part supports the source of the shockwave to create a shockwave on a central axis and includes a focussing arrangement mounted on the second part for focussing the shockwave on the central axis . to locate the calculus or stone , two scanning heads having sector scanning planes are mounted at a predetermined angle on the focus arrangement . to locate the stone , the second housing part is rotated to locate the stone in one of the scan planes , and then the second housing part is pivoted to move the second scan plane onto the stone .

reference will now be made in detail to embodiments of the present invention , one or more drawings of which are set forth herein . each drawing is provided by way of explanation of the present invention and is not a limitation . in fact , it will be apparent to those skilled in the art that various modifications and variations can be made to the teachings of the present invention without departing from the scope of the invention . for instance , features illustrated or described as part of one embodiment can be used with another embodiment to yield a still further embodiment . thus , it is intended that the present invention covers such modifications and variations as come within the scope of the appended claims and their equivalents . other objects , features , and aspects of the present invention are disclosed in , or are obvious from , the following detailed description . it is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only and is not intended as limiting the broader aspects of the present invention . referring to fig1 , a mechanical arm 100 is shown . the mechanical arm 100 may include a frame 102 . the frame 102 may be made of any appropriate material including , but not limited to , any sufficiently strong metal , alloy , polymer , polymer mixture , wood , composite , or any combination thereof . the frame 102 may be of any suitable shape including , but not limited to , an elongate flat beam , an elongate beam that curves along the lateral portions , a plurality of connected elongate beams , a prismatic frame with a cross - section perpendicular to the axis that is square ( or circular , rectangular , triangular , hexagonal , and the like ), a lattice of elongate sections of an appropriate material , one or more pipes of any given cross - sectional geometry ( hollow or solid ), and the like . the frame 102 may have a gripping end 104 and a receiving end 106 opposite the gripping end . the frame 102 may be of any appropriate geometry . in embodiments forming a passageway interior to the frame 102 , the passageway may be of a constant or varying cross - sectional area . a handle 108 may be disposed on the frame 102 between the gripping end 104 and the receiving end 106 . the handle 108 may be of any shape including , but not limited to , a flat beam , a rounded beam , a pistol grip , an arcuate member , any ergonomic shape known in the art , a cantilevered beam , a connected beam , and the like . the handle 108 may include a stationary element 110 connected to the frame 102 . the stationary element 110 may be connected to the frame 102 in any manner including , but not limited to , through the use of fasteners such as screws , nuts and bolts , bolts ; welding of any kind ; gluing ; being formed as one part with the frame ; and the like . the stationary element 110 may also be connected to the frame 102 in one or more locations . the handle 108 may also include an actuation element 112 translatable relative to the stationary element 110 . the actuation element 112 may be translatable between an actuated position ( as shown in fig2 ) and an unactuated position ( as shown in fig1 ). the translation of the actuation element 112 can be any appropriate motion including , but not limited to , linear translatable motion toward and away from the stationary element 110 , rotatable motion about an attachment point to the frame 102 or the stationary element , and the like . the actuation element 112 may be translatably attached to the stationary element 110 ( along rails , telescoping rods , springs , any combination thereof , and the like ), translatably attached to the frame 102 , pivotably connected to the frame , pivotably connected to the stationary element , and the like . at least one elongate member 114 may be connected to the actuation element 112 . the elongate member 114 may be attached to the actuation element 112 in any manner including , but not limited to , fastened with any fastener , welded in any way , through the use of adhesives , molded as one part with the actuation element , any combination thereof , and the like . the elongate member 114 may extend from the actuation element 112 toward the gripping end 104 of the frame 102 . the elongate member 114 may also include a row of gear teeth 116 . the elongate member 114 may be of any appropriate shape and size so as to translate a row of gear teeth . the elongate member 114 may be a plate , a bar , a row of gear teeth thick enough to be attached to the actuation element and maintain its orientation , any combination thereof , and the like . a first grip member 118 and a second grip member 120 may be disposed on the frame 102 . the first grip member 118 and second grip member 120 may oppose each other directly or indirectly including , but not limited to , an orientation anywhere between more than 0 and up to 180 degrees relative to each other . the first grip member 118 may be rotatable about a first axis a 1 relative to the frame 102 . any number of grip members may be included in an embodiment of the mechanical arm 100 . each grip member 118 , 120 may be of any suitable size and shape . each grip member 118 , 120 may be thicker than what would normally be used in order to be sufficient for industrial applications and the like , or each grip member may be made of stronger or otherwise different material for the same purpose . the grip members 118 , 120 may be made of any appropriate material including , but not limited to , metal , alloy , polymer , polymer mixture , wood , composite , or any combination thereof . at least one first gear 122 may be connected to the first grip member 118 . the first gear 122 may be connected to the first grip member 118 in any method of attaching two objects discussed above . the first gear 122 may include teeth 124 complementary to the row of gear teeth 116 and engaging the row of gear teeth . the first gear 122 may also be configured to rotate the first grip member 118 about the first axis a 1 upon translation of the actuation element 112 . any number of gears may be used , and each gear may be of any appropriate dimension . the first gear 122 , for instance , may be an elongate gear so as to span from one side of the frame 102 to the other side of the frame in one embodiment . third grip member 126 and fourth grip member 128 may also be disposed on the frame 102 . the third grip member 126 may be rotatable about the first axis a 1 relative to the frame 102 . the third grip member 126 may move with the first grip member 118 , in a different timing than the first grip member , independently of the first grip member , and the like . a first shaft 130 may be rotatably mounted to the frame 102 . the first grip member 118 may be connected to the first shaft 130 in any connection manner contemplated above . the first gear 122 may also be connected to the first shaft 130 in any manner . the elongate member 114 may also include a second row of gear teeth 132 in any configuration as contemplated above with respect to the first row of gear teeth 116 . the second grip member 120 may be rotatable about a second axis a 2 relative to the frame 102 . at least one second gear 134 may be connected to the second grip member 120 in any manner contemplated above with regard to the first gear 122 and first grip member 118 . the second gear 134 may include teeth 136 complementary to the second row of gear teeth 132 and engaging the second row of gear teeth . the second gear 134 may be configured to rotate the second grip member 120 about the second axis a 2 upon translation of the actuation element 112 . in some embodiments , the first axis a 1 and the second axis a 2 may be parallel or substantially parallel to each other . a second shaft 138 may be rotatably mounted to the frame 102 . the second grip member 120 may be connected to the second shaft 138 in any manner of connection contemplated above . the second gear 134 may also be connected to the second shaft 138 in any manner of connection . in some embodiments , the frame 102 is configured to cover at least a portion of a user &# 39 ; s hand and forearm ( not shown ) during use . the frame 102 may cover one side of a user &# 39 ; s hand and forearm that comes into contact with the frame . the frame 102 may include at least one support portion 140 configured to at least partially support a user &# 39 ; s wrist ( not shown ) during use . the support portion 140 may be an integral part of the frame 102 or may be attached to the frame in any manner of attachment as contemplated above . the frame 102 may also include multiple support portions 140 such as 2 , 3 , 4 , or more support portions . at least one resilient member 142 may be configured to bias the actuation element 112 toward the unactuated position ( shown in fig1 ). the resilient member 142 may be any component or components configured to bias the actuation element 112 toward the unactuated position including , but not limited to , any type of spring , dimensions of the respective parts that biases toward a certain configuration , elastic members , resilient material between the components such as polymers or air bags , and the like . any number of resilient members 142 may be included , and any combination of resilient members may be used . the frame 102 may further include a gear cover 144 . the gear cover 144 may be configured to at least partially cover the at least one first gear 122 . the gear cover 144 may also be configured to cover at least a portion of all the gears 122 , 134 of the mechanical arm 100 . in one embodiment , the gear cover 144 may substantially cover all the gears 122 , 134 and prevent the gears from interacting with any exterior item ( such as articles to be manipulated by the mechanical arm 100 , a user &# 39 ; s finger , foreign contaminants , and the like ). the frame 102 may include a user cover 146 . the user cover 146 may be configured to at least partially cover a user &# 39 ; s hand and arm ( not shown ) placed interior to the frame 102 . the user cover 146 may also be configured to cover all portions of a user &# 39 ; s hand and arm ( not shown ) placed interior to the frame 102 . the user cover 146 may be configured to protect any portion of a user &# 39 ; s hand and forearm shrouded by the user cover from unwanted interaction with outside contaminants and forces . the user cover 146 may be any appropriate flexible material that is simply intended to prevent liquid or bacterial contamination of a user &# 39 ; s hand and forearm . the user cover 146 may also be any appropriate rigid material to prevent a user &# 39 ; s hand from being crushed by articles to be manipulated by the mechanical arm 100 or other objects and machines . the user cover 146 may be a separate part from the frame 102 and attached in any manner contemplated above , integral to the frame , or may be the same portion of the frame as the support portion 140 . at least one of a plurality of article engagement elements 148 is connected to the first grip member 118 . at least one of the plurality of article engagement elements 148 is also connected to the second grip member 120 . in embodiments including a third grip member 126 and fourth grip member 128 , the article engagement elements 148 may also be attached thereto . the grip members 118 , 120 , 126 , 128 may be made of any appropriate material including , but not limited to , metal , alloy , polymer , polymer mixture , wood , composite , or any combination thereof . the article engagement elements 148 may be configured to engage an article ( not shown ) to be manipulated by the mechanical arm 100 . in one embodiment , each of the article engagement elements 148 may include an elongate finger portion 150 . in another embodiment , each of the article engagement elements 148 may include an arcuate portion 152 , as best seen on fig3 . as shown in fig4 in still another embodiment , each of the article engagement elements 148 may include an engagement surface 154 having at least one protrusion 156 to aid in gripping an article ( not shown ). the engagement surface 154 may also include any surface feature that is configured to accomplish a specific function or variety of functions . the engagement surface 154 may include , but is not limited to including , one or more recesses , dimples , bumps , grooves , holes , needles , pins , channels , hooks , and the like . the article engagement elements 148 may include any appropriate attachment to accomplish a specific function or a variety of functions . some additional article engagement attachments 148 may include , but are not limited to , cutting members , hole punching members , embossing members , piercing members , and the like . the article engagement elements 148 may be connected to the grip members 118 , 120 , 126 , 128 in any manner contemplated above . in one embodiment , the article engagement elements 148 may be removably connected to the first grip member 118 and the second grip member 120 ( and third grip member 126 and fourth grip member 128 in embodiments including them ). this removable connection may allow for attachment of a variety of different article engagement elements 148 . any combination of article engagement elements 148 may be used in order to accomplish desired functions with the mechanical arm 100 , including mixing and matching varying article engagement elements . the article engagement elements 148 may be made of any suitable material including , but not limited to metal , alloy , polymer , polymer mixture , wood , composite , or any combination thereof . some article engagement elements 148 may be made of a different material than others to be suitable for different purposes . this written description uses examples to disclose the invention and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal language of the claims . although embodiments of the invention have been described using specific terms , such description is for illustrative purposes only . the words used are words of description rather than limitation . it is to be understood that changes and variations may be made by those of ordinary skill in the art without departing from the spirit or the scope of the present invention , which is set forth in the following claims . in addition , it should be understood that aspects of the various embodiments may be interchanged in whole or in part . while specific uses for the subject matter of the invention have been exemplified , other uses are contemplated . therefore , the spirit and scope of the appended claims should not be limited to the description of the versions contained herein .

a mechanical arm includes a frame with a distal end and a proximal end opposite the distal end . at least one gear may be rotatably connected to the frame . the gear may include a series of projections along its circumference . a pair of opposing jaw members may extend beyond the distal end of the frame . at least one jaw member may be connected to a corresponding gear . an elongate member may be slidably disposed on the frame . the elongate member may include a row of teeth configured to operatively mesh with the series of projections of the gear and may cause rotation of the gear upon translation of the elongate member . a handle may be disposed on the frame nearer the distal end than the proximal end . the handle may include an actuator connected to the elongate member . the actuator may translate the elongate member upon actuation .

with reference next to the drawing , there is shown a figurine 10 . the figurine 10 has a porous fabric , outer covering 11 preferably made of a knitted nylon , contoured and decorated in a conventional manner to resemble a human face . a mass or body of plant life nutrient material 13 , preferably sawdust , and a bed of grass seeds 14 , preferably buffalo grass seeds , are contained within the covering 11 . the grass seeds 14 are positioned beneath a porous scalp portion 16 of the covering 11 . the figurine 10 is positioned upon a shallow , liquid container or basin 18 in fluid communication with liquid contained therein so that the liquid may be drawn into the figurine . the figurine 10 is manufactured by inverting the covering 11 and positioning the grass seeds within the interior of the covering through an unshown opening in the bottom of the covering 11 . the remainder of the interior is filled with sawdust 13 and the opening then closed . the covering has interstices of a size which prevent the permeation of the seeds and sawdust therethrough , yet which allow the permeation of liquids and the stalks of grass . the knit of the covering is also somewhat stretchable to allow the interstices to increase in size as the grass stalks grow . the covering may be configured and decorated to resemble a face before or after it is filled with the seeds and sawdust . in use , the figurine 10 is positioned upon the liquid container 18 as shown in fig2 . water is then poured or sprinkled onto the scalp portion 16 of the covering 11 so as to soak through the scalp portion so as to saturate the grass seeds 14 and sawdust 13 . water may also be added directly to the basin 18 to maintain the sawdust moist through capillary - like action of the liquid therethrough . the figurine is placed in an area with sufficient light to promote plant growth . within a short period of time the grass seeds germinate causes them to sprout grass stalks g which grow through the interstices of the scalp portion of the covering towards the light . the stalks g have the appearance of hair growing from the scalp portion . the continued growth of the grass stalks causes the interstices to become enlarged to accommodate the stalks . as shown in fig2 one may then cut the grass stalks to a desired shape or particular hair style . the grass can continue to grow for an extended period of time so long as it is cared for by providing sufficient water and light . vital nutrients are supplied to the grass by the sawdust . it should be understood that the figurine may be made in a variety of forms and shapes such as animals . the covering may alternatively be made of a woven nylon or other fibrous material or of a perforated plastic sheet material . the figurine may also be constructed of other material with only the scalp portion 16 comprised of woven material or the like . an internal liquid reservoir may also be used to supply liquid to the nutrient material . the interior of the figurine may be filled with other types of nutrient materials such as soil and peat . other types of plant seeds may be used as an alternative to grass seeds , such as flower seeds , vegetable seeds and herb seeds . from the foregoing it is seen that a unique , new product is now provided . it should however be understood that the just described embodiments merely illustrate principles of the invention in its preferred form . many modifications , additions and deletions may be made without departure from the spirit and scope of the invention as set forth in the following claims .

an animalian figurine has an outer covering which contains a body of plant life nutrient material and a bed of plant seeds . the plant seeds are positioned adjacent a scalp portion of the covering so that the grass stalks sprouting therefrom grow through a scalp portion to simulate hair .

as stated above this invention is directed to an apparatus for collecting the waste materials of animals and in particular , the waste materials of animals such as dogs . the apparatus is specifically designed to permit collection of the waste material subsequent to the evacuation of the material from the animal and prior to the deposit of the waste material on the earth . referring therefore to fig1 an apparatus according to the invention is shown in perspective view and designated generally by the reference numeral 10 . apparatus 10 can be seen to comprise a tray section 12 , a cover section 14 , a handle 16 and a link member 18 , the link member being pivotally attached to cover 14 and handle 16 as is discussed below in detail . as best may be seen in fig3 tray element 12 is a generally rectangular structure having a bottom wall 22 , a first pair of opposed parallel sidewalls 24 and 25 and second pair of opposed parallel sidewalls 26 and 27 . the respective pairs of opposed parallel sidewalls are secured to the peripheral edges of bottom wall 22 and are further rigidly secured to each other along their intersecting edges . thus the respective pairs of opposed parallel sidewalls cooperate with bottom wall 22 to define a major cavity . as best may be seen from fig3 parallel opposed sidewalls 24 and 25 are provided with outwardly extending flanges 28 and 29 , respectively . flanges 28 and 29 define slide support surfaces for cover 14 during the operation of apparatus 10 . extending generally normally between opposed parallel sidewalls 24 and 25 is a partition 30 . partition 30 is rigidly secured at its ends to opposed parallel sidewalls 24 and 25 and along its bottom to bottom wall 22 . partition 30 divides the major cavity or tray 12 into a waste material compartment 32 and a deodorant material compartment 34 . the positioning of partition 30 is not critical and may be chosen to most suitably facilitate the construction as desired . tray element 12 may be manufactured from any of the many generally known materials suitable for manufacturing structures of this type . thus it may be a molded plastic material , it may be sheet metal or it may be some other material depending upon the particular desires of the manufacturer . as best may be seen in fig3 slidable cover 14 is a generally rectangular element having a cover sheet 36 which is sized to be slightly wider than the distance between the external edges of flanges 28 and 29 and to be slightly longer than the lengths of opposed parallel sidewalls 24 and 25 . the edges of cover 14 adjacent flanges 28 and 29 are provided with downwardly depending flanges 38 and 39 which preclude transverse displacement of cover 14 with respect to tray 12 but which do not interfere with sliding of tray 12 longitudinally i . e . in the direction of parallel opposed sidewalls 24 and 25 . further , the dependency of flanges 38 and 39 is such as to not interfere with cover 14 being able to tilt with respect to tray 12 during operation of apparatus 10 from a position such as that shown in fig1 to a position such as that shown in fig2 . secured to cover 14 adjacent one transverse edge thereof is one leaf of a hinge which cooperates with remaining hinge structure to pivotally connect cover 14 with link 18 as is discussed below . it should also be recognized that link 18 may be provided with an integral pintle to cooperate with barrel structure on cover 14 to effect the desired pivotal connection . referring now primarily to fig1 and 3 , handle 16 can be seen to comprise a hand pole 42 , a yoke 44 and a t element 46 . t element 46 is provided with a longitudinally extending bore in which to receive first and second dowel elements 48 and 49 which cooperate to define yoke 44 . thus , element 48 and 49 are rigidly secured within the longitudinally extending bore such that their orientation is contained in a single plane and their lower ends 51 , 52 respectively cooperate to define a tong effect . in this regard , lower ends 51 and 52 are spaced apart by a distance substantially equal to the distance between opposed parallel sidewalls 24 and 25 of tray 12 . further , ends 51 and 52 are adapted to be received within pintle retainer elements 53 , 54 which are mounted on the external surface of opposed parallel sidewalls 24 and 25 at the substantial midpoint between opposed parallel sidewalls 26 and 27 . thus , by reason of the relationship between ends 51 and 52 and pintle receiving elements 53 and 54 , tray 12 is pivotally mounted with respect to handle 16 . formed in the transversely extending portion of t element 46 is a threaded bore for receiving handle pole 42 . thus , handle pole 42 , t element 46 and yoke sections 48 and 49 are assembled to define a single rigid unit which is pivotable with respect to tray 12 and which cooperate to define the overall handle structure 16 . one side of t element 46 is adapted to mount a hinge leaf which comprises part of a hinge structure 61 mounted on link 18 to cause handle 16 to be pivotally connected with link 18 . in this regard , link 18 is a relatively flat elongated member having hinge elements 61 and 62 mounted on opposed transversely extending edges . hinge element 62 is operatively connected to cover 14 and hinge element 61 is operatively connected to t element 46 . the length of link 18 is that length which is substantially equal to the distance between the transverse edge of cover 14 and the surface of t element 46 when handle structure 16 is disposed perpendicularly to the plane of bottom wall 22 of tray 12 . all of the elements of apparatus 10 may be made from materials which are conventionally available and using techniques which are well known in the art . thus standard handle poles may be used for pole 42 , plastic or metal materials are perfectly suitable and even wood is acceptable . further , the apparatus may be constructed using manufacturing techniques which are well known in the art . considering therefore the manner of use of apparatus 10 , it is contemplated that the user carry apparatus 10 by handle 16 as he walks the animal to be guarded . ordinarily , if the animal is trained well , apparatus 10 need be carried only during those times when it can be expected that its use will be necessary . when it is determined that the animal is about to evacuate , apparatus 10 is placed on the ground and handle 16 is rotated from the position shown in fig1 to the position shown in fig2 so as to uncover waste compartment 20 . thereafter , the apparatus is positioned in the drop zone so that waste materials are caught in waste compartment 20 prior to hitting the ground . upon completion of the event , handle 16 is rotated from the position shown in fig2 to the position shown in fig1 thereby to cover the now full or at least partially full waste compartment 20 . upon returning home , the waste materials may then be disposed of in an acceptable manner and thus , the grounds , lawns , sidewalks and the curb have been spared despoilation . it should be noted that waste compartment 20 may be lined with a disposable liner such as liner 70 shown in fig4 . in this regard , the liners may be made from readily disposable materials , inserted in waste compartment 20 prior to use and , subsequent to use , disposed with the waste material in the conventional manner . still further , liner 70 may be provided with a snap - type top ( not shown ) to totally encase the waste material as may be desirable for certain modes of disposal . it should also be noted that appropriate deodorant material may be placed in compartment 22 to overcome offensive odors which may be emitted from the waste materials . apparatus 10 is a preferred embodiment of apparatus according to the invention . it will be recognized , however , that various modifications may be made to the disclosed preferred embodiment without departing from the spirit and the scope of the invention .

apparatus for collecting the waste material of animals and in particular dogs is disclosed to include a tray having a collection compartment and a deodorant compartment , cover means displaceable between tray covering and tray uncovering positions , a handle for providing portability to the apparatus and means connecting the handle to the tray cover for displacing the tray cover between covered and uncovered positions in response to movement of the handle .

referring first to fig1 and 2 , a first therapy patch ( generally 20 ) is disclosed . this patch is designed to deliver a treatment chemical as well as massaging vibration to human skin . pad 22 has an adhesive layer 24 impregnated with a treatment chemical 26 . the adhesive layer 24 is , until use , protected by a peel - off layer 28 on one side and backed by a support layer 30 on the other . at least lower side 32 of the support layer 30 is preferably impermeable to the treatment chemical 26 . upper side 34 of the support layer 30 has a pair of spring arms 36 fixed thereon that can clamp a battery - motor sub - assembly 38 down in a removable fashion . the adhesive layer 24 is suitable to removably stick on human skin after peel - off layer 28 is removed . the treatment chemical 26 is then free to migrate from the adhesive layer 24 to the human skin . while a wide variety of materials are suitable for the various layers of the pad , we prefer that the peel - off layer 28 be made of polypropylene . of course , a wide variety of other materials ( preferably plastics ) can be used for this purpose . in this regard , the art is well developed with respect to peel - off layers used for traditional bandages and transdermal patches . similarly , the adhesive layer 24 be made of a wide variety of materials . in this regard , the adhesive layer can be a hydrogel material formed with carboxymethylcelluose sodium , glycerin , kaolin , methyl acrylate / 2 - ethylhexyl acrylate copolymer , polyacrylic acid , polysorbate 80 , sodium polyacrylate , tartaric acid , titanium dioxide , and water . in another form , the hydrogel can be formed with acrylic acid , aluminum hydroxide , carmellose sodium , 2 - ethylhexyl acrylate , glycerin , isopropyl myristate , methyl acrylate , nonoxynol - 30 , polyacrlyate , polyacrylic acid , polysorbate 80 , sorbitan sesquioleate , starch , talc , tartaric acid , titanium dioxide , and water . in still another embodiment , the hydrogel can be formed with butylate hydroxytoluene , hydrogenated rosin glycerol ester , maleated rosin glycerin ester , natural rubber , perfume , polybutene , polyisobutylene , silicon dioxide , starch grafted acrylate , titanium dioxide , tocopherol acetate , and zinc oxide . we prefer that our adhesive layer be made of the hydrogel referred to above ( formed with carboxymethylcelluose sodium , glycerin , kaolin , methyl acrylate / 2 - ethylhexyl acrylate copolymer , polyacrylic acid , polysorbate 80 , sodium polyacrylate , tartaric acid , titanium dioxide , and water ) when our treatment chemical is mentholatum . examples of other potential treatment chemicals include but are not limited to those that can stimulate , soothe , or otherwise affect skin sensation or treatment such as counter - irritants ( e . g ., menthol , methyl salicylate , mentholatum , camphor , peppermint oil extract , and capsaicin ), analgesics ( e . g ., eucalyptus ), numbing agents ( e . g ., lidocane and prilocain ), and corticosteroids ( e . g ., alclometasone ( aclovate ), clocortolone ( cloderm ), desonide ( desowen ), and hydrocortisone ( cortizone - 10 and cortaid )). some , like menthol , will be for topical effect . others may be designed for entering the blood stream ( e . g . certain analgesics ). we expect that a most preferred adhesive layer will be 2 - 3 mm thick , 600 cm in area , and impregnated with 0 . 1 ml of the treatment chemical if mentholatum is used . we would propose to use therewith a polypropylene peel - off layer to cover one surface of it , which layer would be less than 1 mm thick . the support layer 30 can be made of a wide variety of materials . for example , with the adhesive layer and peel - off layer of the prior paragraph we propose a support layer 30 made of polypropylene that is less than 1 mm thick . the spring arms 36 can be made of plastics , metals , or other flexible materials . we prefer to use a plastic such as polypropylene . the battery - motor sub - assembly 38 may have a resin casing 39 , a battery 40 , an initiator 42 and a motor 44 , the latter having a vibrating attribute . in this regard , the motor 44 can have an internal off - center weight that rotates during operation ( under self - contained battery power ) to induce vibrations in the casing 39 ( and thus the overall pad 22 ) that are communicated to the target skin when therapy patch 20 is attached to the skin surface . the motor 44 and / or battery 40 can be designed for use with a first , and then one or more subsequent , therapy patches 20 , or can be designed for use with only an original therapy patch , to be disposed of when the patch is thrown away . it is possible to control the motor 44 via a microcontroller linked to the sub - assembly to produce controlled pulsed on / off cycles . microcontrollers capable of providing this feature are available from such companies as the atmel corporation . an example of possible circuitry to accomplish this is shown in fig5 . to start motor operation , and as will be appreciated from fig2 , a pull tab initiator 42 can be removed , thereby permitting an upper contact of the motor 44 to bias down onto the battery 40 . alternatively the initiator 42 could be in the form of a switch that provides tactile feedback when depressed . when the motor is switched on , this will initiate vibration . while the fig2 embodiment of battery - motor sub - assembly has the battery on top of the motor , the battery - motor sub - assembly can also take a motor - on - top - of - battery form . with such a form , the upper surface of the motor can be exposed to a depression panel on the top of the puck , thereby permitting pressure to initiate the motor . in fig3 there is depicted a string of patches 50 that are linked together in tear - off fashion ( e . g . analogous to a roll of kitchen paper towels ). these patches 50 are rectangular in top view and each have a selected pad , motor , and battery arrangement of the sort described above ( e . g ., analogous to the fig1 construction ). a feature of particular interest with respect to fig3 is that these patches are now linked together via web sections 52 and thus may provide a tear - off replacement supply . alternatively , a series of linked patches can be used as a group , with multiple motors and batteries , to affect a more extended area on the body . when linked patches are used as a group , with multiple motors and batteries , the motors may be allowed to run independently . alternatively , they may be so governed as to operate in a coordinated way . as an example , if the motors in a connected series of patches are made to pulse in succession down the series , the effect could be a sensation of kneading , rolling or pulsing motions across the body . a microcontroller ( similar to that discussed above with respect to pulsing operation of a single patch ) could be programmed to coordinate the activation of such a series of motors . alternatively , most motors could be controlled to work continuously , while a particular motor ( or motors ) could be provided with special pulsing instructions . this might be a system suitable for focusing on a particular area of ache , while also more generally providing massaging and a treatment chemical . when patches are to be used individually , one can , for example sever a patch 50 off of the string along the web section 52 . because the peel off layer 54 and the support layer 56 are sealed together in this region , the severing will not expose the adhesive layer 58 of the adjacent patch to air . thus , this provides a unique replacement supply . when the chemical in a first patch 50 is exhausted , the motor and battery can be removed from that patch and positioned in the next patch that is torn off . however , the tearing process does not compromise the patches that are not to be immediately used . in fig4 there is depicted another alternative patch 70 . this construction is similar to that depicted in fig1 and 2 ( e . g ., it has an adhesive layer 74 impregnated with a treatment chemical 76 , a peel off layer 78 , and a support layer 80 ) except that pad 72 has a substantially annular periphery 82 and the support layer 80 defines a centrally disposed recess 84 , rather than having spring arms attached for receiving battery - motor assembly 86 . the recess 84 is sized to receive the battery - motor assembly 86 . cover 88 is provided , which can be formed from a flocked pvc that spans over the battery - motor assembly 86 , and is connected to wall 90 via an adhesive ring 92 . the periphery of the recess 84 and the cover 88 cumulatively provide a casing that encapsulates the battery - motor assembly 86 . there are other possible alternatives for mounting the motor . rather than having a permanent recess or a permanent set of tabs , one might construct the pad so that it automatically closes around the motor and battery once they are positioned in the pad , somewhat like a foldable coin purse . the exact forms of the motor and battery are not critical , albeit it is highly preferred that they be extremely lightweight . examples of a preferred motor and a preferred battery are the sanko 1e120 motor from sanko electric co ., ltd ., of taiwan , and the energizer cr2430 battery from energizer holdings , inc . the therapy patch 20 could include additional features . for example , a suitable portion of the therapy patch 20 can be treated with a volatile scented material , for example such as lavender or peppermint oil , that is expected to be released into the air upon use of the patch . sachets or other holders of volatile scented materials ( not shown ) similarly could be included on or within the therapy patch 20 for the same purpose . furthermore , any suitable music or noise maker could be incorporated in the therapy patch 20 , if the delivery of sound in conjunction with the other sensations provided by the patch is desired . also , such a device could also deliver heat or cold temperatures to the surface being treated using techniques described in our priority application , which is incorporated by reference as if fully set forth herein . while the patches of the present invention can be used at a variety of locations along human skin , it is expected to be most preferred to apply the patch along the back of the neck , or to the shoulder area . in any event , the broad principles of the present invention can be applied in a wide variety of other ways apart from those specifically noted herein . still other modifications may be made without departing from the spirit and scope of the invention . thus , the claims ( rather than just the preferred embodiments ) should be reviewed in order to understand the full scope of the invention . the present invention provides therapy patches that can topically deliver a treatment chemical with massaging vibration to human skin .

therapy patches provide portable massaging devices that can also deliver topical treatment chemicals . these patches can be adhered to the skin via an adhesive layer that is also impregnated with the treatment chemical . kits are also provided to create a string of linked patches that can be used together or separately , and a microcontroller controls the vibration of the device for optimized massaging effects .

referring now to the drawings , in which like numerals refer to like components or steps , there are disclosed broad aspects of various exemplary embodiments . fig1 illustrates a method for producing microbeams using a collimator . the collimator 105 may include a plurality of parallel slits 115 in a vertical direction . a high - energy radiation fan beam 100 that may be narrow in the vertical direction and wide in the horizontal direction may pass through the collimator 105 . because the collimator 105 is made of a high - z material , it blocks portions of the incident x - ray radiation of the high - energy radiation fan beam 100 . the portion of the high - energy radiation fan beam 100 that passes through the slits 115 of the collimator 105 forms the microbeams 110 . the microbeams 110 may be used to treat a subject . depending upon the vertical height of the fan beam 100 relative to the size of the treatment area , the subject may have to be moved relative to the microbeams 110 in order to irradiate the whole treatment area . typically , it is not possible to move the high - energy radiation fan beam 100 because of the massive size of the facility necessary to produce the high - energy radiation fan beam 100 . mbrs may apply very high - energy radiation beams for a very short period of time and in some cases for a fraction of a second . one problem with mbrs may occur when scattered electrons are emitted in the treatment area due to the photoelectric and compton effects , which scattered electrons my then enter the non - treatment area ( valley regions ). this may result in smearing of the peak and valley doses applied to the subject . effective and safe mbrs relies upon valley dose areas in which the radiation dose is low enough to prevent any damage to the healthy cells . the photoelectric effect causes electrons to be emitted from irradiated matter as a consequence of absorption of energy by the irradiated matter from electromagnetic radiation of very short wavelength and high frequency , such as , for example , incident ultraviolet or x - ray radiation . compton scattering is an inelastic scattering of a photon by a free charged particle , usually an electron . compton scattering results in a decrease in energy ( increase in wavelength ) of the photon ( which may be an x - ray or gamma ray photon ), called the compton effect . part of the energy of the photon is transferred to the scattering electron . both these effects may produce scattered electrons that deposit their energy and , directly or indirectly , damage healthy tissues in the valley region . a magnetic field may be applied to substantially confine such scattered electrons to the treatment area and hence limit their contribution of radiation damage in the valley regions . suppose that a charged particle like an electron is moving in a magnetic field and that the direction of the motion is at right angles to that field . the result is that the electron is acted upon by an electromagnetic force f which is perpendicular both to the direction of the field and to the direction of the velocity of the particle . fig3 illustrates this scenario where an electron has a velocity along the x axis and a magnetic field with a direction along the z axis . the magnitude of the force depends on the charge of the electron e , its velocity v , and the magnetic field b : because the resulting force is perpendicular to the velocity , it causes the electron to move in a circular path of radius r which is illustrated in fig4 . thus , for example , a 1 tesla magnetic field would cause 10 kev secondary electrons to spin in a circle with a radius of 337 μm . this magnetic field could be in any direction or axis and the resultant circular electron motion would spin around the axis of the magnetic field and contain any component of the electron movement perpendicular to the axis of the radiation . the component of the velocity parallel to the axis of the magnetic field would not be affected by the magnetic field . therefore , placing an axis of a magnetic field parallel to the plane of the microbeams would allow movement of the electron within the treatment area of the peaks while decreasing electron movement outside the treatment area in the valley regions . the strength of the magnetic field may be chosen to minimize the number of scattered electrons that may leave the treatment area . the resulting radius of motion of the scattered electrons may be selected to be less than a fraction of the peak with such as 0 . 01 to 0 . 2 ( for example , 0 . 01 , 0 . 05 , 0 . 1 , or 0 . 2 ) of the thickness of the microbeams . even lower fractional values of the peak width values may be used if practicable . the level of containment of the secondary electrons depends on the strength of magnetic field and the energy / velocity of the scattered electrons . further , the energy / velocity of the electrons depends upon the specific spectral characteristics of the radiated energy in the microbeams . also , the specific composition of the treatment area ( i . e ., bone , muscle , fat , air , etc .) may affect the number of scattered electrons . all of these parameters may be taken into account to determine the magnitude of the magnetic field needed to provide the desired and practicable containment of the scattered electrons . prior to treatment of the subject , detailed three - dimensional measurements may be made of the treatment area as well as modeling with a physical and / or virtual phantom of the zone to be irradiated to determine the optimal treatment . information from these measurements and phantom modeling may be further used to determine the level of containment of the scattered electrons . fig2 illustrates an embodiment of a mbrs system . the mbrs system 200 may include a source 205 that produces a high - energy fan beam 100 , a beam filtering and limiting system 210 , a collimator 220 , a movable platform 225 , and magnets 235 . a subject 230 may be treated by the mbrs system 200 . the source 200 may produce high - energy electromagnetic radiation beam such as x - ray or gamma radiation beam . high - energy x - ray radiation may be especially beneficial . in any generated photon beam , the photons are produced having a characteristic spectrum of energies . the photon energy of the beams may range optimally from about 30 kev to about 300 kev . a synchrotron may be used to generate an x - ray beam having practically no divergence and a high fluence rate . these synchrotron generated x - rays have the potential for projecting sharply defined beam edges deep in the body . this source may be useful for generating x - ray microbeams for radiobiology , radiotherapy , and radiosurgery . a high fluence rate is required to implement mbrs because exposure times must be short enough ( e . g ., less than about 1 second ) to avoid the blurring of margins of the irradiated zones of tissue due to body or organ movements . in some cases a fraction of a second to prevent blurring of normal cardiac motion . absorbed doses to non - targeted tissues ( i . e ., in tissues both proximal and distal to the isocentric target where the microbeams do not overlap ) situated between microbeams may be kept below the threshold for radiation damage . these factors make it possible to effectively irradiate a target using a field of many well defined , closely spaced microbeams . the radiation beam for producing the microbeam array may be obtained from industrial x - ray generators or from synchrotron beamlines at electron storage rings . the radiation beam may be obtained from a wiggler or undulator inserted in an electron storage ring . a conventional “ planar ” wiggler uses periodic transverse magnetic fields to produce a beam with a rectangular cross - section , typically having a horizontal to vertical beam opening angle ratio on the order of 50 : 1 . in an alternative embodiment , the radiation beam is obtained from a “ helical ” wiggler , a configuration capable of producing a substantially less anisotropic beam . while a fan beam is discussed in the embodiment below , it is also possible to place the subject to be treated a large distance ( i . e ., & gt ; 100 m ) from the source 205 , which may allow the x - ray beam from the source to expand enough in both the horizontal and vertical directions so that the beam covers the whole treatment area , and hence , it may not be necessary to move the subject relative to the high - energy beam . further , such beam - spreading could be accomplished by two orthogonal wigglers that would spread the beam first in one direction and then in a second orthogonal direction . such embodiments would not require movement of the subject , but the collimator may still be affixed to the subject as with the previously described embodiments . in another alternative embodiment , bending magnets may be used to spread the beam . for example , many synchrotrons may include a plurality of straight sections connected by bent sections where the beam is bent from straight section to the adjacent section . the beam may be recovered from the bent section of the synchrotron using a wiggler that would result in a spread beam . alternatively , the bender connecting adjacent straight sections may itself be a wiggler , i . e ., a “ wiggler - bender ,” in which each successive centripital force on any particular circulating bunch of electrons is slightly more forceful than the preceding centrifugal force on the same bunch . this would not only result in a spread x - ray beam but would make appropriate medical use of space at the facility presently occupied by a simple bending magnet emitting x - rays of energy below those that might be useful for mbrs : the forceful “ wiggles ” in a wiggler - bender would assure a higher median energy of x - rays emitted tangentally therefrom than would be the case without “ wiggles ” in the bender . the beam filtering and limiting system 210 filters and limits the high - energy beam 100 for treating the subject 230 . as mentioned above the source may produce a high - energy beam with a range of energies . often only a certain range of energies may be used to treat the subject . accordingly , various filters made of various materials may be placed in the path of the high - energy beam to filter out the undesired energy bands in the high - energy beam . further , spatial limiting may be used to limit the beam to the desired beam size and geometry . this may help to prevent unwanted and unsafe stray radiation from the source 200 . such spatial limiting may be accomplished , for example , with plates having slits . the plates may be of sufficient thickness and high - z material to block portions of the high - energy beam from the source 200 and act to maintain the radiation in the peak region and out of the valley region . further , examples of spatial limiting are described in u . s . patent application entitled , “ low dose - rate radiation for medical and veterinary therapies with three dimensionally shaped profiles ,” attorney docket no . mib 3002 - cip filed concurrently herewith and which is hereby incorporated by reference for all purposes as if fully set forth herein . the high - energy fan beam 100 may irradiate the collimator 220 . as described above with respect to the fig1 , the collimator 220 may include a plurality of slits . the slits split the high - energy fan beam 100 into a plurality of microbeams 110 ( as shown in fig1 ). the collimator 220 may be affixed securely to the subject . as a result , the micro beams formed by the collimator 220 are fixed relative to the subject , even if the subject moves . in other embodiments , the collimator 220 may affixed to other elements of the mbrs system 200 , or even be affixed to its own movable or stationary platform . the movable platform 225 may hold the subject in a fixed position and then move the subject relative to the high - energy fan beam 100 . the movable platform 225 may be any known platform that secures the patient and then allows for very precise movement of the patient relative to the high - energy fan beam 100 . in other embodiments , the subject may be placed on a stationary platform instead . magnets 235 may be positioned around the subjected 235 in order to produce a magnetic field in a plane parallel to the microbeams 110 . the magnets 235 may be any type of magnet that may be capable of producing the needed magnetic field in the desired direction . for example , permanent magnets , electromagnets , super - conducting magnets , etc . may be used . the magnets may be positioned anywhere around the subject , but must be able to produce the needed magnetic field mainly in the non - targeted normal tissue order to contain the photoelectric effect and the compton effect scattered electrons of the radiation in the peak regions , thereby optimizing the repair of normal tissues traversed by the peak - dose zones of the microbeam array . although there might be a concomitant magnetic field imposed on the targeted zone , that part of the field would serve no useful purpose , indeed might promote the repair of the undesired targeted malignancy , were that possible : it has been shown , unexpectedly and favorably , that supporting cells in malignant tissues have little self - repair capacity after being lethally irradiated . in one embodiment , the magnets 235 may be affixed to the collimator 220 . in this embodiment the magnets may be aligned with the slits in the collimator 220 in order to contain the scattered electrons produced in the peak regions . such an arrangement has the advantage that the magnetic field from the magnets 235 may be accurately aligned to the microbeams produced using the collimator 220 . in other embodiments , the magnets 235 may be separate from the collimator 220 . in these embodiments , some sort of alignment apparatus and / or method may be used to align the magnetic field of the magnets . such apparatus and / or methods my include mechanical systems , optical systems , magnetic field detectors , or other known alignment systems . because such high - energy radiation may be used in mbrs it is very important to precisely control the dose of radiation applied to the subject 230 . prior to treatment , a medical physicist may use sophisticated computer tools and modeling to determine the dosage parameters to use during the mbrs . while the application of a single mbrs dose may be effective to effectively treat a subject , it may also be beneficial to provide multiple treatments from different directions . the treatment directions and doses would be selected to allow the multiple different sets of microbeams to intersect in the target area . these multiple doses of high - energy radiation to the treatment area may increase the effectiveness of the mbrs . therefore , for each treatment direction , the magnets 235 may be repositioned to provide a magnetic field in a plane parallel to the microbeams to thus contain scattered electrons during treatment in each direction . in the area of intersection of with the microbeams , the tissue would be totally destroyed . however , this magnetic confinement would protect the valley regions in the non - irradiated regions . while the high radiation beam 100 is described as being spread in the horizontal direction , it may be beneficial to spread the beam in the vertical direction or any other direction . using other beam spreading directions may provide benefits in accurately delivering a dose . also , if multiple mbrs treatments are used , then the ability to spread the high - energy beam 100 in various directions may be beneficial . for example , when producing high - energy x - rays using a synchrotron , a wiggler may be used to spread the beam in a desired direction . such a wiggler may be mounted so that it can be rotated around an axis parallel to the high - energy beam . as a result the beam may be spread in any desired direction . the rotation of the wiggler may be precisely and accurately controlled to allow the beam to spread as needed to apply the desired radiation dose . therefore , for each beam direction , the magnets 235 may be repositioned to provide a magnetic field in a plane parallel to the microbeams to thus contain scattered electrons during treatment in each direction . although the various exemplary embodiments have been described in detail with particular reference to certain exemplary aspects thereof , it should be understood that the invention is capable of other embodiments and its details are capable of modifications in various obvious respects . as is readily apparent to those skilled in the art , variations and modifications can be affected while remaining within the spirit and scope of the invention . accordingly , the foregoing disclosure , description , and figures are for illustrative purposes only and do not in any way limit the invention , which is defined only by the claims .

various embodiments relate to a method of performing microbeam radiation therapy on a subject , including : producing a high - energy radiation beam in a first direction ; producing planar microbeams using the high - energy radiation beam in the first direction , wherein the microbeams have a width , wherein the planar microbeams produce scattered electrons ; and applying a magnetic field in a direction lying in a plane substantially parallel to the planar microbeams , wherein the strength of the magnetic field corresponds to the width of the microbeam .

the present invention is a fishing hook and a method for attaching a snell a line to the fishing hook . referring first to fig1 , features of the fishing hook may be appreciated . the fishing hook 20 is preferably formed from a relatively strong metal wire . the fishing hook 20 includes a shank 22 . the lower end of the shank 22 is bent to form a hook portion 32 that comes to a barbed point 34 . the upper portion of the shank 22 is preferably bent to form a d - shaped eyelet 26 defining an eyelet opening 28 with a cleft 24 ( best shown in fig2 a ) at the apex of the eyelet 26 . the d - shaped eyelet 26 is formed by a rectilinear extension 36 of the shank and an arcuate leg 38 that curves downward and outward from the apex of the eyelet 26 towards the point 34 of the hook portion 32 and then back towards the shank 22 . a leader line or snell 40 is attached to the fishing hook 20 with a knot that lodges in the cleft 24 of the eyelet 26 . the cleft 24 maintains the position of the knot in the eyelet so that a force pulling on the leader line or snell 40 operates along the axis of the shank 22 , generating lever action to aid in setting the hook portion 32 into a fish . the d - shaped eyelet 26 is preferably an open loop . the end of the shank 22 forming the eyelet 26 may be blunted by being bent into a small closed loop 30 at the end of arcuate leg 38 , by fastening a blunt tip to the end of the eyelet , by peening or flattening the end of the eyelet 26 , or by any other means . by looping the end of the wire into the shank 22 , the exposed end of the wire is covered , thus mitigating the risk of the end of the wire cutting into the hand of a user . the formed eyelet 26 can be used as a handle to hold onto the fishing hook 32 while extracting the hook portion 32 from a fish . the relatively large area enclosed by the eyelet circumference forms an impediment against swallowing of the entire hook by a fish , ensuring that a user can readily grasp the fishing hook 20 to remove the hook 20 from a fish . by referring to fig2 a , 2b , and 2 c , additional details of the eyelet 26 may be appreciated . fig2 a and 2b show the eyelet 26 in an open position . the closed looped end 30 of the wire forming the eyelet 26 is aligned to pass to one side of the shank 22 , forming a small gap between the loop 30 at the end of the eyelet 26 and the shank 22 . the bend forming the circumference of the eyelet 26 is biased to maintain the formed gap , keeping the eyelet 28 open . as shown in fig2 c , the eyelet opening may be closed by moving the closed loop 30 to the opposite side of the plane of the shank 22 and hook portion 32 , so that spring bias holds the eyelet 28 closed with the arcuate leg 38 bearing against the shank 22 . as further illustrated in fig2 b and 2c , the closed loop portion 30 may be colored , textured or otherwise visually marked , through the use paint , ink , dye or any other suitable visual marking method . this allows the fisherman to easily identify the location and angle of the fishing hook within the fish &# 39 ; s mouth following hooking of the fish with respect to the eyelet portion ; i . e ., the hook point indicator allows the fisherman to determine the direction of the bend at the bottom of the hook with respect to the eyelet . a method of attaching a snell ( a short length of leader line ) to the fishing hook 20 is described by referring to fig3 a , 3b , 3 c , 3 d and 3 e . referring first to fig3 a , a loop 50 is formed in the end of the snell 40 . the loop is passed through the eyelet opening 28 . next , as shown in fig3 b , the fishing hook 20 is rotated through one or more rotations about an axis collinear with the shank 22 of the fishing hook 20 . preferably , the fishing hook 20 is only rotated once , as multiple full revolutions will result in a weaker knot . the rotations cause the loop 50 to form twists above the wire defining the eyelet 26 of the fishing hook 20 adjacent the cleft 24 , as shown in fig3 c . next , as may be appreciated in fig3 d , with the eyelet 26 in the open position , as described above with reference to fig2 b , the end of the loop 50 is passed over the end 30 of the eyelet . finally , as shown in fig3 e , by pulling on the end of the fishing line 40 , the snell 40 is drawn into a knot 60 next to cleft or apex 24 , which is then snugly positioned into the cleft 24 of the eyelet opening 28 through manual force being applied to either the snell 40 and / or the fishing hook 20 . once the knot 60 is formed , the eyelet 26 may be closed as described above with reference to fig2 c . variations on the fishing hook may be appreciated by referring to fig5 , 7 , 8 , 9 , and 10 . fig5 illustrates a selectively openable and closable eyelet fishing hook 220 with an eyelet adapted to accommodate a snap swivel 72 . the shank , and hook portion of the fishing hook 220 are of identical construction to the fishing hook 20 described above with reference to fig1 . however , the latchable eyelet has a second bend 232 below the apex of the eyelet . the second bend forms a notch that prevents the swivel catch 72 from moving within the eyelet to a position out of line with the shank , the cleft being defined within the notch . fig6 illustrates a selectively openable and closable eyelet fishing hook 320 having an eyelet formed identically to the fishing hook described with reference to fig1 . the shank of the fishing hook 320 , in this embodiment , is provided with additional shank barbs 82 . the fishing hook 420 illustrated in fig7 is a selectively openable and closable eyelet fishing hook with a flag - shaped opening 428 . the eyelet again has a cleft at the apex of the eyelet , as described above . however , the lower portion of the eyelet is widened to produce a flag - shaped eyelet , providing an enhanced impediment to being swallowed by a hooked fish . the wire of the end loop 430 of the eyelet is bent substantially downward so that the end loop 430 is positioned approximately parallel to the shank . the bent closing loop provides an additional impediment to being swallowed by a hooked fish . fig8 illustrates a latchable selectively openable and closable eyelet fishing hook 520 having a selectively openable and closable eyelet , shank , and hook portion of similar construction to the fishing hook 20 described above with reference to fig1 . as will be described below with reference to fig1 , the latchable eyelet , and variations thereof , may further be used to hold bait to the fishing hook . the latchable eyelet fishing hook 520 differs from the fishing hook of fig1 in that the loop 530 at the end of the wire is not closed , but is open and has a gap wide enough to allow the shank to slip within the circumference of the loop 530 , thereby hooking the eyelet closed . when the loop encircles the shank , the eyelet of the fishing hook 520 is latched closed . fig1 illustrates an alternative embodiment of the fish hook 920 , which is similar to fish hook 520 of fig8 , except that the loop portion 530 is replaced with a relatively flat catch member 930 , which catches on the shaft of the fish hook in the closed position . this configuration allows for the positioning of bait ( illustrated in fig1 in dashed line as an exemplary worm ) on both the upper portion of the fish hook and the lower portion of the hook , as shown . it will be noted that other embodiments of the fishing hook may also be formed with the free end of the arcuate leg 38 crossing the shank 22 and extending beyond the medial portion of the shank 22 , the blunted end of the eyelet 26 preventing puncture of the fingers . fig9 illustrates a weighted selectively openable and closable eyelet fishing hook 620 having a selectively openable and closable eyelet , shank , and hook portion of identical construction to the fishing hook 20 described above with reference to fig1 . a jig 100 made of lead or other dense material is affixed to the eyelet . fig1 illustrates a selectively openable and closable eyelet fishing hook 720 having a selectively openable and closable eyelet , shank , and hook portion of identical construction to the fishing hook 20 described above with reference to fig1 . the fishing hook 720 is additionally provided with a swivel attachment loop or conventional closed eyelet 740 located at the apex of the selectively openable and closable eyelet . a snap swivel may be attached to the closed eyelet 740 . a closed eyelet fishing hook in accordance with the invention is described with reference to fig4 . the closed eyelet fishing hook 120 is formed from a stiff , resilient wire . the closed eyelet fishing hook 120 comprises a shank 122 . the lower portion of the shank 122 is bent into a hook portion 132 . the upper portion of the shank 122 is bent at an acute angle to form an eyelet opening 128 with a cleft 124 at the apex of the eyelet . the cleft 124 maintains the position of fishing line secured to the eyelet 126 so that the a force pulling on the line operates along the line of the shank 122 , generating lever action to aid in setting the hook portion 132 into a fish . the end 42 of the wire forming the eyelet is attached to the shank 122 by braising , welding , or other permanent means , resulting in a closed eyelet 126 . the eyelet opening 126 provides a handle for grasping the fishing hook 120 when removing the hook from a fish , and provides an impediment against swallowing of the fishing hook 120 by a fish . additionally , the enlarged eyelet opening provides for greater structural strength than the relatively small eyelets provided in conventional fish hooks . by tying the end of the fishing line about cleft 24 of the enlarged d - shaped opening 28 , the upper portion of the fish hook ( forming the eyelet opening ) may take an increased force load ( produced by the fishing line ) without deforming . in order to enhance the load - bearing properties of a conventional fishing hook , the upper portion forming the eyelet opening would have to be thickened or otherwise structurally enhanced from its present configuration . it is to be understood that the present invention is not limited to the embodiments described above , but encompasses any and all embodiments within the scope of the following claims .

the fishing hook has a shank , a pointed hook portion formed at the lower end of the shank , and an eyelet formed at the upper end of the shank . the eyelet is formed by a generally d - shaped open loop that defines a cleft at the apex of the eyelet . the method of attaching a snell to a fishing hook includes the steps of : forming a loop in a snell ; passing the loop through the eyelet ; rotating the fishing hook at least one full rotation to twist the loop ; passing the loop over the open end of the eyelet ; and pulling the snell to form a knot at the apex of the eyelet .

as best seen in fig1 , footswitch 10 of the present invention generally includes base 12 , treadle 14 having heel cup 16 and side or wing switches 18 , all of which can be made from any suitable material , such as stainless steel , titanium or plastic . base 12 may contain protective bumper 20 made from a relatively soft elastomeric material . as best seen in fig2 a - 2c , 3 and 4 a - 4 b , side switches 18 may be adjusted inwardly ( fig2 b ) or outwardly ( fig2 c ) to increase or decrease the distance between switches 18 and accommodate for variations in the width of user foot 100 . such adjustment is accomplished by pushing on locking buttons 22 , causing locking pin 24 on base 12 to be released from within detents 26 in switches 18 and rotating about pins 28 in holes 30 located on base 12 . when buttons 22 are released , springs 32 push detents 26 against locking pin 24 , thereby holding switches 18 in a locked position . the relative position of switches 18 may be determined visually by the use of switch position indicators 34 , as best seen in fig2 b and 2c . as best seen in fig5 , 6 and 7 a - 7 b , the length of treadle 14 may be adjusted by sliding movement of heel cup 16 . as best seen in fig6 , treadle 14 is mounted to treadle base 36 by thrust bearing 38 , thereby allowing treadle 14 to pivot about axis 40 . heel cup slide 42 is received on treadle 14 and contains locking lever 44 , which is held onto heel cup slide 42 by retainers 46 . locking pins 48 are held within locking lever 44 by shafts 50 . locking pins 48 are biased into locking pin holes 52 in treadle 14 by springs 54 pushing against locking pin retainer 56 . in this manner , pushing on locking lever 44 pulls locking pins 48 out of locking pin holes 52 and allows heel cup slide 42 to slide lengthwise along slots 58 in treadle 14 as illustrated in fig7 a - 7b . the relative position of heel cup 16 relative to treadle 14 may be visually indicated by indicators 60 . in addition , treadle 14 may contain raised reference point 62 , indicating the center oftreadle 14 . the width and length adjustments described above preferably allow footswitch 10 to be adjusted to accommodate the 5 th percentile female to the 95 th percentile male foot width and length , with or without shoes . as best seen in fig1 , ankle rotation axis 65 of foot 100 is located behind pivot axis 68 of treadle 14 for all three treadle lengths . as best seen in fig8 and 9 a - 9 b , treadle 14 may rotate or counter - rotate about thrust bearing 38 to operate left and right switches 64 , which are mounted on treadle base 36 . return springs 66 provide for automatic centering of treadle 14 following rotation . as best seen in fig1 a and 11b , treadle base 36 contains alignment pin 70 hat fits within hole 72 in base 12 when treadle 14 is in the resting , non - pivoted position . such a construction prevent rotation of treadle 14 to activation switches 64 when treadle is in the resting , non - pivoted position ( fig1 a ), but allows rotation of treadle 14 when treadle 14 is depressed or pivoted ( fig1 b ). as shown in fig1 and 13 , heel cup 16 is mounted to heel cup slide 42 using thrust bearing 74 , alignment cap 76 and screws 82 . such a construction allow for the rotation of heel cup 16 independently of any rotation of treadle 14 ( as show in fig8 and 9 a - 9 b ) and allows for the operation of side switches 18 when treadle is in the resting and rotationally locked position ( fig1 a ). return lever , 78 , mounted to heel cup 16 acts against return springs 80 to provide for automatic centering of heel cup 16 in the resting position . as shown in fig1 and 15 a - 15 c , bottom 85 of base 12 preferably is covered by relatively high friction polymer ( e . g ., versaflex tpe ) material 84 and contains a plurality of retractable , anti - gravity spring - loaded plunger feet 86 made from a low friction polymer material ( e . g ., delrin ® acetal resin ). as shown in fig1 a and 15b , when there is no weight on footswitch 10 , spring loaded plunger 86 project a short distance d ( e . g ., 0 . 04 inches ) outwardly from bottom 84 , thereby contacting the floor and allowing easy sliding of footswitch 10 on relatively low friction plunger tips 88 . as shown in fig1 c , when weight is placed on footswitch 10 , plungers 86 retract , and high friction bottom 84 contacts the floor , thereby making it more difficult to slide footswitch 10 during use . this description is given for purposes of illustration and explanation . it will be apparent to those skilled in the relevant art that modifications may be made to the invention as herein described without departing from its scope or spirit .

a footswitch having an adjustable treadle and switch placements , thereby helping to make the footswitch ergonomically more correct for a variety of users .

this application discloses methods and apparatuses for removing material from a patient . in the exemplary embodiment disclosed herein , the methods and apparatuses are used for removing ingested material from a patient &# 39 ; s stomach in patients that have been fitted with a gastrostomy tube . examples of suitable gastrostomy tubes are described in u . s . patent application publication nos . us 2004 / 0220516 , us 2005 / 0277900 and us 2005 / 0283130 , each of which is incorporated herein by reference . additional gastrostomy tubes are described in u . s . provisional patent application 60 / 806 , 556 , which is also incorporated herein by reference . the primary contemplated use for the methods and apparatuses described herein is achieving weight loss in obese or overweight people . although the exemplary embodiments are described herein in the context of removing ingested material from a patient &# 39 ; s stomach , the methods and apparatus can also be used for removal of a variety of fluids from a patient ( with , when necessary , appropriate modifications that will be apparent to persons skilled in the relevant arts ). fig1 shows a patient 10 that is fitted with a gastrostomy tube with a system for removing ingested material from a stomach . an example of such a gastrostomy tube 45 is shown in fig8 a . the gastrostomy tube 45 interfaces with the outside world via connection 14 , so the system communicates with the gastrostomy tube 45 through that connection . the system preferably includes an assembly 16 for infusing fluid into the stomach through the connection 14 in a manner permitting the fluid to mix with the ingested material or , for use in priming the system when desired , and a drain line 18 for draining content of the stomach received from the connection 14 . the drain line 18 may be in communication with the assembly 16 , as shown . in alternative embodiments ( not shown ), the drain line 18 may be implemented independent of the assembly 16 . for example , one line may be used to drain content of the stomach through the connection 14 and another line may infuse the fluid into the stomach through the connection . the system preferably includes a patient line 20 in communication with the assembly 16 and the connection 14 to the patient 10 , and the patient line 20 preferably has a suitable connector at its upper end that mates with the connection 14 . in alternative embodiments ( not shown ), the assembly 16 may be coupled directly to the external gastrostomy connection 14 without using an intermediate patient line . the assembly 16 may include a fluid source and may optionally include a valve arrangement and / or one or more pumps as described in more detail below . in operation , the system is connected up to the connection 14 to remove the contents of the stomach via the connection . in some embodiments , the removal may be accomplished by pumping the stomach contents out via the connection 14 . in alternative embodiments , this removal is accomplished by setting up a siphon system so that the contents of the stomach can be siphoned out of the patient &# 39 ; s stomach . in siphon - based systems , the drain line 18 preferably has a length in excess of 25 cm in order to create a pressure differential that is sufficient to form an effective , efficient siphon that can gently and passively drain content from the stomach . however , in alternative embodiments , the drain line 18 can be of a length less than 25 cm . note that when the patient is standing , the overall siphon system is measured from the lowest point in the tube or line that is inserted into the stomach to the end of the drain line 18 . optionally , the siphon system may be designed to be long enough to run from the stomach of a standing patient to a position proximate to a floor - based disposal arrangement , such as a toilet or waste container . the drain line may include a siphon tube made from flat , collapsible tubing or other flexible tubing . silicon is a suitable material for the patient line 20 and the drain line 18 . however , in alternative embodiments , the patient line 20 can be made from any material known and used in the art of tubes or any material that could be used to impart the necessary function of the patient line 20 . in some situations ( e . g ., when the patient has drank a significant amount of liquids ), an effective siphon effect can be achieved without infusing any liquids into the patient &# 39 ; s stomach . in other situations , however , it may be necessary to add additional fluid into the patient &# 39 ; s stomach to help start up the siphoning , so that the ingested material can be effectively removed from the patient &# 39 ; s stomach . this may be done by having the patient drink additional fluids or by infusing additional fluid into the stomach through the connection 14 . in many cases , a single siphoning operation will be insufficient to remove the desired amount of ingested material from the patient &# 39 ; s stomach . in those cases , it is desirable to introduce additional liquid into the stomach so that one or more additional siphoning operations can be done . a preferred approach for introducing additional liquid into the stomach is by infusing the liquid into the stomach through the connection 14 . for example , after eating a meal and drinking liquids , the subject may attach the device to the connection 14 , and siphon out a large portion of the stomach contents ( e . g ., fluid with solid particulate , pieces , and / or chunks of food ). for a typical meal , the volume of this initial siphoning operation may be on the order of 750 cc , but that number will of course vary based on the volume and characteristics of the ingested meal . once the siphon effect stops , the subject infuses water back through the connection 14 into the stomach and then initiates another siphoning operation to remove the infused water , which will carry out additional solid food particles , pieces and / or chunks . the infusing and siphoning steps may then be repeated until the desired amount of ingested material is removed from the stomach . an example of a suitable volume for infusing into the stomach during the infusing step is 180 cc , although any other volume may be used . note that the methods described herein are preferably used to remove a significant portion of the food that the patient has ingested ( e . g ., between 30 and 60 %, and more preferably between 40 and 50 %, of the ingested food ). removing all the food that was ingested by the patient is not preferred and will usually be impractical . examples of systems that implement both the removal of ingested material and the infusion of fluids are described below . fig2 schematically shows a first embodiment of a system for alternately removing ingested material from a stomach and infusing fluid into the stomach . the fluid may be any biocompatible fluid such as water or saline , and may optionally include one or more nutrients and / or medications . as shown , the assembly 16 includes a fluid source 22 and a valve arrangement 24 in communication with the fluid source 22 , the drain line 18 , and the patient line 20 . the valve arrangement 24 may include one or more valves and any type of valve , such as , but not limited to , check valves , blade occluder and diverter valves . for example , the valve arrangement 24 may be implemented using a single 3 - way valve with two operating positions — one position that opens a path between the patient line 20 and the drain line 18 , and another position that opens a path between the fluid source 22 and the patient line 20 . alternatively , the valve arrangement 24 may be implemented using two valves — a first valve used to open a path between the patient line 20 and the drain line 18 and a second check valve used to open a path between the fluid source 22 and the patient line 20 when fluid is pumped from the fluid source 22 into the patient &# 39 ; s stomach via connection 14 ( shown in fig1 ). in operation , the first valve is opened to drain the contents of the stomach . the first valve is then closed and fluid is pumped from the fluid source 22 to the patient line 20 . optionally , the first valve may be closed automatically by the fluid when the fluid is pumped from the fluid source 22 . the first valve may then be re - opened to drain content of the stomach when fluid is no longer pumped to the patient line 20 . other embodiments may include a plurality of valves , such as shown in fig3 . fig3 schematically shows an assembly 16 having a check valve , valve a , in communication with the fluid source 22 and also with two valves , valve b and valve f . valve b is in communication with a check valve , valve c , which is in communication with the connection 14 ( shown in fig1 ) via the patient line 20 . valve f is in communication with a check valve , valve e , which is in communication with the drain line 18 . another valve , valve d is in communication with the patient line 20 and the drain line 18 . valve b and valve f may be coupled , such that valve b is opened when valve f is closed , and valve f is opened when valve b is closed . in operation , valve b is opened while valve f is closed . valve d may then be opened to drain the contents of the stomach received from the patient line 20 . optionally , the system may be configured so that as fluid is pumped through valve b and valve c , the movement of the fluid closes valve d and permits the fluid to flow into the stomach through the patient line 20 . when fluid is no longer pumped through valves b and c , valve d may be activated automatically or manually to re - open to drain content of the stomach . when finished removing content from the stomach , valve d is closed and valve b is closed , which in turn opens valve f . the fluid may then be pumped through valve a , valve f and valve e to the drain line 18 in order to clean the drain line after use . variations on the assembly 16 shown in fig3 may be implemented using one or more pumps in communication with the valve arrangement 24 , the fluid source 22 and / or the drain line 18 . for example , a pump may be coupled between the fluid source 22 and the patient line 20 with a check valve in communication with the fluid source 22 and the pump and another check valve in communication with the pump and the patient line 20 to facilitate fluid flow to the connection 14 ( shown in fig1 ). a pump may be coupled between the patient line 20 and the drain line 18 with a check valve in communication with the patient line 20 and the pump and another check valve in communication with the pump and the drain line 18 . a pump may also be provided by the squeezing of a hand , e . g ., squeezing the fluid source . a combination of two or more pumps may be used , to facilitate fluid flow to the patient line 20 , to the drain line 18 , or both . for example , during operation , if the system becomes clogged with content of the stomach such that the draining and / or infusing is not functioning properly , a pump may be provided to clear the obstruction in the patient line 20 and / or the drain line 18 . various types of pumps may also be used , such as , but not limited to , a diaphragm pump , a spring loaded piston pump , a syringe pump , a peristaltic pump , a flexible vein pump , a pneumatically actuated pump or a combination thereof . the pump ( s ) may be removable from the system such that a pump is only provided when necessary . referring now to fig2 and 3 , a removable syringe may be provided at an auxiliary port 25 to provide suction for removing clogs from the patient line 20 and / or drain line 18 . although various configurations have been discussed for the valves and pumps with respect to fig2 and 3 , it will be apparent to those skilled in the art that any number , kind , and / or configuration of valves and pumps may be used . fig4 and 5 a - 5 c show an embodiment of a system for removing ingested material from the stomach . in this embodiment , the system includes the fluid source 22 , the drain line 18 , and the patient line 20 and also includes an actuation handle 26 for opening and closing a path between the patient line 20 and the drain line 18 and for opening and closing a path between the fluid source 22 and the patient line 20 . in operation , the actuation handle 26 may toggle the assembly 16 between two modes , a drain mode and an infusion mode . for example , in the drain mode , the actuation handle 26 may be in its original or un - actuated position which may cause the path between the patient line 20 and the drain line 18 to be opened and the path between the fluid source 22 and the patient line 20 to be closed , thus permitting content of the stomach to be drained . when the actuation handle 26 is squeezed or actuated , the actuation handle 26 causes the path between the patient line 20 and the drain line 18 to be closed and the path between the fluid source 22 and the patient line 20 to be opened . the actuation handle 26 causes the fluid source 22 to be squeezed or pumped , forcing the fluid out of the fluid source 22 , thus allowing fluid to flow into the stomach in the infusion mode . for example , a user may squeeze the actuation handle 26 and fluid source 22 by hand . when the actuation handle 26 is released , the actuation handle 26 is returned to its original position , e . g ., by a spring force , such as an extension spring , causing the path between the patient line 20 and the drain line 18 to be re - opened and the path between the fluid source 22 and the patient line 20 to be re - closed . the actuation handle 26 may cause the various paths to be opened or closed using any of a variety of approaches that will be apparent to persons skilled in the relevant arts , e . g . by pressing or pinching the various fluid lines or actuating valves . still referring to fig4 and 5 a - 5 c , the system may also include a patient line cap 28 and a patient port plug 30 for when the system is not in use and removed from the patient . for example , the assembly 16 may be removed from the patient line 20 and the patient line cap 28 may be used to terminate the patient line 20 . similarly , the patient port plug 30 may be used to plug the opening where the patient line 20 couples to the assembly 16 . the assembly 16 may also include a rinse slide 32 for opening and closing a path between the fluid source 22 and the drain line 18 . after the system is used to infuse fluid into the stomach and drain contents out of the stomach , the fluid source 22 may be used to rinse out or clean the patient line 20 , the drain line 18 or both . upon completion of use , the actuation handle 26 may be squeezed with the fluid source 22 to cause fluid to flow through and clean the patient line 20 . once the patient line 20 is clear , the patient line 20 may be clamped while still holding the actuation handle 26 and the patient line 20 may be disconnected from the assembly 16 . the actuation handle 26 may then be released . in order to clean the drain line 18 , the rinse slide 32 may be activated , allowing fluid to flow from the fluid source 22 down the drain line . when the rinse slide is activated , both valves open and since the drain line is lower than the fluid source , the fluid flows out of the drain line 18 . the actuation handle 26 may then be squeezed with the fluid source 22 , causing fluid to be pumped out of the fluid source 22 and through the drain line 18 , cleaning the drain line 18 . referring now to fig4 , optionally , the system may include an attachment mechanism 34 such as a belt clip , for attaching the assembly 16 to the patient during use of the system . now referring to fig4 and 5 a - 5 c , the attachment mechanism 34 may be coupled to the assembly 16 at an attachment location 36 . the fluid source 22 may be coupled to the assembly 16 at an attachment assembly 38 . fig6 a and 6b depict an alternative assembly 16 ′ that may be used in place of the assembly 16 depicted in fig4 and 5 a - 5 c . in this embodiment an actuation lever 44 alternately either ( a ) opens a path between the patient line 20 and the drain line 18 or ( b ) closes the path between the patient line and the drain line . referring now to fig6 b , when the lever 44 is actuated in this embodiment , it causes the path between the patient line 20 and the drain line 18 to be clamped by clamp 49 and the path between the fluid source 22 and the patient line 20 to be opened . when the fluid source 22 is squeezed while the lever 44 is in an actuated position , fluid from the fluid source 22 will flow through a check valve , into the patient line and into the stomach . when the lever 44 is in a non - actuated position , the path between the patient line 20 and drain line 18 is open . upon squeezing the fluid source 22 in a non - actuated position , water flows from the fluid source 22 through the drain line 18 and causes a rinsing effect , which obviates the need for the separate rinse slide . in the illustrated embodiment , the actuation lever 44 may cause the paths to be closed / opened by clamp 49 pressing or pinching on the tubing lines . however , persons skilled in the relevant arts will recognize that alternative approaches for opening and closing the various fluid flow paths may be substituted by making appropriate modifications . since water bottles may have varied thread designs which would not ordinarily mate with conventional female fittings , a universal fluid source receptacle 46 may optionally be implemented to accept any water bottle neck , and to lock around the bottle neck flange . upon actuation the receptacle releases the flange on the fluid source . this feature may also be implemented in the other embodiments described herein . the system is preferably connected to a gastrostomy tube that has previously been installed in a patient ( e . g ., through the patient &# 39 ; s abdominal wall ), with a port that extends out of the patient &# 39 ; s body . preferably , the port is relatively flush with the surface of the patient &# 39 ; s abdomen and has a connector that mates with a mating connector of the system . a variety of ways to implement such a flush mount connection interface can be readily envisioned . fig8 - 15 depict one preferred implementation of a flush mount connection interface . one part of the interface is the “ skin connector ” 60 ( shown in fig9 - 12 ) which is an implementation of the connection 14 discussed above in connection with fig1 , and is affixed to the patient and the gastrostomy tube 45 that resides inside the patient &# 39 ; s stomach . this embodiment of the skin connecter 60 includes a rotational valve assembly that controls opening and closing of the pathway into the stomach , as shown in fig1 a - 14b . the other part of the interface is the “ tube connector ” 65 , also shown in fig1 a - 14b , which is positioned at the upper end of the patient line 20 and is designed to mate with the skin - connector 60 with a fluid - tight interface . fig9 - 11 depict a rotational valve assembly 50 that is assembled inside a skin flange 55 to create a flush mount skin connector 60 , and fig1 a is an exploded view of the rotational valve assembly 50 . three of the valve assembly components 81 , 82 , 83 have a thru - hole biased to one quadrant , arranged so that the valve is opened when the thru - holes are aligned and so that the valve is closed when the thru - holes are not aligned . in the preferred embodiment , the size for the entire valve assembly ranges from about 3 cm to about 4 cm in diameter , and the size for the thru - holes is about 6 - 8 mm in diameter . in the valve assembly 50 the platform diameter can measure from about 3 . 5 to about 7 times larger than the diameter of the thru - hole that passes therethrough . however , in other embodiments , the valve assembly can be proportionally different size , either larger or smaller . the valve assembly 50 is preferably constructed of top platform 81 and a bottom platform 83 , with a layer of elastomer 82 that is attached to the top platform 81 and sandwiched between the top platform and the bottom platform 83 with a force that is high enough to prevent leaks , yet low enough to permit rotation of the elastomer 82 with respect to the bottom platform 83 . the elastomer is attached to the top platform using any adhesive that would attach the silicon to the plastic , however , in one embodiment , a primer and a fast curing adhesive is used . the top platform 81 is preferably made of a lubricious plastic for example , acetyl , and in some embodiments , delrin ®, teflon ®, polyethylene , etc , can be used , and the bottom platform 83 is preferably made of abs or another hard plastic that is , for example , biocompatable . however , in alternative embodiments , those components may be made of other materials that provide similar functionality . in some embodiments , the first platform is placed adjacent to the patient &# 39 ; s skin . the first platform can be mounted adjacent the patient &# 39 ; s skin . in some embodiments , the first platform can directly contact and sit against the patient &# 39 ; s skin . a top retaining ring 80 is configured to attach to the bottom platform 83 to retain the top platform 81 and the middle layer 82 while allowing those two layers to rotate with respect to the bottom platform 83 . attaching can be in the form of snap fitting , welding , gluing or any other method of attachment . the top retaining ring 80 is preferably also made of abs or another hard plastic . in some embodiments , the components of the valve assembly ( e . g ., the top platform and the bottom platform ) move with respect to one another . as discussed , one platform can move with respect to another platform by a rotational force . however , thru - holes that pass through each of these platforms can move with respect to one another by other suitable forces by , for example , a force in a linear direction . the geometric shape of the components of the valve assembly may be adjusted to enable alternative forms of movement , for example , the platform , a retainer , and / or the elastomer layer may have a square , rectangular or other suitable geometry the enables the thru - holes that pass through each platform ( and optionally the elastomer layer ) to alternately align and offset from one another . in such configurations , one platform may be moved linearly backward and forward with respect to the other platform ( i . e ., move linearly backward to provide the first position and move linearly forward to provide the second position ) or the movement can be in a single direction , for example . in the illustrated embodiment , as best seen in fig9 - 11 , the valve assembly 50 has protrusions 53 at its bottom that allows it to fasten to recesses 56 in the skin flange 55 to form the skin connector 60 . the top face of the valve assembly preferably has a structure ( e . g ., the top platform 81 has the cut - outs 52 ) for mating with a corresponding surface on the tube connector 65 . the valve assembly 50 can be disassembled from the skin connector 60 by pushing the protrusions 53 at its bottom out of the recesses 56 in the skin flange 55 . with significant force , manually or with a tool directed at the bottom of the recesses 56 , the barbed protrusions 53 can be freed from the recesses 56 in skin flange 55 and the valve assembly 50 can be removed . removal of the valve assembly 50 from the skin connector 60 may be required when a course of treatment is finished or in connection with valve replacement due to wear , scheduled maintenance , cleanliness , or length adjustment . using a removable valve permits adjustment of the length of the gastrostomy tube ( e . g . after patient weight loss ) to compensate for a shortened stoma tract . after the valve assembly 50 is removed , the tube is cut to a shorter length , and then the valve is replaced , advantageously avoiding the need to replace the gastrostomy tube . in some embodiments , the valve assembly 50 is connected directly to the gastrostomy tube such that its bottom platform 83 sits against the patient &# 39 ; s skin . in this way , use of the skin flange 55 is avoided . optionally , the bottom platform 83 has a smooth surface and does not contain protrusions . in some embodiments , an assembly includes a valve and a tube having a first fluid pathway for disposal in a body of a patient . the valve has a bottom platform , a top platform and a retainer . the bottom platform and the top platform each has a thru - hole that passes therethrough . a retainer retains the bottom platform in proximity to the top platform so that the top platform can be moved with respect to the bottom platform between a first open position that aligns the thru - holes of the bottom and top platforms and a second closed position that offsets the thru - holes of the bottom and top platforms . the proximal end of the tube disposed in a patient &# 39 ; s body is mated with the thru - hole in the bottom platform . a second tube that is external to the patient &# 39 ; s body has a second fluid pathway . the second fluid pathway can supply water or other fluid to the assembly . a distal end of the second tube is adjacent the thru - hole in the top platform . the first fluid pathway and the second fluid pathway join to form a single fluid pathway . when the valve is positioned in the first position , the open position , the two thru - holes align to provide access through the single fluid pathway . in the second position , the closed position , the thru - holes offset to provide a fluid tight seal and to prevent access through the fluid pathway . in some embodiments , each of the tube in the patient &# 39 ; s body , the two thru - holes , and the external tube has a substantially similar internal diameter , thus the flow of fluid through this single fluid pathway is substantially consistent , i . e ., it is not restricted by a changing internal diameter . in some embodiments , the top platform is moved in a substantially linear direction with respect to the bottom platform . in some embodiments , placement of the valve in the second position , the closed position , offsets the thru - holes to provide a fluid tight seal and to prevent access through the fluid pathway when the external tube is disconnected from the tube in the patient &# 39 ; s body . in some embodiments , in order to disconnect the external tube from the valve the valve must first be positioned in the second position , the closed position . due to protrusions 66 on the contacting surface of the tube connector 65 being configured to mate and mechanically couple with the cut - outs 52 on the valve assembly 50 at a rotational distance of approximately 120 ° from the “ open ” position of valve assembly 50 , fluid will not leak out of valve assembly 50 during tube connector 65 removal ( i . e . disc 68 is always covering the passageway of skin connector 60 prior to removal .) for a gastrostomy tube designed to aspirate food from a full stomach ( i . e . larger diameter to accommodate food particles ,) the fluid pressure may be higher than traditional feeding tubes , and the illustrated valve embodiments can withstand such higher pressures without leaking . the illustrated valve embodiments are also designed to provide a large , uniform lumen from the tube through the valve . the rotational gasket configuration allows sealing of the tube without restricting the lumen dimension when the valve is in the “ open ” position , thereby minimizing the probability of tube clogging during food aspiration . in one embodiment , referring to fig1 - 12 , the skin connector 60 skin flange 55 has a thru - hole 57 . the thru - hole 57 can be shaped to complement the gastrostomy tube when an end of the gastrostomy tube is interested in the thru - hole 57 . the bottom platform 83 can include spout 511 ( fig1 b ) that , for example , surrounds the thru - hole 54 . the spout 511 of the thru - hole 54 can be sized to enter the lumen of the gastrostomy tube . for example , an end of the gastrostomy tube is positioned so that the spout 511 of the thru - hole 54 enters its lumen and a portion of the gastrostomy tube is compressed between the spout 511 and the thru - hole 57 of the skin flange 55 . the thru - hole 57 of the skin flange 55 can be shaped to improve compression of the gastrostomy tube , for example , the thru - hole 57 can have a funnel shape . in one embodiment , the outer diameter of the spout 511 is the same as the inner diameter of the proximal end of the gastrostomy tube . the shape of the thru - hole 57 can be selected according to the shape of the spout 511 surrounding the thru - hole 54 of the bottom platform 83 . compression of the spout 511 against the thru - hole 57 can create a water - tight seal . in one embodiment , at least a portion of the gastrostomy tube is made from a hydrophobic gasket material such as , for example , eptfe . the portion of the gastrostomy tube containing a hydrophobic gasket material may be compressed between the spout 511 and the thru - hole 57 thereby forming a water - tight seal that prevents leakage of the gastrostomy tube . in another embodiment , the thru - hole 57 defined by the flange 55 has an inside surface with a thread that complements a helical support structure disposed on at least a portion of an outside surface of the gastrostomy tube . support for a gastrostomy tube having a helical support structure and / or employing eptfe my be found in u . s . patent application ser . no . 11 / 824 , 953 entitled “ shunt apparatus for treating obesity by extracting food ” by solovay et al ., which is incorporated by reference . in embodiments where the skin connector 60 includes a spout 511 surrounding the thru - hole of the bottom platform 83 and / or the flange has an inside surface with a thread the complements a helical support structure on the gastrostomy tube , removal of the valve required when treatment is finished or in connection with valve replacement can require additional steps . for example , prior to or after unfastening protrusions of the valve 50 from the flange 55 the spout 511 is removed from the lumen of at the proximal end of the gastrostomy tube . in another example , prior to or after unfastening protrusions of the valve 50 from the flange 55 the valve 50 is rotated in a direction opposite the helical support disposed on the gastrostomy tube thereby to remove the valve 50 from the gastrostomy tube . referring to fig1 - 13 , in one embodiment , a proximal end of a gastrostomy tube is mated with a thru - hole in the bottom platform of a skin connector 60 . the bottom platform 83 is placed adjacent to the patient &# 39 ; s skin , optionally , a portion of the skin connector &# 39 ; s 60 flange 55 is between the bottom platform 83 and the patient &# 39 ; s skin . the skin connector 60 can be placed adjacent to the patient &# 39 ; s skin . the skin connector 60 is rotated to a first position to cause the thru - hole 51 that passes through the top platform 81 to substantially align with the thru - hole 54 in the open position to provide access to the fluid pathway for a first period of time . when the skin connector 60 is in the first position , the patient &# 39 ; s stomach contents can be aspirated through the gastrostomy tube . rotating the skin connector 60 to the first position avoids restriction of the gastrostomy tube thereby aiding aspiration . the skin connector 60 is rotated to a second position to cause the thru - hole 51 to be offset from the thru - hole 54 to provide a fluid tight seal to the proximal end of the gastrostomy tube and to prevent access to the fluid pathway for a second period of time . in some embodiments , a proximal end of a tube other than a gastrostomy tube is mated with a thru - hole 54 in the bottom platform 83 and the bottom platform 83 is placed adjacent to the patient &# 39 ; s skin . providing the valve 50 in the first position provides access to a fluid pathway in the tube during a first period of time and providing the valve 50 in the second position provides a fluid tight seal to the proximal end of the tube and access to the tube &# 39 ; s fluid pathway is prevented during a second period of time . fig1 a and 13b depict a tube connector 65 that is connected at the upper end of the patient line 20 . the tube connector 65 is designed to mate with the skin connector , and protrusions 66 on the contacting surface of the tube connector 65 are configured to mate with the cut - outs 52 on the valve assembly 50 ( both shown in fig9 b ). the body of the tube connector 65 is preferably constructed of a hard plastic such as abs . the contacting surface of the tube connector 65 is preferably implemented using a disc 68 made of an elastomeric material such as silicone , with a biased thru - hole 67 that is dimensioned and positioned to match the thru - hole of the skin connector . in the illustrated embodiment , the tube connector 65 has a ridge 71 around the perimeter of its contacting surface that is configured to fit into a mating surface of the skin connector ( i . e ., the valley 61 around the perimeter of the skin connector 60 , shown in fig1 c ). the outer surface of the illustrated tube connector also has a handle 69 for grasping by the user and a barbed hollow protrusion 70 that is in fluid communication with the thru - hole on the contacting surface for fastening to the patient line tubing . referring now to fig1 c and 12 - 14 , when the tube connector 65 and the skin connector 60 are not mated , the valve assembly 50 on the skin connector 60 is in a “ closed ” position , with the thru - hole 51 in the top platform 81 and the middle layer 82 oriented out of phase with respect to the thru - hole 54 in the bottom platform 83 . to connect the tube connector 65 and the skin connector 60 , the thru - hole 67 of the tube connector is aligned with the thru - hole 51 in the top platform 81 of the valve assembly 50 . the tube connector 65 is then turned by grasping the handle 69 and turning it clockwise . when this happens , the biased thru - hole 51 in the top platform 81 and the middle layer 82 and the thru - hole 67 in the tube connector 65 will all rotate together into alignment with the thru - hole 54 in the bottom platform 83 of the valve assembly 50 , thereby opening a passage to the gastrostomy tube . rotating the tube connector 65 clockwise also engages mating features 66 on the tube connector with corresponding cut - outs 52 on the valve assembly 50 ( shown in fig9 b ) to lock the tube connector 65 to the skin connector 60 . the fluid pathway of the patient line 20 of the tube connector 65 can join with the fluid pathway of the gastrostomy tube 45 that connects to the skin connector 60 thereby providing a single fluid pathway . after the passage is open , removal of ingested material from the patient &# 39 ; s stomach is performed , as described above ( optionally in alternation with the infusing of liquids into the patient &# 39 ; s stomach ). subsequently , the patient or practitioner rotates the tube connector 65 counterclockwise , which causes the thru - hole 67 , the biased thru - hole 51 in the top platform 81 , and the middle layer 82 to all rotate together away from the thru - hole 54 in the bottom platform 83 of the valve assembly 50 , to the position shown in fig1 a , thereby closing the valve in the skin connector 60 . the tube connector 65 can then be pulled away from the skin connector 60 . referring now to fig1 - 11 , the skin connector 60 is preferably constructed with an outer skirt 58 composed of a soft , compliant material ( e . g . elastomer , foam , etc .) that tapers the fully assembled low - profile skin - port towards the skin to provide a more aesthetic appearance , to prevent the skin connector 60 from catching on the user &# 39 ; s clothing , and to serve as a bumper against applied stresses . in alternative embodiments , the skin connector 60 and tube connector 65 can be configured in various other forms and / or can use different materials to optimize various characteristics . for example , both the skin connector 60 and tube connector 65 can be made with an oblong shape . more specifically , one or more of the top platform , the bottom platform , the disk , and the retaining ring ( i . e ., the retainer ) have an oblong shape . the mating features and turning of the valve can be actuated by alternate means that will be apparent to persons skilled in the relevant arts , including but not limited to thumbwheel mechanisms , scissor mechanisms , etc . when mounted on the surface of the patient &# 39 ; s skin , the skin connector 60 and / or the combination of the skin connector 60 mated to the tube connector 65 sits above the patient &# 39 ; s skin at a distance that measures from about 5 mm to about 20 mm , or from about 7 mm to about 9 mm . thus , the overall height of the skin connector 60 and / or the combination of the skin connector mated to the tube connector 65 ranges from about 5 mm to about 20 mm , or from about 7 mm to about 9 mm . it is desirable for the skin connector 60 and / or the skin connector 60 mated to the tube connector 65 to have a low - profile ( i . e ., a small distance that measures from the patient &# 39 ; s skin ). having a low - profile enables a patient to discretely wear the valve and discretely use the system to remove ingested material from the patient &# 39 ; s stomach one potential side - effect of aspirating food from the stomach is lowering of electrolytes , such as potassium . the removal of hydrochloric acid ( hcl ) from the stomach along with food particles can cause the human body to excrete potassium to maintain a charge balance , and excretion of too much potassium can cause hypokalemia . one method for preventing hypokalemia is to give the patient potassium supplements and a proton pump inhibitor . another method for preventing hypokalemia is to selectively remove hcl from the extracted material , and return it to the patient &# 39 ; s stomach , in order to prevent electrolyte imbalance and obviate the need for additional therapeutics . to achieve acid return to the stomach , the device may be configured with one or more semi - permeable filters that selectively screen out waste product and retain hcl for return to the stomach . examples of suitable filters include mechanical filters , chemical filters , ionic membranes ( e . g . anionic exchange membrane , cationic exchange membrane , bipolar membrane ), and electrochemical filtrations systems ( or a combination of the above ). one way to implement food evacuation with the return of acid to the stomach is by using two filters in series . the first filter , or pre - filter , separates food particles from the fluid . examples of suitable filters for performing this function include mechanical filters like standard glass - fiber or cellulose filters that selectively remove solids above a specified particle size , leaving “ waste ” fluid . a suitable porosity for such a filter is 2 . 5 μm porosity . the second filter removes hydrochloric acid from the pre - filtered fluid . examples of suitable filters for performing this function include semi - permeable membranes , or an anionic exchange membrane ( e . g . neosepta ™, tokuyama , japan ). fig7 a depicts a first embodiment for returning acid to the stomach . a siphon effect or a pump is used to force evacuated stomach contents through the pre - filter 110 and into one compartment 122 of a dual chamber container 120 , which is separated from the other compartment 126 by an anionic exchange membrane 124 . the second chamber 126 contains deionized water . the difference in ionic concentration between the dual chambers of the cell 120 will drive a diffusion dialysis process to occur in which the cl − and h + ions from hydrochloric acid selectively transfer across the membrane 124 into the water filled chamber 126 . the waste fluid can then be released to exit to the toilet , and a pump 130 can then be actuated to force the hcl and water solution back into the patient &# 39 ; s stomach . fig7 b depicts an alternative embodiment that is similar to the fig7 a embodiment , but adds a separate water infusion subsystem 140 to allow the subject to continue to flush and siphon the stomach while the diffusion dialysis process is occurring . more complex filtration system can also be used , including but not limited to electrodialysis , or an anode and a cathode to separate charged ions in an electrophoresis like fluid suspension . the electrofiltration process could potentially decrease the time to remove the hcl from the waste product . repeated removal of food from a patient &# 39 ; s stomach to achieve weight loss requires close medical supervision to avoid complications ( e . g ., a drop in electrolyte levels ). it may therefore be desirable for the physician to ensure that the patient returns for follow - up and blood testing to avoid improper use of the device , or at a minimum have data that reveals the patient compliance with proper use of the system . a shut - off mechanism may be built into the system to ensure that the patient returns for such follow - up . the shut - off mechanism preferably operates based on some measurement of usage such as the passage of time ( e . g ., to disable the device after one month ), the number of cycles of use ( e . g ., to disable the device after 90 uses ), or the volume of extracted matter ( e . g ., to disable the device after 50 liters of material have been removed ). the measurement of usage may be implemented by mechanical or electrical means , as will be appreciated by persons skilled in the relevant arts ( e . g ., using a mechanical counter such as a multi - decade geared mechanism that is incremented using a cam - actuated sprocket , or an electrical counter that is incremented by a suitable sensor ). suitable events that can be used to increment the count include , but are not limited to , the connection of a water bottle to the system , the connection of the tube connector to the skin connector , etc . the shut - off mechanism may also be implemented by mechanical or electrical means . one example of a suitable mechanical shut - off mechanism is a preloaded spring mechanism that , when actuated , blocks fluid from moving through one of the system &# 39 ; s tubes . an example of a suitable electrical device for implementing shut - off is a solenoid actuated valve , and a wide variety of alternatives will be apparent to persons skilled in the relevant arts . the shut - off mechanism may be designed to permanently disable the device , in which case the patient would have to obtain a new device to continue using the system . alternatively , it may be configured to be resettable by a doctor ( e . g ., using an electronic shut - off mechanism that can be reset by entry of a password or a biometric key such as a fingerprint detector ). after the patient is examined by the doctor ( e . g ., using blood tests to confirm healthy electrolyte levels ), the doctor could provide a new device or reset the shut - off mechanism . one application of some of the above - described embodiments is to implement a method of removing ingested food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this method includes the steps of : ( a ) siphoning a first portion of the ingested food out of the patient &# 39 ; s stomach via the gastrostomy tube ; ( b ) infusing liquid into the patient &# 39 ; s stomach via the gastrostomy tube ; and ( c ) siphoning at least some of the infused liquid out of the patient &# 39 ; s stomach via the gastrostomy tube , together with a second portion of the ingested food . optionally , this method may further include the steps of : ( d ) infusing liquid into the patient &# 39 ; s stomach via the gastrostomy tube ; and ( e ) siphoning at least some of the infused liquid out of the patient &# 39 ; s stomach via the gastrostomy tube , together with a third portion of the ingested food , wherein step ( d ) is performed after step ( c ), and wherein step ( e ) is performed after step ( d ). another application of some of the above - described embodiments is to implement an apparatus for removing food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this apparatus includes : a connector configured to connect to a proximal end of the gastrostomy tube with a fluid - tight connection ; a first fluid path provided between the connector and a drain port , configured to permit siphoning or pumping food from the patient &# 39 ; s stomach out to the drain port ; a second fluid path provided between the connector and an input port , configured to permit infusion of liquid from the input port into the patient &# 39 ; s stomach ; and a fluid circuit configured to alternately ( a ) open the first fluid path during a first interval of time to permit siphoning or pumping food out of the patient &# 39 ; s stomach and ( b ) open the second fluid path during a second interval of time to permit infusion of the liquid in the reservoir into the patient &# 39 ; s stomach . another application of some of the above - described embodiments is to implement a method of removing ingested material from a stomach of a patient fitted with an external gastrostomy connection to the stomach . this method includes : coupling a siphon tube to the connection so as to create a siphon system having an aggregate length in excess of 25 cm ; and draining content of the stomach through the siphon tube . another application of some of the above - described embodiments is to implement a method of removing ingested material from a stomach of a patient fitted with an external gastrostomy connection to the stomach . this method includes the steps of : pumping a fluid through the connection into the stomach to increase fluid in the stomach without ingestion of fluid ; and draining content of the stomach through the connection . optionally , the fluid may include one or more of the following : water , a nutrient , a medication , and returned gastric juices . another application of some of the above - described embodiments is to implement an apparatus for removing ingested material from a stomach of a patient fitted with an external gastrostomy connection to the stomach . this apparatus includes : a fluid source for infusing fluid into the stomach through the connection ; and a drain line for draining content of the stomach received from the connection . optionally , a siphon system is used for passively draining content of the stomach , preferably using flat tubing . optionally , a pump may be coupled to the fluid source for pumping fluid through the connection into the stomach . another application of some of the above - described embodiments is to implement a method of removing ingested food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this method includes the steps of : ( a ) extracting a portion of the matter contained in the patient &# 39 ; s stomach via the gastrostomy tube ; ( b ) removing stomach acid from the matter extracted in the extracting step ; and ( c ) returning the stomach acid removed in the removing step to the patient &# 39 ; s stomach via the gastrostomy tube . optionally , the removing step includes the steps of : ( i ) filtering out solid portions from the matter extracted in the extracting step ; and ( ii ) filtering a liquid resulting from step ( i ) using a semi - permeable membrane or an anionic exchange membrane . in this application , the extracting step may be implemented by siphoning or pumping . another application of some of the above - described embodiments is to implement an apparatus for removing food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this apparatus includes : a connector configured to connect to a proximal end of the gastrostomy tube with a fluid - tight connection ; a filter configured to separate stomach acid from other matter ; a first path from the connector to the filter , configured to route matter extracted from the patient &# 39 ; s stomach into the filter ; a pump configured to pump stomach acid that has been separated by the filter back into the patient &# 39 ; s stomach ; and a second path configured to route the other matter to a waste outlet . in this application , the matter extracted from the patient &# 39 ; s stomach may be routed into the filter by pumping or siphoning . optionally , this apparatus may further include a reservoir configured to hold liquid and a pump configured to pump the liquid from the reservoir into the patient &# 39 ; s stomach via the connector . another application of some of the above - described embodiments is to implement a method of removing ingested food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this method includes the steps of : providing an apparatus for siphoning or pumping ingested food out of the patient &# 39 ; s stomach via the gastrostomy tube ; and limiting the number of times that the siphoning or pumping operation can be performed by the apparatus . the number of times that the siphoning or pumping operation can be performed may be limited by a variety of factors such as ( a ) elapsed time from a first use , ( b ) how many times siphoning or pumping of food has been performed , ( c ) how many times the apparatus has been connected to the gastrostomy tube , or ( d ) the volume of matter that has been extracted from the patient &# 39 ; s stomach . optionally , this method may further include the step of infusing liquid into the patient &# 39 ; s stomach via the gastrostomy tube , wherein the infusing step is performed in alternation with the siphoning or pumping . another application of some of the above - described embodiments is to implement an apparatus for removing food from a patient &# 39 ; s stomach via a gastrostomy tube that passes through the patient &# 39 ; s abdominal wall into the patient &# 39 ; s stomach . this apparatus includes : a connector configured to connect to a proximal end of the gastrostomy tube with a fluid - tight connection ; and a first fluid path provided between the connector and a drain port , configured to permit , for a limited number of times only , siphoning or pumping food from the patient &# 39 ; s stomach out to the drain port . the number of times that the siphoning or pumping can be performed may be limited by a variety of factors such as ( a ) elapsed time from a first use , ( b ) how many times siphoning or pumping of food has been performed , ( c ) how many times the apparatus has been connected to the gastrostomy tube , or ( d ) the volume of matter that has been extracted from the patient &# 39 ; s stomach . optionally , this apparatus may further include : a reservoir for holding liquid to be infused into the patient &# 39 ; s stomach ; a second fluid path from the reservoir to the connector , configured to permit infusion of the liquid in the reservoir into the patient &# 39 ; s stomach ; and a fluid circuit configured to alternately ( a ) open the first fluid path during a first interval of time to permit siphoning or pumping food from the patient &# 39 ; s stomach and ( b ) open the second fluid path during a second interval of time to permit infusion of the liquid in the reservoir into the patient &# 39 ; s stomach . note that while the system is described herein in the context of removing the ingested material from the patient &# 39 ; s stomach , it can also be used to remove the ingested material from other portions of the patient &# 39 ; s upper digestive tract ( e . g ., the jejunum ). although the above discussion discloses various exemplary embodiments of the invention , it should be apparent that those skilled in the art can make variations and modifications that will achieve some of the advantages of the invention without departing from the true scope of the invention . accordingly , other embodiments are within the scope of the following claims .

when a patient is fitted with an external gastrostomy connection to the stomach , ingested food can be removed through the gastrostomy connection using a pump - based or siphon - based system to achieve weight loss . the process of removing ingested food can be improved by alternating the infusion of liquid into the stomach with the removal of material from the stomach . optionally , stomach acid may be captured and returned to the stomach . optionally , nutritional supplements or medicines may be added to the infused liquid . optionally , a flush mount connectorized system with a built in valve may be used to simplify the interface with the gastrostomy hardware that remains installed in the patient . optionally , the system may be configured to disable itself from further use after a triggering event has occurred .

for ease of understanding the present invention , the dynamics of snoring are explained with reference to fig1 – 4 . the hard palate hp overlies the tongue t and forms the roof of the mouth m . the hard palate hp includes a bone support b and does not materially deform during breathing . the soft palate sp is soft and is made up of mucous membrane , fibrous and muscle tissue extending rearward from the hard palate hp . a leading end le of the soft palate sp is anchored to the trailing end of the hard palate hp . a trailing end te of the soft palate sp is unattached . since the soft palate sp is not structurally supported by bone or hard cartilage , the soft palate sp droops down from the plane of the hard palate hp in an arcuate geometry of repose . the pharyngeal airway passes air from the mouth m and the nasal passages n into the trachea tr . the portion of the pharyngeal airway defined between opposing surfaces of the upper surface of the soft palate sp and the wall of the throat is the nasopharynx np . during normal breathing , the soft palate sp is in the relaxed state shown in fig1 with the nasopharynx np unobstructed and with air free to flow into the trachea tr from both the mouth m and the nostrils n . during swallowing , the soft palate sp flexes and extends ( as shown in fig2 ) to close the nasopharynx np thereby preventing fluid flow from the mouth m to the nasal passages n . simultaneously , the epiglottis ep closes the trachea tr so that food and drink pass only into the esophagus es and not the trachea tr . the soft palate sp is a valve to prevent regurgitation of food into the nose n . the soft palate sp also regulates airflow through the nose n while talking . since the soft palate sp performs such important functions , prior art techniques for surgically altering the soft palate sp can compromise these functions . the majority of snoring is caused by the soft palate sp flapping back and forth . if breathing is solely through the nose n with the mouth closed , the trailing edge te of the soft palate sp is sucked into the nasopharyngeal space np obstructing the airway and subsequently falls opening the airway in a repeating cycle . when the mouth is open , air flows over the upper and lower surfaces of the soft palate sp causing the soft palate sp to flap up and down alternating in obstructing the oral and nasal passageways m , n . the snoring sound is generated by impulses caused by rapid obstruction and opening of airways . huang , et al ., state the airway passage opening and closing occurs 50 times per second during a snore . huang , et al ., utilize a spring - mass model ( fig5 ) to illustrate oscillation of the soft palate in response to airflow ( where the soft palate is the ball b of mass depending by a spring s from a fixed anchor a ). huang , et al ., analogize the shortening of the soft palate sp in uvulopalatopharyngoplasty as effectively raising the critical air flow speed at which soft palate flutter will occur . the shaded area sa in fig3 shows the area of the trailing end te of the soft palate sp to be removed during this procedure . the alternative procedure proposed by huang , et al ., reduces the flexibility of the soft palate sp through surface scarring which is asserted as effecting the critical flow speed . the shaded area sa ′ in fig4 shows the area to be scarred by this alternate procedure . in fig4 , dashed line l shows the demarcation between the soft and hard palates . using the spring - mass model of fig5 as a convenient model of the soft palate sp , the present invention is directed to a surgical implant into the soft palate sp to alter the elements of the model and thereby alter the dynamic response of the soft palate sp to airflow . the implant can alter the mass of the model ( the ball b of fig5 ), the spring constant of the spring s , the dampening of the spring s or any combination of these elements . unlike the prior art surgical techniques , the implants that will be described are easy to insert in a small incision resulting in reduced patient discomfort and are not exposed to the interior of the mouth ( such as the surface scarring of huang , et al .) as a patient irritant . also , as will be described , the degree of dynamic remodeling can be fine tuned avoiding the need for excessive anatomical modification and are reversible in the event of adverse consequences . fig6 – 7 illustrate a first embodiment of the present invention where individual units 10 of mass ( in the form of implantable modular devices such as spheres or implants of other geometry ) are imbedded in the soft palate sp in close proximity to the trailing end te . with reference to the model of fig5 , the spheres add mass to the mass - spring system thereby altering dynamic response to airflow and adding resistance to displacement and accelerating . the placement of the units 10 of mass also alter the location of the soft palate &# 39 ; s center of mass further altering the model and dynamic response . the embodiment of fig6 – 10 is tunable to a particular patient in that multiple modules 10 can be implanted ( as illustrated in fig7 ). this permits the surgeon to progressively increase the number of implanted modules 10 until the altered dynamic response is such that snoring inducing oscillation is abated at normal airflow . the individual modules 10 may be placed into the soft palate sp through small individual incisions closed by sutures which is much less traumatic than the gross anatomical destruction of uvulopalatopharyngoplasty or the large surface area scarring proposed by huang , et al . preferably , such modules 10 of mass are solid modules such as spheres of biocompatible material which are radiopaque ( or radio - marked ) and compatible with magnetic resonance imaging ( mri ). titanium is such a material . by way of non - limiting example , the modules 10 of mass may be about 2 – 4 mm in diameter . in the case of pure , non - sintered titanium , each such sphere 10 would add 0 . 15 – 1 . 22 gm of mass to the trailing end te of the soft palate sp and contribute to re - modeling the mass distribution of the soft palate sp . an example of an alternative material is any biocompatible ceramic . as shown in fig9 , the spheres ( labeled 10 ′ to distinguish from the version 10 of fig8 ) may be sintered throughout or otherwise provided with tissue growth inducing material 12 on their outer surface . such material may be a sintered outer layer or a coating or covering such as a polyester fabric jacket . such material permits and encourages tissue in - growth to secure the implant 10 ′ in place . also , placement of an implant 10 or 10 ′ will induce a fibrotic response acting to stiffen the soft palate sp ( and further alter the dynamic response and resistance to displacement and acceleration ). a sintered or coated sphere 10 ′ will enhance the fibrotic response and resulting stiffening . while tissue in - growth and enhanced fibrotic response have the benefits described above , such embodiments may make the implant 10 ′ more difficult to remove in the event reversal of the procedure is desired . therefore , as shown in fig1 as an alternative , the spheres ( labeled 10 ″ to distinguish from the implants 10 , 10 ′) may be coated with smooth coating 14 ( such as parylene or ptfe ) to reduce fibrosis . the embodiments of fig6 – 10 add to and relocate the mass of the spring - mass system of fig5 to remodel the dynamic response . the amount of mass is selected to alter the dynamic response but not preclude the soft palate sp being moved to close off nasal passages n during swallowing . through fibrotic response and incision healing , the spring s of the model is stiffened . in addition to modifying the mass profile of the spring - mass system , the spring component s of fig5 can be modified ( alone or in combination with mass modification ) to alter dynamic response . fig1 - 16 illustrate an implant 20 in the form of a flexible strip for placement in the soft palate . the use of the term “ strip ” herein is not intended to be limited to long , narrow implants but can also include plates or other geometries implanted to alter the dynamic model of the soft palate sp . elongated strips are presently anticipated as a preferred geometry to facilitate ease of implant . the strip 20 has a transverse dimension less than a longitudinal dimension . by way of non - limiting example , the strip may have a length l s of about 20 – 30 mm , a thickness t s of about 2 – 4 mm and a width w s of 5 – 10 mm . as shown in fig1 , the strip 20 is embedded in the soft palate sp with the longitudinal dimension l s extending from adjacent the hard palate hp toward the trailing end te of the soft palate sp . as shown in fig1 , multiple strips 20 may be embedded in the soft palate sp extending either straight rearward or angled to the sides while extending rearward . the strips 20 may be formed straight ( fig1 ) or pre - shaped ( fig1 ) to have a rest shape approximate to the side - cross section shape of the soft palate in a relaxed state . the strips 20 may be any flexible , biocompatible material and are preferably radiopaque or radio - marked as well as mri compatible . the strips 20 need not be elastic and having a material spring constant biasing them to their original shape . such strips 20 could simply be flexible , plastically deformable strips which are stiffer than the soft palate sp to reinforce the soft palate sp and assist the soft palate sp in resisting deflection due to airflow . such stiffening of the soft palate sp stiffens and dampens the spring s in the spring - mass system of fig5 and alters the dynamic response of the soft palate sp . the strip 20 may be a spring having a spring constant to further resist deflection of the soft palate sp as well as urging the soft palate sp to the relaxed state of fig5 . the stiffness of the strip 20 , a spring constant of the strip 20 , and the number of strips 20 , are selected to avoid preclusion of closure of the soft palate sp during swallowing . examples of suitable materials include titanium and nitinol ( a well - known nickel - titanium alloy ). as with the examples of fig9 and 10 , the strips 20 may be provided with tissue in - growth surfaces or may be coated as desired . also , the strips may be structurally modified to control their flexibility . in fig1 , the bottom 22 of the strip 20 ( facing the tongue after placement ) is provided with transverse notches 24 to enhance downward flexion of the strip 20 relative to upward flexion of the strip 20 following placement . fig1 provides an alternative to the strips 20 of fig1 . in fig1 , the strip 20 ′ includes a housing 26 having an interior space 28 with an access opening 25 . the interior space 28 extends in the longitudinal dimension of the housing 26 . the strip 20 ′ further includes a longitudinal insert 32 sized to be passed through the access opening 25 and into the space 28 . by way of non - limiting example , the housing 26 could be silicone rubber ( with radio - markers , not shown , to indicate placement ) and the inserts 32 could be titanium rods or other flexible member . with the embodiment of fig1 , the housing 26 ( without an insert ) may be embedded in the soft palate sp . the housing 26 acts independently as a stiffening strip to add stiffness to the soft palate sp to alter the soft palate &# 39 ; s dynamic response . in the event further stiffening or a spring action is desired , the implant 20 ′ can be selectively tuned to the patient &# 39 ; s unique dynamic model by placing the insert 32 into the space 28 at the time of initial surgery or during a subsequent procedure . the embodiment of fig1 , permits selection of an insert 32 from a wide variety of materials and construction so that an insert 32 of desired characteristics ( e . g ., stiffness and spring action ) can be selected to be inserted in the space 28 and alter the dynamic response as desired . the embodiment of fig1 also permits later removal of the insert 32 and replacement with a different insert 32 of different properties for post - surgery modification of the soft palate &# 39 ; s dynamic response . the embodiment of fig1 is similar to that of fig1 . the housing 26 ′ is provided with multiple , parallel - aligned interior spaces 28 ′ and access openings 25 ′. in addition to the function and benefits of the embodiment of fig1 , the number of inserts 32 may be varied to alter and adjust the dynamic response of the soft palate sp . fig1 illustrates a still further embodiment of the strip implant . in fig1 , the strip 20 ′″ is a bladder having a housing 26 ″ in the form of a completely sealed envelope of flexible synthetic material defining an interior space 28 ″. the envelope 26 ″ is preferably self - sealing following needle injection . fluid is injected into the housing 26 ″ ( e . g ., through hypodermic needle 40 injection ) to stiffen the strip 20 ′″. addition of fluid further stiffens the strip 20 ′″ and further alters the dynamic response of the soft palate sp . removal of fluid increases the flexibility . unlike the embodiments of fig1 ( where inserts 32 are most effectively replaced post - operatively through incision to alter flexibility ), the embodiment of fig1 permits selectively varying flexibility of the soft palate sp through needle injection . an alternative to fig1 is to fill the space 28 ″ with a so - called phase change polymer and inject a stiffening agent into the space 28 ″ to alter the flexibility of the polymer . fig2 – 23 illustrate a still further embodiment of the present invention . in the foregoing embodiments , the spring - mass system of fig5 is altered by altering the mass of the soft palate sp or the spring characteristics of the soft palate sp . the dynamic response can also be altered by altering the force acting on the spring - mass system . namely , the force acting on the soft palate sp is generated by airflow over the surface of the soft palate . the soft palate acts as an airfoil which generates lift in response to such airflow . by modifying the longitudinal ( i . e ., anterior to posterior ) cross - sectional geometry of the soft palate sp , the aerodynamic response and , accordingly , the dynamic response are altered . in the embodiments of fig2 – 23 , the implant 30 is inserted into the soft palate sp through an incision . the implant 30 has an oval shape to cause deformation of the geometry of the soft palate sp . prior to implantation , the implant 30 is preferably formed as a flat oval ( fig2 and 22 ) for ease of insertion . after implantation , the implant 30 expands to an enlarged oval ( fig2 and 23 ). while such expansion could be accomplished mechanically ( i . e ., through balloon expansion ), the implant 30 is preferably formed as a shape - memory alloy ( such as nitinol ) which expands to the enlarged shape in response to the warmth of the body . in addition to changing the aerodynamics of the soft palate sp , the implant 30 can be constructed with a mass and stiffness as desired to alter the spring and mass components of the spring - mass system of fig5 . the foregoing describes numerous embodiments of an invention for an implant for the soft palate to alter a dynamic response of the soft palate . the invention is much less traumatic than prior surgical treatments . further , the invention permits use of reversible procedures as well as procedures which can be selectively tuned both during surgery and post - operatively . having described the invention , alternatives and embodiments may occur to one of skill in the art . for example , the strips of fig1 may be encased coiled springs which may be tightened to further stiffen the strips . such strips may also be hinged segments . it is intended that such modifications and equivalents shall be included within the scope of the following claims .

a method and apparatus for treating snoring of a patient includes providing an implant for altering a dynamic response of a soft palate of the patient to airflow past the soft palate . the implant is embedded in the soft palate to alter the dynamic response . for example , the implant has a mass , stiffness or dampening sufficient to alter the dynamic response following the implantation without substantially impairing a function of the soft palate to close a nasal passage of the patient during swallowing .

the present invention is described by the following specific embodiments . those with ordinary skills in the arts can readily understand the other advantages and functions of the present invention after reading the disclosure of this specification . the present invention can also be implemented with different embodiments . various details described in this specification can be modified based on different viewpoints and applications without departing from the scope of the present invention . referring to fig1 , a block diagram illustrating an image processing unit for optical tomography according to an embodiment of the present invention is shown . as shown , the image processing unit for optical tomography 1 is applicable within a diffusion optical tomography device . the image processing unit for optical tomography 1 mainly includes an image reconstruction element 10 and an image post - processor 11 . it should be noted that in order to facilitate use in home health care , the present invention proposes an image processing unit for a small but high - performance miniaturized diffusion optical tomography device . with the reduction in the size of the device , traditional approach of using software to perform immense calculations required for image processing is no longer appropriate . thus , the image reconstruction element 10 and the image post - processor 11 of the present invention can be realized by hardware circuits , such as those embedded in a chip , thereby meeting the needs for both miniaturization and high performance . however , this is only a preferred embodiment , and the image processing unit for optical tomography 1 of the present invention is not limited to this . the image reconstruction element 10 is used for receiving a plurality of optical signals 100 from an reaction of an object under test with irradiating light and object information 200 inputted in advance . in this embodiment , the object information 200 is an inverse solution matrix generated by an image model of the object , and the image reconstruction element 10 performs correlation calculations on each of the optical signals 100 and the inverse solution matrix , for example , a sub - frame algorithm is used to compute scalar product of the optical signals 100 and the inverse solution matrix , which generate a corresponding original image of the object . in implementations , the object information 200 is an inverse solution matrix calculated from an image model of the object . the image model of the object can be established by optical parameters of the object that are data inputted in advance . these optical parameters may include measurement depth , adsorption coefficient , reflection coefficient , diffusion coefficient , etc . then , singular value decomposition is computed on the image model to obtain the inverse solution matrix . the method for obtaining the inverse solution matrix is not the focus of the present invention , and thus will not be further described . in addition , the diffusion optical tomography device emits a plurality of light sources such as near - infrared light to the object . the light reacts with the object and is reflected and received by a detector . in other words , the plurality of optical signals 100 generated from an reaction of an object under test with the irradiating light indicate biological signals in different regions of the object . for example , the object is the inner structure of a human body , after the near - infrared light is irradiated on the human body , different structures in the body may absorb and reflect different levels of the near - infrared light . the detector then detects the optical signals 100 returned resulting from light emitted by each light source , thereby detecting the differences in the inner structure of the human body . thus , all light sources are regionally divided , so that the optical signal 100 for the region onto which the light irradiates can be individually calculated . this is different from the prior art , which calculates sensing information from all light sources in a single calculation and results in very long computation time . the image reconstruction element 10 obtains the scalar product of the received optical signals 100 and the inverse solution matrix of the preset image model of the object to obtain the complete original image of the object . the image post - processor 11 performs a gaussian extended algorithm on the original image generated by the image reconstruction element 10 to output a processed final image 300 . specifically , since the image reconstruction element 10 regionally divides the light sources , the separate calculation for each individual light source results in discontinuities at the boundary of images for two neighboring regions in the overall image , so post processing is carried out on the original image generated by the image reconstruction element 10 , such as a smooth process or increasing of image resolution is performed at the boundary of two image regions , so the final image 300 will have a better representation . it can be understood from the above that , in order to overcome the very long computation time resulted from using software to perform extremely large computations and oversized equipment , the present invention designs the image reconstruction element 10 and the image post - processor 11 as hardware chips so as to perform calculations on the optical signals and the image model to generate the original image and especially speeds up the calculations by separating calculations for each light source , and optimizes the final image through post - image processing , thereby enabling a miniaturized and efficient diffusion optical tomography device . fig2 is a block diagram illustrating details of an image reconstruction element in an image processing unit for optical tomography according to an embodiment of the present invention . in fig2 , an image processing unit for optical tomography 2 provides functions such as image reconstruction and image post - processing , wherein an image reconstruction element 20 , an image post - processor 21 , optical signals 100 and object information 200 are the same as those described with respect to fig1 . the image reconstruction element 20 further includes an optical signal buffer 201 , an object information buffer 202 and an image reconstruction module 203 . however , the aforementioned module or structure is not to be constructed in a limiting sense , and can be adjusted according to needs . the optical signal buffer 201 is used for buffering the plurality of optical signals 100 , and the object information buffer 202 is used for buffering the object information 200 , that is , the aforementioned inverse solution matrix . the optical signal buffer 201 and the object information buffer 202 primarily provide buffering of the optical signals 100 and the object information 200 . this avoids computation problems resulting from two entries of information entering at different times , and can be used for repetitive readings . the image reconstruction module 203 processes each optical signal 100 through a sub - frame algorithm to obtain detection data of the object , and obtains a scalar product of the detection data and the inverse solution matrix to reconstruct the original image . the image reconstruction module 203 is the operation core of the image reconstruction element 20 . the image reconstruction module 203 converts each optical signal 100 into digital detection data , obtains the scalar product of the detection data and the inverse solution matrix to get the original image of the object and transmits this original image to the image post - processor 21 . in addition , the image reconstruction element 20 further includes a control module ( not shown ) connected with the image reconstruction module 203 and the optical signal buffer 201 to provide control of the analog - to - digital conversion of the optical signals 100 and the image reconstruction process . fig3 is a block diagram illustrating details of an image post - processor in an image processing unit for optical tomography according to an embodiment of the present invention . in fig3 , an image processing unit for optical tomography 3 also provides functions such as image reconstruction and image post - processing , wherein an image reconstruction element 30 , an image post - processor 31 , optical signals 100 and object information 200 are the same as those described with respect to fig1 . the image reconstruction element 30 further includes an input buffer 311 and an image processing module 312 . however , the aforementioned module or structure is not to be constructed in a limiting sense , and can be adjusted according to needs . the input buffer 311 is used for buffering the original image generated by the image reconstruction element 30 . this provides a similar function with the optical signal buffer 201 and the object information buffer 202 described in fig2 . the image processing module 312 performs an image smoothing process on the original image based on weighted array formed by the gaussian extended algorithm to obtain the final image 300 . more specifically , the image processing module 312 is the operating core of the image post - processor 31 . the image processing module 312 performs image post - processing on the original image to obtain an image that can be easily viewed by human eyes . the image smoothing process performed by the image processing module 312 enables boundaries of two neighboring optical signals to have image continuity . alternatively , the image processing module 312 can increase image resolution so that the final image 300 will have a better appearance . the image post - processing may include numerous approaches such as fine tuning of photo parameters ( e . g . saturation , contrast , sharpness etc .) or an image edge smoothing process to avoid any observable discontinuities at boundaries . in addition , the image post - processor 31 further includes a control module ( not shown ) connected with the image processing module 312 for providing control of the image post - processing . the application of the image processing unit for optical tomography described with respect to fig1 - 3 in a diffusion optical tomography device is discussed as follows . fig4 is a block diagram illustrating an image processing unit for optical tomography applied to a diffusion optical tomography device according to an embodiment of the present invention . in fig4 , a diffusion optical tomography device 4 is a miniaturized device that is easy to carry and small in size . compared to the large equipment employed for software computations in the prior art , the diffusion optical tomography device 4 is more advantageous . the diffusion optical tomography device 4 includes an optical tomography element 40 and a sensing circuit 41 . the sensing circuit 41 is electrically connected to light sources 411 and a detector 412 . the light sources 411 emit light such as near - infrared light to a human chest 1000 , and the reflected light is then detected by the detector 412 to generate the aforementioned optical signals . that is , the sensing circuit 41 obtains the optical signals corresponding to the inner structure of the human chest 1000 , and transmits them to the optical tomography element 40 . the optical tomography element 40 primarily performs the image reconstruction and image post - processing . the optical tomography element 40 includes an operating unit 401 , a control unit 402 and an image processing unit 403 . the control unit 402 primarily controls the operations of various units within the optical tomography element 40 . the operating unit 401 performs pre - processing on the optical information of the object so as to generate the original image of the object in combination with the sensed optical signals . the image processing unit 403 performs the image reconstruction and image post - processing . more specifically , a user can input optical parameters related to an object under test via a user control interface ( not shown ). meanwhile , a model processor 4011 , based on the control by the control unit 402 , establishes an image model of the object based on the optical parameters of the object , that is , converts the received optical parameters of the object into factors used for matrix calculation , and establishes a model matrix of the object based on the factors used for matrix calculation and some preset basic information in the sensing circuit 41 . then , a singular value decomposer 4012 performs singular value decomposition on the model matrix to obtain an inverse solution matrix of the object . the inverse solution matrix is combined with the sensed optical signals to generate the original image of the object . the image processing unit 403 is the aforementioned image processing core technique of the present invention . after the inverse solution matrix generated by the operating unit 401 and the optical signals sensed by the sensing circuit 41 are received , an image reconstructing element 4031 performs image reconstruction , and then an image post - processor 4032 performs image post - processing on the original image of the object generated to obtain an image output 2000 with a better effect . therefore , the overall diffusion optical tomography device 4 can be a circuit design and manufactured as chips for miniaturization . especially , fast and efficient image processing can be achieved through image reconstruction and image post - processing by the image reconstructing element 4031 and the image post - processor 4032 in the image processing unit 403 . in summary , the image processing unit for optical tomography of the present invention is primarily used for image reconstruction and image post - processing that combines and calculates each optical signal and the image model of the object , that is , obtains the scalar product using the sub - frame algorithm to obtain the original image of the object then , the gaussian extended algorithm is performed on the original image to increase the resolution of the image and achieve continuities between images in each zones , thus obtaining a better image output . the image processing unit for optical tomography of the present invention is realized as a chip , so that the size of the device can be minimized , and the chip is relatively cheap with fast processing speed . this makes it suitable for application in home or portable health care equipment , and is clearly more advantageous than the large optical tomography device employing software calculations currently used . the above embodiments are only used to illustrate the principles of the present invention , and they should not be construed as to limit the present invention in any way . the above embodiments can be modified by those with ordinary skill in the art without departing from the scope of the present invention as defined in the following appended claims .

an image processing unit for optical tomography is applicable in miniaturized diffusion optical tomography devices . it includes an image reconstructor and an image post - processor . the image reconstructor receives a plurality of optical signals generated from an reaction of an object under test with irradiating light and an inverse solution matrix of an image model of the object , and obtains scalar product on each of the optical signals and the inverse solution matrix through a sub - frame algorithm to generate an original image corresponding to the object . then , the image post - processor performs a gaussian extended algorithm on the original image to output a final image . with the image reconstruction and image post - processing of the present invention , slowing down of computation speed due to miniaturization of the conventional optical tomography techniques can be avoided , while providing good quality in the output image .

referring to the drawings , a folding table system comprises a table top 2 and a collapsible structure 4 . the collapsible structure 4 comprises four legs 6 . two connecting members 8 connect one end of each of the two pairs of legs 6 to form two support frames 10 . the support frames 10 are connected by two folding frame structures 12 each of which comprises a first member 14 connected by hinge means 15 to one support frame 10 and a second frame member 16 connected by a hinge means 15 to the other support frame 10 , the first and second frame members 14 , 16 being connected together by hinge 18 . in use , the table is erected by separating the members 8 so that the hinges 18 are fully opened and the members 14 and 16 align to span the width of the table . the table top is then placed on the opened structure 4 . to collapse the table , the table top 2 is removed and the members 8 brought together so that the members 14 and 16 pivot with respect to each other and with respect to the members 8 as shown in fig2 . in the fully collapsed position the members 14 and 16 lie substantially parallel to the members 8 as shown in fig3 . referring in particular to fig4 a cover member 20 may be provided on the frame structure 12 so that it can be swung over the hinged joint at 18 when the structure is erected to provide extra strength and to conceal the hinged joint formed between the members 14 and 16 . thus the cover member 20 acts as a reinforcement to the central joint . pressure applied to the joint will be taken up by the cover member 20 so that undue pressure cannot be applied to the hinge 18 itself . use of a reinforcing cover member 20 at the central hinge location thus obviates the need for elaborate frame members in the folding frame structures 12 so that simple single element frame members 14 and 16 are sufficient . the cover member 20 carries the weight of the table top 2 or similar surface , and any weight applied thereto , at the central hinge location 18 . typically the cover member 20 comprises a channel section member slidably or otherwise located in the direction of arrow a over one end of one of the frame members 14 , 16 as the structure is opened . the other end of the cover member 20 may be secured for example by bonding or welding to the adjacent end of the other frame member 16 , 14 . preferably the cover member 20 is arranged centrally around the central hinge joint 18 when in use , as shown in fig4 . when the structure is in the closed position as shown in fig3 the cover member 20 extends beyond the end of the frame member 14 , 16 to which it is secured and between that end and the opposing end of the second frame member 14 , 16 . the cross - sectional shape of the cover member 20 generally corresponds to that of , and is a close fit on , the frame member to which it is secured . preferably the cover member is also a close fit on the frame member over which it is slidably located . as shown in fig2 and 3 , the hinge plates 22 of the hinge 18 may be secured externally to the adjacent ends of the frame members 14 and 16 . however , it is preferred that the hinge plates 22 of the hinge 18 be secured internally to the adjacent ends of the frame members 14 and 16 as shown in fig4 . in particular , the frame members 14 , 16 may comprise hollow section members , the hinge plates 22 being secured , for example by welding , to the internal side walls of the members . the cover member 20 effectively conceals the gap 24 formed between the adjacent ends of the frame members 14 , 16 opposite hinge 18 . referring to fig6 hinge means 15 comprises an elongate member 26 of generally circular cross - section . an upper region 28 of the member 26 has a recess 30 formed therein . the side wall 32 of the recess 30 has a straight portion 34 and an end curved portion 36 . a horizontally projecting lug 38 , typically of rectangular cross - section , extends from the upper region 28 generally in the direction of the straight portion 34 of the side wall 32 . a lower region 40 of the elongate member 26 extends downwardly from the upper region 28 and is adapted to engage preferably , with a close fit or press fit in an aperture or recess 42 , formed in the upper end of the leg 6 of the collapsible structure , as shown in fig7 . the aperture 42 may comprise a hollow end of the leg 6 which preferably has a cut - out region 44 so that the lower region 40 of the member 26 fits within an uncut portion of the hollow end below cutout region 44 and the upper region 28 of the member 26 fits within the cut - out region 44 , the lug 38 extending from the cut - out region 44 . an aperture 46 which may be a through aperture , is formed in the lower region 40 and extends generally in the longitudinal direction of the elongate member 26 . the aperture is open proximate of the recess 30 of upper region 28 . a hinge member 48 comprises a base member 50 having a longitudinal dimension generally similar to the height of the side wall 32 and having a curved back wall portion 52 which corresponds to the end curved portion 36 of the recess 30 so that the base member 50 can pivot relative to the curved portion 36 about a pivot axis defined by the central axis of the aperture 46 . a pivot pin 54 extends from the base member 50 and is adapted to engage in at least part of the aperture 46 to join the hinge member 48 to the elongate member 26 and to facilitate pivoting of the hinge member relative to the elongate member . a horizontally projecting lug 56 , typically of rectangular cross - section , extends from the base member 50 in a direction away from the curved back wall portion 52 . in use , the hinge means 15 is mounted on the support structure by connecting the elongate member and the hinge member as aforesaid , inserting for example as a press fit , the elongate member into the upper region of a leg 6 and connecting corresponding connecting members 8 and frame members 14 , 16 to the lugs 38 and 56 . typically the ends at least of the connecting members and frame members will be hollow and shaped so that the lugs 38 or 56 may be pushed therein to form a close fit or press fit . referring to fig8 and 9 , an alternative embodiment of hinge means 15 is generally similar to that described with reference to fig6 and 7 . however , in this case the elongate member 26 and the leg 6 have a generally rectangular or square cross - section .

a collapsible support structure for a removable table is disclosed . the collapsible structure comprises four legs and connecting members extending between the legs . hinged connections between the legs and some of the connecting members provided by a pin extending from the connecting members and a hole in the top of the legs extending parallel to the legs .

referring to fig1 , the over - the - wire interlock attachment / detachment mechanism of the present invention indicated generally at 10 is adapted for movement along a conventional guidewire 12 such as a 0 . 014 ″ guidewire . the over - the - wire interlock attachment / detachment mechanism includes a male locking section 14 , a female lock receiving section 16 , and a tubular sheath 18 dimensioned to slide over the male and female sections . preferably , the female section 16 is secured to an implantable medical device 20 such as a septal occluder , a filter or stent to be released in the heart or a blood vessel or other vessel of the human body or to be retrieved or repositioned within the heart or vessel . the male locking section 14 includes a tubular body 22 which defines an open ended central chamber 24 through which the guidewire 12 passes . projecting outwardly from the forward end of the tubular body 22 are one or more elongate guide fingers 26 . these guide fingers are straight , elongate pins with arcutely shaped ends 28 , and two such guide fingers are shown in fig1 although more than two can be provided . the outer surface of each guide finger is preferably coextensive with the outer surface of the tubular body 22 . also projecting outwardly from the forward end of the tubular body 22 are one or more flexible , elongate locking arms 30 which are substantially equal in width to the width of the guide fingers 26 . underlying each of the locking arms is a slot 32 formed in the tubular body to receive the locking arm . when unconfined , each locking arm is formed to angle outwardly beyond the outer surface of the tubular body 22 . a shaped locking member 34 is formed at the end of each locking arm . preferably , this locking member , which extends laterally from at least one side of the locking arm , is circular in shape , but other shapes which extend laterally from the locking arm including but not limited to an ellipse , a “ t ”, a rectangle , a square , a hook , a triangle or an “ l ” can be used . a circular locking member facilitates engagement with the lock receiving section 16 . the guide fingers and locking arms are equally spaced around the tubular body 22 . they are preferably equal in number , and although two of each are shown , more can be used . the female lock receiving section 16 includes a tubular body 36 which defines an open ended central chamber 38 for receiving the guidewire 12 . the tubular body 36 is substantially equal in diameter to the tubular body 22 so that the two are coextensive when the male locking section is engaged with the female lock receiving section . the female lock receiving section includes a plurality of shaped locking cutouts 40 which are shaped to conform to and receive the shaped locking members 34 . the number of shaped locking cutouts 40 is equal to the number of guide fingers 26 and locking arms 30 . extending into each of the shaped locking cutouts 40 is a straight , open ended , cutout entry section 42 which is formed to receive either a guide finger 26 or a locking arm 30 . the shaped locking cutouts 40 and open ended entry cutout sections 42 are equally spaced around the tubular body 36 to conform to the spacing of the guide fingers 26 and locking arms 30 . outwardly projecting spacer sections 44 extend outwardly between adjacent shaped cutouts and open ended entry cutout sections and each terminate in inclined outer end surfaces 46 and 48 which form an apex 50 . each inclined outer surface angles downwardly toward an open ended entry cutout section 42 and the inclined outer end surface 46 of a spacer section 44 forms with the inclined outer end surface 48 of an adjacent spacer section an enlarged outwardly tapered opening 52 for each open ended cutout section . the female lock receiving section 16 is secured to one end of a medical implant 20 , which can be an over the wire device such as a septal occluder . for purpose of illustration , the female lock receiving section is shown with the over - the - wire free standing filter 54 . the free standing filter 54 has a filter body with an elongate guidewire receiving member 56 extending centrally therethrough to define an open ended channel configured to receive a plurality of different sized guidewires . an expandable and contractible frame 58 surrounds the elongate guidewire receiving member and is connected at a proximal end to the elongate guidewire receiving member . a porous embolic capturing unit 60 has an open end 62 connected to the frame and a closed end 64 connected to the elongate guidewire receiving member which extends through the porous embolic capturing unit . fig1 , 3 and 4 disclose the manner in which the over - the - wire interlock attachment / detachment mechanism 10 is operable to positively engage and remove a medical implant 20 from a body organ or vessel . the male locking section 14 is enclosed within the sheath 18 so that the locking arms 30 are forced into the slots 32 and do not project outwardly beyond the periphery of the male locking section . in this configuration , the male locking section is passed along the wire 12 until it is positioned in close proximity to the female lock receiving section 16 . at this point , the sheath 18 is drawn back to permit the locking arms 30 to angle outwardly from the male locking section 14 . the male locking section is then moved toward the female lock receiving section 16 until the guide fingers 26 engage the outer end surface 46 or 48 of a spacer section 44 . as the male locking section continues to move toward the female lock receiving section , each guide finger will be guided by an inclined outer end surface 46 or 48 into an open ended cutout entry section 42 which then guides the guide finger into the associated shaped cutout 40 . the over - the - wire interlock attachment / detachment mechanism is now in the configuration illustrated in fig3 . it will be noted that when the guide fingers move into the open ended cutout entry sections 42 , they position the locking arms 30 and the locking members 34 above and in alignment with open ended cutout sections 42 and their associated shaped cutouts 40 . now , shown in fig4 , the tubular sheath 18 is moved forwardly over the tubular bodies 22 and 36 to force the locking members 34 into the shaped cutouts 40 and positively engage the male locking section 14 with the female lock receiving section 16 . once a positive engagement has been established between the male locking section and female lock receiving section , the over - the - wire interlock attachment / detachment mechanism can be drawn back over the wire 12 to remove the medical implant 20 . because of the positive locking engagement , forces present on the medical implant as it is withdrawn will not result in detachment from the over - the - wire interlock attachment / detachment mechanism . this is very important for medical implants such as the removable filter 54 where hooks 58 must be withdrawn from the wall of the vessel . it is often difficult to accurately position a medical implant within a vessel without disconnecting or misaligning the implant relative to the positioning device . this problem is rectified by the over - the - wire interlock attachment / detachment mechanism 10 . the medical implant 20 with an attached female lock receiving section 16 is positively locked to the male locking section 14 in the manner shown by fig4 before it is moved over the wire 12 into position within a body vessel . the positive locking action between the male locking section and female lock receiving section facilitates accurate positioning of the medical implant within a vessel without misorientation or the likelihood of a disconnect . once the implant device is positioned , the sheath 18 can be moved back as shown in fig3 allowing the locking arms 30 to spring outwardly to disengage the locking members 34 from the shaped cutouts 40 . now the male locking section 14 can be drawn back over the wire 12 away from the female lock receiving section 16 . the sheath 18 may be replaced by other operating mechanisms capable of moving the locking arms 30 into the slots 32 . for example , elongate tethers attached to the ends of the locking arms which extend back through the central chamber 24 might perform this function . the male locking section 14 can be modified as shown in fig5 and 6 to provide a flexible end section 68 adjacent to the elongate guide fingers 26 and elongate locking arms 30 . by providing a flexible section 68 in the body 22 proximal to the guide fingers and locking arms , it becomes easier to align the guide fingers , locking arms and locking members 34 with the cutouts in the female lock receiving section 16 . the flexible section 68 can be formed in a variety of ways . for example , a spring section can be welded or bonded to the body 22 between the main portion of the body and the guide fingers and locking arms to form the flexible section 68 . ideally , as shown in fig5 , the body 22 is formed with a unitary spring section 68 by cutting the body in a spiral to create a helical spring 70 . this can be done with a laser which can also be used to shape the guide fingers , locking arms and locking members in the tubular body 22 . alternatively , as shown in fig6 , a flexible , tubular polymer section 72 can be formed between the main portion of the body 22 and the guide fingers and locking arms to provide the flexible section 68 .

the over - the - wire interlock attachment / detachment mechanism includes a cylindrical lock receiving section of a small diameter attached to an implantable medical device such as a blood clot filter , a stent , or a septal occluder . this cylindrical lock receiving section has a plurality of spaced , curved cutouts to receive both the guide fingers and contoured locking fingers formed on a cylindrical locking section . the locking fingers are angled outwardly from the cylindrical body of the cylindrical locking section , and are moved inwardly into engagement with the curved cutouts of the cylindrical lock receiving section by a sheath which slides over the cylindrical locking section or other suitable operator .

an objective lens adapter according to an embodiment of the present invention will be described below referring to fig1 to 5 . as shown in fig2 , an objective lens adapter 1 according to this embodiment , which is an objective lens adapter 1 that is attachably / detachably attached to an objective lens 3 for in vivo observation and that has a small - diameter distal - end portion 2 , is provided with a fixed member 5 that is fixed to a lens tube 4 of the objective lens 3 , a distal - end member 6 that is disposed so as to cover the small - diameter distal - end portion 2 of the objective lens 3 , and a compression coil spring ( elastic member ) 7 that is disposed between the distal - end member 6 and the fixed member 5 . the fixed member 5 is formed substantially cylindrically , has an inside diameter that allows it to fit on the lens tube 4 of the objective lens 3 , and has an inner - rib like inner flange portion 5 a on one end extending radially inward . the inner flange portion 5 a is provided with a through - hole 5 b that penetrates in the axial direction . the fixed member 5 can be fixed onto the lens tube 4 of the objective lens 3 by friction from pressing the distal end of a set screw 8 , which is screwed into a threaded hole 5 c penetrating in the radial direction thereof , against the external surface of the lens tube 4 of the objective lens 3 . the distal - end member 6 is provided with a substantially cylindrical tubular portion 6 a , a prism ( optical element ) 9 fixed on one end of the tubular portion 6 a , and an outer - rib like outer flange portion 6 b that extends radially outward on the other end of the tubular portion 6 a . the tubular portion 6 a has an outside diameter slightly smaller than the inside diameter of the through - hole 5 b of the inner flange portion 5 a . in addition , the outer flange portion 6 b has an outside diameter sufficiently larger than the inside diameter of the through hole 5 b . reference sign 6 d in the drawings is a stopper that sets the position of the distal - end member 6 to a predetermined position with respect to the fixed member 5 . the tubular portion 6 a has a sharp portion 6 c whose distal end is in a cut - off configuration at a 45 ° angle with respect to the axis line . the prism 9 is formed in a columnar shape as shown in fig3 and has a reflection surface 9 a inclined at 45 ° with respect to the axis line . the prism 9 is fittingly accommodated in the sharp portion 6 c at the distal end of the tubular portion 6 a . as shown in fig3 and 4 , a ring shaped spacer 10 whose thickness is controlled is disposed on the surface of the prism 9 inside the tubular portion 6 a . by inserting the spacer 10 , direct contact between the prism 9 and a lens ( not shown ) at the distal end of the objective lens 3 is avoided , thereby preventing damage to the prism 9 and the lens at the distal end of the objective lens 3 . in addition , as shown in fig4 and 5 , a part of the side wall of the tubular portion 6 a is cut away on the side of the sharp portion 6 c , exposing the prism 9 accommodated inside . in addition , so as not to form a large level difference between the surface of the prism 9 exposed to the outside and the tubular portion 6 a , the side wall of the tubular portion 6 a is also cut away in an area continuous with the prism 9 and is sealed by bonding a plate portion 11 whose plate thickness gradually increases . the reflection surface 9 a is covered by a cover member 12 , and , as shown in fig1 to 3 , the surface of the cover member 12 opposing the reflection surface 9 a is provided with a concave portion 12 a close to the center position thereof . by disposing the concave portion 12 a opposite the reflection surface 9 a of the prism 9 , an air layer can be formed on the back surface side of the reflection surface 9 a , and thus total reflection of light at the reflection surface 9 a is possible . by having the tubular portion 6 a penetrate the through - hole 5 b , the compression coil spring 7 is disposed in a position sandwiched in the axial direction between the outer flange portion 6 b disposed inside the fixed member 5 and the inner flange portion 5 a of the fixed member 5 . thus , by relatively moving the fixed member 5 and the distal - end member 6 in the axial direction , the amount of elastic deformation of the compression coil spring 7 is changed , causing mutual elastic forces to act . the operation of the thus - configured objective lens adapter 1 according to this embodiment will be described below . to attach the objective lens adapter 1 according to this embodiment to the distal end of the objective lens 3 having the small - diameter distal - end portion 2 , the fixed member 5 and the distal - end member 6 of the objective lens adapter 1 are placed thereon from the small - diameter distal - end portion 2 side of the objective lens 3 to bring the prism 9 into contact with the distal - end surface of the small - diameter distal - end portion 2 via the spacer 10 . from this state , the fixed member 5 is moved with respect to the distal - end member 6 , in a direction indicated by an arrow a in fig2 , toward the proximal end of the objective lens 3 ; thereby the compression coil spring 7 sandwiched between the outer flange portion 6 b of the distal - end member 6 and the inner flange portion 5 a of the fixed member 5 is compressed , generating an elastic force . then , the set screw 8 provided on the fixed member 5 is screwed into the threaded hole 5 c in a state wherein the compression coil spring 7 is elastically deformed enough to obtain a predetermined elastic force ; the fixed member 5 can be fixed in that position by pressing the distal end of the set screw 8 against the external surface of the lens tube 4 of the objective lens 3 . by doing so , the prism 9 can be precisely positioned with respect to the objective lens 3 because the state in which the prism 9 is pressed onto the distal end of the small - diameter distal - end portion 2 via the spacer 10 is maintained by means of the elastic force of the compression coil spring 7 . in addition , generation of an excessive pressing force is prevented because the pressing is achieved by means of the elastic force of the compression coil spring 7 , and thus occurrence of the problem of the small - diameter distal - end portion 2 of the objective lens 3 and the prism 9 being damaged can be proactively prevented . in particular , in the case of the objective lens 3 for observing the internal condition of brain tissue , the small - diameter distal - end portion 2 is extremely thin , and therefore , attachment / detachment by screws tends to apply an excessive pressing force ; however , an advantage of this embodiment is that there is no such problem . with the objective lens adapter 1 according to this embodiment , attached to the distal end of the objective lens 3 in this way , it is possible to simplify the procedure of piercing biological tissue with the sharp portion 6 c provided on the distal end . in other words , whereas a part of the biological tissue is crushed when piercing with the small - diameter distal - end portion 2 of an objective lens 3 with a flat distal end as it is , causing severe damage , according to this embodiment , there is an advantage in that , due to the sharp portion 6 c , the objective lens 3 can pierce the biological tissue without inflicting damage . in addition , because the side wall adjacent to the sharp portion 6 c is cut away to expose a part of the prism 9 , when piercing the biological tissue , the biological tissue can be brought into contact with the exposed surface of the prism 9 . furthermore , because the objective lens adapter 1 is configured so as not to form a level difference between the surface of the prism 9 and the external surface of the tubular portion 6 a , when piercing the biological tissue , the problem of the biological tissue being scraped by the level difference thereby inflicting damage can be prevented . then , the illumination light guided from the objective lens 3 side is emitted from the small - diameter distal - end portion 2 , is incident on the prism 9 , is deflected 90 ° at the reflection surface 9 a of the prism 9 , and thus the illumination light is radiated onto the biological tissue in contact with the surface of the prism 9 from a notch 6 e provided in the tubular portion 6 a . in the case where the illumination light is excitation light , the illumination light excites a fluorescent substance that exists in the biological tissue , generating fluorescence , and the generated fluorescence returns along the same path to be collected by the objective lens 3 . in this case , because the cover member 12 , disposed so as to cover the reflection surface 9 a of the prism 9 , has the concave portion 12 a that forms the air layer with the prism 9 , it is possible to bring about total reflection of light at the reflection surface 9 a . as a result , reduction of the intensity of the illumination light radiated onto the biological tissue and the detected light , such as fluorescence obtained from the biological tissue , is prevented ; the illumination efficiency and the detection efficiency are improved ; and it is thus possible to conduct observation with a bright image . in addition , with the objective lens adapter 1 according to this embodiment , when conducting multiple observations of the same site with time intervals therebetween , after conducting an observation with the objective lens 3 , having the objective lens adapter 1 attached thereto , piercing biological tissue , the set screw 8 is loosened to release the fixing of the fixed member 5 to the lens tube 4 of the objective lens 3 , thereby making it possible to withdraw the objective lens 3 from the objective lens adapter 1 while leaving the objective lens adapter 1 piercing the biological tissue . then , to resume observation , the objective lens 3 may be inserted into and fixed to the objective lens adapter 1 that pierces the biological tissue . note that , in this embodiment , the sharp portion 6 c , which is shaped as if the distal end of the tubular portion 6 a is cut off at an angle , is provided , and the prism 9 , having the reflection surface 9 a inclined at 45 °, is disposed inside ; however , instead , a prism 9 having a reflection surface 9 a inclined at an angle other than 45 ° may be adopted . although the cover member 12 having the concave portion 12 a opposing the reflection surface 9 a of the prism 9 is provided , instead , a metallic thin film , a dielectric multilayer film , etc ., may be formed on the reflection surface 9 a . in this case , the reflection efficiency becomes lower than in the case of total reflection , but it is advantageous in that the cover member 12 and the concave portion 12 a are not necessary . in addition , although the prism 9 having the reflection surface 9 a is adopted as an optical element in this embodiment , instead , a glass flat plate member that transmits light in the optical axis direction may be adopted . by doing so , the working distance can be adjusted to the optimal position . in addition , although the columnar prism 9 is accommodated in the cylindrical tubular portion 6 a , instead , a triangular prism ( not shown ) may be employed , and an accommodation portion may be formed at the distal end of the tubular portion 6 a in such a shape that the triangular prism can be accommodated therein . further , when using the triangular prism , as shown in fig6 , the plate member 11 may be omitted by providing a thick - walled tubular portion 6 a . additionally , as shown in fig7 , the plate member 11 may be omitted while keeping the outside diameter small by decentering the inside diameter and outside diameter of the tubular portion thereby forming a thick - walled portion .

high - precision observation is made possible while allowing contact between a distal end of an objective lens and an optical element without damaging the distal end of the objective lens and the optical element even when attaching to and detaching from the distal end of the objective lens . provided is an objective lens adapter including a fixed member that is fixed to a lens tube of an objective lens , a distal - end member including an optical element that is made to be placed in contact with the distal - end surface of the objective lens , and an elastic member that is disposed between the distal - end member and the fixed member and that urges the optical element in a direction that causes the optical element to contact the distal - end surface of the objective lens .

the present invention relates to a system and method for treating cardiac arrhythmia and , in particular , a system and method for treating atrial fibrillation ( af ). representative of the present invention , fig1 illustrates an example configuration of a system 10 for combining av node vagal stimulation ( avn - vs ) with on - demand pacing , such as vvi pacing , to achieve a desired ventricular rate with a desired ventricular rhythm in response to atrial fibrillation . for example , the system 10 may combine avn - vs and on - demand pacing to achieve a relatively slow ventricular rate with a substantially regular ventricular rhythm . in the example embodiment of fig1 , the system 10 includes a control unit 20 , one or more vagal stimulation ( vs ) electrodes 30 , and one or more pacing electrodes 40 . the vs electrodes 30 are operatively connected with the control unit 20 via vs leads 32 . the pacing electrodes 40 are operatively connected with the control unit 20 via pacing leads 42 . the control unit 20 is operative to provide electrical stimulation signals to the vs electrodes 30 and the pacing electrodes 40 via the leads 32 and 42 , respectively . the control unit 20 modulates or controls the frequency , amplitude , duration / pulse - width of the stimulation signals in accordance with the description set forth below in order to achieve the desired ventricular rate and rhythm . the control unit 20 may also be operative to monitor cardiac activity , such as r waves , via the pacing electrodes 40 . referring to fig2 , a patient 50 is outfitted with the system 10 of the example embodiment of fig1 . the pacing electrodes 40 are delivered and implanted in the right ventricle 52 of the patient &# 39 ; s heart 54 via blood vessels , which may be accessed by known means ( not shown ), such as by cannulization and catheterization of the vessels . in the embodiment of fig2 , the pacing electrodes 40 are inserted into the left brachiocephalic vein 60 , pass through the superior vena cava 62 and right atrium 64 , and are delivered to the right ventricle 52 ( e . g ., the right ventricular apex ) of the patient &# 39 ; s heart 54 . while this procedure is commonly used to deliver the pacing electrodes 40 , those skilled in the art will appreciate that the pacing electrodes may be delivered to the right ventricle 52 in any suitable alternative manner . in the embodiment of fig2 , the vs electrodes 30 are implanted or otherwise positioned on an av nodal fat pad 70 of the patient &# 39 ; s heart 54 . the av nodal fat pad 70 is an epicardial fat pad located adjacent the posterior av groove of the heart 54 . the av nodal fat pad 70 is rich with vagal nerves / nerve fibers . the vs electrodes 30 may be positioned on the av nodal fat pad 70 in a variety of manners . for example , the vs electrodes 30 may be positioned on the av nodal fat pad 70 via a surgical procedure in which the patient &# 39 ; s chest cavity is opened and the electrodes are positioned on the heart 54 directly . those skilled in the art will appreciate , however , that the vs electrodes 30 may be positioned on the av nodal fat pad 70 in an alternative manner , such as via a minimally invasive surgical procedure . the control unit 20 may be implanted subcutaneously in the chest area of the patient 50 , as shown in fig2 . as known in the art , the pacing electrodes 30 may also serve as sensors for monitoring the electrical activity of the heart 54 , such as the r - r intervals of the heart . the control unit 20 may thus monitor the rate or rhythm of the heart 54 via the pacing electrodes 30 and may detect the occurrence of atrial fibrillation . alternatively , separate electrodes ( not shown ) may be used to detect af . the system 10 thus may be an active or “ on - demand ” system in which ventricular rate and rhythm control is applied in response to detection to an af episode . fig3 illustrates a functional block diagram depicting a process 120 performed by the system 10 of fig1 and 2 in accordance with the present invention . referring to fig3 , at 100 , the system 10 monitors electrical cardiac activity . at 102 a determination is made as to whether atrial fibrillation is detected . if atrial fibrillation is not detected , the system 10 reverts to 100 and continues to monitor the cardiac electrical activity . the system 10 thus may provide continuous monitoring of cardiac electrical activity for the occurrence of atrial fibrillation . if , at 102 , atrial fibrillation is detected , the system 10 proceeds to 104 and applies avn - vs . in the embodiment illustrated in fig2 , the control unit 20 delivers electrical stimulation to the av nodal fat pad 70 via the vs electrodes 30 and lead 32 . this avn - vs is effective to reduce the ventricular rate during af . by titrating or modulating the energy delivered to the av nodal fat pad 70 , the average ventricular rate can be controlled ( i . e ., lowered ) to or toward a desired value . at 104 , the control unit may implement an open loop control algorithm for applying the avn - vs energy . in this example configuration , the avn - vs energy may be applied at a constant predetermined level or intensity to lower the ventricular rate during af . the rate to which the ventricular rate is lowered may depend on a variety of factors , such as the ventricular rate at the onset of af and the particular physiological cardiac conditions of the particular patient . thus , in an open loop control configuration , the ventricular rate is lowered using avn - vs without being controlled to a particular desired rate . alternatively , at 104 , the control unit 20 may implement a closed loop control algorithm to control the avn - vs in order to achieve a particular desired ventricular rate . the closed loop algorithm implemented in the control unit 20 may be any algorithm suited to achieve active feedback control . for example , a classic proportional - integral - derivative ( pid ) control algorithm may be implemented in the control unit 20 . in this example configuration , the control unit 20 would measure the instantaneous heart rate based on the time interval between two successive heart beats . this instantaneous heart rate would then be compared to the desired ventricular rate to determine an error value , which is provided to the pid control algorithm . based on the error value , the pid control algorithm calculates an increase or decrease in the intensity of the avn - vs energy to control or “ steer ” the ventricular rate toward the desired value . this control loop continues until a zero - error condition is achieved . through implementation of the closed loop control algorithm , the control unit 20 may thus maintain the ventricular rate at the desired value . according to the present invention , with the average ventricular rate is adjusted to the desired value using avn - vs procedure described above , the system 10 proceeds to 106 , where the ventricular rhythm is normalized via on - demand ventricular pacing ( e . g ., vvi pacing ). referring to fig2 , the control unit 20 delivers electrical stimulation to the cardiac tissue of the right ventricle 52 via the pacing electrodes 40 and lead 42 . this on - demand pacing is effective to help normalize the ventricular rhythm brought about by the af . by controlling the frequency , amplitude , or both the frequency and amplitude with which the energy is delivered to the right ventricle 52 , the ventricular rhythm can be controlled to help maintain a desired ventricular rhythm . thus , according to the present invention , the system 10 combines the avn - vs and on - demand ventricular pacing to help achieve a regular slow ventricular rate in response to af . the system 10 may achieve this purpose while avoiding the use of avn ablation and medication therapy . the description set forth above regarding the process 120 performed by the system 10 is not meant to limit the steps to any sequence or order . for example , while the steps of applying avn - vs ( step 104 ) and on - demand pacing ( step 106 ) appear as being performed in a particular sequence , these steps could be performed in any order or simultaneously . in fact , the steps of monitoring cardiac activity 100 , determining the occurrence of af 102 , applying avn - vs 104 , and applying on - demand pacing 106 may all be performed simultaneously . on - demand ventricular ( vvi ) pacing , when initiated during af , helps eliminate r - r intervals longer than the pacing interval . a progressively increasing pacing rate can also eliminate many of the r - r intervals that are shorter than the pacing interval . when the pacing rate is faster than the average intrinsic ventricular rate during af , it has been found that a regular ventricular rhythm ensues . thus , when the intrinsic ventricular rate is already excessively rapid during af , the required pacing rate would be unacceptably high , rendering the on - demand pacing method impractical for clinical applications . the specific pacing rate required to achieve regularization is thus directly linked to the spontaneous ventricular rate during af . therefore , regularization at a desired rate level could be achieved if the average intrinsic ventricular rate during af is slowed down first . according to the present invention , the application of avn - vs prior to ventricular pacing helps lower the average ventricular rate to a level at which an increase induced by subsequent ventricular pacing remains at an acceptable level . on - demand pacing as a rate regularization tool necessitates relatively short pacing intervals . for example , a significant reduction of irregularity during af can be achieved at a cost of about 2 % to 17 % increase of ventricular rate . however , because the ventricular rate during af frequently is quite rapid without medications , such an increase in the ventricular rate may be undesirable . on - demand pacing could thus be viewed as being somewhat limited due to concerns over elevating the ventricular rate to dangerously high levels . instead of using on - demand ventricular pacing as the ventricular rate slowing mechanism , the present invention utilizes neural control of av transmission during af ( i . e ., avn - vs ) to slow the ventricular rate . avn - vs takes advantage of the rich and selective supply of vagal nerves to the av node , which exert negative dromotropic effect . by modulating the stimulation amplitude applied during avn - vs , one can achieve graded ventricular rate slowing in order to reach an optimal hemodynamic response . this pacing strategy is mechanistically based on suppression of conduction through the avn as a result of collision of anterograde and retrograde wavefronts . to begin with , af itself has been shown to result in random , high - rate bombardment at the avn inputs , resulting in subsequent concealed conduction of multiple impulses . while the precise mechanism of concealment remains undetermined , it certainly depends on the delayed recovery of nodal excitability as reflected in the “ refractory ” theory for ventricular response in af . whether or not associated with decremental conduction , the coexistence of multiple anterograde impulses should result in collision , intranodal block ( s ), and electrotonic events that modulate subsequent propagation . as postulated by the “ interception ” theory and demonstrated in modeling studies , in these conditions retrograde impulses invading the avn are followed by refractoriness with slow recovery of excitability , setting the stage for electrotonic inhibition of anterograde impulses . therefore , it is most likely that ventricular pacing at a rate equal to or above that present during af results in a critical degree of collision / annihilation of retrograde and anterograde impulses in the avn . the major role of the avn - vs would be to further inhibit the propagation through the avn during af . because a reduced number of atrial impulses would successfully traverse the node , a comparatively lower rate vvi pacing would be necessary to counteract them and achieve the effect of “ electrical jam .” thus , avn - vs accentuates the vvi effect by permitting full elimination of anterograde propagation of fibrillatory impulses at substantially lower rates . to determine the efficacy of the systems and methods described herein , experiments were performed on adult canine specimens ( body weight 21 - 30 kg ). the specimens were anesthetized and ventilated with room air supplemented with oxygen as needed to maintain normal arterial blood gases . the left external jugular vein was cannulated , and normal saline was infused at 100 to 200 ml / h to replace spontaneous fluid losses . standard surface ecg leads i , ii , and iii were monitored continuously throughout the entire study . intermittent arterial blood gas measurements were taken , and adjustments of ventilator were made to correct metabolic abnormalities . body temperature was monitored and maintained at 36 to 37 ° c . using an electrical heating pad placed under the specimen and operating room lamps . micromanometer - tipped catheters were inserted through cannulated femoral and carotid arteries and advanced to the thoracic aorta and left ventricle ( lv ), respectively , to record blood pressure and lv pressure . after the chest was opened through a median sternotomy , a cardiac output probe was placed around the aorta and connected to a flow meter to measure aortic flow . custom - made quadripolar plate electrodes were sutured to the high right atrium and right ventricular apex for bipolar pacing and recording . atrial pacing was used to induce af , whereas ventricular vvi pacing was used for rate regularization . a bipolar stimulating electrode was sutured to the epicardial fat pad ( the inferior vena cava - left atrium fat pad ) that contains parasympathetic neural pathways selectively innervating the avn . all signals ( surface ecg , right atrial and right ventricular ecgs , aortic blood pressure , lv pressure , and aortic flow signals ) were properly amplified , filtered , and for purposes of display and recording . avn - vs was delivered to the inferior vena cava - left atrium fat pad by a computer - controlled feedback program to achieve three levels ( targets ) of average ventricular rate slowing . these targets were defined as 75 %, 100 %, and 125 % of the corresponding spontaneous sinus cycle length ( scl ) present before af was induced . the program implemented a classic , proportional - integral - derivative closed - loop process control in delivering the avn - vs . to achieve target ventricular rate levels during af , avn - vs was delivered as short bursts synchronized with the right ventricular electrogram . after each target rate was achieved , vvi pacing was initiated at a rate equal to the achieved target while maintaining delivery of the avn - vs . after surgical preparation and at least 30 minutes of stabilization , scl was determined . af then was induced and maintained by rapid right atrial pacing ( 20 hz , 2 ms ). after at least 15 minutes of stabilization , the ventricular rate was determined on - line by averaging 500 cardiac cycles collected during af . then , while maintaining af , the feedback computer program was initiated to deliver the avn - vs and to slow the average ventricular rate to 1 of 3 target levels : 75 %, 100 %, or 125 % of the corresponding scl . the computerized avn - vs was considered satisfactory when the targets were reached within 5 %. after a given target level was reached and maintained for at least 500 beats , vvi pacing at a cycle length equal to the achieved target was added to the on - going avn - vs and another 500 beats were collected . the order of the three levels of ventricular rate slowing was randomized . a recovery period of 5 minutes was allowed after each target study , although the af was maintained uninterrupted . af produced irregular and rapid ventricular responses that resulted in an average ventricular rate substantially faster than the spontaneous sinus rate . the average r - r during af was 287 ± 36 ms , or 56 % of the scl ( scl = 514 ± 57 ms , n = 8 , p & lt ; 0 . 01 ). avn - vs successfully slowed average ventricular rate to each of the three target levels ( achieved values = 74 %, 99 %, and 123 % of scl , respectively ). fig4 shows an example of r - r interval distribution during af ( beats 1 - 500 ), with average r - r interval of 298 ms ( corresponding to 201 bpm ) and a standard deviation ( sd ) of 70 ms . avn - vs prolonged the r - r intervals ( i . e ., ventricular rate was slowed ). in this case , scl was 510 ms ( corresponding to 118 bpm ), and the target was 100 % scl ( beats 501 - 1000 ). the achieved average r - r interval was 505 ms but with a sd of 141 ms . thus , compared with af , avn - vs reduced the average ventricular rate but not the irregularity . when , in addition to avn - vs , vvi pacing at a cycle length equal to the achieved target level ( i . e ., 505 ms ) was initiated , it not only abolished all r - r intervals longer than the pacing interval but also eliminated all intervals shorter than the pacing interval ( beats 1001 - 1500 ). thus , a regular ventricular rhythm was immediately achieved and maintained . this regularity was just as immediately lost when avn - vs was turned off ( beats 1501 - 2000 ), indicating that avn - vs was a crucially needed component of the complex pacing algorithm used to maintain regular ventricular rate . ecg traces from the same experiment are shown in fig5 a - 5d . fig5 a illustrates recordings during af revealing the irregularity of the right ventricular electrograms ( r - r range 242 - 428 ms in this episode ). fig5 b - 5d illustrate episodes of combined delivery of avn - vs and vvi pacing . in fig5 b , the avn - vs intensity was first titrated to maintain the average ventricular rate during af at a level corresponding to 75 % scl . the concomitant vvi pacing then resulted in constant r - r = 379 ms ( 158 bpm ). fig5 c and 5d illustrate the outcome at 100 % and 125 % scl , respectively . again , progressively slower but strictly regular rhythms ( r - r = 505 ms [ 119 bpm ] and 620 ms [ 97 bpm ], respectively ) were achieved in each case . the computer - controlled intensity of the brief avn - vs bursts increased from 1 . 2 ma in fig5 b to 3 . 5 ma in fig5 d ( where small artifacts produced by the brief avn - vs bursts are indicated on the ecg at 110 ). thus , by combining avn - vs with vvi pacing , regular slow ventricular rhythms were achieved at each of the three target levels . as set forth below , table 1 lists the average r - r intervals and the corresponding standard deviation ( sd ) in each of the eight specimens ( along with the composite data ) during sinus rate , af , after rate slowing by avn - vs alone , and during avn - vs plus vvi pacing . note that although average ventricular rates were successfully controlled by avn - vs alone ( achieved average cycle lengths were within 2 % of the corresponding targets ), the rates still were very irregular , as evidenced by large sd . however , avn - vs plus vvi pacing resulted not only in rate slowing but also in rhythm regularization ( sd = 0 ). fig6 a - 6h illustrate the improved hemodynamic responses realized through the application of the avn - vs plus vvi pacing during af in accordance with the present invention . in fig6 a - 6h , the hemodynamic parameters are shown as measured during sinus rhythm ( sa ), during atrial fibrillation ( af ), and during avn - vs plus vvi pacing at 75 %, 100 %, and 125 % of the sinus cycle length ( scl ). in fig6 a - 6h , plot points that include an asterisk (*) indicate values that are statistically significant over values experienced during af ( i . e ., where p & lt ; 0 . 05 , as determined using post hoc tukey &# 39 ; s honestly significant difference test ). as shown in fig6 a - 6h , during af , the measured hemodynamic parameters were significantly worsened compared to sinus rhythm . regular slow rates achieved by avn - vs plus vvi pacing during af significantly improved all responses , with the exception that diastolic blood pressure ( dsb , see fig6 d ) improved only slightly and without statistical significance . in particular , systolic blood pressure ( sbp , see fig6 c ), lv systolic pressure ( lvsp , see fig6 e ), lv end - diastolic pressure ( lvedp , see fig6 f ), ± dp / dt ( see fig6 g and 6h ), stroke volume ( sv , see fig6 b ), and cardiac output ( co , see fig6 a ) all improved significantly at each of the regular slow rates achieved by avn - vs plus vvi pacing . cardiac output , ± dp / dt , and lv end - diastolic pressure were best improved at a rate target corresponding to 100 % scl . this indicates that slowing the average ventricular rate to the level of the spontaneous sinus rhythm provided optimal overall hemodynamic benefits during af . the experimental data set forth above confirms that , with use of selective neural avn - vs as a first step , subsequent regular vvi pacing at predetermined desired slow rates can be achieved . the slow , regular ventricular rates achieved by avn - vs plus vvi pacing were associated with pronounced hemodynamic benefits that were rate dependent and permitted an optimal tune - up of the pacing protocol . based on the above , it will be appreciated that the system 10 of the present invention , capable of delivering vvi pacing along with avn - vs , could achieve not only rate control but also regularization of the ventricular rhythm . the system 10 of the present invention could , for example , be embodied as a pace maker adapted to provide the on - demand pacing and avn - vs functionality described above . the use of avn - vs in combination with on - demand pacing may be preferable over ablation procedures and drug therapy , or may be used in addition to drug therapy . fig7 illustrates an example configuration of a system 10 a for combining avn - vs with on - demand pacing to achieve a desired ventricular rate with a desired ventricular rhythm in response to af . the system 10 a of the second embodiment of the invention is similar to the system 10 of the first embodiment , except that the avn - vs is administered in a manner that differs from that of the first embodiment . therefore , in fig7 , reference numbers similar to those used to describe the first embodiment will be used to describe like elements , the suffix “ a ” being added to the reference numbers in fig7 to avoid confusion . the system 10 a includes a control unit 20 a , one or more vagal stimulation ( vs ) electrodes 152 , and one or more pacing electrodes 40 a . the vs electrodes 152 are operatively connected with the control unit 20 a via vs leads 150 . the pacing electrodes 40 a are operatively connected with the control unit 20 a via pacing leads 42 a . the control unit 20 a is operative to provide electrical stimulation signals to the vs electrodes 152 and the pacing electrodes 40 a via the leads 150 and 42 a , respectively . the control unit 20 a modulates or controls the frequency , amplitude , duration / pulse - width of the stimulation signals as described herein to achieve the desired ventricular rate and rhythm . the control unit 20 a may also be operative to monitor cardiac activity , such as r waves , via the pacing electrodes 40 a . in fig7 , a patient 50 a is outfitted with the system 10 a of the second embodiment . the pacing electrodes 40 a are delivered and implanted in the right ventricle 52 a of the patient &# 39 ; s heart 54 a via blood vessels in a manner similar or identical to that described above in regard to the first embodiment . according to the second embodiment , vs electrodes 152 are implanted or otherwise positioned for stimulating left vagus nerves 154 of the patient 50 a . in the embodiment of fig7 , the left vagus nerves 154 are cervical vagus nerves accessed through the patient &# 39 ; s neck 156 via means , such as a catheterization or surgical procedure . the control unit 20 a may monitor electrical cardiac activity , such as r - r intervals , via the pacing electrodes 30 a , in a manner similar or identical to that described above in regard to the first embodiment . this allows the system 10 a to monitor the rate or rhythm of the heart 54 a and detect the occurrence of atrial fibrillation . the system 10 a thus may be an active or “ on - demand ” system in which ventricular rate and rhythm control is applied in response to detection to an af episode . in operation , the system 10 a of the second embodiment operates in a manner similar or identical to that of the first embodiment as described above , with the exception that avn - vs signals are delivered to the left cervical vagus nerve 154 as opposed to the av nodal fat pad . the functional block diagram of fig3 thus depicts a process performed by the system 10 a of fig7 . more specifically , as shown in fig3 , the system 10 a monitors electrical cardiac activity for the occurrence of atrial fibrillation . upon detecting an af episode , avn - vs is applied to reduce the ventricular rate and ventricular ( vvi ) pacing is applied to help maintain a desired ventricular rhythm . thus , according to the second embodiment of the present invention , the system 10 a combines the avn - vs and on - demand ventricular pacing to help achieve a regular slow ventricular rate in response to af . fig8 illustrates an example configuration of a system 10 b for combining avn - vs with on - demand pacing to achieve a desired ventricular rate with a desired ventricular rhythm in response to af . the system 10 b of the third embodiment of the invention is similar to the systems 10 and 10 a of the first and second embodiments , except that avn - vs is administered in a manner that differs from those of the first and second embodiments . therefore , in fig8 , reference numbers similar to those used to describe the first and second embodiments will be used to describe like elements , the suffix “ b ” being added to the reference numbers in fig8 to avoid confusion . the system 10 b includes a control unit 20 b , one or more vagal stimulation ( vs ) electrodes 172 , and one or more pacing electrodes 40 b . the vs electrodes 172 are operatively connected with the control unit 20 b via vs leads 170 . the pacing electrodes 40 b are operatively connected with the control unit 20 b via pacing leads 42 b . the control unit 20 b is operative to provide electrical stimulation signals to the vs electrodes 172 and the pacing electrodes 40 b via the leads 170 and 42 b , respectively . the control unit 20 b modulates or controls the frequency , amplitude , duration / pulse - width of the stimulation signals as described herein to achieve the desired ventricular rate and rhythm . the control unit 20 b may also be operative to monitor cardiac activity , such as r waves , via the pacing electrodes 40 b . in fig8 , a patient 50 b is outfitted with the system 10 b of the third embodiment . the pacing electrodes 40 b are delivered and implanted in the right ventricle 52 b of the patient &# 39 ; s heart 54 b via blood vessels in a manner similar or identical to that described above in regard to the first embodiment . according to the second embodiment , vs electrodes 172 are implanted or otherwise positioned for stimulating vagal nerve fibers indirectly via various endocardial structures . the embodiment of fig8 illustrates various different alternative locations for endocardial placement of the vs electrodes 172 . one location for endocardial placement of the vs electrodes 172 is the av node 180 . with this placement , the vs electrodes 172 apply post - ganglionic vagal stimulation to the av node 180 directly . another location for endocardial placement of the vs electrodes 172 is on the inside surface of the atrial wall as identified at 182 in fig8 . with this placement , the lead tip of the vs electrodes 172 will be in relatively close proximity to the avn fat pad . other locations for endocardial placement of the vs electrodes 172 include the interior wall of the superior vena cava 184 , coronary sinus 186 , or right pulmonary artery 188 . the control unit 20 b may monitor electrical cardiac activity , such as r - r intervals , via the pacing electrodes 30 b in a manner similar or identical to that described above in regard to the first embodiment . this allows the system 10 b to monitor the rate or rhythm of the heart 54 b and detect the occurrence of atrial fibrillation . the system 10 b thus may be an active or “ on - demand ” system in which ventricular rate and rhythm control is applied in response to detection to an af episode . in operation , the system 10 b of the third embodiment operates in a manner similar or identical to those of the first and second embodiments as described above , with the exception that avn - vs signals are delivered to one or more of the endocardial locations set forth above , i . e ., the av node 180 , atrial wall 182 , superior vena cava 184 , coronary sinus 186 , or right pulmonary artery 188 . the functional block diagram of fig3 thus depicts a process performed by the system 10 b of fig8 . more specifically , as shown in fig3 , the system 10 b monitors electrical cardiac activity for the occurrence of atrial fibrillation . upon detecting an af episode , avn - vs is applied to reduce the ventricular rate and ventricular ( vvi ) pacing is applied to help maintain a desired ventricular rhythm . thus , according to the third embodiment of the present invention , the system 10 b combines the avn - vs and on - demand ventricular pacing to help achieve a regular slow ventricular rate in response to af . from the above description of the invention , those skilled in the art will perceive improvements , changes and modifications . such improvements , changes and modifications within the skill of the art are intended to be covered by the appended claims .

a system for achieving a desired cardiac rate and cardiac rhythm in response to atrial fibrillation in a heart includes an atrial fibrillation detector for detecting af . the system also includes an atrioventricular node vagal stimulator for stimulating vagal nerves associated with an atrioventricular node of the heart . the system further includes an on - demand pace maker for providing ventricular pacing stimulation to the heart . a control unit is operatively connected with the af detection device , the avn - vs device , and the on - demand pacing device . the control unit is responsive to af detection by the af detector to cause the avn - vs to stimulate the vagal nerves to help reduce the ventricular rate of the heart . the control unit is further responsive to af detection by the af detector to cause the on - demand pace maker to help regulate the ventricular rate of the heart .

the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . the present invention is a device comprising a solid or hollow cylindrical member that is capable , upon rotation of the cylindrical member , of snagging , pulling or entangling the hair trapped within the bristles of a hairbrush . in some embodiments , the device consists substantially of the solid or hollow cylindrical member . fig1 shows various embodiments of the device of the invention . in one embodiment , the device of the invention comprises at least one hook 11 or projection 10 attached to the cylindrical member that is capable of entangling at least one hair within the hairbrush . once the first hair becomes entangled , the continuing rotation of the cylindrical member will cause such hair to become wrapped around the member , further entangling additional hairs . thus , for example , the hook 11 , which may be perpendicular or co - linear with the longitudinal axis of the cylindrical member , serves as an initial hooking mechanism to entangle the hair of the hairbrush . in a particular embodiment , the cylindrical member of the device of the invention is a straight , long , thin shaft with a hook at its end , as shown in device 3 . in another particular embodiment the cylindrical member is a long , thin shaft comprising one or more bends , kinks or twists along its length ( for example , device 4 ), and such bends , kinks , or twists serve as the initial hooking mechanism . in a particular embodiment , the cylindrical member has a spiral or corkscrew shape . in another embodiment , the cylindrical member of the device itself has a plurality of knobs , ridges or rises 9 on its surface that can act to help entangle hair ( for example , device 1 , shown in cross - section ). in one embodiment , the present invention comprises a solid or hollow cylindrical member with its circumferential surface partially or fully covered by a plurality of projections 10 ( e . g ., bristles , hooks , spikes , prongs ), the projections capable , upon rotation of the cylindrical member , of snagging , pulling or entangling the hair trapped within the bristles of a hairbrush . once the first hair becomes entangled , the continuing rotation of the cylindrical member will cause such hair to become wrapped around the device , further entangling additional hairs . for example , in fig1 , such embodiments include devices 2 , 6 , and 7 . in one embodiment , the entire circumferential surface of the cylindrical member of the device of the invention is covered by such projections ( as in device 6 ). in another embodiment , the present invention comprises a solid or hollow cylindrical member with its circumferential surface partially or fully covered with an adhesive material or an abrasive material ( for example , device 8 ). such adhesive material would be capable of snagging and entangling hairs from a hairbrush by virtue of its stickiness , while such abrasive material ( e . g ., sandpaper - like ) would be capable of snagging and entangling hairs by virtue of its roughness ( high coefficient of friction ). in another embodiment , some terminal portion of the cylindrical member of the device of the invention ( e . g ., the terminal 10 mm of the cylindrical member ) is free of projections , enabling the user to grasp the cylindrical member without encountering the bristles . for example , in devices 7 and 8 , the region 14 is free of projections or adhesive / abrasive material . the device of the invention may consist of one or more component parts connected together in a way as to form the entire device of the invention . for example , the cylindrical member of the device of the invention may consist of a solid or hollow cylindrical core to which the surface covered with a plurality of projections is attached by an adhesive mechanism . in a preferred embodiment , the device of the invention is sized such that it can conveniently be inserted along its longitudinal axis into the space between the bristles of a hairbrush . for example , the cylindrical member of the device of the invention may have an external diameter , including any surface projections , of from 0 . 25 mm to 15 mm , preferably from about 1 mm to 15 mm , more preferably from about 3 mm to about 12 mm , more preferably from about 4 mm to about 10 mm , still more preferably from about 5 mm to about 10 mm , and most preferably from about 6 mm to about 8 mm ; and a length of from about 5 mm to about 200 mm , preferably from about 5 mm to about 100 mm , more preferably from about 5 mm to about 50 mm , more preferably from about 10 mm to about 40 mm , and most preferably from about 20 mm to about 40 mm . in a particular embodiment , wherein the cylindrical member of the device of the invention consists essentially of a long , thin shaft , optionally containing a hook at one end , wherein the shaft is optionally straight , kinked , twisted , spiral or contains one or more bends , the device of the invention has a diameter of the shaft of about 0 . 25 to 2 mm , preferably 0 . 5 to 1 mm , and a length of 20 to 200 mm , preferably 40 to 100 mm , still more preferably 50 to 75 mm . where such device contains a hook at one end , said hook extends radially to a distance of 0 . 1 to 10 mm , preferably 0 . 2 to 5 mm , and more preferably 0 . 4 to 3 mm . the device of the invention may be made of any suitable material , including but not limited to , one or more of : metal ( e . g . aluminum , titanium , iron , copper , tin , silver , nickel , or any mixtures or alloys thereof ), synthetic polymers or plastics ( e . g ., polyethylene , polypropylene , polystyrene , polyvinyl chloride , polyacrylonitrile , nylon ), and natural polymers ( e . g ., cellulose ). synthetic polymers can include straight - chain or branched polymers , high - or low - density polymers , semi - synthetic polymers , and polymers comprised of different monomeric units ( e . g ., copolymers ). any such polymers may comprise additional chemical additives such as what are known to those skilled in the art , including but not limited to , plasticizers , dyes , anti - oxidants , and coatings . natural and semi - synthetic polymers may have the added benefit of being biodegradable . in a preferred embodiment , the device of the invention is made of polyethylene or polypropylene . the device of the invention may also be made of more than one material , consisting as it may of components attached to each other by means known to those skilled in the art , such as by the use of adhesive materials . in such embodiments , the different materials may be chosen for their different properties . for example , a cylindrical core may be constructed of a material with high strength and little or no flexibility , while an outer layer containing any hooks or projections or adhesive or abrasive may be constructed of a material with higher flexibility and less strength . in a preferred embodiment , at one end the cylindrical member of the device of the invention is fitted with a structure capable of attachment to a means for rotation . such means for rotation may be , for example , a shaft attached to a handle ( e . g ., a screwdriver - type handle 15 ), whereby a user could grasp said handle and thereby insert the device of the invention between the bristles of the hairbrush , and upon manual rotation of the handle , the device of the invention will snag , pull or entangle the hair trapped in the hairbrush , enabling removal of said hair . preferably , where the cylindrical member of the device of the invention contains a terminal portion free of bristles , said structure is located at the end of the cylindrical member that is free of bristles , in order to allow easier grasping of the device of the invention while attaching it to the means for rotation . the mechanism by which the device of the invention attaches to the means for rotation can be any of those commonly found in the mechanical arts including , but not limited to , couplings ( e . g ., shaft couplings , sleeve couplings ), screw - and - thread fittings , male and female tapered fittings ( e . g ., slip tip ), tongue - in - groove fittings , or slotted fittings . in some embodiments , the device of the invention attaches to the means for rotation in like manner to a slotted , phillips head , square - head or hex - head or other screwdriver attaching to the corresponding screw . as shown in fig2 , in some embodiments , the device of the invention 18 is attached to an adaptor 17 , and the adaptor is attached to the means for rotation ( e . g ., a means for rotation such as 16 ). in another embodiment , the means for rotation is a hand - powered means for rotation , such as a bow drill , a hand drill , a push drill or other drill using a spiral ratchet mechanism . in some embodiments , the means for rotation operates by a mechanism in which the user creates non - rotational motion that the means for rotation converts to rotational motion at the point of attachment of the adaptor , if there be one , or the device of the invention . in another embodiment , the means for rotation is an electrically - powered means for rotation , such as a battery - powered or ac - powered drill ( as depicted in fig2 , 16 ) or drill - like device ( e . g ., a powered screwdriver ). in some embodiments , the device of the invention may require an adapter in order to be attached to a hand - powered or electrically - powered means for rotation . for example , in order to use any drill with a chuck , e . g . the standard 3 - jaw chuck , the device of the invention would be attached using an adapter which at one end secures the device of invention , and at the other end consists of a metal or plastic shank of hexagonal cross - section . in some embodiments , the device of the invention may be used with a universal adapter , i . e ., one that can allow attachment of the device of the invention to a variety of means for rotation . by separating the means for rotation ( e . g ., 16 ) from the device of the invention ( e . g ., 18 ), the great benefit is achieved that the device of the invention itself is small , cheap and disposable . a consumer can expend one device with each cleaning of a hairbrush , while retaining for future use whatever means for rotation is chosen ( whether it be manual or powered ). in addition , the consumer has the flexibility to change the means of rotation used without having to acquire new or different devices of the invention . in certain embodiments of the invention , the device of the invention is sold to a consumer packaged along with a manual handle - type means for rotation , and / or along with one or more adapters capable of attaching the device of the invention to various hand - powered or electrically - powered means for rotation . in some embodiments , the device of the invention may be used to remove human hair or animal hair from hair brushes , e . g ., dog , cat or horse hair from grooming brushes , as shown in fig3 . in other embodiments , the device of the invention may be used to remove natural or synthetic hair - like substances from brush - like devices , for example , devices that accumulate natural or synthetic fibers during the course of manufacture of said fibers or manufacture of products ( e . g ., clothing ) containing such fibers . in another aspect , the present invention includes a method of removing hair from a hairbrush that comprises inserting into a brush for grooming of hair ( e . g ., a hairbrush , 19 ) a device ( for example , a device of the invention 20 ) comprising a rotating part that is capable , upon rotation of such part , of snagging , pulling or entangling the hair that is trapped within the brush , and causing said part of the device to rotate . this method is demonstrated in fig4 , wherein the device is a device of the invention 20 . such a method may comprise the steps of : attaching said device 20 to a means for rotation , inserting the device into a brush 19 for grooming hair , causing the cylindrical member of the device to rotate , thus entangling and removing the hair 21 that is trapped within the bristles 22 of the hair brush , then causing the cylindrical member to stop rotating , and removing the device from the hairbrush . as shown in fig4 , the result is that the hair removed from the hairbrush 23 is now wrapped around the cylindrical member of the device 24 . the method may further comprise the steps of separating the device from the means for rotation , and then , optionally , either cleaning the trapped hair off of the device or discarding the device . preferably , a user may move the cylindrical member of the device about within the hairbrush while causing it to rotate , thus ensuring that most or all of the hair trapped in the hairbrush becomes entangled on the device and removed . a user may also reverse the order of some of the steps described above . for example , the method may be practiced by first causing the cylindrical member to start rotating , and then inserting the device into a brush for grooming hair . similarly , the method may be practiced by removing the device from the brush and then causing the cylindrical member to stop rotating . in a particular embodiment , the device used in the above described method , in any of its embodiments , is a device of the present invention . in all embodiments of the present invention , the cylindrical member of the device of the invention undergoes active rotation in its operation at the direction of the user , rather than passive rotation , as would occur if a freely rotatable cylindrical device were to be brushed across the surface of a hairbrush . as used herein , the term “ circumferential surface ” of a cylinder refers to the outward facing surface along the long axis of the cylinder , that surface which is distinct from the two circular surfaces that form the ends of the cylinder . as used herein , “ cylinder ” and “ cylindrical ” include the traditional right circular cylinder , as well as variations of such , including tapered cylinders in which the two circles that form the opposite ends of the cylinder are of different radii , and shapes substantially resembling cones , as by progressively shrinking the radius of one end of a cylinder . in addition , “ cylinder ” and “ cylindrical ” also embrace shapes substantially similar to cylinders whose cross - section is an ellipse , a triangle , or square , a rectangle , a pentagon , a hexagon , or any other regular or irregular polygon . in addition , “ cylinder ” embraces the shapes described above across the entire range of length - to - diameter ratios that can be envisioned , from those that are very short and wide ( e . g ., with a length - to - diameter ratio of about 1 or less ), to those that are very long and thin ( e . g ., with a length - to - diameter ratio of greater than 1 , or greater than 5 , or greater than 10 , or greater than 50 , or greater than 100 , or greater than 1000 ). as used herein , the term “ diameter ” refers to the largest cross - sectional diameter . for a radially symmetrical cross - section ( e . g ., a circle ), there is only one such diameter . for a non - radially symmetrical cross - section ( e . g ., an ellipse or a regular polygon ), there is more than one such diameter , and the term “ diameter ” as used herein is to refer to the largest of such diameters . for example , for an elliptical cross - section , the diameter thereof , as used herein , is the major axis ( or transverse diameter ), while for a hexagonal cross - section , the diameter thereof , as used herein , is the distance between opposite vertices . as used herein , “ rotation ” refers to axial rotation . as applied to , for example , the cylindrical member of the device of the invention , axial rotation refers to rotation about the long axis of the member . rotation may refer to continuous or intermittent rotation , and may refer to clockwise or counterclockwise rotation , or a combination thereof . for example , the means for rotation may cause the cylindrical member of the device of the rotation to rotate in a certain sequence ( e . g ., two rotations clockwise then one rotation counterclockwise , repeating ; or any other sequence ). as used throughout , ranges are used as shorthand for describing each and every value that is within the range . any value within the range can be selected as the terminus of the range . in addition , all references cited herein are hereby incorporated by referenced in their entireties . in the event of a conflict in a definition in the present disclosure and that of a cited reference , the present disclosure controls .

the present invention provides an improved device for the removal of hair from hairbrushes . in a particular embodiment , the device of the invention itself is both cheap , transportable and disposable .

in accordance with the present invention , there is provided therapeutic compositions comprising krill extract and conjugated linoleic acid for the prevention and / or treatment and / or therapy of diseases . a variety of treatments and compositions are possible pursuant to the present invention . the compositions can also be used prophylactically to prevent the onset of diseases as well as to maintain a healthy individual . it is believed that there are synergistic effects achieved by combining conjugated linoleic acid and krill oil extract in a single composition or treatment . these benefits are derived from the two oils that have different compositions but produce enhanced or synergistic benefits through shared eicosanoid mechanisms . these mechanisms include changing membrane composition through phospholipid incorporation , longer chain fatty acid incorporation and conjugated linoleic acid incorporation . in addition to these synergistic shared mechanisms the ability of conjugated linoleic acid to activate peroxisome peroxidation activation receptors ( ppar ), which are thought to be involved with glucose and lipid metabolism as well as adipocyte apoptosis produces a synergistic effect . these combined oils are believed to be beneficial in indications , applications and compositions listed below . various combinations of the oils can be used . the oils can be topically applied or , parenterally and / or orally delivered . by way of example , a daily dosage can provide as little as 1 mg of the oils or as much as 15 g of the oils ; in an embodiment , between 100 mg to 12 g of oil is provided daily . efficacious doses will depend on the condition being addressed . by way of example , combinations of either oil can be used in a 1 : 1 ratio or a ratio of 0 . 05 : 1 to 1 : 0 . 05 . these oils can be combined with other organic or inorganic compounds known to further enhance the conditions being addressed . with respect to the krill extract , a multi - therapeutic oil extract free of enzyme is derived from krill and / or marine , found in any marine environment around the world , for example , the antarctic ocean ( euphasia superba ), the pacific ocean ( euphasia pacifica ), the atlantic ocean , the indian ocean , in particular coastal regions of mauritius island and / or reunion island of madagascar , canadian west coast , japanese coast , st - lawrence gulf and fundy bay , and this oil extract is a free fatty acid lipid fraction . ( a ) placing marine and / or aquatic krill and / or marine in a ketone solvent , preferably acetone , to achieve the extraction of grease from the krill and / or marine ; ( c ) recovering a lipid rich fraction from the liquid phase obtained at step ( b ) by evaporation of the solvent present in the liquid phase ; ( d ) placing the solid phase in an organic solvent , which can be alcohol , preferably ethanol , isopropanol or t - butanol , or esters of acetic acid , preferably ethyl acetate . this in order to extract the remaining soluble lipid fraction from the solid phase ; ( f ) recovering a lipid rich fraction from the liquid phase obtained at step ( e ) by evaporation of the solvent present in the liquid phase . as set forth in pct application no . pct / ca02 / 00843 , the active components of the enzyme - free krill and / or marine oil extract are : the pct application states that in the preferred embodiment , the omega - 3 fatty acids are found in more than 30 g / 100 g as set forth in the pct application , the neutral lipids of the krill and / or marine extract also comprises : the pct application states in another embodiment , the krill and / or marine extract also comprises : the pct application sets forth that after characterization of the krill and / or marine oil extract , it was determined that the extract contains less than 25 ppm of solvent residue from the extraction process . pursuant to the present invention , the method and composition comprises administering krill extract and conjugated linoleic acid . if desired , the composition can include non - active ingredients and / or agents such as flavors , artificial sweeteners , excipients , etc . the product of the present invention is intended to provide a physiologically based means to aid in maintaining normal physiological homeostasis . conjugated linoleic acid refers to a group of dienoic derivatives of linoleic acid that occur naturally in milk and meat of ruminating animals . it can be synthesized in the laboratory and in commercial scale and is currently available commercially as a dietary supplement . conjugated linoleic acid is believed to be absorbed efficiently into the body in a manner similar to that of other fatty acids , e . g ., linoleic acid . the safety of conjugated linoleic acid has been demonstrated in detailed toxicological assessments and through extensive use in humans , both as a naturally occurring substance and as a dietary supplement . it is believed that conjugated linoleic acid is safe for human consumption . pursuant to the present invention , the conjugated linoleic acid can be conjugated linoleic acid such as that set forth in u . s . pat . no . 5 , 986 , 116 the disclosure of which is incorporated herein by reference . in an embodiment , the conjugated linoleic acid is either a pure isomer of octadecadienoic acid , or a mixture of octadecadienoic acid isomers selected from the group consisting of : cis - 8 , cis - 10 ; cis - 8 , trans - 10 ; trans - 8 , cis - 10 ; trans - 8 , trans - 10 ; cis - 9 , cis - 11 ; cis - 9 , trans - 11 ; trans - 9 , cis - 11 ; trans - 9 , trans - 11 ; cis - 10 , cis - 12 ; cis - 9 , trans - 12 ; trans - 9 , cis - 12 ; trans - 10 , trans - 12 ; cis - 11 , cis - 13 ; cis - 11 , trans - 13 ; trans - 11 , cis - 13 ; trans - 11 , trans - 13 octadecadienoic acid ; metabolites thereof , including but not limited to 18 : 3 cis - 6 , cis - 9 , trans - 11 ; 18 : 3 cis - 6 , trans - 10 , cis - 12 ; 18 : 3 cis - 8 , trans - 12 , cis - 14 ; 20 : 3 cis - 8 , cis - 11 , trans - 13 ; 20 : 4 cis - 5 , cis - 8 , cis - 11 , trans - 13 ; 20 : 4 cis - 5 , cis - 8 , trans - 12 , cis - 14 ; as well as precursors or derivatives thereof . pursuant to the present invention , the composition can be taken as a dietary supplement or a pharmacological product . by way of example and not limitation , contemplative examples of indications / applications that can be treated benefit from the present invention are as follows : anti - inflammatory reactions : both conjugated linoleic acid and krill oil reduce the adverse effects that occur when the eicosanoid pathway through cox - 1 and cox - 2 enzymatic reactions leading to prostaglandin synthesis , such as pge - 2 , pge - 1 , leukotrienes and thromboxanes , are extended beyond normal , physiological needs from those signals initially produced by stress or injury . the continuation of eicosanoid production leads to chronic inflammation as indicated in osteoarthritis , joint pain , cartilage breakdown , increased adipose deposition , bone breakdown . in addition , involvement of those eicosanoids ( proinflammatory ) known to increase platelet aggregation and eventual plaque formation when endothelial injury has occurred — all involved with cardiovascular disease . the most probable cause of the physical symptoms of pms seems to be the combined interaction of hormones and essential nutrients leading to an increased inflammatory response . the emotional symptoms of pms seem to be propagated by an exaggerated response of neurotransmitters to psychosocial stresses . reducing arachidonic incorporation or its release from phospholipids ( sn - 2 position ) decreases formation of prostaglandin e2 which when elevated continues inflammatory response . by increasing the ratio of omega - 3 fatty acids to omega - 6 ( as in the case of krill oil ): and by reducing the synthesis of arachidonic acid ( by decreasing linoleic acid , its precursor ) ( both conjugated linoleic acid and krill oil accomplish this by two different mechanisms ) will lead to reduced inflammatory responses . metabolic syndrome encompasses specific abnormalities such as elevated plasma tg &# 39 ; s , low levels of hdl , increased blood pressure , fasting glucose and increased abdominal adipose tissue . having three or more of these conditions constitutes syndrome x . conjugated linoleic acid decreases elevated glucose levels , decrease elevated tg levels and decrease high blood pressure . krill oil lowers elevated glucose and reduce plasma cholesterol , tg and simultaneously elevate hdl levels . the combination of these two oils should have a positive impact on those specific parameters involved with this syndrome . conjugated linoleic acid reduces fat accumulation in humans by decreasing lipoprotein lipase ( lpl ) synthesis , hormone lipase synthesis , decrease adipose cell number by apopotosis at early cell development , and increase fat as a fuel source ( beta - oxidation ). in addition , conjugated linoleic acid increases muscle mass ( lbm ) even under catabolic conditions such as calorie reduction via weight loss . krill increases energy level , feelings of wellness and energy levels , skin , hair and nails improvement , which combined with fat loss will give physical and emotional benefits in those using these oils . cardiovascular health can be improved via the present invention due to the ability of the compositions to achieve the following : increasing elasticity of endothelial lining and reducing platelet aggregation precursors ( anti - inflammatory response ) ( conjugated linoleic acid and krill oil ) reducing the chronic stress catabolic response and inflammatory response by intake of both conjugated linoleic acid and krill oil should dramatically favor an environment of bone synthesis and reduce bone degradation . the omega - 3 present in krill oil improves the ability of conjugated linoleic acid to increase bone mineral content possibly by conjugated linoleic acid &# 39 ; s ability to decrease inflammatory prostaglandins . krill oil also contains other compounds such as antioxidants and flavonoids that would likely improve the micro - environment surrounding bone cells and joints . conjugated linoleic acid increases antibody response to viral invasion . combined with the antioxidants , omega - 3 , vitamin and mineral profile and phospholipids present in krill oil , enhancing macrophage ability to respond to immune challenge . conjugated linoleic acid decreases elevated glucose and increase insulin sensitivity . krill oil decreases elevated glucose ; combining these oils will strengthen their ability to promote glucose utilization and favor a healthier glucose plasma level . conjugated linoleic acid is a naturally occurring anticarcinogen . krill oil protects against free radical damage from sunlight and environmental toxins . both oils will have a favorable impact in reducing risk of cancer , especially those cancers induced by free radical damage . significant improvement in female mood swings occur prior and during menstruation . this suggests that there will likely be overall benefit in reducing hormonal changes that naturally occur during each month by increasing the omega - 3 portion of triglycerides and phospholipids that are part of brain cells . increasing membrane fluidity by increasing long chain fatty acids ( omega - 3 ) enhances the ability of protein receptors to respond to substrate interaction and therefore , should be improved general cell health by the addition of krill oil and conjugated linoleic acid . in addition , cell membrane composition will be improved by the naturally occurring phospholipids existing in krill oil . the unique chemical composition appears to allow the molecule to be absorbed quickly and is easily incorporated into cell membranes , which could explain the neurological and hormonal aspects of the observed benefits seen in women taking this product . the existence of these unique phospholipids with a phosphate group in sn - 2 position , allows greater effects of conjugated linoleic acid to act as a cox - 2 inhibitor since the conjugated linoleic acid molecule would not have to be released by phospho lipases within the cell , thus more conjugated linoleic acid will exist in the free form and more should be available for either ppar activation or further synthesis of conjugated linoleic acid elongated and desaturated products . therefore , the combination of the two oils will have an enhanced and perhaps synergistic responses in reducing the ill effects of inflammatory eicosanoids , as well as increasing the fluidity of cell membranes . subjective data from clinical study supports the overall feelings of increased mental focus , more energy , less fatigue and less mood swings . the anti - inflammatory response of both conjugated linoleic acid and krill oil will reduce stress catabolic response ( hormonally induced reaction to stressors in life ) and will enhance the bodies ability to maintain homeostasis . krill oil improves women &# 39 ; s perception of healthier skin , hair and nails , which is likely do to the improved ratio of omega - 3 to omega - 6 fatty acids in addition to the antioxidant properties of vitamin a and vitamin b , flavonoids and astathanxine . conjugated linoleic acid may also help these factors by displacing arachidonic acid and allowing more omega - 3 to compete with cox enzymes and increase odd numbered eicosanoids . aging and many chronic diseases in humans is related indirectly if not directly to the ability of cells to reduce chronic inflammatory responses . thus , conditions such as asthma , rheumatoid arthritis , allergies , etc . could all possibly be improved by reducing the eicosanoids responsible for the continuation of inflammation and the cytokines involved in perpetuating those chronic disorders . both conjugated linoleic acid and krill oil are shown to reduce these inflammatory compounds . conjugated linoleic acid behaves as a weak antioxidant . krill oil is a potent anti - oxidant . thus , both oils will have a beneficial impact in cell &# 39 ; s ability to reduce free - radical damage associated with cell death , aging , neurological damage , and cardiovascular disease by specific reduction in ldl oxidation . it should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art . such changes and modifications can be made without departing from the spirit and scope of the present invention and without diminishing its intended advantages . it is therefore intended that such changes and modifications be covered by the claims .

methods and compositions for the prevention , therapy and / or treatment of several disease states . the methods comprise the administration of a therapeutically effective amount of a composition including krill extract and conjugated linoleic acid . in addition , the present invention provides new and improved therapeutic compositions including krill extracts and conjugated linoleic acid .