Split (1)

train · 999 rows

prompt stringlengths 455 74.5k
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: A federal court says a Florida law that restricts the number of early-voting days could result in a dramatic reduction in voting by blacks. When Florida’s Republican controlled Legislature passed a sweeping new elections law last year, the changes couldn’t go into effect in five of Florida’s counties because of a history of voter discrimination. Critics argue the changes not only suppress minority voters but it's causing a lot of confusion. “Yeah, yeah, I hear it all the time at the beauty shop and other places, because they want to know why,” said Democratic State Senator Arthenia Joyner whose district covers both rules. The U.S. District Court ruled the law which reduces the number of early voting days from 12 to 8, would disproportionately impact African-Americans who typically vote early. “It’s clearly targeting minorities which is why we have and why congress renewed and why we continue to need the voting rights act to prevent state government from interfering with the constitutional rights of minorities,” said Baylor Johnson with the ACLU of Florida who contents it's a common tactic around the country. The ruling means the state could be dealing with two different types of early voting rules for this year’s presidential election.But the ruling did say there were ways the state could come up with a plan to change early voting that would not adversely impact minority voting rights. By Ethan Magoc News21 African-American civic groups, politicians and church leaders are concerned that changes in Florida’s early voting schedule will lower minority turnout, which could mean fewer votes for Democrats in November. Florida’s early, in-person voting period almost certainly will shrink this fall. Since 2004, when the state began early voting, county election officials had to provide a minimum of 14 voting days, or 96 hours, of early voting opportunities, including limited weekend hours. Under a law passed in 2011, counties can still offer 96 hours of early voting, but those hours cannot be spread over more than the state-required eight days. About This Project “Who Can Vote?” was produced by News21, a national investigative reporting project involving college journalism students across the country and headquartered at the Walter Cronkite School of Journalism and Mass Communication at Arizona State University. News21 is funded by the Carnegie Corporation of New York and the John S. and James L. Knight Foundation. Review the complete Voting Rights in America project. Related Read other stories in the “Who Can Vote?” series. The 2011 law also eliminated voting on the Sunday before the election, which was offered by 10 of the state’s 67 counties in 2008. African-American churches traditionally reserved that day for “Souls to the Polls” campaigns, in which voters went from churches to early-voting sites. “We do believe it’s a deliberate attempt to disenfranchise the voters,” said state Rep. Barbara Watson, a Democrat from Miami Gardens, concerned about the law’s effect on turnout in large counties such as Miami-Dade. Rep. Dennis Baxley, a Republican from Ocala who sponsored the legislative change, said that eliminating Sunday hours was about timing. “It seems like we had too tight a squeeze (before Election Day on Tuesday),” he said. “You had to count the early votes and be all set up in the counties for a general election in two days. What’s the big deal? It’s just a scheduling issue.” President Barack Obama won 96 percent of Florida’s black vote in 2008. African Americans that year cast 22 percent of the state’s early in-person votes, although they were only 13 percent of registered voters, according to an analysis by Daniel Smith, a University of Florida political science professor, and Michael Herron of Dartmouth. Democratic turnout for early and absentee voting in Florida increased 5 percent from 2004 to 2008, while Republican early votes dropped 6 percent, according to data compiled by Michael McDonald, a political scientist at George Mason University. “What we have to do is act like that old Florida chameleon that changes colors,” said Elder Lee Harris, 68, pastor of Mount Olive Primitive Baptist Church in Jacksonville. “We have to adapt to whatever our environment is.” Harris said his church and its 300-member congregation joined another 60 churches to encourage Sunday voting the weekend before the 2008 presidential election. He said the group will organize on one of the other weekend days this year. State Sen. Chris Smith, a Democrat who represents Broward and Palm Beach counties, is encouraging churches in his district to hold services on Saturdays during early voting. Voters like Anita Smith, 38, of Gainesville, enjoy the convenience of voting early. “I didn’t want to be in the long lines,” said Smith, who voted early in the 2008 primary and general elections. “I went early and got it out of the way.” In Palm Beach County, Supervisor of Elections Susan Bucher wants to keep turnout near 2008 early-voting levels. She plans to open two additional early voting sites, which she said will cost $52,000 for voting machines and salaries. Rodney Long, a retired Democratic politician in northern Florida’s Alachua County, said his group, the African American Accountability Alliance, will organize church and political leaders for early voting. “If you tell me that there’s a problem with that Sunday, there should be some evidence. There’s 67 people in Florida who could provide it. (Lawmakers) did not receive any testimony from the 67 county officials about Sunday processing. Everyone’s voting electronically – no more chads, no delays,” Long said. Andrea Rumbaugh of News21 contributed to this story. This report is part of a project on voting rights in America produced by the Carnegie-Knight News21 program. SUMMARY: [/INST] A federal court yesterday ruled that a new Florida law restricting early voting would not be implemented in the five historically black districts covered by the Voting Rights Act of 1965. Section 5 of the Act allows the government to review election laws in places with a history of racial discrimination. The three-judge panel ruled that the change "would make it materially more difficult for some minority voters to cast a ballot," the AP reports. Minorities have a habit of voting early in Florida. The law, passed by Florida's Republican legislature last year, cut the early voting window from 12 days to eight, and specifically banned voting on the Sunday before the election, which happens to be when black churches usually hold "Souls to the Polls" events, the Florida Center for Investigative Reporting explains. "It's clearly targeting minorities," an ACLU official tells WFSU. But the court did say it would be possible to change early voting in a non-discriminatory way. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: WASHINGTON (AP) — U.S. officials say the only American soldier held prisoner in Afghanistan has been freed and is in U.S. custody. The officials say Sgt. Bowe Bergdahl's (boh BURG'-dahl) release was part of a negotiation that includes the release of five Afghan detainees held in the U.S. prison at Guantanamo Bay, Cuba. The negotiation between the U.S. and the Taliban was mediated by the government of Qatar. The 28-year-old Berghdal had been held by the Taliban since June 30, 2009. The officials say he is in good condition and able to walk. The officials insisted on anonymity in order to describe the details on Bergdahl's release. Taliban fighters released the sole remaining American military hostage Saturday morning to a team of U.S. troops in eastern Afghanistan, who quickly hustled him onto a helicopter. Once airborne, Sgt. Bowe Bergdahl scribbled the letters “SF?” on a paper plate, seeking confirmation that he was with Special Operations forces. “Yes!” one of the troops hollered back above the din of the aircraft’s blades, according to a defense official who described Bergdahl’s first moments of freedom. “We’ve been looking for you for a long time.” Bergdahl, 28, who had been held captive nearly five years, broke down in tears. His release was secured after the Obama administration, working through Qatari government intermediaries, agreed to free five high-profile Afghan inmates held by the U.S. military in Guantanamo Bay, Cuba. The influential commanders, including the former head of the Taliban’s army, were loaded onto a U.S. military aircraft bound for Qatar after U.S. officials got confirmation that Bergdahl had been freed. Bergdahl’s “safety and health were both in jeopardy,” and officials had to act quickly to obtain his release, Defense Secretary Chuck Hagel said Sunday, according to the Associated Press. 1 of 33 Full Screen Autoplay Close Skip Ad × Caption U.S. Army Sgt. Bowe Bergdahl, the only U.S. service member known to be held hostage in Afghanistan, was handed over on May 31 by members of the Taliban in exchange for five Afghan detainees held at the military prison in Guantanamo Bay, Cuba, U.S. officials said. U.S. Army Sgt. Bowe Bergdahl is seen in this undated photo. Courtesy of Kim Harrison Buy Photo President Obama hailed Bergdahl’s recovery as a triumph of years of high-wire diplomatic efforts that reached a breakthrough in the waning months of the U.S. combat mission there. “He wasn’t forgotten by his country,” Obama said Saturday evening in the Rose Garden, standing alongside Bergdahl’s parents, Robert and Jani. “The United States of America does not ever leave our men and women in uniform behind.” His father, who grew a long beard in a gesture of solidarity with his son, said a few words to him in Pashto, the language spoken in southern Afghanistan, saying that he understood his son is having trouble speaking English. “I am your father, Bowe,” Robert Bergdahl said. “I look forward to continuing the recovery of our son which will be a considerable task for our family.” While leaders across the political spectrum expressed relief at the news, prominent Republican lawmakers chided the White House for skirting a legal requirement to notify them about the planned release of Guantanamo inmates. Some criticized the president for breaking with longtime U.S. policy against negotiating with militant groups. “This fundamental shift in U.S. policy signals to terrorists around the world a greater incentive to take US hostages,” Rep. Mike Rogers (R-Mich.), the chairman of the House Intelligence Committee, said in a statement. The AP reported Hagel, who was traveling to Afghanistan to meet with U.S. troops, as saying that the action was not relayed to Congress because of its urgency. He said intelligence indicated that Bergdahl’s “health was deteriorating.” Peaceful exchange Bergdahl’s release at 10:30 a.m. in Khost province, which borders Pakistan, capped a week of intense, secret negotiations conducted through the Qataris. A team of dozens of Special Operations forces took custody of Bergdahl from a group of 18 Taliban fighters. The rare encounter on the battlefield between warriors who have spent years killing one another lasted just a few minutes and was peaceful, U.S. officials said. Bergdahl walked onto the aircraft, U.S. officials said, suggesting he is in relatively stable health. Officials said it was too early to know anything definitive about the mental state of a soldier who bewildered his comrades after he walked off base in volatile Paktika province on June 30, 2009. Officials at the Pentagon, who had grown concerned that the end of the U.S. combat mission in Afghanistan at the end of the year would dim the prospect of getting Bergdahl back alive, rejoiced. “It is our ethos that we never leave a fallen comrade,” Gen. Martin E. Dempsey, the chairman of the Joint Chiefs of Staff, said in a statement. “Today we have back in our ranks the only remaining captured soldier from our conflicts in Iraq and Afghanistan. Welcome home Sgt. Bowe Bergdahl.” There was no indication that the soldier would face any reprimand for the circumstances under which he was taken, which led some of his comrades to call him a deserter. While it is unclear whether he will remain on active duty, a senior U.S. military official said the Army plans to promote Bergdahl to staff sergeant next month. “I can’t imagine there would be repercussions,” said the official, who was among several who would speak about the case only on the condition of anonymity. Defense officials said they were working to get Bergdahl to the United States as soon as possible. After passing through Bagram air base in Afghanistan, Bergdahl was en route to the U.S military hospital in Landstuhl, Germany, according to Pentagon officials traveling with Hagel. They said his first U.S. stop would likely be the Brooke Army Medical Center in San Antonio, where after a thorough medical screening he will likely be debriefed by intelligence officials. Year-long stay in Qatar The released inmates include Mullah Mohammad Fazl, a former Taliban deputy defense minister. U.S. officials said that under a memorandum of understanding signed by Washington and Doha, the men will be subject to a year-long travel ban in Qatar. They declined to offer more details about any restrictions the men would face but expressed confidence that their release would not put Americans in harm’s way. “The United States has coordinated closely with Qatar to ensure that security measures are in place and the national security of the United States will not be compromised,” Hagel said in a statement from Singapore, where he was attending a security conference. “Sgt. Bergdahl’s return is a powerful reminder of the enduring, sacred commitment our nation makes to all those who serve in uniform.” Hagel informed members of Congress on Saturday about the prisoner swap deal. The administration is required by law to notify Congress about its intention to release Guantanamo detainees 30 days in advance. “Due to a near-term opportunity to save Sergeant Bergdahl’s life, we moved as quickly as possible,” a senior administration official said, speaking on the condition of anonymity to explain the timing of the congressional notification. “The administration determined that given these unique and exigent circumstances, such a transfer should go forward notwithstanding the notice requirement” in the law. Talks falter, then revive The Obama administration began seriously exploring the possibility of negotiating Bergdahl’s release in late 2011, when secret talks between U.S. diplomats and members of the Taliban appeared to be gaining traction. The talks, part of a broader effort to explore a negotiated end of a conflict that had only become deadlier as the White House approved a surge of 30,000 troops in 2009, collapsed in March 2012 when the Taliban suspended them, arguing that the United States was not acting in good faith. Last summer, when the Taliban was allowed to open a political office in the Qatari capital, American officials grew hopeful that prisoner swap negotiations could resume. The effort foundered just hours after the office formally opened after the Afghan government protested that the Taliban had been given de-facto diplomatic status. Unexpectedly, representatives of the Taliban conveyed to U.S. officials last fall that they were once again amenable to discussing the release of Bergdahl, but set as a condition that they would only deal with Washington through intermediaries, American officials said. U.S. officials received a video of Bergdahl last fall after they had demanded proof that he remained alive. Unlike past videos of the captive, the one released last year was delivered privately, rather than through the Taliban’s media operatives. It showed the soldier looking “very gaunt, haggard,” a U.S. military official who has seen clips said. In a departure of its former negotiating stance, the administration sought to enhance the American offer of a prisoner exchange by proposing to release the five men simultaneously. Taliban representatives had objected to the previous proposed plan, under which the inmates would be turned over in stages in an effort to test whether the Taliban and the Qatari intermediaries could guarantee that the men would not return to militancy. A statement issued Saturday by the Taliban said the men would be residing with their families in Qatar, a tiny, wealthy Gulf emirate. U.S. officials said they had no indication that the Taliban was open to more substantive talks but expressed hope that the swap would build trust. “We continue to hope there will be a decision by the Taliban to move forward to initiate a political dialogue with the Afghan government, and it is our hope that the events leading to Sergeant Bergdahl’s return could potentially open the door for broader discussions with the Taliban by building confidence that the two sides can negotiate honestly with each other,” a senior administration official said. A celebration in Idaho The Obama administration has sought to keep Bergdahl’s profile relatively low over the years, fearing that widespread publicity of his plight would boost his value in the eyes of the Taliban and strengthen the group’s negotiating hand. For a period, White House officials asked that several U.S. newspapers refrain from publishing his name in the context of peace talks. As his hopes dimmed, Bergdahl’s father sought to personally secure his son’s release by learning Pashto and attempting to contact the Taliban online. Bergdahl’s parents had traveled to Washington for a Memorial Day event and stayed in town for a few days to attend meetings with senior U.S. officials. They were in Washington when Obama called them Saturday morning to deliver the news, U.S. officials said. “We were so joyful and relieved when President Obama called us today to give us the news that Bowe is finally coming home!” Bergdahl’s parents said in a statement. “We cannot wait to wrap our arms around our only son. Today, we are ecstatic!” In Bergdahl’s home town of Hailey, Idaho, there was jubilation Saturday. Residents had been planning a June 28 concert to call attention to his plight. They were expecting up to 7,000 people to attend, and singer Carole King was going to perform for free. The concert will go on, said organizer Stefanie O’Neill, but it is now going to be “the biggest welcome-home party the country has ever seen.” Kim Harrison, who said she was listed as Bergdahl’s godmother in his military records, said, “I’m excited, I’m kind of numb, and I hope that they take it easy on him when he gets back.” She said she knows Bergdahl as the precocious teenager who took ballet with her daughter and came to spend hours at the Harrison house in Ketchum, Idaho, reading poetry and studying philosophy. She described Bergdahl as a sensitive young man who “questioned everything” and who went to Afghanistan because he wanted to help people. “Now the only thing I can think of worth talking about is protecting him from people criticizing him and trying to find a negative source of why he left in the first place,” she said. Karen DeYoung, traveling in Asia with Defense Secretary Chuck Hagel, and Anne Gearan, Julie Tate and Stephanie McCrummen in Washington contributed to this report. WASHINGTON — The lone American prisoner of war from the Afghan conflict, captured by insurgents nearly five years ago, has been released to American forces in exchange for five Taliban detainees held at Guantánamo Bay, Cuba, Obama administration officials said Saturday. The soldier, Sgt. Bowe Bergdahl, 28, was handed over to American Special Operations troops inside Afghanistan near the Pakistan border about 10:30 a.m. Saturday in a tense but uneventful exchange with 18 Taliban officials, American officials said. Moments later, Sergeant Bergdahl was whisked away by the helicopter-borne commandos, American officials said. He was described in good physical condition. The five Taliban detainees at Guantánamo, including two senior militant commanders said to be linked to operations that killed American and allied troops as well as implicated in murdering thousands of Shiites in Afghanistan, were flown from Cuba in the custody of officials from Qatar, who will accompany them back to that Persian Gulf state. They will be subject to security restrictions there, including a one-year travel ban. Photo Senior administration officials cautioned that the discussions over the prisoner swap, which were secretly restarted last fall after collapsing several months earlier, did not necessarily presage the resumption of the broader, on-again-off-again peace talks to end the 13-year war. “This is the only issue we’ve discussed with the Taliban in recent months,” said one senior Obama administration official involved in the talks. “We do hope that having succeeded in this narrow but important step, it will create the possibility of expanding the dialogue to other issues. But we don’t have any promises to that effect.” But word of renewed, secret negotiations with the Taliban brought immediate criticism from some lawmakers, including Representative Mike Rogers of Michigan, the Republican chairman of the House Intelligence Committee. “I have little confidence in the security assurances regarding the movement and activities of the now-released Taliban leaders, and I have even less confidence in this administration’s willingness to ensure they are enforced,” he said. “I believe this decision will threaten the lives of American soldiers for years to come.” A Western official in Kabul said the Afghan government was not told ahead of time that the Taliban were going to hand over Sergeant Bergdahl or that the release of prisoners from Guantánamo Bay was proceeding, though the Afghans were broadly aware that the talks had been rekindled. American officials feared leaks could scuttle the deal. President Obama personally called the soldier’s parents on Saturday, shortly after Sergeant Bergdahl was transferred to the American military; the Bergdahl family was in Washington after a visit here for Memorial Day, officials said. Later on Saturday in the White House Rose Garden, Mr. Obama, flanked by Robert and Jani Bergdahl, the sergeant’s parents, said, “Right now, our top priority is making sure that Bowe gets the care and support that he needs, and that he can be reunited with his family as soon as possible.” The Bergdahls, who have waged a tireless campaign for their son’s release, have sometimes criticized the Obama administration for lack of action. But at the impromptu Rose Garden appearance and in a statement released earlier in the day, they praised the American and Qatari governments for their help. “We cannot wait to wrap our arms around our only son,” they said in the statement. “Today, we are ecstatic!” Family and friends in the Bergdahl family’s hometown, Hailey, Idaho, said they were planning a celebration on Sunday. A Pentagon official said Saturday evening that Sergeant Bergdahl was en route to Landstuhl Regional Medical Center in Germany. He would then be transferred to Brooke Army Medical Center in San Antonio when doctors felt he was fit to travel. Continue reading the main story Video Negotiations and internal deliberations over the potential for a swap have waxed and waned for years, but they intensified in the past several weeks as an agreement appeared within reach, according to an official familiar with the matter. Among other complications, there was a potential legal obstacle: Congress has imposed statutory restrictions on the transfer of detainees from Guantánamo Bay. The statutes say the secretary of defense must determine that a transfer is in the interest of national security, that steps have been taken to substantially mitigate a future threat by a released detainee, and that the secretary notify Congress 30 days before any transfer of his determination. In this case, the secretary, Chuck Hagel, acknowledged in a statement that he did not notify Congress ahead of time. When Mr. Obama signed a bill containing the latest version of the transfer restrictions into law, he issued a signing statement claiming that he could lawfully override them under his executive powers. “The executive branch must have the flexibility, among other things, to act swiftly in conducting negotiations with foreign countries regarding the circumstances of detainee transfers,” he wrote in the signing statement, adding that if the restrictions “operate in a manner that violates constitutional separation of powers principles, my administration will implement them in a manner that avoids the constitutional conflict.” An administration official said the circumstances of a fast-moving exchange deal made it appropriate to act outside the statutory framework for transfers. The top Republicans on the House and Senate Armed Services Committees, Representative Howard McKeon of California and Senator James M. Inhofe of Oklahoma, said the release of the Taliban prisoners “clearly violated laws” governing the transfer of detainees from Guantánamo Bay. One senior administration official defended the decision, saying that “due to a near-term opportunity to save Sergeant Bergdahl’s life, we moved as quickly as possible,” requiring action outside the notice requirement of the statute. In his comments Saturday afternoon, Mr. Obama said, “The Qatari government has given us assurances that it will put in place measures to protect our national security.” Prisoner swaps have been more common in conventional wars between two nation-state armies than in the sort of insurgency conflict that characterized Afghanistan and Iraq, and American officials could not cite another instance in which an American soldier had been freed in these conflicts in a swap. Photo The transfer reduces the detainee population at Guantánamo to 149. They include 12 Afghan citizens — each of whom was deemed far less important and dangerous than the five who were included in the swap. Sergeant Bergdahl was believed to have been held by the militant Haqqani network in the tribal area of Pakistan’s northwest frontier, on the Afghan border. He was captured in Paktika Province in Afghanistan on June 30, 2009. The circumstances of how he was separated from his unit and captured have remained a mystery. Continue reading the main story Advertisement Hopes for Sergeant Bergdahl’s release were lifted last November when the Taliban signaled it was prepared to engage the United States on the limited issue of a prisoner swap, but not on wider issues including reconciliation with the government of Afghanistan, a senior administration official said Saturday. The discussions resumed with the Qatari government acting as an intermediary for messages between the two sides, the official said. Previous talks faltered over issues including restrictions on any released detainees; it was unclear whether the one-year travel prohibition was a breakthrough compromise. While it was described by American officials, it was not mentioned in a Taliban statement on the swap. The latest evidence indicating that Sergeant Bergdahl, who was promoted twice while being held as a prisoner, was still alive came in January, when the American military obtained a video showing him alert but also apparently in declining health. In the past week, detailed negotiations culminated in an agreement for a Taliban delegation to bring Sergeant Bergdahl to Afghanistan, where he would be retrieved by American Special Operations troops. Mr. Obama called the emir of Qatar on Tuesday, and they gave each other assurances about the proposed transfers, an administration official said Saturday. Sergeant Bergdahl was handed over about 7 p.m. local time without incident with the several dozen Special Operations troops spending only a few minutes on the ground, said American officials, who did not disclose the swap’s location in Afghanistan. Taliban officials, though, said the exchange was carried out in Khost Province. Photo The Taliban statement said that the swap was “a result of nonstraightforward negotiations” with the United States, with mediation by Qatar, and that the released detainees “will reside in Qatar with their families.” The details of what the government believes it knows about the five former Taliban leaders were made public in classified military files given to WikiLeaks by Pfc. Bradley Manning, now Chelsea Manning. Mohammad Nabi Omari is described in the files as “one of the most significant former Taliban leaders detained” at Guantánamo. He is said to have strong operational ties to anticoalition militia groups, including Al Qaeda, the Taliban and the Haqqani network. A former Taliban provincial governor, Mullah Norullah Noori, is also “considered one of the most significant former Taliban officials” at the prison, according to the documents. Both Mr. Noori and a third detainee being exchanged, Mullah Mohammad Fazl, a former Taliban deputy defense minister, are accused of having commanded forces that killed thousands of Shiite Muslims, a minority in Afghanistan, before the Taliban were toppled in the aftermath of the Sept. 11 terrorist attacks. The fourth detainee is Abdul Haq Wasiq, a former top Taliban intelligence official. The fifth, Khirullah Said Wali Khairkhwa, is a former minister of the interior and provincial governor. The Western official in Kabul said the Afghan government was not told about the deal beforehand because there had been a number of false starts since the exchange negotiations had picked up in the past few weeks. One of the Americans’ chief concerns was that word of the plan would leak, and the Taliban would get cold feet or face pressure from harder line elements not to release Sergeant Bergdahl. The Americans also feared the possibility of the exchange being upended by an outburst from the Afghan president, Hamid Karzai, who might see the prisoner swap as an attempt to open peace talks with the Taliban behind his back. He has previously claimed that the United States aimed to weaken the Afghan government by cutting a separate peace agreement with the Taliban and its backers in Pakistan, and “no one wanted to deal with that kind of stuff right now,” the Western official said. SUMMARY: [/INST] Bowe Bergdahl is finally coming home. The Taliban freed the American soldier it has held hostage for five years, and he is now in US custody, reports the AP. The Idaho native went missing on June 30, 2009, in southeast Afghanistan, and had been the only US soldier held captive in the country. The Army sergeant was released as part of a deal brokered by Qatar that also freed five detainees at the military prison in Guantanamo Bay, reports the Washington Post. US officials say the 28-year-old seems to be in good health and was able to walk, but was under the care of military doctors. President Obama personally delivered the news to his parents and in a statement said his release "is a reminder of America's unwavering commitment to leave no man or woman in uniform behind on the battlefield." Bergdahl, believed to have been held by the Taliban offshoot Haqqani network, was turned over to US special-ops forces at an unspecified location. The five Gitmo detainees were being transferred to Qatar and will have a one-year travel ban among other security restrictions, reports the New York Times. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority from the provisional application Ser. No. 61/311,072 which was filed Mar. 5, 2010, the entire contents of which are incorporated herein by reference. GOVERNMENT INTERESTS [0002] This invention was made with U.S. government support under USDA-CSREES Awards Nos. 2008-34467-19445 and 2009-34467-20151. The government has certain rights in the invention. BACKGROUND OF THE INVENTION [0003] For purposes of this invention disclosure, the terms “lipid-soluble” and “lipophilic” refer to compounds or substances which are capable of dissolving in fats, oils, lipids, or non-polar solvents. The terms “lipid-soluble” and “lipophilic” are used interchangeably, and the term “lipophile” refers to a substance which is lipophilic. [0004] Delivery of lipid-soluble materials such as vitamins A, D, E and K, fatty acids and lipid-soluble pharmaceuticals into the human (or animal) body remains a challenge. It can be difficult to maintain lipid-soluble nutrients in low-fat foods because they do not remain in solution and/or they adsorb to packaging materials (Swaisgood et al., 2001). Existing commercial delivery and fortification strategies revolve around emulsification and microencapsulation, both of which have limitations. Emulsification requires product-specific emulsifiers, many of which are not GRAS (Generally Recognized As Safe). Microencapsulation materials, such as cyclodextrins, are often expensive. In addition, these approaches invariably require using a substantial amount of fat as carriers for lipid-soluble materials. [0005] The need for new carriers for lipid-soluble materials has become particularly apparent, given the recent resurgence of vitamin D deficiencies. Vitamin D is associated with bone health, myocardial development, brain and fetal development and reduced cancer risk. While the needs are evident, the means to incorporate vitamin D remain limited, at least in part due to the fact that vitamin D is sensitive to acid, oxygen, and light. Fortification of lipid-soluble vitamins, such as vitamin D, is challenging given their sensitive chemical nature. The presence of conjugated double bonds in vitamin D provides an easy route for decomposition by oxidation. Isomerization can occur under acidic or light conditions. Temperatures above 40° C. and relative humidity above 85% can deteriorate it, while mild acidification can isomerizes it to inactive forms. [0006] Similarly, fortification of foods and beverages with fatty acids, such as polyunsaturated Ω-3 fatty acids, is very challenging because the fatty acids are highly insoluble in water and very sensitive to oxidative degradation which can reduce their health benefits and cause undesirable odors (Zimet et al., 2009). [0007] Protein-based carriers offer a potential alternative to existing carriers, although the limited research to date on protein carriers has focused on dairy proteins. Wang et al. (1997) reported that beta-lactoglobulin, the major protein in whey, showed substantially greater binding affinity to vitamin D 2 than to vitamin A. They did not, however, report being able to produce a complex using beta-lactoglobulin and a vitamin. They also did not provide binding efficiency data which would indicate what proportion of the available vitamins the protein was able to bind. [0008] Swaisgood et al. (2001) also used beta-lactoglobulin to form a complex with vitamin D. While they were able to form a complex which was soluble in aqueous solution, their approach involved affinity purification methods, including use of affinity chromatography in their preferred method, which would be cost-prohibitive for commercial applications. The authors also did not provide information about the proportion of the added vitamin D which was retained in the complex along with beta-lactoglobulin. [0009] Zimet et al. (2009) noted that certain food proteins, particularly milk proteins, had an ability to bind to hydrophobic molecules, making them useful for the encapsulation and delivery of bioactive compounds. They reported that beta-lactoglobulin had been found to bind with vitamin D, retinoic acid, cholesterol and various aromatic compounds and fatty acids. They noted, though, that there had been no prior published work on the binding of proteins to Ω-3 fatty acids. Using a complex containing beta-lactoglobulin and pectin, they reported an encapsulation efficiency for DHA (docosahexaenoic acid) of approximately 64% (i.e., amount of DHA encapsulated as a percent of the initially added DHA). [0010] Semo et al. (2007) attempted to use microencapsulation involving pure casein micelles. They wrote that the use of casein micelles as carriers for nutraceuticals had not yet been reported in the literature. However, they were only able to encapsulate approximately 27% of the analytically recovered vitamin D 2 which they had added to a suspension containing casein micelles. [0011] The inventors of the present invention have unexpectedly found that using a plant-based protein, leaf protein, they were able to create a leaf protein-vitamin D complex which retained approximately 85% of the vitamin D contained in a mixture—more than three times greater percentages of vitamin D than is reported from casein micelles. The present invention pertains specifically to the use of leaf proteins in a complex with lipid-soluble materials. [0012] The term “leaf protein” as used in this invention disclosure is intended to refer to all water-soluble proteins contained in plant leaves. The leaf protein may be obtained from any green leafy plant, as it is well known that all chlorophyll-containing plants contain soluble leaf proteins. Examples of such plants include, but are not limited to, tobacco, alfalfa and spinach. Lo et al. (2008) and Fu et al. (2010) have described a method for efficiently recovering and preparing a leaf protein powder from the leaves of green plants. Leaf protein may be extracted from plants, and a suitable leaf protein powder prepared, using the method described in Lo et al. (2008), which is incorporated by reference, or using other methods which may be known to practitioners of the art. [0013] Leaf proteins—the proteins which occur naturally in the leaves of green plants—are perhaps the most abundant proteins in nature. They contain excellent binding, gelling, foaming, whipping and emulsifying characteristics, and have nutritional value comparable to milk protein (Lo et al., 2008; Sheen et al., 1991). Leaf protein carriers also offer another advantage over other proteins in that consumers do not have to worry about whether the products contain animal-origin or dairy-based ingredients. Leaf protein is therefore a very desirable carrier for the delivery of lipophilic substances. SUMMARY OF THE INVENTION [0014] This invention provides a novel composition of matter comprising a complex of leaf protein and one or more lipid-soluble materials. The present invention also provides methods of making and using such complexes. [0015] Complexes of the invention typically comprise leaf protein and one or more lipid-soluble materials such as, for example, vitamins A, D, E, and K, fatty acids, lipid-soluble pharmaceuticals, or other lipid-soluble materials. In a preferred embodiment, the complex is a powdery solid material. This complex is useful as a carrier for the delivery of lipid-soluble materials, into or onto humans or animals. A non-limiting list of examples for the possible uses of this leaf protein-lipid-soluble material complex are as a food or in food as a delivery system for vitamins or other lipid-soluble materials; in dietary supplements and nutraceuticals, infant formulas, in pharmaceuticals or in topical compositions. Nutrient and vitamin supplements can be in any form known in the art, including but not limited to, powders, tablets (chewable or otherwise), capsules, gel-caps, elixirs, and effervescent tablets. Alternatively, nutrient and vitamin supplements can be in the form of bars, drinks, juices or shakes, among others. These and other aspects of the present invention are disclosed in more detail in the description of the invention below. [0016] The inventors were able to produce a leaf protein-vitamin D 3 complex which retained approximately 85% of the vitamin D added to a mixture, using a preferred embodiment of the claimed method. (See FIG. 1 ). This result indicates that leaf protein is highly effective and efficient as a carrier of lipid-soluble materials. Without wishing to be bound by theory, this result also indicates that leaf protein has many binding sites, and is able to carry large amounts of target lipid-soluble materials. [0017] Methods of the invention typically comprise preparing a suspension containing leaf protein. Optionally, non-water-soluble materials may be removed from the leaf protein suspension. Lipid-soluble materials may then be mixed with the suspension. Optionally, lipid-soluble materials may be prepared by dissolving them in a solvent prior to their addition to the suspension. When the leaf protein suspension and the lipid-soluble materials have been suitably combined, they may be further treated. In one embodiment, the mixture may be frozen and, optionally, lyophilized. In some embodiments, the mixture may be dried without freezing using techniques well known in the art, for example, spray drying. In some embodiments, the mixture is dried into a powder. The resulting product is a solid powder containing a complex of leaf protein and the target lipid-soluble material(s). BRIEF DESCRIPTION OF THE FIGURES [0018] FIG. 1 : Comparison of vitamin D 3 recovery in freeze-dried formulation: with tobacco leaf protein vs. control. [0019] FIG. 2 : Comparison of vitamin D 3 recovery, and crude protein % in vitamin D-tobacco leaf protein complex of different water content. [0020] FIG. 3 : Comparison of vitamin D 3 recovery, and crude protein % in vitamin D-tobacco leaf protein complex of varying pH. [0021] FIG. 4 : Solubility values of vitamin D-tobacco leaf protein complex formulated at different pH (p value=0.0709). [0022] FIG. 5 : Comparison of vitamin D 3 recovery and crude protein % in the vitamin D-tobacco leaf protein complex under different mixing conditions. DETAILED DESCRIPTION OF INVENTION [0023] The principles, preferred embodiments and modes of operation of the present invention will be described hereunder. The invention which is intended to be protected herein should not, however, be construed as limited to the particular forms disclosed, as these are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit of the present invention. Accordingly, the examples, descriptions, and best mode of carrying out the invention given below should be considered exemplary in nature and not as limiting to the scope and spirit of the invention as set forth in the claims. [0024] The objective of the methods of this invention is to produce a complex containing leaf protein and one or more lipid-soluble substances. The present invention may be used to prepare complexes consisting of leaf protein and any other lipid-soluble materials, including but not limited to, vitamins D 3, A, E, K, other types of vitamin D, fatty acids such as DHA, eicosapentaenoic acid, linoleic acid, and alpha-linoleic acid, lipid-soluble drugs (some of which are listed below), cholesterol, retinol and retinoids and other lipophilic substances. In some embodiments, complexes of the invention may comprise 2, 3, 4, 5, or more lipid-soluble materials. [0025] The term “target substance” as used in this invention disclosure refers to the particular lipid-soluble substance(s) which the practitioner wishes to form into a complex with leaf protein. [0026] The present invention is based on the discovery that leaf protein very efficiently forms complexes with lipophilic substances, for example vitamin D. This property allows the use of leaf protein as a carrier for lipophilic nutrients in foods, dietary supplements and nutraceuticals, infant formulas, drugs and pharmaceuticals and topical compositions. [0027] Lipid-soluble materials may be derived from any source known in the art, for example, the vitamin A, vitamin D, vitamin E, and vitamin K as used herein can be from any source known in the art. The term “vitamin A” as used herein refers to any form of vitamin A, including but not limited to, retinol, retinaldehydes, retinal, retinoic acid (also known as tretinoin and retin-A), and vitamin A salts and derivatives (e.g., retinol palmitate, retinyl acetate, and β-carotene and other carotenoids). The term “vitamin D” as used herein refers to any form of vitamin D, including but not limited to, ergocalciferol (D 2 ), cholecalciferol (D 3 ), 22,23-dihydroergocalciferol (D 4 ), and vitamin D salts and derivatives (e.g., 25-hydroxycholecalciferol and 1-α,25-dihydroxycholecalciferol). The term “vitamin E” as used herein refers to the family of compounds known as tocopherols (e.g., α-tocopherol, β-tocopherol, δ-tocopherol, γ-tocopherol), as well as tocol, tocoquinone, tocotrienol, and vitamin E salts (e.g., vitamin E phosphate) and derivatives (e.g., tocopherol sorbate, tocopherol acetate, tocopherol succinate, other tocopherol esters). As used herein, the term “vitamin K” refers to vitamin K 1 (phytonadione), vitamin K 2 (menaquinone), vitamin K 3 (menadione), vitamin K 4, vitamin K 5, vitamin K 6, vitamin K 7, and their salts and derivatives. [0028] Fatty acids refer to carboxylic acids with a long unbranched aliphatic tail, and which are either saturated or unsaturated. Fatty acids include, but are not limited to DHA, eicosapentaenoic acid, linoleic acid, and alpha-linoleic acid, amongst many others. [0029] Leaf protein powder suitable for practicing this invention may be obtained from plant leaves using the method described in Lo et al. (2008) and Fu et al. (2010), or using any other method of leaf protein processing or extraction which may be known to practitioners in the art. [0030] One suitable method for preparing leaf protein is as follows: [0031] Freshly harvested green plant leaves may be chopped with a hammermill. The leaves can be either freshly harvested, or they can be stored in a cool or frozen state or dried following harvest until they are ready for processing. Alternatively, physical maceration procedures, combined with mechanical pressure, can be utilized to disrupt the cell wall and prepare the proteins for solubilization. [0032] Substantially simultaneously with the leaf rupturing, a buffer solution is added to the leaves. The inventors found that a solution containing sodium phosphate dibasic and potassium phosphate monobasic (Na 2 HPO 4 —KH 2 PO 4 ) is especially effective, although other effective buffering agents may be used. The inventors also found that a pH of 7.77 is preferable as it gave the highest protein yields with this agent, although a pH range between approximately 7.4-8.0 or even 6.5-9.0 is acceptable. [0033] It is preferred that the buffer should have a low concentration, in order to avoid precipitating or denaturing the proteins. It was found that a buffer concentration of approximately 0.067M was the optimal concentration, although a range of 0.025M to about 0.3M is quite acceptable, and more preferably a range of about 0.067M-about 0.2 M. [0034] It is preferred that the buffer solution should also contain both a chelating agent and a reducing agent. The purpose of the chelating agent is to remove loose ions from the resulting juice. We have found that 10 mM of EDTA, a well-known chelating agent, is effective to recover loose ions. The purpose of the reducing agent is to prevent oxidation and denaturation of the proteins. We have also found that 25 mM of 2-mercaptoethanol is effective as a reducing agent. [0035] The ruptured leaves may be stored in the buffer solution for up to twenty-four hours, although preferably not more than five hours. While such storage is not necessary, it was found to help improve ultimate protein recovery. [0036] An industrial filter may then be used to filter out the fibrous leaf biomass, leaving a green juice containing the soluble protein. We have found a screw press to give effective results. This green juice contains the soluble proteins along with plant chloroplast materials. Subjecting this green juice to powerful centrifuge will remove this chloroplast material, leaving an “amber juice” which contains the soluble proteins. Centrifuging at a force of approximately 12,000 g for approximately 20 minutes is sufficient to remove leaf chloroplast materials. Either continuous centrifuge or disk centrifuge is suitable. However, failure to adequately centrifuge the green juice will result in incomplete removal of the chloroplasts, and can leave an undesirable green tint in the resulting proteins. [0037] Depending upon the desired use, it is possible to obtain several different protein products from this amber juice. [0038] Product 1—Crude Protein Powder. The simplest approach is to prepare a protein powder product from this resulting amber juice through the use of standard industrial drying processes. This powder product can be prepared using spray drying, vacuum drying or freeze drying. However, spray drying is most practical for scale-up to an industrial level. This crude protein powder could be satisfactory for many commercial uses. [0039] Product 2—Purified Protein Powder. It is possible to remove nucleic acids and small molecule impurities through a precipitation of the amber juice solution at its isoelectric point, which we have found to be at or about pH 5.3 (±0.5). The resulting solution can then be dried via spray drying or other industrial drying techniques to obtain a more highly purified powder product. [0040] Product 3—It is possible to separate ribulose 1.5-bisphosphate carboxylase/oxygenase (RuBisCO) from the amber juice. An isoelectric point precipitation can be conducted at a pH of approximately 5.3 (±0.5), which is the isoelectric point for RuBisCO. This protein can then be centrifuged at a force of approximately 12,000 g or greater. The precipitate is then resuspended in buffer solution at a pH of approximately 7.77. The precipitate is then dried using spray drying or other means to produce a powder product containing RuBisCO. RuBisCO can be further purified if desired. [0041] Product 4—The supernatant from the isoelectric point precipitation at pH 5.3 can be further purified to yield other leaf proteins. A second isoelectric point precipitation can be conducted involving the supernatant at a pH of approximately 4.2 (±0.5). The proteins can then be resuspended in buffer at a pH of approximately 7.77, and then dried using spray drying or other forms of drying. [0042] Any of the above-described leaf protein powders may be used in the practice of the present invention. [0043] The leaf protein powder is then placed in a suitable solvent, such as water, to form a suspension. Failure to place the protein powder into a suitable solvent may inhibit or prevent formation of an effective protein complex, as the dry protein is generally too coarse to efficiently bind or form a complex with a target substance. Additionally, preparing this protein-containing suspension is believed to expose additional binding sites to the target substance. In a preferred embodiment, water is used as the solvent to form the leaf protein aqueous suspension. In a particularly preferred embodiment, the ratio of leaf protein powder to water will be approximately 1 gram of leaf protein powder to between approximately 30 to 80 ml of water. Failure to maintain adequate water content will reduce the capacity of leaf protein to form a complex with the target substance. Use of excessive water content may add drying time and cost, and may reduce interaction of the protein and target substance. [0044] In a preferred embodiment, the pH of the water is adjusted to between 3.3 and 6.3. Using a pH below this range may degrade the leaf protein. Using a pH in the preferred range maintains the structure of the protein, which optimizes its ability to retain the target substance. [0045] In the present invention, the leaf protein forms a complex with one or more target substances in solution. The target substance(s), which is a lipid-soluble material, is solubilized in a suitable organic solvent, such as ethanol, methanol, other alcohols, hexane, acetone, or toluene, amongst many others. One skilled in the art will realize that the optimal organic solvent will depend on the nature of the lipid-soluble material. As an example, ethanol is particularly preferred if vitamin D 3 is the target substance. [0046] Following solubilization of the target substance(s), the protein-containing suspension and the target-substance(s)-containing solution are then mixed together and then, in a preferred embodiment, frozen. Several techniques known to practitioners in the art may optionally be used to enhance mixing, for example, magnetic stirring, sonication, vortexing, or a combination of mixing methods. Practitioners in the art will recognize that different mixing techniques may prove more suitable for particular lipid-soluble materials than other techniques. If vitamin D 3 is the target substance, a preferred embodiment is the use of magnetic stirring for approximately five minutes. [0047] In a preferred embodiment, freezing should occur within one hour after the protein-containing suspension is mixed with the target-substance-containing solution. In a more preferred embodiment, freezing occurs substantially immediately after the protein-containing suspension is mixed with the target-substance-containing solution. Delays in freezing after mixing the protein-containing suspension with the target-substance-containing solution may reduce the amount of the target substance which forms a complex with the leaf protein. At the time of mixture, the protein and target substance are in close contact. However, they may separate as time is allowed to pass. One skilled in the art will recognize that the rate at which the protein and target substance dissociate will depend on the nature of the target substance(s), and that this will affect the optimal time for freezing to occur. [0048] Any techniques which obtain substantially immediate freezing of the protein-target substance mixture are potentially suitable. A non-limiting list of suitable freezing techniques include use of liquid nitrogen, dry ice or methanol. A preferred embodiment is the use of liquid nitrogen for freezing. [0049] In a preferred embodiment, following freezing, the frozen mixture of protein and the target substance(s) is then dried. Any technique for drying may be suitable, including but not limited to freeze-drying, precipitation, oven-drying, microwaving or a combination of methods. One preferred embodiment is freeze-drying, as this technique will not degrade the protein or target substance. If freeze-drying is used, then the end product will be a powdery material containing a complex which contains leaf protein and the target substance. [0050] The resulting dried complex, containing leaf protein and the lipid-soluble target substance(s), is suitable for use as a food additive, in forming nutrient, vitamin or other dietary supplements or nutraceuticals. Such products can be in any form known in the art, including but not limited to, tablets (including chewable tablets), capsules, gel-caps, powders, elixirs, and effervescent tablets. Alternatively, such products can be in the form of shakes, juices or other drinks, and bars. [0051] The present invention also provides food compositions comprising complexes of leaf protein and lipophilic nutrients. Preferably the lipophilic nutrients are vitamin A, vitamin D, vitamin E, vitamin K 1, cholesterol, carotenoids, conjugated linoleic acid, essential fatty acids, and other fatty acids. Because of its excellent nutritional qualities and water-solubility, leaf protein is highly suitable as a suitable carrier for lipophilic nutrients in food compositions. Complexes of leaf proteins and lipophilic nutrients are also useful for fortifying infant formulas with DHA and other lipid-soluble substances. [0052] The food compositions of the present invention are formed by combining a leaf protein-lipid-soluble material complex according to the present invention with other food ingredients. Alternately stated, a food composition is a food product containing a leaf protein-lipid-soluble material complex of the present invention as an ingredient or component. A food composition can be a liquid or a solid food for human or animal consumption, and includes, but is not limited to, dairy products, processed meats, breads, cakes and other bakery products, processed fruits and vegetables, etc. [0053] The present invention also includes compositions comprising a leaf protein-lipid soluble material complex, in which the leaf protein forms a complex with a lipophilic drug for delivery into humans or animals. Such compositions can be in any form known in the art, including but not limited to, tablets (including chewable tablets), capsules, gel-caps, powders, elixirs, and effervescent tablets. A non-limiting list of lipophilic drug substances which may used to form a leaf-protein-lipid-soluble material complex according to the present invention includes the following: Analgesics and anti-inflammatory agents: aloxiprin, auranofin, azapropazone, benorylate, diflunisal, etodolac, fenbufen, fenoprofen calcim, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamic acid, mefenamic acid, nabumetone, naproxen, oxyphenbutazone, phenylbutazone, piroxicam, sulindac; Anthelmintics: albendazole, bephenium hydroxynaphthoate, cambendazole, dichlorophen, ivermectin, mebendazole, oxamniquine, oxfendazole, oxantel embonate, praziquantel, pyrantel embonate, thiabendazole; Anti-arrhythmic agents: amiodarone, disopyramide, flecamide acetate, quinidine sulphate; Anti-bacterial agents: benethamine penicillin, cinoxacin, ciprofloxacin, clarithromycin, clofazimine, cloxacillin, demeclocycline, doxycycline, erythromycin, ethionamide, imipenem, nalidixic acid, nitrofurantoin, rifampicin, spiramycin, sulphabenzamide, sulphadoxine, sulphamerazine, sulphacetamide, sulphadiazine, sulphafurazole, sulphamethoxazole, sulphapyridine, tetracycline, trimethoprim; Anti-coagulants: dicoumarol, dipyridamole, nicoumalone, phenindione; Anti-depressants: amoxapine, maprotiline, mianserin, nortriptyline, trazodone, trimipramine maleate; Anti-diabetics: acetohexamide, chlorpropamide, glibenclamide, gliclazide, glipizide, tolazamide, tolbutamide; Anti-epileptics: beclamide, carbamazepine, clonazepam, ethotoin, methoin, methsuximide, methylphenobarbitone, oxcarbazepine, paramethadione, phenacemide, phenobarbitone, phenyloin, phensuximide, primidone, sulthiame, valproic acid; Anti-fungal agents: amphotericin, butoconazole nitrate, clotrimazole, econazole nitrate, fluconazole, flucytosine, griseofulvin, itraconazole, ketoconazole, miconazole, natamycin, nystatin, sulconazole nitrate, terbinafine, terconazole, tioconazole, undecenoic acid; Anti-gout agents: allopurinol, probenecid, sulphin-pyrazone;] Anti-hypertensive agents: amlodipine, benidipine, darodipine, dilitazem, diazoxide, felodipine, guanabenz acetate, isradipine, minoxidil, nicardipine, nifedipine, nimodipine, phenoxybenzamine, prazosin, reserpine, terazosin; Anti-malarials: amodiaquine, chloroquine, chlorproguanil, halofantrine, mefloquine, proguanil, pyrimethamine, quinine sulphate; Anti-migraine agents: dihydroergotamine mesylate, ergotamine tartrate, methysergide maleate, pizotifen maleate, sumatriptan succinate; Anti-muscarinic agents: atropine, benzhexyl, biperiden, ethopropazine, hyoscyamine, mepenzolate bromide, oxyphencylcimine, tropicamide; Anti-neoplastic agents and Immunosuppressants: aminoglutethimide, amsacrine, azathioprine, busulphan, chlorambucil, cyclosporin, dacarbazine, estramustine, etoposide, lomustine, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, mitozantrone, procarbazine, tamoxifen citrate, testolactone. tacrolimus, sirolimus; Anti-protozoal agents: benznidazole, clioquinol, decoquinate, diiodohydroxyquinoline, diloxanide furoate, dinitolmide, furzolidone, metronidazole, nimorazole, nitrofurazone, omidazole, timidazole; Anti-thyroid agents: carbimazole, propylthiouracil; Alixiolytic, sedatives, hypnotics and neuroleptics: alprazolam, amylobarbitone, barbitone, bentazepam, bromazepam, bromperidol, brotizolam, butobarbitone, carbromal, chiordiazepoxide, chlormethiazole, chlorpromazine, clobazam, clotiazepam, clozapine, diazepam, droperidol, ethinamate, flunanisone, flunitrazepam, fluopromazine, flupenthixol decanoate, fluphenazine decanoate, flurazepam, baloperidol, lorazepam, lormetazepam, medazepam, meprobamate, methaqualone, midazolam, nitrazepam, oxazepam, pentobarbitone, perphenazine pimozide, prochlorperazine, sulpiride, temazepam, thioridazine, triazolam, zopiclone; beta-Blockers: acebutolol, alprenolol, atenolol, labetalol, metoprolol, nadolol, oxprenolol, pindolol, propranolol; Cardiac Inotropic agents: amrinone, digitoxin, digoxin, enoximone, lanatoside C, medigoxin; Corticosteroids: beclomethasone, betamethasone, budesonide, cortisone acetate, desoxymethasone, dexamethasone, fludrocortisone acetate, flunisolide, flucortolone, fluticasone propionate, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone; Diuretics: acetazolamide, amiloride, bendrofluazide, bumetanide, chlorothiazide, chlorthalidone, ethacrynic acid, frusemide, metolazone, spironolactone, triamterene; Anti-parkinsonian agents: bromocriptine mesylate, lysuride maleate; Gastro-intestinal agents: bisacodyl, cimetidine, cisapride, diphenoxylate, domperidone, famotidine, loperamide, mesalazine, nizatidine, omeprazole, ondansetron, ranitidine, sulphasalazine; Histamine H-Receptor Antagonists: acrivastine, astemizole, cinnarizine, cyclizine, cyproheptadine, dimenhydrinate, flunarizine, loratadine, meclozine, oxatomide, terfenadine; Lipid regulating agents: bezafibrate, clofibrate, fenofibrate, gemfibrozil, probucol; Nitrates and other anti-anginal agents: amyl nitrate, glyceryl trinitrate, isosorbide dinitrate, isosorbide mononitrate, pentaerythritol tetranitrate; HIV protease inhibitors: Nelfinavir; Opioid analgesics: codeine, dextropropyoxyphene, diamorphine, dihydrocodeine, meptazinol, methadone, morphine, nalbuphine, pentazocine; Sex hormones: clomiphene citrate, danazol, ethinyl estradiol, medroxyprogesterone acetate, mestranol, methyltestosterone, norethisterone, norgestrel, estradiol, conjugated oestrogens, progesterone, stanozolol, stibestrol, testosterone, tibolone; Stimulants: amphetamine, dexamphetamine, dexfenfluramine, fenfluramine, and mazindol. (See Benita et al., 2007 regarding a list of lipophilic drugs). [0054] The present invention also includes compositions for use in personal care and/or hygiene comprising the leaf protein-lipid-soluble material complexes disclosed herein (e.g., soaps, skin creams, soaps, cleansers, shampoos). Topical compositions containing complexes of leaf protein with vitamin E, vitamin A, conjugated linoleic acid, and essential fatty acids are preferred. The topical compositions disclosed herein are suitable for topical application to mammalian skin. The compositions comprise a safe and effective amount of the leaf protein complexes and other active agents, and a cosmetically- and/or pharmaceutically-acceptable topical carrier. [0055] The phrase “cosmetically- and/or pharmaceutically-acceptable carrier”, as used herein, means any substantially non-toxic carrier suitable for topical administration to the skin, which generally has good aesthetic properties, and is compatible with the leaf protein-lipid-soluble material complexes of the present invention. By “compatible” it is meant that the leaf protein-lipid-soluble material complexes will remain stable and retain substantial activity therein. The carrier can be in a wide variety of forms, such as sprays, emulsions, mousses, liquids, creams, oils, lotions, ointments, gels and solids. Suitable pharmaceutically-acceptable topical carriers include, but are not limited to, water, glycerol, alcohol, propylene glycol, fatty alcohols, triglycerides, fatty acid esters, and mineral oils. Suitable topical cosmetically-acceptable carriers include, but are not limited to, water, petroleum jelly, petrolatum, mineral oil, vegetable oil, animal oil, organic and inorganic waxes, such as microcrystalline, paraffin and ozocerite wax, natural polymers, such as xanthanes, gelatin, cellulose, collagen, starch or gum arabic, synthetic polymers, alcohols, polyols, and the like. Preferably, because of its non-toxic topical properties, the pharmaceutically- and/or cosmetically-acceptable carrier is substantially miscible in water. Such water miscible carrier compositions can also include sustained or delayed release carriers, such as liposomes, microsponges, microspheres or microcapsules, aqueous based ointments, water-in-oil or oil-in-water emulsions, gels and the like. [0056] The disclosed complex is also suitable as a component of tissue culture media or microbial growth media to promote growth, differentiation and/or viability of cultured cells. Milk proteins have been shown to be a suitable fatty acid carrier in cell culture (Swaisgood et al., 2001), and therefore leaf proteins should be similarly suitable. EXAMPLES Example 1 [0057] Evaluation of Different Strategies for Solubilizing Leaf Protein. [0058] The purpose of this test was to evaluate different strategies for solubilizing the leaf protein. It is necessary to solubilize the leaf protein in order to remove residual pigments, fat content and other form a complex with the target lipid-soluble molecules. [0059] Protein samples were subjected to solvent extraction with three organic solvents; hexane; acetone and methanol. Leaf protein powder prepared by the method of Lo et al. (2008) and Fu et al. (2010) has a water solubility value of 10.08±0.15 grams/liter (g/l). Hexane extraction of the protein powder yielded only a marginal increase in solubility of 10.82 g/l, whereas acetone extraction showed even smaller increase in solubility and methanol actually caused solubility to decrease. Based on these findings, the inventors did not utilize a solvent as pretreatment prior to mixing with vitamin D. Example 2 [0060] Effect of Water Content on Leaf Protein-Lipophile Complex [0061] Leaf protein samples were derived from Maryland tobacco variety 609LA, a low-alkaloid variety containing 0.6 mg/g to 0.8 mg/g of nicotine, using the method described in Lo, et al. (2008) and Fu et al. (2010). One gram of leaf protein powder was placed in a 300-ml freeze-drying glass flask (F05657000, Thermoscientific, Pittsburgh, Pa.), followed by addition of either 20 ml or 40 ml of water and 4 ml of vitamin D 3 in 99% pure ethanol (1000 ug/ml). The pH of the mixture was adjusted to pH 4.3 by gradually adding 1 M sodium hydroxide solution to the protein water solution prior to adding vitamin D 3. This mixture was then magnetically stirred for 4 minutes before liquid nitrogen was added. Approximately 250 ml of liquid nitrogen was poured into the glass until the mixture appeared completely solid. The flask was then immediately closed with the lid and carefully placed in a thermally insulated bag filled with dry ice. The connector end of the freeze-drying flask was connected to the freeze-dryer (RVT4104 model Refrigerated Vapor Trap, Thermo Electron Corporation, NY) at −110° for 96 hours. [0062] Using 40 ml of water per gram of leaf protein powder to obtain the vitamin D-protein complex, the inventors obtained a vitamin D 3 recovery of 84.68±3.92% of the total vitamin D 3 added. In contrast, use of only 20 ml of water per gram of protein powder significantly reduced the vitamin D 3 recovery to 70.21±8.92%. (See FIG. 2 ). The inventors observed that the spherical structure in the protein aggregates could not be maintained at the lower water content levels. Without wishing to be bound by theory, the inventors hypothesize that the increased water level at 40 ml helped form hydrogen bonds which maintained the protein structure. Conversely, at the lower water content level (which corresponded with higher protein density), self-stabilization of proteins may have taken place where proteins tended to form bonds which interconnected adjacent proteins, reducing the sites available for vitamin D 3 binding as well as limited surface area of ice-/water interface during the freeze-drying process. Example 3 [0063] Effect of pH on Leaf Protein—Lipophile Complex [0064] The inventors measured the effect of pH on the leaf protein—lipophile complex. They used the same preparation as described above in Example 2, except that they only used one water content level: one gram of leaf protein per 40 ml of water. They also prepared the leaf protein-vitamin D mixture described in Example 2 at three different pH levels (4.3, 8.5 and 11.0). As noted above, for pH adjustment, 1 M sodium hydroxide solution was gradually added to the protein water solution prior to adding vitamin D 3. [0065] The sample tested at pH 4.3 showed substantially higher recovery of vitamin D 3 (84.6%±3.92%, w/w) than either of the two other treatments. (See FIG. 3 ). There was also a slight increase in the water solubility of the vitamin D-protein complex at pH 4.3 from 10.08 to 10.78 g/l (See FIG. 4 ). [0066] In each of the three treatments, the crude protein represented about 30% of the vitamin D 3 -tobacco leaf protein complex. [0067] It is generally recognized that changes in pH can induce significant alterations in protein structure. At pH 4.3, the vitamin D3 -protein complex appeared to be spherical aggregates. As the pH increased to 8.5, the spherical structure opened up and bridged with adjacent aggregates, forming an interwoven structure. At pH 11.0, the spherical structure was completely disrupted, forming a continuous porous structure. In other words, porosity increased as the pH increased, corresponding to the loss of vitamin D. Without wishing to be bound by theory, the inventors believe that this increase in porosity was related to a loss of vitamin D. Again without wishing to be bound by theory, the inventors believe that that the lower porosity and spherical aggregate structure of the protein at the lower pH permitted the protein to retain or “trap” the vitamin D so it could not escape. Example 4 [0068] Effect of Protein-Vitamin Mixing Technique on Vitamin Carrying Capacity [0069] This test measured the effect of different techniques for mixing protein and vitamin D 3 on the protein's vitamin D 3 carrying capacity. They used the same preparation as described above in Example 2, except that they only used one water content level: one gram of leaf protein per 40 ml of water. The inventors also tested three mixing treatments: (i) magnetic stirring for 5 minutes, (ii) a Sonicator (28H ultrasonic bath, Neytech, Bloomfield, Conn.) at a frequency of 47±3 khZ for 5 minutes; and (iii) a combination involving the sonication treatment followed by the stirring treatment. [0070] The highest vitamin recovery was obtained when the samples were stir-mixed for 5 minutes, reaching 84.68%±3.92%, w/w (weight/weight). Sonication alone resulted in a substantial reduction in vitamin D 3 recovery 62.53%±3.68%, w/w. The temperature increased by 20° C. following sonication. Without wishing to be bound by theory, the inventors hypothesize that the sharp change in temperature may have caused degradation of vitamin D 3. Vitamin D 3 recovery was lowest when the samples were treated by both sonication and mixing (56.32±5.11%, w/w), likely due to the exposure of vitamin D 3 under elevated temperature for an extension of 5 minutes during the mixing process. (See FIG. 5 ). The crude protein content remained statistically the same in all three differentially mixed formulations. REFERENCES [0000] Abismaïl, B, J. Canseiler, A. Wilhelm, H. Delmas and C. Gourdon (1999), “Emulsification by ultrasound: drop size distribution and stability.” Ultrasonics Sonochemistry 6: 75-83. Allison S., A. Dong A, J. Carpenter (1996), “Counteracting effects of thiocyanate and sucrose on chymotrypsinogen secondary structure and aggregation during freezing, drying and rehydration.” Biophysical Journal. 71: 2022-2032. [0073] Banville, C, J. Villemard, C. Lacroix (2000), “Comparison of different methods for fortifying Cheddar cheese with Vitamin D.” International Dairy Journal 10: 375-382. [0074] Carrasquilo K G, Sanchez C, Griebenow K (2000), “Relationship between conformational stability and lyophilisation induced structural changes in chymotrypsin.” Biotechnology and Applied Biochemistry 31, 41-53. [0075] Forrest, S., R. Yada, D. Rousseau (2005), “Interactions of vitamin D 3 with bovine β-lactoglobulin A and β-casein.” Journal of Agricultural and Food Chemistry 53: 8003-8009. Fu, H., P. Machado, T. Hahm, R. Kratochvil, C. Wei and Y. Lo (2010), “Recovery of nicotine-free proteins from tobacco leaves using phosphate buffer system under controlled conditions.” Bioresource Technol: 101 (6): 2034-2042. Hudson, B and I. Karis (1973), “Aspects of vegetable structural lipids. I. The lipids of leaf protein concentrate.” Journal of the Science of Food and Agriculture 24: 1541-1550. Hsu, C. H. Nguyen, D. Yeung, D. Brooks, G. Koe, T. Bewley, R. Pearlman (1995), “Surface denaturation at solid-void interface—a possible pathway by which opalescent particulates form during the storage of lyophilized tissue-type plasminogen activator at high temperatures.” Pharm. Res. 12: 69-77. Mozafari, M, C. Johnson, S. Hatziantoniou, C. Demetzos (2008), “Nanoliposomes and their applications in food nanotechnology.” Journal of Liposome Research 18: 309-327. Qi, M., N. Hettiarachchy, U. Kalapathy (1997), “Solubility and emulsifying properties of soy protein isolates modified by pancreatin.” J. Food Sci. 62(6): 1110-1115. Semo E, Kesselman E, Danino D, Livney D (2007), “Casein micelles as a natural nano-capsular vehicle for nutraceuticals.” Food hydrocolloids, 21, 936-942. Sharma A, U. Sharma (1997), “Liposomes in drug delivery: progress and limitations.” International Journal of Pharmaceutics 154: 123-140. Sheen J., (1991), “Comparison of chemical and functional properties of soluble leaf proteins from four plant species.” Journal of Agricultural and Food Chemistry, 39, 681-685. Sheen, J. V. Sheen (1985), “Functional properties of Fraction 1 Protein from tobacco leaf.” Journal of Agricultural and Food Chemistry 33: 79-83. Tso, T. C. (2006), “Tobacco research and its relevance to science, medicine and industry.” Contributions to Tobacco Research 22: 133-146. Tso, T. C. (1990). Production, Physiology, and Biochemistry of Tobacco Plant, Ch. 22: Organic Metabolism—Tobacco Proteins.” Ideals, Inc., Beltsville, Md. Tso, T. S. Kung (1983), “Soluble proteins in tobacco and their potential use.” In: Leaf Protein Concentrates, Tehel L and Graham D G (eds.), Avi Publishing Company Inc., Connecticut, pp. 117-131. Wang, Q., J. Allen and H. Swaisgood (1997), “Binding of vitamin D and cholesterol to beta-lactoglobulin,” Journal of Dairy Science 80(6): 1054-1059. Wang W (2000) “Lyophilization and development of solid protein pharmaceuticals.” International Journal of Pharmaceutics 203: 1-60. Wildman S G (1983), “An Alternative Use for Tobacco Agriculture: Protein for Food Plus a Safer Smoking Material.” In Plants: The Potentials for Extracting Protein, Medicines, and Other Useful Chemicals—Workshop Proceedings; US. Congress, Office of Technology Assessment: Washington, D.C., OTA-BP-F-23, pp 63-77. Zimet, P. et al. (2009), “Beta-lactoglobulin and its nanocomplexes with pectin as vehicles for ω-3 polyunsaturated fatty acids.” Food Hydrocolloids: 23(4): 1120-1126. U.S. Pat. No. 6,290,974 to Swaisgood, et al. U.S. Pat. No. 5,597,595 to DeWille, et al. U.S. Pat. No. 5,462,593 to Poppe, et al. U.S. Pat. No. 4,737,367 to Langer, et al. U.S. Pat. No. 4,554,333 to Krinski, et al. U.S. Pat. No. 4,144,895 to Fiore, et al. WO/2010/045648 to Lo, et al. WO/2008/143914 to Lo, et al. WO/2007/083316 to Benita, et al. [0101] All publications, patents and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. [0102] Modifications may be made without departing from the basic spirit of the present invention. Accordingly, it will be appreciated by those skilled in the art that within the scope of the appended claims, the invention may be practiced other than has been specifically described herein. SUMMARY: [/INST] This invention describes a novel composition of matter describing a complex comprising leaf protein and a lipophilic substance(s), along with the method of producing it. Delivery of lipid-soluble materials into the body is challenging because they are generally highly insoluble in water and very subject to oxidative degradation. The inventors have found that leaf protein-the water-soluble proteins derived from plant leaves-can efficiently form a complex with lipophilic materials. This leaf protein-lipid-soluble material complex is an effective carrier of lipophilic substances. As such, the leaf protein-lipid-soluble material complex disclosed herein can be used for the delivery of lipophilic vitamins, fatty acids, caretenoids, lipophilic drugs, and other lipophilic materials. This complex can be used to deliver lipophiles in foods, nutritional and dietary supplements, topical compositions and in pharmaceutical products. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The Nrf family of transcription factors mediates adaptive responses to stress and longevity, but the identities of the crucial Nrf targets, and the tissues in which they function in multicellular organisms to promote survival, are not known. Here, we use whole transcriptome RNA sequencing to identify 810 genes whose expression is controlled by the SKN-1/Nrf2 negative regulator WDR-23 in the nervous system of Caenorhabditis elegans. Among the genes identified is the synaptic cell adhesion molecule nlg-1/neuroligin. We find that the synaptic abundance of NLG-1 protein increases following pharmacological treatments that generate oxidative stress or by the genetic activation of skn-1. Increasing nlg-1 dosage correlates with increased survival in response to oxidative stress, whereas genetic inactivation of nlg-1 reduces survival and impairs skn-1-mediated stress resistance. We identify a canonical SKN-1 binding site in the nlg-1 promoter that binds to SKN-1 in vitro and is necessary for SKN-1 and toxin-mediated increases in nlg-1 expression in vivo. Together, our results suggest that SKN-1 activation in the nervous system can confer protection to organisms in response to stress by directly regulating nlg-1/neuroligin expression. Oxidative stress is generated in cells when an imbalance occurs between the production of electrophilic reactive species and the endogenous defenses against these harmful molecules [1]. Increased reactive oxygen species (ROS) can cause damage to cellular components such as lipids, DNA, and proteins, and can result in a myriad of detrimental effects, including protein aggregation, changes in cell signaling, or altered cell cycle progression. Given the nervous system' s high metabolic demands, high lipid and iron content, and low regenerative ability, it is not surprising that oxidative stress is particularly detrimental to this tissue; indeed, elevated levels of reactive species have been implicated in a range of neurodegenerative diseases including Parkinson' s disease, Alzheimer' s disease and amyotrophic lateral sclerosis [2]–[4]. In multicellular organisms, investigating pathways that can mitigate the consequences of elevated oxidative stress on a cellular and organismal level is an ongoing area of investigation. The Nrf (nuclear factor E2-related factor) family of transcription factors controls the primary response to oxidative and xenobiotic stress in mammals [5]–[7]. Studies of Nrf2 have established a critical role for the transcription factor in defending tissues from oxidative damage [7], [8]. During normal conditions, Nrf2 is sequestered in the cytoplasm by the kelch-domain containing protein Keap1; in response to stress, Keap1 releases Nrf2, allowing the transcription factor to translocate into the nucleus and initiate transcription of downstream targets by binding to the antioxidant response element (ARE) in the promoter region of stress response genes [6], [9]. Nrf2 is ubiquitously expressed, and in neurons, increased Nrf2 activity protects against toxicity by hydrogen peroxide, glutamate, and mitochondrial toxins [10], [11]. Microarray studies using neuronal cultures lacking Nrf2 have identified detoxifying, antioxidant and defense genes to be regulated by the transcription factor [10]–[12]. Interestingly, these studies have also found changes in the expression of genes involved in a variety of processes, including cell signaling and calcium homeostasis, as well as neuron-specific genes, but the functional significance of these changes has not been determined. In C. elegans, the Nrf family homolog SKN-1 [13] confers cellular and organismal protection from a variety of environmental stressors. Although most studies have examined detoxification and stress response in the intestine, a role for SKN-1 in the nervous system is emerging. SKN-1 functions in a pair of neurons to promote longevity [14], and systemic knockdown of skn-1 increases dopaminergic neuron degeneration during methylmercury, aluminum and manganese toxicity [15]–[17]. Furthermore, loss of skn-1 enhances manganese-induced organismal death [18]. In C. elegans, the abundance of SKN-1 is negatively regulated in part by the DDB-1/CUL-4 ubiquitin ligase substrate targeting protein WDR-23, which is proposed to function in an analogous manner as Keap1 to promote degradation of SKN-1 during non-stressed conditions. [19], [20]. Mutants lacking wdr-23 have increased SKN-1 protein levels, express high levels of genes involved in antioxidant and xenobiotic responses, and are resistant to stress [19]–[21]. In this study, we find that SKN-1 is negatively regulated by WDR-23 in cholinergic motor neurons. Using whole transcriptome RNA sequencing (RNAseq) of wdr-23 mutants expressing functional wdr-23a in the nervous system, we identify 810 genes whose expression is likely to be regulated by SKN-1; one of these is the cell adhesion molecule nlg-1/neuroligin. Both nlg-1 expression in neurons and NLG-1 protein abundance at synapses increase in mutants with increased SKN-1 activity as well as in animals exposed to toxins that generate mitochondrial stress. Furthermore, increasing NLG-1 protein abundance enhances survival following toxin treatment, and loss of nlg-1 diminishes SKN-1-mediated toxin resistance. Together, these results support a role for SKN-1 in promoting organismal survival by regulating synaptic neuroligin abundance. The skn-1 locus encodes three isoforms, skn-1a, skn-1b and skn-1c (wormbase. org), which differ in their N termini and utilize unique transcriptional start sites. skn-1c is primarily detected in the intestine; skn-1b, on the other hand, is expressed principally in a pair of sensory neurons and is involved in dietary restriction induced longevity [13], [14]. The expression of the longest isoform, skn-1a, however, has not been examined. To examine the expression of skn-1a, we generated a fluorescent reporter by using a 7. 3 kb fragment upstream of the skn-1a start site to drive gfp fused to a nuclear localization signal (nls-gfp). skn-1a is a downstream gene within the bec-1/beclin operon [14], [22], [23], and the 7. 3 kb fragment includes the bec-1 coding region and 3. 3 kb upstream of bec-1 (Figure 1A). In animals expressing this construct, fluorescence was observed in many tissues, as previously reported [24], [25], as well as in cholinergic neurons of the ventral cord (labeled with the unc-17/VAChT promoter expressing mCherry) and GABAergic neurons (unlabeled ventral cord neurons; Figure 1B). WDR-23 has two isoforms, WDR-23a and WDR-23b, which are expressed in neurons of the ventral cord [19]–[21]. In cholinergic neurons of the ventral cord, a WDR-23a: : GFP fusion protein was found in cell bodies and in axons where it adopted a punctate pattern of fluorescence (Figure 1C), whereas WDR-23b: : GFP localized exclusively to nuclei (Figure 1D). In axons, WDR-23a puncta co-localized with a synaptic vesicle marker (Figure 1C), and WDR-23a fluorescence became diffuse in animals lacking unc-104/kinesin (Figure 1E′), which is required for trafficking of organelles along microtubules in neurons [26]. This suggests that WDR-23a associates with presynaptic organelles. WDR-23a also co-localized with a mitochondrial marker at synapses (Figure 1E), and in unc-104 mutants, WDR-23a puncta remained co-localized with displaced mitochondria in axons (Figure 1E′). In mutants defective in drp-1/Drp1, a protein required for normal mitochondrial fission [27], both WDR-23 and mitochondrial markers became displaced in axons (Figure 1E″). Together, these results suggest that WDR-23a may associate with presynaptic organelles, including mitochondria, at synapses. Consistent with this, WDR-23a co-localizes with outer mitochondrial membrane markers when expressed in muscle cells [20]. To test whether WDR-23 regulates the abundance of SKN-1 in the nervous system, as it does in the intestine [19], [21], we examined the abundance of SKN-1a: : GFP fusion proteins in motor neurons. We drove SKN-1a: : GFP expression using the cholinergic unc-17/VAChT promoter since unc-17 is not transcriptionally regulated by wdr-23 [20], and therefore changes in SKN-1a: : GFP should reflect changes in protein abundance and not skn-1 expression. In wild type animals, SKN-1a: : GFP fluorescence was detected in 49% (n = 272) of ventral cord cholinergic neurons (Figure 2A), consistent with low levels of SKN-1 reported in the intestine in non-stressed animals [13]. In wdr-23 mutants, SKN-1a: : GFP fluorescence was detected in a larger fraction of neurons compared to wild type animals (77%, n = 349). In addition, the average fluorescence intensity of SKN-1a: : GFP in neuronal cell bodies of wdr-23 mutants increased compared to wild type controls (Figures 2A and 2B; mean fluorescence±sem wt: 44. 7±2. 8; wdr-23: 62. 6±3. 1; p<0. 001, Student' s t-test). Together, these results suggest that WDR-23 negatively regulates the abundance of SKN-1a in motor neurons. wdr-23 mutants have a variety of developmental and behavioral defects including reduced locomotion, resistance to stress, small size, and developmental delay. Each of these defects is suppressed by loss of skn-1 [19]–[21], suggesting that the primary function of WDR-23 is to negatively regulate SKN-1. We previously identified 2,285 transcripts that are significantly up-regulated in wdr-23 mutants compared to wild type controls using RNAseq [20]. To identify genes among these that are regulated by WDR-23 specifically in the nervous system, we performed RNAseq of wdr-23 mutants expressing an integrated array of full-length wdr-23a cDNA driven by the pan-neuronal snb-1 promoter (referred to as WDR-23 rescue). Of the 2,285 genes whose expression increased in wdr-23 mutants, transcripts of 810 were significantly reduced in the WDR-23 rescue animals (Figure 3A and Table S1). The average expression levels of the rescued genes in wdr-23 mutants was 20. 74 fold above wild type which is similar to the average of 23. 99 for all 2,285 genes, indicating that the rescue was not caused by a bias generated by rescuing specifically low expressing genes in wdr-23 mutants. We used the Database for Annotation, Visualization and Integrated Discovery (DAVID) [28], to assign GO terms for the 810 rescued genes; of the 492 genes with predicted functions, many genes involved in stress, detoxification and metabolism were identified, consistent with the known stress response roles of skn-1 (Figure 3B). The expression of 177 genes has been experimentally examined (wormbase. org), and 93 of these are expressed in the nervous system (Figure 3C and Table S1). A subset of these is expressed exclusively in neurons (Table 1), including eight genes encoding insulins or FMRFamide related peptides, as well as three genes encoding proteins involved in neuropeptide processing—egl-3/proprotein convertase, egl-21/carboxypeptidase, and sbt-2/7B2. We also identified five genes encoding synaptic proteins, including unc-13/Munc13, nlg-1/neuroligin, pde-4/cyclic nucleotide phosphodiesterase, dlk-1/MAPKKK, and cab-1/NPDC-1 [29]–[32]. Together, these results suggest that neuronal WDR-23, possibly through SKN-1, regulates the expression of genes involved in neuroendocrine signaling and synaptic function. To identify genes that may be direct SKN-1 targets, we examined the promoters of the neuronal genes for the presence of consensus SKN-1 binding sites. SKN-1 is predicted to bind the consensus sequence WWTDTCAT on either strand in the promoters of target genes. Using the web based program Regulatory Sequence Analysis Tools (RSAT), we scanned 1000 bp promoter fragments for each gene for the SKN-1 consensus [33]; the promoter fragments for 70 of the 93 neuronal genes contained at least one potential binding site (Table S1). We then cross-referenced the list of rescued neuronal genes with SKN-1 ChIP-seq datasets taken from L1, L3 and L4 stage animals (ModEncode and [34]) and found that 31 genes contained significant SKN-1 peaks within 2000 bp upstream or 500 bp downstream of the transcription start site (Table S1). These results indicate that a subset of the neuronal genes identified by RNAseq may be direct binding targets of SKN-1. Among the neuronal genes containing SKN-1 consensus sites in their promoter, the cell adhesion molecule nlg-1/neuroligin emerged as an interesting candidate since it has been implicated in C. elegans stress response and in synaptic function [30], [35], [36]. nlg-1 is the sole neuroligin family ortholog in C. elegans, and NLG-1 is expressed in cholinergic motor neurons where it localizes to presynaptic terminals [35], [37]. To examine the effects of skn-1 on nlg-1 expression, we constructed reporter strains consisting of a 3. 6 kb nlg-1 rescuing promoter fragment [30] driving soluble gfp (Pnlg-1: : gfp, vjIs47, and vjIs48; Figure 4A). In wild type animals, we detected Pnlg-1: : gfp fluorescence in a few head neurons and in ventral nerve cord neurons, previously reported to be DA and VA class cholinergic motor neurons [30], [35]. nlg-1 reporter fluorescence has been reported at low levels in muscles [30], but we did not detect Pnlg-1: : gfp in muscle cells in either transgenic line. In mutants lacking wdr-23, Pnlg-1: : gfp fluorescence in motor neurons increased approximately 5 fold (Figure 4B and 4C), in agreement with the 5. 6 fold increase in nlg-1 transcript levels detected by RNAseq [20]. Cell-specific expression of either wdr-23a or wdr-23b cDNA in nlg-1 expressing cells (using the nlg-1 promoter) fully rescued the increased Pnlg-1: : gfp fluorescence to wild type levels (Figures 4B and 4C), indicating that the regulation of nlg-1 expression by wdr-23 is cell autonomous. In skn-1 mutants lacking the skn-1a/c isoforms (zu67 mutants), Pnlg-1: : gfp expression was similar to wild type. However, skn-1 is required for the increased Pnlg-1: : gfp fluorescence caused by loss of wdr-23, since skn-1 mutations reduced the Pnlg-1: : gfp reporter fluorescence of wdr-23 mutants to wild type levels (Figures 4D and 4E). Conversely, Pnlg-1: : gfp fluorescence increased by ∼35% in mutants in which skn-1 is hyperactive (lax120gf or lax188gf; Figure 4F). lax120gf and lax188gf are thought to prevent SKN-1a/c interaction with mitochondrial docking proteins, resulting in an activated pool of SKN-1a/c [38]. Together, these results show that skn-1 is not necessary for baseline nlg-1 expression in motor neurons, but skn-1 activation positively regulates nlg-1 expression. The nlg-1 promoter has four SKN-1 binding consensus sites within 500 bp upstream of the transcriptional start site (Figure S1). Promoter alignments between the nematode Caenorhabditis species elegans, briggsae, japonica and remanei revealed that one of these sites located 396 bp upstream of the C. elegans start is completely conserved in all species (Figure S1). This site has the sequence AATGTCAT, which matches the consensus perfectly. The underlined region is predicted to be a largely invariant sequence that directly interacts with SKN-1 [13], [39]. We mutated AATGTCAT at −396 to AACTGCAG in the Pnlg-1: : gfp reporter to create a reporter with a deleted binding site (the Pnlg-1 (Δbs): : gfp reporter; Figure 4A). Basal motor neuron fluorescence of transgenic animals expressing Pnlg-1 (Δbs): : gfp was similar to transgenic animals expressing the Pnlg-1: : gfp reporter (Figure 4B). However, Pnlg-1 (Δbs): : gfp reporter fluorescence did not increase in either wdr-23 mutants or in skn-1 (gf) mutants compared to wild type controls (Figure 4B, 4C and 4F), suggesting that this site is critical for skn-1-mediated increases in nlg-1 expression. To test whether SKN-1 binds to this site, we performed electrophoretic mobility shift assays. In vitro translated SKN-1a bound to labeled probes containing the putative SKN-1 binding site in the nlg-1 promoter, and binding was disrupted by the addition of excess unlabeled probe (Figure 4G). These results indicate that the SKN-1 binding site at −396 in the nlg-1 promoter can be bound by SKN-1 in vitro and is critical for skn-1-induced expression of nlg-1 in vivo. To determine whether the transcriptional regulation of nlg-1 by SKN-1 impacts NLG-1 protein levels at synapses, we examined synaptic levels of NLG-1 in animals expressing a fusion protein in which GFP was inserted near the C-terminus of NLG-1 (NLG-1-GFP, vjEx561 and vjIs105). This fusion protein is functional [30] and localizes to presynaptic terminals in motor neurons [35], [37]. NLG-1-GFP driven by the nlg-1 promoter adopted a punctate pattern of fluorescence in the dorsal and ventral cords, where presynaptic terminals of DA and VA class motor neurons are located, respectively (Figure 5A). We examined changes in the synaptic abundance of NLG-1-GFP by measuring the average punctal fluorescence intensity (peak fluorescence) and synapse number (interpunctal interval) [40], [41]. In skn-1 (gf) mutants, the punctal fluorescence of NLG-1-GFP significantly increased in both the dorsal and ventral cords, while the interpunctal interval did not change (Figure 5A, 5B and Table S2). These results indicate that SKN-1 positively regulates synaptic NLG-1 protein abundance but does not affect synapse number. We next tested whether toxins that induce oxidative stress could increase neuroligin expression and abundance in motor neurons. We found that exposure to the mitochondrial stressors juglone or sodium arsenite, both of which have been shown to activate skn-1 [42], [43], robustly induced Pnlg-1: : gfp fluorescence in motor neurons compared to untreated animals (Figure 6A and 6B). Treatment with an organic mercury (thimerosal) increased nuclear SKN-1: : GFP in the intestine (Figure S2) and also increased Pnlg-1: : gfp fluorescence (Figure 6B). However, these toxins had no effect on Pnlg-1 (Δbs): : gfp fluorescence (Figure 6A and 6B). We found that juglone treatment significantly increased punctal fluorescence of NLG-1-GFP, without changing the interpunctal interval (Figure 6C, 6D and Table S2). These results suggest that activation of skn-1 by oxidative stress increases NLG-1 synaptic abundance by increasing nlg-1 expression in neurons. To further explore how SKN-1 activity is regulated in the nervous system, we tested the impact of altering insulin signaling, mitochondrial respiration or synaptic activity on Pnlg-1: : gfp expression. The insulin-like signaling (IIS) pathway regulates SKN-1 in the intestine [44]; activation of DAF-2/insulin-like receptor leads to SKN-1 phosphorylation by SGK-1/SGK, resulting in decreased SKN-1 activity. We examined putative null sgk-1 mutants and found that Pnlg-1: : gfp reporter fluorescence increased by ∼25% (Figure S3). Conversely, during conditions of stress, PMK-1/p38 MAPK phosphorylates SKN-1, resulting in nuclear SKN-1 translocation [45]. We found no change of baseline Pnlg-1: : gfp fluorescence in mutants lacking either sek-1/MAPKK or pmk-1 (Figure 6E, 6F and S3). However, sek-1 and pmk-1 mutations suppressed the juglone-induced increase in Pnlg-1: : gfp reporter fluorescence (Figure 6E and 6F). C. elegans mutants with impaired mitochondrial respiration, for example the conserved clk-1/COQ7, necessary for the biosynthesis of coenzyme Q, and isp-1/ISP, a subunit of mitochorial complex III, are resistant to toxins that increase oxidative damage [46]. pink-1/PINK1, on the other hand, is predicted to act in conjunction with the E3 ligase Parkin to initiate mitophagy of damaged mitochondria [47], [48]. Pnlg-1: : gfp expression increased mildly in mutants lacking clk-1, but not isp-1. Conversely, loss of pink-1 resulted in a significant decrease of Pnlg-1: : gfp fluorescence (Figure S3). Finally, in order to test whether neuronal activity regulates SKN-1 in the nervous system, we examined mutants with increased synaptic activity (dgk-1/diacylglycerol kinase or goa-1/Gαo) and mutants with decreased activity (unc-2/VGCC or unc-18/nSec1), as well as mutants lacking mef-2/MEF and mir-1/microRNA, which are involved in a retrograde synaptic signaling pathways that is dependent on nlg-1 [35]. We detected no change in reporter fluorescence in these mutants (Figure S3). Together, these results indicate that insulin signaling and mitochondrial metabolism contribute to the activation of SKN-1 in neurons, while changes in synaptic transmission do not seem to impact neuronal SKN-1 activity. We next sought to determine whether nlg-1 mediates the protective effects of skn-1 activation in response to environmental toxins. skn-1 mutants are hypersensitive to toxicity induced by arsenite and juglone treatment (Figure 7A and S4; [42], [43]). In addition, we found that skn-1 mutants were sensitive to thimerosal-induced toxicity (Figure S5), in agreement with studies showing SKN-1 protects from metal toxicity [15], [18]. In contrast, animals lacking wdr-23 were resistant to toxicity of both thimerosal and juglone, and resistance was completely blocked by loss of skn-1 (Figures 7A and S5; [43]). Similarly, hyperactive skn-1 (gf) mutants were resistant to juglone toxicity (Figure 7B and S6). Interestingly, loss of wdr-23 did not confer protection against sodium arsenite (Figure S4), suggesting specificity in drug resistance in mutants lacking wdr-23. nlg-1 mutants are hypersensitive to heavy metal toxicity by thimerosal and oxidative stress induced by paraquat [30]. We found that mutants lacking nlg-1 were also more sensitive to juglone toxicity (Figure 7A and S5). In contrast, transgenic animals over-expressing NLG-1-GFP were significantly more resistant to juglone-induced toxicity compared to non-transgenic controls (Figure 7C). To confirm that the juglone resistance caused by NLG-1-GFP transgenes was due to nlg-1 expression, we examined juglone responses of animals expressing Pnlg-1: : gfp and found that they were not as resistant to juglone as NLG-1-GFP expressing animals (Figure S7). Finally, nlg-1 mutations dramatically reduced the ability of activated skn-1 to protect animals from the toxic effects of juglone: skn-1 (gf); nlg-1 double mutants were significantly less resistant to juglone than skn-1 (gf) mutants alone (Figure 7B). Together, these data suggest that the dosage of nlg-1 is a critical determinant of survival in response to stress, and that nlg-1 contributes to skn-1-dependent survival. Previous studies have demonstrated SKN-1/Nrf2 dependent transcriptional programs are initiated in response to oxidative and xenobiotic stress, and these programs are critical for organismal survival and longevity [42], [43], [49]. Among the genes regulated by SKN-1, few have been shown to mediate the protective effects of SKN-1, and fewer still have been shown to be direct binding targets. Furthermore, attempts to identify a comprehensive set of genes regulated by SKN-1/Nrf2 required to protect organisms from stress have been difficult due to the lack of tissue-level resolution. Here, we have used comparative whole transcriptome RNA sequencing to identify an inclusive set of genes that are likely to be regulated by SKN-1 in the nervous system. For this analysis, we examined wdr-23 mutants expressing a rescuing wdr-23a transgene driven by the pan-neuronal snb-1 promoter. Genetic studies indicate that several distinct phenotypes displayed by wdr-23 mutants are completely suppressed by skn-1, indicating that SKN-1 is selectively activated in wdr-23 mutants, and a yeast-two hybrid screen identifies the only binding target of WDR-23 to be SKN-1 [19], indicating that SKN-1 is selectively activated in wdr-23 mutants. Interestingly, wdr-23 mutants appear to activate SKN-1 to a greater extent than skn-1 (gf) mutations or toxin treatment. For example, loss of wdr-23 results in greater survival in response to juglone treatment than skn-1 (gf) mutations. In addition, wdr-23 mutations increase nlg-1 expression in the ventral cord neurons fivefold, whereas skn-1 (gf) or toxin treatment increased it by approximately 30%. Thus, wdr-23 mutants may provide increased sensitivity when used for transcriptional profiling, maximizing our ability to identify SKN-1 targets expressed in low abundance or in a small subset of cells. It is, however, possible that WDR-23 has functions beyond SKN-1 regulation, in which case some of the genes identified by this approach may not be targets of SKN-1. While the snb-1 promoter fragment drives expression of GFP strongly in the nervous system, the possibility that this promoter may be leaky raises the prospect that some of the genes identified here may be regulated by WDR-23 in other tissues in addition to the nervous system. The 810 genes identified here most likely represent either direct SKN-1 targets or indirect targets of SKN-1 that are secondarily activated in neurons or other tissues. SKN-1 ChIP-seq of larval stage animals identified a list of approximately 3000 genomic peaks bound by SKN-1 in vivo [34]; we cross-referenced our gene list of rescued neuronal genes with SKN-1 ChIP-seq datasets taken from L1, L3 and L4 stage animals [34] and found that a subset of the genes we identified contain a significant SKN-1 peak near to their transcriptional start sites (Table S1), but many genes do not. Differences between these datasets may be a byproduct of using non-stressed animals for the ChIP-seq experiments, reflecting basal, but not stress-induced, promoter occupancy by SKN-1. Among the genes we identified were several neuropeptides and insulins, as well as peptide processing enzymes reported to be expressed in neurons. We speculate that stress-induced peptide processing and release may be part of a humoral response to promote organismal survival. Identification of the precise peptidergic signaling pathways will help to elucidate the mechanisms by which SKN-1 confers survival. We also identified a handful of known synaptic genes, including two cell adhesion molecules, nlg-1 and ncam-1, indicating SKN-1 might play a role in maintaining the stability of neural networks. A theory has emerged suggesting axonal retraction might precede neuronal apoptosis in neurodegeneration, called dying back degeneration [50], and synaptic breakdown may occur prior to axonal retraction. The identification of cell adhesion molecules in this study suggests that prior to synaptic breakdown, neurons might initiate transcriptional programs to protect the integrity of the synapse. In support of this, recent evidence suggests that increased expression of NCAM in SH-SY5Y cultures prevents oxidative stress-induced apoptosis, and over-expression of a truncated NCAM molecule protects neuronal tissue in lesioned rats [51], [52]. Activation of SKN-1/Nrf2 can protect against cell toxicity induced by oxidative stress [53]–[55]. In primary neuronal cultures, for example, activation of Nrf2 prevents cell death in response to rotenone and MPP, potent inhibitors of mitochondrial respiration [11]. Loss of OPA1, a key regulator of the morphology of mitochondria, results in increased Nrf2 activation [56]. These studies and others collectively suggest a potential role for SKN-1/Nrf2 as a sensor for increased mitochondrial dysfunction in the nervous system. We found that genes involved in drug detoxification, including the glutathione precursors gst-4, gst-10, gcs-1, and gst-1 were reduced by neuronal expression of wdr-23a. Interestingly, gst-1 has also been shown to contribute to dopaminergic neuron survival after manganese treatment [16]. Given their confirmed expression in neurons, is possible that these genes have a role in directly enhancing neuronal protection. SKN-1 associates with purified mitochondrial fractions, and the skn-1 (gf) alleles are proposed to reduce mitochondrial association, suggesting that mitochondria may act as a sink for SKN-1 [38]. Our data is consistent with the idea that WDR-23a associates with presynaptic organelles, including mitochondria. First, WDR-23a localizes to presynaptic terminals, where mitochondria are abundant. Second, WDR-23a remains associated with mitochondria in mutants in which mitochondria are displaced. Third, WDR-23a localizes to the outer membrane of mitochondria in muscle cells [20]. We speculate that WDR-23 may be a mitochondrial stress sensor that regulates SKN-1 abundance. Our data supports the idea that SKN-1 activation leads to increased NLG-1 abundance at synapses. We found that nlg-1 confers some, but not all, of the protective effects of activation of SKN-1, as nlg-1 mutations reduced, but did not eliminate, the resistance of skn-1 (gf) mutants to juglone. Additional SKN-1 targets either in neurons or in other tissues are likely to contribute to organismal survival in response to juglone treatment. Interestingly, loss of nlg-1 did not suppress wdr-23 mutants resistance to thimerosal or juglone (Figure S5 and data not shown). This may be due to higher SKN-1 activity in wdr-23 mutants compared to skn-1 (gf) mutants, which may compensate for the lack of nlg-1. Because nlg-1 mutants themselves are hypersensitive to stress, it is possible that nlg-1 and skn-1 function in parallel pathways to promote resistance; however, our data do not support this idea, but rather support the notion that nlg-1 is a direct transcriptional target of SKN-1. Basal nlg-1 transcription is not likely to be under skn-1 regulation, since nlg-1 reporter expression remains unchanged in skn-1 mutants. Consistent with this, SKN-1 does not occupy the SKN-1 binding site we identified at position −396 in the nlg-1 promoter in unstressed larval animals by ChIP-seq analysis. How might increased expression of a synaptic cell adhesion molecule promote organismal survival in response to stress? Recent work has established the presence of “mitokines” in neurons—a signal produced in the neurons in response to dysfunctional mitochondrial electron transport [57]; release of these mitokines results in increased organismal survival. It is possible that nlg-1 may be required in neurons for proper release of mitokines. Furthermore, the neuropeptides identified in this study are candidates for being signals released in response to stress to promote resistance. nlg-1 expression has been detected in head neurons, motor neurons, and muscle cells [30]; thus, it is possible that nlg-1 functions in any of these tissues to convey protection. In mammals, neuroligin is a post-synaptic cell adhesion molecule that binds to the presynaptic protein neurexin; this junction is necessary for maintaining mature synaptic connections and normal synaptic transmission [58], [59]. In humans, rare mutations in neuroligin are associated with autism and other cognitive disorders. Some of these mutations reduce neuroligin delivery to the cell surface, interfering with synapse development and synaptic transmission [60]–[62]. Interestingly, it has been suggested that oxidative stress and mitochondrial dysfunction may play a role in the pathogenesis of autism, as certain biomarkers for oxidative stress are elevated in autistic patients [63]–[65]. It is possible that individuals with these mutations are unable to increase synaptic neuroligin levels in response to stress, and it will be interesting to identify the cellular and molecular mechanisms underlying neuroligin-dependent survival in response to stress. Strains were cultured at 20° using standard methods. All experiments were performed on young adult hermaphrodites unless otherwise indicated. The following strains were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources (NCRR): sek-1 (km4), pmk-1 (km25), sgk-1 (ok538), skn-1 (zu67), nlg-1 (ok259), clk-1 (e2519), mef-2 (gv1), mir-1 (gk276), isp-1 (gm150), and pink-1 (ok3538). Strain wdr-23 (tm1817) was provided by the National BioResource Project (Japan). The wild type reference strain was N2 Bristol. The following strains were also used: drp-1 (tm1108), dgk-1 (nu62), goa-1 (sa734), unc-2 (lj1), unc-18 (md299), glo-1 (zu391), unc-104 (e1265), skn-1 (lax120gf), skn-1 (lax188gf), nuIs152[Pttx-3: : RFP, Punc-129: : GFP: : SNB-1]II, nuIs321[Pmyo-2: : GFP, Punc-17: : mCherry], nuIs225[Pmyo-2: : GFP, Psnb-1: : WDR-23a], idIs7[rol-6 (su1006), Pskn-1: : skn-1b/c: : GFP], yuIs25[Pmyo-2: : GFP, Punc-129: : mito-GFP]V, and vjIs26[Pmyo-2: : GFP, Punc-129: : WDR-23a: : GFP]III. Mutant strains were outcrossed a minimum of 4 times; all integrants were outcrossed at least 8 times. C. elegans cDNA was used to clone all genes into pPD49. 26 using standard molecular biology techniques, unless otherwise noted. Promoter elements were amplified from mixed stage genomic DNA. The following plasmids were generated: pTS147[Punc-129: : invom: : rfp], pTS31[Pbec-1: : nls-gfp], pDS284[Pnlg-1: : gfp], pDS286[Pnlg-1 (ΔBS): : gfp], pKG8[Pnlg-1: : nlg-1-gfp], pTS79[Punc-17: : skn-1a: : gfp], pDS139[Punc-129: : snb-1: : mCherry], pDS237[Psnb-1: : wdr-23a: : gfp], pTS85[Psnb-1: : wdr-23b: : gfp], pDS334[Pnlg-1: : wdr-23a], pDS335[Pnlg-1: : wdr-23b], and pTS199[T7: : skn-1a]. Oligo sequences: Pbec-1 oTS44: ccccccGGATCCcgacaattatacatgttcccc oTS45: ccccccGCTAGCcgactgactggattatgatagatcc Pnlg-1 oDS694: ccccccGCATGCtaagcccccgtacgctaacacc oXL13: ccccccGGATCCgcctgttcacttccaaattcgc Pnlg-1 (Δbs) oDS692: cctgttgccccccaaatgCTGCAGttacctcttttcctcccttctacc oDS693 ggtagaagggaggaaaagaggtaaCTGCAGcatttggggggcaacagg Transgenic strains were generated by injecting N2 with expression constructs (2. 5–90 ng/µL) and the co-injection marker KP#708 (Pttx-3: : rfp, 40 ng/µL) or KP#1106 (Pmyo-2: : gfp, 10 ng/µL). Microinjection was performed using standard techniques as previously described [66]. At least three lines for each transgene were examined for expression, and representative lines were quantified. The following strains were made: vjEx7[Punc-129: : wdr-23b: : gfp] vjEx663[Punc-129: : invom: : rfp], vjEx254[Pbec-1: : nls-gfp], vjEx391[Pnlg-1 (Δbs): : gfp], vjEx756[Pnlg-1 (Δbs): : gfp], vjEx561[Pnlg-1: : nlg-1-gfp], vjEx339[Punc-129: : snb-1: : mCherry], vjEx423[Psnb-1: : wdr-23a: : gfp], vjEx426[Psnb-1: : wdr-23b: : gfp], vjEx447[Pnlg-1: : wdr-23a], vjEx436[Pnlg-1: : wdr-23b], vjIs45[Punc-17: : skn-1a: : gfp]II, vjIs47[Pnlg-1: : gfp]IV, vjIs48[Pnlg-1: : gfp]I, vjIs105[Pnlg-1: : nlg-1-gfp]III. To image animals, adult worms were paralyzed using 2,3-butanedione monoxime (BDM, 30 µg/µL; Sigma) and mounted on 2% agarose pads for imaging. Images were captured with a Nikon eclipse 90i microscope equipped with a Nikon PlanApo 60× or 100× objective (NA = 1. 4) and a PhotometricsCoolsnap ES2 camera. For fluorescence imaging of synapses, images were captured either from the ventral or dorsal cord near the posterior gonadal bend of the worm, as indicated. Images of animals expressing nlg-1 reporters were captured at the ventral cord near the posterior gonadal bend of the worm. We found that skn-1 mutants expressing fluorescent integrants arrest at larval stages when the integrant is homozygous, making quantification of fluorescence markers challenging; however, skn-1 mutants expressing heterozygous integrants develop fully into adults. Metamorph 7. 0 software (Universal Imaging/Molecular Devices) was used to capture serial image stacks, and the maximum intensity projection was used for analysis of the dorsal and ventral cords. Line scans of the maximum intensity projection image were also recorded using Metamorph. The fluorescence intensity values were then quantified using Puncta 6. 0 software written with Igor Pro (Wavemetrics), as previously described [67]. For all experiments, fluorescence values were normalized to the values of 0. 5 µm FluoSphere beads (Invitrogen) captured during each imaging session. This was performed to provide a standard for comparing absolute fluorescence levels between animals from different sessions. To quantify changes in neuronal SKN-1a: : GFP, an anterior and posterior image was taken for each animal in both RFP and GFP channels. Cell bodies were identified by the presence of soluble mCherry. Average cell body fluorescence was calculated by outlining the entire cell body and taking the average intensity. Background values were determined by finding the average fluorescence of the area immediately adjacent to the cell body and were subtracted from each cells' average fluorescence. Cells were categorized as low, medium, or high expressing cells using arbitrary cut off levels after background subtraction—low expressing cells were those cells below the level of detection (less than 30 units different than background fluorescence), medium expressing cells were between 30–70 arbitrary units, and high expressing cells had a total fluorescence greater than 70 units. Stock solutions of 50 mM juglone (Calbiochem) and 20 mM thimerosal (Enzo) were freshly dissolved in DMSO or water, respectively, prior to addition to molten NGM. Sodium arsenite (Ricca) was maintained in aqueous solution at 0. 5% w/v and stored at room temperature. Plates were freshly made approximately 24 hours before use and seeded with concentrated OP50 the night before being used. To assess longevity, age matched young adult animals were transferred to 100 mm NGM plates containing either drug or control and assayed over time. Animals which escaped the plates were excluded from the analysis. At least four replicates of n = 40 animals per genotype per stress were tested; final samples sizes reported in Table S3. Animals were stored at 20° except during time points. Animals were scored as dead if they did not respond to repeated light prodding. Percentages alive for each genotype were determined by averaging the fraction alive per plate at each time point and plotting graphically. For fluorescence toxicity studies using the nlg-1 reporters, L4 stage animals were exposed to NGM plates supplemented with drug or control overnight for 14 hours; animals were allowed 2–4 hours recovery time before imaging. Concentrations were chosen that did not result in animal death after 14 hours. For juglone imaging, control plates were supplemented with an equal volume of DMSO, as the juglone was diluted to 50 mM in DMSO prior to addition to the test plates. A Student' s t test was used to determine significance when comparing fluorescence of nlg-1 reporters in different conditions, unless otherwise specified. Log rank tests with a Bonferroni correction were calculated by JMP Pro version 10. 0 software and were used to determine significant differences between genotypes for toxicity studies; differences between genotypes are reported in Table S3. Total RNA was isolated from approximately 10,000 mixed stage animals for wild type, wdr-23 (tm1817) mutants and wdr-23; nuIs225 using Stat60 (Tel-test B, Texas). Transcriptome libraries were prepared using TruSeq RNA sample preparation kit (Illumina) according to manufacturer' s TruSeq protocol as previously described [20]. Libraries were amplified by PCR and quality and quantity of libraries were evaluated on BioAnalyzer 2100 (Agilent). Sequencing was performed on HiSeq2000 (Illumina). Sequencing reads were aligned to the C. elegansgenome (release WS210) using TopHat [68]. Gene models were downloaded from ENSEMBL and quantified using Cufflinks. Differentially expressed genes at false discovery rate (FDR) of 0. 05 were identified using the Cuffdiff module of the Cufflinks package. Full-length SKN-1a cDNA was cloned into a pBS backbone driven by the T7 promoter and expressed using TnT T7 Quick Coupled Transcription/Translation System for DNA (Promega). EMSA was performed using the LightShift Chemiluminescence EMSA Kit (Pierce) according to manufacturer' s protocols. Complementary 5′ biotinylated oligonucleotides containing the pnlg-1 SKN-1 binding site were self-annealed and incubated with 1 µl of SKN-1 lysate, 1 µg Poly (dIdC) and 5 mM MgCl2 for 20 minutes at room temperature. Samples were separated on a 5% native polyacrylamide gel and blotted on Biodyne B nylon membranes (Pierce). Pnlg-1 probes: oTS300: 5′ biotin-gttgccccccaaatgATGACATTacctcttttcctccc 3′ oTS310: 5′ biotin-gggaggaaaagaggtAATGTCATcatttggIgggcaac 3′ SUMMARY: [/INST] Organisms have evolved mechanisms to protect themselves at the cellular level in response to a variety of environmental stresses. Oxidative stress, caused by an imbalance in the cellular production of free radicals and endogenous antioxidant defenses, can be particularly detrimental to the nervous system. Indeed, elevated levels of oxidative stress have been linked to nearly all neurodegenerative diseases. Therefore, understanding how living creatures protect themselves against oxidative stress, from a cellular to a systemic level, is vital. Here, we have found that increased stress activates a pathway that increases the amount of certain proteins found at neuronal synapses. This presents an interesting model in which, in response to stress, neurons might attempt to enhance the strength of the synapse to prevent degeneration. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Police Commissioner Charles Ramsey showed no remorse over the alleged bad behavior of a former "hero" cop who is now being held on a $60 million dollar bail -- charged with sex assaults at gunpoint. (Published Monday, May 20, 2013) Former Philadelphia police officer Richard DeCoatsworth, once honored by President Barack Obama for his heroism, remains in jail on $60 million bail for allegedly raping two women -- forcing one into prostitution. Now, NBC10 has learned the City of Philadelphia is spending more than $1.5 million defending itself against DeCoatsworth's checkered past on the force. Law enforcement sources say DeCoatsworth had nine citizen complaints against him over his nearly five year stint with the department. The complains, sources say, included allegations of assault, abuse and misconduct. Issues with the 27-year-old began to arise in 2005 when he was in the Philadelphia Police Academy. DeCoatsworth allegedly injured a Girard Avenue business owner during a fight. However, he was allowed to remain a recruit despite the allegations. Former Hero Officer Charged With Rape A former Philadelphia Police Officer once hailed a hero is now in jail on $60 million bail after he allegedly raped two women at gunpoint. NBC10's Katy Zachry has the latest details. (Published Sunday, May 19, 2013) In 2007 as a rookie officer, DeCoatsworth was severely injured after being shot in the face. After being shot, he managed to chase down the suspect for several blocks before collapsing. He called in enough information by radio that police were able to track down and arrest the suspect later the same day. His actions earned him an invitation from Vice President Joe Biden to attend President Obama’s first congressional address at the U.S. Capital in February 2009. The officer sat in the gallery with First Lady Michelle Obama during the speech. He was also honored by his peers as a 2008 Top Cop. Exclusive Beaten Man Flabbergasted by Police Arrest Soon after, though, he was involved in two more dramatic incidents. In April 2009, police say DeCoatsworth was jumped and attacked by a man when he tried to disperse a crowd at the Logan section of the city. During the struggle, sources say DeCoatsworth’s gun went off and hit the suspect who took off running. Another officer responding to the scene shot the suspect dead, according to sources. Bail Set at $60M for Hero Officer Charged With Rape Bail was set at $60 million Saturday for a former Philadelphia police officer Richard Decoatsworth who has been charged with raping two women at gunpoint. NBC10's Nefertiti Jaquez reports on the developing case. (Published Sunday, June 9, 2013) In September 2009, DeCoatsworth and another officer stopped a man on a motorcycle in the Kensington section of the city. While they were questioning him, a second man allegedly jumped on the motorcycle and drove at the officers. Police say DeCoatsworth shot at the suspect, who sped off. The suspect was found later at the hospital where his mother had taken him to be treated for a shotgun wound. During the incident, local witnesses claimed the two suspects did nothing wrong and that DeCoatsworth and the other officer acted recklessly -- shooting while children were nearby. In November 2011, Internal Affairs investigated an alleged scuffle between DeCoatsworth and another officer, according to Philly.com. DeCoatsworth retired from the police force on disability back in December 2011. Hero Officer Charged With Raping Women A former Philadelphia police officer once hailed as a hero and given a seat next to the first lady at a speech by President Obama has been arrested and charged with raping two women and other crimes. Former officer Richard DeCoatsworth was arrested and charged Saturday with rape, sexual assault, terroristic threats and related offenses. NBC10's Cydney Long reports. (Published Saturday, May 18, 2013) In February of 2012, an arrest warrant was issued for DeCoatsworth after he allegedly threatened a woman in Port Richmond. The most recent incident began two weeks ago after DeCoatsworth allegedly met a woman at a bar on North Front Street. Police say the former officer forced the woman into prostitution at a Days Inn hotel along Roosevelt Boulevard in the Lawncrest section of the city. Then, between 2 a.m. Thursday and Friday evening, DeCoatsworth went to the woman’s home along North Howard Street in the Fishtown-Kensington area, according to a law enforcement source close to the investigation. Once he arrived, DeCoatsworth allegedly forced that woman and a second woman, both in their 20s, to use drugs and perform oral sex on him at gunpoint. The alleged victims reported the assault Friday only after DeCoatsworth went home, according to police. Hero Officer Arrested A former Philadelphia Police Officer once hailed a hero was arrested on Saturday for allegedly holding two women captive. NBC10's Katy Zachry has the details. (Published Saturday, May 18, 2013) Police raided DeCoatsworth’s house on the 2700 block of Salmon Street in the Port Richmond section of Philadelphia around 6:30 a.m. on Saturday. He was arraigned and charged with rape, sexual assault, terroristic threats and other related offenses. Police also confiscated drugs and guns from the home, according to a source. No word yet on what kind of drugs were removed from the home. Video Crossing Gate Hits School Bus as Train Approaches According to court documents, bail was set at $25 million for each of the alleged victims. Another $10 million bail was set in a separate domestic violence case DeCoatsworth is now being charged with, according to investigators. Police say he assaulted his live-in girlfriend on May 9. The $60 million bail is reportedly one of the highest set in Philadelphia history. DeCoatsworth faces more than 32 crimes in all three cases. He is scheduled for another court appearance on June 17. One of DeCoatsworth’s neighbors said she was relieved to hear about his arrest. “I am scared to be saying this now but I hope he stays where he is at, he has been a thorn in the side of this neighborhood for so long,” said the woman who did not want to be identified. Philadelphia Mayor Michael Nutter's Office says of the nine complaints lodged against DeCoatsworth -- one resulted in a lawsuit. The suit alleged DeCoatsworth used aggressive behavior while on the job. The city settled that suit for $1.5 million. However, officials say Philadelphia has accrued other legal costs related to DeCoatsworth. Last year, Philadelphia Police Commissioner Charles Ramsey told police he believed he failed DeCoatsworth by letting him go back to work with a stressful unit too soon after he was shot in the face. "I think I screwed up on that," Ramsey told the Daily News. "I think I should have given him more time. He didn't want more time but I should have done that." In light of his most recent arrest however, Ramsey had much harsher words for DeCoatsworth on Monday. "He has to be held accountable," Ramsey said. "Just like anybody else. There should be no special consideration given simply because he once served as a police officer." DeCoatsworth is being held on $60 million bail. A figure that is rarely seen in the U.S. criminal justice system. Philadelphia District Attorney's Office spokeswoman Tasha Jamerson said prosecution did not request a high bail amount, rather that DeCoatsworth be held without bail. “Being held without bail is the highest bail situation you could face as a defendant in Philadelphia," Jamerson said, “At DeCoatsworth's arraignment on Saturday, we requested that he be held without bail, but the judge instead chose to impose bail at $60 million.” Other high-profile cases, including federal trials held in Pennsylvania, have included large sums, but none are near what the 27-year-old is held on. While many with similarly egregious crimes are held without bail, some are held on bonds that reach into the millions of dollars. Christina Regusters, the 20-year old woman charged with abducting and raping a 5-year old girl in Cobbs Creek, is currently held on $4 million bond. Ariel Castro, the Ohio man who is facing four counts of kidnapping and three counts of rape for holding three women captive in his home for a decade, is held on only $8 million. While DeCoatsworth is listed as being represented by a public defender, family members are currently helping him acquire an attorney. NBC10's Emad Kahlil contributed to this report. Get the latest Philly.com Daily Headlines newsletter delivered to your email. Sign up now! Richard DeCoatsworth in happier times, as he joined first lady Michelle Obama and Jill Biden at a presidential address in 2009. (Associated Press/File) A retired Philadelphia police officer once hailed as a hero and invited by Michelle Obama in 2009 to sit next to her during the president's State of the Union address has been arrested and charged with raping and holding two women captive for two days. Richard DeCoatsworth, 27, was taken into custody early Saturday. When police arrived at his Port Richmond house on the 2700 block of Salmon Street, DeCoatsworth, who was armed, went to the basement to open a garage door and let out his pit bull, a law enforcement source said. The dog ran away after police fired two flash grenades. DeCoatsworth, discarding his gun, ran into the bedroom, where there was a loaded shotgun. Police subdued and arrested him without incident, the source said. DeCoatsworth had been under investigation by the Special Victims Unit after two women alleged that he forced them to use drugs and engage in sexual activity. The women said they came into contact with DeCoatsworth about 2 a.m. Thursday at a party, said Officer Christine O'Brien, a police spokeswoman. They left the party with him, and the three went to another location. Police did not identify the site of the party or say where the alleged crimes took place. At the second site, DeCoatsworth took out a handgun and allegedly forced the two women "to engage in the use of narcotics and sexual acts," O'Brien said. The women reported the incident to police, and DeCoatsworth was charged with rape, sexual assault, terroristic threats, and related charges. His bail was set at $60 million. The women told police DeCoatsworth had held them captive for two days, according to the law enforcement source. It was a long fall from grace for the former officer, who in 2007 was lauded as a hero. 2009 tribute As a 21-year-old rookie, DeCoatsworth took a shotgun blast to the face and, bleeding heavily and returning fire, pursued his attacker for several blocks before collapsing and radioing for help. The gunman, Antonio Coulter, was caught and later pleaded guilty in the shooting. DeCoatsworth underwent extensive surgery and returned to duty in June 2008. His heroism in that case led to an invitation to sit next to the first lady during the president's 2009 address. DeCoatsworth then became involved in two controversial incidents in which he shot at suspects. In April 2009, he shot Anthony Temple when the man lunged for his gun, police said, and a backup officer then shot and killed Temple. The following September, he wounded a man in a leg who allegedly ran at him on a motorcycle. DeCoatsworth racked up a number of Internal Affairs complaints, and he retired in December 2011 at age 25. He left, a police spokesman said at the time, due to injuries from the 2007 shooting. 'Something like this' Some in the Police Department had feared DeCoatsworth was badly troubled. One officer said DeCoatsworth's unpredictable behavior and temper had led some in the department to view him as a time bomb. "I hate to say it, but I did see something like this coming," the officer said Saturday. Neighbors at a diner down the block from DeCoatsworth's home said he had been known to behave erratically. A woman who asked not to be named said she avoided the former officer after an incident in the fall in which his pit bull allegedly charged at her chihuahua. "From the look in his eyes," she said, "I was terrified." Shattered glass from DeCoatsworth's door spilled out over his front steps Saturday afternoon, and people inside refused to answer the door. When two people left the apartment, they declined to comment. Contact Jonathan Lai at 856-779-3220, jlai@phillynews.com, or follow on Twitter @elaijuh. Inquirer staff writer Allison Steele contributed to this article. SUMMARY: [/INST] In 2007, now-former Philadelphia police officer Richard DeCoatsworth was hailed as a hero for chasing down a suspect after being shot in the face. Yesterday, he was arrested on charges of rape, sexual assault, and terroristic threats, as police raided his home, also confiscating guns and drugs, NBC Philadelphia reports. According to police, DeCoatsworth met two women at a party, then is alleged to have pulled a gun on them and forced them "to engage in the use of narcotics and to engage in sexual acts." His bail was set at $60 million. DeCoatsworth received a "Top Cops" award in 2008 and was promoted to an elite highway patrol unit following his act of bravery. But he retired from the force in 2011, after accruing a large number of Internal Affairs complaints and two controversial incidents where he shot at suspects, reports the Inquirer. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of one or more previously filed provisional applications identified as follows: Application Ser. No. 61/229,857 filed Jul. 30, 2009. TECHNICAL FIELD This invention relates to the field of exercise equipment and specifically to hand held weights in the form of dumbbells. BACKGROUND OF THE INVENTION Adjustable weight dumbbells are known that use an elongated, cylindrical bar as the handle. An inner collar is inset inwardly from each end of the bar with the collar being releasably fixed to the bar by some type of fastener or holding device. The inset provides a space on each end of the bar that is used to support one or more weight plates on the ends of the bar outboard of the inner collars. After the user stacks a desired number of weight plates on the ends of the bar, the user installs an outer collar on each end of the bar to hold the stacked weight plates on the ends of the bar to prevent the weight plates from sliding off the bar during exercise. The user adjusts the exercise mass of the dumbbell by changing the number of weight plates that are held between the inner and outer collars on each end of the bar. Typically, the weight plates are flat, circular plates having a central bore for slipping the weight plates onto the bar. To use the dumbbell described above, the user merely grabs the center of the bar between the stacks of weight plates on the ends of the bar. Inherently, the user's hand is positioned centrally between the stacks of weight plates along a centerline of the bar, which is also a centerline of the stacked weight plates. The user can then lift and manipulate the dumbbell in any of the known ways to perform various weight training exercises, such as arm curls, arm presses, etc. In the past, one manufacturer of dumbbells of the type described above has offered an optional U-shaped handle for converting this type of dumbbell to a kettlebell style. The bottoms of the spaced legs of the U-shaped handle were formed with circular bores that were designed to slide onto the bar that formed the usual handle for the dumbbell. The user would remove weight plates and the inner and outer collars from one end of the bar to provide access to the center of the bar. The user would then slip the U-shaped handle onto the bar from this end of the bar, namely the end of the bar from which the weight plates and collars had been removed, simply by telescoping or inserting the bores in the legs of the U-shape onto the bar and by then sliding the U-shaped handle inwardly to the center of the bar. The removed weight plates and collars could then be replaced onto the end of the bar from which they had been taken. When so installed as described above, the U-shaped handle was captured between the inner collars on the bar. In addition, the legs of the U-shaped handle were long enough so that the base of the U-shaped handle, namely the connecting piece between the two legs of the handle, was positioned to be parallel to the bar but to be vertically displaced above the weight plates. Thus, the user could now grab the base of the U-shaped handle and swing or manipulate the dumbbell in the manner of a kettlebell. Thus, a standard adjustable weight dumbbell could be converted in this manner to a kettlebell type of exercise device. Other adjustable weight dumbbells are known which are referred to as selectorized dumbbells, such as that shown in U.S. Pat. No. 5,637,034 as also shown in FIG. 1 of this application. In such a dumbbell, the handle is no longer a simple, cylindrical bar, but has a more complex shape. The handle of this type of dumbbell has a pair of planar ends that are spaced apart from one another but are rigidly joined to one another at least by a central hand grip that extends between the ends and is affixed thereto. In addition to the hand grip, there may be one or more cross tubes that also extend between and unite the spaced planar ends of the handle together. Some type of movable selector is used which coacts with the handle and with a desired number of weight plates disposed in left and right stacks of weight plates. When the selector is moved between different positions relative to the handle, different numbers of weight plates are coupled to the left and right ends of the handle to adjust the exercise mass of the selectorized dumbbell. In a selectorized dumbbell of the type described above and as shown in FIG. 1 of this application, there is no way to use the U-shaped handle of prior dumbbells with the selectorized dumbbell to provide a kettlebell style of exercise. The U-shaped handle of the prior dumbbell is designed to slip onto a bar from which access can be had from one end of the bar. In the selectorized dumbbell, even if one considers the hand grip a bar, the ends of the hand grip are united to planar left and right ends of the handle thereby blocking access to the hand grip. There is simply no way to slide an auxiliary U-shaped handle onto the hand grip of the handle of the selectorized dumbbell as one is blocked from doing so by either the planar left end of the handle or the planar right end of the handle. It would be an advance in the art to provide some way of converting this type of selectorized dumbbell into a kettlebell type of exercise device. SUMMARY OF THE INVENTION One aspect of this invention relates to a selectorized dumbbell which comprises a plurality of nested weights comprising a stack of nested left weight plates and a stack of nested right weight plates separated by a gap. At least a first handle is provided with the handle having a hand grip extending along an axis with the handle further having opposite, substantially planar left and right ends that are rigidly joined to one another. The handle may be dropped down into the gap between the stacks of nested left and right weight plates such that the left end of the handle is adjacent an innermost left weight plate in the left stack of weight plates and the right end of the handle is adjacent an innermost right weight plate in the right stack of weight plates. A selector is movable into different positions relative to the handle and relative to the weight plates for coupling selected numbers of left weight plates to the left end of the handle and selected numbers of right weight plates to the right end of the handle. The hand grip of the first handle comprises an upwardly extending loop that is fixed at a bottom portion thereof between the left and right ends of the handle to join the left and right ends of the handle together and with the loop having a top gripping portion that is vertically positioned above the left and right ends of the handle and above top edges of the weight plates in the manner of a kettlebell exercise device. Another aspect of this invention relates to a selectorized dumbbell, which comprises a plurality of nested weights comprising a stack of nested left weight plates and a stack of nested right weight plates separated by a gap. A handle is provided having a first hand grip extending along an axis with the handle further having opposite, substantially planar left and right ends joined to opposite ends of the hand grip with the left and right ends of the handle extending perpendicularly to the hand grip. The first hand grip of the handle extends substantially horizontally between top and bottom edges of the left and right ends of the handle such that the first hand grip of the handle will be located below top edges of the weight plates in the manner of a standard dumbbell. A selector is movable into different positions relative to the handle and relative to the weight plates for coupling selected numbers of left weight plates to the left end of the handle and selected numbers of right weight plates to the right end of the handle. A second hand grip is provided comprising a loop that is carried on the handle. The loop is movable relative to the handle between a first operative position in which a top gripping portion of the loop is vertically positioned above the left and right ends of the handle and above top edges of the weight plates in the manner of a kettlebell exercise device and a second non-operative position in which the top gripping portion of the loop is disposed between the left and right ends of the handle. The user can use the dumbbell in the manner of a kettlebell exercise device by moving the second hand grip comprising the loop into its first, operative position and by grasping the top gripping portion of the loop or in the manner of a standard dumbbell by disposing the top gripping portion of the loop in its second non-operative position and by grasping the first hand grip rather than the top gripping portion of the loop. Yet another aspect of this invention relates to a selectorized dumbbell which comprises a plurality of nested weights comprising a stack of nested left weight plates and a stack of nested right weight plates separated by a gap. A handle is provided having opposite, substantially planar left and right ends that are rigidly joined to one another. The handle may be dropped down into the gap between the stacks of nested left and right weight plates such that the left end of the handle is adjacent an innermost left weight plate in the left stack of weight plates and the right end of the handle is adjacent an innermost right weight plate in the right stack of weight plates. The handle carries a pair or hand grips thereon comprising a first cylindrical bar type hand grip that in use is substantially horizontal and extends between the left and right ends of the handle and is disposed beneath top edges of the weight plates in the manner of a standard dumbbell and a second loop type hand grip that in use has a top gripping portion that that is vertically positioned above the left and right ends of the handle and above top edges of the weight plates in the manner of a kettlebell exercise device. A selector is movable into different positions relative to the handle and relative to the weight plates for coupling selected numbers of left weight plates to the left end of the handle and selected numbers of right weight plates to the right end of the handle. BRIEF DESCRIPTION OF THE DRAWINGS This invention will be described more completely in the following Detailed Description, when taken in conjunction with the following drawings, in which like reference numerals refer to like elements throughout. FIG. 1 is an exploded, perspective view of a prior art selectorized dumbbell known as the PowerBlock®; FIG. 2 is a perspective view of a first embodiment of a selectorized dumbbell that is convertible to a kettlebell configuration; FIG. 3 is a perspective view of a second embodiment of a selectorized dumbbell having a dedicated kettlebell configuration; FIG. 4 is an exploded, perspective view of the handle of the selectorized dumbbell of FIG. 3 ; FIG. 5 is a partially exploded, perspective view of a handle of a third embodiment of a selectorized dumbbell that is convertible to a kettlebell configuration; FIG. 6 is an operational, perspective view of the handle of FIG. 5, particularly showing the kettlebell hand grip in a lowered, stowed position in which the kettlebell hand grip is not operational; and FIG. 7 is an operational, perspective view similar to FIG. 6, but showing the kettlebell hand grip in a raised, accessible position in which the kettlebell hand grip is operational. DETAILED DESCRIPTION A selectorized dumbbell of the type with which this invention can be used is shown as 2 in FIG. 1. Dumbbell 2 is one of the PowerBlock® lines of dumbbells manufactured and sold by Power Block, Inc. of Owatonna, Minn. The details of such dumbbell 2 are disclosed in U.S. Pat. No. 5,637,034, assigned to the assignee of this invention, which is hereby incorporated by reference. One characteristic of dumbbell 2 is the use of a plurality of nested weights 4. Each weight 4 comprises a left weight plate 6 l, a right weight plate 6 r, and a pair of side rails 8 that hold weight plates 6 in a spaced apart orientation. Side rails 8 are attached in any suitable manner to the front and back edges of the pair of weight plates 6 that form one of weights 4 at the same vertical height along the front and back edges. Weights 4 are nested in the sense that the left and right weight plates 6 l and 6 r in each weight 4 are progressively spaced apart slightly further from one another. Thus, all of the left weight plates 6 l are nested against one another in a set of nested left weight plates 6 l and all of the right weight plates 6 r are nested against one another in a set of nested right weight plates 6 r. Obviously, to make this happen, side rails 8 used in each weight 4 in a set of weights 4 have progressively longer lengths. Side rails 8 used in the innermost weight will be the shortest with side rails 8 then becoming progressively longer as required to space weight plates 6 in the other weights 4 progressively further apart. This is shown in FIG. 1 by the progressively longer lengths of side rails 8 proceeding from top to bottom. A gap 12 is provided between the sets of nested left weight plates 6 l and nested right weight plates 6 r. A handle 14 can be dropped down into gap 12. Handle 14 has a pair of opposite left and right ends 18 l and 18 r that are connected together by spacers or cross tubes 20. The user can drop his hand down between the two upper cross tubes 20 to grip a hand grip 22 that extends between the ends 18 l and 18 r of handle 14 parallel to cross tubes 20. Hand grip 22 fixedly connects to the laterally spaced ends 18 l and 18 r of handle 14 approximately at the centers of the ends 18 l and 18 r of handle 14. Each end 18 l and 18 r of handle 14 has a vertical array of slots 24 that traverse across the end 18 l and 18 r of handle 14 from the front to the back of handle 14. Slots 24 are substantially horizontal grooves or shelves cut or formed into the ends 18 l and 18 r of handle 14. Slots 24 are adapted to receive a pair of horizontal prongs on a selector 26 that is used to adjust how many weights are attached to handle 14. Once handle 14 has been inserted by the user in gap 12, a desired number of weights 4 can be selectively coupled to handle 14 depending upon how selector 26 is positioned. If selector 26 is inserted into handle 4 beneath the lowermost side rails 8, then selector 26 will pick up all weights 4 when handle 14 is lifted. Moving selector 26 up will pick up fewer weights to thereby adjust the exercise mass carried by handle 14. Essentially, only those weights 4 whose side rails 8 are above the location of selector 26 will be coupled to handle 14. FIG. 2 shows a first embodiment of a dumbbell 2 according to this invention. In this embodiment, a handle 14 like that shown in FIG. 1 is used except that the usual dumbbell style hand grip 22 has been replaced with a kettlebell hand grip 28. Kettlebell hand grip 28 will be fixedly secured in any suitable manner to each end 18 l and 18 r of handle 14 in place of dumbbell hand grip 22. Kettlebell hand grip 28 includes an upwardly extending loop 30 that protrudes above weights 4 in the manner of a kettlebell exercise device. Thus, the user can grip loop 30 and lift and swing dumbbell 2 in the manner of a kettlebell. It would be possible for dumbbell hand grip 22 and for kettlebell hand grip 28 to each be removable and replaceable from within handle 14, e.g. by unbolting or unscrewing one hand grip and by then installing the other hand grip. Thus, one would convert dumbbell 2 from its traditional dumbbell use to kettlebell use by swapping out just the hand grip portions 22 or 28 of handle 14. However, it would also be possible to sell and for a user to purchase two complete handles 14, one with a dumbbell hand grip 22 and the other with a kettlebell hand grip 28, with the user simply using whichever handle 14 that he or she desires at any given time. This latter alternative is attractive because the user does not have to bolt or unscrew anything to make the conversion. All the user has to do is pick up whichever handle 14 that has the hand grip style the user wishes to use and then drop that handle down into gap 12 of dumbbell 2. FIGS. 3 and 4 show a second embodiment of a dumbbell 2 according to this invention. This embodiment is a dedicated kettlebell style of dumbbell 2 in which the gap 12 in the nested weights 4 is narrowed so that it is no longer wide enough to accommodate a user's hand, i.e. it is no longer possible to use a dumbbell hand grip 22 in gap 12. The only way for a user to use dumbbell 2 as shown in FIG. 4 is in the manner of a kettlebell. Thus, handle 14 includes only a kettlebell hand grip 28 ′ with a loop 30 ′ protruding up above weights 4. As shown in FIG. 4, handle 14 in this embodiment includes the ends 18 l and 18 r, but such ends 18 l and 18 r are now spaced apart far enough simply to receive a mounting flange 32 on kettlebell hand grip 28 ′. In effect, flange 32 is tightly sandwiched and clamped between ends 18 l and 18 r when such ends are bolted or screwed together. Loop 30 ′ of kettlebell hand grip 28 ′ is fixed atop flange 32 as shown in FIG. 4. Ends 18 l and 18 r of handle 14 can be brought so close together in this embodiment since this version of dumbbell 2 is not designed to function as a normal dumbbell with the user's hand between the spaced weight plates 6, but only as a kettlebell. Kettlebell hand grips 28, 28 ′ as shown in the embodiments of FIGS. 2 and 3 have the loops 30, 30 ′ thereof extending parallel to the axes of side rails 8. Loops 30, 30 ′ could also be swung around 90° relative thereto to extend perpendicularly to the axes of side rails 8. Handle 14 for a third embodiment of a dumbbell 2 according to this invention is shown in FIGS. 5-7. This embodiment of dumbbell 2 will use a traditional set of nested weights 4 from the PowerBlock® dumbbell as shown in FIGS. 1 and 2, namely where a normal sized gap 12 is provided such that a full sized handle 14 can be dropped into gap 12. However, for the sake of clarity, the set of nested weights 14 is not shown in FIGS. 5-7. Only the handle 14 is depicted. Handle 14 of the third embodiment of dumbbell 2 has all the characteristics of the usual handle for a PowerBlock® dumbbell, namely spaced left and right ends 18 l and 18 r, upper cross tubes 20 and a dumbbell hand grip 22. However, in this embodiment, handle 14 includes a kettlebell hand grip 28 ″ forming a loop 30 ″ that is installed on handle 14 and is carried with handle 14 in addition to dumbbell hand grip 22. Kettlebell hand grip 28 ″ is selectively movable on handle 14 between a lowered, stowed position and a raised, accessible position. In the lowered, stowed position thereof as shown in FIG. 6, loop 30 ″ is located towards the bottom of handle 14 between the left and right ends 18 l and 18 r of handle 14 and cannot be gripped or used by the user since it will normally be obstructed by side rails 8 of weights 4. In the raised, accessible position thereof as shown in FIG. 7, loop 30 ″ is located above all the weights 4 in a position where the user can grip kettlebell hand grip 28 and swing and use weights 4 in the manner of a kettlebell. Kettlebell hand grip 28 ″ is U-shaped with loop 30 ″ being formed by the U-shape. Kettlebell hand grip 28 ″ has a pair of aligned circular openings 34 in the ends of the legs thereof. This allows kettlebell hand grip 28 ″ to be pivotally mounted on one of the cross tubes 20 of handle 14. The pivoting action of hand grip 28 ″ around cross tube 20, as indicated by arrow A in FIG. 6, is what permits movement of hand grip 28 ″ between the lowered, stowed position thereof and the raised, accessible position thereof. Such pivoting movement will be performed by the user when handle 14 is not inserted within the gap 12 of nested weights 4 in order that such movement not be obstructed by side rails 8. A detent or lock mechanism is provided in handle 14 to securely hold kettlebell hand grip 28 ″ in its lowered, stowed position or in its raised, accessible position. Such detent or lock mechanism comprises spring biased pop pins 36 that are received in sockets 38 beneath cross tube 20 in each 18 l and 18 r of handle 14. See FIG. 5. Only one socket 38 is shown in FIG. 5 in end 18 r since the corresponding socket in end 18 l is hidden. Each pop pin 36 cooperates with one of a series of holes 40 located in the legs of hand grip 28 ″ with holes 40 surrounding openings 34 on a diameter that allows each hole 40 to register with pop pin 36. When a hole 40 is brought over and is aligned with pop pin 36 by virtue of pivoting motion of hand grip 28 ″, the internal spring bias on pop pin 36 will cause the head of pop pin 36 to extend and be received in a locking engagement with the hole. The spring force that biases pop pin 36 into such locking engagement is strong enough to hold hand grip 28 ″ in a desired position thereof during use of dumbbell 2, but is not so strong that it cannot be overcome by the user providing manual force on hand grip 28 ″ to pivot hand grip 28 ″ around cross tube 20. One hole 40 a is located on one side of opening 34 and is effective to lock hand grip in its lowered, stowed position as shown in FIG. 6. Three holes 40 b, 40 c, 40 d spaced apart in increments of 30° or so are provided on the opposite side of opening 34. One such hole 40 b, 40 c, 40 d is used to receive pop pin 36 and lock hand grip 28 ″ in its raised, accessible position. When middle hole 40 c is used as shown in FIG. 7, hand grip 28 ″ and loop 30 ″ thereof extend straight up from cross tube 20. If holes 40 b or 40 d are used, hand grip 28 and loop 30 ″ will extend upwardly in an inclined fashion tilting either outwardly or inwardly, respectively, with respective to cross tube 20. The series of holes 40 b - 40 d allows the user to select whatever specific position of hand grip 28 ″ is most comfortable to him or her when using kettlebell hand grip 28 to exercise with dumbbell 2 in the manner of a kettlebell. The embodiment of dumbbell 2 shown in FIGS. 5-7 is advantageous because it allows a user to quickly and easily convert dumbbell 2 from use as a traditional dumbbell to use as a kettlebell. Only a single handle 14 need be purchased and used by the user. To convert dumbbell 2 into kettlebell use, the user need only lift handle 14 out of gap 12 until it clears the nested weights 4 and then grip kettlebell hand grip 28 ″ and swing it upwardly from the position shown in FIG. 6 to the position shown in FIG. 7. The user can dispose hand grip 28 ″ either straight up and down as shown in FIG. 7 or can incline it inwardly or outwardly depending upon which one of the holes 40 b - 40 d is used to receive pop pin 36. Then, the user simply drops the converted handle 14 back down into the gap 12 of the nested weights and positions selector 26 to pick up whatever number of weights the user wishes to use. When the user picks up handle 14 again, he or she can pick it up using the now raised and accessible kettlebell hand grip 28 ″ and the selected number of weights will rise with handle 14 for use as the exercise mass in a kettlebell style of exercise. Various modifications of this invention will be apparent to those of skill in the art. Accordingly, the scope of this invention is to be limited only by the appended claims. SUMMARY: [/INST] A selectorized dumbbell has nested stacks of left and right weight plates, a handle that can be disposed between the two stacks of weight plates, and a selector that couples selected numbers of the left and right weight plates to left and right planar ends of the handle. The handle has at least one loop type hand grip located above the ends of the handle and above the weight plates to allow the dumbbell to be used as a kettlebell. This loop type hand grip can be replaced with a bar type hand grip if the dumbbell is to be used like a standard dumbbell, or the handle can be provided in kettlebell or standard versions thereof. Alternatively, the loop type hand grip can be movably disposed on the handle for movement between operative and non-operative positions. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a national phase application pursuant to 35 U.S.C. §371 of International Application No. PCT/EE2007/000025, filed Dec. 10, 2007, which claims priority to Estonia Application No. P200600039, filed Dec. 12, 2006. FIELD OF THE INVENTION [0002] The present invention relates to the field of molecular biology. [0003] More particularly, the invention relates to transgenic animals that can serve as models for psychological disorders caused by pathological anxiety. Pathological anxiety causes the reduction of the ability of the organism to adaptations in stressful conditions and reduction of general coping. BACKGROUND OF THE INVENTION [0004] The current invention relates to Wfs1 gene and anxiety disorders, as an example we describe Wfs1 deficient mice as a model for anxiety disorders. [0005] Anxiety disorders are among the most prevalent psychological disorders and their treatment requires significant expenses from the health care system. For example, in the USA it has been found that about 25% of the population suffers from some kind of anxiety disorder during some life stage and the treatment of these patients costs about 44 million dollars per year (Greenberg et al., 1999; Hettema et al., 2001; Kessler et al., 1994). Anxiety is an emotion, which is connected to the response of the organism to stressogenic factors, whereas the hazardous factors are potential and avoidable. Anxiety becomes pathological, when the accompanying reactions are excessive or the duration of the state of anxiety is too lengthy. Anxiety disorders are classified as stress-related or stress non-related anxiety disorders. Stress-related anxiety disorders involve adaptation disorder, acute stress response; stress non-related anxiety disorders are panic disorder and generalized anxiety disorder. Anxiety can be studied using animal models. Animal models exist, where trait anxiety or state anxiety has been induced in lab animals. For example, U.S. Pat. No. 6,353,152 (Vale Wylie. W., Lee Kuo-Fen, Bale Tracy L., Smith George W., Corticotropin releasing factor receptor 2 deficient mice and uses thereof) and U.S. Pat. No. 6,060,642 (Tecott Laurence H., Brennan Thomas J., Serotonin 5-HT6 receptor knockout mouse) represent animal models for anxiety. [0006] Wolfram syndrome is a rare hereditary genetic disorder caused by loss-of-function mutations in the Wfs1 gene. This disorder is sometimes referred to as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy and deafness). Juvenile diabetes mellitus and optic atrophy are most commonly described early symptoms of this hereditary disorder (Wolfram D J, Wagener H P (1938) Diabetes mellitus and simple optic atrophy among siblings: report of four cases. Mayo Clin Proc 13:715-718). In addition to abnormalities in endocrine system, Wolfram syndrome patients develop various neurodegenerative symptoms with optic atrophy, hearing loss, nystagm, peripheral neuropathy and dementia among them (Swift R G, Sadler D B, Swift M (1990) Psychiatric findings in Wolfram syndrome homozygotes. Lancet 336:667-669; Swift R G, Perkins D O, Chase C L, Sadler D B, Swift M (1991) Psychiatric disorders in 36 families with Wolfram syndrome. Am J Psychiatry 148;775-779). Wolfram syndrome has multisystem manifestations whereas diabetes mellitus and diabetes insipidus strongly suggest involvement of the endocrine system. The necessary symptoms for the diagnosis of Wolfram syndrome are juvenile insulin dependent diabetes and bilateral progressive optic atrophy. Both may be present in childhood, adolescence, or early adult life; typically, but not invariably, diabetes mellitus is detected first. The diabetes occurring in case of Wolfram syndrome can be distinguished from the juvenile diabetes by the absence of the antibodies against glutamate decarboxylase (GAD-65). These antibodies have been described in Wolfram syndrome only in single cases. Among the neurological symptoms in Wolfram syndrome patients hearing loss, urinary tract atony, ataxia, peripheral neuropathy, mental retardation, dementia, and psychiatric illnesses should be outlined. Moreover, widespread atrophic changes in the brain of Wolfram syndrome patients have been described (Rando T A, Horton J C, Layzer R B (1992) Wolfram syndrome: evidence of a diffuse neurodegenerative disease by magnetic resonance imaging. Neurology 42:1220-1224). It has been shown, that 60% of Wolfram syndrome patients have episodes of severe depression, psychosis, or organic brain syndrome, as well as compulsive verbal and physical aggression (Swift R G, Sadler D B, Swift M (1990) Psychiatric findings in Wolfram syndrome homozygotes. Lancet 336;667-669). Estimated risk for a Wolfram syndrome heterozygote to be hospitalized for psychiatric illness or to attempt suicide is approximately 8 times higher than that of a non-carrier (Swift R G, Perkins D O, Chase C L, Sadler D B, Swift M (1991) Psychiatric disorders in 36 families with Wolfram syndrome. Am J Psychiatry 148:775-779). [0007] Importance of wolframin gene in predicting risk for mood disorders was verified recently (Koido K, Koks S, Nikopensius T, Maron E, Altmae S, Heinaste E, Vabrit K, Tammekivi V, Hallast P, Kurg A, Shlik J, Vasar V, Metspalu A, Vasar E (2005) Polymorphisms in wolframin (WFS1) gene are possibly related to increased risk for mood disorders. Int J Neuropsychopharmacol 8:235-244). However, the role and detailed mechanism of Wfs1 protein in the development of mood disorders and other psychiatric disorders is unknown yet. [0008] In U.S. Pat. No. 6,984,771 (Mice heterozygous for WFS1 gene as mouse models for depression, Roberds, Steven L, Huff, Rita M., 2006; “the '771 patent) a recombinant depression model in rodents has been described. The rodent disclosed in the '771 patent has cells with mutations appearing in the Wfs1 gene. The described rodent is a mouse heterozygous for mutations in the 8th exon of the Wfs1 gene. Due to the mutations, a non-functional wolframin protein is obtained, which lacks all or part of the transmembranic regions. In the named patent methods and descriptions for making and using such mouse and its cells are disclosed. [0009] Methods for the assessment of the activity of the wolframin protein have been disclosed in US patent application US20040058405 (Pharmacia & Upjohn Company, 2004) and U.S. Pat. No. 7,037,695 (Pharmacia & Upjohn Company, 2006). [0010] The aforementioned patents and applications are related to the wolframin protein and the method of assessment of the modulators of the interaction of it and its binding to appropriate cellular partner. [0011] WFS1 isolated from human chromosome 4p has been disclosed in international patent application PCT/US99/22429 (WO0018787, Washington University, Permutt, M. Alan, et al, 2000). The association of WFS1 gene mutation with the development of Wolfram syndrome has been described. The authors have suggested that the WFS1 gene together with its cDNAs, encoded protein and antibodies immunologically specific for it, may represent a biological marker for early diagnosis of the syndrome and assessment of a persons predisposition for this syndrome. SUMMARY OF THE INVENTION [0012] The current invention comprises an animal model for pathological anxiety and methods for using it, including 1) methods for using the described animal model for the assessment of the efficiency of substances and therapeutical agents useful for treatment of disorders caused by pathological anxiety; 2) methods for using the described animal model for the assessment of substances and therapeutical agents, which increase the expression of the Wfs1 protein and suppress pathological anxiety; 3) methods for using the Wfs1 protein as a target for testing the efficiency of drugs or other therapeutical compounds for the treatment of disorders caused by pathological anxiety. [0013] The present invention provides an animal model for pathological anxiety, which comprises a rodent without a functional Wfs1 protein or with a Wfs1 protein of impaired properties, wherein the rodent lacks both of the wild type alleles of the Wfs1 gene or wherein the function of the Wfs1 protein of the rodent is impaired for example via suppressing the expression level by RNA interference with antisense oligo- or polynucleotides or—nucleotide analogues or wherein the rodent does express a compound protein, which has been created by substituting a part of the genomic coding sequence of the wild type Wfs1 gene with a coding sequence of an identifyable marker gene. An ordinarily skilled artisan will recognize that the identifyable marker protein may be any protein (enzyme, fluorescent protein, affinity target), which has been appended in reading frame to the sequence encoding the Wfs1 protein or which is controlled by the DNA regulatory elements regulating the expression of the Wfs1 gene and which can be conveniently visualized in the tissues and/or cells of the animal of interest. Preferably, the identifiable marker protein of the invention is the β-galactosidase enzyme (LacZ protein), which can be visualized by using standard LacZ staining procedures. [0014] The distinctive properties and expressions of the proposed animal model for pathological anxiety include: 1) increased sensitivity to stress—some mice express vocalization in connection with environmental changes or in connection with getting into a new environment, as well as vocalization to mice vocalizing in another cage; 2) reduced exploratory activity; 3) increased frequency of risk avoidance behaviours. [0015] In case of the transgenic model for pathological anxiety we are dealing with a rodent with noticeable difficulties in adaptation to the environment, increased stress sensitivity and several symptoms of anxiety. One embodiment of an animal model is a mouse lacking both of the wild type Wfs1 alleles and exhibiting complete lack of the function of the Wfs1 protein. These mice exhibit a behaviour similar to anxiety disorder in models based on inherited anxiety responses (significantly reduced explorative behaviour in elevated plus-maze, light-dark cage exploration test, motor activity box, increased risk behaviour in elevated plus-maze, and avoidance of novel food in hyponeophagia test). Suppressed exploratory activity and risk behaviour were significantly reduced with diazepam (1 mg/kg), a GABAA receptor agonist, which is a clinically widely used medication against anxiety. Increased sensitivity of Wfs1-deficient mice to the anxiolytic action of diazepam can be related to changes in activity of GABAergic system. [0016] Experimentally naive Wfs1-deficient animals display a significant down-regulation of α1 (Gabra1) and α2 (Gabra2) subunits of GABA_A receptors, mediating sedative and anxiolytic effect of diazepam, in the temporal lobe and frontal cortex. Similar changes occur in the same brain areas of wild-type mice when wild-type mice are exposed to the elevated plus-maze. Since the expression of enzymes responsible for the synthesis of GABA is not significantly affected by the invalidation of Wfs1 gene, then the increased anxiety established in Wfs1-deficient mice as well as the increased anxiolytic action of diazepam could be linked to down-regulation of GABA_A receptor subunits. These mice exhibit difficulties in adaptation to new environment or changes in environment (new cage, new room, transportation). Moreover, in stressogenic situations some of these mice exhibit peculiar vocalization (audible sound or whistle). Such vocalization depends on the level of stress. In a room with dim light (20 lux) the transgenic mice exhibit a vocalization resembling bird warbling in elevated plus-maze test. In a room with very bright lighting (1000 lux) the vocalization of these mice intensifies and resembles a creak from a door. Wild type and heterozygous mice do not make any sound in a similar situation. Some animals vocalize also in reply to the companions in the neighbouring cage, who create similar sounds. Thus it is possible to assess the tolerance of the Wfs1 mutant homozygous mice to significantly lower environmental changes. Stress-induced vocalization in Wfs1 −/− mice could be removed by administering 1 mg/kg diazepam. A lower dose 0.5 mg/kg of diazepam is not effective. Accordingly, the present animal model can be used for testing new drugs for the treatment of pathological anxiety. The current invention is the first animal model, which is a mouse model for pathological anxiety created using gene technology, that expresses difficulties in adaptation with environment, increased stress sensitivity and other symptoms of anxiety. [0017] The current invention involves methods for the identification of compounds useful for the treatment of psychological disorders, which are at least partially caused by pathological anxiety and which comprise administering one or more agents under testing to a rodent, who lacks functional Wfs1 protein or whose function of the Wfs1 protein is disturbed. The efficiency of potential anxiolytics in removing/reducing the symptoms of anxiety is established by comparing the effect of the investigated compound with the effect of diazepam, the classical anti-anxiety drug. The symptoms and markers of anxiety comprise: 1) increased stress sensitivity; 2) reduced exploratory activity; 3) increased risk avoidance behaviour. [0018] The invention consideres methods for using the Wfs1 protein as a target for identifying compounds eliminating pathological anxiety, which comprise administration of one or more agent under investigation to rodents, who lack functional Wfs1 protein or to animals with reduced levels of functional Wfs1 protein. Likewise, the screening for new anti-anxiety substances comprises studies, where the expression level of the Wfs1 protein is determined in parallel with reduction or disapperence of behavioural symptoms of anxiety. As one option, primary antibodies against wild type Wfs1 protein can be used to observe Wfs1 expression level. As another option, the activity of an identifiable marker protein appended by homologous recombination to the sequence encoding the Wfs1 protein or a identifiable marker protein under the transcriptional control of the Wfs1 gene promoter is used as the indicator of Wfs1 protein expression level. Definitions [0019] Pathological Anxiety [0020] As used herein, the term “pathological anxiety” refers to a chronic condition, where excessive anxiety occurs in case of lack of real threats, causing reduction of the capability of an individual to cope with problems, suppresses motivation and induces the status of constant stress and exhaustion. On the contrary to pathological anxiety, normal anxiety is an adaptation-promoting mechanism, which increases the readiness of an individual to cope with demanding or potentially dangerous situations. [0021] Wfs1 Protein or Wolframin [0022] As used herein, the term “Wfs1 protein” refers to a human protein of 890 amino acids that has an amino acid sequence as described in, for example, (Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, Bernal-Mizrachi E, Mueckler M, Marshall H, Donis-Keller H, Crock P, Rogers D, Mikuni M, Kumashiro H, Higashi K, Sobue G, Oka Y, Permutt M A (1998), which is incorporated herein by reference. A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat Genet 20:143-148) and (Strom T M, Hortnagel K, Hofmann S, Gekeler F, Scharfe C, Rabl W, Gerbitz K D, Meitinger T (1998) Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum Mol Genet 7:2021-2028), and other mammalian homologs thereof, such as described in (Takeda K, Inoue H, Tanizawa Y, Matsuzaki Y, Oba J, Watanabe Y, Shinoda K, Oka Y (2001). WFS1 (Wolfram syndrome 1) gene product: predominant subcellular localization to endoplasmic reticulum in cultured cells and neuronal expression in rat brain. Hum Mol Genet 10:477-484) (rat homologue). Exemplary proteins intended to be encompassed by the term “Wfs1 protein” include those having amino acid sequences disclosed in GenBank with accession numbers NP — 005996, NP — 005996.1, CAA77022, AAH30130.1, AAC64943, AAH30130, CAA77022.1, AAC64943.1 or e.g., encoded by nucleic acid molecules such as those disclosed in GenBank with accession numbers NM — 006005.2 (gi:1337699)], Y18064.1 (gi:3766440), BC030130.2 (gi:33871564), AF084481.1 (gi:3777582), NM — 031823.1 (gi:13929175), AF136378.1 (gi:7381176), NM — 011716.1 (gi:6755996), AJ011971.1 (gi:3776089), BC046988.1 (gi:28422738), AF084482.1 (gi:3777584). Wfs1 is also referred to in the art as Wolfram syndrome 1, Wolframin, WFS, DFNA6, DFNA14, DFNA38, DIDMOAD. [0023] Markers of Anxiety [0024] Various numerical values or scores used for the assessment of the anxiety of the experimental animal or a test subject. To obtain a score or value for assessing anxiety specific behavioural tests are used, but observing spontaneous behaviour may also be sufficient. BRIEF DESCRIPTION OF THE DRAWINGS [0025] FIG. 1 Schematical presentation of the construct used for knocking out the gene encoding Wfs1 protein. [0026] FIG. 2 and FIG. 3. Exploratory activity of female and male Wfs1 −/− mice in elevated plus-maze. [0027] FIG. 2. Time spent on an open arm (s). White bars—female wild type mice; black bars—female Wfs1 −/− mice; vertical striped bars—male wild type mice; vertical striped bars—male Wfs1 −/− mice. p<0.05 compared to female Wfs1 −/− mice. +p<0.05 compared to male Wfs1 −/− mice (Newman-Keuls test, Two-way ANOVA). [0028] FIG. 3 Number of head dippings from the open arm. White bars—female wild type mice; black bars—female Wfs1 −/− mice; vertical striped bars—male wild type mice; vertical striped bars—male Wfs1 −/− mice. &p<0.05 compared to female wild type Wfs1 −/− mice. p<0.05 compared to female wild type Wfs1 −/− mice (Newman-Keuls test, Two-way ANOVA). [0029] FIG. 4, FIG. 5 and FIG. 6 The effect of diazepam (1 mg/kg) on the exploratory activity of female Wfs1 −/− mice in elevated plus-maze. [0030] FIG. 4 Time spent on the open arm (s). White bars—wild type mice administered with physiological saline; checked bars—wild type mice administered with (1 mg/kg) diazepam; black bars—Wfs1 −/− mice administered with physiological saline; diagonally striped bars—Wfs1 −/− mice administered with (1 mg/kg) diazepam. [0031] FIG. 5 Number of head dippings from the open arm. White bars—wild type mice administered with physiological saline; checked bars—wild type mice administered with (1 mg/kg) diazepam; black bars—Wfs1 −/− mice administered with physiological saline; diagonally striped bars—Wfs1 −/− mice administered with (1 mg/kg) diazepam. p<0.05 compared to wild type mice administered with physiological saline. (Newman-Keuls test, Two-way ANOVA). [0032] FIG. 6 Risk avoidance behaviour. White bars—wild type mice administered with physiological saline; checked bars—wild type mice administered with (1 mg/kg) diazepam; black bars—Wfs1 −/− mice administered with physiological saline; diagonally striped bars—Wfs1 −/− mice administered with (1 mg/kg) diazepam. p<0.05 compared to wild type mice administered with physiological saline. +p<0.009 compared to Wfs1 −/− mice administered with physiological saline. (Newman-Keuls test, Two-way ANOVA). [0033] FIG. 7, FIG. 8 and FIG. 9. Exploratory activity of female and male Wfs1 −/− mice in light-dark cage. [0034] FIG. 7 Entries into the third region. White bars—female wild type mice; black bars—female Wfs1 −/− mice; vertical striped bars—male wild type mice; grey bars—male Wfs1 −/− mice. p<0.05 compared to female wild type mice. (Newman-Keuls test, Two-way ANOVA). [0035] FIG. 8 Time spent in the light region (s). White bars—female wild type mice; black bars—female Wfs1 −/− mice; vertical striped bars—male wild type mice; grey bars—male Wfs1 −/− mice. p<0.05 compared to female wild type mice; +p<0.05 compared to female Wfs1 −/− mice; +++p<0.05 compared to male Wfs1 −/− mice. (Newman-Keuls test, Two-way ANOVA). [0036] FIG. 9 Number of rises on back paws. White bars—female wild type mice; black bars—female Wfs1 −/− mice; vertical striped bars—male wild type mice; grey bars—male Wfs1 −/− mice. p<0.05 compared to female wild type mice; *p<0.01 compared to male wild type mice. (Newman-Keuls test, Two-way ANOVA). [0037] FIG. 10, FIG. 11, FIG. 12 and FIG. 13 exploratory activity of female Wfs1 −/− mice in motor activity box. [0038] FIG. 10 Time spent in the middle (s). White bars—wild type mice; black bars—Wfs1 −/− mice; p<0.05 compared to wild type mice. (Tukey HSD test, One-way ANOVA). [0039] FIG. 11 Number of rises on back paws. White bars—wild type mice; black bars—Wfs1 −/− mice. p<0.05 compared to wild type mice. (Tukey HSD test, One-way ANOVA). [0040] FIG. 12 Motility in cage (m). White bars—wild type mice; black bars—Wfs1 −/− mice. p<0.01 compared to wild type mice. (Tukey HSD test, One-way ANOVA). [0041] FIG. 13 Duration of motility in cage (s). White bars—wild type mice; black bars—Wfs1 −/− mice. p<0.01 compared to wild type mice. (Tukey HSD test, One-way ANOVA). [0042] FIG. 14 Hyponeophagia test. White bars—female wild type mice; black bars—female Wfs1 −/− mice. p<0.05 compared to wild type mice. (Tukey HSD test, One-Way ANOVA). [0043] FIG. 15 and FIG. 16 LacZ staining to present the expression level of Wfs1 gene and its determination. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Example 1 Creating a Transgenic Animal Model for Pathological Anxiety [0044] The ordinarily skilled artisan recognizes that there are a number of basic strategies for creating a rodent with nonfunctional Wfs1 protein. In a preferred embodiment a mutation is introduced into the wild-type Wfs1 gene of a rodent so that it renders the Wfs1 protein nonfunctional. In a preferred embodiment this is done by cloning a DNA targeting construct that comprises a mutation (point mutation, deletion, insertion) flanked (e.g. surrounded) by sequences of desired length of the wildtype Wfs1 gene allele to permit homologous recombination ( FIG. 1 ). In preferred embodiments, the rodent is the mouse as mouse is the only mammal where homologous recombination with efficient germline transmission is currently available. An exemplary procedure used in the present invention to generate a transgenic mouse line expressing nonfunctional Wfs1 protein and having a NLS-LacZ marker protein fused to the truncated form of Wfs1 polypeptide includes the following steps: 1) A 500 bp PCR product from the 8th exon of mouse WFS1 gene was used as a probe to screen mouse genomic PAC library RPCI21 (derived from 129/SvevT ACfBR mouse DNA), as a result clone 391-J24 was isolated. 2) A 9.7 kb BamHI fragment was isolated from clone 391-J24 including the 7th and 8th exons of the Wfs1 gene with flanking introns and the named fragment was subcloned into pGem-11Z+ (Promega) cloning plasmid. 3) A 3.7 kb NcoI fragment containing all but the first 208 nucleotides of the eighth exon of the Wfs1 gene and 1.3 kb of the following noncoding genomic sequence was replaced with an in-frame NLSLacZNeo cassette. 4) pgk-TK negative selection cassette was cloned via XhoI into pGem11-Z+ multicloning site upstream of the 5′ genomic arm of the targeting construct. 5) The Wfs1 targeting construct was transformed into DH-5α E. coli competent cells and purified from bacterial lysates using Plasmid Midi Kit (QIAGEN). 6) 40 μg of Wfs1 targeting construct was linearized with NotI and precipitated in cold ethanol. 7) 20 μg of the targeting construct was electroporated into W4/129S6 embryonic stem cells (Taconic) and positive clones were selected using G418 selection. Positive clones were enriched for homologous recombination events using resistance to Gancyclovir treatment. 8) All surviving embryonic stem cell clones were picked and genotyped for homologous recombination by PCR using primers NeoRI (5′-gac cgc tat cag gac ata gcg-3′; SEQ ID No. 1) and Wfs1_WTR1 (5′-agg act cag gtt ctg cct ca-3′; SEQ ID No. 2) and verified with DNA sequencing. 9) Clones identified as positive for homologous recombination were injected into C57/bl6 blastocysts to obtain chimeric mice. 10) Male chimeras were mated with wildtype C57/bl6 mice or 129/SvEvTac mice to obtain mice heterozygous for Wfs1 deficiency. 11) Mice homozygous for Wfs1 deficiency were obtained by mating heterozygotes. [0045] The expression of the Wfs1 protein could be reduced in transgenic animals also by means of RNA interference with antisense oligo- or polynucleotides or nucleotide analogs. In that case antisense construct is inserted into the genome of the transgenic mouse and this insertion is inheritable. Example 2 Animal Models for Pathological Anxiety [0046] In order to describe some possible applications of the object of the invention, we performed several behavioural experiments. Anxiety markers were assessed or animal behaviour was scored in the experiments. [0047] Anxiety Tests. [0048] Ethological models based on inborn anxiety reactions. [0049] Elevated Plus-Maze [0050] The plus cage consisted of two reciprocally positioned closed (surrounded by walls) and open arms, resembling a plus sign in shape. The cage was elevated to the height of 30 cm. The principle of the model consists in the tendency of anxious animals to avoid entering the open arms of the cage and to prefer to stay in the closed arms. The experiment was performed with preceding isolation (15-20 min) of the animals from their cage fellows. Lighting level during the experiment was 12-20 lux. The experiments revealed that female and male Wfs1 −/− mice behave differently. Namely, female Wfs1 −/− mice exhibit a significant reduction of the exploratory activity (anxiety) and the males display an increase in exploratory activity. Compared to female wild type mice, the female Wfs1 −/− animals spent 2 times less time on the aversive open arm ( FIG. 2 ) and performed downwards examinations from the open arm 1.6 times less ( FIG. 3 ). We have observed such kind of behavioural distinction between male and female mice among wild type mice after three weeks of isolation (Abramov et al., 2004). Conclusively, the Wfs1 −/− mice are extremely sensitive to environmental factors. Short isolation causes similar behavioural changes in transgenic animals like long-term isolation in their wild-type littermates. Diazepam increased the time spent on the open arms of the cage in female Wfs1 −/− homozygotes ( FIG. 4 ), the number of downwards examinations from the open arms ( FIG. 5 ), while risk avoidance behaviour significantly decreased ( FIG. 6 ) and vocalization terminated (vocalization: physiological saline group 24%, diazepam group 0%). An interesting influence on the vocalization of the mice occurred also due to applying lighting levels of different intensities. Namely, at low lighting intensity 19% of the Wfs−/− animals vocalized, while at very strong lighting the amount of vocalizing mice with mutated Wfs1 gene grew to 24% together with significant increase in the intensity of the vocalization. We discovered weight differences between different genotypes. The average weight of the male mice of the “wild type” was 28.6 g, that of Wfs1 −/− of the same sex was 22.5 g; “wild type” females 23.8 g and Wfs1 −/− 19.9 g. [0051] Light-Dark Cage Test [0052] The cage was divided into two: a ⅔ part was lighted and a ⅓ part with darkened cover. The light part was divided into three equal parts, so that the most aversive part was the third part, which is located most distantly from the dark part. Anxious animals preferred to remain mostly in the dark part and avoided the aversive light partition. The experiment was performed one week after the elevated plus-maze experiment and no preliminary isolation of the animals was applied. Lighting level in the light part of the cage was 270 lux. [0053] The results of the experiment revealed that both female and male Wfs1 −/− mice exhibited anxiety-like behaviour, while it was somewhat more clearly expressed in females. The Wfs1 −/− mice were significantly more anxious than the wild type mice. Namely, the female Wfs1 −/− mice performed 1.5-2 times less entrances to the various parts of the light partition, if compared to the wild type mice ( FIG. 7 ) and the duration of their stay in the light part was twice shorter ( FIG. 8 ). In addition, the Wfs1 −/− mice exhibited 2.5 times less rises on hindpaws, which also reflects the anxiety of the animal ( FIG. 9 ). In the test cage 30% of the Wfs1 −/− mice vocalized. Injecting an anxiolytic dose of diazepam completely removed the vocalization. [0054] Motor Activity Box [0055] Mice were studied for exploratory activity during 30 minutes in a cage supplied with photosensors (448×448×450 mm). No difference was found between the male mice, female Wfs1 −/− mice exhibited significantly reduced exploratory activity. Wfs1 −/− mice spent 2.5 times shorter periods in the middle of the cage compared to the wild type mice ( FIG. 10 ). Wfs1 −/− mice made 2 times less rises on hindpaws ( FIG. 11 ). Different genotypes exhibited 1.5 times differences in motion in cage and motion duration as well ( FIG. 12 and FIG. 13 ). [0056] Hyponeophagia [0057] Mice starved for 24 hours were examined for the rapidity of acceptance of unknown food in a novel environment and if they accept it at all. No difference was observed between male mice, while female mice with Wfs1 gene deficiency largely avoided novel food. Comparison of wild type and genetically deficient female mice gave a statistically significant difference ( FIG. 14 ). [0058] Localisation in Brain [0059] The expression profile of β-galactosidase refers to preferred expression of the Wfs1 gene in brain structures related to olfactory sensation and emotions. Especially remarkable expression of the Wfs1 gene is observed in two most important brain structures related to anxiety—the central nucleus of amygdala and the bednucleus of stria terminalis. The role of nucelus accumbens is remarkable in explorative behaviour as well and also in this structure very selective and remarkable expression of the Wfs1 gene was observed. The selective expression of the Wfs1 gene in the CA1 region of hippocampus is also worth attention. [0060] These results obtained from morphological studies are an important support to the changes described in behavioural experiments. [0061] Mice with Wfs1 gene deficiency (especially females) exhibit a very important adaptational disturbance in new environment, which is apparently caused by changes in the limbic structures of the brain (amygdala, bednucleus of stria terminalis and accumbens). Example 3 Identification of Compounds Suitable for the Treatment of Diseases or Conditions Caused by Pathological Anxiety [0062] The following example describes one possible mode for using the invention for the identification of compounds suitable for the treatment of diseases or conditions caused by pathological anxiety. [0063] Two groups of mice with Wfs1 gene deficiency took part in the experiment. Mice in the test group were injected a solution containing a compound or a mixture of compounds in a known concentration. The administration was performed into the abdominal cavity, when the agent was capable to penetrate effectively the haematoencephal barrier (e.g. a low-molecular compound) or into brain ventricles, when the agent (e.g. a peptide or other rapidly metabolized compound) was not able to penetrate it. The mice in the control group were administred physiological saline. After the administration of the agent or physiological saline a behavioural experiment was performed on the animals, where their anxiety behaviour was assessed in elevated plus-maze. The agent was considered as reducing anxiety, if the anxiety behaviour of the animals in test group was statistically significantly reduced in comparison with the mice of the control group ( FIG. 4, FIG. 5 and FIG. 6 ). [0064] Diazepam in the dose of 1 mg/kg was used for testing agents, but the current invention is not limited to the named compound. The high efficiency of diazepam suggests that the named transgenic mouse can be utilized for screening for new potential anxiolytic drugs. Example 4 Using the Wfs1 Protein as a Target for Identification of the Compounds with an Effect Against Pathological Anxiety [0065] The following example describes one possible mode for using the wfs1 protein of the invention as a target for the identification of compounds with an effect against pathological anxiety or anxiety disorders. [0066] Two groups of mice with Wfs1 gene deficiency took part in the experiment. Mice in the test group were injected a solution containing a compound or a mixture of compounds in a known concentration, whereas the compound exhibits direct or indirect effect on the expression and biological activity of the Wfs1 protein. The administration was performed into the abdominal cavity, when the agent was capable to penetrate effectively the haematoencephal barrier (e.g. a low-molecular compound) or into brain ventricles, when the agent (e.g. a peptide or other rapidly metabolized compound) was not able to penetrate the biological barrier between brain and blood. The mice in the control group were administred physiological saline or the solvent of the solution of the tested compound. After the administration of the agent or solvent a behavioural experiment was performed on the animals, where their anxiety behaviour was assessed in elevated plus-maze. The agent was considered as reducing anxiety, if the anxiety behaviour of the animals in test group was statistically significantly reduced in comparison with the mice of the control group. [0067] Diazepam in the dose of 1 mg/kg was used for testing agents, but the current invention is not limited to the named compound. [0068] Assessment of the agents increasing the expression of the Wfs1 protein. [0069] As one aspect of the invention, the described animal model was used for assessing the compounds (agents), which increase the expression of the Wfs1 protein. The current animal model expressed a compound LacZ-Wfs1 protein lacking the activity of the Wfs1 protein enabling the assessment of the level of expression of the Wfs1 protein in an animal who lacked the functional Wfs1 protein by measuring the activity of the lacZ protein directly in whole organs and tissues of the animal after fixation with paraformaldehyde. The exemplary staining procedure used in the current invention for the identification of the Wfs1-NLSLacZ compound protein in Wfs1 deficient mice comprised: 1) Wfs1 −/− mice were deeply insensitized with ketamine and fixed by transcardiac perfusion with 20 mL PBS and 20 mL 2% PFA; 2) Organs of interest were dissected, embedded in 30% sucrose solution, slices and incubated for 24 hours in lacZ staining solution (5 mM K3Fe(CN)6; 5 mM K4Fe(CN)6; 1 mg/mL X-Gal; 0.125% IGEPAL in 0.1M PB, pH 7.3) at ambient temperature in dark; 3) samples were recorded with Canon digital CCD camera, the images were processed with Adobe Photoshop software. The results are shown in FIG. 15 and FIG. 16. [0070] It appears from these figures, that using the present invention it is possible to check and measure the expression of the Wfs1 protein, i.e. the expression after translation, applying shown simple method of staining. This method is significantly more informative from the functional aspect than just sole measurement of transcriptional activity (assessment of mRNA level), as it enables the assessment of changes in proteins. The activation of the function of the Wfs1 protein gives rise to enhanced lacZ staining. This example also describes how to assess changes in the expression of the Wfs1 protein in various brain regions, when the effects of a tested medication are described. This is a feature of especially high practical value, as anti-anxiety substances presumably possess specific effect in various brain structures. Localization of effects in this manner helps to develop drugs with less undesired side effects. SUMMARY: [/INST] The invention discloses the transgenic animal model for pathological anxiety, the method to generate this model, the method to test drugs and drug candidates for the treatment of pathological anxiety and the method to use Wfs1 as target for screening of new anxiolytic drugs to treat pathological anxiety. This animal model is useful to test potential drug candidates for the treatment of diseases caused by pathological anxiety and to screen therapeutic compounds for the psychiatric disorders caused by reduces stress-tolerance and deficiency in adaptation to environmental challenges. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Anna Hodgekiss. PUBLISHED:. 10:34 EST, 11 March 2013. \|. UPDATED:. 07:06 EST, 12 March 2013. Joanne Thompson, a senior staff nurse in the special care baby unit of the hospital, is accused of allowing a more junior nurse to administer the incorrect dose. Premature twins born at the scandal-hit Stafford Hospital died after receiving ten times the recommended dose of morphine, a disciplinary hearing has been told. Alfie and Harry McQuillan, who died on November 1 2010, were given an 'excessive' dose of morphine hours after their birth. The babies, who were born at 27 weeks, received 600 and 850 microgrammes (mcg) of morphine respectively when they should have been given between 50 and 100 mcg, a Nursing and Midwifery Council (NMC) hearing was told. Joanne Thompson, a senior staff nurse in the special care baby unit of the hospital, is accused of allowing a more junior nurse, Lisa Lucas, prepare and administer the drug to the twins with the help of a junior doctor. This is against hospital protocol which states this should be carried out by two registered nurses. Hayley Amos, a neo natal senior staff nurse at the hospital at the time, said she had reported for duty on the 7am shift on October 30 2010 after the overdose had been administered. Speaking about the reaction of the two nurses after the error had been discovered, she said: 'Joanne went very quiet at this point and was visibly shocked. Lisa was hysterical and kept saying: "Oh my God, what if I have killed these babies?" and she was crying and shaking. 'I did my best to calm and reassure Lisa by saying, ‘look at them Lisa, they are fine, now calm down’. I don’t recall Joanne saying anything. I sent them to the staff room to calm down.' The two nurses were told to complete Serious Incidents Forms by senior mangers at the Stafford NHS Trust and told not take part in any clinical care of the twins, Ms Amos said. She continued: 'Lisa and Jo completed their forms in a consulting room. 'I do not know what discussions were had or what went on between them.' But she added: 'It seems unfair that only Lisa has been held accountable for this drug error. 'Lisa is a very compassionate nurse who normally provides great care to babies on the unit. 'I do not know what went wrong that day. But you cannot say that Lisa is entirely responsible. 'As the senior nurse, Joanne should have ensured that the hospital's procedure was adhered to and that instruction was given to the junior nurse. 'A controlled drug error had taken place and Joanne should take some responsibility.' Despite being the senior nurse on duty at the time of the deaths, Ms Thompson was back on duty two days later on November 2nd, before an investigation had began while Miss Lucas remained suspended. Mrs. Thompson denies a series of charges including failing to take the. clinical lead of nursing care when required in relation to the. administration of the morphine to the babies. The twins' mother, Ami Dean, was rushed to Stafford Hospital in the early hours of October 30th, 2010, after she began to bleed. Alfie and Harry McQuillan died at Stafford Hospital (pictured) two days after being given an 'excessive' dose of morphine hours after their birth in October 2010. Despite being born prematurely, the. identical twins had been in a 'good' condition during the first few. hours of their lives, an inquest into their deaths in 2012 heard. But it was decided to give the twins. morphine to stabilise them before they were transferred to the maternity. unit at the University Hospital of North Staffordshire where the twins. died on November 1st. The Nursing and Midwifery Council. (NMC) heard today how an error in administration led to the babies. having two doses of morphine administered at the same time. Miss Thompson is accused of not following hospital protocol by allowing a junior doctor to be involved in the administration of medication. Aj Hall, for the NMC, said: 'On the hospital protocols it clearly states that medication administration should be carried out by two registered nurses. It is well known doctors do not get involved in administrating drugs as this is done by nursing staff. 'Mrs Thompson should have ensured that this policy was complied with. The junior doctor had very limited experience and should not have been involved in administering the drugs. 'Mrs Thompson would have been well aware of this.' She added: 'It is vital she take responsibility for this.' Thompson is also accused of not keeping adequate records by scribbling out her signature on the morphine prescription charts without explanation, the court heard. Miss Hall added: 'She scribbled out her signature on the chart but never explained why she did this.' Shoosmiths - the law firm representing the twins’ parents - said last May that South Staffordshire Coroner Andrew Haigh had described the babies’ treatment after birth as'suboptimal', adding that 'there were failings in the care the twins received'. A spokesman for the company said the coroner, who recorded a narrative verdict at Cannock Coroner’s Court, said the boys died from complications of extreme prematurity and that morphine was 'likely to have played a role'. The hearing comes after the Francis inquiry into failings at Stafford Hospital where it is estimated there were between 400 and 1,200 excess deaths between 2005 and 2009. The hearing continues SUMMARY: [/INST] Alfie and Harry McQuillan were born at 27 weeks in October 2010. Were in a 'good condition' despite being born so early, inquest heard. Prescribed morphine to stabilise them but instead given 'excessive dose' Died at scandal-hit Stafford Hospital two days later. Nurse in charge, Joanne Thompson, now facing disciplinary hearing. Accused of letting less senior member of staff administer wrong dose. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: RELATED APPLICATION This application claims the benefit of priority, pursuant to 35 U.S.C. §119(e), from copending U.S. Provisional Patent application Ser. No. 60/202,587 filed May 9, 2000, incorporated by reference. FIELD OF THE INVENTION The present invention is directed to a control system for linear actuator devices, and more particularly to a control system for linear actuator devices utilized upon a floor maintenance machine. BACKGROUND OF THE INVENTION For purposes of convenience, the invention will be described in conjunction with a presently preferred implementation thereof embodied in an electric linear actuator. It will be understood, however, that the principles of the invention may apply equally as well to devices of analogous structure. The design of automatic floor cleaning equipment often involves a considerable amount of rotary and/or linear motion actuation and control. Positioning of structures such as cleaning heads and squeegees must be accomplished quickly and transparently to the operator. The traditional method of controlling motion on cleaning equipment utilizes limit switches or other proximity switches that either directly control the power to one or more linear actuators, e.g., via relay switches, etc., or indirectly control linear actuators via a signal sent to a CPU indicating the position of the actuators. These switches introduce negative reliability and assembly issues into the design of the machine. For example, an actuator or linkage could be damaged if a jam occurs in mid stroke of the actuator as current would continue to be supplied to the actuator. Additionally, limit switches may become contaminated or damaged through the operation of the machine. The switches may also be mis-aligned during the assembly of the machine. Any of these situations can cause the actuator to stall, overheat, and/or damage the linkage or associated structure coupled thereto. In mobile equipment systems that include a plurality of electric and or hydraulic devices, such as servo actuators, motors and pumps, it is conventional practice to couple all of such devices to a remote master controller for coordinating or orchestrating device operation to perform a desired task. Motors and actuators may be employed, for example, at several coordinated stages of a surface cleaning machine for automated control of fluids and surface working devices. In accordance with conventional practice, the master controller may comprise a programmable controller or the like coupled to the various remotely-positioned devices. Feedback from the remote devices may be provided via control signals therefrom. For closed-loop operation, a sensor may be coupled to each device for sensing operation thereof, and feeding a corresponding signal to the master controller through an analog-to-digital converter, etc. Thus, in a system that embodies a plurality of electric and/or hydraulic devices, a substantial quantity of electrical conductors must be provided for feeding individual control signals to the various devices and returning sensor signals to the master controller. Such conductors interfere with system design and operation, and are subject to failure. The bank of D/A and A/D converters for feeding signals to and from the master controller add to the expense and complexity of the overall system. Perhaps most importantly, system performance is limited by capabilities of the master controller. For example, a programmable controller may require one hundred milliseconds to scan a device sensor signal, compute a new control signal and transmit such control signal to the remote device. An overburdened programmable controller may not perform acceptably in high performance applications that may require a ten millisecond response time, for example, at each of a plurality of remote devices. SUMMARY OF THE PRESENT INVENTION The present invention relates to a linear actuator control system exhibiting improved performance. To solve some of these limitations associated with the prior art devices, a control system has been implemented in which the speed and force from the actuator can be independently controlled from a control processing unit (CPU). In a system according to the present invention, the CPU can monitor the force being delivered to the actuator and that information can be used to deduce the force and/or position of the actuator. This information can also be used to determine that the actuator has reached the end of its stroke. A system according to the present invention has the ability to reduce or terminate the power being delivered to the load device in order to prevent damage to the device. The reaction time of this protection circuitry is short enough to prevent damage to the load and the energy control circuitry. Importantly, such a system can eliminate the position sensing devices normally used in this type of machine. The present invention relates to a control system for one or more linear actuator devices, such as present on a surface maintenance machine. One aspect of the invention is to provide a linear actuator control system for use on a surface maintenance machine, such as a scrubber or sweeper, which utilizes a comparison circuit in which a signal representative of the load current in an linear actuator is modified by a signal representative of the desired load current to maintain applied load current at a desired level. Another aspect of the present invention provides a control system which automatically limits the current load to a linear actuator in the event of an abnormal condition, e.g. linkage jamming, obstruction contact, etc. Another aspect of the present invention provides a control system for automatically controlling one or more linear actuators of a surface maintenance machine which may be applied to various types of surface maintenance machines having different surface maintenance tools and providing for different surface maintenance functions. A linear actuator control system in accordance with a further aspect of the invention includes a linear actuator having an electric motor component. The electric motor component is connected to drive circuitry that includes a solid state switch, preferably a FET, that is connected between one terminal of the electric motor, with the other terminal being connected to electrical ground. The control switch circuit receives a switch control signal from the microprocessor-based control electronics, and is connected to the control electrode (gate) of the FET for setting the switch circuit and controlling power to the electric motor of the linear actuator through the FET in response to the control signal. Feedback circuitry is responsive to the current through the electric motor for resetting the switch circuit and interrupting application of power to the electric motor. The feedback circuitry is responsive to a voltage drop across a shunt resistor. It is therefore a general object of the present invention to provide a linear actuator control system that exhibits a fast response time necessary for high performance applications, while at the same time reducing cost and complexity that are inherent in prior art system of the character described above. In furtherance of the foregoing, a more specific object of the invention is to provide a system of the described character wherein each of the system linear actuators embodies microprocessor-based control adapted to communicate with a central or master controller and for thereby distributing, at least partial, control of the several linear actuators while maintaining overall coordination thereamong. Another object of the present invention is to provide a linear actuator control structure in which all control components, including current level detectors and microprocessor-based control electronics, are fully integrated into compact inexpensive packages, and which may be readily employed in a wide variety of system applications. Yet another object of the invention is to provide a linear actuator of the described character with enhanced robustness of hardware, including the elimination of limit switches or other position detection devices within or in association with the linear actuator. Still another object of the present invention is to provide a system for controlling a linear actuator device, with control electronics that limit current overload as compared with prior art devices of a similar character, and that have enhanced capabilities for protecting the linear actuator against damage due to structure obstruction, contact, etc. BRIEF DESCRIPTION OF THE DRAWINGS Preferred embodiments of the invention will be described in detail hereinafter with reference to the accompanying drawings, in which like reference numerals refer to like elements throughout, wherein: FIG. 1 is a perspective of a typical walk-behind surface maintenance machine which may utilize the control system of the present invention; FIG. 2 is a block diagram illustrating the control system for a linear actuator according to the present invention; FIG. 3 is a simplified schematic circuit illustrating a preferred embodiment of the present invention; and FIGS. 4A and 4B together illustrate a preferred embodiment of the control system of FIG. 1. DESCRIPTION OF PREFERRED EMBODIMENTS For purposes of convenience, the invention will be described in conjunction with a presently preferred implementation thereof embodied in an electric linear actuator. It will be understood, however, that the principles of the invention may apply equally as well to devices of analogous structure. In FIG. 1, a vehicle such as a floor scrubbing machine 10 is indicated generally and may be of a type manufactured by Tennant Company of Minneapolis, Minn., assignee of the present invention. Such a device is disclosed in U.S. Pat. No. 4,757,566, the entire disclosure of which is incorporated by reference herein for all purposes. The scrubber 10 may include a housing 12 and a rear operating control 14 which is used by the operator to control vehicle 10 speed and direction. A control device 16 is used to control functions of the machine 10. There may be a pair of rotating brushes or pads 18. A linear actuator 20 may be utilized to control the position, and hence the downward force, of the brushes 18. A squeegee 22 is normally positioned at the rear of the vehicle 10 and is effective, as is known in the art, to squeegee the floor and remove any standing water. Normally, there will be a vacuum device 24 attached to the squeegee 22 which will apply suction to remove standing water collected by the squeegee. In one embodiment of the present invention, there may be one or more surface working tools such as sweeping brushes, scrubbing brushes or polishing pads, and there may be one or more electric actuators 20 controlling the position of said surface maintenance tools 18. In other embodiments of the present invention, there may be one or more hopper or debris containers (not shown), and there may be one or more linear actuators 20 controlling the lifting of the hopper during a hopper dumping procedure. Linear actuators 20 may comprise an electric DC motor as the motive element. Those versed in the art are aware that in an electric DC motor the current which the motor draws is proportional to the load on the motor. Although the invention will be described in connection with a scrubber 10, it should be clear that the control structure according to the present invention has application to other types of vehicles using surface maintenance tools, such as a sweeper or a polishing or burnishing machine. Referring to FIG. 2, a block diagram is provided to explain functional interrelations between various elements of a control device 16 according to the present invention. The control device 16 is utilized to control the linear actuator 20. Control device 16 includes a central processor unit 30 (CPU) which receives input from elements of the control system and provides output signals to elements of the control system. Control device 16 includes the additional elements: maximum current level converter 32, high speed current limit 34, power control device 36, current measurement element 38, current level converter 40. Additional elements or components would be appreciated by those skilled in the relevant arts. CPU 30 may be a dedicated controller or may be part of a larger controller for operating additional functions of a maintenance machine. CPU 30 may be a programmable logic controller (PLC). CPU 30 provides a speed request signal 42 to the high speed limit block 34. The speed request signal 42 may be an analog or digital signal. In one embodiment, the speed request signal 42 is an analog signal comprising a voltage level representative of the speed request. CPU 30 also provides a maximum force request signal 44 which is converted by the maximum current level converter 32, which may be D/A converter, into a maximum current level signal 46. Maximum current level signal 46 is provided as another input signal to the high speed current limit block 34. CPU 10 receives a signal 48 from the high speed current limit block 34 indicating whether or not a maximum designated current of the linear actuator 20 has been exceeded. The CPU 10 utilizes this information to determine if the actuator 20 has reached the end of its stroke, or if it has come in contact with an obstacle. The CPU 10 can utilize internal timers to estimate the position of the actuator 20 during a move. It can use this information to adjust the speed and maximum force of the actuator 20 as the actuator movement progresses. For instance, the CPU 10 may request high speed and high current to start the actuator moving, high speed and medium current through the bulk of the movement, and low speed, low current to minimize the impact at the end of actuator stroke. The feedback signal 48 could be a current level, rather then the maximum force signal. In that case, the CPU 10 could also use the load information to make decisions as to actuator 20 speed, position, or stroke length. For example, this would be useful if a hopper lift height of a particular machine should be limited by load. This could also be used to estimate the speed and position of the actuator 20 using back EMF calculations or changes in mechanical advantage as the actuator 20 progresses through its stroke. The maximum current level conversion block 32 converts the force request 44 from the CPU 10 to a maximum current level 46 that can be interpreted by the high speed current limit block 34. The high speed current limit block 34 uses the maximum current level signal 46 from the maximum current level conversion block 32, the speed request signal 42 from the CPU block 10, and a current level signal 50 from the current level conversion block 40 to generate an energy level control signal 52 for the power control device 36. In one embodiment, the energy level control signal 52 is a pulse width-modulated signal used to control the gate of a Field Effect Transistor (FET) within the power control device 36. The output of the high speed current limit block 34 will reflect the duty cycle of the speed request 42 unless the maximum current level is exceeded (current limit mode). When in current limit mode, block 34 will signal the power control device 36 to limit the current of the linear actuator 20 in order to prevent overheating of the device or other damage. Also when in current limited mode, the high speed current limit block 34 will send a maximum force exceeded signal 48 to the CPU 10 indicating that the maximum allowable current has been exceeded. The CPU 10 can then utilize this information to terminate operation of the load. Because the high-speed current limit 34 acts prior to CPU 10 direction to reduce the current to the load 20, the time delay induced waiting for the CPU 10 to directly terminate operation of the load 20 is less critical. The power control device 36 receives the control signal 52 from the high speed current limit block 34, and uses it to control power flow from a battery 54 to the load. In one embodiment, the power control device 36 is a Field Effect Transistor (FET). The current measurement block 40 provides a voltage level 50 proportional to the level of current flowing to the load. In this design, the current measurement device 38 is a shunt resistor. The current level conversion block 40 receives the raw current level information from the current measurement block 38, and transforms it into a format that can be received by the high speed current limit block 34. FIGS. 3 and 4 illustrate preferred embodiments of the present invention. A microprocessor controller (or CPU) 110 is utilized in the control structure. Those skilled in the relevant arts will recognize that the controller 110 can receive a variety of inputs and control a variety of outputs. Specific to illustrated embodiment of the present invention, the outputs of the controller 110 include a PWM (pulse-width-modulated) drive signal 112 and a “force request” signal 114. An input to the microprocessor 110 includes a comparison signal 106. The force-request signal 114 is received by a D/A converter 122 which calculates a maximum current level corresponding to the force request signal 114 and outputs an analog signal representing the maximum current level 124 to a threshold comparator 160. The output input 130 to the comparator 160 is received from a motor current signal circuit 142, as described hereinafter. The comparator output 136 is provided both to a NAND device 162 and as a comparison signal 106 to the microprocessor 110 (as a feedback signal). The PWM drive signal 102 and comparator output 136 are received as input signals into the NAND device 162, the output of which is used to control the power control device (FET) 138. The linear actuator power control switch 138 is a FET having primary current-conducting source and drain electrodes connected in series with the linear actuator 120 and a current sensing shunt resistor 166 between ground. The motor current signal 130 (to the comparator) 160 is obtained via a motor current signal circuit 142 vis-a-vis an amplified shunt resistor voltage. The output 130 from an amplifier 143 is a voltage indicative of load current in the linear actuator 120. The motor current sensor 142 utilizes a shunt resistor 166, with the voltage drop across the shunt 166 used as an indicator of the current flow to the motor 120. Alternative current sensors 142 maybe used, however. For example, a toroidal core or other non-contact type of sensor may be utilized. In operation, the microprocessor 110 generates a PWM drive signal 102 and a force request signal 104. In under-load current conditions (the comparison signal 106 not high), the PWM signal 102 is passed through the NAND device 162 to the FET switch 138 to control the duty cycle of the linear actuator 120. Conversely, when under excessive current load condition (the comparison signal 106 is high), the NAND device 162 blocks the PWM signal 102 from activating the FET switch 138. After the PWM drive signal 102 is generated, the force request signal 114 is generated and passed from further processing by the D/A converter 122. The threshold comparator 160 is used to detect over current conditions (the motor current signal 130 exceeds the D/A output signal) 124. A comparison signal 136 is generated and fed back to the microprocessor 110. FIG. 3 includes additional aspects of the present invention, include a multiplexer and the FET-based bridge for implementing the control system for a pair of linear actuators. Various modifications of the above-described embodiment of the invention will be apparent to those skilled in the relevant arts, and it is to be understood that such modifications can be made without departing from the scope of the invention. SUMMARY: [/INST] A control system for a linear actuator having an electric motor drawing a variable current level during operation. The control system includes a current level sensor for determining an operational current level of the linear actuator and a controller for generating a drive signal and a force request signal representative of a desired current level of the linear actuator. The drive signal remains constant during a predetermined time interval of the controller. The control system further includes a current limiting component for receiving the force request signal, the current level of the linear actuator and the drive signal. The current limiting component minimizes the current level of the electric motor in response to a comparison between the force request signal and the desired current level within a time interval substantially smaller than the predetermined time interval of the controller. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority of provisional application Ser. No. 60/405,769, filed Aug. 23, 2002. TECHNICAL FIELD This invention relates to prosthesis for implantation within the human or animal body for the repair of damaged lumens such as blood vessels. BACKGROUND OF THE INVENTION Although this invention will be discussed with respect to its application to repair of abdominal aortic aneurysms the invention is not so limited and may apply to prosthesis for repair of other lumens within the human or animal body. Throughout this specification when discussing the application of this invention to the aorta the term distal with respect to a prosthesis is intended to refer to the end of the prosthesis furthest away in the direction of blood flow from the heart and the term proximal is intended to mean the end of the prosthesis which when implanted would be nearest to the heart. In our earlier patent specification published number WO98/53761 an endoluminal prosthesis was disclosed which in particular was useful for repair of aortic aneurysms. A problem with such a prosthesis is that for different persons or animals different size prostheses must be constructed because the specific dimensions of an aorta are quite variable in each of length, diameter and angulation between the renal artery region and the region of the aortic bifurcation. SUMMARY OF THE INVENTION It is the object of this invention to provide a composite prosthesis which can be assembled to fit a range of lengths of aorta thereby saving inventory costs and enabling off the shelf supply of a prosthesis assembly. In one form therefore although this may not necessarily be the only or broadest form the invention is said to reside in a prostheses assembly adapted for deployment in an aorta to span an aortic aneurysm, comprising at least first and second members with an end portion of one member to be joined to an end portion of the other member portion when in and when expanded within a lumen of a patient, wherein each member comprises a stent arrangement associated with a graft arrangement, wherein the end portion of one member has at least part of its stent arrangement on the inner surface of its graft, and wherein the end portion of the said other member has at least part of its stent arrangement on the inner surface of its graft. In an alternative form the invention is said to reside in a two part stent graft prostheses assembly comprising at least first and second members to be located within and joined together within a lumen of a patient, wherein one member is to be initially located and expanded within the lumen, said one member having one end portion with one or more stents on the inner surface of the graft, wherein the other member is to be sequentially located within and expanded within the said lumen and has a second end portion to be located within the said one end portion, and wherein the said second end portion has a graft portion with a stent or stents on the inside surface thereof, so that when the said one and said other end portions are in engagement with one another there is no stent material between the engaging portions. Preferably the said one member has a stent or stents on the outer surface of a further part or the remainder of the graft of the said one member and the said other member has a stent or stents on the outer surface of a further part or the remainder of the graft of the said other member. Preferably the stent graft prosthesis member for use with the above assembly of claim comprises a stent or stents on one graft surface at one end portion thereof, and further comprises a stent or stents on at least a part of the other graft surface which part is spaced longitudinally from the said one end portion. In an alternative form the invention is said to reside in a composite prosthesis adapted for deployment in a lumen, the prosthesis comprising a first substantially tubular prosthesis portion and a second substantially tubular prosthesis portion, characterized by each prosthesis portion having a plurality of self expanding stents on an outer surface thereof along the length of each portion and at least one self expanding stent on an inside surface thereof at each end of each portion, each prosthesis portion having a connecting end adapted to engage with the connecting end of the other prosthesis portion and a remote end at the opposite end to the connecting end, each connecting end having the same outside diameter as the other connecting end, whereby in use the connecting end of the first prosthesis portion can be deployed either inside or outside the connecting end of the second prosthesis portion with at least two stents overlapping. In further form the invention is said to reside in a composite prosthesis adapted for deployment in an aorta to span an aortic aneurysm adjacent to or including an aortic bifurcation, the prosthesis comprising a substantially tubular proximal prosthesis portion and a substantially tubular distal prosthesis portion, characterised by each prosthesis portion having a plurality of self expanding stents on an outer surface thereof along the length of each portion and at least one self expanding stent on an inside surface thereof at each end of each portion, each prosthesis portion having a connecting end adapted to engage with the connecting end of the other prosthesis portion and a remote end at the opposite end to the connecting end, each connecting end having the same outside diameter as the other connecting end, whereby in use the connecting end of the proximal prosthesis portion can be deployed either inside or outside the connecting end of the distal prosthesis portion with at least two stents overlapping such that the either the distal or proximal prosthesis portion can be deployed first and the other prosthesis portion deployed so that its connecting end is within the connecting end of the first deployed prosthesis portion. It will be seen that by these general forms of the invention the amount of overlap of the first and second or proximal and distal prosthesis can be varied thereby enabling a variety of lengths of aorta or other body lumen or the region being spanned in the aorta to be allowed for. The ability to deploy with the connecting end either inside or outside means that the either the first or second prosthesis portion can be deployed first and then the other one deployed inside it. This gives a physician considerable flexibility and means that a hospital can have a stock of prostheses which can be readily assembled depending upon the observed vasculature. Having the same diameter for each connecting end means that an interference fit is obtained whether one connecting end goes inside or outside the other connecting end. In one form of the invention the second or distal prosthesis portion may be a bifurcated graft having a body portion and two leg portions. Alternatively the second or distal prosthesis portion may be an aorto-uni-iliac prosthesis. The bifurcated second or distal prosthesis portion may have a shorter leg and a longer leg and there may be self expanding stents on the outside of the shorter leg and the inside of the distal end of the longer leg. There may be further included at least one leg prosthesis portion. The leg prosthesis portion may be adapted to be deployed in to either the longer or shorter legs of the bifurcated second or distal prosthesis portion or into the end of the aorto-uni-iliac prosthesis. The first or proximal prosthesis portion may be provided with a proximally extending self expanding stent. Such a proximally extending self expanding stent may include barbs to engage against the wall of a lumen to hold the graft in place. This proximally extending self expanding stent may be adapted to span across the renal arteries to provide good mounting of the composite prosthesis within the aorta. Each of the stents may be zig zag or z-stents made from nitinol or stainless steel. Where it is desirable for the prosthesis portions to be flexible to allow for angulation of or curves in the aorta the stents along the length of the prosthesis portion may be spaced apart along the graft material. Spacing of stents may be from 0 mm to 8 mm. More flexibility may be provided on the proximal portion than the distal portion. In an alternative form the stents may be balloon expandable stents. BRIEF DESCRIPTION OF THE DRAWING This then generally describes the invention but to assist with understanding reference will now be made to the accompanying drawings which show preferred embodiments of the invention. FIG. 1 shows a first embodiment of composite prosthesis according to the invention in an exploded view; FIG. 2 shows an assembled view of the embodiment shown in FIG. 1 ; FIG. 3 shows an alternate assembled view of the embodiment shown in FIG. 1 ; FIG. 4 shows an alternative embodiment of a distal prosthesis portion according to the invention; FIG. 5 shows an assembled view of part of the embodiment shown in FIG. 1 and the embodiment shown in FIG. 4 ; FIG. 6 shows an alternate assembled view of part of the embodiment shown in FIG. 1 and the embodiment shown in FIG. 4 ; FIG. 7 shows an detailed cut away view of the connecting region of a prosthesis assembly of one embodiment of the invention showing the bottom up approach; and FIG. 8 shows an detailed cut away view of the connecting region of a prosthesis assembly of one embodiment of the invention showing the top down approach. DETAILED DESCRIPTION U.S. Pat. No. 5,387,235 entitled “Expandable Transluminal Graft Prosthesis For Repair Of Aneurysm” discloses apparatus and methods of retaining grafts onto deployment devices. These features and other features disclosed in U.S. Pat. No. 5,387,235 could be used with the present invention and the disclosure of U.S. Pat. No. 5,387,235 is herewith incorporated in its entirety into this specification. U.S. Pat. No. 5,720,776 entitled “Barb and Expandable Transluminal Graft Prosthesis For Repair of Aneurysm” discloses improved barbs with various forms of mechanical attachment to a stent. These features and other features disclosed in U.S. Pat. No. 5,720,776 could be used with the present invention and the disclosure of U.S. Pat. No. 5,720,776 is herewith incorporated in its entirety into this specification. U.S. Pat. No. 6,206,931 entitled “Graft Prosthesis Materials” discloses graft prosthesis materials and a method for implanting, transplanting replacing and repairing a part of a patient and particularly the manufacture and use of a purified, collagen based matrix structure removed from a submucosa tissue source. These features and other features disclosed in U.S. Pat. No. 6,206,931 could be used with the present invention and the disclosure of U.S. Pat. No. 6,206,931 is herewith incorporated in its entirety into this specification. PCT Patent Publication No. WO 98/53761 entitled “A Prosthesis And A Method And Means Of Deploying A Prosthesis” discloses an introducer for a prosthesis which retains the prosthesis so that each end can be moved independently. These features and other features disclosed in PCT Patent Publication No. WO 98/53761 could be used with the present invention and the disclosure of PCT Patent Publication No. WO 98/53761 is herewith incorporated in its entirety into this specification. PCT Patent Publication No. WO 99/29262 entitled “Endoluminal Aortic Stents” discloses a fenestrated prosthesis for placement where there are intersecting arteries. This feature and other features disclosed in PCT Patent Publication No. WO 99/29262 could be used with the present invention and the disclosure of PCT Patent Publication No. WO 99/29262 is herewith incorporated in its entirety into this specification. PCT Patent Publication No. WO 03/034948 entitled “Prosthesis For Curved Lumens” discloses prostheses with arrangements for bending the prosthesis for placement into curved lumens. This feature and other features disclosed in PCT Patent Publication No. WO 03/034948 could be used with the present invention and the disclosure of PCT Patent Publication No. WO 03/034948 is herewith incorporated in its entirety into this specification. U.S. Provisional Patent Application Ser. No. 60/392,682, filed Jun. 28, 2002, and U.S. patent application Ser. No. 10/447,406, filed May 29, 2003, entitled “Trigger Wires” disclose release wire systems for the release of stent grafts retained on introducer devices. This feature and other features disclosed in U.S. Provisional Patent Application Ser. No. 60/392,682 and U.S. patent application Ser. No. 10/447,406, filed May 29, 2003 could be used with the present invention and the disclosure of U.S. Provisional Patent Application Ser. No. 60/392,682 and U.S. patent application Ser. No. 10/447,406, filed May 29, 2003 are herewith incorporated in their entirety into this specification. U.S. Provisional Patent Application Ser. No. 60/392,667, filed Jun. 28, 2002, and U.S. patent application Ser. No. 10/609,846, filed Jun. 30, 2003, entitled “Thoracic Deployment Device” disclose introducer devices adapted for deployment of stent grafts particularly in the thoracic arch. This feature and other features disclosed in U.S. Provisional Patent Application Ser. No. 60/392,667 and U.S. patent application Ser. No. 10/609,846, filed Jun. 30, 2003 could be used with the present invention and the disclosure of U.S. Provisional Patent Application Ser. No. 60/392,667 and U.S. patent application Ser. No. 10/609,846, filed Jun. 30, 2003 are herewith incorporated in their entirety into this specification. U.S. Provisional Patent Application Ser. No. 60/392,599, filed Jun. 28, 2002, and U.S. patent application Ser. No. 10/609,835, filed Jun. 30, 2003, entitled “Thoracic Aortic Aneurysm Stent Graft” disclose stent grafts that are useful in treating aortic aneurysms particularly in the thoracic arch. This feature and other features disclosed in U.S. Provisional Patent Application Ser. No 60/392,599 and U.S. patent application Ser. No. 10/609,835, filed Jun. 30, 2003 could be used with the present invention, and the disclosure are herewith incorporated in their entirety into this specification. U.S. Provisional Patent Application Ser. No. 60/391,737, filed Jun. 26, 2002, entitled “Stent-Graft Fastening Arrangement” discloses arrangements for fastening stents onto grafts particularly for exposed stents. This feature and other features disclosed in U.S. Provisional Patent Application No. 60/391,737 could be used with the present invention and the disclosure of U.S. Provisional Patent Application Ser. No. 60/391,737 is herewith incorporated in its entirety into this specification. U.S. Provisional Patent Application Ser. No. 60/405,367, filed Aug. 23, 2002, entitled “Asymmetric Stent Graft Attachment” discloses retention arrangements for retaining onto and releasing prostheses from introducer devices. This feature and other features disclosed in U.S. Provisional Patent Application Ser. No. 60/405,367 could be used with the present invention and the disclosure of U.S. Provisional Patent Application Ser. No. 60/405,367 is herewith incorporated in its entirety into this specification. U.S. patent application Ser. No. 10/322,862, filed Dec. 18, 2002, entitled “Stent Graft With Improved Adhesion” discloses arrangements on stent grafts for enhancing the adhesion of such stent grafts into walls of vessels in which they are deployed. This feature and other features disclosed in U.S. patent application Ser. No. 10/322,862 could be used with the present invention and the disclosure of U.S. patent application Ser. No. 10/322,862 is herewith incorporated in its entirety into this specification. Now looking more closely to the drawings and in particular the embodiment shown in FIGS. 1, 2 and 3 it will be seen that the composite prosthesis includes a first or proximal prosthesis portion 2, a second or distal prosthesis portion 4 and leg prosthesis portion 6. The first or proximal prosthesis portion 2 comprises a fabric material graft body 8 of substantially tubular form with self expanding zig zag stents 10 on the outside along most of its length and self expanding zig zag stents 14 within the tubular body 8 at the proximal end 16 and distal end 12. Extending from the proximal end 16 is a supra-renal zig zag stent 18 with barbs 20 extending distally to provide fixation into the wall of the aorta. The zig-zag stents are also well known as Gianturco Z-stents commercially available from William A Cook Australia Pty Ltd, Brisbane, Australia or Cook Inc, Bloomington, Ind., USA. The graft material is typically DACRON® material available from a number of medical graft manufacturers. The zig zag stent within the proximal end 16 of the first or proximal prosthesis portion 2 assists with sealing of the graft against the walls of the aorta and the external zig zag stents provide a smooth inner surface for the flow of blood through the prosthesis. The internal zig zag stent 14 at the distal end 12 provides an outer surface of the tubular body 8 which is smooth and can seal within the proximal end of the second or distal prosthesis portion 4 when it is deployed within the second or distal prosthesis portion 4. The second or distal prosthesis portion 4 comprises a fabric material graft body 26 and has an internal zig zag stent 22 at its proximal end 24 so that the outer surface of its tubular body 26 is smooth and can seal within the distal end of the first or proximal prosthesis portion 2 when it is deployed within the first or proximal prosthesis portion 2. The external zig zag stents 25 provide a smooth inner surface for the flow of blood through the prosthesis. Towards the distal end of the second or distal prosthesis portion 4 the tubular body 26 bifurcates into a longer leg 28 and a shorter leg 30 each of which has zig zag stents 29 on its outside surface except the terminal zig zag stent 32 on the longer leg. The leg prosthesis portion 6 which is adapted to extend into the contralateral-iliac artery is comprised from a tubular fabric material body 34 with outside zig zag stents 36 along its length except for internal zig zag stents 38 at its proximal and distal ends. FIG. 2 shows the assembled prosthesis in a first arrangement or configuration in which the connecting end 24 of the second or distal prosthesis portion 4 is deployed within the distal connecting end 12 of the first or proximal prosthesis portion 2. It will be realized that the amount of overlap between the first or proximal prosthesis portion 2 and the second or distal prosthesis portion 4 can be varied for different lengths of an aorta from the renal arteries to the aortic bifurcation. It is preferable, however, that there is at least a longitudinal or axial overlap of two stents. This means that there will be a smooth inner surface of one portion engaged against a smooth outer surface of the other portion to provide a good seal. The leg prosthesis portion 6 is deployed with its proximal end 37 within the shorter leg 30 of the second or distal prosthesis portion 4. The prosthesis in FIG. 2 is assembled in what is also known as a top down approach or assembly. The physician will deploy the proximal prosthesis portion 2 first in the aorta of a patient followed by deploying or placing the distal prosthesis portion 4 in the aorta with the proximal end 24 of the distal prosthesis portion 4 inside the distal end 12 of the proximal prosthesis portion 2. FIG. 3 shows the assembled prosthesis in a second arrangement in which the connecting end 12 of the first or proximal prosthesis portion 2 is deployed within the connecting end 24 of the second or distal prosthesis portion 4. It will be realized that the amount of overlap between the first or proximal prosthesis portion 2 and the second or distal prosthesis portion 4 can be varied for different lengths of an aorta from the renal arteries to the aortic bifurcation. It is preferable, however, that there is at least an overlap of two stents. This means that there will be a smooth inner surface of one portion engaged against a smooth outer surface of the other portion to provide a good seal. The leg prosthesis portion 6 is deployed with its proximal end 37 within the shorter leg 30 of the second or distal prosthesis portion 4. The prosthesis in FIG. 3 is assembled in a second arrangement or configuration in what is also known as a bottom up approach or assembly. Here, the physician deploys the distal prosthesis portion 4 first in the aorta of a patient followed by deploying or placing the proximal prosthesis portion 2 through the distal prosthesis portion 4 and into the aorta with the distal connecting end 12 of the proximal prosthesis portion 2 inside the proximal connecting end 24 of the distal prosthesis portion 4. FIG. 4 shows an aorto-uni-iliac prosthesis portion 38 which is suitable as an alternative second or distal prosthesis portion. This portion 38 is adapted to be deployed inside or outside a first or proximal prosthesis portion as depicted in FIGS. 5 or 6 and to extend from the aorta into either of the iliac arteries. In such a situation a plug would normally be deployed into the other iliac artery. The aorto-uni-iliac prosthesis portion 38 comprises a tubular slightly tapered body 40 with a proximal end 42 and a distal end 52. The taper is used because the iliac arteries are normally of lesser diameter than the aorta. The aorto-uni-iliac prosthesis portion 38 has an internal zig zag stent 46 at its proximal end 42 so that the outer surface of its tubular body 40 is smooth and can seal within the distal end of the first or proximal prosthesis portion 2 when it is deployed within the first or proximal prosthesis portion 2. The external zig zag stents 48 provide a smooth inner surface for the flow of blood through the prosthesis. The internal zig zag stent 50 at the distal end 52 provides an outer surface of the tubular body 40 which is smooth and can seal within and against the wall of the iliac artery when it is deployed. FIG. 5 shows an assembled aorto-uni-iliac prosthesis in a first arrangement or configuration in which the connecting end 42 of the aorto-uni-iliac prosthesis portion 38 is deployed within the proximal connecting end 12 of the first or proximal prosthesis portion 2. It will be realised that the amount of overlap between the first or proximal prosthesis portion 2 and the aorto-uni-iliac prosthesis portion 38 can be varied for different lengths of an aorta from the renal arteries to the aortic bifurcation and to a suitable landing spot in one of the iliac arteries. It is preferable, however, that there is at least an overlap of two stents. This means that there will be a smooth inner surface of one portion engaged against a smooth outer surface of the other portion to provide a good seal. FIG. 6 shows an assembled aorto-uni-iliac prosthesis in a second arrangement or configuration in which the distal connecting end 12 of the first or proximal prosthesis portion 2 is deployed within the connecting end 42 of the aorto-uni-iliac prosthesis portion 38. It will be realised that the amount of overlap between the first or proximal prosthesis portion 2 and the aorto-uni-iliac prosthesis portion 38 can be varied for different lengths of an aorta from the renal arteries to the aortic bifurcation and to a suitable landing spot in one of the iliac arteries. It is preferable, however, that there is at least an overlap of two stents. This means that there will be a smooth inner surface of one portion engaged against a smooth outer surface of the other portion to provide a good seal. The use of the aorto-uni-iliac prosthesis in either the first or second configuration again depends upon the whether the physician prefers to utilise a top down or bottom up approach or assembly as previously described. FIG. 7 shows an detailed cut away view of the connecting region of a prosthesis assembly of one embodiment of the invention showing the bottom up approach. In this embodiment the distal end 60 of the proximal portion 62 is deployed within the proximal end 64 of the distal prosthesis portion 66. The end stent 68 of the proximal portion 62 is inside the graft material of that portion and hence the outer surface 70 in that region is smooth. The end stent but one 72 of the distal prosthesis portion 66 is on the outside of the graft material so that the inner surface 74 in that region is smooth. These smooth surfaces 70 and 74 engage with each other when the prosthesis is assembled and provide a seal between the proximal and distal portions. FIG. 8 shows an detailed cut away view of the connecting region of a prosthesis assembly of one embodiment of the invention showing the top down approach. In this embodiment the proximal end 64 of the distal portion 66 is deployed within the distal end 64 of the proximal prosthesis portion 62. The end stent 76 of the distal portion 66 is inside the graft material of that portion and hence the outer surface 78 in that region is smooth. The end stent but one 82 of the proximal prosthesis portion 62 is on the outside of the graft material so that the inner surface 80 in that region is smooth. These smooth surfaces 78 and 80 engage with each other when the prosthesis is assembled and provide a seal between the proximal and distal portions. Intended Use In one embodiment the composite prosthesis of the present invention is intended to treat aneurysms of the abdominal aortic or aortoiliac by excluding the aneurysmal portion of that vessel from arterial flow and pressure. The composite is a multi-piece device and is to be used in instances where the implanting physician desires the ability to vary the overall length of the device by ‘tromboning’ or for applications where an increase in the angulation of the neck is required. The device is inserted via surgical cutdown into a femoral artery, the device is advanced into the desired position over a stiff wire guide using endovascular interventional techniques. A range of endovascular graft lengths and diameters are offered to the implanting physician to cater for individual patient anatomies. The composite prosthesis of the present invention in one embodiment is a self-expanding, fully supported and modular bifurcated system developed for endovascular repair of infrarenal abdominal aortic aneurysms (AAA). The main body of the graft consists of two parts, a distal bifurcated graft and a proximal tubular extension graft. The other components of the graft are the iliac legs which when coupled with the main bifurcated body provide a variety of overall device lengths. Ancillary devices such as body extenders, aorto-uni-iliac converters, and iliac plugs may also be required. Each individual device has it's own separate delivery system. The bifurcated graft has one long limb with an iliac cuff and one short limb on the contra-lateral side. There is a radiopaque marker at the graft bifurcation and a ‘tick’ marker at the distal end of the contra-lateral limb. This bifurcated graft is pre-mounted into a deployment device with a tethered top stent introduction system which provides a controlled release for the graft. This graft is attached to the delivery system at both ends and released by three independent trigger wires. The first wire releases the compressed short leg, the second wire releases the proximal end of the graft and the third wire releases the distal end of the graft. The proximal extension graft is a tubular structure with an exposed proximal attachment stent to allow for suprarenal fixation. Small radiopaque markers indicate the proximal edge of the graft. This proximal extension graft is pre-mounted into a deployment device with a top cap introduction system which provides a controlled release for the graft. The exposed attachment stent is constrained within a top cap and held there by a trigger wire. The distal end of the graft is also attached to the delivery system and held by an independent wire. The iliac legs are tubular grafts which are used to extend the composite graft into the iliac arteries. An iliac leg must be placed into the short limb from the contra-lateral side while a separate iliac leg can also be placed if needed into the long limb via the ipsilateral side. Each component comes in a range of lengths and diameters which allows the physician to tailor the device to individual patient anatomies and to select the best iliac landing site. The diameter at the connecting end of both the proximal tubular extension graft and the distal bifurcated graft may be 22 or 24 mm. The diameter of the proximal end of the proximal tubular extension graft may be from 22 to 34 mm. The length of the proximal tubular extension graft may be from 73 to 131 mm. The diameter of the distal end of the a distal bifurcated graft may be from 12 to 24 mm. The length of the distal bifurcated graft to the bifurcation may be from 50 to 95 mm and the overall length may be from 100 to 180 mm. Spacing of the stents on the proximal extension graft may be from 1 to 8 mm. Spacing of the stents on the distal bifurcated graft may be from 0 to 1 mm on the body portion and from 1 to 3 mm on the longer leg portion. Throughout this specification various indications have been given as to the scope of the invention but the invention is not limited to any one of these but may reside at two more of these combined together. The examples are given for illustration only and not for limitation. Throughout this specification unless the context requires otherwise the words comprise and include and variations such as comprising and including will be understood to imply the inclusion of stated integers or group of integers but not the exclusion of any other integer or group of integers. SUMMARY: [/INST] A prosthesis assembly for deployment in an aorta to span an aortic aneurysm. The prosthesis assembly has at least first and second members ( 2,4 ) with an end portion ( 12 ) of one member ( 2 ) to be joined to an end portion ( 24 ) of the other member ( 4 ) when in and when expanded within a lumen of a patient. Each member ( 2,4 ) has a stent arrangement ( 10,25 ) associated with a graft arrangement ( 8,26 ). The end portion of one member has at least part of its stent arrangement on the inner surface of its graft arrangement and the end portion of the other member has at least part of its stent arrangement on the inner surface of its graft arrangement. Advantageously two stents are overlapped. The joining portions of the first and second members can have the same diameter. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: WASHINGTON, Nov. 26 (UPI) -- Pedestrians in wheelchairs have a 36 percent higher risk of being killed in road traffic collisions over other types of pedestrians, a new study found. Some 76,000 pedestrians are injured and 5,000 are killed in traffic collisions each year, according to U.S. Department of Transportation data. Using the National Highway Traffic Safety Administration's Fatality Analysis Reporting System, or FARS, and details from news articles, researchers from Georgetown University's School of Medicine found 528 pedestrians using wheelchairs were killed in road traffic collisions between 2006 and 2012, often at intersections. According to the data, those in wheelchairs are killed 36 percent more than other pedestrians. In addition, wheelchair-using men ages 50 to 64 have a 75 percent higher risk of death in a traffic collision than similarly aged pedestrians. "Understanding and describing risks are the first steps to reversing them," study author John Kraemer, assistant professor of health systems administration at Georgetown's School of Nursing & Health Studies, said in a press release. "While there was a little data on non-fatal pedestrian injuries among people who use wheelchairs, there were almost none on fatal injuries." Kraemer said it is unclear exactly why the higher incidence of fatalities occur, but that it could be due to shoddy sidewalks and poor "pedestrian infrastructure." "A high proportion of crashes occurred at locations without traffic controls or crosswalks," Kraemer said. "When there is poor pedestrian infrastructure or it's poorly adapted to people with mobility impairments, people who use wheelchairs often are forced to use the streets, or are otherwise exposed to greater risk. It also may be telling that, in three-quarters of crashes, there was no evidence that the driver sought to avoid the crash." The study was published in BMJ Open. Data sources Two independent registries of fatal crashes involving pedestrians using wheelchairs from 2006 to 2012 were constructed. The first registry used data in NHTSA's Fatality Analysis Reporting System (FARS), a census of road crashes that occur on US public trafficways and produce at least one fatality within 30 days. FARS is based on police reports and fully described elsewhere.14 While FARS seeks to fully capture fatal crashes, preliminary assessment of its data suggested incomplete ascertainment of wheelchair use, rendering it an incomplete source for identifying fatal crashes among pedestrians who use wheelchairs. A crash was included if a killed non-vehicle occupant was identified as ‘restricted to a wheelchair’ or a motorised wheelchair rider and one of the following non-occupant types: pedestrian, non-motor vehicle transport device occupant or person using a personal conveyance. Individuals who otherwise met the inclusion criteria but endured non-fatal injury were excluded. The second registry was constructed by searching the LexisNexis US newspaper database with the following search term: HEADLINE (wheelchair or wheel chair) and (kill! or die! or death! or dead or fatal) and (car or truck or vehicle or road or street or highway or crosswalk or van or crash or accident or strike! or struck or hit). Each identified article was reviewed for relevance and included if it described a crash on a public trafficway that killed a pedestrian using a wheelchair. Articles were abstracted for information sufficient for matching (including crash and death date, time, and location; age, sex, and race; and a narrative summary). Abstraction was conducted by one author and visually checked by the other. For capture–recapture estimation, fatal crashes in the two registries were matched if they occurred in the same location on the same date, and if the victim's age and sex matched. Minor variation in age and date were tolerated if (1) the news story's crash street address matched the FARS global positioning system (GPS) crash coordinates and (2) there were other reliable indicia that the registry entries corresponded, such as matching crash time of day and news story crash narratives that corresponded to the crash event sequence recorded in FARS. After capture–recapture matching and estimation of the number of fatalities, unmatched cases included in the news story registry were sought in the general FARS database. Because the FARS-based registry's incompleteness resulted primarily from incomplete ascertainment of wheelchair use—not missing crash episodes—almost all unmatched cases could be identified in FARS as pedestrian crashes that failed to code the pedestrian as using a wheelchair (with 252 of the total of 255 identified cases ultimately identifiable in FARS). Thus, without compromising the FARS wheelchair crash registry's independence from the news registry, it was possible to create a combined listing of crashes that incorporated all relevant FARS variables. Assuming that identified cases represent those that were calculated to exist by capture–recapture but unidentified (testing for which is described below), the combined listing is a sample of the overall population of fatal pedestrian crashes among wheelchair users. This sample was used for further descriptive analyses. Rate calculations used denominator data—the number of persons using wheelchairs in the USA—which came from the Census Bureau's Survey of Income and Program Participation (SIPP), which is fully described elsewhere.15 SIPP is a population-representative survey of non-institutionalised persons, and it has a periodic disability module that includes wheelchair use items. Estimates were calculated from these items using sampling weights, with SEs adjusted for the complex sampling approach using Fay's method with balanced repeated replication or Taylor linearisation, depending on how the data were structured each survey year.16 SIPP wheelchair use data are available for 2002, 2003, 2005 and 2010, so denominators for other years were calculated by geometric extrapolation from the nearest years, which assumes a constant rate of population change.7 For comparison purposes, pedestrian death risk in the general US population was determined by querying CDC's WISQARS fatal injury report database,17 which derives from the National Vital Statistics System (NVSS) census of death certificate records and is fully described elsewhere.18 Wheelchair Users More Likely To Be Killed In Car Crashes (Photo : Flickr) People in wheelchairs are more likely to die in car crashes than the general public, according to a recent study. New research suggests people in wheelchairs are more likely to die in car crashes than the general public, Reuters Health reported. Like Us on Facebook Researchers found that pedestrian wheelchair users in the United States are a third more likely to be killed in road traffic collisions than the general public. They also found that men's risk is five times higher than women's. Every year nearly 5000 pedestrians are killed and another 76,000 injured in road traffic collisions on public roads in the United States. "[Our] findings underscore the need for policy-makers and planners to fully incorporate disability accommodations into pedestrian infrastructure and for persons who use wheelchairs--and others with disabilities--to remain a salient population when road safety interventions are designed," researchers wrote in the study. For the study, researchers used a technique that mines the overlap between two independent but incomplete data sources (capture-recapture) to estimate the total number of pedestrian deaths caused by car crashes between 2006 and 2012, UPI reported. Based on these data, the researchers calculated that approximately 528 pedestrians using wheelchairs were killed in road traffic collisions in the US between 2006 and 2012. This equates to a risk of death for a pedestrian wheelchair user that is more than a third higher than for American pedestrians in general. Furthermore, the risk of a car crash death was over five times higher for men in wheelchairs than for women, particularly among men aged 50 to 64, the analysis showed. Researchers said the figures are likely to be an underestimate of the true number of deaths because mobility devices were not always differentiated from recreational scooters and mopeds in news stories. About 48 percent of the fatal crashes occurred at intersections, and in almost four out of 10 of these cases, traffic flow was not controlled. Many fatal crashes occurred at locations with inadequate pedestrian facilities. For example, crosswalks were unavailable at the site in one in five fatal crashes. The police reports also indicated that drivers frequently failed to give way to wheelchair users, and that the wheelchair user was not sufficiently visible in 15 percent of the incidents. Print Print Email Email Get Our FREE Newsletters The findings are detailed in the journal BMJ Open. © 2015 University Daily News, All rights reserved. Do not reproduce without permission. A wheelchair is pictured next to a walking frame during a media presentation in the 300-square-metre therapeutic garden of the Acute Neurological Rehabilitation Unit at Lausanne University Hospital (CHUV) in Lausanne, Switzerland, August 25, 2015. (Reuters Health) - Wheelchair users may be more likely to die in collisions with cars than other pedestrians, an analysis of U.S. crash data suggests. Pedestrians in wheelchairs were 36 percent more likely to die in these crashes than other people, the examination of accident records found. Men’s risk was more than five times higher than the fatality odds for female wheelchair users. The data don’t show why wheelchair users may be more vulnerable than other pedestrians. But the findings suggest that city planners should consider ways to make sidewalks safer and drivers should be aware that people in wheelchairs may not move or react in the same way as others do, said study co-author John Kraemer of the Department of Health Systems Administration at Georgetown University in Washington, D.C. “It is entirely possible that people who use wheelchairs may be at greater risk of death if they are in a pedestrian crash perhaps because drivers are less likely to see them, brake, and collide slower; because being lower to the ground wheelchair users may be hit more squarely; or because some people who use wheelchairs may have pre-existing medical vulnerabilities,” Kraemer said by email. But regardless of the reasons that wheelchair users may be more vulnerable, the take home message for drivers is the same, he said. “Pay attention, stop texting, obey stops and speed limits,” Kraemer said. “But also remember that there are road users like bicyclists and pedestrians like people with disabilities who may not be moving in exactly the same ways they would expect.” In the U.S. alone, nearly 5,000 pedestrians are killed and another 76,000 are injured on public roadways each year, Kraemer and co-author Connor Benton at the Georgetown University School of Medicine write in the journal BMJ Open Access. To assess how vulnerable wheelchair users may be in car crashes, they looked at data from 2006 to 2012 from the National Highway Traffic Safety Administration’s Fatality Analysis Reporting System, which is based on police reports of collisions, as well as data from news reports of accidents. The researchers calculated that approximately 528 pedestrians using wheelchairs were killed in road traffic collisions during the study period, a death rate that is more than a third higher for wheelchair users than for the general population. Almost half of fatal crashes occurred in intersections and about 39 percent of these collisions happened in locations without any traffic control devices such as stoplights, the analysis found. Among intersection crashes, 48 percent involved a wheelchair user in a crosswalk; no crosswalk was available in about 18 percent of cases. In about 21 percent of the crashes, drivers failed to yield the right-of-way, while in about 78 percent of the collisions no crash-avoidance efforts by drivers were detected. The wheelchairs weren’t sufficiently visible in about 15 percent of the incidents. The study may have underestimated the proportion of fatalities involving wheelchairs, the authors acknowledge. That’s because motorized scooters weren’t counted as wheelchairs in the analysis since the available data was insufficient to separate mopeds and the like from mobility devices. Another missing piece of information is the type of wheelchairs involved in these accidents, noted Rory Cooper, director of the Human Engineering Research Laboratories at the University of Pittsburg in Pennsylvania. Overall, wheelchair users might be more vulnerable to crashes than other pedestrians because they might have a harder time moving quickly out of the way on sidewalks or because they might have to travel on the street when a lack of curb cuts makes it impossible for them to use sidewalks, Cooper, who wasn’t involved in the study, said by email. It’s also possible that people using power wheelchairs might be more agile at avoiding a collision than individuals in manual chairs, Cooper said. To stay safe, wheelchair users can also avoid crossing at intersections when they don’t have enough time or seek assistance to cross faster, Cooper noted. Reflective clothing may also make them more visible. Still drivers also need to pay closer attention. “Drivers should look for wheelchair users on roadways and treat them like a slower moving cyclist,” Cooper said. SOURCE: bit.ly/1MDoxCU BMJ Open Access, online November 20, 2015. SUMMARY: [/INST] Pedestrians in wheelchairs are a whopping 36% more likely to die in a traffic collision compared to those out walking, according to a new study that's raising concerns about driver awareness and the availability of crosswalks. Researchers at Georgetown University combed through news articles and data from the National Highway Traffic Safety Administration to identify 528 wheelchair-using pedestrians killed in collisions from 2006 to 2012, reports UPI. Though about 5,000 pedestrians die in traffic collisions in the US each year, according to the Department of Transportation, researchers say pedestrians in wheelchairs have a much higher risk of death. The risk for male wheelchair users was five times higher than for female users, reports Reuters, while male users aged 50 to 64 had a 75% higher risk of death compared to walkers of the same age group. Researchers found no evidence that drivers tried to avoid a collision in 75% of crashes involving wheelchair users. Nearly half of collisions occurred at intersections; in almost 20% of those cases, there was no crosswalk available, and in nearly 40% of those cases, there were no traffic controls, reports the University Herald. This suggests "pedestrian infrastructure" is ill-suited to people with mobility impairments, study author John Kraemer says. They may even be forced to use the street thanks to a lack of curb cuts allowing them to use the sidewalk. "It is entirely possible that people who use wheelchairs may be at greater risk of death... because drivers are less likely to see them, brake, and collide slower; because being lower to the ground wheelchair users may be hit more squarely; or because some people who use wheelchairs may have pre-existing medical vulnerabilities," he adds. "Understanding and describing risks are the first steps to reversing them." </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Sure, it's been a positive few days with England effectively securing their place at the 2016 European Championships thanks to that exciting win in Switzerland. But really the international breaks serve only to highlight how brilliant the Premier League is and how much we miss it when it isn't there. Here's 10 reasons why Sportsmail can't wait for top flight club football to return this weekend. 1. Saturday summit meeting. There will be no easing back into the Premier League action on Saturday as Arsenal and Manchester City meet in an early clash of the title contenders. These are the kind of mouth-watering, high-stakes encounters that a Euro 2016 qualifying campaign simply can't offer. Arsene Wenger will likely hand £16m signing Danny Welbeck his Gunners debut, no doubt encouraged by the two goals he scored for England out in Basel on Monday. Man City also have a point to prove after their surprise home defeat to Stoke City last time out and will have all guns blazing at the Emirates. You can like our Arsenal Facebook page here. Ready, Danny? Welbeck is set to be handed his Arsenal debut following his £16million move to the Emirates. A tasty clash: Arsenal boss Arsene Wenger (left) and Manchester City manager Mauricio Pochettino meet. 2. First glimpse of the Gaal-acticos. The international pause came at the wrong moment for Man United fans, who are drooling at the prospect of seeing expensive new boys Angel di Maria and Radamel Falcao on the pitch. They'll get their chance at Old Trafford on Sunday and QPR must be fearing a drubbing despite United's lacklustre start to the campaign. In addition to £6m loanee Falcao, we could see debuts for Daley Blind, Luke Shaw and Marcos Rojo on Sunday as Louis van Gaal tries to inject life into United's campaign. And trying to contain them all in the QPR defence will be Rio Ferdinand, who is sure to get a nice reception on his Old Trafford return. You can like our Manchester United Facebook page here. It's time: Angel di Maria (left) and Radamel Falcao (right) playing together has Manchester United drooling. Rather you than me, Rio... Ferdinand will be asked to try and contain the duo on his Old Trafford return. 3. Clash of the in-form sides. Everyone expected Chelsea to make a bright start to the season but few could have predicted their home match with Swansea would be a top-of-the-table affair. The Welsh side have started impressively, with the wins over Man United, Burnley and West Brom constituting their best winning run in the Premier League. Chelsea were at their free-scoring best in the 6-3 win at Everton and Diego Costa has adapted to life in England effortlessly. He is an injury doubt for the Swansea match, however, so we could see a Chelsea debut for deadline day signing Loic Remy. Predator: Diego Costa may be in the line to start up front for Chelsea but the striker remains an injury doubt. Be prepared: We could see a Chelsea debut for deadline day signing Loic Remy if Costa is on the sidelines. 4. Balotelli's Anfield bow. Liverpool fans have already taken Mario Balotelli to their hearts and he'll make his home debut against Aston Villa on Saturday evening. The madcap Italian has pledged to score a load of goals to carry Liverpool to a long-overdue Premier League title and the team showed their capabilities in a 3-0 win at Tottenham last time. Adam Lallana, who at £25m was Liverpool's most expensive summer acquisition, may also make his debut after recovering from a knee injury suffered in pre-season. But Villa, who have started the season unbeaten, will certainly not be cowed as they aim to push on. Together: Adam Lallana (left) and Mario Balotelli (right) could play against Aston Villa on Saturday evening. One of the gang: Liverpool fans have already taken Balotelli to their hearts and his Anfield debut beckons. 5. Spurs with a point to prove. They started the Mauricio Pochettino era in superb style, winning London derbies against West Ham and QPR. But Spurs were left questioning their top four credentials after Liverpool smashed them 3-0. Having stewed over that result for a fortnight, they finally have the chance to make amends up at Sunderland on Saturday, who are still searching for their first win. Bounce back: Brendan Rodgers (front) wins 3-0 while Tottenham's Maurico Pochettino (behind) looks glum. Thinking time: Having stewed over that 3-0 loss for a fortnight, Tottenham can make amends at Sunderland. SATURDAY. Arsenal vs Manchester City (12.45pm) Chelsea vs Swansea City (3pm) Crystal Palace vs Burnley (3pm) Southampton vs Newcastle United (3pm) Stoke City vs Leicester City (3pm) Sunderland vs Tottenham Hotspur (3pm) West Bromwich Albion vs Everton (3pm) Liverpool vs Aston Villa (5.30pm) SUNDAY. Manchester United vs Queens Park Rangers (4pm) MONDAY. Hull City vs West Ham United (8pm) 6. A legend at Leicester. Newly-promoted Leicester certainly raised a few eyebrows with their pursuit of Argentine legend Esteban Cambiasso over the summer. And the former Real Madrid and Inter Milan midfielder may make his debut in Saturday's match away to Stoke. Leicester were a match for Arsenal in their last fixture, while Stoke were shock winners away to Man City, so both enter in a good frame of mind. Surprising: Argentine legend Esteban Cambiasso may make his debut in Saturday's match away to Stoke. Fighters: Leicester proved a good match for Arsenal in their last fixture and will hope for more of the same. 7. Basement battle. It's a little too soon to be talking about six-pointers, but Saturday's meeting of the bottom two - Crystal Palace and Burnley - has that'must-win' feel for both. Palace twice surrendered the lead against Newcastle before Wilfried Zaha earned a point in Neil Warnock's first game in charge and the new boss will return to the Selhurst Park touchline on Saturday. Burnley, who gained their first point against Man United last time out, were busy on deadline day and we could see debuts for £3m striker George Boyd as well as young loanees Nathaniel Chalobah and Michael Keane. He's back! Wilfried Zaha earned a point in Neil Warnock's first game in charge against Newcastle United. Held: Burnley picked up their first point against Manchester United last time out as Wayne Rooney stumbled. VIDEO United won't win the title - Robson. 8. Life goes on for Saints. Many feared for them after the summer exodus of their best players but Southampton have started encouragingly and will be looking for more gains when they host Newcastle on Saturday. The Saints picked up their first Premier League win of the Ronald Koeman era when they beat West Ham 3-1, with new boy Graziano Pelle opening his account. Newcastle, who are still waiting for their first three points, are hopeful 'ginger Pirlo' Jack Colback will be back from the injury that denied him a senior England debut. They certainly will be aiming to do better than the 4-0 drubbing they were dealt in this fixture back in March. In: Southampton picked up their first win under Ronald Koeman against West Ham 3-1 Graziano Pelle scoring. Fit? Newcastle await their first three points and hope 'ginger Pirlo' Jack Colback will be back from the injury. 9. Toffees hoping to kick-start season. Watching Everton has certainly not been dull so far this season, with 17 goals scored in their three matches so far. Unfortunately, the majority have gone against them. But with Steven Naismith in brilliant form and Samuel Eto'o opening his account against former club Chelsea last time out, there have been some positives for Roberto Martinez. They will chase a first league win at West Brom on Saturday, who have an identical record so far. Alan Irvine is optimistic that some of his new signings will feature at The Hawthorns, including striker Georgios Samaras. Revenge: Samuel Eto'o's header caused Chelsea problems at Goodison Park and it opened his account. Deal: Everton boss Roberto Martinez is chasing his first win and hopes Eto'o will help against West Brom. 10. Tigers' new boys set to roar. Steve Bruce proclaimed Hull's deadline day business as 'fantastic' and now fans will get the chance to see the new boys in action - albeit having waited until Monday night. The Tigers took Newcastle's Hatem Ben Arfa on loan and smashed their club record to sign £10m Abel Hernandez. Mohamed Diame, another newcomer, will see plenty of familiar faces when they welcome West Ham, while ex-Southampton man Gaston Ramirez could also feature. West Ham will likely include Barcelona loanee Alex Song in their line-up, likewise new signing from Marseille Morgan Amalfitano. Glad to escape: Hatem Ben Arfa could get his chance to pull on the Hull shirt against West Ham at home. Return to England: West Ham will likely include Barcelona loanee Alex Song in their line-up on Monday night SUMMARY: [/INST] Danny Welbeck set for Arsenal debut against Manchester City on Saturday. Angel di Maria and Radamel Falcao could be unleashed on QPR in Premier League's only match on Sunday on Rio Ferdinand's Old Trafford return. Diego Costa an injury doubt for Chelsea but Loic Remy could fill the gap. Mario Balotelli set for Anfield debut with Adam Lallana potentially returning for Liverpool from a knee injury against Aston Villa on Saturday. The Premier League returns after the international break, and Sportsmail examine why we're all so glad the packed weekends are finally back... </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Chesapeake Bay Restoration Act of 2009''. SEC. 2. FINDINGS. Congress finds the following: (1) Between the years 1990 and 2000, the population of the Chesapeake Bay watershed increased 8 percent while impervious surface cover increased 41 percent. (2) Suburban and urban stormwater runoff is the only major source of pollution in the Chesapeake Bay watershed that is increasing, as pollution from point sources and agriculture is decreasing. (3) States, local governments, developers, and nonprofit organizations have developed numerous development techniques since the late 1990s, which use infiltration, plants, and stormwater harvesting techniques to retain stormwater and associated sedimentation and nutrient pollutants. (4) A study by the Environmental Protection Agency of low impact development projects in the United States found that low impact development stormwater management techniques are almost always less expensive than traditional stormwater management techniques. (5) Local governments throughout the Chesapeake Bay watershed are proactively implementing retention techniques and strict new requirements to reduce stormwater runoff. (6) The National Academy of Sciences recommends strong new regulations with respect to stormwater runoff and the provision of funding for local stormwater regulation efforts and finds that retention measures that infiltrate, evapotranspire and harvest stormwater are more effective than traditional stormwater management infrastructure at protecting and restoring stable hydrology. (7) Data from multiple jurisdictions with respect to the health of fish and other organisms living in Chesapeake Bay tributaries suggest a strong negative correlation between impervious surface cover and stream health. (8) According to the Environmental Protection Agency's Chesapeake Bay Program Office, an average of 100 acres of forest are lost from the Chesapeake Bay watershed every day and forest cover within the watershed has declined from 95 percent to 58 percent. (9) Forests capture up to 85 percent of airborne nitrogen pollution and infiltrate or evapotranspirate between 90 percent and 95 percent of annual rainfall, preventing pollution associated with stormwater runoff. SEC. 3. REDUCTION OF POLLUTION RESULTING FROM IMPERVIOUS SURFACES. Section 117 of the Federal Water Pollution Control Act (33 U.S.C. 1267) is amended-- (1) by redesignating subsection (j) as subsection (k); and (2) by inserting after subsection (i) the following: ``(j) Reduction of Pollution Resulting From Impervious Surfaces.-- ``(1) Permits.-- ``(A) In general.--Not later than January 1, 2009, each unit of local government within the Chesapeake Bay watershed that discharges stormwater through a storm sewer system, regardless of storm sewer system ownership and, without regard to the size of the population shall obtain and comply with a permit under section 402(p). ``(B) Requirements.--A permit under section 402(p) for a unit of local government within the Chesapeake Bay watershed shall include requirements to ensure that a project to develop land within the jurisdiction of such unit of local government, which affects land that is more than one acre in size and that is less than 5 percent covered by impervious surfaces prior to the project, is carried out in a manner that not less than the volume of the 95th percentile precipitation event shall infiltrate, evapotranspirate from, or be harvested and used on such site after the project is completed. ``(C) Definition of 95th percentile precipitation event.--The 95th percentile precipitation event is the event whose precipitation total is greater than or equal to 95 percent of all 24-hour storm events on an annual basis. ``(2) Grant program.-- ``(A) In general.--The Administrator is authorized to make grants to a unit of local government with a permit described under paragraph (1). ``(B) Uses.--A grant under subparagraph (A) may be used by a unit of local government for the following: ``(i) Costs associated with complying with such permit. ``(ii) Costs associated with implementing a project that is designed, constructed, and maintained to meet the relevant performance standard of part (1)(B). ``(C) Matching requirement.--A grant for costs associated with implementing a low impact development project may not be in an amount that exceeds 75 percent of such costs. ``(3) On-site retention guidance.--Not later than June 1, 2010, the Administrator shall issue guidance with respect to the implementation of practices that retain stormwater on-site through infiltration, evapotranspiration, or harvesting, to assist entities affected by the permit described under paragraph (1) to meet the requirements of such permit. ``(4) Forest cover.--Not later than January 1, 2012, the Administrator shall coordinate with the heads of other Federal departments and agencies to develop plans to maximize forest cover on land owned by the Federal Government in the Chesapeake Bay watershed through the preservation of existing forest cover and the development of reforestation plans with respect to land that has been disturbed or developed in the past. ``(5) Unit of local government defined.--In this subsection, the term `unit of local government' means any county, city, or other general purpose political subdivision, including regional authorities of a State with jurisdiction over land use. ``(6) Authorization of appropriations.--In addition to amounts authorized to be appropriated or otherwise made available to carry out this section, there is authorized to be appropriated to the Administrator $1,500,000,000 to carry out this subsection, to remain available until expended.''. SUMMARY: [/INST] Chesapeake Bay Restoration Act of 2009 - Amends the Federal Water Pollution Control Act to require, by January 1, 2009, that each local governmental unit within the Chesapeake Bay watershed that discharges stormwater through a storm sewer system obtain and comply with a permit for municipal or industrial stormwater discharges under such Act. Requires such permit to include requirements to ensure that a project to develop land within that unit's jurisdiction, which affects land more than one acre in size and less than 5% covered by impervious surfaces prior to the project, is carried out in a manner that not less than the volume of the 95th percentile precipitation event (the event whose precipitation total is greater than or equal to 95% of all 24-hour storm events on an annual basis) shall infiltrate, evapotranspirate from, or be harvested and used on such site after the project is completed. Authorizes the Administrator of the Environmental Protection Agency (EPA) to make grants to a local governmental unit with such a permit, which may be used for costs associated with: (1) complying with such permit; and (2) implementing a project designed, constructed, and maintained to meet the relevant performance standard. Prohibits a grant for costs associated with implementing a low impact development project from exceeding 75% of such costs. Requires the Administrator, by: (1) June 1, 2010, to issue guidance regarding the implementation of practices that retain stormwater on-site through infiltration, evapotranspiration, or harvesting, to assist entities affected by the permit to meet its requirements; and (2) January 1, 2012, to coordinate with heads of other federal agencies to develop plans to maximize forest cover on government-owned land in the watershed through the preservation of existing forest cover and the development of reforestation plans for land that has previously been disturbed or developed. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Daily Mail Reporter. PUBLISHED:. 01:35 EST, 10 January 2013. \|. UPDATED:. 08:38 EST, 10 January 2013. A former Miami University student has escaped criminal charges after he distributed a flier on how to get away with raping female students. The case drew national outrage in October after the shocking notice titled 'Top Ten Ways to Get Away With Rape' was found in a freshman co-ed dorm bathroom at the Ohio college. The flier told readers that 'practice makes perfect. The more you rape, the better you get at it.' It also said: 'If you're afraid that the girl will identify you, slit her throat.' The student pleaded guilty to disorderly conduct, but a Butler County judge sealed records in the case, keeping the student's name secret, according to The Cincinnati Enquirer. Anger: A flier posted in a freshman dorm at Miami University, pictured, caused outrage, as it lists the top ten ways to get away with rape. After The Enquirer challenged the judge's move to seal records in the case, the student was allowed to withdraw his plea and Prosecutor Michael Gmoser asked to drop the charges. Judge Rob Lyons said sealing the case was something he routinely does for students. According to The Enquirer, Lyons of Butler County Area I Court in Oxford allowed the student to withdraw his plea in a hearing on December 13. Butler County prosecutors then decided against pursuing the case, and Lyons said he dismissed the charge. Trouble: A flier posted in the men's restroom at a Miami University freshman co-ed dorm offered pointers on the Top Ten Ways to Get Away with Rape' The judge then sealed the criminal case a second time at the request of the student's defense attorney, Dennis Deters, to correct a mistake he made in November. That mistake was among several violations The Enquirer alleged in its challenge to sealing the case. The Enquirer asked the Ohio Supreme Court to order Lyons to rescind his sealing order and open the file. The case is pending. The newspaper sued after the student initially pleaded guilty to misdemeanor disorderly conduct. It also claimed that Lyons could not issue a blanket order sealing every document in the case, that he didn’t hold a required hearing the first time around, and that he failed to consider any less-restrictive means of limiting public access to the records, which is required by the Ohio Supreme Court. 'Safety for all and fair justice for suspects are among our most important expectations of government,' Enquirer Editor and Vice President Carolyn Washburn said. 'In this case – a situation in which someone encouraged the heinous crime of rape – all of the handling of the only suspect happened in secret, including a decision to no longer prosecute. 'That does not make the community feel safe. And it does not allow the community to watch our elected judges and prosecutors to ensure justice was appropriately handled.' Lyons wouldn't say whether he or prosecutors came up with the idea to hold the second hearing.An assistant for Gmoser is representing Lyons in the Enquirer suit. Lyons said the charge against the student was 'insignificant' though he described the behavior behind it as 'offensive.' Escaped: The former Miami University student has escaped criminal charges. Sealing the case the first time around was routine, he said. 'If you went to any college town, the number of sealings is very high because we have such a high degree of students that get convictions,' he told the newspaper. 'You've got kids with indiscretions that want their records sealed before they start applying for graduate school or go to the job market. Literally every week I have a stack of sealing entries.' According to The Enquirer, Lyons' private law firm advertises that it can help seal criminal records.Lyons has asked the Ohio Supreme Court to dismiss The Enquirer's suit. Deters and Gmoser declined to talk to The Enquirer about the case for the story. The Enquirer's lawyer Jack Greiner said that the student was prosecuted as an adult and should therefore be identified. 'It goes to the heart of the public's right to know. The public is denied the right to observe the proceeding,' Greiner said. 'The judge's after-the-fact effort to rewrite history by allowing this individual to withdraw his guilty plea for no reason other than to allow the judge to cover up his initial illegal sealing order is appalling. It is why people become cynical about the system,' he added SUMMARY: [/INST] Flier encouraging readers to rape unconscious women and prey on female students walking alone was found in freshman bathroom in October at public university. The suspect pleaded guilty to disorderly. conduct, but a Butler County judge sealed records in the case, keeping. the student's name secret. Judge Rob Lyons then allowed the student to withdraw his guilty plea and prosecutors dropped charges. Cincinnati Examiner is suing the judge for unnecessarily sealing the case and allowing the suspect's encouragement of the 'heinous crime of rape' to go unpunished. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Photo by Hulton Archive/Getty Images Twenty years ago this week, Friends premiered. The show about six pals who hang out all the time debuted to middling reviews and OK ratings before becoming a gargantuan hit and phenomenon. Friends was a top-10 series for its entire run, and a top-five series if you discount the first season. It always averaged more than 20 million viewers and had 25 million as late as its eighth season. It spawned a haircut fad and dozens of mostly mediocre copycats. Between TBS and Nick at Nite, it is currently rerun eight times a day. The anniversary of its premiere has been greeted with untempered enthusiasm, even for this era of rampant Internet-based nostalgia. (There’s been little celebration for ER, which premiered the same week, and was a bigger hit, if for a few years too long.) Jimmy Kimmel is staging mini-reunions, websites are dueling to create the definitive best-episode list, and residents of New York City can now head down to SoHo and get coffee—and Friends merch—at a Central Perk pop-up shop, where poor Gunther will be making appearances and maybe pouring out lattes, like some sitcom Sisyphus. The almost entirely positive nostalgia trip surrounding Friends is a little curious— and I say that as a devoted Friends partisan. The show ended just a decade ago, and when it did it was a kind of shorthand for that which is popular, likeable, and unchallenging: pure TV pop. It was a show about white people living in oversized apartments they definitely couldn’t afford in a New York City populated by so few people of color that all the ones with speaking parts could be easily assembled in a single, rhyming YouTube video. Compared with punchier, sourer, more cynical sitcoms—from All in the Family to Seinfeld to The Office—that found humor in humanity’s bad behavior, Friends was smiley and conflict-averse to the point of being featherweight. Willa Paskin Willa Paskin is Slate’s television critic. The show’s Thursday night partner, Seinfeld, was famously about “nothing,” a claim that, especially in the context of Norman Lear’s morally instructive, socially aware series, was a kind of nihilist cri de coeur, a pledge with philosophical as well as comedic heft. Friends took Seinfeld’s nothing and its ancillary “no learning, no hugging” rule to heart—and then put the hugging back in. It did more than any show to excise the teachable moment from sitcoms for grown-ups: Friends occasionally ran up against “issues,” including lesbian mothers and weddings, but always treated such matters in a casual, offhand manner. It was a show without take-home lessons that was as cute and sweet as any show with them. Advertisement When it ended, critics, even those who liked it, struggled to find the words to celebrate it. Heather Havrilesky, writing in Salon, channeled the sort of “yes, but” spirit of loving Friends: “Yes, Friends was silly and sentimental and self-important and fluffy at times. But isn’t that an indelible part of what we liked about it?” Time’s James Poniewozik wrote that unlike most other great sitcoms, Friends “is simply about being a pleasant sitcom.” The pure pleasure-giving sitcom has never been a rarer thing. But in the decade since Friends ended, it has become clear just how hard it is to make a straightforwardly pleasant sitcom, one that 20 million people want to watch and discuss. What Friends did so effortlessly has become, noticeably, very difficult. (Parks and Recreation, a sweet and funny show starring a very talented cast, can’t reliably attract 4 million viewers.) Nostalgia demands that we see the past through rose-colored glasses: The aggravating and the annoying, the painful and the piercing, these things fade away, leaving us with a soothing memory of a more carefree time. But Friends really did begin in a more carefree time. It was the quintessential Clinton-era comedy, existing in the historical period between the end of the Cold War and 9/11—even though the show went on for three more years, into 2004—and in a TV era when the networks could still reliably mint mass-appeal sitcoms. No concern—sandwiches, pet chickens, naked neighbors—was too small when times were so good. The tug of nostalgia is strong, but Friends, which was “nothing more” than a very funny, anxiety-free sitcom starring a supremely talented cast, almost doesn’t require nostalgia to be glowingly appreciated from this particular vantage point: The pure pleasure-giving sitcom has never been a rarer thing. (Nostalgia, or memory loss, is required to forgive the dreaded Rachel-Joey romance.) * * * Advertisement The pilot of Friends was not particularly well-reviewed, but it plays well in hindsight. It begins with the gang, sans Rachel, hanging out at Central Perk, endlessly chatting, one conversation fading out and another fading in. The group talks about Chandler’s dreams and Ross’s divorce with a chatty, wannabe art-house cinema vibe. This discursiveness wouldn’t last, but most of the characterizations would: The sarcastic, neurotic Chandler, too-reasonable Monica, space-cadet Phoebe, and lovelorn Ross are all here, more or less fully formed. Only Joey, more of a meathead in the early going, would really transform, into someone more sweetly stupid. And then into Central Perk walks Rachel, in a wedding dress, demanding and spoiled, incapable of making a cup of coffee or living without her father’s credit card. As the show went on, the characters leaned into their quirks, or grew new ones—Ross developed his paranoid-frantic physical-comedy side, Monica’s OCD got shrill—except Rachel, who grew out of hers. Aniston has spent the last decade being a celebrity and the star of mostly middling movies, but her Rachel is a towering comedic performance. She took a cliché—a ditzy JAP with a nose job and no sense of responsibility—and exploded it, keeping Rachel funny while turning her into an everywoman, the only character not reducible to a tagline. Unlike with so much contemporary TV, there is no barrier to entry with Friends. Do you like to watch attractive people being funny while doing amusing and sometimes romantic things? Do you want to hang out with people who feel like your own friends? Think about the current comedy universe—which Friends, with its eight episodes a day and with Aniston, especially, still all over the tabloids, arguably inhabits. Some critically acclaimed comedies (Louie, Girls) are barely concerned with laughter, and can cut more painfully than the most poignant dramas. And series that center on a group of friends are often alienating in their generational exactitude. The characters on New Girl are older than those of Friends were, but they’re even more childlike. The best Friends copycat of all, ABC’s canceled Happy Endings, played like a feverish generational in-joke. These shows have absolutely no truck with broad—specificity is what they are all about. This, especially in the case of Girls and Louie, is an artistic choice, but it also reflects the larger TV landscape: Regular viewers may not care very much about the general collapse in TV ratings, but the kind of shows that get made now—series aiming at ever smaller, hopefully passionate demographics—reflect the drying up of a large general-audience pool. This has given us lots of great, edgy comedies, but it has also given new network comedies a light sheen of anxiety—they have to do everything they can, right away, to find an audience—and a tough choice: Should they be unbearably broad, in the hopes of attracting everyone, or self-defeatingly narrow, in the hopes of inspiring the passion of the cool kids? In comparison, Friends is wonderfully relaxed, casually assuming it has a claim on your attention even when it has made an entire episode about Ross’s misguided leather pants or the time the gang was going to be late. Advertisement Friends has an inviting, welcoming air. The only thing it is really specific about—the only thing it needs to be really specific about—is the friends themselves. The best episodes exist entirely within the fictitious world the show created—episodes set entirely in Monica and Rachel’s apartment, for instance, or with video flashbacks to their lives in the ’80s or trivia contests featuring questions only about each other. This is the reason it has aged so well: Not only is it relatively timeless for a sitcom, watching Friends turns you into a friend, initiated into the ins and outs of their relationships and personalities, their inside jokes, the PG way to flip somebody off. CTRL-C or CMD-C, then press Enter. Click/tap elsewhere to exit, or press ESC. Today marks the 20th anniversary of the premiere of Party of Five, and as you can clearly see from the amazing behind-the-scenes video above: The roller-brush hair dryer has been around longer! How else would you explain Scott Wolf and Matthew Fox's magnificently and perfectly curled-under bangs? You guys. Why do I not remember this being a thing?! Hot guys with Dorothy Hamill hair? And we all SWOONED! FOX Anyway, to celebrate the 20th birthday of the beloved Salinger clan, we dug up our behind-the-scenes footage of E!'s very first set visit to Party of Five in 1994, and it is exquisite. For starters, everyone should know that Matthew Fox, Scott Wolf and Neve Campbell have not really aged in two decades, and clearly must have some sort of pact with the devil. And the hair. It's awesome. For you who don't remember (and aren't ancient like moi), Party of Five aired on Fox from 1994 – 2000 and launched the careers of Matthew, Scott, Neve and also Jennifer Love Hewitt and Lacey Chabert. But it was really all about: THE TEARS. Every single damn episode, we fans would cry our ever-living guts out because, not only were these five kids trying just trying to move on after the tragic passing of their parents in a car crash (they were the original Elena and Jeremy Gilbert—mmmkay?), but Charlie (Matthew Fox) batted cancer, Bailey (Scott Wolf) battled alcoholism, Julia (Neve Campbell) dealt with domestic violence and our hearts were never the same. FOX Party of Five was never a huge ratings hit, but it had a hardcore fan following, and was the surprise winner in 1996 for the Golden Globe for Best Drama, making it one of the lowest-rated shows ever to win the award. So, a tip of the hat to the good ol' Salinger clan. And a tip of our curling iron to Scott and Matthew, who never looked more ridiculous/adorable. Share Tweet Share Email <> Embed CTRL-C or CMD-C, then press Enter. Click/tap elsewhere to exit, or press ESC. SUMMARY: [/INST] As if news that Party of Five debuted 20 years ago this month doesn't make you feel old enough, Friends is this week hitting the same milestone. And as Willa Paskin writes for Slate, the anniversary is being "greeted with untempered enthusiasm, even for this era of rampant Internet-based nostalgia." That has Paskin asking-and answering-the question of why. As she writes, "it did more than any show to excise the teachable moment from sitcoms for grown-ups." It was sweet, it was fluffy, and it was... a rare thing. In the 10 years since Rachel, Chandler, et al have left us, it's become apparent that making a "straightforwardly pleasant sitcom, one that 20 million people want to watch and discuss," is actually incredibly difficult. Today's comedies take one of two routes: They make specificity king (Paskin cites Girls and Louie) in the hope of reeling in a small but fervent audience or they go "unbearably broad" in a bid to reel in, well, everyone. But the attempts to do the latter are largely tainted by a "light sheen of anxiety," writes Paskin. "They have to do everything they can, right away, to find an audience." Friends, in contrast, "casually [assumes] it has a claim on your attention even when it has made an entire episode about Ross's misguided leather pants." At the end of the day, we watch TV for pleasure, and 20 years on, Friends does that "reliably, effortlessly." Click for Paskin's full column. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The bacterial endosymbiont Wolbachia pipientis protects its hosts from a range of pathogens by limiting their ability to form infections inside the insect. This “pathogen blocking” could be explained by innate immune priming by the symbiont, competition for host-derived resources between pathogens and Wolbachia, or the direct modification of the cell or cellular environment by Wolbachia. Recent comparative work in Drosophila and the mosquito Aedes aegypti has shown that an immune response is not required for pathogen blocking, implying that there must be an additional component to the mechanism. Here we have examined the involvement of cholesterol in pathogen blocking using a system of dietary manipulation in Drosophila melanogaster in combination with challenge by Drosophila C virus (DCV), a common fly pathogen. We observed that flies reared on cholesterol-enriched diets infected with the Wolbachia strains wMelPop and wMelCS exhibited reduced pathogen blocking, with viral-induced mortality occurring 2–5 days earlier than flies reared on Standard diet. This shift toward greater virulence in the presence of cholesterol also corresponded to higher viral copy numbers in the host. Interestingly, an increase in dietary cholesterol did not have an effect on Wolbachia density except in one case, but this did not directly affect the strength of pathogen blocking. Our results indicate that host cholesterol levels are involved with the ability of Wolbachia-infected flies to resist DCV infections, suggesting that cholesterol contributes to the underlying mechanism of pathogen blocking. Wolbachia are maternally inherited bacterial endosymbionts that naturally infect an estimated 40% of all arthropod species [1]. They are primarily known for their manipulation of host reproductive biology, particularly through the phenotype of cytoplasmic incompatibility (CI), which facilitates the spread of the symbiont through wild populations [2]. Some Wolbachia strains manipulate their hosts in other interesting and useful ways, such as through the phenotype known as pathogen blocking, which limits the ability of many pathogenic viruses, bacteria and nematodes to grow in the host [3], [4], [5], [6], [7], [8], [9]. The phenotype has been well characterised in Drosophila fruit flies where it was originally discovered. Blocking occurs against many species of naturally pathogenic viruses including Drosophila C virus and Flock House virus [5], [8], [10], [11]. The effect typically involves a delay in virus-induced mortality for Wolbachia-infected flies, with the strength of the effect varying by strain and pathogen type [8], [10]. For some strains this is also accompanied by a delay in virus accumulation, although this is not required to delay mortality [10]. Stronger blocking occurs in strains that grow to high density, with lower density strains having little effect [10]. Together these factors imply that Wolbachia can cause interference with pathogen replication. Pathogen blocking has also been well studied in mosquitoes because of their role as disease vectors. Here the effect differs from Drosophila in that many key vector species are naturally uninfected by Wolbachia, and the strength of the blocking effect is measured in terms of its impact on viral replication and transmission rather than host survival. Several naturally uninfected species, including the dengue vector Aedes aegypti, have been transinfected with Wolbachia strains from other organisms, including wMelPop and wMel, both originally from D. melanogaster [12], [13]. These strains produce a strong blocking effect and inhibit the replication of dengue virus (DENV), Chikungunya virus, the filarial worm Brugia malayi and the model malaria parasite Plasmodium gallinaceum [3], [6], [7], [13]. A strong level of pathogen blocking also leads to a greatly decreased presence of DENV in mosquito saliva [3], [7], [13], which provides a means to reduce disease transmission to humans. Wolbachia strains that induce CI and pathogen blocking can be used to invade and replace uninfected mosquito populations [14]. The success of this strategy hinges on a strong blocking phenotype persisting in the field; consequently it is critical to determine how Wolbachia cause pathogen blocking. Since its discovery, several hypotheses have emerged to explain the mechanistic basis of pathogen blocking. The first posits that the presence of the symbiont activates the insect' s innate immune response, priming the host for its subsequent interaction with the vectored pathogens, [7], [6], [8], [15]. The second suggests that Wolbachia may outcompete pathogens for critical nutritional resources, especially given that it has a much-reduced genome and is highly dependent on the host for metabolic support [7], [16]. Given the wide range of pathogens affected by Wolbachia it is quite possible that a mixture of these mechanisms is acting. The notion of “immune priming” was initially supported by heightened expression of innate immunity genes in transcriptional profiles of A. aegypti infected with wMelPop-CLA [7], [6]. However the wMelPop infection is not representative of most Wolbachia, over replicating to high densities and causing tissue damage in its native D. melanogaster [17]. Transcriptional activation of innate immunity genes could have resulted as an effect of this pathogenicity. Furthermore, as theory predicts that pathogens often have more severe effects in novel hosts [18], the infection was likely to be more virulent in the mosquito than in the fly [12]. A subsequent set of studies was then performed that compared the immune response of both the fly and the mosquito to infection with the benign (wMel) and virulent (wMelPop) strains. The findings indicated that pathogen blocking against DENV was present in both mosquitoes and flies, but that Drosophila did not exhibit a clear and consistent immune response to Wolbachia, similar to what is seen in other infected species [9], [19], [20]. This suggests that the reported immune activation associated with Wolbachia infection in mosquitoes is not necessary for pathogen blocking, and while it could enhance the trait it cannot be the only mechanism operating. An obvious alternative mechanism for pathogen blocking is competition for key cellular molecules such as cholesterol, which is critical to the biology of host, symbiont and infecting viruses. Cholesterol in insects is vital to membrane stability and cellular signalling [21], [22], and serves as the precursor to steroid hormones involved in oogenesis [23]. Wolbachia replication is cholesterol-dependent, requiring cholesterol-rich host membranes to form the vacuole surrounding each bacterium [24], and their survival may also be linked to host cholesterol usage [25]. Both insect and Wolbachia lack the biosynthetic pathways to produce cholesterol and as such both depend on and compete for dietary cholesterol. Many viruses are also dependent on host cholesterol for their replication and cellular entry [26], [27], to the extent that the immune response to some viral infections includes down regulation of sterols [28]. Consequently, manipulation of host cholesterol by Wolbachia could influence the ability of infecting viruses to propagate, thus producing a blocking effect. To test whether competition for cholesterol affected Wolbachia-based pathogen blocking, we worked with Drosophila melanogaster, where blocking was first discovered [5], [8], and where methods for dietary manipulation of cholesterol are well established [29]. Using supplementation studies paired with viral infectivity assays for Drosophila C Virus (DCV), we demonstrate that viral success as measured by increased titre and faster death in flies is conferred by increased access to cholesterol in the presence of two different Wolbachia strains tested. This provides the first evidence supporting a molecular competition hypothesis for Wolbachia-mediated pathogen blocking. Upon challenge with DCV, a pathogen blocking effect was observed for all three Wolbachia strains, with wMelPop providing the greatest level of protection, wMelCS yielding intermediate protection, and wMel the weakest. For wMelPop-infected flies the addition of cholesterol to dietary media reduced the protective effect of Wolbachia in a dose dependent manner, with increasing cholesterol concentrations in the media leading to quicker DCV-induced mortality (Cox regression – Exp1: X2 = 14. 62, df = 2, P<0. 0001 (Fig. 1A); Exp2: X2 = 11. 13, df = 2, P<0. 01; Exp3: X2 = 21. 61, df = 2, P<0. 0001). The average survival of flies reared on the cholesterol-enriched Intermediate and High diets was approximately four and five days less, respectively, than those reared on Standard food (Table 1). On average across experiments, rearing on the Intermediate and High cholesterol diets proved a hazard that increased the likelihood of death by 2. 08 and 2. 80 times respectively. Reduced pathogen blocking was also observed for wMelCS-infected flies reared on cholesterol-enriched food in two out of three experiments (Cox regression – Exp1: X2 = 14. 76, df = 1, P<0. 0001; Exp2: X2 = 6. 95, df = 2, P<0. 05 (Fig. 1B); Exp3: X2 = 5. 64, df = 2, P>0. 05). The average hazard increase across the three experiments was 1. 47-fold for the Intermediate diet and 2. 12-fold for the High diet. For wMel-infected flies, cholesterol did not significantly affect survival (Cox Regression – Exp1: X2 = 4. 33, df = 2, P>0. 05; Exp2: X2 = 5. 40, df = 2, P>0. 05 (Fig. 1C); Exp3: X2 = 0. 06, df = 2, P>0. 05), however in experiments two and three experiments mean survival was lower for flies from at least one of the cholesterol-enriched diets compared to those from the standard diet (Table 1). Dietary cholesterol level did not significantly affect Wolbachia-uninfected flies in any experiment (Figure 1). Survival curves for the experiments not depicted in Figure 1 are provided as supplementary materials (Fig. S1). Mortality in PBS-injected lines was generally low with an average death rate of less than 5% across all injection experiments, suggesting that there was no pathogenic contamination as a result of injection (Fig. 1, Fig, S1). Flies that had their wMelPop infection cured by treatment with tetracycline died within seven days after infection with DCV, confirming that the pathogen blocking effect occurred due to the presence of Wolbachia (Fig. S2). Cholesterol levels for flies taken from the same bottles used in each survival experiment were quantified using the Amplex Red Cholesterol Testing Kit (Invitrogen). Through statistical analysis by ANOVA, dietary cholesterol level was identified as a significant factor affecting fly cholesterol levels in all experiments (Table S1). In general, fly cholesterol levels were strongly correlated to dietary cholesterol intake (Fig. 1D–F, Fig. S2, Table S1). Fly cholesterol levels showed a strong inverse correlation to mean survival time with higher cholesterol strongly associated with increased time to death (Table 1). In four experiments (wMelPop Exp2, wMelCS Exp2, wMel Exp1 and Exp2) there was no difference in cholesterol level observed between Intermediate and High diet flies, and there was also no difference in survival observed between these treatments. This suggests that even though there can be variability in cholesterol uptake between experimental replicates, the relationship between host cholesterol levels and the protective effect of pathogen blocking is strong. To determine whether increased dietary cholesterol affected the rate of viral accumulation, total DCV genome copies in pools of five wMelPop- and wMelCS-infected flies at five days post-infection were measured relative to the expression of the control gene Cyclin K. For both Wolbachia strains increased dietary cholesterol led to significantly increased viral load suggesting the presence of excess cholesterol facilitates viral propagation (Fig. 2). For wMelPop-infected flies DCV titre was significantly higher for the Intermediate and High cholesterol diets than for the control (Mann Whitney U-tests – Int: U = 8. 00, P<0. 05; High: U = 4. 00, P<0. 01). No difference in titre was observed between the two cholesterol-enriched diets (MWU – U = 31. 00, P>0. 05). Median DCV: CycK ratio was 13. 60 for the control diet, 84. 38 for the Intermediate diet, and 57. 22 for the High diet. DCV titre in wMelCS-infected flies was higher for Intermediate and High cholesterol diets (MWU – Int: U = 34. 00, P<0. 01, High: U = 3. 00, P<0. 001) and higher in the High cholesterol diet than in the Intermediate (MWU – U = 51. 00, P<0. 05). Median DCV: CycK ratio was 0. 000218 for the Standard diet, 0. 0145 for the Intermediate diet, and 1. 590 for the High diet. Differences in accumulation between the strains reflect the use of different viral aliquots. Wolbachia density was quantified for both wMelPop- and wMelCS-infected flies using qPCR (Fig. 3). There was no effect of diet on Wolbachia levels for wMelCS-infected flies (ANOVA: F = 0. 76, df = 2, MSS = 1. 57, P = 0. 47). For wMelPop-infected flies there was a significant effect of diet on Wolbachia density (ANOVA: F = 6. 24, df = 2, MSS = 20. 42, P = 0. 0036). Here the density was significantly lower for flies from the High diet than either the Intermediate or Standard diets (Student' s t tests – Standard-High: t = 2. 59, df = 36, P<0. 05; Int-High: t = 3. 37, df = 37, P<0. 01). Interestingly, when flies from these same High and Intermediate bottles were challenged with DCV, no difference in survival was observed between the two diets (Kaplan Meier Log Rank Test: X2 = 0. 035, df = 1, P>0. 05), indicating that this change in density did not affect pathogen blocking. The ability of the Wolbachia strains wMelPop and wMelCS to protect their host against virus appears to be dependent on the total level of host cholesterol. In Drosophila these Wolbachia strains typically protect their host against virus-induced mortality, resulting in increased survival time and delayed virus accumulation [5], [8], [10]. This protective effect was greatly reduced for flies with high levels of cholesterol, resulting in a significantly decreased survival after challenge with DCV, although survival was never compromised to the point where the protective effect was completely eliminated. Strain-specific differences in pathogen blocking strength have been previously observed and it appears there is also a strain specific difference in the effect of dietary cholesterol. In our experiments the decrease in survival time due to excess host cholesterol ranged between two and five days, with a greater survival cost observed for the wMelPop infection than with the wMelCS. The wMel strain provided reduced pathogen blocking compared to the other two strains, and consequently there was no significant effect of increased dietary cholesterol on survival time. However, in two of the three experiments involving this strain, flies from at least one of the cholesterol-enriched treatments showed increased mortality rates compared to the control, which suggests that an effect of cholesterol may have been present but was constrained by the fact that there was little increase in survival time due to Wolbachia. In one assay the average survival of wMel-infected flies was only one day longer than uninfected flies. Stronger pathogen blocking is linked to higher Wolbachia densities [10], [11] and it is curious to note that of the three strains we examined wMel has the lowest density [17], [30]. The effect of excess dietary cholesterol is likely linked to both Wolbachia density and therefore blocking strength, with strains that offer stronger blocking providing a greater delay in virus-induced mortality and potentially providing more scope for competition over cholesterol to affect viral propagation. In flies without Wolbachia there was no effect of cholesterol on virus-induced mortality, however it is possible that such an effect would only become apparent during infections with lower viral titres where flies would survive longer. For all three strains the level of host cholesterol was intrinsically linked to the mean survival time, as within an experiment lines with higher cholesterol levels had lower survival times. With the exception of wMel experiment 1, both significantly increased mortality and cholesterol levels were observed for flies reared on the supplemented diets compared to the control. Additionally, in cases where the two treatment diets had similar survival times, they generally had similar cholesterol levels. This suggests that there is a strong relationship between fly cholesterol levels and virus-induced mortality, and therefore represents an important determinant of pathogen blocking strength. In Drosophila, some Wolbachia strains can also cause a delay in the accumulation of certain viruses, including DCV, relative to Wolbachia-uninfected flies [5], [10]. This effect has been attributed to the ability of Wolbachia to somehow interfere with the viral replication. Cholesterol has been identified as a critical factor in the replication of several viruses [26], [27], [31], [32]. In a competitive environment, if Wolbachia affected the usage of cholesterol by DCV, and this inhibited viral replication, we would expect to see greatly increased viral titres when cholesterol is provided in excess. For both wMelPop- and wMelCS-infected flies reared on cholesterol-enriched diets we observed a significant increase in DCV titre at five days post-infection. This suggests not only that the replication of DCV is dependent on cholesterol, but also implies a role for competition over cholesterol between Wolbachia and infecting viruses that can restrict viral propagation. As an alternative to competition for cholesterol, it was possible that the observed increase in mortality and viral accumulation could have been explained if there was a corresponding decrease in Wolbachia density seen with the cholesterol-enriched diets. We compared the density of the wMelPop infection across the three host diets and observed a slight but significant decrease with the highest level of cholesterol. On the surface this might suggest that the observed effects of cholesterol on survival could have been caused by a drop in density, however there was no difference in mean survival and total cholesterol levels between intermediate and high cholesterol flies taken from the same bottles. In contrast, both lines had decreased survival and higher cholesterol than the control line, which showed no significant difference in Wolbachia density to the intermediate line. For wMelCS there was no difference in density due to diet, but mean survival and total host cholesterol differed across all three diets. While we see that dietary supplementation with cholesterol consistently increases viral titers the effects on Wolbachia densities are less clear. In all but one case here, Wolbachia densities are unaffected by cholesterol treatment, the exception being the decline seen in wMelPop in response to high diet. Wolbachia density is likely determined by a complex series of genetic and environmental interactions [33]. There may be a threshold requirement for cholesterol beyond which increases do not lead to greater densities of the symbiont. If this were true, Wolbachia densities might be expected to decline under dietary restriction. The unique behavior of wMelPop under the high diet could be explained by an interaction between the long term rearing on the diet and the high virulence/titer associated with the strain. Regardless, the decline in Wolbachia densities in this treatment did not lead to corresponding decreases in blocking efficacy as measured by host survival. Our results further provide insight into the complex nature of Wolbachia-mediated pathogen blocking. This trait extends across multiple insect families, incorporating a range of effects against many different pathogens, including protection against viral-induced mortality, and blocking of pathogen replication and tissue invasion. One potential explanation for pathogen blocking in Wolbachia-infected mosquitoes was the broad upregulation of host immune genes associated with Wolbachia infection [6], [7], which has been shown to directly affect the ability of Wolbachia to hinder viral replication [15]. Critically, this immune priming response is not universal across Wolbachia-infected organisms, as D. melanogaster challenged with dengue virus, which is non-pathogenic in flies, show blocking of viral replication but without an accompanying immune system upregulation [9], [19]. Future work must determine whether cholesterol plays a similar role in pathogen blocking in mosquitoes, and if so whether there is also an additive relationship with the innate immune activation that has already been measured. Cholesterol supplementation of diet diminished, but did not eliminate the protective effect in our experiments, suggesting that either there is scope to completely remove blocking by further increasing cholesterol levels, or alternatively that there is a further aspect of the blocking mechanism that is as yet unidentified. The replication of dengue and other viruses is contingent on cholesterol [32], [34], but also depends on a variety of host lipids. DENV infection perturbs lipid homeostasis and drastically alters host lipid profiles [35]. To facilitate replication DENV induces upregulation of fatty acid synthase resulting in increased fatty acid biosynthesis as well as relocation of fatty acid biosynthetic machinery to its own replication complexes [36]. Wolbachia is known have limited lipid biosynthesis capabilities and relies heavily on the host cell to meet this requirement [16]. As with dengue infection, Wolbachia induces an upregulation of fatty acid synthase in the host [19], and consequently there may be competition between Wolbachia and virus for key lipids beyond cholesterol that underpins pathogen blocking. Cholesterol and lipids share an association with host membranes and the Golgi apparatus, which is used by Wolbachia and viruses including DCV and DENV as a site for replication [24], [37], [38], [39]. Interestingly, excess cellular cholesterol accumulates around the Golgi [40], which suggests that this organelle could serve as the source of lipids for both Wolbachia and infecting viruses, and fuel the competitive process that contributes to pathogen blocking. Pathogen blocking in flies has been linked to Wolbachia density, with high-density strains providing greater protection against virus-induced mortality [10]. The two strains where there was the greatest effect of cholesterol supplementation on pathogen blocking, wMelPop and wMelCS, both grow to high density and provide strong protection from the pathogenic effects of DCV infection, while the wMel infection, which is less pervasive in fly tissues does not. This suggests that while competition for cholesterol plays an important role in pathogen blocking, the effect is stronger for strains that provide greater protection to their host, as this offers more scope for competition under conditions of high cholesterol. As for Drosophila, pathogen blocking in Wolbachia-infected Aedes aegypti shows a high degree of density dependence, with low-density natural infections such as those in Aedes fluviatillis and Aedes albopictus providing only minimal blocking, and transinfected infections of wMelPop-CLA and wMel in Aedes aegypti growing to high density and providing strong interference against many pathogens [7], [13]. A. aegypti, infected with these high density strains, have been used in field releases designed to introduce Wolbachia into wild mosquito populations to render them incapable of dengue transmission [14]. Given our results there is scope for a role for competition over cholesterol to affect pathogen blocking in these lines. The results presented here indicate that the mechanism of pathogen blocking is likely to be multifaceted. This in turn would suggest that development of resistance by pathogens to Wolbachia blocking is likely to be more difficult than if the mechanism was mediated solely through immune priming. Moreover since assays measuring the strength of pathogen blocking are conducted using laboratory animal lines reared under optimal nutritional conditions, it is possible that these assays are underestimating the strength of blocking that occurs under field conditions where insects are often subjected to extremely nutrient deficient habitats. Drosophila melanogaster were reared on one of three diets - Standard media (50 g Sugar, 17 g Torula Yeast, 15 g Agar/L of food) [41], Intermediate cholesterol or High cholesterol. Powdered cholesterol (Sigma Aldrich C3045) was dissolved in 100% ethanol to produce an increase in dietary concentration of 0. 05 mg/mL for Intermediate, and 0. 1 mg/mL for High. Cholesterol in ethanol was added to media during cooking after it had boiled when the temperature had decreased to approximately 60°C. 1 mL of ethanol + cholesterol was added per 40 mL of food. 1 mL of ethanol without cholesterol was added to the control diet to account for any potential effects of ethanol on fly survival. Flies were reared in bottles containing 40 mL of media at a standardised density of approximately 150 larvae per bottle. Bottles were maintained at 25°C, RH 60% in an incubator. Three independent lines of Drosophila melanogaster from the w1118 background, infected with the wMelPop, wMel and wMelCS Wolbachia strains were moved to media containing 0. 3 mg/mL tetracycline-HCl [2]. After two generations females from each line were screened for the presence of the Wolbachia surface protein gene (wsp). Primers (5′ - 3′): (wspF – TGGTCCAATAAGTGATGAAGAAAC); (wspR – AAAAATTAAACGCTACTCCA). Flies were then screened with PCR to determine that they did not harbour a vertically transmitted DCV infection. Primers (5′ - 3′): (DCVF AGGCTGTGTTTGCGCGAAG); (DCVR – AATGGCAAGCGCACACAATTA) [42]. Once flies were free of Wolbachia, they were removed from tetracycline-supplemented food and transferred to bottles where uninfected male flies had been allowed to feed freely for 24 hours. This allowed for recolonisation of typical microbial infections of the digestive system that were removed with the Wolbachia infection by tetracycline treatment. Flies were reared on either Standard, Intermediate or High diets for between 7 and 11 generations before experiments. DCV accumulation in wMelCS-infected flies was measured after 30 generations on cholesterol-enriched food. S2 cells were infected with DCV from previous stocks [42] by incubating for 5 days at 28°C in Schneider' s standard media + 10% FBS + 1% Pen/strep. Cells were thawed and frozen to allow the release of the virus from the cells. The supernatant was centrifuged at 4000 rpm at 12°C for 25 mins and then ultracentrifuged at 25,000 rpm at 12°C for 3 hours. The pellet was resuspended in 1. 5 mL 50 mM Tris pH 7. 4 and left overnight at 4°C. The solution was layered using a 10–40% sucrose gradient and then ultracentrifuged again at 27,000 rpm at 12°C for 3 hours. Fractions were collected from the gradient and aliquots of the suspension were run on an SDS-PAGE gel to determine which fractions contained the bulk of the DCV. These fractions were then ultracentrifuged at 27,000 rpm at 12°C for 3 hours and the pellets resuspended in 50 mM Tris. The amount of DCV was quantified using a TCID-50 assay. S2 cells were infected with DCV in a dilution series on a 96 well cell culture plate and incubated at 28°C. After six days these cells were scored to determine which had become infected. These data were used as part of a formula that considered the dilution of virus and proportion of infected wells to determine the TCID-50 value of the aliquot in infectious units per mL [42]. Infected cells were non-confluent and surrounded by cellular debris. Three TCID-50s were performed and the overall concentration of the DCV stock was taken as the average of the three. Both TCID-50 and injection aliquots were thawed only once on the day of use. Through experimental trials it was determined that a DCV titre of approximately 50 infectious units per fly would kill flies uninfected by Wolbachia in 5–7 days, and w1118-wMel-infected flies in approximately 9–10 days. This concentration was selected for use in further survival assays. Male flies from each of the three diets were challenged with DCV via intra-peritoneal injection using a Nanoject II (Drummond Scientific). Flies for each injection were the same age, although age varied between 4–7 days post-eclosion between different experiments, a similar age range used in previous experiments [5]. Three vials of 12 flies each were injected per diet by infection status condition for each experiment. Additionally, one vial of flies per condition was injected with 1× PBS to serve as a control for the effects of the DCV infection. Survival was monitored daily, with deaths in the first 48 hours post-injection treated as being due to trauma. Three separate injections were conducted for each of the wMelPop-, wMel- and wMelCS-infected lines. Survival curves represent a single injection experiment (Figs. 1 and S1). The effect of diet and Wolbachia infection on survival were analysed for each experiment using Cox Regression. Survival between treatments was then evaluated using the Kaplan-Meier log-rank test with strata = vial for each experiment separately. In principle it would be desirable to use ANOVA to test for the significance of the interaction term Wolbachia*cholesterol level on survival across all experiments, but this is not possible given the unavoidable variation in viral titer between preparations for the replicate experiments. All statistics were performed using SPSS V17 (IBM). Flies from the wMelPop-infected line were treated with tetracycline-hydrochloride to cure their Wolbachia infection. These “cured” flies were then challenged with DCV as above to determine that Wolbachia caused the protective effects observed in the other survival experiments. Cholesterol quantification was performed on flies from the same bottle used in each survival experiment to clarify that there was a diet-based difference in cholesterol levels between the injected lines. For each assay male flies from each line were provided only 10% sucrose for 24 hours to clear their digestive systems of cholesterol-containing media, and were then collected in pools of five. Flies were normalised by weight and then homogenized in buffer (150 mM NaCl, 50 mM Tris pH 7. 5,2 mM EDTA) to a final concentration of 10 µg/µL. Total cholesterol and cholesteryl ester levels were quantified using the Amplex Red Cholesterol Testing Kit (Invitrogen) according to the manufacturer' s instructions. Data were obtained using a BioTek SYNERGYMX Fluorescent plate reader (Millennium Sciences) and compared statistically for each experiment with student' s t-tests and ANOVA using Prism V 5. 0d, (Graph Pad Software). Total DCV levels were independently quantified for male wMelPop- and wMelCS-infected flies in order to determine the effects of increased dietary cholesterol on virus accumulation. Flies from the three dietary conditions were infected with DCV as in the survival experiments. Flies were collected in pools of four at 5 days post-infection. RNA was extracted using the TRIzol RNA extraction protocol (Invitrogen), and cDNA synthesised using Superscript III Reverse Transcriptase (Invitrogen). Levels of DCV were quantified relative to Cyclin K (CycK - FlyBase ID: FBgn0025674) in duplicate with a LightCycler 480 II Instrument (Roche) using LightCycler 480 SYBR Green I Master (Roche). DCV primers were as above. CycK primers were as previously described (5′ – 3′): (CycKF – GAGCATCCTTACACCTTTCTCCT); (CycKR – TAATCTCCGGCTCCCACTG) [43]. The qPCR profile was as previously described [42]. The expression levels of the reference and target genes were quantified in duplicate for each biological replicate. Mean Normalised DCV: CycK expression ratios were calculated using qGene [44]. These ratios were compared between treatments with Mann Whitney U-tests and Bonferroni-Holm multiple testing corrections using Prism V 5. 0d (Graph Pad Software). Wolbachia density was quantified for wMelPop-infected flies from the same generation used in survival experiment two, and for wMelCS-infected flies from the same generation used in survival experiment one. DNA was extracted from 20 individual males using the ReliaPrep gDNA Tissue Miniprep System (Promega), according to manufacturer' s instructions. Wolbachia density was then determined by relative quantitative PCR (qPCR) by comparing the abundance wsp to that of the single-copy Drosophila melanogaster rps17 gene. Primers (5′ - 3′): (RpS17F – CACTCCCAGGTCCGTGGTAT); (RpS17R – GGACACTTCCGGCACGTAGT). wsp primers were as above. For each sample, qPCR amplification of DNA was performed in duplicate with a LightCycler 480 II Instrument (Roche) using LightCycler 480 SYBR Green I Master (Roche) according to the manufacturer' s protocol. The temperature profile of the qPCR was 10 mins of pre-incubation at 95°C, 45 cycles of 95°C for 10 s, 60°C for 15 s, 72°C for 10 s. wsp: rps17 ratios were obtained for each biological replicate using the LightCycler 480 II software (Roche), and then compared independently for each strain using ANOVA and student' s t-tests with a Bonferroni multiple testing correction (Graph Pad Prism 5. 0d). SUMMARY: [/INST] Wolbachia pipientis is an intracellular bacterium that naturally infects many insect species. These bacteria can block the replication and dissemination of a variety of pathogens that coinfect the insect. In mosquitoes this effect applies to viruses including dengue and the parasite that causes malaria. This makes Wolbachia a promising method of controlling a number of insect-transmitted diseases of humans. Some studies suggest that pathogen blocking is due to Wolbachia stimulating the host innate immune system, however in the fly Drosophila melanogaster, blocking occurs in the absence of such an immune effect. This suggests that there is an additional component to the mechanism. Host nutrients such as cholesterol are a limiting factor in virus replication and may serve as a source of competition that underlies pathogen blocking. Here we show that competition over cholesterol contributes to the pathogen blocking effect, with higher available cholesterol levels causing less effective blocking, and increased viral titres in Wolbachia-infected D. melanogaster challenged with the pathogenic Drosophila C virus. These results suggest that competition over cholesterol is an important part of the pathogen blocking mechanism. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Sia fans are wigging out with over her disappointing concert in Israel last week — enough to sue the pop star for a full refund. A group of dissatisfied spectators from the Aug. 11 show at Tel Aviv's Yarkon Park filed a class-action lawsuit Monday, the Jerusalem Post reported. Apparently hearing Sia belt "Cheap Thrills" wasn't enough for attendees, who paid 344 Israeli Sheqels ($91) for tickets. The concertgoers' biggest gripe is the length of the singer's set — a mere 65 minutes. (By way of comparison, Bon Jovi warbled for over two hours during a show at the same venue last October.) Sia to headline free concert in support of abortion access This is a better view of Sia performing than many concert goers at her show last week in Tel Aviv witnessed, according to a class action lawsuit. (ATTILA KISBENEDEK/AFP/Getty Images) And the litigious listeners didn't find that time well spent, complaining the singer was about as mobile and engaged as a real chandelier, staying towards the back of the stage. Sia, who hides her face behind a wig, "never once addressed the crowd, mentioned what it was like to be in Tel Aviv, or bantered in any way," according to the Israeli newspaper's account. Instead, fans who didn't shell out for the pricey front-row tickets — which afforded a full view of the stage — had to make do with what they could see on the video screens. The Australian singer and the promoter are facing a $2.1 million suit. (ATTILA KISBENEDEK/AFP/Getty Images) The problem, the suit charges, was that they were shown a pre-recorded video featuring Kristen Wiig with Sia instead of the live performance happening on stage. Internet theory suggests Sia has been kidnapped by Beyoncé The lawsuit is demanding 8 million Sheqels ($2.1 million) from Sia and Israeli promoter Tandi Productions, the Jerusalem Post reported. That the Australian pop diva played in the country at all, though, was no simple business transaction. She faced enormous pressure in the past few months from the pro-Palestinian BDS (Boycott, Divestment and Sanctions) movement to cancel the show. Sign up for BREAKING NEWS Emails privacy policy Thanks for subscribing! Australian pop sensation Sia’s highly anticipated performance in Tel Aviv last week apparently led many concert-goers to feel that the “Cheap Thrills” singer had left them with just that. On Monday, a number of disappointed crowd members filed a class-action suit against the “Elastic Heart” artist, seeking to compensate all ticket holders for the August 11 concert. Concert-goers who paid NIS 344 for lawn seats in Tel Aviv’s Yarkon Park were dismayed when the entire concert ended after just 65 minutes, an unusually short length for a major production. But that wasn’t the only thing that upset fans, many of whom spent hours getting to the venue, waiting for the show to start, and battling traffic on the way home afterward.During the show, the megatron screens usually devoted to portraying the on-stage performance aired a polished, prerecorded video instead.The footage featured famous actresses such as Kristen Wiig, of Bridesmaids fame, and Gaby Hoffman, from the hit Amazon series Transparent, as dancers, even though they were absent from the actual stage.Although the video was meant to complement what was happening on stage, the sync was imperfect, even as the colors and lighting were vastly superior to the stage show.As a result, the vast majority of concert-goers (with the possible exception of people who shelled out for expensive front-row “golden ring” tickets) experienced in essence a movie screening on the lawn of the Yarkon, complete with live backing vocals from a bewigged Sia and a distant stage show they couldn’t see. Even the live vocals felt impersonal, as the artist never once addressed the crowd, mentioned what it was like to be in Tel Aviv, or bantered in any way.Those downtrodden crowd members also complained that the “Chandelier” artist put on a lackluster show, standing toward the back of the stage throughout the performance while wearing the signature wig that predominantly covered her face.The suit against Sia and Tandi Productions – the firm that brought her to Israel – reportedly calls for a nearly NIS 8 million sum to be paid as nominal reparations to all of the concert’s ticket holders. SUMMARY: [/INST] Sia may hide behind her fake bangs when she's performing, but her coif likely won't shield her from the $2.1 million class-action lawsuit just filed against her and an Israeli production company. Disgruntled concertgoers who forked over around $90 for tickets to the Australian singer's Aug. 11 concert in Tel Aviv's Yarkon Park were upset when the concert ended after only 65 minutes-and now want "nominal reparations," as the Jerusalem Post puts it. They may have expected a longer show in that particular venue, as the New York Daily News notes Bon Jovi played in the same park last year for more than two hours. To add impersonal insult to injury, the complaint also alleges Sia didn't interact with the crowd at all and that the large-screen monitors around the park showed a prerecorded video starring Kristen Wiig and Gaby Hoffman instead of what was going on onstage. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Because coevolution takes place across a broad scale of time and space, it is virtually impossible to understand its dynamics and trajectories by studying a single pair of interacting populations at one time. Comparing populations across a range of an interaction, especially for long-lived species, can provide insight into these features of coevolution by sampling across a diverse set of conditions and histories. We used measures of prey traits (tetrodotoxin toxicity in newts) and predator traits (tetrodotoxin resistance of snakes) to assess the degree of phenotypic mismatch across the range of their coevolutionary interaction. Geographic patterns of phenotypic exaggeration were similar in prey and predators, with most phenotypically elevated localities occurring along the central Oregon coast and central California. Contrary to expectations, however, these areas of elevated traits did not coincide with the most intense coevolutionary selection. Measures of functional trait mismatch revealed that over one-third of sampled localities were so mismatched that reciprocal selection could not occur given current trait distributions. Estimates of current locality-specific interaction selection gradients confirmed this interpretation. In every case of mismatch, predators were “ahead” of prey in the arms race; the converse escape of prey was never observed. The emergent pattern suggests a dynamic in which interacting species experience reciprocal selection that drives arms-race escalation of both prey and predator phenotypes at a subset of localities across the interaction. This coadaptation proceeds until the evolution of extreme phenotypes by predators, through genes of large effect, allows snakes to, at least temporarily, escape the arms race. The phenotypic interface of the predator–prey interaction between garter snakes and newts of the genus Taricha revolves around tetrodotoxin (TTX). TTX is one of the most potent neurotoxins known, binding to the outer pore of voltage-gated sodium channels in nerve and muscle tissue, thereby blocking the propagation of action potentials [46,47]. Taricha have high levels of TTX in the skin and are lethal to a variety of potential predators [28,48–52]; individuals from some populations have up to 14 mg of toxin, which is enough TTX to kill thousands of mice or up to 10–20 humans. A growing body of evidence suggests that newts produce their own TTX, but the genetics and biosynthesis of this process are poorly understood [50,53–57]. Some garter snakes of the genus Thamnophis have evolved resistance to this prey toxin through modifications of the sodium channel structure in skeletal muscle [58,59] and are capable of ingesting whole adult newts without permanent adverse effects [60,61]. Resistance in snakes is heritable [62,63] and is associated with a cost of reduced locomotor performance [64]. The functional interactions and relationships between individual newt toxicity and effects on individual snakes have been worked out in detail [27,58–63,65,66]. Both toxicity of newts and resistance of snakes vary geographically [28,60,62,63]. Where newts are absent or nontoxic, T. sirtalis are not resistant to TTX [28,62]. Elevated TTX resistance in western T. sirtalis is clearly derived, reaching levels 10–1,000 times that of other members of the genus in some populations [65]. Population differences in resistance are correlated with functionally important differences in amino acid sequences of skeletal muscle sodium channels [59]. Although considerable effort has been devoted to understanding the evolution of geographic and genetic patterns of TTX resistance in snakes, similar information regarding variation in newt toxicity is lacking. Data from only a few localities in the Pacific Northwest of North America suggest tight matching between prey and predator phenotypes [60], but a comprehensive survey of newt toxicity has not been previously conducted. Mean total skin TTX levels of newts ranged from no detectable TTX to 4. 69 mg/newt and differed among populations (Figure 1; ANOVA: F28,382 = 20. 38, p < 0. 0001). Across this phenotypic range, newt toxin levels were closely correlated with the resistance of sympatric snakes (Spearman ranked correlation, ρ = 0. 71, p < 0. 0001). Geographically, regions of highest newt toxicity also corresponded to regions of highest snake resistance, with extreme values of both traits found in the Willamette Valley of Oregon and the San Francisco Bay Area of California (Figure 1). Isocline maps of newt toxicity and snake resistance show generally similar spatial patterns of phenotypic variation (Figure 2A and 2B). Despite the overall spatial concordance of predator and prey phenotypes, an analysis of functional interaction reveals that over one-third of the localities sampled may qualify as ecological mismatches (Figure 3, Table 1, and Figure S1). The isocline map of the degree of mismatch, d, indicates that most of the geographic range of the newt–snake interaction is best characterized as mismatched and that regions of close ecological match are small and spatially restricted (Figure 2C, yellow to red areas). Localities where phenotypes are closely matched do not uniformly coincide with areas of elevated predator and prey phenotypes, but instead, include both ends of the phenotypic distributions of newts and snakes (Figures 1 and 2 and Table 1). The observed levels of phenotypic mismatch ranged from near zero to d > 2. 5 (Table 1). Values of d > 0. 6 indicate populations that lay outside the 15% and 85% lines in Figure 3 and values of d < 0. 6 indicate populations that fell between the 15% and 85% lines. Estimates of 0 < \|d\| < 0. 6 indicate that localities lie within the zone of potentially experiencing reciprocal selection. In every case of mismatch (ten localities), predator resistance was much greater than the effective level of toxicity of local prey (Figure 3, gray zone, Table 1, and Figure S1A). Mismatches included six populations of newts (Parsnip Lake, Oregon; Bear Ridge, California; Inland Lake, British Columbia; Crescent City, California; Latah, Idaho; and Scott Lake, Oregon) with little or no TTX (Figure 3, purple symbols in gray zone, Table 1, and Figure S1A). Snake populations at the same localities all fall in the lowest level of TTX resistance for garter snakes, wherein ingestion of ≈0. 1–0. 5 mg of TTX would reduce performance to 50%. This level of resistance is equivalent to the ancestral level of TTX resistance for the genus Thamnophis (50% dose ≈ 0. 11 mg), including mostly species that have never coevolved with tetrodotoxic newts [65]. Four additional localities not explicitly recognized as mismatched (Skagit River, Washington; Orick, California; Priest Lake, British Columbia; and Vandenburg, California), also exhibited predator resistance greater than toxicity of local prey as well as reduced levels of resistance and toxicity (Figure 3, blue symbols in gray zone and one blue symbol in the nonshaded zone, Table 1, and Figure S1B). These nearly mismatched localities had phenotypic distributions of newt toxicity wherein a small reduction in the performance of local snakes could only result from ingestion of the most toxic newts present. We did not observe a single case where prey levels were greater than comparable predator abilities. The other four mismatches include four populations of moderately to highly toxic newts (San Mateo, California; East Bay, California; Willow Creek, California; and Omo, California) that co-occur with the most resistant snake populations known (Figure 3, light green and yellow symbols in gray zone, Table 1, and Figure S1A). All of these localities occur within two geographic regions (the Bay Area of California and central Sierra Nevada) and include three species of Taricha (Ta. torosa and Ta. granulosa in the Bay Area and Ta. sierrae in the central Sierra Nevada) and likely two lineages of T. sirtalis [67]. As with the other mismatched populations, snakes in these localities can ingest sympatric newts with no reduction in performance or fitness consequence (Figure 4 and Figure S1A), however both newt and snake phenotypes are highly elevated, compared with ancestral conditions and conspecific populations (Figures 1,2A, 2B, and 3, and Table 1). Population-specific interaction gradients confirm the interpretation of mismatch across the interaction (Figure 4, Figure S1, and Table S1). Regressions of the predicted performance of snakes after ingestion of co-occurring newts indicate that TTX levels observed in newts at mismatched localities do not have variable effects (Figure 4, Figure S1A, and Table S1). Resulting interaction gradients in these mismatched populations have an average slope that is substantially lower that that seen in matched populations, and no differences in expected fitness are associated with variation in either TTX levels and TTX resistance at these localities (Figure 4, Figure S1, and Table S1). Interaction gradient slopes (β) of the four nearly mismatched localities were an order of magnitude greater than in mismatched populations, but much less than in matched localities, suggesting that these nearly matched localities experience reduced potential for selection relative to other matched populations, but greater than our mismatched localities (Figure S1 and Table S1). Our results suggest, contrary to previous analyses [60], that extreme trait mismatches are not uncommon in this predator–prey system. However, the absence of localities in which newt toxicity was high enough to kill or disable any sympatric snake suggests that it is possible for the predator, but not the prey, to evolutionarily escape the reciprocal selection of the arms race. This directional asymmetry appears to contradict theoretical predictions arising from equilibrium theory [68], as well as the so-called “Life-Dinner Principle” (i. e., that prey experience stronger selection than predators in an arms race) [69], which predict that arms-race coevolution should favor defensive adaptations in prey over offensive adaptations in predators. This pattern may reflect a reversal in selective inequity as predicted for systems with deadly prey [70], or it may be particular to the unique biology of the newt–garter snake interaction. The adaptive changes in resistance and toxicity are mediated not only by the strength of selection, but also by the genetic architecture of the traits at the interface. There is reason to expect adaptive changes in mechanisms of TTX resistance to proceed in a less-than-gradual fashion. If phenotypic changes in resistance are due to one or a few genes, then fixation of such genes in snake populations could be rapid and lead to phenotypic mismatches in one (or few) evolutionary step (s). Much of the variation in TTX resistance in T. sirtalis results from the expression of TTX-resistant voltage-gated sodium channels in skeletal muscle [58,59]. Resistance in these sodium channels is conferred by a small number of nucleotide substitutions in the TTX binding site [59]. The extreme resistance in at least one of these mismatched snake populations (Willow Creek, California) results from the substitution of a single amino acid [59]. Rapid fixation of such a simple mutation could explain how some populations of predators have escaped the arms race with prey. On the prey side, little is known about the basis of differences in TTX toxicity in newts, but some [52,71,72] have suggested that constraints on toxicity due to limited exogenous factors (e. g., environmentally derived precursors of TTX) may be one factor allowing predators to outpace prey in the arms race. However, the extreme levels of toxicity found in some newt populations demonstrate that elevated levels of the trait are possible within Taricha. Our results indicate that geographic regions of phenotypic escalation are not necessarily congruous with coevolutionary hot spots. Coevolutionary hot spots (where reciprocal selection is intense) and cold spots (where selection is absent) are defined on the nature of the interaction rather than the level of the phenotype [1,2, 4,27,60]. Our data reveal that current cold spots exist at localities with upper and lower extremes of phenotypes in both predator and prey (Figures 1–3). These results contradict earlier assessments of the geographic mosaic of coevolutionary hot spots in this system, which assumed that elevated predator phenotypes coincided with intense coevolution [60]. Similarly, reciprocal selection is possible at localities previously identified as cold spots (e. g., Vancouver Island, British Columbia) where phenotype distributions overlap and appear well matched despite the low levels of prey toxicity and predator resistance (Figure 1). Despite the fact that both predator and prey phenotypes show similar geographic patterns of escalation, the distribution of phenotype mismatch (i. e., cold spots) is not concordant (Figure 2). Coevolutionary hot spots may not be unequivocally assessed on phenotypic data alone, but at least the potential for reciprocal selection is observed across the range of phenotypic values in both taxa. The observed pattern of trait mismatches among localities suggests a general arms-race dynamic for the process of predator–prey coevolution between Thamnophis and Taricha. The majority of localities occupy a broad band of phenotypic values within which potential reciprocal selection might occur (Figure 3). This zone of possible matching includes linearly increasing values of both newt toxicity and snake resistance that range from ancestral levels and increase several orders of magnitude, consistent with a counter-escalating arms-race dynamic in which pairs of populations experience reciprocal selection and evolve ever-increasing trait values [1,2, 37,69]. This phenotypic zone includes multiple lineages of Taricha as well as at least two lineages of snakes that have evolved extreme levels of TTX resistance, suggesting that escalating dynamics have occurred multiple times during this evolutionary interaction [60,67,73,74]. Because many factors might ameliorate reciprocal selection at these localities, it is not possible to be certain that each of these localities represents a currently coevolving pair of populations. One clear and testable prediction from this interpretation is that older interactions should represent the populations with elevated phenotypes if average realized selection and the genetic architecture of toxicity and resistance are stable across localities. Mismatched localities fall into two distinct groups that likely have different explanations and implications. At one end of the phenotypic distribution are the four populations of moderately to highly toxic newts that co-occur with the most resistant snake populations known (Figures 1 and 3, light green and yellow symbols in gray zone, and Table 1). As with other mismatched populations, snakes in these localities can ingest sympatric newts with no or little reduction in performance or fitness consequence, however both newt and snake phenotypes are highly elevated compared to ancestral conditions and conspecific populations. This pattern suggests that these localities have undergone arms-race coevolution, but that predators have escaped the arms race through the rapid evolution of extreme TTX resistance (see above). The extreme levels of TTX present at other localities (e. g. Benton, Oregon) suggest that there does not appear to be a physiological limit to toxicity that explains these mismatches. These localities occur in nearby geographic regions (the Bay Area of California and the central Sierra Nevada; Figure 1) and involve different species of Taricha (Ta. granulosa and Ta. torosa in the Bay Area, and Ta. sierrae in the Sierra Nevada) [75]. Phylogeographic evidence suggests these represent two related groups of snake populations [67], indicating that escape from the arms race has occurred once or possibly twice in this fashion. At the opposite end of the phenotypic distribution, we see mismatched localities from multiple lineages that appear never to have engaged in the arms race (Figures 1 and 3, purple symbols in gray zone). Population-specific interaction gradients (Table S1 and Figure S1A) and values of d (Figure 3 and Table 1) confirm that the opportunity for reciprocal selection in these localities is negligible. Both prey and predator traits at these localities appear to be close to estimated ancestral levels, wherein snakes have the slight ecological advantage of some predisposition to TTX resistance [60]. Average TTX levels in these newt populations range from 0 (or below our measurable lower limit of 0. 0001 mg) to a high of around 0. 002 mg (Parsnip, Oregon). This level of TTX is at or below the concentrations detected in related salamandrid species. In Notophthalmus, the sister genus to Taricha, reported levels of TTX range from 0 to a high of ≈0. 06 mg per animal (estimated from [76]). In Cynops pyrrohgaster, an Asian TTX-bearing newt, typical whole-animal TTX levels range from 0–0. 2 mg, with most population means ≈0. 002 mg (estimated from [77]). The highest reported TTX level in the European newt genus Triturus (sensu lato) is 0. 017 mg TTX (Tr. cristatus), with TTX levels in other species of Triturus an order of magnitude lower [78]. These comparative data suggest that mismatched localities at the low end of the phenotypic distribution have not engaged in counter-escalating coevolution. Alternatively, these populations may have been coevolving in the past, but once reciprocal selection was alleviated, costs of toxicity and resistance drove levels of both traits back to reduced levels. The four nearly mismatched localities (Figure 3, blue symbols in gray zone and one blue symbol in nonshaded zone) suggest that populations in this lower range can move from disengaged to engaged or that the process may be cyclical. Multiple snake and newt lineages are represented at the localities with unelevated phenotypes, suggesting that the phenomenon is not merely a phylogenetic artifact [67,73–75]. The apparent dynamic of arms-race coevolution in the newt–snake system, then, includes three or more stages. First, we see localities with low levels of traits at the phenotypic interface. Some of these localities, for reasons not yet clear, do not experience reciprocal selection and appear never to have engaged in the arms race. All of these localities involve predators able to subdue toxic prey without ill effect, suggesting that if newt toxicity rose in these populations, reciprocal selection would follow. As populations of newts gain toxicity (through mutation, migration from more toxic locales, or some exogenous influences), counter-escalation ensues and can lead to up to three–order-of-magnitude increases in traits. Initial increases in toxicity might be promoted by selection from interactions with other species as in other systems [3,17,22], including predators on early life stages [50]. Some localities (e. g., Benton, Oregon) seem to persist in this escalation zone, while others (e. g., Omo, California) escape from the arms race due to rapid evolution of extreme resistance through simple genetic mechanisms. Such adaptive changes suspend reciprocal selection, and no counter escalation follows. The next step for these populations is unclear. If costs to either resistance or toxicity are high enough, we might expect to see such escaped populations eventually lose phenotypic value and return to the lower left of Figure 3, resulting in de-escalation and a long-term cyclical dynamic. This scenario is plausible and has been suggested as an important dynamic in the chemically mediated coevolution between parsnip webworms and their host plant [79]. However, de-escalation is not supported by the observed patterns in the newt–snake interaction, which do not reveal mismatched localities with intermediate levels of resistance or toxicity. We sampled a total of 383 newts from 28 localities co-occurring with populations of garter snakes for which TTX resistance has been described [60]. This sampling regime included most of the geographic range of this interaction and included localities from the central coast of British Columbia to the central coast region of California (Figure 1). The number of individuals sampled for each locality ranged from two to a maximum of 57 (Table 1). Only sexually mature animals were assayed in order to minimize variation in toxin levels associated with ontogeny. We included both males and females in our analysis; sex ratios of specimens varied among localities. Although earlier work suggested that there might be minor gender differences in toxicity of Ta. granulosa [55], we detected no such differences in our data set (ANOVA: F1,370 = 3. 26, P = 0. 0719). We sampled populations of Ta. granulosa, Ta. torosa, and Ta. sierrae. Because average toxicities of Ta. torosa and Ta. sierrae populations were completely within the range of Ta. granulosa populations, we included all three species in a single analysis for this study (Table 1). We predicted and evaluated the distribution of expected performance outcomes for each population of snakes interacting with sympatric newts over the range of toxicity observed in newts from each given population. This model of the chemical ecology and physiology of the interaction is based on an extensive understanding of the functional interaction between newt toxicity and snake resistance [27,28,49,53,55,56,60–63,66]. For each locality, we estimated the toxicity (in mg of TTX) of newts, the doses of TTX (in mg) required to reduce performance of co-occurring snakes to 15%, 50%, and 85% of their baseline performance, and the degree of match or mismatch between newt and snake phenotypes (see below for details). Newt toxicity estimates and quantification of skin TTX levels. The amount of TTX present in dorsal skin of individual newts was quantified with high-performance liquid chromatography–fluorescence detection, and estimates of total skin TTX (in mg) per animal were generated following previously published methods [28,49,50,53,55]. This methodology has been shown to be a highly repeatable and accurate method for measuring dorsal skin TTX levels [28,49,53,55] as well as for estimating the total skin TTX of individual animals [49]. Quantification of TTX-resistance in Th. sirtalis. Whole-animal resistance data (in mass-adjusted mouse units or MAMU) were taken from Brodie et al. [60], in which TTX-resistance was measured with a bioassay based on a reduction in organismal performance after an interperitoneal (IP) injection of TTX [60,62,63]. This bioassay provides a highly repeatable estimate of individual and population level differences in susceptibility to TTX that expresses resistance as a percentage of baseline locomotor performance. A measure of 50% resistance means that an individual (or population on average) could crawl at 50% of its baseline speed after an injection of a given amount of TTX. TTX-resistance estimates used here are based on data from a total of 2,449 snakes from 269 families from 28 populations. We used these published dose-response curves to interpolate the average 15%, 50%, and 85% IP resistance doses (in MAMU) for each locality. Comparing TTX toxicity in newts with TTX resistance in Th. sirtalis. Because absolute levels of TTX resistance in snakes (i. e., doses in mg rather than in MAMU) are related to size [60,61,66], we adjusted population average TTX resistance with respect to post-partum female mass for each population. Adult females are the largest size class in a given population and therefore are the most likely to prey on newts. Additionally, because of asymptotic growth curves in snakes, adult females represent the best size class to compare across populations. The 15%, 50%, and 85% IP doses (in mg) of TTX for adult post-partum female snakes at each population of Th. sirtalis were thus estimated using the average mass of this demographic group at each locality (Table 1). In the case of one locality, East Bay, size data were unavailable and we used an estimate of the average female mass based on its nearest geographic neighbors. Because 1 MAMU = 0. 01429 μg TTX per gram of snake [60,62,63,66,80], the IP dose of TTX (in mg) required to reduce performance to a given amount (e. g., 50%) for an adult female snake at any given locality is estimated as: where θ is the performance reduction dose of interest (e. g., 15%, 50%, or 85% in MAMU) and snake mass is the mean post-partum weight of female snakes from a given population. We modeled the effect of oral consumption of newts by snakes by converting the above IP doses to oral dose. The relationship between oral and IP doses of TTX is linear for Th. sirtalis (as well as other vertebrates; e. g., mice). At all levels of resistance and doses of TTX, the oral dose required to achieve the same effect as an IP dose is 40× [61]. We converted the IP 15%, 50%, and 85% resistance doses (in mg) to oral doses (in mg) by multiplying each dose by 40. Modeling mismatch. We defined a functional mismatch if ecological interactions between individuals of sympatric species do not result in variable fitness consequences for either taxa (i. e., all predators are able to subdue all prey without impairment, or all prey able to repel or kill all predators). We defined a given locality as “matched” if a sympatric interaction could potentially result in variable fitness outcomes for one or both taxa. This outcome was conservatively judged to occur if the average performance reduction of a local snake ingesting any sympatric newt fell between 15% and 85% of normal crawl speed. The phenotypic space referred to as “matched” is more properly the region wherein potential reciprocal selection could occur between TTX toxicity and resistance. At performance levels <15%, snakes that ingest newts are fully immobilized or killed and newts escape [81], whereas at performance levels >85% snakes are unaffected and all captured newts die. We visualized match and mismatch at individual populations by plotting total skin TTX of newts against the size adjusted, oral 50% dose of snakes at each locality along with 15% and 85% dose model lines (see below) on a log scale (Figure 3). The actual range of newt phenotypes at each locality was used to illustrate the distribution of prey phenotypes. Because predator phenotypes are based on an estimated asymptotic function, it was not possible to plot them as range and we used the 95% confidence interval around each localities 50% as an estimate of phenotypic range. Our data included populations of newts that had no measurable TTX; as a result we transformed all values (TTX in newts and 50% doses in snakes) by adding 0. 0001 mg to each value. This adjustment maintained the overall relationship between newt phenotypes and snakes phenotypes but allowed zero values to be plotted. The 15%, 50%, and 85% model lines were plotted using the absolute (i. e., in mg) estimates of the 15%, 50%, and 85% resistance doses (see above for details) for each locality. Quantification of phenotypic mismatch. We calculated (d) as the orthogonal distance from the joint mean of each locality to the predicted 50% performance line (Figure 3). This estimate of distance d from the best match provides a quantification of the degree of mismatch at a given locality. An analogous approach has been used to evaluate arms-races between the sexes within species [37]. Although the choice of 50% to express this mismatch metric is somewhat arbitrary, the model of performance was robust and returned similar results for a range of (40% to 60%) of hypothetical matches. Because of the extreme range and nonlinearity of snake 50% doses and the presence of newt populations that had TTX levels below our detectable levels, we used log-transformed values of the following— (newt total skin TTX + 0. 0001) and (snake 50% dose + 0. 0001) —to calculate d (see above). This method uses the equation for estimating the shortest distance from a point to a line: where A and B are the respective components of the slope and C is the intercept of the line. Our model assumes that the best functional match of newt and snake phenotypes at a given locality is one in which ingestion of an average newt by an average adult female snake will result in a reduction of that snake' s crawl speed to 50% of baseline. This assumption results in the prediction that the model line describing perfect match is: Thus the line describing perfect phenotypic match has a slope and intercept of 1 and 0 respectively, and A = 1, B = −1, and C = 0, and our estimate of d simplifies to: where xi = log (50 % dose + 0. 0001) of snakes from a given locality, and yi = log (average total skin TTX + 0. 0001) of co-occurring newts. Population-specific interaction gradients. Interaction gradients were generated for each locality by estimating the performance reduction experienced by an average snake after ingesting any of the observed sympatric newts. Thus the gradients reflect the observed distributions of whole newt toxicity for each locality. Interaction gradients are estimated with simple linear regression (SNAKE PERFORMANCE = (NEWT TTX) * β + ERROR). to reveal the average slope of the fitness consequence analogous to directional selection gradients, regardless of the form of regression that best fits the data [82]. Snake performance values are calculated from population-specific dose-response curves (see above). For the purposes of plotting, we normalized newt TTX levels to range from 0–1, with the most toxic newts scaled to 1 for each locality. Phenotypic distributions and functional matching. We used the quantitative estimate of mismatch d to visualize geographic patterns of mismatch. Isocline maps that included all sampled localities seen in Figure 1 were generated using inverse distance-weighted interpolation based on observed values (i. e., TTX levels, snake resistance, and d) and the latitude and longitude coordinates for each population. Because of nonlinearity in resistance values (see also [60]) oral 50% doses of >5 mg were entered as 5 mg. The function' s power was set at two and the neighborhood at 500 km. Analyses were performed in ArcView GIS 3. 3 with Spatial Analyst 2. 0. Analysis of geographic patterns of TTX-resistance and justification for phenotype classes in snakes (Figure 2B) was performed as per [60]. We used multiple post-hoc comparisons to estimate phenotype classes for Figure 2A (newt total skin TTX). Populations with values of d > 0. 6 (i. e., those that lie outside the range of the 15% and 85% dose lines and were considered mismatched) are colored in blue and purple (Figure 2C). Populations with values of d < 0. 6 fell between the 15% and 85% lines and are colored in red, orange, yellow, and green (Figure 2C). SUMMARY: [/INST] Arms races between natural enemies can lead to the rapid evolution of extreme traits, high degrees of specialization, and the formation of new species. They also serve as the ecological model for the evolution of drug resistance by diseases and for host-pathogen interactions in general. Revealing who wins these arms races and how they do so is critical to our understanding of these processes. Capitalizing on the geographic mosaic of species interactions, we examined the dynamics of the arms race between snakes and their toxic newt prey. Garter snakes in some populations have evolved dramatic resistance to the tetrodotoxin defense of the their local prey. By evaluating the pattern of mismatches between toxicity and resistance, we discovered that predators sometimes escape the arms race through the evolution of extreme resistance, but that prey never come out ahead. The reason for this one-sided outcome appears to depend on the molecular genetic basis of resistance in snakes, wherein changes to a single amino acid residue can confer huge differences in resistance. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: West Nile virus (WNV) and Rift Valley fever virus (RVFV) are two emerging arboviruses transmitted by Culex pipiens species that includes two biotypes: pipiens and molestus. In Lebanon, human cases caused by WNV and RVFV have never been reported. However, the introduction of these viruses in the country is likely to occur through the migratory birds and animal trades. In this study, we evaluated the ability of Cx. pipiens, a predominant mosquito species in urban and rural regions in Lebanon, to transmit WNV and RVFV. Culex egg rafts were collected in the West Bekaa district, east of Lebanon and adult females of Cx. pipiens were experimentally infected with WNV and RVFV Clone 13 strain at titers of 1. 6×108 and 1. 33×107 plaque forming units (PFU) /mL, respectively. We estimated viral infection, dissemination and transmission at 3,7, 14 and 19 days post infection (dpi). Results showed that infection was higher for WNV than for RVFV from 3 dpi to 19 dpi. Viral dissemination and transmission started from 3 dpi for WNV; and only from 19 dpi for RVFV. Moreover, Cx. pipiens were able to excrete in saliva a higher number of viral particles of WNV (1028 ± 405 PFU/saliva at 19 dpi) than RVFV (42 PFU/saliva at 19 dpi). Cx. pipiens from Lebanon are efficient experimental vectors of WNV and to a lower extent, RVFV. These findings should stimulate local authorities to establish an active entomological surveillance in addition to animal surveys for both viruses in the country. West Nile virus (WNV) and Rift Valley fever virus (RVFV) are two important emerging mosquito-borne zoonotic agents transmitted by Culex pipiens, a complex of sibling species that includes Cx. pipiens s. s., Cx. quinquefasciatus and possibly Cx. australicus [1,2]. Cx. pipiens s. s. includes two biotypes or subspecies: Cx. pipiens pipiens and Cx. pipiens molestus [1,3]. The first biotype is primarily a bird-feeding mosquito present in temperate areas while Cx. pipiens biotype molestus feeds on mammals (mainly human) and thrives in sewers in temperate and sub-tropical regions [3,4]. Because morphological identification of these biotypes is not possible, they can only be distinguished using molecular techniques [3–5]. WNV is a member of the Flavivirus genus (Flaviviridae family) and was first isolated in Uganda in 1937 [6]. Usually, only 20% of infected individuals develop symptoms and less than 1% of infected people develop serious and potentially fatal neurological illnesses such as meningitis and encephalitis. Birds are considered the main reservoir of the virus and Cx. pipiens is recognized as one of the primary enzootic vector [7]. WNV infections have been reported in many tropical and temperate countries in Africa, Europe, Asia and America. The Middle East and North Africa (MENA) region has been long considered as a WNV-endemic area [8,9]. Locally acquired cases have been recently reported in Israel [10], Greece [11], Turkey [12], and Italy [13]. In addition, evidence of WNV circulation has been reported in Jordan [14] and Egypt [15]. The introduction of WNV into the United States in 1999, which constitutes a turning point in WNV epidemiology, is thought to have originated from Israel following introduction from Africa [16,17]. RVFV belongs to Phlebovirus genus (Bunyaviridae family). It was first identified in Kenya in 1931 [18]. This virus usually affects livestock and causes abortion. The main enzootic vectors belong to the Aedes genus [19]. However, several Culex species, including Cx. pipiens are considered secondary vectors and contribute to the transmission of RVFV to humans [19]. Infected people can be asymptomatic or develop a mild febrile disease. In less than 10% of cases, people may develop more severe symptoms such as encephalitis and hemorrhagic fever. RVFV was responsible for numerous outbreaks among animals and humans in Sub-Saharan Africa [20] up to Mauritania [21] but also in Egypt [22]. In the Middle East, epizootics were reported in Saudi Arabia and Yemen [23]. In Lebanon, Cx. pipiens is a predominant mosquito species besides another vector of arboviruses, Aedes albopictus [24,25]. Cx. pipiens colonizes urban and rural habitats whereas Ae. albopictus is mostly present in the densely populated coastal fringe. Local Ae. albopictus are competent to transmit Chikungunya virus and to a lesser extent, Dengue virus [26]. The vector competence of local populations of Cx. pipiens to transmit WNV and RVFV has never been evaluated. Diseases caused by these two viruses have never been reported in Lebanon. Nevertheless, a serological study conducted in a main hospital in the capital city of Beirut, confirmed the presence of neutralizing WNV antibodies in blood donors [27]. In fact, Lebanon is situated in a WNV-endemic area and located on the flyways of migratory birds with potential introduction of the virus into the country. Moreover, Lebanon is geographically close to Yemen and Saudi Arabia, regions where RVFV had circulated actively. Intensive livestock trade between Lebanon and these countries increases the risk of RVFV introduction. Here, we assess the vector competence of local populations of Cx. pipiens towards WNV and RVFV. We estimate viral infection, dissemination and transmission at different days after experimental infections. Culex egg rafts were sampled in June 2015 in Bab Mareh, in the West Bekaa district, a sub-humid, agricultural area in east of Lebanon with large stagnant water systems (Fig 1). Egg rafts were collected on the water surface in an artificial basin and placed individually in a tube containing 30 mL of water collected from the breeding site. Collected egg rafts were shipped to the Laboratory of Arboviruses and Insect Vectors (AIV) at the Institut Pasteur, Paris. They were reared until the adult stage. Adults emerging from each raft were morphologically identified and only Cx. pipiens species were retained for this study. Two viruses were used in this study: WNV lineage 1 strain isolated from a horse in Camargue (France) in 2000 [9] and an avirulent RVFV strain Clone 13 isolated from a human case in Bangui (Central African Republic) in 1974 [28]. After passages on Vero (E6) cells (ATCC cell lines), both viruses were produced on C6/36 mosquito cells. Viral stocks were stored at -80°C until use. The infectious blood meal was composed of a viral suspension (1: 3) diluted in washed rabbit erythrocytes (New Zealand White rabbit, Charles River) collected at the day of mosquitoes infection. A phagostimulant (ATP) was added at a final concentration of 5 mM. Virus titer in the blood meal was 1. 6×108 plaque forming units (PFU) /mL for WNV and 1. 33×107 PFU/mL for RVFV. The susceptibility of Lebanese Cx. pipiens mosquitoes to WNV and RVFV was tested on F0 and F1 generation respectively. Ten-to-twelve day-old female Cx. pipiens mosquitoes were left to starve for 48 h in Biosafety Level 3 (BSL3) insectary at 28±1°C with 80% relative humidity and a 16h: 8h photoperiod. Females were then allowed to feed for one hour through a chicken skin membrane (obtained from a commercially purchased chicken) covering the base of a capsule of the feeding system (Hemotek) containing the blood-virus mixture maintained at 37°C. Fully engorged females were sorted, then transferred in cardboard containers and maintained with 10% sucrose at 28±1°C until examination. Around 20 female mosquitoes were tested at 3,7, 14 and 19 days post-infection (dpi). For each mosquito, saliva was collected using the forced salivation technique [29]. Briefly, mosquitoes were chilled, their legs and wings removed and the proboscis was inserted into 20 μL tip filled with 5 μL of Fetal Bovine Serum (FBS). After 45 min, medium containing the saliva was expelled into 0. 2 mL tube containing 45 μL of Dulbecco’s MEM (DMEM) medium. Collected saliva and the remaining mosquito bodies were conserved at -80°C for further analysis. In order to assess the ability of both viruses to invade and cross the midgut barrier, the infection rate (IR) and the dissemination efficiency (DE) were determined. IR reflects the proportion of female mosquitoes with infected bodies (thorax and abdomen including the midgut) among tested specimens while DE is the proportion of female mosquitoes with infected head (detection of the virus having succeeded to reach the mosquito general cavity) among tested ones. Thus, heads and bodies were separated and ground each in 300 μL DMEM supplemented with 3% FBS. After centrifugation, the supernatant of each homogenate was conserved at -80°C. Then, 20 μL of each sample were diluted in 180 μL DMEM supplemented with 2% FBS and distributed in serial dilutions from 10−1 to 10−3 in duplicates on Vero cell monolayers (3. 105 cells/well) in 96-well plates. After incubation at 37°C for 6 days, inoculum was removed and the cells were fixed and stained using a crystal violet solution (0. 2% in 10% formaldehyde and 20% ethanol). After washing, the presence or absence of cytopathic effect was noted. The capacity of the WNV and RVFV to cross the salivary glands barrier was evaluated by determining the transmission efficiency (TE) which corresponds to the proportion of female mosquitoes that secrete infectious saliva among tested specimens. The number of infectious particles within collected saliva samples was estimated on Vero cell culture and expressed as PFU/saliva. Briefly, 20 μL of each saliva were diluted in 280 μL DMEM 2% FBS. The total volume was inoculated on a monolayer of Vero cells (8. 105cells/well) in six-well plates. Cells were incubated at 37°C for 6 days under an overlay consisting of DMEM, 2% FBS, 1% antibiotic-antimycotic mix and 1% agarose. The lytic plaques were counted after staining with a crystal violet solution. Proportions (IR, DE and TE) were compared using Fisher’s exact test and sample distributions (number of viral particles) with the Kruskal-Wallis test. Statistical analyses were conducted using the Stata software (StataCorp LP, Texas, and USA). P-values<0. 05 were considered significant. Collected egg rafts were hatched in laboratory conditions and provided 480 adult females of Culex pipiens (F0 generation); of those only 174 (36. 25%) had successfully fed on a WNV-infected blood. A batch of 600 F1 female mosquitoes was used for the RVFV infection assay. Of those, only 91 (15. 16%) had successfully fed on infected blood. Infection rate (IR) for each virus was estimated by determining the number of infected bodies (abdomen and thorax) among all engorged female mosquitoes examined at each dpi (3,7, 14 and 19) (Fig 2A). For WNV, IRs were very high (94. 7–100%) from 3 to 19 dpi. For RVFV, IRs were much lower: at 3 dpi, the IR was 44. 0% and increased gradually to reach 65. 0% at 14 dpi and 64. 3 at 19 dpi. The detection of viral particles in mosquito heads allowed estimating the ability of the virus to disseminate from the midgut to internal organs. For WNV, dissemination efficiency (DE) increased from 31. 6% (3 dpi) to 94. 7% (19 dpi) (Fig 2B). For RVFV, virus was only detected at 19 dpi with a DE of 21. 4% (Fig 2B). The ability of mosquitoes to transmit the virus was measured by detecting viral particles in saliva expectorated by mosquitoes. With WNV, transmission efficiencies were much higher than with RVFV (Fig 2C). TE increased gradually from 10. 5% at 3 dpi to 68. 4% at 19 dpi (Fisher’s exact test: p < 10−4). To note, TE decreased slightly but not significantly from 86. 4% at 14 dpi to 68. 4% at 19 dpi (Fisher’s exact test: p = 0. 17). For RVFV, viral particles were only detected in saliva at 19 dpi with a TE of 7. 1% (Fig 2C). Mosquitoes were able to deliver an average of 550 (±450) PFU/saliva at 3 dpi with WNV, which increased to reach 1004 (±442) PFU/saliva at 7 dpi (Fig 3). Despite a decrease at 14 dpi, the viral load remained high at 19 dpi with 1028 (±405) PFU/saliva. For RVFV, only one female had infectious particles in saliva at 19 dpi with a viral load of 42 PFU (Fig 3). Culex pipiens is the most widely distributed mosquito species in Lebanon and is suspected to transmit WNV and RVFV in several countries [7,19]. Using experimental infections, we showed that Cx. pipiens populations collected from West Bekaa, Lebanon were susceptible to infection by these two viruses and ensured efficient transmission of WNV and to a lesser extent, RVFV. Cx. pipiens was capable to ensure viral infection, dissemination and transmission starting from 3 dpi. Most mosquitoes exposed to the infectious blood-meal were infected as IRs reached 100% at the 4 dpi examined (3,7, 14 and 19 dpi). Dissemination and transmission were slightly lower suggesting that not all infected mosquitoes were able to transmit WNV. Mosquitoes delivered more than 500 viral particles in saliva from 3 dpi. On the other side, infections with RVFV present different patterns: lower IR, DE and TE. Only 21% of mosquitoes were able to ensure viral dissemination at 19 dpi and 7% were able to transmit at 19 dpi. This suggests a significant role of the midgut and the salivary glands as respective barriers to the release of viruses into the body cavity and their excretion in saliva [30]. In this manner, Cx. pipiens was less susceptible to RVFV than to WNV. Overall, Cx. pipiens can transmit experimentally both viruses but the time interval between the ingestion of the viremic blood-meal and the ability to transmit the virus termed the extrinsic incubation period (EIP) was 3 days for WNV. For RVFV, we only found one mosquito able to transmit the virus 19 days after ingestion. It is likely that more females would have been able to transmit the virus if more mosquitoes were able to feed on RVFV-infected blood. Cx. pipiens from Tunisia showed similar EIP of 3 days with WNV and a much shorter EIP of 3 days with RVFV [31] underlining the significant role of mosquito genotype in specific interactions between mosquito and virus genotypes; these interactions promoting adaptation of viral lineages to specific mosquito vector genotypes influence the outcome of transmission [32]. In addition, when viral dose increases in blood meals, transmission efficiency also increases suggesting that hosts presenting a high viremia may infect more mosquitoes [33]. Animals susceptible to RVFV can develop very high viremia, higher than 1010. 1 MIPLD50 (mouse intraperitoneal 50% lethal dose/mL) in lambs [34]. Then, at higher titers of blood meal, RVFV may infect more mosquitoes. In conclusion, the predominant Cx. pipiens mosquito in Lebanon is susceptible to both viruses, WNV and RVFV. As Lebanon is located in a region where WNV and RVFV can be potentially introduced (respectively through migratory birds and animal trades), local health authorities should establish an active surveillance to detect any new human cases in addition to reinforce the entomological surveillance allowing an early viral detection in field-collected mosquitoes. SUMMARY: [/INST] West Nile virus (WNV) and Rift Valley fever virus (RVFV) are two emerging mosquito-borne arboviruses mainly transmitted by Culex mosquitoes. WNV considered one of the most important causative agent of viral encephalitis has a wide distribution in many tropical and temperate countries including the Middle East. RVFV is mainly distributed in Sub-Saharan Africa but epizootics were also reported in Egypt, Saudi Arabia and Yemen. The mosquito vector belongs to the Culex pipiens species which includes two biotypes: pipiens and molestus. Both biotypes are the most widely distributed mosquitoes in Lebanon. Using experimental infections of mosquitoes, our study showed that Cx. pipiens populations collected in West Bekaa were susceptible to infection by these two viruses and ensured efficient transmission of WNV and to a lesser extent, RVFV. Our findings may help to prepare a control strategy more adapted to these mosquito vectors. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: On the morrow, in the evening, Lord Warburton went again to see his friends at their hotel, and at this establishment he learned that they had gone to the opera. He drove to the opera with the idea of paying them a visit in their box after the easy Italian fashion; and when he had obtained his admittance--it was one of the secondary theatres--looked about the large, bare, ill-lighted house. An act had just terminated and he was at liberty to pursue his quest. After scanning two or three tiers of boxes he perceived in one of the largest of these receptacles a lady whom he easily recognised. Miss Archer was seated facing the stage and partly screened by the curtain of the box; and beside her, leaning back in his chair, was Mr. Gilbert Osmond. They appeared to have the place to themselves, and Warburton supposed their companions had taken advantage of the recess to enjoy the relative coolness of the lobby. He stood a while with his eyes on the interesting pair; he asked himself if he should go up and interrupt the harmony. At last he judged that Isabel had seen him, and this accident determined him. There should be no marked holding off. He took his way to the upper regions and on the staircase met Ralph Touchett slowly descending, his hat at the inclination of ennui and his hands where they usually were. "I saw you below a moment since and was going down to you. I feel lonely and want company," was Ralph's greeting. "You've some that's very good which you've yet deserted." "Do you mean my cousin? Oh, she has a visitor and doesn't want me. Then Miss Stackpole and Bantling have gone out to a cafe to eat an ice--Miss Stackpole delights in an ice. I didn't think they wanted me either. The opera's very bad; the women look like laundresses and sing like peacocks. I feel very low." "You had better go home," Lord Warburton said without affectation. "And leave my young lady in this sad place? Ah no, I must watch over her." "She seems to have plenty of friends." "Yes, that's why I must watch," said Ralph with the same large mock-melancholy. "If she doesn't want you it's probable she doesn't want me." "No, you're different. Go to the box and stay there while I walk about." Lord Warburton went to the box, where Isabel's welcome was as to a friend so honourably old that he vaguely asked himself what queer temporal province she was annexing. He exchanged greetings with Mr. Osmond, to whom he had been introduced the day before and who, after he came in, sat blandly apart and silent, as if repudiating competence in the subjects of allusion now probable. It struck her second visitor that Miss Archer had, in operatic conditions, a radiance, even a slight exaltation; as she was, however, at all times a keenly-glancing, quickly-moving, completely animated young woman, he may have been mistaken on this point. Her talk with him moreover pointed to presence of mind; it expressed a kindness so ingenious and deliberate as to indicate that she was in undisturbed possession of her faculties. Poor Lord Warburton had moments of bewilderment. She had discouraged him, formally, as much as a woman could; what business had she then with such arts and such felicities, above all with such tones of reparation--preparation? Her voice had tricks of sweetness, but why play them on HIM? The others came back; the bare, familiar, trivial opera began again. The box was large, and there was room for him to remain if he would sit a little behind and in the dark. He did so for half an hour, while Mr. Osmond remained in front, leaning forward, his elbows on his knees, just behind Isabel. Lord Warburton heard nothing, and from his gloomy corner saw nothing but the clear profile of this young lady defined against the dim illumination of the house. When there was another interval no one moved. Mr. Osmond talked to Isabel, and Lord Warburton kept his corner. He did so but for a short time, however; after which he got up and bade good-night to the ladies. Isabel said nothing to detain him, but it didn't prevent his being puzzled again. Why should she mark so one of his values--quite the wrong one--when she would have nothing to do with another, which was quite the right? He was angry with himself for being puzzled, and then angry for being angry. Verdi's music did little to comfort him, and he left the theatre and walked homeward, without knowing his way, through the tortuous, tragic streets of Rome, where heavier sorrows than his had been carried under the stars. "What's the character of that gentleman?" Osmond asked of Isabel after he had retired. "Irreproachable--don't you see it?" "He owns about half England; that's his character," Henrietta remarked. "That's what they call a free country!" "Ah, he's a great proprietor? Happy man!" said Gilbert Osmond. "Do you call that happiness--the ownership of wretched human beings?" cried Miss Stackpole. "He owns his tenants and has thousands of them. It's pleasant to own something, but inanimate objects are enough for me. I don't insist on flesh and blood and minds and consciences." "It seems to me you own a human being or two," Mr. Bantling suggested jocosely. "I wonder if Warburton orders his tenants about as you do me." "Lord Warburton's a great radical," Isabel said. "He has very advanced opinions." "He has very advanced stone walls. His park's enclosed by a gigantic iron fence, some thirty miles round," Henrietta announced for the information of Mr. Osmond. "I should like him to converse with a few of our Boston radicals." "Don't they approve of iron fences?" asked Mr. Bantling. "Only to shut up wicked conservatives. I always feel as if I were talking to YOU over something with a neat top-finish of broken glass." "Do you know him well, this unreformed reformer?" Osmond went on, questioning Isabel. "Well enough for all the use I have for him." "And how much of a use is that?" "Well, I like to like him." "'Liking to like'--why, it makes a passion!" said Osmond. "No"--she considered--"keep that for liking to DISlike." "Do you wish to provoke me then," Osmond laughed, "to a passion for HIM?" She said nothing for a moment, but then met the light question with a disproportionate gravity. "No, Mr. Osmond; I don't think I should ever dare to provoke you. Lord Warburton, at any rate," she more easily added, "is a very nice man." "Of great ability?" her friend enquired. "Of excellent ability, and as good as he looks." "As good as he's good-looking do you mean? He's very good-looking. How detestably fortunate!--to be a great English magnate, to be clever and handsome into the bargain, and, by way of finishing off, to enjoy your high favour! That's a man I could envy." Isabel considered him with interest. "You seem to me to be always envying some one. Yesterday it was the Pope; to-day it's poor Lord Warburton." "My envy's not dangerous; it wouldn't hurt a mouse. I don't want to destroy the people--I only want to BE them. You see it would destroy only myself." "You'd like to be the Pope?" said Isabel. "I should love it--but I should have gone in for it earlier. But why"--Osmond reverted--"do you speak of your friend as poor?" "Women--when they are very, very good sometimes pity men after they've hurt them; that's their great way of showing kindness," said Ralph, joining in the conversation for the first time and with a cynicism so transparently ingenious as to be virtually innocent. "Pray, have I hurt Lord Warburton?" Isabel asked, raising her eyebrows as if the idea were perfectly fresh. "It serves him right if you have," said Henrietta while the curtain rose for the ballet. Isabel saw no more of her attributive victim for the next twenty-four hours, but on the second day after the visit to the opera she encountered him in the gallery of the Capitol, where he stood before the lion of the collection, the statue of the Dying Gladiator. She had come in with her companions, among whom, on this occasion again, Gilbert Osmond had his place, and the party, having ascended the staircase, entered the first and finest of the rooms. Lord Warburton addressed her alertly enough, but said in a moment that he was leaving the gallery. "And I'm leaving Rome," he added. "I must bid you goodbye." Isabel, inconsequently enough, was now sorry to hear it. This was perhaps because she had ceased to be afraid of his renewing his suit; she was thinking of something else. She was on the point of naming her regret, but she checked herself and simply wished him a happy journey; which made him look at her rather unlightedly. "I'm afraid you'll think me very 'volatile.' I told you the other day I wanted so much to stop." "Oh no; you could easily change your mind." "That's what I have done." "Bon voyage then." "You're in a great hurry to get rid of me," said his lordship quite dismally. "Not in the least. But I hate partings." "You don't care what I do," he went on pitifully. Isabel looked at him a moment. "Ah," she said, "you're not keeping your promise!" He coloured like a boy of fifteen. "If I'm not, then it's because I can't; and that's why I'm going." "Good-bye then." "Good-bye." He lingered still, however. "When shall I see you again?" Isabel hesitated, but soon, as if she had had a happy inspiration: "Some day after you're married." "That will never be. It will be after you are." "That will do as well," she smiled. "Yes, quite as well. Good-bye." They shook hands, and he left her alone in the glorious room, among the shining antique marbles. She sat down in the centre of the circle of these presences, regarding them vaguely, resting her eyes on their beautiful blank faces; listening, as it were, to their eternal silence. It is impossible, in Rome at least, to look long at a great company of Greek sculptures without feeling the effect of their noble quietude; which, as with a high door closed for the ceremony, slowly drops on the spirit the large white mantle of peace. I say in Rome especially, because the Roman air is an exquisite medium for such impressions. The golden sunshine mingles with them, the deep stillness of the past, so vivid yet, though it is nothing but a void full of names, seems to throw a solemn spell upon them. The blinds were partly closed in the windows of the Capitol, and a clear, warm shadow rested on the figures and made them more mildly human. Isabel sat there a long time, under the charm of their motionless grace, wondering to what, of their experience, their absent eyes were open, and how, to our ears, their alien lips would sound. The dark red walls of the room threw them into relief; the polished marble floor reflected their beauty. She had seen them all before, but her enjoyment repeated itself, and it was all the greater because she was glad again, for the time, to be alone. At last, however, her attention lapsed, drawn off by a deeper tide of life. An occasional tourist came in, stopped and stared a moment at the Dying Gladiator, and then passed out of the other door, creaking over the smooth pavement. At the end of half an hour Gilbert Osmond reappeared, apparently in advance of his companions. He strolled toward her slowly, with his hands behind him and his usual enquiring, yet not quite appealing smile. "I'm surprised to find you alone, I thought you had company. "So I have--the best." And she glanced at the Antinous and the Faun. "Do you call them better company than an English peer?" "Ah, my English peer left me some time ago." She got up, speaking with intention a little dryly. Mr. Osmond noted her dryness, which contributed for him to the interest of his question. "I'm afraid that what I heard the other evening is true: you're rather cruel to that nobleman." Isabel looked a moment at the vanquished Gladiator. "It's not true. I'm scrupulously kind." "That's exactly what I mean!" Gilbert Osmond returned, and with such happy hilarity that his joke needs to be explained. We know that he was fond of originals, of rarities, of the superior and the exquisite; and now that he had seen Lord Warburton, whom he thought a very fine example of his race and order, he perceived a new attraction in the idea of taking to himself a young lady who had qualified herself to figure in his collection of choice objects by declining so noble a hand. Gilbert Osmond had a high appreciation of this particular patriciate; not so much for its distinction, which he thought easily surpassable, as for its solid actuality. He had never forgiven his star for not appointing him to an English dukedom, and he could measure the unexpectedness of such conduct as Isabel's. It would be proper that the woman he might marry should have done something of that sort. SUMMARY: [/INST] The next day Lord Warburton goes to the opera, where he knows he will find Isabel and the others. He spots Isabel in a box with Gilbert Osmond and decides to join her. Lord Warburton then glumly watches the two together during the opera. He feels angry and puzzled. Osmond later asks about Lord Warburton. Upon finding out about his character and his fortune, he declares that he would like to be Lord Warburton. Isabel jokes that he is always envying someone, and Osmond responds that his envy is not dangerous. A day later, Lord Warburton abruptly announces that he is leaving Rome, when he encounters them in the gallery of the Capitol. Isabel, then, left alone, in front of the statue of the Dying Gladiator, feeling the vividness of the past. Isabel wonders about these Greek sculptures around her, wondering what they would say if they were alive. After she is sitting alone for half an hour, Gilbert Osmond appears. Osmond notes that Isabel is quite cruel to Lord Warburton. We learn that Osmond, who is very fond of originals, takes a real liking from the idea that Lord Warburton desires Isabel. He likes the idea of taking a "young lady who had qualified herself to figure in his collection of choice objects by declining so noble a hand". In other words, he thinks of Isabel as a collector's object that he will hoard for himself. She has more value now that she has had the original idea of rejecting such an aristocratic figure as Lord Warburton. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: This undated handout photo provided by the US Air Force shows Lt. Gen. James M. Kowalski, the commander of Air Force Global Strike Command, who is responsible for the entire force of 450 Minuteman 3 missiles,... (Associated Press) Air Force officers entrusted with the launch keys to long-range nuclear missiles have been caught twice this year leaving open a blast door that is intended to help prevent a terrorist or other intruder from entering their underground command post, Air Force officials said. The blast doors are never to be left open if one of the crew members inside is asleep _ as was the case in both these instances _ out of concern for the trouble an intruder could cause, including the compromising of secret launch codes. Transgressions such as this are rarely revealed publicly. But officials with direct knowledge of Air Force intercontinental ballistic missile operations told The Associated Press that such violations have occurred, undetected, more times than in the cases of the two launch crew commanders and two deputy commanders who were given administrative punishments this year. The blast door violations are another sign of trouble in the handling of the nation's nuclear arsenal. The AP has discovered a series of problems within the ICBM force, including a failed safety inspection, the temporary sidelining of launch officers deemed unfit for duty and the abrupt firing last week of the two-star general in charge. The problems, including low morale, underscore the challenges of keeping safe such a deadly force that is constantly on alert but is unlikely ever to be used. The crews who operate the missiles are trained to follow rules without fail, including the prohibition against having the blast door open when only one crew member is awake. The officers, known as missileers, are custodians of keys that could launch nuclear hell. The warheads on the business ends of their missiles are capable of a nuclear yield many times that of the U.S. atomic bombs dropped on Japan in 1945. "The only way that you can have a crew member be in `rest status' is if that blast door is shut and there is no possibility of anyone accessing the launch control center," said Lt. Gen. James Kowalski, the commander of Air Force Global Strike Command. He is responsible for the entire force of 450 Minuteman 3 missiles, plus the Air Force's nuclear-capable bombers. The written Air Force instructions on ICBM safety, last updated in June 1996, says, "One crewmember at a time may sleep on duty, but both must be awake and capable of detecting an unauthorized act if... the Launch Control Center blast door is open" or if someone other than the crew is present. The blast door is not the first line of defense. An intruder intent on taking control of a missile command post would face many layers of security before encountering the blast door, which _ when closed _ is secured by 12 hydraulically operated steel pins. The door is at the base of an elevator shaft. Entry to that elevator is controlled from an above-ground building. ICBM fields are monitored with security cameras and patrolled regularly by armed Air Force guards. Each underground launch center, known as a capsule for its pill-like shape, monitors and operates 10 Minuteman 3 missiles. The missiles stand in reinforced concrete silos and are linked to the control center by buried communications cables. The ICBMs are split evenly among "wings" based in North Dakota, Wyoming and Montana. Each wing is divided into three squadrons, each responsible for 50 missiles. In neither of the two reported violations was security of the crews' missiles compromised, the Air Force said in response to questions from the AP, "due to the multiple safeguards and other protections in place." But these were clear-cut violations of what the Air Force calls "weapon system safety rules" meant to be strictly enforced in keeping with the potentially catastrophic consequences of a breach of nuclear security. In the two episodes confirmed by the Air Force, the multiton concrete-and-steel door that seals the entrance to the underground launch control center was deliberately left open while one of two crew members inside napped. One officer lied about a violation but later admitted to it. Sleep breaks are allowed during a 24-hour shift, known as an "alert." But a written rule says the door _ meant to keep others out and to protect the crew from the blast effects of a direct nuclear strike _ must be closed if one is napping. In an extensive interview last week at his headquarters at Barksdale Air Force Base, La., Kowalski declined to say whether he was aware that ICBM launch crew members had violated the blast door rule with some frequency. "I'm not aware of it being any different than it's ever been before," he said. "And if it had happened out there in the past and was tolerated, it is not tolerated now. So my sense of this is, if we know they're doing it they'll be disciplined for it." It is clear that Air Force commanders do, in fact, know these violations are happening. One of the officers punished for a blast door violation in April at the 91st Missile Wing at Minot Air Force Base, N.D., admitted during questioning by superiors to having done it other times without getting caught. Both officers involved in that case were given what the military calls nonjudicial punishment under the Uniform Code of Military Justice, rather than being court-martialed. One was ordered to forfeit $2,246 in pay for two months and received a letter of reprimand, according to Lt. Col. John Sheets, spokesman for Air Force Global Strike Command. The other launch officer, who admitted to having committed the same violation "a few" times previously, was given a letter of admonishment, Sheets said. Kowalski said the crews know better. "This is not a training problem," he said. "This is some people out there are having a problem with discipline." The other confirmed blast door violation happened in May at Malmstrom Air Force Base, Mont. In that case, a person who entered the capsule to do maintenance work realized that the deputy crew commander was asleep with the door open and reported the violation to superiors. Upon questioning, the deputy crew commander initially denied the accusation but later confessed and said her crew commander had encouraged her to lie, Sheets said. The crew commander was ordered to forfeit $3,045 in pay for two months, Sheets said, and also faces an Air Force discharge board, which could force him out of the service. The deputy crew commander was given a letter of reprimand. A letter of reprimand does not require the officer to leave the service but usually is a significant obstacle to promotion and could mean an early end to his or her career. The AP was tipped off to the Malmstrom episode shortly after it took place by an official who felt strongly that it should be made public and that it reflected a more deeply rooted disciplinary problem inside the ICBM force. The AP learned of the Minot violation through an internal Air Force email. The AP confirmed both incidents with several other Air Force officials. Sheets said the Minot and Malmstrom violations were the only blast door disciplinary cases in at least two years. The willingness of some launch officers to leave the blast door open at times reflects a mindset far removed from Cold War days when the U.S. lived in fear of a nuclear strike by the Soviet Union. It was that fear that provided the original rationale for placing ICBMs in reinforced underground silos and the launch control officers in buried capsules _ so that in the event of an attack the officers might survive to launch a counterattack. Today the fear of such an attack has all but disappeared and, with it, the appeal of strictly following the blast door rule. Bruce Blair, who served as an ICBM launch control officer in the 1970s and is an advocate for phasing out the ICBM force, said violations should be taken seriously. "This transgression might help enable outsiders to gain access to the launch center and to its super-secret codes," said Blair, who is now a research scholar at Princeton University. That would increase the risk of unauthorized launch or of compromising codes that might consequently have to be invalidated in order to prevent unauthorized launches, he said. "Such invalidation might effectively neutralize for an extended period of time the entire U.S. strategic nuclear arsenal and the president's ability to launch strategic forces while the Pentagon scrambles to reissue new codes," he added. ___ Follow Robert Burns on Twitter at http://www.twitter.com/robertburnsAP The careers of four Air Force officers who held the keys and codes to launching nuclear missiles are likely over after they were severely reprimanded for leaving blast doors open on their underground launch capsules, Air Force officials told NBC News on Tuesday. The two incidents occurred earlier this year at Minot Air Force Base in North Dakota and Malmstrom Air Force Base near Great Falls, Mont., the officials said. The officers involved weren't identified in the incidents, which were first reported Tuesday by The Associated Press. Security wasn't breached in the incidents, The AP reported. But while the violations weren't criminal, the reprimands are considered "career-ending," Air Force officials told NBC News. These are merely the most recent in a long string of security and safety violations involving the Air Force's stewardship of nuclear missiles, especially at the Minot base — one of the most critical in the U.S. nuclear structure. In May, NBC News reported that 17 officers were suspended and disqualified from controlling nuclear missiles at Minot after a safety inspection earned a grade of "D." In August 2007, six cruise missiles loaded with W80-1 nuclear warheads were flown from Minot to Barksdale Air Force Base in Louisiana before authorities discovered that the warheads hadn't been removed for safety, as required. In a review of the incident in February 2008 (.pdf), the Defense Advisory Board blamed "process and systemic problems" at Minot that had "developed over more than a decade and have the potential for much more serious consequences." Just five months later, three Air Force officers fell asleep at the controls of a component that contained old launch codes for nuclear ICBMs at Minot. They were immediately barred from working with classified and nuclear materials and were later discharged from the service. In the newest incidents, the two-man launch crews at Minot and Malmstrom violated regulations that require heavy steel blast doors to be closed and locked when one of the crew members is sleeping. Even though the tightly packed and cramped launch capsules are deep underground — and guarded by heavy security on the surface — the rule is strictly enforced. The blast doors could be a way for someone to gain access to command posts for nuclear sites housing 10 Minuteman-3 missiles, Air Force officials said. The AP reported that in both incidents, the concrete and steel doors were deliberately left open while one of two crew members inside slept. One of the officers lied about a violation but later admitted to it, according to The AP. Watch the most-viewed videos on NBCNews.com SUMMARY: [/INST] It's reassuring to know the people entrusted with the launch keys to our nuclear missiles are at least well rested-if not well secured. US Air Force officers in charge of these keys have been caught twice this year napping while leaving the blast door to their underground launch center open, the AP reports. The door is far from the only line of defense between a terrorist and the 10 Minuteman 3 missiles housed within-the bunkers are underground and guarded by many layers of security. And one of the two officers on duty is actually allowed to catch some Zs while on a 24-hour shift. But doing so with the blast door open is still a big no-no. "The only way that you can have a crew member be in'rest status' is if that blast door is shut and there is no possibility of anyone accessing the launch control center," says Lt. Gen. James Kowalski, who is in charge of all 450 of our Minuteman 3 missiles. The four officers caught have all been reprimanded-two had to forfeit pay, and all received letters of reprimand. One is facing the discharge board. The letters may sound like a slap on the wrist, but Air Force officials tell NBC News that they are considered "career-ending." "This is not a training problem," says Kowalski, per the AP. "This is some people out there are having a problem with discipline." The transgressions occurred at two bases: Montana's Malmstrom Air Force Base and the problem-ridden Minot Air Force Base in North Dakota. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: THE ENCANTADAS; OR, ENCHANTED ISLES. SKETCH FIRST. THE ISLES AT LARGE. --"That may not be, said then the ferryman, Least we unweeting hap to be fordonne; For those same islands seeming now and than, Are not firme land, nor any certein wonne, But stragling plots which to and fro do ronne In the wide waters; therefore are they hight The Wandering Islands; therefore do them shonne; For they have oft drawne many a wandring wight Into most deadly daunger and distressed plight; For whosoever once hath fastened His foot thereon may never it secure But wandreth evermore uncertein and unsure." * * * * * "Darke, dolefull, dreary, like a greedy grave, That still for carrion carcasses doth crave; On top whereof ay dwelt the ghastly owl, Shrieking his balefull note, which ever drave Far from that haunt all other cheerful fowl, And all about it wandring ghosts did wayle and howl." Take five-and-twenty heaps of cinders dumped here and there in an outside city lot; imagine some of them magnified into mountains, and the vacant lot the sea; and you will have a fit idea of the general aspect of the Encantadas, or Enchanted Isles. A group rather of extinct volcanoes than of isles; looking much as the world at large might, after a penal conflagration. It is to be doubted whether any spot of earth can, in desolateness, furnish a parallel to this group. Abandoned cemeteries of long ago, old cities by piecemeal tumbling to their ruin, these are melancholy enough; but, like all else which has but once been associated with humanity, they still awaken in us some thoughts of sympathy, however sad. Hence, even the Dead Sea, along with whatever other emotions it may at times inspire, does not fail to touch in the pilgrim some of his less unpleasurable feelings. And as for solitariness; the great forests of the north, the expanses of unnavigated waters, the Greenland ice-fields, are the profoundest of solitudes to a human observer; still the magic of their changeable tides and seasons mitigates their terror; because, though unvisited by men, those forests are visited by the May; the remotest seas reflect familiar stars even as Lake Erie does; and in the clear air of a fine Polar day, the irradiated, azure ice shows beautifully as malachite. But the special curse, as one may call it, of the Encantadas, that which exalts them in desolation above Idumea and the Pole, is, that to them change never comes; neither the change of seasons nor of sorrows. Cut by the Equator, they know not autumn, and they know not spring; while already reduced to the lees of fire, ruin itself can work little more upon them. The showers refresh the deserts; but in these isles, rain never falls. Like split Syrian gourds left withering in the sun, they are cracked by an everlasting drought beneath a torrid sky. "Have mercy upon me," the wailing spirit of the Encantadas seems to cry, "and send Lazarus that he may dip the tip of his finger in water and cool my tongue, for I am tormented in this flame." Another feature in these isles is their emphatic uninhabitableness. It is deemed a fit type of all-forsaken overthrow, that the jackal should den in the wastes of weedy Babylon; but the Encantadas refuse to harbor even the outcasts of the beasts. Man and wolf alike disown them. Little but reptile life is here found: tortoises, lizards, immense spiders, snakes, and that strangest anomaly of outlandish nature, the _aguano_. No voice, no low, no howl is heard; the chief sound of life here is a hiss. On most of the isles where vegetation is found at all, it is more ungrateful than the blankness of Aracama. Tangled thickets of wiry bushes, without fruit and without a name, springing up among deep fissures of calcined rock, and treacherously masking them; or a parched growth of distorted cactus trees. In many places the coast is rock-bound, or, more properly, clinker-bound; tumbled masses of blackish or greenish stuff like the dross of an iron-furnace, forming dark clefts and caves here and there, into which a ceaseless sea pours a fury of foam; overhanging them with a swirl of gray, haggard mist, amidst which sail screaming flights of unearthly birds heightening the dismal din. However calm the sea without, there is no rest for these swells and those rocks; they lash and are lashed, even when the outer ocean is most at peace with, itself. On the oppressive, clouded days, such as are peculiar to this part of the watery Equator, the dark, vitrified masses, many of which raise themselves among white whirlpools and breakers in detached and perilous places off the shore, present a most Plutonian sight. In no world but a fallen one could such lands exist. Those parts of the strand free from the marks of fire, stretch away in wide level beaches of multitudinous dead shells, with here and there decayed bits of sugar-cane, bamboos, and cocoanuts, washed upon this other and darker world from the charming palm isles to the westward and southward; all the way from Paradise to Tartarus; while mixed with the relics of distant beauty you will sometimes see fragments of charred wood and mouldering ribs of wrecks. Neither will any one be surprised at meeting these last, after observing the conflicting currents which eddy throughout nearly all the wide channels of the entire group. The capriciousness of the tides of air sympathizes with those of the sea. Nowhere is the wind so light, baffling, and every way unreliable, and so given to perplexing calms, as at the Encantadas. Nigh a month has been spent by a ship going from one isle to another, though but ninety miles between; for owing to the force of the current, the boats employed to tow barely suffice to keep the craft from sweeping upon the cliffs, but do nothing towards accelerating her voyage. Sometimes it is impossible for a vessel from afar to fetch up with the group itself, unless large allowances for prospective lee-way have been made ere its coming in sight. And yet, at other times, there is a mysterious indraft, which irresistibly draws a passing vessel among the isles, though not bound to them. True, at one period, as to some extent at the present day, large fleets of whalemen cruised for spermaceti upon what some seamen call the Enchanted Ground. But this, as in due place will be described, was off the great outer isle of Albemarle, away from the intricacies of the smaller isles, where there is plenty of sea-room; and hence, to that vicinity, the above remarks do not altogether apply; though even there the current runs at times with singular force, shifting, too, with as singular a caprice. Indeed, there are seasons when currents quite unaccountable prevail for a great distance round about the total group, and are so strong and irregular as to change a vessel's course against the helm, though sailing at the rate of four or five miles the hour. The difference in the reckonings of navigators, produced by these causes, along with the light and variable winds, long nourished a persuasion, that there existed two distinct clusters of isles in the parallel of the Encantadas, about a hundred leagues apart. Such was the idea of their earlier visitors, the Buccaneers; and as late as 1750, the charts of that part of the Pacific accorded with the strange delusion. And this apparent fleetingness and unreality of the locality of the isles was most probably one reason for the Spaniards calling them the Encantada, or Enchanted Group. But not uninfluenced by their character, as they now confessedly exist, the modern voyager will be inclined to fancy that the bestowal of this name might have in part originated in that air of spell-bound desertness which so significantly invests the isles. Nothing can better suggest the aspect of once living things malignly crumbled from ruddiness into ashes. Apples of Sodom, after touching, seem these isles. However wavering their place may seem by reason of the currents, they themselves, at least to one upon the shore, appear invariably the same: fixed, cast, glued into the very body of cadaverous death. Nor would the appellation, enchanted, seem misapplied in still another sense. For concerning the peculiar reptile inhabitant of these wilds--whose presence gives the group its second Spanish name, Gallipagos--concerning the tortoises found here, most mariners have long cherished a superstition, not more frightful than grotesque. They earnestly believe that all wicked sea-officers, more especially commodores and captains, are at death (and, in some cases, before death) transformed into tortoises; thenceforth dwelling upon these hot aridities, sole solitary lords of Asphaltum. Doubtless, so quaintly dolorous a thought was originally inspired by the woe-begone landscape itself; but more particularly, perhaps, by the tortoises. For, apart from their strictly physical features, there is something strangely self-condemned in the appearance of these creatures. Lasting sorrow and penal hopelessness are in no animal form so suppliantly expressed as in theirs; while the thought of their wonderful longevity does not fail to enhance the impression. Nor even at the risk of meriting the charge of absurdly believing in enchantments, can I restrain the admission that sometimes, even now, when leaving the crowded city to wander out July and August among the Adirondack Mountains, far from the influences of towns and proportionally nigh to the mysterious ones of nature; when at such times I sit me down in the mossy head of some deep-wooded gorge, surrounded by prostrate trunks of blasted pines and recall, as in a dream, my other and far-distant rovings in the baked heart of the charmed isles; and remember the sudden glimpses of dusky shells, and long languid necks protruded from the leafless thickets; and again have beheld the vitreous inland rocks worn down and grooved into deep ruts by ages and ages of the slow draggings of tortoises in quest of pools of scanty water; I can hardly resist the feeling that in my time I have indeed slept upon evilly enchanted ground. Nay, such is the vividness of my memory, or the magic of my fancy, that I know not whether I am not the occasional victim of optical delusion concerning the Gallipagos. For, often in scenes of social merriment, and especially at revels held by candle-light in old-fashioned mansions, so that shadows are thrown into the further recesses of an angular and spacious room, making them put on a look of haunted undergrowth of lonely woods, I have drawn the attention of my comrades by my fixed gaze and sudden change of air, as I have seemed to see, slowly emerging from those imagined solitudes, and heavily crawling along the floor, the ghost of a gigantic tortoise, with "Memento * * * * " burning in live letters upon his back. * * * * SUMMARY: [/INST] The story starts off with a quote from Edmund Spenser's The Faerie Queene about dangerous islands that are dark, doleful, dreary, and other things beginning with "d". The story proper begins with a discussion of the Enchanted Isles, or Encantadas, known in English as the Galapagos. The islands were made by volcanos, and they are...well, dark, doleful and dreary, Shmoop supposes. Melville says the islands are even more awful and desolate than other isolated places, because they're at the equator, where nothing changes. There aren't even jackals on the Galapagos; that's how forlorn it is. There are just reptiles. It's all volcanic rock and wasteland. Not a vacation spot The ocean currents are nasty too, which makes it hard to get from island to island. There's a superstition that reptiles are transformed wicked sea-officers. Would being a turtle really be so bad? Turtles seem pretty content, really.... That is Shmoop's opinion there. Melville thinks turtles look sad. Melville says sometimes now at home he imagines himself back in those brutal islands. This is sort of like "The Piazza," but with turtles instead of Marianna. The turtles work better. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: WASHINGTON (AP) — It looks like President Donald Trump is getting the military parade he wants in Washington — though he may have to settle for no tanks. A Pentagon memo released Friday says the parade will only include wheeled vehicles to minimize damage to District of Columbia streets. But it will end with a "heavy air component," meaning lots of airplanes flying overhead. The memo from the office of Defense Secretary Jim Mattis offers initial guidance to the chairman of the Joint Chiefs of Staff, which will stage the parade. The event is being planned for Nov. 11, Veterans Day, along a route from the White House to the Capitol. Trump decided he wanted to have a military parade in Washington after he attended France's Bastille Day celebration last year in Paris. Washington (CNN) President Donald Trump will get his military parade, but it is unlikely to mirror the Paris Bastille Day event which inspired him as it will not involve any heavy military vehicles like tanks to avoid doing damage to the streets of Washington, according to a Pentagon planning memo shown to CNN. The Pentagon memo sent to the chairman of the Joint Chiefs of Staff was issued on Thursday and outlined the initial guidance on how Trump's sought after parade, scheduled for November 11 -- Veterans Day -- will look. The memo says the parade will integrate with the annual DC Veterans Day parade and focus on the contributions of US veterans from the Revolutionary War to today "with an emphasis on the price of freedom." The parade will "include wheeled vehicles only, no tanks," the memo said, adding that "consideration must be given to minimize damage to local infrastructure." It will, however, involve "a heavy air component" with military aircraft flying overhead at the end of parade, including older aircraft "as available," the memo said. Read More SUMMARY: [/INST] It looks like President Donald Trump is getting the military parade he wants in Washington-though he may have to settle for no tanks, the AP reports. A Pentagon memo released Friday says the parade will only include wheeled vehicles to minimize damage to District of Columbia streets. But it will end with a "heavy air component," meaning lots of airplanes flying overhead. The event will also include the Old Guard Fife and Drum, a unit that specializes in period uniforms, CNN reports. The memo from the office of Defense Secretary Jim Mattis offers initial guidance to the chairman of the Joint Chiefs of Staff, which will stage the parade. The event is being planned for Nov. 11, Veterans Day, along a route from the White House to the Capitol. Trump decided he wanted to have a military parade in Washington after he attended France's Bastille Day celebration last year in Paris. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: According to my source, this producer went on to sue the production for misconduct over what she witnessed between DeMario and Corinne. From this point forward, things turned into "soft core porn." They did not have sex. But it was very raunchy. The fourth season of the 'Bachelor' spinoff was being filmed for a summer air date. ABC has halted filming on the upcoming new season of Bachelor in Paradise. "We have become aware of allegations of misconduct on the set of Bachelor in Paradise in Mexico," Warner Bros. said Sunday in a statement. "We have suspended production and we are conducting a thorough investigation of these allegations. Once the investigation is complete, we will take appropriate responsive action.” The fourth season of the ABC reality series had recently begun filming and is slated to premiere Aug. 8. The summer series reunites former castoffs of The Bachelor and The Bachelorette at a resort in Sayulita, Mexico, in hopes they find love with other stars of the franchise. ABC had announced the first round of the Bachelor in Paradise cast last week. The 16 men and women who had begun filming included two runner-ups from previous seasons, two returning Bachelor in Paradise stars and four villains, including Corinne Olympios from Nick Viall's season of The Bachelor and DeMario Jackson, a recent castoff of Rachel Lindsay's The Bachelorette. Blogger Reality Steve (Steve Carbone) posted a photo of many of the show's stars that was snapped by a fan at the airport in Puerto Vallarta, saying the cast was being told only that they were being flown to Houston. Here's most of the cast at the airport an hour ago. Being told they're being flown to Houston. Still don't know what's going on pic.twitter.com/eNgGp0tyZ1 — RealitySteve (@RealitySteve) June 11, 2017 Carbone, who has long posted spoilers about the show, initially named two contestants who were reportedly involved in the incident but later deleted the tweets after media coverage indicated that a crime may have been committed. Though the initial cast list has been announced, more familiar franchise faces were set to join the Chris Harrison-hosted spinoff and would be announced at a later date. The cast of BIP shuffles each week, with a handful of contestants joining the dating competition throughout to shake up existing relationships and form new ones. Last year's cycle ended with three engagements, though only one couple (Carly Waddell and Evan Bass) is still set to walk down the aisle. Most of the cast has yet to comment, save for contestant Robby Hayes who took to Twitter on Monday to say, "What happens in paradise, stays in paradise. #NoComment #BIP4." On June 3, Bachelor creator Mike Fleiss announced that filming on the season had begun by posting a picture of Harrison on set in Mexico, along with a photo of the show's resident bartender, Jorge. The Bachelorette, which is currently airing, returns next week and won't be new Monday due to the ongoing NBA Finals. See the full list of Bachelor in Paradise season-four castmembers below. Rachel Lindsay's season of The Bachelorette: DeMario Jackson *Jack Stone (ABC hasn't announced Stone, who is currently competing on Bachelorette. But he is shown in the above photo.) Nick Viall's season of The Bachelor: Raven Gates Corinne Olympios Alexis Waters Kristina Schulman Danielle Maltby Jasmine Goode Lacey Mark Taylor Nolan JoJo Fletcher's season of The Bachelorette: Derek Peth Nick “St. Nick” Benvenutti Robby Hayes Alex Woytkiw Vinny Ventiera Ben Higgins' season of The Bachelor: Amanda Stanton Kaitlyn Bristowe's season of The Bachelorette: Ben Zorn Bachelor in Paradise has abruptly halted production in Mexico, E! News can exclusively report. On Sunday, Warner Bros. released a statement, "We have become aware of allegations of misconduct on the set of Bachelor in Paradise in Mexico. We have suspended production and we are conducting a thorough investigation of these allegations. Once the investigation is complete, we will take appropriate responsive action." A source tells E! News that production has been suspended "indefinitely." Another source tells E! News that some contestants are already home and that they got home yesterday. The source also added that the situation is quite serious and that the production isn't just suspended, that it's totally done for this season and possibly forever. Previously, the filming for Bachelor in Paradise season four, which announced its full cast earlier this week, had been in full swing. The ABC reality hit was slated to premiere on Tuesday, Aug. 8. Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more SUMMARY: [/INST] Trouble in paradise: Warner Bros. on Sunday announced it has suspended production on season four of Bachelor in Paradise following "allegations of misconduct on the set." The Bachelor spinoff was filming in Mexico ahead of an Aug. 8 premiere date, and Warner Bros. had little more to add than the following: "We have suspended production and we are conducting a thorough investigation of these allegations. Once the investigation is complete, we will take appropriate responsive action." For the uninitiated, the Hollywood Reporter explains the ABC show pulls together castmembers from the Bachelor and Bachelorette who didn't end up with the final rose, in hopes that sparks will fly. According to TMZ's sources, the incident involved sexual activity in a swimming pool between two "villains" from previous seasons: Corinne Olympios and DeMario Jackson. It says there are "different versions" of what happened and outlines one (it's fairly graphic; you can read it here). ET reports by way of a source that a "third party"-apparently a producer- "felt uncomfortable, claiming misconduct in the workplace." Los Angeles Times reporter Amy Kaufman tweeted the producer sued over what she saw, which a source tells Kaufman was "soft-core porn" but didn't involve sex. According to E!'s source, this isn't just a suspension of production: The season is kaput. Infamous Bachelor spoiler Reality Steve said much the same, tweeting, "Certainly doesn't look like BIP is happening." </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Story highlights A new poll shows Republicans want Newt Gingrich and Ron Paul to drop out The poll indicates Gingrich supporters back Mitt Romney as their second choice Romney has a 2-to-1 lead in delegates over Rick Santorum Gingrich, Paul and Santorum say they will stay in the race With calls increasing for some or all of them to drop out, challengers to Republican presidential front-runner Mitt Romney say they intend to keep battling until the nomination gets settled. A CNN/ORC International poll released Tuesday indicated that most Republicans would like to see former House Speaker Newt Gingrich and Texas Rep. Ron Paul end their bids, but they also want conservative challenger Rick Santorum to stay in the race. The poll, conducted over the weekend, showed that about six in 10 Republicans want Gingrich and Paul to halt their campaigns, while a similar number supported Santorum continuing his bid. According to CNN's latest estimate, Romney has secured 569 delegates and needs 575 more to reach the 1,144 required to clinch the GOP nomination. Santorum, the former Pennsylvania senator, has 262 delegates, with Gingrich at 136 and Paul at 71. Despite the long odds, none of the three trailing candidates appears close to giving up. Santorum challenged the delegate math, telling CNN's Wolf Blitzer on Monday that the Republican race was likely to continue until the party's national convention in August in Florida. JUST WATCHED Santorum bashes Obama over whispering Replay More Videos... MUST WATCH Santorum bashes Obama over whispering 00:50 JUST WATCHED Romney: Alarmed by Obama open mic gaffe Replay More Videos... MUST WATCH Romney: Alarmed by Obama open mic gaffe 03:41 JUST WATCHED Ron Paul: Too soon to write people off Replay More Videos... MUST WATCH Ron Paul: Too soon to write people off 02:06 "There may be someone with what they say are enough delegates, but as you also know, Wolf, a huge number of delegates are uncommitted," Santorum said. "They may be for me, or they may be for Mitt, but they're technically uncommitted, and therefore you can't put them in your column." Gingrich said Tuesday that he would drop out if Romney, the former Massachusetts governor, reaches the 1,144-delegate threshold to claim the nomination. However, Gingrich added he doubted that would happen before the convention. "Gov. Romney is the front-runner but is a long way from a majority," Gingrich said at Maryland's capitol building in Annapolis. "If (Romney) does get, by the time Utah votes on the 26th of June, if he gets a majority, obviously I will support him and will be delighted to do anything I can to help defeat Barack Obama." Otherwise, Gingrich said, a failure by Romney to secure the nomination in the primaries would bring "one of the most interesting open conventions in American history." "It'll be a 60-day dialogue on television, radio, the Internet all the way up to Tampa," Gingrich said. "And the question will be asked: Who can best beat Barack Obama? And at that point, I think, most Republicans agree that I would probably do a better job debating Obama than any other candidate. And I think it becomes a very viable, very lively campaign." Paul also sounded committed to staying in the race, telling CNN's "Piers Morgan Tonight" on Monday that "it's way too soon for you to write anybody off." "Why should we just throw in the towel because people like you say, 'Hey, throw in the towel'? " Paul asked. According to the new poll, 36% of Republicans support Romney for the nomination, and 26% back Santorum. It was a different story in February, when the two men were effectively tied in CNN's last national survey, with Santorum at 34% and Romney at 32%. The survey seemed to dispel the commonly held notion that Gingrich and Santorum were vying for conservative support against the more moderate Romney. According to the poll, most of Gingrich's supporters said Romney was their second choice, rather than Santorum. "If you recalculate the GOP horse race using the Gingrich voters' second choice, Romney's lead over Santorum grows to 15 percentage points -- 45% for Romney and 30% for Santorum -- compared to the 10-point margin Romney currently has in the four-man field," CNN Polling Director Keating Holland said. The primary calendar resumes April 3 with contests in Wisconsin, Maryland and the District of Columbia. A three-week break follows until April 24, when New York, Pennsylvania, Delaware, Connecticut and Rhode Island vote. Those contests in more moderate states in the Northeast, Mid Atlantic and Midwest appear to favor Romney over Santorum, with the possible exception of Pennsylvania, which Santorum represented in Congress for nearly two decades. On Tuesday, a week before the Wisconsin primary, a new poll by the Marquette Law School showed Romney leading Santorum, with Paul and Gingrich well back in the contest for 42 delegates. Amid a series of self-inflicted campaign blunders, Republican presidential upstart Rick Santorum’s huge lead in Pennsylvania has evaporated, according to a new Franklin & Marshall University poll. Santorum enjoyed a 29-point lead over Mitt Romney in February’s F&M poll. The lead has dwindled to a two-point advantage in March. The staggering reversal comes with Romney yet to spend any time or money in the commonwealth. It sets the stage for a highly contested April 24 state Republican primary. The poll, conducted from March 20 through Sunday, found that native son Santorum’s support among likely Republican voters fell from 45 percent to 30 percent since February. In the same time, Romney’s appeal grew from 16 percent to 28 percent. Franklin & Marshall pollster G. Terry Madonna said the dramatic shift is largely down to Santorum himself. “He was leading a month ago when he was on message, talking about the economy and foreign policy,” Madonna said. “But his forays into cultural and social issues have certainly cost him support. It’s been provocatively off message.” The F&M poll surveyed 505 registered Republicans. The survey has a margin of error of 4.2 percentage points. U.S. Rep. Ron Paul of Texas and former House Speaker Newt Gingrich stayed in single digits in the new poll. Gingrich, who was born in Harrisburg and raised in Hummelstown, finished fourth. The poll also found that a significant number of Pennsylvania Republicans backing Romney are tiring of the combative GOP nomination race. Some 18 percent of the former Massachusetts’ governor’s supporters might vote against the Republican nominee in November if the nominee is not Romney, according to the poll. “The longer this goes on, the more and more Republicans are saying this has to end,” Madonna said. “In 2008, this ideological divide didn’t exist between [Democratic nomination rivals Hillary Rodham Clinton and Barack Obama] and it wasn’t as bitter and divisive. This [2012 race] has gotten personal.” Santorum confidants struggled to explain the drop. “It’s hard to imagine without any real campaigning going on in the state that you could have that dramatic a switch,” said state Sen. Jake Corman, R-Centre County, a Santorum ally. “It will be close when all the [GOP] establishment and money pours in for Romney. That’ll make it a bigger hurdle, but we’re confident he’ll be able to carry his home state.” In recent weeks, Santorum’s campaign has faltered from a pox of damaging statements. Campaigning in Puerto Rico two weeks ago, he told voters in the Spanish-speaking U.S. territory that officially adopting English should be a pre-condition of statehood. Santorum followed that misstep last week in Illinois by appearing insensitive to the nation’s jobless. “I don’t care what the unemployment rate is going to be,” he said. “It doesn’t matter to me. My campaign doesn’t hinge on unemployment rates and growth rates. It’s something more foundational that’s going on.” And 48 hours later, Santorum drew widespread condemnation from within his own party after telling Texas Republicans, “We might as well stay with what we have instead of taking a risk with” Romney. He lost Puerto Rico and Illinois. Texas votes May 29. Santorum’s comments and subsequent losses feed into the common critique that his combative, hard-right ideology makes him a general-election pariah. And a verbal altercation with a New York Times reporter on Sunday didn’t help dispel the growing caricature. The Romney campaign has used the incident to add to the portrait of an irritable candidate panicking in the final stages of the campaign. “Rick Santorum is becoming more desperate and angry and unhinged every day,” Romney campaign spokesman Ryan Williams said. Romney himself was a bit less disparaging. “I’m not going to worry about what Rick is saying these days,” Romney told CNN. “I know that when you fall further and further behind, you get a little more animated.” Santorum was less animated Saturday when he contritely addressed the Pennsylvania Leadership Conference, an annual gathering of commonwealth conservative activists. Having represented Pennsylvania in Congress for 24 years before he was soundly defeated in 2006, Santorum indirectly acknowledged that he brought about his ouster by supporting Republican-turned-Democrat Arlen Specter in 2004. “It was a real eye-opening, awakening experience for me, and I took that as a good bit of self-correction,” he said. The measured, hat-in-hand appeal bore episodic fruit. Santorum won the PLC straw poll, drawing 45 percent to Romney’s 28 percent. Paul, who grew up in Pittsburgh and attended Gettysburg College, won 16 percent. Despite addressing the PLC in person, Gingrich finished last with 10 percent. Even with the straw poll results, the tempered applause directed toward Santorum at the conference suggests that the politically compatible PLC crowd had not forgiven his 2004 transgression. Wednesday’s Franklin & Marshall poll confirms that Santorum faces an uphill climb to win back some conservatives. Complicating matters is the likelihood that even if he takes the Pennsylvania primary in a landslide, he’ll leave with a pittance of delegates. Pennsylvania’s GOP primary voters select delegates by their own name in each congressional district. But the delegate candidates are not directly identified with any presidential candidate on the ballot. In that setup, voters are more likely to select a delegate they know, or the first person listed. Gingrich and Romney have prominently placed delegates all over the state. “Pennsylvania is not as important to Romney as it is obviously to Santorum,” said Alan Novak, a Romney supporter and former Pennsylvania GOP chairman. But because of his superior delegate ballot placement, “Romney can end up with as many or more delegates out of Pennsylvania.” The new Franklin & Marshall poll will be seen as an open invitation for the Romney forces to press their monetary and organizational advantage, beat Santorum in his own state, and eliminate him from the race once and for all. SUMMARY: [/INST] Most Republicans believe there are two too many candidates still seeking their party's nomination, according to the latest CNN poll. The poll found that roughly 60% of the GOP want Newt Gingrich and Ron Paul to call it a day, while a similar proportion want Rick Santorum to stick around. But neither Gingrich nor Paul appear likely to drop out: Gingrich has big plans for the Republican National Convention and when Piers Morgan asked Ron Paul about dropping out, the Texan told him not to "pester me with silly questions." But even though most Republicans want Santorum to stay in the race, it looks like he has a tough few weeks ahead of him. The CNN poll gave Romney a 10-point lead over Santorum, 36% to 26%, and most of the states voting in April appear likely to hand more victories to Romney. The one exception was Pennsylvania, which votes April 24, but the latest poll there found that Santorum's lead has shrunk from 29 points in February to just two points. The pollsters blame Santorum's "forays into cultural and social issues" for the drop, the Patriot-News notes. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: A major oil spill in the region would have covered up to 750km of beaches and disrupted whale migration, reveal government documents BP tried to suppress By Karl Mathiesen BP’s plans to drill for oil in the Great Australian Bight were controversial from the outset. Even more so after the regulator twice rejected its environmental safety plan. For the first time, Climate Home News can reveal why. Government documents have been released under freedom of information laws, nearly two years after they were requested. BP had tried to suppress the information. A major oil spill in the sensitive seascape would pollute up to 750km of beaches and shoreline, according to BP’s own modelling, and the company thought drilling may disrupt migration of the endangered southern right whale. Two letters from the National Offshore Petroleum Safety and Environmental Management Authority (Nopsema) to BP in 2015 and 2016 show BP had failed to address the regulator’s concerns about managing these risks. The details suggest it will be costly for any oil company to drill the area in an environmentally responsible way. BP withdrew its plans to drill in October 2016, citing better options for investment. But the company said the Bight remained a prospect and still owns two of the four offshore leases that were subject to the original plans. The other two leases were passed from BP to Statoil last year and the Norwegian firm, which was a partner in BP’s initial project, intends to drill an exploratory well in one of them by October 2019. But the Nopsema letters show any oil company seeking to drill that wild and remote corner of the Southern Ocean will face serious regulatory hurdles. “Given the plan was never finalised, this material doesn’t represent the final views of BP or the regulator,” a spokesperson from BP said, adding that BP had no plans to reactivate its interest in the Bight. Chevron has also since dropped its own plans for the area. In 2016, BP released modelling showing a spill could hit land as far away as New South Wales. The letters revealed that BP’s “worst case shoreline oiling scenario predicts oiling of 650km coastline [sic] at 125 days after the spill, increasing to 750km after 300 days”. Nopsema had raised concerns over BP’s ability to mobilise the people and equipment needed to clean-up such a vast expanse of coast. According to Nopsema’s letters, crew on BP’s seismic survey saw migrating southern right whales and feeding sperm whales “on a number of occasions”. The oil company’s environment plan concluded whales may be exposed to underwater sound “at levels within the behavioural disturbance range”. BP had not evaluated the potential ecological consequences of the exposure. For example, BP concluded southern right whales (which are endangered under Australian law) would simply change course to go around the area, but did not assess what that might mean for their ability to access food. BP had also claimed that activity to clean up an oil spill would provide a “welcome boost” to local coastal economies. Nopsema asked them to remove that statement. “This correspondence included a range of feedback that BP was working to address,” said the company spokesperson, when asked about these specific impacts. Campaigners who fought BP’s proposal said the Nopsema letters showed particular difficulties associated with drilling in the Great Australian Bight that Statoil would struggle to overcome. Former Greens politician and activist Bob Brown said protecting the Bight’s wildlife from these risks would prove “prohibitively expensive”. “That’s why BP and Chevron have withdrawn. Statoil must meet the same standards required of BP: its shareholders, not least the Norwegian government, need to know the company cannot reasonably meet the cost of keeping Australia’s southern ocean and coastlines safe from an oil spill which could take months to cap. Statoil should drop its plans,” he said. Nathaniel Pelle, a senior campaigner at Greenpeace Australia, told CHN: “Now we not only know how far it could reach, but how extensive an oiled coastline could be – 750km of oiled beaches is a horrifying thought.” Pelle said this scale and the lack of a plan to recruit the necessary salvage crews, “confirms the community’s concerns that an effective clean-up would not be possible”. Even after BP was given a detailed rejection notice by Nopsema in November 2015, its resubmitted plan failed to comply, or had provided insufficient information, on 69 out of 88 required criteria, the documents show. A Nopsema spokesperson said it was “common to see improvements in the environmental management approach proposed by titleholders for a particular activity as an environment plan assessment progresses”. BP said the letters were part of an “ongoing process” and until the time it withdrew, it was “absolutely committed to working with the regulator to finalise our draft environment plan”. Bob Bea is professor emeritus at University of California Berkeley’s engineering department. He told CHN the number of objections from the regulator showed Nopsema “clearly recognised that it was a very important, environmentally sensitive area”. BP’s plan in the case of a major blow out, such as occurred at BP’s Deepwater Horizon rig in the Gulf of Mexico in 2010, had been to keep a ‘capping stack’ – to plug the well – in Singapore. In Bea’s judgement, Nopsema was building a case that the sensitivity of the area was too great to leave a capping stack 5,000km and 35 days’ travel away. He said Nopsema “was clearly going to show that BP’s proposal was not acceptable. It had to do something to lower the likelihood of an uncontrolled blowout and lower the consequences”. BP Great Australian Bight Timeline by Zak Derler October 2015 – BP submits a new application to drill four explorations wells in the Ceduna Sub-basin of Southern Australia. November 2015 – BP told it hasn’t met environmental standards set out by Nopsema. March 2016 – BP resubmits environment plan May 2016 – BP is rejected for a second time by Nopsema and given another opportunity to modify its plans and resubmit. August 2016 – The company announces the locations of two of their sites and causes widespread controversy upon realisation that the sites fall within a Commonwealth Marine Reserve. September 2016 – Nopsema requests more information from BP on its environment plans December 2016 – The company withdraws their application to drill in the region. June 2017 – Statoil announces a swap agreement with BP to take over two exploration permits in the Bight. October 2019 – Statoil plans to drill an exploration well by the end of the month. Keeping a capping stack on call significantly increases costs. Bea said Nopsema may also have required the presence of a back-up rig, which could drill a pressure-relieving well. Asked whether the regulator considered a capping stack and relief well to be prerequisites for drilling in the Bight, Nopsema’s spokesperson said he could not provide a generic response for all future programmes. “However,” he added, “for every drilling activity a titleholder must demonstrate that they will be able to bring an uncontrolled release under control in the most efficient and effective way possible. This may include deployment of a capping stack and/or the drilling of a relief well.” Andrew Hopkins, an emeritus professor of sociology at the Australian National University who has consulted and written books on BP’s safety practices, said it would have cost BP “many millions” to comply with the regulator’s requirements. BP told CHN that compliance with the regulator had not made the project uncompetitive. “Statoil must be able to see what will be required,” Hopkins said. Both he and Bea gave expert evidence to the Australian senate enquiry on drilling in the Bight. Bea said Statoil had a long history of working in highly-regulated environments and predicted they would not make the same mistakes as BP. “I think Statoil will take the experience of Nopsema and BP as a starting point so that they can do a thorough evaluation of the risk. Because of Statoil’s experience and background, I’m hopeful that the sad end that BP experienced in the Great Australian Bight won’t be realised again,” said Bea. A spokesperson for Statoil said the company was developing an environmental plan to submit to Nopsema, which would be subject to consultation. “We will only undertake drilling activity if we can do it safely. By the time we drill we will have spent more than two years planning this well to satisfy ourselves that we can operate safely and in accordance with Australia’s strict environmental and regulatory requirements. We have collaborated with CSIRO [the Australian government-backed Commonwealth Scientific and Industrial Research Organisation] to study the local environment and this is taken into account in our plans. Our exploration project is also designed to protect the interests of fishing, aquaculture and tourism operators,” according to an emailed statement. “As the world’s leading deep-water operator, we will draw on more than 45 years of experience successfully operating in similar offshore environments. We are speaking with local suppliers and stakeholders to ensure we properly understand the local conditions. We have decades of experience coexisting with other interests, including fisheries and tourism. We will continue to use a combination of local experts and global best practice throughout our exploration program. With careful planning and regulatory oversight, we are taking the time we need to prepare for safe operations.” View/search document collection Both Bea and Hopkins applauded the detailed work done by Nopsema’s assessors. “I think Australia has done a great service for not only that country, but for other parts of the world in forcing this process in the direction that they have,” said Bea. Hopkins told CHN he was “surprised” that many of the problems listed the first rejection of BP’s environment plan remained unaddressed second time around. “Maybe BP wasn’t taking the whole process seriously enough. In many other parts of the world these big companies aren’t dealing with very competent regulators and are used to getting away with relatively superficial kinds of plans,” he said. CHN’s freedom of information request to Nopsema was delayed by BP until well after its commercial interest in the region had cooled. CHN’s original document request was made in August 2016. The Bob Brown Foundation assisted CHN with the $386 fee for the request, but had no further input until asked to comment for this article. BP initially delayed Nopsema’s processing of the request by claiming the relevant staff member was on leave. Nopsema notified CHN of its decision to allow access the documents in October 2016. But BP appealed the decision, first to the information commissioner, then to the Australian Administrative Appeals (AAT) tribunal. The case never went before the AAT. After two hearings were scheduled, then delayed after BP claimed it needed more time to prepare, the oil company dropped its appeal. “After an internal review, BP has taken the position that, while potentially open to misinterpretation, it is clear this correspondence was part of an ongoing process,” said the spokesperson. A further document, released to CHN but heavily redacted, was 142 pages of technical advice which Nopsema said contained the assessment team’s “detailed thought processes and opinions”. Nopsema cited laws that protect government agencies from having to release ‘deliberative’ material. Other notable findings from Nopsema’s rejection of BP’s second environment plan: The documents reveal the degree to which Nopsema was unhappy about BP’s spill modelling, which lacked detail. One consequence of this, said Nopsema, was the exclusion of the Walpole and Nornalup Inlets Marine Park in southern West Australia from any further assessments “even though they may be at risk”. BP’s plan to rely on contracting in local vessels to help it deal with a spill was criticised by Nopsema, which was unconvinced BP had shown it could mobilise the required number of boats. Greenpeace’s Pelle said: “Statoil will face the same problem if it pursues its Bight plans. There are only about 160 boats registered for offshore operations in South Australia… The Deepwater Horizon disaster required roughly 6,500 boats for a cleanup effort that was still unable to prevent oil washing up on thousands of kilometres of coastline.” Nopsema said BP’s plan predicted spilled oil would weather, condense and change into more solid forms, reducing the potential impacts on wildlife that liquid oil might have. But the plan did not assess how these “waxy flakes and tar balls” would affect human activities, such as surfing, fishing and swimming. BP had not adequately accounted for local historical weather and wave conditions to assess how adverse weather that could delay the deployment of a capping stack and relief well in the case of a blowout, such as occurred at the Deepwater Horizon rig in the Gulf of Mexico. The sound impacts modelled on a drilling rig with thrusters that had 12.5% less power than the Ocean Great White rig BP was planning to use. BP told the regulator the drilling sites were not in commercially fished waters or close to shipping lanes. But that was contradictory to the information it had given to the regulator. Proposals from the Australian Southern Bluefin Tuna Industry Association, South Australian Oyster Growers Association and the Wilderness Society to have relief wells and capping stacks positioned nearby, lower spill modelling thresholds and toxicity testing of dispersant had “not been adequately evaluated”. Republish this article BP document says an oil spill would be a 'welcomed boost' to local communities Updated An oil spill in the Great Australian Bight would provide a "welcomed boost" to local economies, BP said in a 2016 report released under Freedom of Information laws. Key points A BP spokesperson says the statement "did not reflect BP's views" BP made the statements in March 2016 in an environment plan during its bid to drill in the pristine region Ceduna's Mayor said if there was a risk of an oil spill, drilling would not be supported BP made the statements in an environment plan in March 2016 during its bid to drill in the pristine region, but a spokesman for the company says it "did not reflect BP's views". The report was submitted to the National Offshore Petroleum Safety and Environmental Management Authority (NOPSEMA), but obtained by London-based website Climate Home News. A search of the report revealed a suggested edit for the document stating there are statements that "should be removed": "Examples include stating that impacts of spill response strategies may be offset by the use of vessels from the local fishing fleet … and stating that "in most instances, the increased activity associated with clean up operations will be a welcome boost to [local] economies." South Australia's coastal town of Ceduna was predicted to be one of the many communities impacted if an oil spill ever occurred in the Bight. Ceduna Mayor Allan Suter told the ABC the company's claim was silly and unnecessary. "What an incredibly stupid thing to say, it certainly wouldn't have been a welcomed boost the local economy, we could have done very nicely thank you very much without it," Mr Suter said. "A spill like the one that happened in Mexico would be devastating, and if there was the slightest danger of that happening then obviously the drilling wouldn't be supported." BP has since withdrawn plans to drill in the region, but Norwegian oil and gas company Statoil has taken over the leases and it plans to drill an exploratory well in October 2019. Senator still concerned over potential drilling South Australian Greens senator Sarah Hanson-Young said Statoil had already made an application to drill in the Bight with NOPSEMA. "We are very concerned because even though BP has pulled out … we can see how negligent they were in their commitment to protecting the Great Australian Bight," she said. "They have pulled out but their leases have gone to Statoil, so the risk of this oil slick, of an accident like this happening, of the devastation to Kangaroo Island and our coastline still remains very real." Senator Hanson-Young said BP'S comments were "ridiculous". "I think South Australians will horrified to think that a big multinational company like BP thinks the only thing good for them is [to be] out there with some buckets and some mops cleaning up an oil slick, and it is offensive and it is just unrealistic," she said. A spokesperson for BP said the wording "does not reflect BP's views". "This correspondence relates to a draft document that was never finalised," the spokesperson said. "We acknowledge that a number of aspects should have been better thought through and articulated, even in the draft stage. "They do not reflect the final views of BP or of the regulator." Statoil's Australian manager Jacques-Etienne Michel said while the company could not comment on BP's work, it was currently working on the environmental plan to be submitted to NOPSEMA for its project. "The plan will be subject to a consultation and engagement process," Mr Michel said. "We will only undertake drilling activity if we can do it safely and with the approval of the regulator." Topics: oil-and-gas, environmental-impact, environmental-management, mining-environmental-issues, sa, wa First posted Coastal towns would benefit from an oil spill in the pristine Great Australian Bight because the clean up would boost their economies, energy giant BP has claimed as part of its controversial bid to drill in the sensitive marine zone. BP, which has since withdrawn the drilling plan, also told a federal government agency that a diesel spill would be considered “socially acceptable”. Eyre Peninsula, South Australia. BP said local economies would be boosted by clean up activities if its plan to drill for oil caused a spill. BP made the statements in an environment plan submitted to the National Offshore Petroleum Safety and Environmental Management Authority in March 2016. The company had been seeking to drill two wells off the South Australian coast, raising fears of an environmental disaster akin to BP's 2010 Deepwater Horizon oil spill in the Gulf of Mexico. SUMMARY: [/INST] Two years ago, BP applied to drill for oil off the Australian coast. Now government letters show that BP praised the "welcome boost" local economies could receive doing cleanup in an oil spill, the Sidney Morning Herald reports. Australia's National Offshore Petroleum Safety and Environmental Management Authority-or Nopsema, for short-mentioned BP's claim in letters to the company about regulatory concerns. Nopsema quoted BP's argument that "in most instances, the increased activity associated with cleanup operations will be a welcome boost to local economies." BP also apparently saw no social impacts: "Since there are no unresolved stakeholder concerns... BP interprets this event to be socially acceptable." Australia rejected BP's effort to drill in the Great Australian Bight, but the recently revealed Nopsema letters have roused political ire. "What an incredibly stupid thing to say," says Allan Suter, the mayor of the coastal town of Ceduna, per ABC News Australia. "It certainly wouldn't have been a welcomed boost the local economy, we could have done very nicely thank you very much without it." Published by Climate Change News under freedom of information laws, the letters also say BP underestimated its impact on whales. BP acknowledged that southern right whales migrated through the drilling zone and sperm whales had been spotted there, but the oil and gas company failed to identify "potential ecological consequences" on whale feeding and migrating, Nopsema writes. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Background Federal agencies can choose among three main contract types to procure goods and services: fixed-price, time-and-materials, and cost- reimbursement. Each contract type comes with a different level of cost or performance risk for the government, as shown in table 2. Different types of cost-reimbursement contracts can be used, based on whether incentives, award fees, or other arrangements can be used to motivate contractor efforts and discourage contractor inefficiency and waste. Some of these types, and their limitations, follow. Cost-sharing contracts: The contractor receives no fee and is reimbursed only for an agreed-upon portion of its allowable costs. A cost-sharing contract may be used when the contractor agrees to absorb a portion of the costs, in the expectation of substantial compensating benefits. Cost-plus-incentive-fee contracts: An objective relationship can be established between the fee earned and performance results, such as actual costs or delivery dates. This contract type provides for an initially negotiated fee to be adjusted later by a formula based on the relationship of total allowable costs to total target costs. Cost-plus-award-fee contracts: Objective incentive targets are not feasible and judgmental standards, such as quality and technical ingenuity, can be applied. A potential fee is intended to provide an incentive for excellence in such areas as quality, timeliness, technical ingenuity, and cost effective management; award of the fee is a unilateral decision made solely by the government. We have reported on agencies’ use of cost-plus-award-fee contracts, finding in some cases that award fees had been paid to contractors regardless of acquisition outcomes. Cost-plus-fixed-fee contracts: These contracts provide for payment to the contractor of a negotiated fee that is fixed at contract inception. The fixed fee does not vary with actual cost, but may be adjusted as a result of changes in the work to be performed under the contract. This contract type permits contracting for efforts that might otherwise present too great a risk to contractors, but it provides the contractor only a minimum incentive to control costs. Cost-plus-fixed-fee contracts are suitable, for example, when contracting for research or preliminary exploration or study, and the level of effort required is unknown. Cost-reimbursement contracts are suitable only when uncertainties involved in contract performance do not permit costs to be estimated with sufficient accuracy to use a fixed-price contract. The two major reasons for the inability to accurately estimate costs are (1) the lack of knowledge of the work needed to meet the requirements of the contract, for example, under research contracts, which necessarily involve substantial uncertainties, and (2) the lack of cost experience in performing work, such as the development of a weapon system because manufacturing techniques and specifications are not stable enough to warrant contracting on a fixed-price basis. We have reported that during weapon system development, the Department of Defense (DOD) often asks prime contractors to develop cutting-edge systems and awards cost- reimbursement contracts for the work. Because the government often does not perform the up-front analysis needed to determine whether its needs can be met by the contract requirements, significant cost increases can occur under the contracts as the scope of requirements changes or becomes better understood. As of fiscal year 2007, for example, DOD anticipated reimbursing the prime contractors on the Joint Strike Fighter and Future Combat Systems programs nearly $13 billion more than initially expected. Cost-reimbursement contracts involve significantly more government oversight than do fixed-price contracts, which means the government incurs additional administrative costs on top of what it is paying the contractor. For example, the government must determine that the contractor’s accounting system is adequate for determining costs related to the contract and update this determination periodically. In addition, contractor costs need to be monitored—known as cost surveillance—to provide reasonable assurance that efficient methods and effective cost controls are used. Congress has taken action to increase oversight of these contracts, for DOD specifically as well as governmentwide. The John Warner National Defense Authorization Act for Fiscal Year 2007 called for the Secretary of Defense to modify DOD’s regulations to require at Milestone B (approval for major acquisition programs to enter the engineering and manufacturing development phase) documentation of the basis for the contract type. Before approving the use of a cost-type contract for development, the Milestone Decision Authority must execute a written determination that among other things, the program is so complex and technically challenging that it would not be practicable to reduce program risk to a level that would permit the use of a fixed-price type contract. Further, the conference report accompanying the act stated that DOD should reduce program risk to the point that the use of a fixed-price contract for a major acquisition program may be appropriate. In addition, the Duncan Hunter National Defense Authorization Act for Fiscal Year 2009 called for revisions to the FAR, to include guidance on (1) when and under what circumstances cost-reimbursement contracts are appropriate, (2) the acquisition plan findings necessary to support decisions to use cost-reimbursement contracts, and (3) the acquisition workforce resources necessary to award and manage cost-reimbursement contracts. The FAR revisions were required by July 11, 2009, but as of September 28, 2009, had not been implemented. This act also states that within 1 year after these revisions are promulgated, the inspector general for each executive agency shall review the use of cost-reimbursement contracts by the agency for compliance with these regulations and must include the results of the review in the inspector general’s next semiannual report. Finally, in a March 2009 memorandum on government contracting issued to the heads of departments and agencies, President Obama noted that excessive reliance by the federal government on cost-reimbursement contracts “creates a risk that taxpayer funds will be spent on contracts that are wasteful, inefficient, subject to misuse, or otherwise not well designed to serve the needs of the Federal Government or the interests of the American taxpayer.” The President directed the Office of Management and Budget to develop guidance to assist agencies in “reviewing, and creating a process for ongoing review of, existing contracts in order to identify contracts that are wasteful, inefficient, or not otherwise likely to meet the agency’s needs, and to formulate appropriate corrective action in a timely manner.” In this regard, on July 29, 2009, the Office of Management and Budget sent a memorandum to the heads of departments and agencies requiring agencies to reduce high-risk contracting authorities, such as cost-reimbursement contracts. The memorandum requires agencies to reduce by 10 percent the share of dollars obligated in fiscal year 2010 under new contract actions that are awarded with high- risk contracting authorities. Full Picture of Agencies’ Use of Cost- Reimbursement Contracts Is Unclear The complete picture of the government’s use of cost-reimbursement contracts is unclear. From fiscal years 2003 through 2008, federal obligations under cost-reimbursement contracts were reported to have increased by $16 billion, from $120 billion to $136 billion. When viewed as a percentage of total reported federal obligations, this represented a decrease over the 6-year period, from 34 percent to 26 percent. However, this decrease is misleading for several reasons, including a significant increase in agencies’ reported obligations under the “combination” contract type, which includes cost-reimbursement obligations, and contradictory guidance in the FPDS-NG user manual, which could result in misreporting of contract type. Further, although contract type is a data element field required in FPDS-NG for all awards, we found billions of dollars reported as missing a contract type (i.e., no specific contract type was indicated) or indicating “other” as the contract type. The contract type field displays the type of contract that applies to the particular procurement. It is incumbent on the contracting officers and agencies to ensure the accuracy of all information submitted. Significant Increase in “Combination” Contract Type Belies Reported Use of Cost-Reimbursement Contracts Combination contracts, one of the contract type fields in FPDS-NG, are those where two or more contract types are used, such as in different line items in one contract action. Agencies have recently reported a significant increase in obligations under this contract type, from less than 1 percent ($1.3 billion) of total government obligations in fiscal year 2004 to almost 8 percent ($39 billion) in fiscal year 2008. DOD obligations accounted for $34 billion, or 87 percent, of this amount. Figure 1 depicts the reported trends in the percentage of total obligations under cost-reimbursement contracts and under combination contracts. We analyzed fiscal year 2008 FPDS-NG obligations coded as combination contracts and found that half of the $39 billion was obligated under contracts that had at least some cost-type actions, and about a quarter of this amount ($9 billion) went to contracts that had 50 percent or more cost-type obligations. These obligations were not recorded as cost- reimbursement in FPDS-NG. Further illustrating the potential overlap between combination and cost- reimbursement contract types, we found that contracts coded as combination are used to procure similar items as those coded as cost- reimbursement. Our examination of the 15 categories of items most often procured under both cost-reimbursement and combination contract types over the past several years showed substantial overlap. Table 3 depicts the top 15 categories in both contract types and the 11 categories that are the same, from fiscal year 2005 to July 13, 2009, the most current data available at the time of our analysis. Because many of the combination contracts include cost-type obligations, those contracts coded as cost-reimbursement do not portray the full picture of the government’s use of cost-reimbursement contracting. FPDS- NG does not delineate what contract types comprise those coded as combination, for example, whether they are cost-plus-award-fee and cost- plus-incentive-fee contracts, or a mix of fixed-price and labor-hour line items. We also identified conflicting definitions in the FPDS-NG user manual, which agency officials use as guidance when entering contract information into the database, that further complicate efforts to identify obligations under cost-reimbursement contracts. For contracts composed of more than one contract type, instructions direct agencies to “identify the type with greater contract value.” For example, if a contract has both cost- reimbursement and fixed-price portions but the fixed-price portion of the contract makes up 55 percent of the expected contract value, the contract would be coded as fixed-price. However, the very next page of the user manual describes combination contracts as awards “where two or more contract types apply.” It is not clear, then, whether contracts with more than one contract type should be coded as the contract type representing the preponderance or as combination contracts. According to a response to a draft of this report by the Office of Federal Procurement Policy (OFPP), a change was recently approved to FPDS-NG, anticipated to be effective for all new contracts awarded in fiscal year 2010, that will eliminate “combination” as a contract type. Contracts containing more than one contract type will be coded as the contract type representing the preponderance of obligations. With the elimination of the combination contract type option, the conflicting user manual definitions we identified will be removed. Missing Contract Types and Obligations Using “Other” Contract Type Contribute to Lack of Clarity about Extent of Cost-Reimbursement Obligations Although FPDS-NG guidance states that contract type is a required field for all contracts, we found that billions of dollars in obligations are either missing a contract type (i.e., no contract type was reported) or the contract type is indicated as “other.” In fiscal year 2008, over $10 billion in obligations was reported as missing a contract type and $4.3 billion was reported as “other.” In addition, some very large contracts that had been previously labeled as cost-reimbursement were subsequently coded as missing a contract type in fiscal year 2008. For example, six Navy contracts with missing contract types had been coded in prior years as predominately cost-reimbursement; in total these contracts accounted for over $2 billion. Additionally, FPDS-NG guidance prohibited the use of the “other” category as a contract type beginning in fiscal year 2009, but we found contracts in fiscal year 2009, with obligations of $1.3 billion, that were still using this category. OFPP, in its response to a draft of this report, explained that contracts previously designated as “other” retain that designation when modifications to those contracts are subsequently made. We queried FPDS-NG and verified that the fiscal year 2009 obligations for the “other” contract type were all modifications to contracts awarded earlier than fiscal year 2009. In its response, OFPP noted that agencies have the ability to self-correct the contract type selection on modifications and stated that it would discuss with agencies the burden associated with making such changes on a voluntary basis (such as for modifications to contracts that were recently awarded and may not expire for a number of years). Agencies Purchase a Range of Services under Contracts Coded as Cost- Reimbursement For contracts coded strictly as cost-reimbursement in FPDS-NG, the largest procurement categories in fiscal year 2008 were defense systems research and development, professional services, and the operation of government-owned buildings. The 10 largest procurement categories reported as using cost-reimbursement contracts in fiscal year 2008 are listed in table 4. Contracts included in our sample make clearer the range of services agencies are procuring under cost-reimbursement contracts. Table 5 provides examples of the goods and services procured with cost- reimbursement contracts at the 10 agencies in our review. By contrast, the 10 agencies in our review that reported very high use—95 percent or more—of fixed-price contracts procure goods and services for which the requirements are known and research and development is not required, and that are available commercially and have substantial pricing histories on which to base fixed prices. For example, officials from the Department of Justice’s Bureau of Prisons told us they procure items for prison operation and maintenance, as well as goods needed to regularly operate these facilities, such as food and inmate clothing. The Department of Agriculture’s Agricultural Marketing Service officials said that they purchase janitorial services, and Defense Commissary Agency officials said they purchase goods, such as groceries, which are sold in commissaries throughout the world. Other examples of procurements by those agencies that had a very high use of fixed-price contracts include fuel, pharmaceutical products, ammunition, office supplies, clothing, and information technology (IT) equipment, according to officials. Rationale for Using Cost-Reimbursement Contracts Is Often Not Clear, and Analysis Is Not Conducted to Determine if Contract Type with Firmer Pricing Is Warranted Contracting officials frequently did not document contract files to show why they awarded cost-reimbursement contracts. The documentation we did find, for the most part, used boilerplate language; was short, vague, and repetitive; and did not show why a cost-reimbursement contract was selected. In three cases, documentation in contract files stated that funding unavailability was a reason cost-reimbursement contracts, rather than fixed-price contracts, were awarded. We also found little evidence at the agencies we reviewed that contracting officers are analyzing contract pricing history or requirements to determine if experience under the contract could provide a basis for firmer pricing. Little Documentation Available Showing Why Contracting Officers Use Cost-Reimbursement Contracts Although a formal determination and findings is no longer required to justify a cost-reimbursement contract (as is the case for using time-and- materials contracts), contracting officers are generally required to include in the contract file documentation to show why a particular contract type was selected. The FAR does not contain details as to what this documentation is to entail. Along these lines, a regulatory change is in process to implement a recent congressional direction that acquisition plans set forth the findings necessary to support a decision to use cost- reimbursement contracts. Standards for Internal Control in the Federal Government also state that for an agency to manage its operations, it must have relevant, reliable, and timely information relating to internal events. From a management standpoint, that information should be recorded and available to help ensure that this contract type is used only when suitable. Setting forth a full and specific explanation showing why a cost- reimbursement contract was selected for award could, for example, provide agency personnel and their managers with helpful information as they consider awarding future contracts or exercising options on an existing contract. Of the 92 contract files we reviewed, we found that 28, or 30 percent, contained no documentation showing why a cost-reimbursement contract was selected for award, including in the acquisition plans. Contracting officers frequently could not provide an explanation for its absence, were unaware of the need for documentation, or stated that they inherited the contract from contracting officers who had retired or otherwise left the agency. In one case, the contracting officer told us that the decision to use a cost-type contract was not reduced to a specific document in the file but resulted from discussions. In another case, the contracting officer noted that it was intuitive that the contract was not appropriate for a fixed-price arrangement. For those contracts that did contain documentation, it was often brief, vague, and repetitive. For example, National Aeronautics and Space Administration (NASA) contracting officers use a boilerplate template on which they select the appropriate justification, without setting forth the facts and explanation of why this contract type was selected. NASA’s template includes the following choices for why a cost-reimbursement contract should be awarded: The level of complexity is moderate to high and performance uncertainties cannot be sufficiently identified or their cost impacts reasonably estimated. Changes during performance are: likely _____, unlikely_____, or have an average chance of occurring _____. The Environmental Protection Agency also uses standard language, not specific to the procurement at hand, to document its rationale for why it awarded a cost-reimbursement contract. For example, two contract files contained the statement, “these activities are non-routine, complex in nature, and specific requirements have not been completely defined.” Two other contract files had the following language: “due to the uncertainties involved in the performance of this contract, costs cannot be estimated with sufficient accuracy to use any type of fixed-price contract.” Table 6 contains representative examples of rationales we found to be brief and not clearly tied to the individual procurements. The Navy Strategic Systems Program, in addition to the standard language showing why it selected cost-reimbursement contracts, provided us with a briefing explaining that a primary reason for using cost-reimbursement contracts is the emphasis this office places on the safety, reliability, quality, and readiness of the nuclear weapons it procures. Shifting too much risk to the contractor, the Navy states, would increase the risk that safety, reliability, quality, and readiness could be compromised because, when problems are encountered, contractors are motivated not to lose money and to look for ways to cut costs. Cutting costs can translate to performance degradations that may not surface until years later. Navy officials also told us that cost-reimbursement contracts for nuclear weapons are cost-effective because the high technical risk of what is being procured would expose contractors to great financial risk with a fixed- price contract, causing contractors to mitigate such risk with proposals that would be prohibitively expensive. One contract file in our review did include a more specific rationale for using a cost-reimbursement contract type. A memorandum in a NASA contract file justified the use of a cost-reimbursement contract to procure traveling wave tubes, a component of electronic equipment. The memorandum stated that “because of the high breakage rate which occurs during fabrication of Traveling Wave Tubes, a fixed-price contract would be too costly for the government. Consequently, a cost-type contract is the chosen method of procurement.” Funding Availability Sometimes Drove Decision to Use Cost- Reimbursement Contracts In some cases, we found that it was not necessarily uncertainty about requirements that drove the selection of a cost-reimbursement contract, but rather uncertainties about funding availability. Some contracting officers told us that cost-reimbursement contracts could be modified more easily than fixed-price contracts as more funding became available (if, for example, funding was made available on a periodic basis instead of at the beginning of the fiscal year), whereas fixed-price contracts were required to be fully funded up front. For example, a contracting officer at the National Science Foundation (NSF) noted that as a result of the ambiguities of the services provided and the funding available each year, a fixed-price contract was not possible for the procurement. However, the contracting officer said that even if there were no ambiguities regarding the services to be awarded, if funding availability was incremental and uncertain then the contract would be awarded on a cost-reimbursement basis. At the Internal Revenue Service (IRS), one of the contract files we reviewed contained documentation stating the following: “The customer did not have sufficient funding available to structure the task order and obligate the funding under a firm fixed price (FFP) structure. As a result, a Cost Plus Fixed Fee … was awarded. The customer estimated their requirement at $8.1 million; however, they were only able to provide $2.1M at the time of award. After initial award, four (4) additional increments of funds were provided to incrementally fund this requirement in the first year. Given our continuous cycle of Continuing Resolutions each Fiscal Year, our use of Cost Reimbursement contract vehicles are the most practical awards.” In our view, the perceived ease of adding funding under cost- reimbursement contracts as funding is made available is not a correct assumption. Under a cost-reimbursement contract, an agency is required to obligate the estimated costs (or ceiling) established in the base year contract for the required services or products at the time of award. When modifications are approved increasing the original funding ceiling in the contract award, the increased costs are charged to the appropriation current at the time of the modification. It is true that modifications of fixed-priced contracts can be charged against the funding available at the time of the original contract award, depending upon the type of contract modification. However, agencies must obligate the ceiling amount under a cost-reimbursement contract based upon a reasonable estimate of costs for providing the service or product. Agencies cannot simply limit the amount of a recorded obligation by stating that the contract is limited to an amount of funding available for the contract or stating that the contract will be incrementally funded if those amounts are different than the estimated ceiling costs. At the Air Force Aeronautical Systems Center, we found that the availability of research and development funds—as opposed to procurement—was a reason for awarding a cost-reimbursement contract. The price negotiation memorandum for one contract we reviewed stated that “The Government directed the contractor to bid the effort as firm fixed price. (The contractor) submitted a firm fixed price in response …. The Government later changed direction … in order to use FY07 3600 funds.” There was no additional indication in the contract file as to the reason the decision was made to switch to a cost-reimbursement contract. We were unable to discuss the reason for switching with the contracting officer because the contracting officer had left the agency. Agency Officials Are Not Conducting Analysis to Determine Potential to Transition to Contract Types with Firmer Pricing The FAR does not specifically require a transition plan from a cost- reimbursement contract to one with firmer pricing. However, the FAR states that in the course of an acquisition program, a series of contracts, or a single long-term contract, changing circumstances may make a different contract type appropriate in later periods than that used at the outset. In particular, contracting officers should avoid the protracted use of a cost- reimbursement contract after experience provides a basis for firmer pricing, for example, by transitioning part or all of the requirements to a fixed-price contract. Information important to such an effort would include a contracting officer’s analysis of the contract’s pricing history and the results of program offices revisiting the government’s requirements to determine whether they can be better defined. In this regard, on July 29, 2009, the Office of Management and Budget issued a memorandum requiring agencies to reduce high-risk contracting instruments, such as cost-reimbursement contracts. Using fiscal year 2008 as a baseline, the memorandum states that agencies should aim to reduce by at least 10 percent the combined share of dollars obligated through new contracts in fiscal year 2010 that (1) are awarded noncompetitively, receive only one bid in response to a solicitation or a request for quote, or both; (2) are cost-reimbursement contracts; or (3) are time-and-materials and labor- hour contracts. To meet this goal, the memorandum states that agencies might plan for the migration of work from cost-type to fixed-price contracts as requirements become better defined. We did not assess whether an agency’s decision to use a cost- reimbursement contract was the most appropriate choice of contract type during our review, but we generally found no evidence that agency officials assessed, for example, the contract’s pricing history or requirements under the contracts we reviewed to determine whether there was a basis for firmer pricing, even when the contracts had been in place for several years. For example, NSF awarded a $2.8 million cost- reimbursement contract in 2007 to collect and analyze data for a survey of science and engineering research facilities. NSF has been conducting the survey since 1986 and noted in its acquisition plan that methodological studies have been performed during each cycle to improve the design and processes for subsequent cycles. However, the documentation showing why the agency selected a cost-reimbursement contract, rather than one with firmer pricing, was vague, stating that the survey tasks include “analysis work involving several uncertainties, and sufficient room during the collection process for variegated opportunities to revise and improve on survey methods, creating additional areas of uncertainty.” Although contracting officers are to consider the cost-reimbursement contracts’ pricing history, there was no evidence in the contract file that this occurred—or that the program office had revisited requirements—to determine whether there was a basis to convert to a contract type with firmer pricing. In another example, the Agency for Healthcare Research and Quality (AHRQ) awarded a contract to collect data for its annual Medical Expenditure Panel Survey. The contract, awarded in 2002 with options extending through 2008, was worth over $128 million with the options included. The same contractor had performed this survey since 1996, but the contract file contained no evidence regarding why a cost- reimbursement contract continued to be used, despite having at least 6 years of data regarding costs and requirements. We found cases where leadership had encouraged movement away from cost-reimbursement contracts, largely by focusing on the program offices’ role in establishing firmer requirements. An IRS contracting office, for example, recently established a contract review board to review the use of cost-reimbursement contracts supporting a multibillion-dollar IT modernization program that has been in place for over 20 years. Cost- reimbursement contracts had initially been determined to be in the government’s best interest because IRS was unable to define its requirements sufficiently to allow for fixed-price contracts. According to IRS officials, over time cost-reimbursement contracts and orders continued to be awarded and issued for this program because it was easier. In effect, maintaining the status quo became the way contracting was done. Officials told us that the partnership between the contracting and program office was weak; one contracting officer told us that a source selection was conducted, the acquisition plan written, and proposal evaluation made without any input from the contracting officer. In January 2008, new leadership at this IRS contracting office established a contract review board to review and approve procurements proposed as cost- reimbursement contracts. The IRS Director, Office of Information Technology Acquisition, told us that the review board represented a significant paradigm shift from how business was conducted. In one case, the board stopped a planned sole-source, cost-reimbursement order from being awarded in favor of a competitive, firm-fixed-price task order. The order was awarded for approximately $9.5 million—about half of the government estimate and $15 million less than what the contractor requested as a sole-source provider. We also found two additional cases where agencies had contracted for IT services on a firm, fixed-price basis. While we recognize that IT services vary significantly in terms of complexity, in these cases contracting officials had made a concerted effort to work with the program offices to define requirements such that vendors could submit offers on a fixed-price basis. Procurement officials at the District of Columbia’s Pretrial Services Agency and the Department of Agriculture’s Farm Services Agency—two agencies with high proportions of fixed-price contracts—noted that IT services contracts were among their largest obligations under fixed-price contracts. Both of the agencies were successful at implementing these contracts as fixed-price contracts because their technical personnel (i.e., officials in their program offices) were required to separate and define their IT contract requirements into specific, measurable deliverables. The head of contracting activity at the Farm Services Agency told us that it was “a long road” to get the program office on board with this approach, as the office had preferred cost-reimbursement contracts for IT services in the past, but that the effort paid off in terms of savings as well as a greater likelihood that the government would get the deliverables it expected. This official emphasized that a key to the agency’s success was including its technical personnel in the contracting process. Agencies Do Not Always Ensure That Contractors’ Accounting Systems Are Adequate for Determining Costs Applicable to Contracts Cost-reimbursement contracts are to be used only when the contractor’s accounting system is adequate for determining costs applicable to the contract. This determination is critical because it helps assure the government that the contractor has systems in place to accurately and consistently record accumulated costs and bill for allowable costs. If accounting systems are not deemed adequate, problems can arise when costs are accumulated during contract performance. Contracting officers have a number of methods available to them to make this determination. One method is to rely upon assessments of accounting systems prepared by DCAA for prior contracts. The FAR does not specify a time frame within which an accounting system needs to be determined adequate to be used as a basis to award a new cost-reimbursement contract. As such, for the purposes of this review, we used a period of 4 years, which is the outermost time frame in DCAA policy, as being “current” for auditing an accounting system that has a significant impact on government contract costs. Another method by which contracting officers can determine if an accounting system is adequate is to perform a pre-award survey of a prospective contractor’s accounting system. According to the FAR, determining that an accounting system is adequate as part of a pre-award survey includes a determination of whether it is in accordance with generally accepted accounting principles and whether it provides for a proper segregation of direct costs from indirect costs, an identification and accumulation of direct costs by contract, a logical and consistent method for the allocation of indirect cost to intermediate and final cost objectives, an accumulation of costs under general ledger control, a timekeeping system that identifies employees’ labor by intermediate or a labor distribution system that charges direct and indirect labor to the appropriate cost objectives, and an interim (at least monthly) determination of costs charged to a contract through routine posting of books of account. The contracting officer is responsible for verifying that the contractor has an adequate accounting system. For most of the contracts we reviewed, this verification was based on a DCAA opinion stemming from its review of the contractor’s accounting system and related internal control policies and procedures, but the opinion can also be rendered by an independent accounting firm or other designated entity. According to the DCAA Contract Audit Manual, each relevant accounting or management system that has a significant impact on government contract costs should be audited on a cyclical basis, that is, every 2 to 4 years, depending on a documented risk assessment of experience and current audit risk. Regular accounting system reviews are necessary to help ensure that changes to the contractor’s accounting practices are considered by the government and evaluated for compliance with government contract cost principles. Over the period of a contract, the contractor’s cost structure or accounting procedures can change because of multiple factors, such as changing the criteria for capitalizing or depreciating assets, applying different indirect cost allocation bases, or merging of a contractor’s various operating segments. By continuing to pay a contractor without taking into account these changes, the government risks paying for unallowable costs. The contracting officer takes into account DCAA’s opinion, or that of the designated entity, but retains the ultimate authority for determining whether the contractor’s accounting system is adequate. As an example of what can occur when the determination of adequacy is not made or the contractor’s accounting systems are not deemed adequate, in August 2007, a contractor disclosed to the Air Force that it had periodically overbilled on the Joint Strike Fighter Systems Development and Demonstration cost-reimbursement contract since its inception. The amount overbilled was about $267 million. In this case, DCAA had rendered the opinion that the contractor’s accounting system was “inadequate in part.” The contractor reimbursed the Air Force for the amount overbilled and paid an additional $28 million in interest. Timely Accounting System Approval in 52 Cases Reviewed; 13 Others Approved After Award Of the 92 contract files we reviewed, only 52 (about 57 percent) had any evidence that contractors’ accounting systems had been deemed adequate in a current time frame (within 4 years or less) before contract award. Other accounting systems had been deemed adequate either after award or not at all. Where the contract files contained no evidence of an adequacy determination, we interviewed the cognizant contracting officers to confirm the lack of evidence. Table 7 depicts the results of our analysis of contract files and discussions with contracting officers. Thirteen contract files in our sample indicated that contractor accounting systems were determined adequate after contract award; the contracts were awarded before any determination that the accounting systems were adequate for determining cost. For example, the Department of Energy (DOE) awarded a contract in October 1996, but the accounting system was not determined to be adequate until July 1998, more than 2 years after the contract was awarded. Approval for Seven Accounting Systems Occurred More Than 4 Years Prior to Award Seven of the contract files we reviewed revealed that accounting systems were not determined adequate before award within current time frames. For example, NASA awarded a contract with an estimated value of more than $205 million (with options) in April 2005. However, the contractor’s accounting system was last determined to be adequate on a prior contract in August 1998, more than 7 years before the award of the current contract. In another example, at the Defense Microelectronics Activity, DCAA found a contractor’s accounting system to be inadequate in part. The contractor took corrective action, resolving some of the deficiencies to DCAA’s satisfaction; the Defense Contract Management Agency (DCMA) found that the remaining deficiencies were not material to government contracts and concluded that the contractor’s accounting system was adequate. A previous determination, based on a DCAA opinion, that the contractor’s accounting system was adequate, was made by DCMA in 2001—5 to 6 years before the orders we reviewed were issued. No Evidence of Accounting System Adequacy for 20 Contracts We found no evidence, either pre- or post-award, of determinations that the contractors’ accounting systems were deemed adequate for 20 of the contracts we reviewed (with a total value of more than $1.4 billion, not including option periods). This means that contracting officers obligated funds without knowing whether the contractors had accounting systems capable of billing the government properly. These 20 contracts were from the following agencies: NSF - 4 contracts NASA - 2 contracts Air Force Aeronautical Systems Center - 3 contracts Corporation for National and Community Service - 1 contract AHRQ - 10 contracts Contracting officials confirmed the lack of evidence in the contract files. However, most could not provide an explanation for why this was the case, or were not aware of their responsibility for ensuring that contractor accounting systems are determined adequate for cost-reimbursement contracts. Some said that they inherited the contracts from contracting officers who retired or otherwise left the agency. Further, a DCMA official incorrectly told us that the contractor’s accounting system is presumed to be adequate unless it is otherwise documented that the accounting system is not adequate. Four of these contract files contained opinions by DCAA that the accounting systems were inadequate in part. According to DCAA internal control criteria, an inadequate in part opinion meant that one or more significant deficiencies existed that affected parts of the accounting system. Such an opinion required the contractor to take corrective action and could require DCAA to review contractor invoices. For example, one of the Air Force Aeronautical Systems Center contracts we reviewed showed that DCAA found the contractor’s accounting system to be inadequate in part. According to the administrative contracting officer, the inadequate in part opinion was significant enough to preclude the contractor from direct billing the Defense Finance and Accounting System for payment and required the contractor to submit invoices to DCAA for review and approval before payment could be made to the contractor. On December 19, 2008, DCAA issued audit guidance stating that it will no longer report inadequate in part opinions. Audit reports that report any significant deficiencies or material weaknesses will include an opinion that the system is inadequate. At AHRQ, none of the contract files we reviewed contained documentation stating that the contractors’ accounting systems had been deemed adequate for determining costs applicable to the contracts at any time. Three of these contract files contained memos from the former AHRQ senior staff accountant stating that although his review did not consider the adequacy of the contractors’ financial capability or their accounting systems, nothing came to his attention to preclude an award on this basis. The contracting officers told us that they had relied on the National Institutes of Health’s (NIH) negotiation of indirect cost rates for these contracts. But according to the NIH Director of Financial Advisory Services, this indirect rate negotiation does not satisfy the FAR requirement that a contractor’s accounting system is deemed adequate for determining costs applicable to its contracts. Various Procedures for Cost Surveillance Require Effective Implementation to Avoid Improper Payments For the agencies in our review, we found a range of cost surveillance procedures. Cost surveillance procedures under cost-reimbursement contracts are intended to help ensure that the contractor is performing efficiently and effectively and that the government pays only for allowable, allocable, and reasonable costs applicable to the contract. Lack of adequate cost surveillance can lead to overpaying the contractor. The civilian agency procedures call for program officials to review contractors’ invoices. DOD procedures do not include invoice review by program offices, but rely on monthly reviews of contractors’ costs and a project management tool called Earned Value Management (EVM), supplemented by periodic DCAA audits. Whether cost surveillance is done by reviewing invoices or by the methods used by DOD, the key is effective implementation to help avoid improper payments or overbilling. Cost Surveillance Procedures at Civilian Agencies Procedures in the civilian agencies in our review generally call for contracting officers’ representatives (COR) to examine contractor invoices. CORs are appointed by the contracting officer to assist in the technical monitoring or administration of a contract. Invoice reviews help to ensure that the goods and services for which the government is being billed were actually received, the amounts billed are allowable, and the government is not incurring claimed costs that are inadequately supported. Agency officials outlined the steps in the cost surveillance process as follows. The program office directs work to be done, consistent with the contract’s statement of work. How the work is done, together with the time and cost required to do the work, is proposed by the contractor and, upon approval by the program office, becomes a work request. Work requests describe the work to be done, the labor categories needed, and the hours required by each labor category to complete the work. As invoices are submitted, the CORs are supposed to reconcile the invoices to the work requests to ensure that the government only pays for the completed work authorized by the work requests. Some CORs told us that they also pay attention to the labor categories charged to ensure that the contractor is billing for the level of expertise actually used to do the work and the hours worked. Once an invoice is reconciled, payment is made. Should a contractor experience technical problems, which may cause cost overruns, the COR must determine if the technical problems are legitimate before the government will approve continued work and invoices for payment. The efficacy of invoice review depends on an agency’s policies and procedures and the diligence and expertise of the COR in implementing them. Another factor is the time CORs have available to devote to oversight duties. We have reported that CORs are often assigned these oversight functions as an additional duty. In addition, we reported in 2007 that DOE was not adequately reviewing invoices for a multibillion-dollar cost-reimbursement contract to design and construct the Hanford waste treatment plant, risking hundreds of millions of dollars in improper payments. Instead, DOE relied primarily on DCAA’s review and approval of the contractor’s financial systems and on the contractor’s review and approval of subcontractor charges. DOE’s heavy reliance on others, with little oversight of its own, exposed the hundreds of millions of dollars it spent annually on the project to an unnecessarily high risk of improper payments. In September 2008, DOE amended its acquisition guide to hold contracting officers responsible for ensuring that contract invoices are properly reviewed and analyzed before any payment is made to contractors. DOD Reliance on Contractor-Provided Program Management Data May Be Inadequate if Required Audits Are Not Conducted to Supplement Cost Surveillance At DOD, procedures for monitoring contractor costs depend in large part on the EVM system—a tool that presents contractor-provided data to measure the value of work accomplished in a given period compared to the planned value of work scheduled and the actual cost of work accomplished—supplemented with audits for the purpose of testing whether invoiced costs are allowable. DOD policy dictates that CORs shall not be delegated authority to approve invoices (as this is the role of DCAA and administrative contracting officers), but they may review contractor billings to determine whether the hours billed and labor mix are commensurate with the work performed. CORs and program officials responsible for surveillance for the DOD contracts in our sample told us that they rely on contractor-provided monthly reports and EVM data to perform cost surveillance. EVM data do not provide surveillance of specific contract costs, as would be presented in an invoice, but are intended to alert program managers to potential problems with cost or schedule overruns sooner than a review of contract expenditures (such as an invoice review) alone would. At the same time, however, the EVM data’s level of detail at the contract and order level can be much less than that of an invoice—where the specifics in terms of labor categories, travel, and equipment would be reflected. Therefore, analysis of EVM data alone does not satisfy FAR requirements for cost surveillance under cost-reimbursement contracts. In addition to the key control discussed above—determining that the contractor’s accounting system is adequate—the EVM data must be supplemented with audits for the purpose of testing whether invoiced costs are allowable. DOD has two main sets of procedures in place to do this, one for when the contractors are approved for direct billing and one for when they are not. Direct billing allows approved contractors to send their invoices directly to the Defense Finance and Accounting Service for payment, without invoice review by either DCAA or the COR. DCAA is required to perform annual review of paid invoices. In addition, for contractors approved for direct billing, DCAA performs incurred cost audits and conducts “floor checks” at contractor facilities to test the reliability of such things as employee time records and job classifications. To be eligible to participate in the direct billing program, contractors must meet certain criteria, such as having an adequate accounting/billing system and related internal controls, as determined by DCAA. If a contractor is not eligible to participate in the direct billing program, the contractor must submit all cost-reimbursement interim invoices to DCAA for approval for provisional payment. DCAA then submits them to the Defense Finance and Accounting Service for payment. Figure 2 depicts these various procedures. The effectiveness of DOD’s cost surveillance process depends, to a large extent, on the adequacy of these DCAA procedures. Our recent work has raised concerns in this regard. For example, rather than documenting the population of invoices, preparing sampling plans, and testing a random (statistical) sample, as should be done, auditors generally used a nonrepresentative selection of invoices in deciding the number of invoices they would review and the extent of testing they would perform to support conclusions in their work. For example, we found that for one contractor that generated $1.1 billion in annual billings to the government, the DCAA auditor only reviewed 3 invoices totaling $88,000 out of 222 invoices submitted for payment from March 2003 through February 2004, tested the first invoice selected, and performed limited testing on the remaining 2 invoices. Despite this limited testing, DCAA prepared a memorandum for the record, stating that “continued reliance can be placed on the contractor’s procedures for the preparation of interim vouchers (invoices)” and “the contractor has met the criteria for continued participation in the direct billing program.” Also, we recently testified that allegations that certain audits at three locations did not meet professional standards were substantiated. Specifically, contractor officials and the DOD contracting community improperly influenced the audit scope, conclusions, and opinions in three cases, a serious independence issue. At two DCAA locations, we found evidence that (1) working papers did not support reported opinions, (2) DCAA supervisors dropped findings and changed audit opinions without adequate evidence for their changes, and (3) sufficient audit work was not performed to support audit opinions and conclusions. In our review, we found an additional example of what can happen when adequate cost surveillance is not in place. NSF awarded a $1.1 billion, 10- year 5-month cost-reimbursement contract (with options) for logistic and operational support for the U.S. Antarctic Program. As discussed in a series of NSF Office of Inspector General audit reports, DCAA found that the contractor was billing indirect costs as direct costs, billing over the negotiated ceiling limitations, and not providing supporting documentation for other costs. To compound these issues, NSF had not determined that the contractor’s accounting system was adequate for determining costs applicable to its contract. In November 2007, an independent auditor reported that NSF had significant weaknesses in its contract monitoring policies and procedures, meaning that the agency did not know whether the costs it was paying the contractor were allowable and reasonable. NSF officials acknowledged the weaknesses and have begun to take corrective action. As a final example of inadequate cost surveillance, in January 2009, the DOE Inspector General reported weaknesses in a contractor’s internal audit, which DOE relies on to help ensure that contractors’ costs charged to DOE are allowable under the terms of the contract. For fiscal year 2007, the contractor had expended and claimed over $1.4 billion. The Inspector General found that the contractor’s internal audit during fiscal year 2007 was not satisfactory in several material respects. Specifically: Procurements were not properly approved, but the contractor’s internal audit management permitted the contractor to provide approvals 3 years after the fact. Questioned costs associated with the procurements were omitted from the contractor’s audit report. The contractor’s internal audit manager encouraged the omission of information that confirmed improper labor cost allocations. After the completion of audit testing, the contractor’s internal audit management directed the modification of the testing attribute related to independent receipt of procured goods and services, an action that caused some of the questioned costs to be excluded from reporting. As a consequence, DOE managers at the Savannah River Site were not provided with the information necessary to fully comprehend the materiality of, or to address and resolve, internal control weaknesses. The contractor did not agree with all of the Inspector General’s findings, but did acknowledge weaknesses and indicated that it planned to address them. Conclusions Cost-reimbursement contracts are appropriate when contracting for requirements that involve substantial uncertainties, but they require careful management to protect the government’s interests. At a macro level, careful management is enabled by good information. Current reporting in FPDS-NG, specifically regarding the combination contract type and billions of dollars with missing contract types, does not provide decision makers with adequate visibility into the government’s use of cost- reimbursement contracts. Further, while the FAR cautions against the protracted use of cost-reimbursement contracts after experience provides a basis for firmer pricing, it does not set forth procedures or provide guidance for doing the analysis needed to make this determination. We found little evidence that agency officials are analyzing whether such a transition can be made. While recent congressional and executive branch actions are intended to help ensure that cost-reimbursement contracts are used only when appropriate, they have yet to take full effect. Recommendations for Executive Action We recommend that agency officials take the following four actions to address the cost-reimbursement contract issues we found. To help ensure that analysis is conducted to determine whether to continue using cost-reimbursement contracts when experience may provide a basis to transition to firmer pricing, we recommend that the Administrator of OFPP take steps to amend the FAR. Specifically, we recommend that the Administrator require procedures for contracting officers (in conjunction with the requiring activity) to analyze, before the award of a new contract or at other appropriate times during a contract’s period of performance, the agency’s requirement and determine if its experience with a procurement provides a basis for firmer contract pricing. The results and findings of this analysis should be documented in the contract file. If the analysis indicates that a basis for firmer pricing does exist, the procedures should require consideration, modification, and implementation, if feasible, of an acquisition plan to transition to a contract type with firmer pricing. To help clarify reporting requirements in FPDS-NG to provide a clearer picture of the extent to which various contract types, including cost- reimbursement, are being used, we recommend that the Administrator of OFPP implement controls in FPDS-NG to preclude information from being entered without a contract type being identified, that is, eliminate the “missing” contract type option and reconcile the conflicting instructions in the FPDS-NG user manual for coding combination contracts versus coding based on the preponderance of contract type. We also recommend that the Secretary of Health and Human Services direct the Director of AHRQ to provide guidance to the agency’s contracting staff to ensure that they are aware of their responsibility to ensure that contractors’ accounting systems have been deemed adequate before awarding cost-reimbursement contracts. Agency Comments and Our Evaluation We requested comments on a draft of this report from OFPP, the Departments of Defense, Energy, Health and Human Services, and Treasury; NASA; the Environmental Protection Agency; NSF; and the Corporation for National and Community Service. In comments provided via e-mail, OFPP agreed with the recommendations directed to it. The response stated that OFPP would work with the FAR Council to address the issue of setting forth procedures for determining whether analysis may indicate a basis for firmer contract pricing based on contract pricing history and requirements. OFPP also stated that version 1.4 of FPDS-NG (with a projected launch of February 2010) will make the selection of a contract type mandatory, so that new contract awards will no longer be coded as missing a contract type. Finally, OFPP stated that a decision was recently made, while our report was at OFPP for comment, to make changes to FPDS-NG to eliminate the “combination” contract type as an option for new contracts starting in fiscal year 2010. Modifications made to contracts awarded prior to fiscal year 2010 may still show “combination” as the contract type, as contract type is inherited from the base contract award; however, agencies have the ability to self-correct the contract type selection at any time, and the retroactive contract type selection will flow from the base contract to all modifications. A final recommendation to OFPP, which was in our draft report, has been removed based on new information. This recommendation had to with obligations coded as “other” contract type in fiscal year 2009. OFPP stated that agencies are prevented from selecting “other” as a contract type for new procurements awarded after September 30, 2008, but that this contract type may still occur on modifications made after that date. We analyzed fiscal year 2009 FPDS-NG information and confirmed that the obligations coded as “other” were modifications to existing contracts. OFPP noted that, as with the “missing” contract type, agencies have the ability to self-correct the “other” contract type on modifications to existing contracts. OFPP stated that it will discuss with agencies the burden associated with making these changes on a voluntary basis, such as when making modifications to contracts that were recently awarded and may not expire for a number of years. In written comments, reprinted in appendix II, NASA stated that the report provides a balanced view of the issues related to the use of cost- reimbursement contracts. The Department of Health and Human Services (HHS) also provided written comments, included in appendix III, agreeing with our recommendation directed to it. HHS stated that, in response to our findings, the Office of Acquisition Management and Policy issued a departmentwide notice to remind contracting staff of the need to ensure the adequacy of contractors’ accounting systems before award of a cost- reimbursement contract. HHS also stated that it would emphasize the importance of documenting the basis for cost-reimbursement contracts in acquisition plans and further encourage contracting officers to assess the viability of transitioning from cost-reimbursement contracts to more definite contract types. Finally, HHS provided additional information on AHRQ’s contract for its annual Medical Expenditure Panel Survey. The Departments of Defense, Energy, and Treasury provided technical comments which we incorporated as appropriate. The Environmental Protection Agency, NSF, and the Corporation for National and Community Service had no comments on the report. As agreed with your offices, unless you publicly announce its contents earlier, we plan no further distribution of this report until 30 days from the report date. We will then send copies of this report to interested congressional committees; the Secretaries of Defense, Energy, Health and Human Services, and the Treasury; the Administrators of the Environmental Protection Agency, NASA, and OFPP; the Director of NSF; and the Chief Executive Officer of the Corporation for National and Community Service. The report also will be available at no charge on GAO’s Web site at http:///www.gao.gov. If you or your staff have any questions about this report or need additional information, please contact me at (202) 512-4841 or needhamjk1@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this report. Staff acknowledgments are provided in appendix IV. Appendix I: Scope and Methodology To determine the extent to which federal agencies are using cost- reimbursement contracts, we extracted and analyzed, from the Federal Procurement Data System-Next Generation (FPDS-NG), cost- reimbursement coded contract actions and dollars obligated by agencies for fiscal years 2003 to 2007. In some cases, agency data are reported to FPDS-NG at component levels; in other cases, the entire agency reports as a whole. We also extracted and analyzed from FPDS-NG contract actions coded as “combination,” “other,” and “missing” for fiscal years 1999 through 2008. To determine what agencies are buying using cost-reimbursement contracts, we analyzed FPDS-NG data for fiscal year 2008. We also analyzed the statements of work for the contracts and orders in our sample. To determine agencies’ rationales for using cost-reimbursement contracts, whether contracting officers had deemed contractor accounting systems adequate for determining costs applicable to the contracts, and procedures for surveillance of contractor cost controls, we took the following steps. Based on FPDS-NG data for fiscal year 2007, we grouped the agencies and their components into three categories based on their reported obligations under cost-reimbursement contracts. Category 1 comprises agencies that reported obligating less than 20 percent of their total obligations in fiscal year 2007 under cost-reimbursement contracts. Category 2 comprises agencies with reported cost-reimbursement obligations of 20 to 50 percent. Category 3 comprises agencies with cost- reimbursement obligations of 51 percent and higher. We reviewed the files of 10 randomly selected contracts or orders, with obligations of at least $1 million, from 5 of the category 2 and 6 of the category 3 agencies, with two exceptions. We reviewed only one contract at the Corporation for National and Community Service and at the Department of the Treasury’s Alcohol and Tobacco Tax and Trade Bureau, as those contracts accounted for the totality of those agencies’ reported cost-reimbursement contracts in fiscal year 2007. In all, we reviewed 92 contracts or orders at the agencies listed below. Agencies were selected based on location and their reported use of cost- reimbursement procurements. Corporation for National and Community Service, Washington, D.C. – Department of the Air Force, Aeronautical System Center, Wright- Patterson Air Force Base, Dayton, Ohio – 33 percent Department of the Navy, Navy Strategic Systems Program, Arlington, Department of the Treasury, Internal Revenue Service, National Procurement Office, Oxon Hill, Maryland – 36 percent Environmental Protection Agency, Cincinnati Procurement Operations Division, Cincinnati, Ohio – 45 percent Department of Defense, Defense Microelectronics Activity, McClellan, Department of Health and Human Services, Agency for Healthcare Research and Quality, Rockville, Maryland – 87 percent Department of Energy, multiple sites in several states – 90 percent Department of the Treasury, Alcohol and Tobacco Tax and Trade Bureau, Washington, D.C. – 100 percent National Aeronautics and Space Administration, Glenn Research Center, Cleveland, Ohio – 81 percent National Science Foundation, Arlington, Virginia – 81 percent Our review of the contract files focused on whether the files contained documentation providing the rationales for awarding cost-reimbursement contracts and evidence that the contractors’ accounting systems were adequate for determining costs applicable to their contracts. We also reviewed the sections of the Federal Acquisition Regulation (FAR) and implementing agency policies and regulations that stipulate the requirements that need to be met before a cost-reimbursement contract is to be used. We interviewed a recognized expert from academia with experience with this contract type. To supplement file reviews, we interviewed agency contracting officers, contract specialists, or both to determine how they documented their rationales for awarding cost- reimbursement contracts. As a data reliability check, for the 11 agencies in our review we also identified cost-reimbursement contracts coded in FPDS-NG as buying commercial items. We did this because the FAR prohibits the use of cost- reimbursement contracts to acquire commercial items, as commercial items can be procured with a contract type other than a cost contract on the open market. FPDS-NG reported that 3 of the agencies had at least one cost-reimbursement contract coded as buying a commercial item. For these contracts, we obtained explanations for the coding from agency officials. In all cases, agency officials explained, to our satisfaction, that the coding was in error. For example, FPDS-NG showed that 12 cost- reimbursement contracts at the Air Force’s Aeronautical System Center were used to procure commercial items. Center officials explained that the coding was incorrect because of a glitch in the implementation of a new computerized contract writing system, which has subsequently been corrected. A review of the contracts showed that they should have been coded as fixed-price or time-and-materials contracts, not cost- reimbursement contracts, as reported to FPDS-NG. Further, we conducted interviews with agency procurement policy representatives and heads of contracting activities for 10 agencies with very high reported use (95 percent or more) of fixed-price contracts to determine the reasons for their low use of cost-reimbursement contracts. One of the agencies that we identified as having reported a high use of fixed-price contracts in fiscal year 2007, the Department of Justice’s U.S. Marshals Service, was dropped from this part of our review because we found that many of its contracts had been miscoded. Although the U.S. Marshals Service had reported 95 percent of its obligations as fixed price, discussions with contracting officials revealed that many of their obligations should have been coded as labor-hour contracts and not as fixed-price contracts. U.S. Marshals Service officials told us that they have taken steps to correct these coding errors in FPDS-NG. The remaining nine agencies, together with the percentage of their fiscal year 2007 obligations using fixed-price contracts, are presented below. Court Services and Offender Supervision Agency, Pretrial Services Agency, Washington, D.C. – 99.8 percent Department of Agriculture, Agricultural Marketing Service, Washington, Department of Agriculture, Farm Service Agency, Washington, D.C. – 98 Department of Agriculture, Agricultural Research Service, Washington, Department of Defense, Defense Commissary Agency, Fort Lee, Virginia – 100 percent Department of Defense, Defense Logistics Agency, Fort Belvoir, Virginia – Department of the Interior, Office of Surface Mining Reclamation and Enforcement, Washington, D.C. – 97 percent Department of Justice, Federal Prison System, Washington, D.C. – 97 General Services Administration, Public Buildings Service, Washington, Finally, to identify agencies’ procedures for surveillance of contractor costs, we reviewed contract files and documents maintained by surveillance officials for each contract and order in our review. We also reviewed agency cost surveillance procedures, relevant parts of the Defense Contract Audit Agency’s contract audit manual and our Cost Estimating and Assessment Guide, which provides information on practices for ensuring credible cost estimating, including earned value management. In addition, we interviewed contracting officers and the personnel responsible for the surveillance. Where appropriate, we supplemented our analysis with reviews of prior GAO reports, agency inspector general reports, and recent statutory and regulatory actions pertaining to cost-reimbursement contracts. We conducted this performance audit from July 2008 to September 2009 in accordance with generally accepted government auditing standards. Those standards require that we plan and perform the audit to obtain sufficient, appropriate evidence to provide a reasonable basis for our findings and conclusions based on our audit objectives. We believe the evidence obtained provides a reasonable basis for our findings and conclusions based on our audit objectives. Appendix II: Comments from the National Aeronautics and Space Administration Appendix III: Comments from the Department of Health & Human Services Appendix IV: GAO Contact and Staff Acknowledgments Acknowledgments In addition to the contact named above, Michele Mackin, Assistant Director; Julie Hadley; Daniel Hauser; Julia Kennon; LeAnna Parkey; Kenneth Patton; Matthew Shaffer; and Sylvia Schatz made key contributions to this report. SUMMARY: [/INST] Federal agencies obligate billions of dollars annually using cost-reimbursement contracts. This type of contract involves high risk for the government because of the potential for cost escalation and because the government pays a contractor's costs of performance regardless of whether the work is completed. As such, cost-reimbursement contracts are suitable only when the cost of the work to be done cannot be estimated with sufficient accuracy to use fixed-price contracts. Agencies may use this contract type only if certain conditions are met. At your request, GAO assessed (1) the extent of agencies' obligations under these contracts, (2) the rationales for using this contract type, (3) determinations that contractors' accounting systems are adequate for determining costs applicable to the contracts, and (4) procedures for monitoring contractor cost controls. GAO analyzed federal procurement data and contract files and interviewed contracting and other government officials. The complete picture of the government's use of cost-reimbursement contracts is unclear. From fiscal years 2003 through 2008 federal obligations under cost-reimbursement contracts were reported to have increased $16 billion, to $136 billion, which represented a decrease in the total percentage of federal obligations over the 6-year period, from 34 percent to 26 percent. However, the overall downward trend is misleading. A significant increase has been reported for obligations using the "combination" contract type, a category that based on GAO's analysis of 2008 data, includes many contracts with cost-reimbursement obligations that are not recorded as such. According to OFPP, a decision was recently made to eliminate the use of "combination" as a Federal Procurement Data System-Next Generation contract type, effective for all new contract awards starting in fiscal year 2010. In addition, GAO found billions of dollars for which the contract type had been coded as "missing" in fiscal year 2008. Agencies' rationales for using cost-reimbursement contracts were difficult to determine because contracting officers frequently did not document--even in acquisition plans--why they chose to use this contract type. The current requirement for such documentation is minimal, but recent legislation (not yet implemented in the Federal Acquisition Regulation) requires that acquisition plans address the rationale. Of the 92 contracts and orders GAO reviewed, about 30 percent did not include any documentation. The supporting documentation GAO did find generally did not explain why a cost-reimbursement contract for the specific requirement was selected. GAO also found little evidence that agency officials are analyzing contracts' pricing history and requirements to determine if they can transition to a contract type with firmer pricing, even though experience may provide a basis for doing so. Of the 92 contracts and orders GAO reviewed, about half had any evidence that, at least within 4 years before contract award, contractors' accounting systems had been deemed adequate to determine costs applicable to the contract. Twenty contract files had no evidence that the contractors' accounting systems were determined adequate and 20 other contract files contained determinations that had been made either many years before award or after the contract was awarded. Inadequate accounting systems, or accounting systems that had not been deemed adequate for many years, may result in the government making improper payments to contractors. GAO found a range of procedures for monitoring contractor cost controls at the agencies in its review. Procedures at the civilian agencies generally call for program officials to review contractor invoices. At the Department of Defense, cost surveillance depends on contractor-reported earned value management data, supplemented with audits for the purpose of testing whether invoiced costs are allowable. GAO's prior work has raised concerns about the effectiveness of these audits. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Isabel Ramsay, executive headteacher of Bandon Hill Primary School is paid more than the Prime Minister. A primary school head teacher is being paid more than £200,000 a year - taking her income above that of the Prime Minister. Isabel Ramsay is paid more than her boss, the chief executive of Sutton Council and is one of the highest paid headteachers in Britain. Her school, Bandon Hill Primary, said she is paid so much because she is executive head teacher and does work throughout London with other schools. But union workers have said they do not believe Mrs Ramsay should be paid so much more than other teachers and she should be focusing on her school rather than working at others. Mrs Ramsay's income was revealed after Sutton council published its core financial statement this year. This revealed she is paid £190,898 in salary, fees and allowances with a further £14,178 in employer's pension contribution, bringing the total to £205,076. The Prime Minister is paid £142,500 and Mrs Ramsey's boss, Niall Bolger received a basic salary of £163,635, with a pension top up of £28,473 bringing his total to £192.108. Mrs Ramsey's salary is determined by the governors at the school, not Sutton Council or the Department of Education. When Sutton Council asked the school to explain Mrs Ramsey's high income they said it covered her work at Bandon Hill as well as that supporting other schools across the country. Bandon Hill Primary School, in Wallington, south west London, is made up of two primary schools and Oak Field, a specialist autistic unit. Each of the three schools have their own headteacher. Nancy Bonney, 82, is the assistant secretary for NUT Sutton. She said: 'Every teacher I have ever met works extremely hard and their best for the children. 'I don't think a head teacher should work at more than one school. Even if you have the best deputy, it is not the same. Governors at Bandon Hill said Mrs Ramsay's salary is due to the work she does with schools across the UK. Mrs Ramsay's pay was revealed in Sutton Council's core financial statements, showing that with her salary and employer pension contributions she earns more than the chief executive of Sutton Council, her boss. 'She must be run off her feet even if she is very well organised. 'I don't know about head teachers being paid so much more than their staff and I don't think one head should be running more than one school.' Mrs Ramsay's salary increased from £172,218 last year, making her one of the highest paid headteachers in the country. A spokesman for the school governors said her pay reflected the fact she was running a'very large primary school'. He added: 'In addition the Executive Headteacher and other staff from Bandon Hill are currently supporting three other schools, one of which is in London, one in the South East and one in the East of England. As a national leader of education, and as a national support school, the Executive Headteacher and the staff provide a range of interventions, including working directly with other headteachers, to support those schools in accelerating pupil progress and in raising standards of attainment. Mrs Ramsay is one of the highest paid headteachers. In 2010 it was revealed that Mark Elms, 57, of Tidemill Primary School in Lewisham, south-east London, received £248,100. His salary which was due in part to his work on the London Challenge programme, was described as 'extraordinary' and 'exorbitant'at the time. And in May of this year Sir Greg Martin, executive head of Durand Academy in south London, saw his salary and pension increase to a total of £229,138. He was knighted in last year's birthday honours. Ric Adams, chairman of Bandon Hill Primary School's governors, said: 'The salary level of all staff in Bandon Hill, including the executive head teacher, is determined by the school's governing body. 'The salary figure currently being attributed to the executive head teacher is not an accurate reflection of the actual salary paid by Bandon Hill Primary School. 'Bandon Hill is a designated national support school and the executive head teacher is a national leader of education. 'Therefore the remuneration level quoted includes both pension contributions as per requirements and also reflects the work which the executive head teacher and the school do in supporting a number of other schools in several local authorities across the country.' A spokesman for Sutton Council said neither they or the Department of Education had been approached by the school's governors about Mrs Ramsey's level of remuneration.. He said: 'The level of pay for school staff is decided by school's governors and not the responsibility of the council. 'We are aware of the salary figure for the head teacher which is much higher than usual. In 2010 it was revealed that Tidemill Primary School headteacher Mark Elms (left) was earning a salary of £248,100 and earlier this year that Sir Greg Martin (right) was receiving an income of £229,138. 'We asked the governing body to explain the package and have been told it covers school salary plus remuneration for work done at schools in other local authorities.' Mrs Ramsay has been at the school for more than 20 years according to her LinkedIn profile. In its last Ofsted inspection in 2008 the then Bandon Hill Primary School achieved an outstanding rating SUMMARY: [/INST] Isabel Ramsay is executive headteacher at Bandon Hill Primary School. Her salary is £190,898 and she receives pension contributions of £14,178. She earns more than the Sutton Council chief executive and Prime Minister. Her total income makes her one of the highest paid headteachers in Britain. School governors say her pay is due to work with other schools in country. Mrs Ramsay works with three other schools to help raise attainment. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Genome-wide association studies (GWASs) have recently revealed many genetic associations that are shared between different diseases. We propose a method, disPCA, for genome-wide characterization of shared and distinct risk factors between and within disease classes. It flips the conventional GWAS paradigm by analyzing the diseases themselves, across GWAS datasets, to explore their “shared pathogenetics”. The method applies principal component analysis (PCA) to gene-level significance scores across all genes and across GWASs, thereby revealing shared pathogenetics between diseases in an unsupervised fashion. Importantly, it adjusts for potential sources of heterogeneity present between GWAS which can confound investigation of shared disease etiology. We applied disPCA to 31 GWASs, including autoimmune diseases, cancers, psychiatric disorders, and neurological disorders. The leading principal components separate these disease classes, as well as inflammatory bowel diseases from other autoimmune diseases. Generally, distinct diseases from the same class tend to be less separated, which is in line with their increased shared etiology. Enrichment analysis of genes contributing to leading principal components revealed pathways that are implicated in the immune system, while also pointing to pathways that have yet to be explored before in this context. Our results point to the potential of disPCA in going beyond epidemiological findings of the co-occurrence of distinct diseases, to highlighting novel genes and pathways that unsupervised learning suggest to be key players in the variability across diseases. Comorbidity studies show that some distinct diseases tend to co-occur [1]–[6], pointing to a shared genetic and/or environmental component. In the era of genome-wide association studies (GWASs), direct evidence of shared genetic risk factors of diseases comes to light [7]. For example, while it has been previously shown that rheumatoid arthritis and type-1 diabetes co-occur [1], GWASs have identified 12 genes associated with both diseases [8]–[16]. More broadly, disease genes obtained from the Online Mendelian Inheritance in Man [17] were used to assemble the Human Disease Network (HDN) [18], [19], a visual representation of genetic similarity between diseases. Pleiotropy of complex diseases and traits has also been explored by searching genome-wide for variants implicated in more than one disease [16], [20], [21]. Such studies promise to reveal shared genes and offer an expanded understanding from a genetic standpoint of why some diseases tend to co-occur. Methods for exploring shared genetic risk factors between diseases belong to two main categories (see also recent review [7]). The first category of methods focuses on finding individual variants that are associated with a pair or more of diseases being investigated. In one set of such methods, a GWAS is carried out on a pooled set of individuals with different diseases [10], [16], [20], [21], or by analyzing information for multiple diseases available for the same individuals [22], [23]. Alternatively, and based only on summary statistics of the association test for each single nucleotide polymorphism (SNP), one can simply combine p-values from several GWASs using Fisher' s method [24]. The CPMA (cross-phenotype meta-analysis) statistic [25] is another statistic that tests whether a SNP is associated to more than one phenotype. In addition, methods such as the conditional false discovery rate or mixed-models for multiple traits have used known pleiotropy between diseases or traits to increase power [26], [27]. Studies employing these methods have found shared associations between pairs of diseases such as Crohn' s disease and celiac disease [16], other autoimmune disease pairs [20], [21], bipolar disorder and schizophrenia [26] and multiple sclerosis and schizophrenia [28]. They have additionally shown that SNPs associated with one autoimmune disease are likely to be associated to other (though not all) autoimmune phenotypes [25]. The second category of methods focuses on using shared variants to learn about the genetic similarity between diseases. One method employed by Sirota et al. utilizes the correlation between association signals across many SNPs to assess the similarity between pairs of diseases and showed that there are likely two distinct autoimmune classes where a risk allele for one class may be protective in another [29]. Similar methods based on classifier [30] and linear mixed model approaches [27], [31] have also been proposed for assessing the shared genetic variation between two diseases. These exciting new methods are powerful for studying shared genetic risk variants between diseases. At the same time, overcoming some of their limitations can improve the study of shared pathogenesis using data from multiple GWASs. First, some methods have focused on analysis of individual SNPs. Though well suited for scenarios of a single causal SNP in a locus, such methods would suffer a reduction in power when several causal SNPs exist or if different SNPs tag the same underlying causal variant, which is especially relevant for diseases with rare causal variants [32], [33] and when the different GWASs are across different populations [34] or have used different genotyping arrays. Second, when considering the correlation between association statistics of different studies, it might be beneficial to not consider all variants equally (as is the case in [29]), whether or not they play a role in disease susceptibility. Third, most methods assume as known which diseases share pathogenesis, and while the shared pathogenesis of autoimmune disease has been well established [25], [29], it is worthwhile to study shared pathogenesis of other disease classes [6], [35], [36]. And fourth, while some approaches perform well for two correlated traits or diseases, extending the analysis to more than two traits can become difficult [27]. In this study, we present a novel method, disPCA, which uses principal component analysis (PCA) to learn about the shared genetic risk of distinct diseases. PCA maps data from the original axes into new axes in principal component (PC) space via a stretch and rotation of the original axes. Each new axis or PC captures the maximal level of variation in the data not captured by previous PCs. Thus, each PC can potentially capture a different, orthogonal story told by the data. Our method is based on summary level statistics from GWASs of different diseases. We combine data from individual SNPs into gene-based statistics via several p-value combination methods. PCA is applied to a matrix across genes and GWAS datasets, with entries representing the strength of association between a gene and the disease studied in a dataset. Thus, disPCA reveals principal components that are linear combinations of all genes, weighed in accordance with their role in differentiating between the different GWASs. It can be applied to study multiple diseases without prior knowledge of their shared pathogenesis, thereby overcoming all the limitations of existing methods outlined above. disPCA also accounts for potential confounders due to methodological differences between studies, such as in genotyping array, which can otherwise lead to these differences being captured by the PCA. Equipped with this novel method and with data from 31 GWAS datasets, we considered the level of shared pathogenesis between diseases and classes of diseases from all genes, which we term shared pathogenetics. Diseases with more similar underlying genetics are more likely to be located closer together in PC space. As PCA is a non-parametric method, it makes no assumptions regarding which diseases are more similar and does not aim to model it, thereby allowing discovery of new relationships between diseases by examining the top PCs. Each PC captures a different combination of genes that distinguish well between some diseases, or the remaining variation between diseases. No separation between diseases along a PC indicates that they tend to share the pathogenetics underlying that PC. By studying the set of genes underlying each PC for enrichment in specific pathways, we further assessed the function and relationship of genes that separate different disease clusters in PC space. We developed a method, disPCA, for studying the relationship between diseases based on their level of disease risk genes shared. The method works on the gene-level by first combining information from all SNPs in and around each gene. Considering gene-level statistics compensates for different tag SNPs being associated in different datasets even in cases where they capture the same causal variant. It also aggregates information across multiple tag SNPs in each dataset, as well as allows for different underlying causal variants in the same gene being associated with the risk of different diseases. To be widely applicable, disPCA is based solely on the p-values of association of each SNP with the disease under study. Importantly, all SNPs and consequently all genes are considered, rather than focusing on genes that meet a genome-wide significance level of association with a disease. We apply PCA to many different GWASs to axiomatically find and assign importance to genes based on their contribution to distinguishing between diseases and disease classes. The ensuing distance between different disease datasets in PC space inversely corresponds to their level of shared pathogenetics. For each protein-coding gene from the HGNC database [37], we mapped all SNPs that are in the gene or within 0. 01 cM from it (genetic distances were determined via the Oxford genetic map based on HapMap2 data [38], [39]). We discarded all SNPs that were not mapped to within 0. 01 cM of any gene. If a SNP lay between two genes, it was assigned to the closer gene. For each GWAS dataset, we determined the significance of association of each gene with the assayed disease using the following simulation procedure. Let the observed p-value of a gene be the minimum p-value of the n SNPs mapped to the gene. We compared the observed p-value to that of 100,000 groups of n consecutive SNPs chosen in random. Based on these groups, we assign a new p-value to each gene as the proportion of groups for which the observed minimum p-value for that gene is less significant than that of the group. This random sampling procedure may be biased in regions of high linkage disequilibrium (LD) when mapping SNPs to genes using genetic distance (e. g. consecutive SNPs in regions of high LD will be more correlated than those in regions of lower LD). However, for any given gene, these will equally affect each of the datasets. To validate this, we also applied disPCA to p-values obtained from mapping SNPs to genes using physical distance: a SNP was mapped to a gene if it was in the gene or within 10 kb of it. Comparing these results to results based on mapping via genetic coordinates revealed the same clustering of diseases (Figure S1). Furthermore, in studying the loading of each gene, namely their contribution to each PC, we found that the genes with the top 50 average loadings on the first two PCs were significantly correlated (r>0. 67, p-value<8. 4×10−8, Table S1). Thus, in the main text we present results based on mapping by genetic distance as described above. To consider information from beyond only the most significant SNP in a gene, we also implemented the truncated tail strength [40] and the truncated product methods [41] to combine p-values in each gene in replacement of the minimum p-value, and followed a similar procedure for assigning new gene-level p-values. For the analyses presented in the following, results from all methods were similar though results with the minimum p-value approach clusters similar diseases better (Figure S2, S3). We thus only report in the main text results from the minimum p-value approach. Code to carry out this procedure is publicly available at http: //keinanlab. cb. bscb. cornell. edu/content/tools-data. Assume a matrix Z, a d×g matrix of the −log10 gene-level p-values, where d is the number of GWAS datasets, and g is the number of genes present in all datasets. We center the matrix by subtracting the column means from each column. Thus the centered matrix B has entries: (1) To obtain the PCs of matrix B, we must find the eigenvectors and eigenvalues of its covariance matrix BBT. Let vi be a vector of length d and let be a scalar. vi is the eigenvector and λ the eigenvalue of BBT if the following is satisfied: (2) The principal components of B are the normalized eigenvectors of its covariance matrix, BBT, where the eigenvectors are ordered such that the largest eigenvalue corresponds to the first principal component. Each eigenvector is additionally orthogonal to all other eigenvectors. Thus, from (2), we can decompose BBT as follows: (3) Where the columns of U contain the principal components and ∑ is a diagonal matrix with entries equal to the eigenvalues of B' s covariance matrix. One can similarly construct the singular value decomposition (SVD) of B. The SVD of B can be written as: (4) where V is a d×d matrix, D is a d×g diagonal matrix, and W is a g×g matrix. V and W contain the left and right singular vectors of B, respectively, and D contains the singular values of B in its diagonal. Substituting equation (4) for B in equation (3), we find that (5) Thus, the principal components of B, the eigenvectors of its covariance matrix, are equivalent to the left singular vectors of B. In addition, the eigenvalues of B are equivalent to the square of its singular values. We applied SVD to the matrix B using the R [42] implementation of PCA/SVD (prcomp), with no scaling of the data. Due to the heterogeneity of the GWAS datasets (Table S2), variation uncovered by PCA can also reflect differences in features such as genotyping array, association method, and sample size, rather than underlying disease risk genes. To ensure that these features did not influence our results, we first tested each gene for association with each of these features. Let zi = Zi, · be the vector corresponding to the association statistic for gene i across the d datasets. We considered a linear regression of zi as a function of the covariates:, where C1, C2, C3 are vectors of length d that represent the genotyping array, association method and the log10 of the sample size respectively, in each of the studies (Table S2). Testing the significance of regression coefficients can reveal genes that are associated with any of these potential confounders. In our following analysis, 19 genes were significantly associated with association method. However, genes not significantly associated to the above confounders may similarly have an effect. Hence, we also applied SVD (as described above) to the residualized matrix, namely matrix R with rows. We found that applying SVD to R results in the top PCs capturing a higher fraction of the variance of the data than when applied to the original matrix Z, though results are qualitatively similar between the two. We thus present results derived from the residualized matrix R. Resulting distances between datasets were assessed visually by plotting datasets in PC space. To quantify the clustering of datasets, we additionally applied hierarchical clustering in R [42] (hclust) to the Euclidean distance between pairs of datasets across the first two PCs. We simulated a matrix Z for two disease classes, each with 5 diseases (A1, A2, A3, A4, A5, B1, B2, B3, B4, B5) and 10,000 genes. In general, under the null hypothesis of a region containing no risk variant and assuming no confounding factors (e. g. population stratification), p-values should be uniformly distributed between 0 and 1. On the other hand, associated risk variants should be enriched for smaller p-values. We thus considered three sets of genes. The p-values for the first set of genes was drawn from the U (0,1) distribution for all diseases, thus no pleiotropy was captured in this set of genes. The second set of genes was distributed U (0,0. 05) for the first disease class (A1, …, A5) and distributed U (0,1) for the second disease class (B1, …, B5). Finally the third set of genes was distributed U (0,0. 05) for the following diseases: A1, A2, B1, B2 and distributed U (0,1) for all other diseases. Thus the second set of genes simulates pleiotropy between diseases in disease class A, while the last set of genes simulates pleiotropy between diseases in both disease classes. Disease enrichment analysis was completed using the online tool WebGestalt [43], [44] to query the PharmGKB [45] database. WebGestalt tests for enrichment of a category of genes in the observed set of genes using the hypergeometric test [43]. Bonferroni correction for multiple tests was applied and all reported p-values are following this correction. We restricted analysis to categories that contained a minimum of 5 genes in our analysis with the largest 50 weightings in the top two PCs. For gene categories with overlapping or the same set of genes, we list the most significant category. To reduce biases introduced by the clustering of genes with similar function, we filtered our list of genes with the top 50 loadings on the top two PCs by removing the latter gene out of a pair of genes within 0. 1 cM of each other. We then applied WebGestalt to this filtered subset of genes. Pathway enrichment analysis was completed using the Gene Set Enrichment Analysis (GSEA) tool [46]. GSEA sorts genes according to a score, which here is the weighting of a gene in the PC under study. It then assesses whether genes belonging to a certain category (e. g. pathway) are non-randomly distributed in the sorted list. As input to GSEA, we utilized the weights of genes in the top two PCs. GSEA carried out 10,000 gene-set permutations to determine FDR (false discovery rate) q-values. We queried the BioCarta and KEGG pathway databases. We restricted analysis to categories that contained a minimum of 5 genes in our analysis. Throughout we present enrichment analysis only for the top two PCs, though other PCs are available and can be assayed for further insight into the diseases studied. We considered an FDR of 0. 25, suggested by GSEA [46] (GSEA manual online), though this entails that 1 in 4 of our results are false positives on average. As above, to reduce biases introduced by the clustering of genes with similar function, we filtered our full list of genes by removing the latter gene out of a pair of genes within 0. 1 cM of each other and reanalyzed this subset of genes (n = 5,298) with GSEA. We followed a similar approach to that implemented in Zhernakova et al. 2011 [21] while applying it to genes instead of individual SNPs to test for non-random distribution of association values. For each disease pair we retained all k genes that were nominally significant in one disease (p-value<0. 01). We then tested the null hypothesis of a uniform distribution of p-values in the second disease using Fisher' s method for combining p-values:, where pi is the p-value for association of gene i in the second disease. Nearby genes in linkage disequilibrium may violate the independency assumption in Fisher' s method. We thus performed a separate analysis after removing the latter of the two genes that were within 0. 1 cM of each other and nominally significant in one disease. We analyzed a total of 31 GWAS datasets [10], [47]–[76] that spanned different types of cancers, autoimmune diseases, neurological disorders, psychiatric disorders, type-2 diabetes (T2D), ischemic stroke and body mass index (BMI) (Table S2). Datasets were publicly available, obtained from dbGaP or obtained via collaborations. These datasets had non-overlapping samples and were of European ancestry only. For Wellcome Trust Case Control (WT) related datasets, we distributed controls between the five datasets such that none had overlapping samples. For WT type-1 diabetes, rheumatoid arthritis and Crohn' s disease, we obtained further controls from the WT hypertension, cardiovascular disease and bipolar disorder case data [10]. After obtaining gene-level association statistics for 14,018–17,438 autosomal genes for each dataset, we limited our analysis to the 11,927 genes that overlapped all studies. Nineteen of these genes were significantly associated with association method after multiple-testing correction (see above). We tested the replicability of disPCA when applied to real GWASs using six datasets for which we had access to the original data [10], [57], [60], [61], [74], [75]. Each dataset was split into independent subsets of equal size (+/− two samples). We then used PLINK' s logistic regression [77] to evaluate association of each SNP to disease risk. We additionally incorporated covariates derived from EIGENSOFT into the regression analysis [78] to control for population structure. We randomly chose one subset of each of the six datasets for one disPCA analysis, and the rest for another. Hence, these two analyses consist of independent samples. We first applied disPCA to a simulated dataset (Materials and Methods). We varied the number of genes that have correlated association results across simulated datasets, thereby varying the level of pleiotropy between the simulated diseases. disPCA clearly clustered pleiotropic diseases when diseases shared at least 40 shared genes with p-values randomly distributed below 0. 05 in each disease (Figure 1a–b, S4, S5, S6). This can be seen both visually via PCA plots, and via hierarchical clustering based on the Euclidean distance between datasets in the presented space of the first two principal components (PCs) (Figure 1, S4, S5, S6). When diseases are indeed clustered by their simulated pleiotropy according to disPCA (Figure 1b), the first two PCs explain a similar fraction of the variance (Figure 1c), which may increase or decrease depending on the number of genes contributing to pleiotropy (Figure S7). We next examined the contribution of each gene to each PC as captured by its absolute “loading”. Considering the first two PCs in this disPCA analysis, genes with p-values<0. 05 (Materials and Methods) are also enriched for larger absolute loadings, stressing their role in differentiating between the simulated disease classes (Figure 1d–e). We next applied disPCA to empirical data from GWAS datasets. First, we considered only diseases for which we had two datasets: autoimmune diseases (for which we had the most pairs of datasets) and a pair of schizophrenia datasets (as schizophrenia has a high heritability [79]). We observed that datasets of the same diseases were generally clustered together (Figure 2–3). We additionally observed that Crohn' s disease is separated from other autoimmune diseases. This result is consistent with previous reports that inflammatory bowel disorders (IBDs) are distinct from other autoimmune disorders [29]. As in the simulated scenarios, the variance explained by each PC was similar (Figure 2b), and the results suggest that less than a hundred genes contribute to the similarity between each pair of datasets (Figure 3c–d). To test the replicability of the results, we further divided each of the six datasets, for which we had the raw data, into two subsets consisting of the same or similar number of cases and controls (Materials and Methods). We then performed two disPCA analyses, one based on a randomly chosen subset of each of the six datasets, and another based on the remaining subset of each dataset. We found that both independent sets produced the same clustering of diseases (Figure S8, S9). Loadings for 50 genes with the largest average loading across the two disPCA analyses of PC1 and PC2 were also significantly correlated across the two (r>0. 44, p-value<1. 2×10−3, Table S3). These results point to disPCA capturing some of the same pleiotropy in both cases, and further support the replicability of its results. We applied disPCA to a final set of 31 datasets (Table S2), including autoimmune diseases, cancers, obesity-related diseases and traits, psychiatric disorders and neurological disorders. The first two PCs capture visually-interpretable separation of diseases. PC1 for the most part splits the two systemic lupus erythematosus (SLE) and the one dataset of celiac disease from all other datasets (Figure 4). Independent of that separation, PC2 splits autoimmune diseases (in purple) from other diseases, and within autoimmune diseases, inflammatory bowel disorders (Crohn' s disease and ulcerative colitis) are clustered together (Figures 4–5). Schizophrenia, major depressive disorder, cancers, T2D and neurological disorders lie on the negative end of PC2, while attention deficit hyperactivity disorder (ADHD), and some autoimmune diseases that are not well separated on this PC from other diseases, lie near the origin. PCs beyond the first two explain almost the same fraction of the variance (Figure 4b) and hence merit further investigation (see Discussion). As disPCA teases out the important genes of shared and distinct pathogenetics across disease datasets, we next investigated which genes strongly contribute to each PC based on their absolute loadings. Specifically, we retrieved the genes with the top 50 absolute loadings for each of the top two PCs underlying Figure 4 and tested their disease enrichment (Materials and Methods). The top genes underlying the first PC were significantly enriched for genes associated with lupus and autoimmune related diseases, while genes underlying the second PC were mostly enriched for association to IBD (Table 1). These enrichment results are consistent with the separation of studies across each of these 2 PCs with PC1 mostly separating studies of SLE and celiac diseases, and PC2 mostly separating studies of IBD from other diseases. The results were largely unchanged following filtering genes that were within 0. 1 cM of each other to account for linkage disequilibrium and for similar genes being co-located to each other, such as gene families (Table 1) (Materials and Methods). Though the results of the disease enrichment analysis support that disPCA extracts biologically relevant signals, the arbitrary cutoff of the 50 top genes goes against the potential of PCs being linear combinations of all genes. We thus used GSEA [46], which supports analyzing a pre-ranked list of all genes, to perform pathway enrichment of each PC. GSEA assesses whether genes belonging to a certain pathway are non-randomly distributed in the list of pre-ranked genes. We ranked all genes by the absolute loading in the PC under study. Results of this pathway analysis revealed enrichment for immune related pathways on the first 2 PCs (Table 2) at an FDR of 0. 25. The top two pathways enriched on PC1 were the antigen processing and presentation and the intestinal immune network IgA production pathways, which are crucial immune-related pathways. In particular, intestinal IgA antibodies may have a role in celiac disease [80] and inflammatory bowel disease [81], [82]. On PC2, the most significant pathway was the NOD-like receptor signaling pathway. NOD-like receptors have been associated to Crohn' s disease, while other immune-related genes likely interacting with NOD2 have been associated to ulcerative colitis [83]. Other immune system pathways were enriched, including the Fc epsilon RI signaling pathway that is related to the antibody IgE, which induces inflammatory response [84]. Two enriched pathways are related to neurons (i. e. the neurotrophin signaling pathway and the Trk-A pathway). In particular, the neurotrophic factor BDNF (brain-derived neurotrophic factor), which is a part of the neurotrophin pathway, has been previously associated to Alzheimer' s, Parkinson' s disease and depression [85]–[87]. More recently, an intronic variant in this gene has also been associated to BMI [88]. The contribution of genes in these pathways to PC2 may explain the separation of neurological, psychiatric and BMI studies along that PC. As above, we reran GSEA after filtering genes that were within 0. 1 cM of each other (Materials and Methods). The top two pathways on the first PC remained significant, while only the top pathway in PC2 remained significant (Table S4). This is likely due to the contribution to enrichment of several genes that are co-located, which should hence not necessarily be discounted. Many autoimmune diseases share associations from the HLA region. We thus reran disPCA after removing all genes in and around the HLA region, and found a slightly different visual PCA map (Figure 6). SLE and celiac disease were no longer distinguished from other autoimmune diseases and instead lay near the origin. PC1 now differentiated IBD from other diseases, and PC2 separated some autoimmune diseases from the rest on one extreme, and schizophrenia from the rest on the other. This was further supported by clustering results on the first two PCs (Figure S10). A GSEA analysis of the PC loadings retained the NOD-like receptor signaling pathway on PC1 instead of PC2 (Table 3). Analysis of PC2 loadings revealed additional immune related pathways that were not enriched in our previous analysis that included the HLA region. Results such as PC1 in the main analysis clustering schizophrenia close to some autoimmune diseases (Figure 4) prompted us to further explore the shared pathogenetics between diseases by testing for the non-random distribution of gene-based p-values in one disease based on their nominal significance in another disease (Materials and Methods). Generally, the results show that association statistics are non-randomly distributed when considering most pairs of autoimmune diseases, i. e. testing for non-random distribution in one autoimmune disease dataset based on significance in another autoimmune disease dataset (Figure 7). As a control, we tested for non-random distribution for a random set of genes and found that no disease pair was significant for non-random distribution (Figure S11). Our results reported a similar story as observed via disPCA. Genes nominally significant in rheumatoid arthritis, type-1 diabetes and ankyolosing spondylitis were non-randomly distributed in SLE and vice versa. We also found that genes nominally significant for one schizophrenia study were non-randomly distributed in a number of autoimmune diseases (Figure 7). These signals remained even after genes within 0. 1 cM of another gene were removed (Figure S12) (Materials and Methods). In this study we introduced a new method, disPCA, to explore the shared pathogenetics of various diseases and disease classes based on GWAS data. PCA has been widely used in population and medical genetics. Applied to genome-wide genotyping data, it can recapitulate population structure such as revealing European geography [89], has been used as a tool to assess and correct for population stratification in GWAS [78], [90] and has also been proposed as a tool for reducing the dimensionality of multiple phenotypes for association analysis [91]. Our disPCA method considers PCA on a different type of matrix, whereby different GWASs are studied in the space of all genes. It can group GWASs of different diseases together based on gene-level association statistics, while accounting for biases due to heterogeneity in sample size, association method, genotyping array and other confounders between studies. This implementation of PCA assigns weights to each gene and each PC in a manner that maximizes the variation between diseases. Hence, the higher the level of shared pathogenetics between diseases, the closer they will be in PC space. This is in contrast to methods that considered the correlation between diseases across all SNPs [29]. In fact, when we consider such correlations in our data, it is generally very low, even when considering it on the gene rather than on the SNP-level and even when the same disease is studied. For example, the correlation coefficient between the −log10 p-values of the two Crohn' s disease studies is 0. 048, and it is 0. 063 and 0. 031 between ulcerative colitis and each of the two Crohn' s disease studies. More generally, the highest correlation between pairs of datasets of the same disease was obtained for schizophrenia (0. 13, p-value = 2. 2×10−16) while the lowest was obtained for type-2 diabetes (0. 0031, p-value = 0. 73). These results show that there is less power when aggregating information across all genes and that disPCA is able to tease out and weigh the suitable set of genes underlying shared pathogenetics. Though disPCA is designed to uncover shared disease etiology between diseases, other sources of correlation between datasets can also contribute to its results. Potential confounders include shared samples between datasets, technical artifacts, and population structure (if risk factors vary across ancestry). We accounted for technical artifacts introduced by the genotyping array, association method and sample size by regressing out variation in the data attributed to these sources (Materials and Methods). To minimize the impact of population structure and shared samples, we only applied disPCA to studies of individuals of European ancestry and datasets that had no overlapping case or control data. Though we cannot account for other potential confounders that are unknown, our results strongly suggest that the remaining correlation between studies represent shared disease etiology. We applied disPCA to data from 31 GWASs that cover a range of diseases in four main classes: autoimmune diseases, cancers, neurological disorders and psychiatric disorders. We additionally analyzed GWASs on T2D, BMI and ischemic stroke. We first observed that different studies of the same diseases tend to lie closer together on the lead PCs (Figure 2). This is in support of studies of the same disease replicating many of the same signals of associations when samples are of similar ancestry. We additionally find that disPCA positions diseases within the same class closer together (Figure 4). This was especially the case for the major types of IBDs (i. e. Crohn' s disease and ulcerative colitis), which clustered close together (Figure 5). This points to distinct etiology shared between IBDs, that is not shared between IBDs and most other autoimmune diseases. Indeed, it has recently been suggested that IBD is at least in part a primary immunodeficiency disorder [92], [93]. Between the different disease classes, the main 2 PCs in disPCA found overlap between non-autoimmune diseases and traits, as well as pointed to a potential connection between schizophrenia and some autoimmune diseases. Using the weightings of genes on each of the leading PCs, we performed disease and pathway enrichment analysis. We found that PC1, which mainly splits some autoimmune disorders from other autoimmune disorders, is significantly enriched for genes associated to immune and autoimmune disorders. PC2, which splits IBD studies from studies of other diseases, is significantly enriched for genes in some inflammatory related pathways and genes associated with IBD. Further results in PC2 highlighted neuron-related pathways that can be in line with evidence that abnormal neurotrophins levels in the brain have been associated to schizophrenia [94], [95]. Excluding the HLA region revealed significant enrichment for genes in other immune-related pathways. Though the specific analysis presented in this paper focused on the top two PCs, further PCs estimated by disPCA can be examined. For example, PC4 of disPCA on all GWASs distinguishes rheumatoid arthritis from other diseases (Figure S13). Pathway enrichment analysis highlighted the calcineurin pathway (FDR = 0. 182), which is involved in T-cell activation. Additionally, though schizophrenia and vitiligo datasets are further apart on the first two PCs, each pair of datasets is clustered closer together on PC3 and PC4. Altogether, these results support the validity of the enrichment analysis based on disPCA. The analysis in turn also raises new hypotheses of disease etiology by pointing to additional pathways and enrichment for other diseases that were not previously observed. Prompted by the results of disPCA, we further explored shared pathogenetics by testing for the non-random distribution of association statistics between pairs of disease studies (Figure 7). Autoimmune diseases show non-random distribution of association statistics with one another. Interestingly, genes nominally associated with one of the schizophrenia studies were non-randomly distributed in studies of several autoimmune diseases (i. e. ankyolosing spondylitis, systemic lupus erythematosus, and T1D), in support of the above disPCA results. Interestingly, this relationship was only observed for one of the two schizophrenia studies we analyzed, which may be due to a number of factors, including high number of risk factors for schizophrenia, with different ones being associated in different studies. If indeed autoimmune diseases and schizophrenia share disease etiology, then just as one would not include individuals with ulcerative colitis as controls for a Crohn' s disease GWAS since they both are IBDs, one should also be wary of including individuals with autoimmune disorders in a schizophrenia GWAS (and vice versa) as doing so may decrease power in loci implicated in both diseases. Lack of power due to such or other reasons might also underlie our lack of observation of significant shared etiology between the second schizophrenia dataset and autoimmune diseases. Finally, we make a few recommendations for future applications of disPCA to additional studies: (1) Biases can be introduced when studies share sample data; (2) As disPCA maximizes variance across diseases, genes that are implicated in all analyzed diseases will not contribute to the lead PC as they do not distinguish diseases from each other; (3) While here we only focused on using the strength of association and on gene-level signals, the method itself is highly flexible. One can further utilize the direction of association (protective versus deleterious), the heritability at each locus [96], an analysis at the pathway-level or in linkage disequilibrium blocks, include other non-genic functional elements, and/or environmental risk factors; (4) disPCA can be used to generate new hypotheses, which can then be tested by conducting more focused association studies in independent data or by using its output to better combine different diseases in an independent meta-analysis. New hypotheses can also be generated with regard to the genes that contribute to comorbidity between diseases. In conclusion, disPCA offers users a unique general overview of the disease landscape by studying their distinct and shared pathogenetics and flagging pathways and genes for further investigation. disPCA' s flexibility and computational efficiency proves itself as an excellent tool to be applied to additional diseases and disease classes to further our knowledge of shared pathogenetics. SUMMARY: [/INST] Epidemiological studies have revealed distinct diseases that tend to co-occur in individuals. As genome-wide association studies (GWASs) have increased in numbers, more evidence regarding the genetic nature of this shared disease etiology is revealed. Here, we present a novel method that utilizes principal component analysis (PCA) to explore the relationships and shared pathogenesis between distinct diseases and disease classes. PCA groups and distinguishes between data points by uncovering hidden axes of variation. Applying PCA to 31 GWASs of autoimmune diseases, cancers, psychiatric disorders, neurological disorders, other diseases and body mass index, we report several findings. Diseases of similar classes are located near each other, supporting the genetic component of shared disease etiology. Genes that contributed to distinguishing between diseases are enriched for various pathways including those related to the immune system. These results further our knowledge of the genetic component of shared pathogenesis, highlight possible pathways involved and provide new guidelines for future genetic association studies. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Revealing full-body scans and genital-touching pat-downs are poised to become a regular fixture of airline travel in the U.S., and people are hopping mad about it.There have been accusations on both sides of fear mongering, insider profiting scandals and abuse Some of the effects of this two month-old change in the way airline passengers are screened are already being felt: CBS News travel editor Peter Greenberg warns that the most immediate effect of these new security procedures will be longer lines and even travel delays, perhaps in no small part because even airline pilots have come out vehemently against them.• There are several reports, some disputed, of dust-ups with Transportation and Security Administration agents not really offering promised alternatives to the scans.• Some reports claim TSA agents are simply booting passengers and pilots from airports for refusing to take part, something the TSA notes is its right to do after a 9th U.S. Circuit Court of Appeals ruling.A surprising effect of the scans may eventually be a decline in air travel, according to an online Reuters poll. Reuters' readers were asked whether or not they would change their travel plans to avoid the invasive scans and pat-downs, and a whopping 96 percent (65,708 of 68,513) have thus far said yes.Those numbers could be skewed because one of the plethora of online opponents to the new scanning procedures may have asked readers to go to the site and vote.In contrast, a new CBS News Poll released Monday found 81 percent of Americans think airports should use these new machines -- including a majority of both men and women, Americans of all age groups, and Democrats, Republicans, and independents alike. Fifteen percent said airports should not use them.For her part, Homeland Security Secretary Janet Napolitano says in a USA Today opinion piece that body scanners used at many airports are safe and the images viewed in private. Health Blog: Should John Tyner Should Worry about More Than His Junk? Flying somewhere Nov. 24? You could be walking into the midst of a large-scale protest aimed at getting passengers to turn down full-body scans at airports. National Opt-Out Day is planned for the day before Thanksgiving, one of the busiest days of the year for airports. A group of activists is calling on passengers to exercise their Transportation Security Administration-given rights and decline full-body scans that allow technicians to see through their clothes. The American Civil Liberties Union and other groups are up in arms about the scans, saying they violate privacy rights. But some, including pilots unions, say the slower pat-downs aren't much better. Allegations of improper groping have surfaced recently, causing some to demand new security-screening methods at airports. "This country needs security measures in place that not only keep us safe but also do not grossly violate privacy or constitute an unreasonable search, like the current protocol," opt-out organizers wrote in a statement on optoutday.com. A recent CBS poll found that 81 percent of Americans are OK with full-body scanners being used at airports. The opt-out protest is hoping to motivate Congress to pass harsher laws to protect privacy at airports. "It's the day ordinary citizens stand up for their rights, stand up for liberty, and protest the federal government's desire to virtually strip us naked or submit to an 'enhanced pat down' that touches people's breasts and genitals in an aggressive manner," organizers said. They added: "You should never have to explain to your children, 'Remember that no stranger can touch or see your private area, unless it's a government employee, then it's OK.'" Scanners were installed at the Seattle-Tacoma International Airport earlier this fall. SUMMARY: [/INST] A group of organizers angry about full-body scans is sticking with its plan to snarl airport congestion on one of the busiest travel days of the year-the day before Thanksgiving. National Opt-Out Day encourages passengers to opt out of the scans and choose the more time-consuming pat-downs instead. The idea is to pressure Congress into better protecting passenger privacy, reports the Seattle Post-Intelligencer. Despite all the recent hubbub, a recent CBS poll found 81% of Americans have no issue with the use of full-body scanners at airports. Still, if you're interested in joining in on the protest, Jeffrey Goldberg at the Atlantic offers this advice to send an especially pointed message: Wear a kilt, sans underwear. "If nothing else, this will cause TSA employees to throw up their hands in disgust." </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Jennifer Newton. The family of Sir Arthur Conan Doyle, pictured, have been accused of extortion for charging authors to use his characters. A judge has accused the family of Sherlock Holmes creator Sir Arthur Conan Doyle of extortion by charging authors a fee to use his most famous characters. Heirs to the literary rights of the author had filed an appeal with the U.S. Supreme Court in a bid to stop the publication of a book based on the characters Sherlock Holmes and Dr Watson, insisting they must pay a license to use the characters. But a judge in the US has ruled that due to the copyright expiring on all but the last ten Sherlock Holmes stories, charging publishers and authors to use the characters amounted to extortion. According to the Times, Judge Richard Posner of the Seventh Circuit Court of Appeals made the comments after author Leslie Klinger refused to pay for the licence in his new book, In The Company of Sherlock Holmes. Previously he had ruled against the estate's argument and said Mr Klinger was free to use the characters. Now the judge has criticised the estate and ordered it to pay $30,000 in costs. Judge Posner said: The Doyle estate's business strategy is plain; charge a modest fee for which there is no legal basis, in the hope that the 'rational' writer or publisher will pay it rather than incur a greater cost in challenging the legality of the demand. 'It's time the estate changed its business model.' However, lawyers for the estate said they were considering an appeal and said the judge's comments were out of touch. Mr Kilnger had previously paid for the licence in his first book A Study In Sherlock, even though he didn't believe he needed to. Leslie Klinger, left, refused to pay the $5,000 demanded by the family of Sir Arthur Conan Doyle for his new book, right. But he refused to pay a second time, which led to legal action. Doyle wrote four novels and 56 short stories about the London-based sleuth which were published in the U.S. between 1887 and 1927. U.S. copyright protection for the novels and the first 46 stories has lapsed and they are now in the public domain, but the final ten stories remain under copyright. Mr Klinger argued that the essential characteristics of Holmes and Watson, played by Benedict Cumberbatch and Martiin Freeman in the BBC show, were established in the works already in the public domain. For his latest book, Mr Klinger refused to pay and in June a federal appeals court in Chicago ruled in his favour, sparking the latest court action. At the time Judge Posner wrote: 'When a story falls into the public domain, story elements - including characters covered by the expired copyright - become fair game for follow-on authors.' Mr Klinger argued that the essential characteristics of Holmes and Watson were established in the works already in the public domain. Therefore, he says, he and his team are free to write new works based on them. In Britain, works are protected for 70 years after an author's death meaning the works are long out of copyright SUMMARY: [/INST] Family of Sir Arthur Conan Doyle had insisted authors must pay to use his characters. This is despite copyright expiring on all but 10 of the books in the U.S. Judge accuses family of extortion for trying to charge $5,000 to use characters. Previous hearing had ruled against estate and in favour of Leslie Klinger. Mr Klinger had refused to pay for licence for his new Sherlock-inspired book. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Background As you know, Mr. Chairman, the decennial census is a constitutionally mandated enterprise critical to our nation. Census data are used to apportion seats and redraw congressional districts, and to help allocate hundreds of billions of dollars in federal aid to state and local governments each year. In developing the 2010 Census, a long-standing challenge for the Bureau has been the reliability of its IT systems. For example, in March 2009, we reported that the Bureau needed to develop a master list of interfaces between systems; set priorities for the testing of interfaces based on criticality; and develop testing plans and schedules. In the months that followed, while the Bureau strengthened its management and oversight of its IT systems, additional work was needed under very tight time frames. More generally, now that the census has moved to the operational phase, it will be important for the Bureau to stay on schedule. The enumeration has several immutable deadlines, and an elaborate chain of interrelated pre- and post-Census Day activities are predicated upon those dates. Specifically, the Department of Commerce—the Bureau’s parent agency— is legally required to (1) conduct the census on April 1 of the decennial year, (2) report the state population counts to the President for purposes of congressional apportionment by December 31 of the decennial year, and (3) send population tabulations to the states for purposes of redistricting no later than 1 year after the April 1 census date. To meet these reporting requirements, census activities need to take place at specific times and in the proper sequence. A time line of key census operations is shown in figure 1. Because of these tight deadlines, as the enumeration progresses, the tolerance for any operational delays or changes becomes increasingly small. Consequently, as the enumeration progresses, it will be important for the Bureau to closely monitor key performance metrics to ensure that the various operations are on track and quickly address any glitches. Indeed, the interrelated nature of census activities raises the risk that a shortcoming in one operation could trigger other activities to spiral downward. For example, a lower than expected mail response rate would drive up the follow-up workload, which in turn would increase staffing needs and costs. Of course the reverse is also true, where a success in one operation could have a number of positive downstream impacts. Key IT Systems Are Experiencing Significant Performance Issues Although the Bureau has made progress in testing and deploying IT systems for the 2010 Census, significant performance issues have been identified with both the workflow management system—PBOCS—as well as with the Decennial Applicant Personnel and Payroll System (DAPPS), the automated system the Bureau is using to handle the payroll of the more than 1 million temporary employees that are to work on the census. In March 2009, we reported that the Bureau had a number of problems related to testing of key IT systems, including weaknesses in test plans and schedules, and a lack of executive-level oversight and guidance. In that report, we recommended that the Bureau complete key system testing activities and improve testing oversight and guidance. The Bureau agreed with our recommendations. Since that time, we have been monitoring and tracking the Bureau’s progress and, last October, we testified that the Bureau had taken steps to improve its management and testing of key IT system for the 2010 Census, such as naming a Decennial Census Testing Officer whose primary responsibilities include monitoring testing for decennial census activities. The Bureau had also completed limited end- to-end testing of PBOCS. The Bureau developed this workflow management system—which is designed to manage the work assignments and related maps for hundreds of thousands of enumerators—late in the decade when it moved from handheld computers, which it found unreliable, to a paper-based approach for some field operations. These operations include NRFU, when enumerators collect data through personal interviews from the tens of millions of households that fail to mail back a census questionnaire. However, critical performance issues still need to be addressed and additional testing remains to be completed. For example, in December 2009, the Bureau completed two iterations of a key performance test, known as the Decennial Application Load Test. For the test, more than 8,000 field staff at about 400 local census offices performed a combination of manual and automated tests to assess the performance of key IT systems, including DAPPS and the first release of PBOCS. In the first test, DAPPS failed, and other key systems, including PBOCS, performed slowly. There were system communication errors as well. Bureau officials stated that many of these issues were resolved during the second iteration of testing; however, others remain to be resolved and new issues were identified. For example, DAPPS performed slowly during the second iteration of testing. This issue must be resolved and retested. To the Bureau’s credit, the performance test helped to identify significant issues before systems are needed for key field operations. DAPPS program officials stated that the current version of the program has been deployed since October 2008 and has been processing payroll for a smaller number of temporary census employees (about 140,000). However, three major issues, involving system hardware, software, and the operating system, were identified as the likely causes of DAPPS system failure during the first load test. At least one of these issues was known to exist before the load test, but has not yet been resolved. The officials stated that they are taking several steps to resolve these issues, including upgrading and reconfiguring the system, and deploying additional hardware to support the system. An additional load test is also planned for DAPPS. The officials stated that they plan to have all issues resolved by the end of February, and acknowledge that it is critical that DAPPS be fully functional under a heavy load by mid-March, when the Bureau will begin hiring a large number of temporary employees (about 600,000) for NRFU who will need to be paid using the system. In addition to issues mentioned with DAPPS, the December load test was not intended to be a comprehensive test of PBOCS, which has multiple releases at varying stages of development and testing. The first release of this system was deployed for early census field operations in January 2010, but it has known defects, such as limited functionality, slow performance, and problems generating certain progress and performance reports. In addition, the development and testing of two other releases is needed before the system is ready for other key field operations, such as the enumeration of residents in group quarters, scheduled to begin in March 2010. In recognition of the serious implications that a failed PBOCS would have for conducting of the 2010 Census, the Bureau has taken additional steps to mitigate the outstanding risks. For example, in June 2009, the Bureau chartered an independent assessment team, chaired by the Bureau’s Chief Information Officer, to monitor and report on, among other things, the system’s development and testing progress. These efforts are encouraging. However, the aggressive development and testing schedule presents various challenges. For example, two of the three releases of PBOCS were not included in the recent performance test because development of these releases had not yet been completed. This increases the risk that performance issues, such as those described above, may reoccur in future releases of the system and the Bureau’s ability to resolve and retest these issues before the system is needed for key field operations will be limited. In addition to DAPPS and PBOCS, the Bureau will rely on six other key automated systems to conduct the census. Progress has been made with respect to system testing. However, much system testing remains to be completed in the next few months, as shown in the following table. Given the importance of IT systems to the decennial census, it is critical that the Bureau ensure that DAPPS, PBOCS, and other key systems are thoroughly tested. The limited amount of time to resolve what are, in certain cases, significant performance issues creates a substantial challenge for the Bureau. The Bureau Has Revised Its Cost Estimate for Nonresponse Follow- up, but Needs to Complete Additional Updates as Planned In 2008, we reported that the Bureau had not carried out the necessary analyses to demonstrate that the then life-cycle cost estimate of about $11.5 billion for the 2010 Census was credible, and we recommended that the Bureau better document and update the estimate, to which it generally agreed. Since then, two early census field operations have experienced major differences between their estimated and actual costs. For address canvassing, where census workers verify address lists and maps, actual costs exceeded the Bureau’s initial estimate of $356 million by $89 million, or 25 percent. In contrast, for group quarters validation, where census workers verify addresses of group housing, actual costs were below the Bureau’s estimate of $71 million by about $29 million, or 41 percent. Because of cost overruns during address canvassing, as well as concerns over the increased number of vacant units due to foreclosures, the Bureau has implemented our recommendation and reexamined the assumptions and other data used to support the cost estimate for NRFU, the most costly and labor-intensive of all census field operations. Earlier this month, the Bureau provided us with the results from that reexamination. Although we have not fully assessed the Bureau’s analysis, our preliminary review shows that the Bureau now estimates that NRFU will cost about $2.3 billion, a decrease of around $400 million (15 percent) from its previous estimate of about $2.7 billion. In updating the estimate, the Bureau considered a number of cost drivers. For example, the Bureau reviewed 1) field work assumptions—such as miles driven per case, pay rates, hours worked per week, and attrition—which the Bureau updated based on actual Census 2000 data, national and field tests, and address canvassing results; 2) factors affecting response rate and hence NRFU workload—such as the national trend in survey response, use of a bilingual questionnaire and replacement mailing for 2010, and the vacancy rate; and 3) enumerator productivity rates, based on regional managers’ concerns over enumerating vacant units and non-English-speaking households. Further, in its analysis, the Bureau cited holding pay rates for NRFU temporary staff at 2009 levels, rather than the proposed 2010 pay rate, as one of the reasons for the reduction in NRFU costs. According to the Bureau, two cost drivers—workload, based on the mail response rate, and productivity—are uncertain and could have a significant effect on the ultimate cost of NRFU. For example, the Bureau states that if the response rate decreases by 2 percentage points due to extreme circumstances, such as an immigration backlash, costs could increase by $170 million. Likewise, if PBOCS continues to experience performance problems causing 2 weeks of lost productivity, the Bureau says it would need to hire and train more staff to complete NRFU in order to deliver the apportionment counts to the President by December 31, 2010, which, according to the Bureau, could increase costs by about $138 million. As we previously recommended, revising cost estimates with updated data is an important best practice for cost estimation. However, the Bureau’s analyses of cost are not complete. While the Bureau has finalized its reexamination of NRFU cost, it continues to update the costs for other NRFU-related operations. These operations include the NRFU Reinterview, a quality assurance procedure designed to ensure that field procedures were followed and to identify census workers who intentionally or unintentionally produced data errors. It also includes the Vacancy/Delete Check operation, which is a follow-up to NRFU and is designed to verify the status of addresses classified as vacant, or addresses determined to be nonexistent (deletes) during NRFU, as well as cases added since the NRFU workload was initially identified. According to the Bureau, emerging information about the Vacancy/Delete Check operation suggest that the workload may be much higher than originally expected and could increase costs from $345 million to $482 million—almost $137 million, or 40 percent. The Bureau said it will update the cost estimates of both these operations once additional information becomes available. A reliable cost estimate is critical to the success of any program because it provides the basis for informed investment decision making, realistic budget formulation, meaningful progress measurement, proactive course correction when warranted, and accountability for results. The Implementation of Key Enumeration Activities Continues to Make Progress In contrast to the IT systems, the rollout of other activities is going more smoothly. Indeed, the Bureau has taken steps to address certain previously identified problems, and its plans to improve the count of hard-to- enumerate groups are generally more robust compared to similar activities during the 2000 Census. Those activities include procedures for fingerprinting temporary employees; the Bureau’s efforts to count people residing in nursing homes, dormitories, and other group living arrangements known as “group quarters”; the rollout of key marketing efforts aimed at improving the participation of hard-to-count populations; the Bureau’s plans for a mailing a second, follow-up questionnaire and the removal of late mail returns; and the Bureau’s plans to secure a complete count in the hurricane-affected areas along the Gulf Coast. Bureau Has Taken Steps to Reduce the Number of Unclassifiable Fingerprints of Temporary Workers The Bureau plans to fingerprint its temporary workforce for the first time in the 2010 Census to better conduct background security checks on its workforce of hundreds of thousands of temporary census workers. However, the Bureau found that during address canvassing, an operation that the Bureau conducted in the summer of 2009 to verify every address in the country, 22 percent of the workers (approximately 35,700 people) hired for the operation had unclassifiable prints. The Federal Bureau of Investigation (FBI) determined that the issue was generally the result of errors that occurred when the prints were first taken at the local census offices. To fingerprint workers during address canvassing, Bureau employees captured two sets of fingerprints on ink fingerprint cards from each temporary worker by the end of the workers’ first day of training. The cards were then sent to the Bureau’s National Processing Center in Jeffersonville, Indiana, to be scanned and electronically submitted to the FBI. If the first set of prints were unclassifiable, then the National Processing Center sent the FBI the second set of prints. If the results showed a criminal record that made an employee unsuitable for employment, the Bureau either terminated the person immediately or placed the individual in a nonworking status until the matter was resolved. To help ensure the success of fingerprinting operations for NRFU—which will peak at approximately 484,000 fingerprint submissions over a 3-day period from April 28-30, 2010—the Bureau will follow similar procedures, but has taken additional steps to improve fingerprint image quality. They include refining training manuals used to instruct local census office staff on how to take fingerprints, scheduling fingerprint training closer to when the prints are captured, and increasing the length of training. Further, the Bureau plans on using an oil-free lotion during fingerprinting that is believed to raise the ridges on fingertips to improve the legibility of the prints. The Bureau has also revised its procedures for refingerprinting employees when both fingerprint cards cannot be read. During address canvassing, if both sets of fingerprints were unclassifiable, workers were allowed to continue working if their name background check was acceptable, and would be refingerprinted only if they were rehired for future operations. Under the revised policy, the Bureau plans to digitally capture a third and fourth set of fingerprints if the FBI cannot classify the first two sets. The Bureau plans to purchase approximately 1,017 digital fingerprint scanners. Each local census office will receive a minimum of one machine, with the remaining scanners to be distributed at the discretion of the Regional Director. The Bureau estimates that this additional step could reduce the percentage of workers with unclassifiable prints from 22 percent down to approximately 10 to 12 percent, or an estimated 60,000 to 72,000 temporary workers for NRFU. We did not receive a response from the Bureau whether it will allow those workers with unclassifiable prints to continue to work on NRFU operations. Operational Changes Made for 2010 Position the Bureau to More Accurately Classify and Identify Group Quarters During the decennial census, the Bureau conducts separate operations to count people residing in group quarters facilities. The Bureau defines group quarters as “places where people live or stay in a group living arrangement that are owned or managed by an entity or organization providing housing and/or services for the residents,” such as boarding schools, correctional facilities, health care facilities, military quarters, and college and university housing. According to Bureau estimates, more than 8.1 million people, or approximately 3 percent of the population, live in group quarter facilities. During the 2000 Census, the Bureau did not always accurately enumerate group quarters because, among other reasons, group quarters were sometimes hard to distinguish from conventional housing units (see fig. 2), or the address of an administrative building was in a separate geographic location than where the people actually lived, as was sometimes the case with prison complexes. For example, in prior work, we found that the population count of Cameron, Missouri, was off by nearly 1,500 people because the population of the state’s Crossroads Correctional Center was inadvertently omitted from the town’s headcount. Similarly, North Carolina’s population count was reduced by 2,828 people, largely because the Bureau had to delete duplicate data on almost 2,700 students in 26 dormitories (see fig. 3) at the University of North Carolina at Chapel Hill (UNC). Precision is critical because, in some cases, small differences in population totals could potentially impact apportionment and/or redistricting decisions. The Bureau developed and tested new procedures to address the difficulties it had in identifying and counting this population during the 2000 Census. For example, the Bureau moved from manual to GPS- generated mapspots, which should reduce the chance of human error and group quarters populations being counted in the wrong jurisdiction; moved from a telephone interview to a field verification approach, which should increase accuracy; and moved to a single address list, which should reduce the chance of double counting. In addition, following the 2004 Census Test, we recommended that the Bureau revisit group quarter procedures to ensure that this population was properly located and counted. The Bureau implemented our recommendation and revised its group quarters procedures to clearly instruct census workers to properly correct and delete addresses. Further, to better ensure a more accurate group quarters count, the Bureau employed a three-prong effort consisting of those operations shown in table 2. For the 2010 group quarters operations, the Bureau drew from a number of sources to build its list of group quarters addresses including data from the 2000 Census, address submissions provided by state and local governments, Internet-based research, and group quarters located during door-to-door address canvassing. During the first of the three group quarters operations (group quarters validation), approximately 25,000 temporary workers identified over 240,000 group quarters facilities from a workload of over 2 million potential group quarters in both the United States and Puerto Rico. The remaining approximately 1.76 million addresses were identified during group quarters validation as conventional housing units, transitory locations, nonresidential, nonexistent, or duplicates. All addresses that were verified as housing units or transitory locations were added to the appropriate address extracts for subsequent enumeration operations. In addition, over 7,000 addresses from the group quarters validation workload could not be properly processed in the Bureau’s database because they were returned with insufficient information. However, a contingency plan was implemented to ensure these locations were included in the census. The changes made to group quarters operations appear promising, and the Bureau plans to evaluate coverage of the group quarters population. However, the Bureau will not evaluate each of the three group quarters operation’s effectiveness, cost, or value added. Such evaluations could be useful in improving the operations, identifying possibly duplicative operations, and identifying potential cost savings for 2020. For example, given the large number of non-group quarters included in the workload for group quarters validation (about 88 percent), the Bureau may want to consider ways to begin the operation with a more concise initial workload. Additionally, in both group quarters validation and group quarters advance visit operations, census workers personally visit group quarters, verify the facility contact information, provide confidentiality information, and collect occupancy numbers. Because these activities appear to be duplicative, the Bureau may want to reexamine the need to conduct both operations. The Bureau’s Communications Campaign Is Aimed at Hard-to-count Groups A complete and accurate census is becoming an increasingly daunting task, in part because the nation’s population is growing larger, more diverse, and more reluctant to participate. To overcome these challenges, the Bureau has developed the Integrated Communications Campaign aimed at, among other things, improving the mail response rate and reducing the differential undercount. An undercount occurs when the census misses a person who should have been included; an overcount occurs when an individual is counted in error. What makes these errors particularly problematic is their differential impact on various subgroups. Minorities, renters, and children, for example, are more likely to be undercounted by the census while more affluent groups, such as people with vacation homes, are more likely to be enumerated more than once. As shown in table 3, the 2010 communications campaign consists of four components: the partnership program, paid advertising, public relations, and an educational program called Census in Schools. The 2010 communications campaign’s initial budget of $410 million was increased by $220 million in additional funds appropriated by the American Recovery and Reinvestment Act of 2009 (Recovery Act). As a result, the Bureau was able to greatly expand its communications campaign activities. For example, the Bureau hired about 3,000 partnership staff, over 2,000 more than originally planned, and increased its paid advertising purchases targeted to specific ethnic or language audiences by more than $33 million (85 percent) over its initial plan of about $39 million. The increased funding should enhance the Bureau’s capacity to reach out to hard-to-count communities. In all, the Bureau plans to spend about $72 million on paid advertising targeted to specific ethnic or language audiences, which is about $11 million more than the almost $61 million the Bureau plans to spend targeting the general population. However, even with the additional Recovery Act funds, the Bureau plans to spend less for some components of the 2010 paid media buys than it did for 2000, when compared in constant 2010 dollars. For example, although the total budget for the 2010 paid advertising is $253 million, which is about $12 million (5 percent) more than 2000, the Bureau plans to spend about $133 million of it on the total advertising buy (excluding production, labor, and other management costs), which is about $27 million (17 percent) less compared to the about $160 million spent in 2000. Table 4 shows the Bureau’s 2010 budget for paid media buys by target audience compared to what was spent in 2000. Decreased spending on paid advertising may seem like a step in the wrong direction for promoting census participation. However, by better targeting paid advertising buys the Bureau expects to reach those who have historically been the hardest to count. For example, the Bureau based its decisions on how to allocate spending across different ethnic and language audiences based on a variety of factors, such as historical response data for an area, prevalence of hard-to-count households in a market, population size, and availability of in-market media. The Bureau also received input from staff in census regional offices, as well as from an independent 2010 Census advisory group called the Race and Ethnic Advisory Committee. Further, the Bureau targeted the paid advertising messages based on market and attitudinal research. For example, the Bureau’s attitudinal research identified five mindsets people have about the census, ranging from what Bureau research identified as “leading edge”—those who are highly likely to respond—to the “cynical fifth” who are less likely to participate because they doubt that the census provides tangible benefits. The Bureau used this information to develop messages to motivate each cohort to participate in the census. To target the cynical fifth, for example, the Bureau developed advertising that focus on the message that the census is important to their community. In addition, as shown in table 5, the Bureau has made other noteworthy changes to 2010 paid advertising and partnership program activities, which are aimed at expanding outreach to hard-to-count groups and better monitoring campaign effectiveness. In summary, our analysis suggests that the paid advertising and partnership activities, along with the other components of the Bureau’s communications campaign, are generally more robust than the Bureau’s promotional efforts during the 2000 Census in that the entire effort is more comprehensive, and activities appear to be more data-driven and targeted. Moving forward, the key challenge facing the campaign is that it must not only raise awareness of the census, it must also influence behavior, a far more difficult task. Second Census Questionnaire Has Potential to Increase Response Rate, but Will Be Available in English Only The Bureau’s strategy to mail a second, or replacement, census questionnaire will be implemented for the first time in 2010 and is an important step towards improving response and decreasing costs. According to Bureau studies, mailing a replacement questionnaire increases overall response from households that do not respond to the initial questionnaire, which could generate significant cost savings by eliminating the need for census workers to obtain those responses via personal visits. The Bureau plans to mail approximately 30 million replacement questionnaires to all households in census tracts that had the lowest response rates in Census 2000 (known as blanket replacement). Also, the Bureau plans to mail approximately 12 million replacement questionnaires to nonresponding households in other census tracts that had low-to- moderate response rates in 2000 (known as targeted replacement). In order to enhance the effectiveness of the replacement mailing, the Bureau will include a cover letter to distinguish the initial and replacement questionnaires and thus avoid receiving duplicate responses. However, replacement questionnaires will be provided in English-only, regardless of whether the household will receive a bilingual English/Spanish questionnaire in the initial mailing. According to a Bureau official, mailing a bilingual replacement questionnaire was logistically impractical for 2010, given the limitations of the printing process and the five-day time frame for the targeted replacement mailing. Thus, in looking forward to the 2020 Census, it will be important for the Bureau to evaluate potential changes to the mailing strategy that would include, at a minimum, sending bilingual replacement questionnaires to those households that initially received a bilingual questionnaire. The Bureau plans to mail replacement questionnaires between April 1 and April 10 and develop an initial list of nonresponding households on April 7 (see table 6 for key dates in this process). Because the Bureau will likely receive replacement questionnaires after April 7, it must be able to effectively remove these late mail returns from the list of nonresponding households, or NRFU workload. Removing late mail returns is important because it prevents enumerators from visiting households that already returned their census forms, thus reducing NRFU workload and cost, as well as respondent burden. As shown in table 6, the Bureau plans to remove late mail returns from the NRFU workload four times using one automated and three manual processes. The Bureau has some experience with the manual process because some local census offices did some testing of late mail removals during the 2000 Census. In addition, they have developed quality assurance procedures for the manual removal process. Moving forward, it will be important for the Bureau to ensure that local census offices follow these procedures so that households are not unnecessarily visited by an enumerator or inadvertently removed from the follow-up workload and missed in the census count. The Bureau Has Tailored Operations to Enumerate Hurricane-Affected Areas The scale of the destruction in areas affected by hurricanes Katrina, Rita, and Ike has made getting a complete and accurate population count in parts of Mississippi, Louisiana, and Texas especially challenging (see fig. 4). Hurricane Katrina alone destroyed or made uninhabitable an estimated 300,000 homes. As we have previously testified, the Bureau, partly in response to recommendations made in our June 2007 report, developed supplemental training materials for natural disaster areas to help census address listers, when developing the census address list, identify addresses where people are, or may be, living when census questionnaires are distributed. For example, the materials noted the various situations that address listers might encounter, such as people living in trailers, homes marked for demolition, converted buses and recreational vehicles, and nonresidential space such as storage areas above restaurants. The training material also described the clues that could alert address listers to the presence of nontraditional places where people are living and provided a script they should follow when interviewing residents on the possible presence of hidden housing units. To ensure a quality count in the hurricane-affected areas, the Bureau will hand-deliver an estimated 1.2 million census questionnaires in these areas through the Update Leave operation, where census workers update addresses and provide a mail-back census questionnaire to each living quarter in their assigned areas. The Bureau estimates that it will be delivering questionnaires starting March 1, 2010, to housing units that appear inhabitable in much of southeast Louisiana, south Mississippi, and Texas, even if they do not appear on the Bureau’s address list. Occupants will be asked to complete and return the questionnaire by mail. Census workers will also identify modifications for the Bureau’s address list, including additions, deletions, corrections, and spotting duplicate information. By hand delivering questionnaires, the Bureau hopes to ensure that housing units that may have been missed will receive and return questionnaires, ultimately improving the accuracy of the count. Finally, the Bureau stated that it must count people where they are living on Census Day and emphasized that if a housing unit gets rebuilt and people move back before Census Day, then that is where those people will be counted. However, if they are living someplace else, then they should be counted where they are living on Census Day. Concluding Observations Mr. Chairman, with less than two months to go until Census Day, the Bureau’s readiness for the headcount is mixed. On the one hand, with data collection already underway, the ability of key IT systems to function under full operational loads has not yet been demonstrated. The issues facing these systems need to be resolved, and additional testing must take place, with little time remaining. Likewise, questions remain regarding the ultimate cost of the 2010 Census, as the Bureau continues to analyze the cost of NRFU-related operations. On the other hand, certain operations, such as the communications campaign and efforts to enumerate group quarters, generally appear to be on track and more robust compared to similar efforts for the 2000 Census, better positioning the Bureau for a complete and accurate headcount. In the coming weeks and months ahead, we will continue to monitor the Bureau’s progress in addressing these issues, as well as the implementation of the census as a whole, on behalf of the Subcommittee. Mr. Chairman and members of this Subcommittee, this concludes my statement. I would be happy to respond to any questions that you might have at this time. Contacts and Acknowledgments If you have any questions on matters discussed in this statement, please contact Robert N. Goldenkoff at (202) 512-2757 or by e-mail at goldenkoffr@gao.gov. Other key contributors to this testimony include Peter Beck, Steven Berke, Clayton Brisson, Virginia Chanley, Benjamin Crawford, Dewi Djunaidy, Vijay D’Souza, Jennifer Echard, Elizabeth Fan, Ronald Fecso, Robert Gebhart, Ellen Grady, Richard Hung, Kirsten Lauber, Jason Lee, Andrea Levine, Signora May, Catherine Myrick, Lisa Pearson, David Powner, Jonathan Ticehurst, Cheri Truett, Timothy Wexler, and Katherine Wulff. Related GAO Products 2010 Census: Census Bureau Has Made Progress on Schedule and Operational Control Tools, but Needs to Prioritize Remaining System Requirements. GAO-10-59. Washington, D.C.: November 13, 2009. 2010 Census: Efforts to Build an Accurate Address List Are Making Progress, but Face Software and Other Challenges. GAO-10-140T. Washington, D.C.: October 21, 2009. 2010 Census: Census Bureau Continues to Make Progress in Mitigating Risks to a Successful Enumeration, but Still Faces Various Challenges. GAO-10-132T. Washington, D.C.: October 7, 2009. 2010 Census: Communications Campaign Has Potential to Boost Participation. GAO-09-525T. Washington, D.C.: March 23, 2009. 2010 Census: Fundamental Building Blocks of a Successful Enumeration Face Challenges. GAO-09-430T. Washington, D.C.: March 5, 2009. Information Technology: Census Bureau Testing of 2010 Decennial Systems Can Be Strengthened. GAO-09-262. Washington, D.C.: March 5, 2009. 2010 Census: The Bureau’s Plans for Reducing the Undercount Show Promise, but Key Uncertainties Remain. GAO-08-1167T. Washington, D.C.: September 23, 2008. 2010 Census: Census Bureau’s Decision to Continue with Handheld Computers for Address Canvassing Makes Planning and Testing Critical. GAO-08-936. Washington, D.C.: July 31, 2008. 2010 Census: Census Bureau Should Take Action to Improve the Credibility and Accuracy of Its Cost Estimate for the Decennial Census. GAO-08-554. Washington, D.C.: June 16, 2008. Census 2010: Census at Critical Juncture for Implementing Risk Reduction Strategies. GAO-08-659T. Washington, D.C.: April 9, 2008. Information Technology: Census Bureau Needs to Improve Its Risk Management of Decennial Systems. GAO-08-79. Washington, D.C.: October 5, 2007. 2010 Census: Basic Design Has Potential, but Remaining Challenges Need Prompt Resolution. GAO-05-9. Washington, D.C.: January 12, 2005. This is a work of the U.S. government and is not subject to copyright protection in the United States. The published product may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately. SUMMARY: [/INST] In March 2008, GAO designated the 2010 Census a high-risk area in part because of information technology (IT) shortcomings and uncertainty over the ultimate cost of the census, now estimated at around $15 billion. The U.S. Census Bureau (Bureau) has since made improvements to various IT systems and taken other steps to mitigate the risks of a successful census. However, last year, GAO noted that a number of challenges and uncertainties remained, and much work remained to be completed under very tight time frames. As requested, this testimony provides an update on the Bureau's readiness for an effective headcount, covering (1) the status of key IT systems; (2) steps the Bureau has taken to revise its cost estimates; and (3) the extent to which critical enumeration activities, particularly those aimed at hard-to-count populations, are on track. The testimony is based on previously issued and ongoing GAO work. Overall, the Bureau's readiness for a successful headcount is mixed. On the one hand, ongoing performance issues are affecting key IT systems, especially a workflow management system essential for the Bureau's field operations and a payroll processing system that will be used to pay more than 1 million temporary workers. Indeed, an important performance test the Bureau held in December 2009 revealed significant performance issues with each system. Bureau officials stated that many of these issues were resolved in further testing; however, others remain unresolved, and new defects were identified. The Bureau is going to great lengths to address these issues. However, little time remains before the systems need to become fully operational. In addition, the Bureau revised its cost estimate from $2.7 billion to $2.3 billion for nonresponse follow-up, the largest and most costly field operation where census workers follow up in person with nonresponding households. However, the Bureau's analyses of cost are not complete. According to the Bureau, it continues to reexamine the cost of two other nonresponse follow-up related operations. On the other hand, the rollout of key enumeration activities is generally on track, and the Bureau has taken action to address some previously identified problems. For example, the Bureau has taken several steps to reduce the number of unreadable fingerprint cards of temporary workers, a problem that plagued an earlier field operation. Among other actions, the Bureau plans to digitally capture a third and fourth set of fingerprints if the first two sets cannot be read for background security checks. The Bureau has also developed new procedures for counting those living in group quarters, such as dormitories and prisons. For example, the Bureau is using a single address list containing both group quarters and housing units, rather than separate lists as in the 2000 Census, to reduce the chance of double counting. The Bureau's 2010 Census communications campaign is also more robust than the one used in the 2000 Census. Key differences from the 2000 campaign include increased partnership staffing, targeted paid advertising based on market and attitudinal research, and a contingency fund to address unexpected events. To increase participation rates, the Bureau plans to mail a second, replacement questionnaire to census tracts that had low or moderate response rates in the 2000 Census. To help ensure a complete count of areas along the Gulf Coast, the Bureau plans to hand deliver an estimated 1.2 million census forms in areas devastated by hurricanes Katrina, Rita, and Ike. This effort will help ensure that households--even those that were not on the Bureau's address list but appear inhabitable--will be included in the census. Moving forward, it will be important for the Bureau to quickly identify the problems affecting key IT systems and test solutions. Further, given the complexity of the census and the likelihood that other glitches might arise, it will be important for the Bureau to stay on schedule, monitor operations, and have plans and personnel in place to quickly address operational issues. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Solitary polar bears have become the poster boys of global warming. Standing on melting glaciers, their saddened faces are often plastered over posters, adverts and brochures warning of the dangers of greenhouse gas emissions. But some scientists say polar bears, are far from endangered. Instead, they claim, the creatures are being used as political weapons in the heated debate on climate change. Scroll down for interactive map and video. Some scientists say polar bears, are far from endangered. Instead, they claim, the creatures are being used as political weapons in the heated debate on climate change. 'Canadian Inuit say that now is the "time with the most bears",' Mitchell Taylor, a biologist who has been researching polar bears in Canada and around the Arctic Circle for 30 years, told MailOnline. 'In spite of claims to the contrary, there is no reliable scientific evidence that polar bear numbers have declined in any subpopulation so far.' There are an estimated 25,000 bears in the whole of the Arctic and around 60 per cent of those are in Canada, according to the Polar Bear Specialist Group (PBSG). The PBSG estimates that we could lose two-thirds of the world's polar bears by the middle of the century unless the world takes action on climate change. But the same group earlier this year admitted to polar bear specialist Susan Crockford that the estimate was'simply a qualified guess given to satisfy public demand.' Andrew Derocher, a professor of biological sciences at the University of Alberta and past PBSG chair, has spent 30 years studying polar bears. 'In spite of claims to the contrary, there is no reliable scientific evidence that polar bear numbers have declined in any subpopulation so far,' Mitchell Taylor, a polar bear scientist with 30 years experience, told MailOnline. A new tool allows people to watch polar bears as they pad across the ice of Hudson Bay, Canada, from the comfort of their homes. The Bear Tracker (interactive map below) shows the current location of a number of polar bears as well as sea ice levels in the area. By clicking on a bear in the interactive map, you can see what date it was collared, how many cubs it has, its weight and the distance it has travelled. There is also an option to sponsor the bear. The map, created by Winnipeg-based Polar Bears International, can also be used to see the shrinking of areas of sea ice over the past 30 years, as water temperature are believed to have risen. Despite the controversy over numbers, he is adamant that polar bear groups will start going extinct by mid-century as a direct result of climate change. 'It is an international standard to consider conservation of a species using the "three generation rule" looking forward in time,' he told MailOnline. 'For polar bears, three generations is somewhere in the 36 to 45 year timeframe. In this timeframe, sea ice scientists, predict significant changes in the amount of the Arctic covered in sea ice.' According to the UN's Intergovernmental Panel on Climate Change (IPCC), ice levels are 'likely' to fall below one million square kilometres by 2050 due to man-made global warming. 'Polar bears are a habitat specialist: they are not found anywhere that sea ice does not persist. If the sea ice disappears, the bears will too.' But Dr Taylor takes issue with both Dr Derocher's and the IPCC's predictions on climate change. 'Climate models have actually done a poor job of predicting climate warming and sea ice decline,' he said. The Bear Tracker, created by Polar Bears International, shows the current location of a number of polar bears as well as sea ice levels in the area. Click on a polar bear to view its details... 'Polar bears are a habitat specialist: they are not found anywhere that sea ice does not persist. If the sea ice disappears, the bears will too,' said Andrew Derocher, a professor at the University of Alberta. 'My crystal ball says that suggestions of 4.5-5°C warming is unlikely given the warming so far and given the limitations on fossil fuel.' In 2008, Dr Taylor signed the Manhattan Declaration on climate change, which argued that there was no conclusive evidence that emissions from industrial activity was causing climate change. He said that if CO2 is really driving the current warming trend, then we could see maybe another degree of warming, which would not be a threat to polar bears. 'It is not a crisis, just a change that is within the range of historical variation,' he added. And even if polar bears did suffer a loss of ice, Dr Taylor points out that, as a species, polar bears have survived for four million years and have 'behavioural plasticity'. 'That means they evolved even before the Pleistocene glacial cycles, even before there was perennial sea ice in the Arctic Ocean,' he said. And he points out that polar bears can live on stored fat to live for long periods. Pregnant females, for instance, can go eight months without eating. There are an estimated 25,000 bears in the whole Arctic and around 60 per cent of those are in Canada. Dr Taylor said that since he made his views known, he has been ostracised by the polar bear scientific community. Indeed, Dr Derocher is outspoken in his views on scientists who don't believe that polar bears are threatened by climate change. 'Some of the scientists that are claiming resilience in polar bears are being paid by right-wing climate change denier groups,' he said. 'These individuals are paid to obfuscate the scientific data. 'If polar bears could garner the resources they need on land, why do they lose about 0.8-0.9 kg of body mass per day? 'Why do some polar bears starve while on land waiting for the sea ice to reform?' But Dr Taylor claims the figures just don't add up. 'I think it is a bit crazy to speculate about a climate future 50 or 100 years in advance, then guess about how polar bears might respond to this hypothetical climate future, then declare a crisis because the guess was they won't do very well,' said Dr Taylor. 'Especially when the current models don't seem to be able to predict either temperature or sea ice very well so far.' According to the Polar Bear Specialist Group (PBSG), we could lose two-thirds of polar bears by the middle of the century unless the world takes action on climate change. But Dr Taylor claims the figures just don't add up SUMMARY: [/INST] Estimates say we could lose two-thirds of polar bears by mid-century. Some claim global warming has caused a fall in sea ice levels in Arctic. But Dr Mitchell Taylor says 'there no reliable scientific evidence' of decline. He believes polar bears can survive moderate change weather patterns. Dr Andrew Derocher claims that polar bears cannot adapt to conditions. 'Some of the scientists that are claiming resilience in polar bears are being paid by right-wing climate change denier groups,' he told MailOnline. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The body of Whitney Houston was expected to arrive in New Jersey on Monday night in preparation for her funeral, which is likely to be held Friday in Newark, the city where she was born, according to a person with knowledge of the family’s plans. The arrangements will probably include a viewing of the body on Thursday and a funeral on Friday at the Prudential Center, according to the person, who insisted on anonymity because the plans were still preliminary. The services were being handled by Whigham Funeral Home, which arranged the 2003 funeral of Ms. Houston’s father, John. The Prudential Center, home to the New Jersey Devils, can seat up to 17,625 for hockey games and 18,500 for basketball games. As many as 1,000 seats are expected to be set up on the arena’s floor, the person said. That is a far greater number than could be accommodated at New Hope Baptist, the red-brick church where Ms. Houston got her start singing in the choir and where on Sunday mourners gathered to pay their respects by leaving flowers, candles, balloons and condolence cards. Still, a Devils game scheduled for Friday night may pose a logistical challenge to the funeral, the person said. The viewing will probably last throughout the day on Thursday, with lines of thousands of mourners expected to snake through the Prudential Center. It was not yet clear who would speak at the funeral. A photograph of a smiling Ms. Houston appeared on Monday night on the video screen outside the arena. The singer, 48, was pronounced dead on Saturday afternoon in California. Although the authorities have said there was no evidence of foul play, the results of an autopsy are being withheld until toxicology tests determine whether there were drugs in Ms. Houston’s system at the time of her death, the Los Angeles County coroner’s office said. That process is likely to take several more weeks. Dozens of fans and a handful of reporters stood outside the two-story brick funeral home on Monday night as they waited for the body to arrive. As music played from a car stereo nearby, people danced, hugged and even sang along to some of Ms. Houston’s songs, including the 1985 hit “You Give Good Love.” At about 11:50 p.m., a gold-colored hearse with cursive W’s emblazoned on its side windows pulled up to the funeral home, as people chanted, “Whitney!” One of the onlookers, Juan Barja, 43, simply lamented: “I never saw her in concert. Now it’s too late.” Barbara Hargrove, 29, of Newark, said she had come to pay her respects. Ms. Houston “showed the people from Newark that it’s not just an inner city,” Ms. Hargrove said. “We can get out. We can make it.” Ms. Hargrove said she remembered a similar gold-colored limousine and hearse at the funeral of Ms. Houston’s father. “Everything was gold,” she said, “and I know she’ll be in gold, too.” A hearse under heavy police escort arrived late Monday at a funeral home officials said was handling the arrangements for late pop star Whitney Houston. Stacey Bates, center, and Gregory Hanks put up balloons on a makeshift memorial for the late singer Whitney Houston outside of New Hope Baptist Church, Monday, Feb. 13, 2012, in Newark, N.J. As a young... (Associated Press) Evelyn Rios cries after reading a poem she wrote and posted on a makeshift memorial for the late singer Whitney Houston outside of New Hope Baptist Church, Monday, Feb. 13, 2012, in Newark, N.J. As a... (Associated Press) The hearse traveled from Teterboro Airport, where officials had told The Associated Press Houston's body would arrive Monday night on a flight from the Los Angeles area. Several officials familiar with funeral planning said arrangements were being made by Newark's Whigham Funeral Home, which handled the 2003 funeral of Houston's father. They spoke to the AP on Monday on condition of anonymity because they weren't authorized to speak for Houston's family. Houston died Saturday at a hotel in Beverly Hills, California. She was 48. Officials say she was underwater and apparently unconscious when she was pulled from a bathtub. Houston was born in Newark and was raised in nearby East Orange. A woman at the funeral home, where several police officers were stationed, said she could neither confirm nor deny reports that it would handle the arrangements. A white tent was set up leading into the funeral home's rear entrance, and two opulent golden sarcophaguses stood at the front entrance. Dozens of Houston fans went to the funeral home, where they played her songs, sang, lit candles to remember her and hoped to get a glimpse of her casket. Houston's family raised the possibility of holding a wake Thursday and a funeral Friday at Newark's Prudential Center, which hosts college and professional sporting events and seats about 18,000 people. City officials were awaiting the family's arrival to complete the funeral planning. A picture of Houston appeared Monday night on the electronic board outside the arena, one of the nation's busiest entertainment venues, with a New Jersey Devils ice hockey game Friday night posing a logistical challenge to a planned funeral that day. Houston's relatives also were debating whether to have a smaller service at New Hope Baptist Church, where family members have sung. They planned to meet Tuesday with officials to finalize the details, according to someone who had knowledge of the planning but wasn't authorized to speak publicly about it and requested anonymity. Houston began singing as a child at Newark's New Hope Baptist Church, where her mother, Grammy-winning gospel singer Cissy Houston, led the music program for many years. Her cousin singer Dionne Warwick also sang in its choir. On Monday, mourners left flowers, balloons and candles for Houston at the wrought-iron fence around the tall brick church, which sits near the edge of an abandoned housing project near the train line leading to New York City. "She was an inspiration to everybody," said Gregory Hanks, an actor who grew up in the neighborhood and who dropped off a bouquet of flowers. Hanks said he saw Houston perform at the New Jersey Performing Arts Center years ago. "I grew up listening to her as a little boy, and to hear her sing, you knew she was special," the 26-year-old said. Sandy Farrow, a technology consultant from Mitchellville, Maryland, who was in the area visiting relatives, said she was a senior at Clifford J. Scott High School in East Orange when Houston was a freshman. "We felt like she put East Orange on the map," she said. Farrow said Houston's death came as a shock. "We lost somebody who I thought, after all her troubles, was coming back," Farrow said. Across the street from the church, Bashir Rasheed set up shop with a duffel bag full of T-shirts reading "In Memory of Whitney Houston 1963-2012." He said he had sold 24 shirts at $10 apiece within a few hours. ___ Associated Press writer Dave Porter contributed to this report. Whitney Houston's body arrives home in New Jersey Please turn on JavaScript. Media requires JavaScript to play. Whitney Houston's body has been flown from California to her home state of New Jersey, ahead of a funeral expected later this week. A gold hearse took her body from Teterboro airport to a funeral home in her hometown of Newark, reports said. The 48-year-old singer was found underwater and unconscious on Saturday in a bath at a hotel in Beverly Hills, police said. Toxicology tests are under way after an autopsy on Sunday. The authorities say it may be up to eight weeks before they can confirm the cause of death. No criminal probe is under way, police said, but LA's coroner said her room did contain some prescription drugs. Funeral plans In a news conference on Monday, Beverly Hills police spokesman Lt Mark Rosen said fire department officials were told the singer was found unresponsive on Saturday morning. "Ms Houston was pulled from the tub by members of her staff and hotel security was promptly notified," he said. Please turn on JavaScript. Media requires JavaScript to play. "First aid and CPR measures were performed in an attempt to revive her," he said, adding that after unsuccessful attempts, Houston was pronounced dead at 15:55 local time (23:55 GMT). The police spokesman played down reports that prescription drugs might have been involved in her death. "Our intent at Beverly Hills Police Department is not to fuel the speculation or rumours that are circulating right now," Lt Rosen said. "We can't comment on where those rumours have come from." However, the Los Angeles coroner's office then said there were bottles of prescription medicine in the room, although it did not provide further details. "There weren't a lot of prescription bottles," said Ed Winter, the coroner's assistant chief. "You probably have just as many prescription bottles in your medicine cabinet." Houston's body was released to her family late on Monday morning. The body was then flown from Van Nuys Airport in the Los Angeles area east to New Jersey. Born in Newark, Whitney Houston began her singing career as a child at the city's New Hope Baptist Church. Her cousin, singer Dionne Warwick, also sang in its choir. On Monday, mourners left tributes, including flowers, balloons and candles, alongside the church's fence. Houston's hits included I Will Always Love You and I Have Nothing "She was an inspiration to everybody,'' said Gregory Hanks, a 26-year-old actor who grew up in the area. The White House said President Barack Obama offered his condolences. Press secretary Jay Carney said: "I know that his thoughts and prayers are with her family, especially her daughter. "It's a tragedy to lose somebody so talented at such a young age." Houston was one of the world's best-selling artists from the mid-1980s to the late 1990s, selling 170 million records worldwide. But her later career was overshadowed by drug use and a turbulent marriage to singer Bobby Brown. Houston was found in her hotel room just hours before she was supposed to appear at a gala before the Grammy Awards. SUMMARY: [/INST] Whitney Houston is back home in New Jersey, where family members are planning to let fans say farewell at a service for the late singer. A gold hearse took Houston's body from the airport to a funeral home in her hometown of Newark, reports the BBC. Her family hopes to use the city's 18,000-capacity Prudential Center for a wake on Thursday, and a funeral on Friday, sources tell the New York Times. The viewing of the body is expected to last all day Thursday, but a New Jersey Devils game scheduled for Friday night may pose a logistical challenge to funeral arrangements, the source says. Houston's family is also considering holding a smaller ceremony at the New Hope Baptist Church, where the singer started her career in the choir. Mourners have left flowers and candles for Houston at the fence around the church, reports AP. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Background EPA administers and oversees grants primarily through the Office of Grants and Debarment, 10 program offices in headquarters, and program offices and grants management offices in EPA’s 10 regional offices. Figure 1 shows EPA’s key offices involved in grants activities for headquarters and the regions. The management of EPA’s grants program is a cooperative effort involving the Office of Administration and Resources Management’s Office of Grants and Debarment, program offices in headquarters, and grants management and program offices in the regions. The Office of Grants and Debarment develops grant policy and guidance. It also carries out certain types of administrative and financial functions for the grants approved by the headquarters program offices, such as awarding grants and overseeing the financial management of these grants. On the programmatic side, headquarters program offices establish and implement national policies for their grant programs, and set funding priorities. They are also responsible for the technical and programmatic oversight of their grants. In the regions, grants management offices carry out certain administrative and financial functions for the grants, such as awarding grants approved by the regional program offices, while the regional program staff provide technical and programmatic oversight of their grantees. As of June 2003, 109 grant specialists in the Office of Grants and Debarment and the regional grants management offices were largely responsible for administrative and financial grant functions. Furthermore, 1,835 project officers were actively managing grants in headquarters and regional program offices. These project officers are responsible for the technical and programmatic management of grants. Unlike grant specialists, however, project officers generally have other primary responsibilities, such as using the scientific and technical expertise for which they were hired. In fiscal year 2002, EPA took 8,070 grant actions totaling about $4.2 billion. These awards were made to six main categories of recipients as shown in figure 2. EPA offers two types of grants—nondiscretionary and discretionary: Nondiscretionary grants support water infrastructure projects, such as the drinking water and clean water state revolving fund programs, and continuing environmental programs, such as the Clean Air Program for monitoring and enforcing Clean Air Act regulations. For these grants, Congress directs awards to one or more classes of prospective recipients who meet specific eligibility criteria; the grants are often awarded on the basis of formulas prescribed by law or agency regulation. In fiscal year 2002, EPA awarded about $3.5 billion in nondiscretionary grants. EPA has awarded these grants primarily to states or other governmental entities. Discretionary grants fund a variety of activities, such as environmental research and training. EPA has the discretion to independently determine the recipients and funding levels for grants. In fiscal year 2002, EPA awarded about $719 million in discretionary grants. EPA has awarded these grants primarily to nonprofit organizations, universities, and government entities. The grant process has the following four phases: Preaward. EPA reviews the application paperwork and makes an award decision. Award. EPA prepares the grant documents and instructs the grantee on technical requirements, and the grantee signs an agreement to comply with all requirements. Postaward. After awarding the grant, EPA provides technical assistance, oversees the work, and provides payments to the grantee; the grantee completes the work, and the project ends. Closeout of the award. EPA ensures that all technical work and administrative requirements have been completed; EPA prepares closeout documents and notifies the grantee that the grant is completed. As part of its oversight of grantee performance, EPA conducts in-depth reviews to analyze grantees’ compliance with grant regulations and specific grant requirements. EPA conducts two types of in-depth reviews. Administrative reviews, conducted by the grants management offices, are designed to evaluate grantees’ financial and administrative capacity. In contrast, programmatic reviews, conducted by the program offices, are designed to assess the grantees’ activities in five key areas: (1) assessing progress of work, (2) reviewing financial expenditures, (3) meeting the grant’s terms and conditions, (4) meeting all programmatic, statutory, and regulatory requirements, and (5) verifying that equipment purchased under the award is managed and accounted for. Both administrative and programmatic reviews are conducted either at the grantee’s location (on- site) or at EPA’s office or another location (off-site). Furthermore, to determine how well offices and regions oversee grantees, EPA conducts internal management reviews of headquarters and regional offices. EPA’s Competition Policy Shows Promise but Requires a Major Cultural Shift EPA’s September 2002 competition policy requires that most discretionary grants be competed. These grants totaled about $719 million of the $4.2 billion in grants awarded in fiscal year 2002. The policy applies to most discretionary grant programs or individual grants of more than $75,000.The policy also promotes widespread solicitation for competed grants by establishing specific requirements for announcing funding opportunities in, for example, the Federal Register and on Web sites. EPA has also appointed a grant competition advocate to coordinate this effort. EPA’s competition policy faces implementation barriers because it represents a major cultural shift for EPA staff and managers, who historically awarded most grants noncompetitively and thereby have had limited experience with competition, according to the Office of Grants and Debarment. The policy requires EPA officials to take a more planned, rigorous approach to awarding grants. That is, EPA staff must determine the evaluation criteria and ranking of these criteria for a grant, develop the grant announcement, and generally publish it at least 60 days before the application deadline. Staff must also evaluate applications—potentially from a larger number of applicants than in the past—and notify applicants of their decisions. These activities will require significant planning and take more time than awarding grants noncompetitively. Office of Grants and Debarment officials anticipate a learning curve as staff implement the policy and will evaluate the policy’s effectiveness in 2005, including the $75,000 threshold level. While the policy and subsequent implementing guidance have been in effect for a number of months, it is too early to tell if the policy has resulted in increased competition over the entire fiscal year. EPA officials believe that preliminary results indicate that the policy is increasing the use of competition. EPA Needs A More Systematic Approach to Strengthen Oversight EPA’s December 2002 oversight policy makes important improvements in monitoring grantees, but it does not enable the agency to identify and address systemic problems with grant recipients. Specifically, EPA cannot develop systemic information because the policy does not (1) incorporate a statistical approach to selecting grantees for review; (2) require a standard reporting format for in-depth reviews to ensure consistency and clarity in reporting review results; and (3) identify needed data elements or develop a plan for analyzing data in its grantee compliance database to identify and act on systemic grantee problems. Therefore, EPA cannot use data from these reviews to determine the overall compliance of grantees or be assured that it is using its resources to effectively target its oversight efforts. With a more rigorous statistical approach to selecting grantees, standard reporting format, and a plan for using information from in-depth and other reviews, EPA could identify problem areas and develop trends to assess the effectiveness of corrective actions in order to better target its oversight efforts. EPA Needs to Incorporate a Statistical Approach to Selecting Grantees for Review EPA’s new policy allows each office to determine what criteria it will use to select at least 10 percent of its grant recipients for in-depth review. However, because this policy does not employ a statistical method to selecting grantees for review, it limits the usefulness of these reviews as a tool to determine the overall compliance of grant recipients. Furthermore, EPA cannot determine whether 10 percent or any other percentage is the appropriate number of reviews. With a statistical approach, EPA could increase the efficiency and effectiveness of its oversight of grantees by (1) adjusting the number and allocation of its in-depth reviews to match the level of risk associated with each type of grant recipient and (2) projecting the results of its reviews to all EPA grantees. EPA Needs to Require a Standard Reporting Format for In-depth Reviews EPA’s in-depth reviews can provide valuable information that the agency can use to identify problems and implement corrective actions. However, EPA does not have a standard reporting format to ensure consistency, clarity, and usefulness in reporting review results. Consequently, EPA is not able to effectively and efficiently analyze these data to determine systemic grantee problems. Although EPA was requiring offices to conduct in-depth review of grantees in 2002, it did not systematically collect and analyze information from these reviews as part of its oversight efforts. We requested that EPA provide us with its in-depth reviews conducted in 2002 so we could do the analysis. Many of the documents EPA provided were, not in fact, in-depth reviews, but various types of other oversight documents. We sorted through these documents to identify the in-depth reviews using a data collection instrument. Through this approach, we identified 1,232 in-depth reviews. Using a data collection instrument, we collected and analyzed information from each of these in-depth reviews on, among other things, problems with grantees, and significant actions taken against grantees. The full results of our analysis are presented in our report. According to our analysis of EPA’s 1,232 in-depth reviews in 2002, EPA grant specialists and project officers identified 1,250 problems in 21 areas. Tables 1 and 2 show the most frequently identified problems for the 189 administrative and 1,017 programmatic reviews we examined. For example, 73 of 189 administrative reviews found problems with grantees’ written procedures, while 308 of the 1,017 programmatic reviews identified technical issues. The differences in types of problems frequently identified, as shown in tables 1 and 2, reflect differences in the focus of administrative and programmatic reviews. Table 3 describes the nature of these problems. Despite the importance of standard information, our analysis of EPA’s 2002 in-depth reviews shows that EPA officials across the agency report in various formats that do not always clearly present the results of the review. For example, some EPA officials provided a narrative report on the results of their reviews, while others completed a protocol that they used in conducting their review. In 349 instances, the project officer or grant management specialist did not clearly explain whether he or she had discovered a problem. EPA Needs to Develop a Plan for Using Information in Its Grantee Compliance Database EPA has recognized the importance of the information in its in-depth reviews by establishing a grantee compliance database to store the reviews, forming a database work group, and collecting a limited amount of data from its in-depth reviews. However, as of August 29, 2003, EPA had not yet developed data elements or a plan for using data from all its oversight efforts—in-depth reviews, corrective actions, and other compliance efforts—to fully identify systemic problems and then inform grants management officials about oversight areas that need to be addressed. As our analysis of EPA’s 2002 in-depth reviews showed, valuable information could be collected from them for assessing such issues as the (1) types of grantees having problems, (2) types of problem areas needing further attention, (3) types of reviews—on-site or off-site—that provide the best insights into certain problems areas, and (4) corrective actions required or recommended to resolve problems. A Systematic Approach to Collection and Analysis of Compliance Information Would Enhance Oversight With a statistical approach to selecting grantees for review, standard reporting format, and a plan for using information from in-depth and other reviews, EPA could identify problem areas and develop trends to assess the effectiveness of corrective actions to better target its oversight efforts. In particular, according to our analysis of EPA’s 2002 in-depth reviews, administrative reviews identify more problems when conducted on site, while the number of problems identified by programmatic reviews does not differ by on-site or off-site reviews. However, nearly half of the programmatic reviews, which constituted more than 80 percent of the 2002 reviews, were conducted on-site. Since on-site reviews are resource intensive because of travel costs and staff used, a systematic analysis could enable EPA to better target its resources. Similarly, EPA could incorporate other information into its grantee compliance database, such as Inspector General reports, to identify problem areas, and target oversight resources. In addition, EPA could use the database to track the resolution of problems. EPA Faces Challenges to Enhancing Accountability Successful implementation of EPA’s 5-year grants management plan requires all staff—senior management, project officers, and grant specialists—to be fully committed to, and accountable for, grants management. Recognizing the importance of commitment and accountability, the plan has as one of its objectives the establishment of clear lines of accountability for grants oversight. The plan, among other things, calls for (1) ensuring that performance standards established for grant specialists and project officers adequately address grants management responsibilities in 2004; (2) clarifying and defining the roles and responsibilities of senior resource officials, grant specialists, project officers, and others in 2003; and (3) analyzing project officers’ and grant specialists’ workload in 2004. In implementing this plan, however, EPA faces challenges to enhancing accountability. First, although the plan calls for ensuring that project officers’ performance standards adequately address their grants management responsibilities, agencywide implementation may be difficult. Currently, project officers do not have uniform performance standards, according to officials in EPA’s Office of Human Resources and Organizational Services. Instead, each supervisor sets standards for each project officer, and these standards may or may not include grants management responsibilities. It could take up to a year to establish and implement a uniform performance standard, according to these officials. Instead, the Assistant Administrator for the Office of Administration and Resources Management is planning to issue guidance this month including grants management responsibilities in individual performance agreements for the next performance cycle beginning in January 2004. Once individual project officers’ performance standards are established for the approximately 1,800 project officers, strong support by managers at all levels, as well as regular communication on performance expectations and feedback, will be key to ensuring that staff with grants management duties successfully meet their responsibilities. Although EPA’s current performance management system can accommodate the development of performance standards tailored to each project officer’s specific grants management responsibilities, the current system provides only two choices for measuring performance— satisfactory or unsatisfactory—which may make it difficult to make meaningful distinctions in performance. Such an approach may not provide enough information and dispersion in ratings to recognize and reward top performers, help everyone attain their maximum potential, and deal with poor performers. GAO has identified key practices that federal agencies can use to establish effective performance management systems, which include making distinctions in performance. Furthermore, it is difficult to implement performance standards that will hold project officers accountable for grants management because (1) grants management is often a small part of a wide range of project officers’ responsibilities, (2) some project officers manage few grants, and (3) project officers’ grants management responsibilities often fall into the category of “other duties as assigned.” To address this issue, EPA officials are considering, among other options, whether the agency needs to develop a smaller cadre of well-trained project officers to oversee grantees, rather than rely on the approximately 1,800 project officers with different levels of grants management responsibilities and skills. Some EPA officials believe that having a cadre may help the agency more effectively implement revised grants management performance standards because fewer officers with greater expertise would oversee a larger percentage of the grants. Second, EPA will have difficulty achieving the plan’s goals unless, not only project officers, but all managers and staff are held accountable for grants management. The plan does not call for including grants management standards in all managers’ and supervisors’ agreements. Senior grants managers in the Office of Grants and Debarment as well as other Senior Executive Service managers have performance standards that address grants management responsibilities, but middle-level managers and supervisors, who oversee many of the staff that have important grants management responsibilities, do not. According to Office of Grants and Debarment officials, they are working on developing performance standards for all managers and supervisors with grants responsibilities. Third, it may be difficult to hold all managers and staff accountable because the Office of Grants and Debarment does not have direct control over many of the managers and staff who perform grants management duties—particularly the approximately 1,800 project officers in headquarters and regional program offices. The division of responsibilities between the Office of Grants and Debarment and program and regional offices will continue to present a challenge to holding staff accountable and improving grants management, and will require the sustained commitment of EPA’s senior managers. Conclusions If EPA is to better achieve its environmental mission, it must more effectively manage its grants programs—which account for more than half of its annual budget. EPA’s new policies and 5-year grants management plan show promise, but they are missing several critical elements necessary for the agency to address past grants management weaknesses. Specifically to improve EPA’s oversight of grantees, our report recommends that EPA’ (1) incorporate appropriate statistical methods to identify grantees for review; (2) require EPA staff to use a standard reporting format for in-depth review so that the results can be entered into the grantee compliance database and analyzed agency wide; and (3) develop a plan, including modifications to the grantee compliance database, to integrate and analyze compliance information from multiple sources. These actions would help EPA identify systemic problems with its grantees and better target its oversight resources. To enhance accountability, our report further recommends establishing performance standards for all managers and staff responsible for grants management and holding them accountable for meeting these standards. Until EPA does so, it cannot be assured that is fulfilling its grants management responsibilities. While EPA’s 5-year grants management plan shows promise, we believe that, given EPA’s historically uneven performance in addressing its grants management challenges, congressional oversight is important to ensure that EPA’s Administrator, managers, and staff implement the plan in a sustained, coordinated fashion to meet the plan’s ambitious targets and time frames. To help facilitate this oversight, our report recommends that EPA annually report to Congress on its progress in improving grants management. Mr. Chairman, this concludes my prepared statement. I would be happy to respond to any questions that you or Members of the Subcommittee may have. Contacts and Acknowledgments For further information about this testimony, please contact John B. Stephenson at (202) 512-3841. Individuals making key contributions to this testimony were Andrea Wamstad Brown, Carl Barden, Christopher Murray, Paul Schearf, Rebecca Shea, Carol Herrnstadt Shulman, Bruce Skud, Kelli Ann Walther, and Amy Webbink. This is a work of the U.S. government and is not subject to copyright protection in the United States. It may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately. SUMMARY: [/INST] The Environmental Protection Agency (EPA) has faced persistent challenges in managing its grants, which, at about $4 billion annually constitute over one-half of the agency's total budget. EPA awards grants to thousands of recipients to implement its programs to protect human health and the environment. Given the size and diversity of EPA's programs, its ability to efficiently and effectively accomplish its mission largely depends on how well it manages its grant resources and builds accountability into its efforts. In our comprehensive report on EPA's management of its grants, released last week, we found that EPA continues to face four key grants management challenges despite past efforts to address them--(1) selecting the most qualified grant applicants, (2) effectively overseeing grantees, (3) measuring the results of grants, and (4) effectively managing its grant staff and resources. The report also discusses EPA's latest competition and oversight policies and its new 5-year plan to improve the management of its grants. This testimony, based on our report, focuses on the extent to which EPA's latest policies and plan address (1) awarding grants competitively, (2) improving oversight of grantees, and (3) holding staff and managers accountable for fulfilling their grants management responsibilities. Late in 2002, EPA launched new efforts to address some of its long-standing grants management problems. It issued two policies--one to promote competition in awarding grants and one to improve its oversight of grants. Furthermore, in April 2003, EPA issued a 5-year grants management plan to address its long-standing grants management problems. These policies and plan focus on the major grants management challenges we identified but will require strengthening, enhanced accountability, and sustained commitment to succeed. EPA's September 2002 competition policy should improve EPA's ability to select the most qualified applicants by requiring competition for more grants. However, effective implementation of the policy will require a major cultural shift for EPA managers and staff because the competitive process will require significant planning and take more time than awarding grants noncompetitively. EPA's December 2002 oversight policy makes important improvements in monitoring grantees, but it does not build in a process for effectively and efficiently analyzing the results of its monitoring efforts to address systemic grantee problems. Specifically, EPA does not (1) use a statistical approach to selecting grantees for review, (2) collect standard information from the reviews, and (3) analyze the results to identify and resolve systemic problems with grantees. As a result, EPA may not be using its oversight resources as efficiently as it could. With improved analysis, EPA could better identify problem areas and assess the effectiveness of its corrective actions to more efficiently target its oversight efforts. EPA's 5-year grants management plan recognizes the importance of accountability, but it does not completely address how the agency will hold all managers and staff accountable for successfully fulfilling their grants management responsibilities. For example, the plan calls for developing performance standards for staff overseeing grantee performance, but it does not call for including grants management performance standards in their managers' and supervisors' performance agreements. Unless all managers and staff are held accountable for grants management, EPA cannot ensure the sustained commitment required for the plan's success. Our report, Grants Management: EPA Needs to Strengthen Efforts to Address Persistent Challenges, GAO-03-846, details EPA's historically uneven performance in addressing its grants management challenges. Over the years, EPA's past actions to improve grants management have had mixed results because of the complexity of the problems, weaknesses in policy design and implementation, and insufficient management attention to overseeing grants. While EPA's latest policies and new 5-year grants management plan show promise, it is too early to tell if these will succeed more than past actions. If EPA is to better achieve its environmental mission, it must more effectively manage its grants. Our report contains specific recommendations to address critical weaknesses in EPA's new oversight policy and plan. EPA stated that it agreed with GAO's recommendations and it will implement them as part of its 5- year grants management plan. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Post-mortem brains from Down syndrome (DS) and Alzheimer' s disease (AD) patients show an upregulation of the Down syndrome critical region 1 protein (DSCR1), but its contribution to AD is not known. To gain insights into the role of DSCR1 in AD, we explored the functional interaction between DSCR1 and the amyloid precursor protein (APP), which is known to cause AD when duplicated or upregulated in DS. We find that the Drosophila homolog of DSCR1, Nebula, delays neurodegeneration and ameliorates axonal transport defects caused by APP overexpression. Live-imaging reveals that Nebula facilitates the transport of synaptic proteins and mitochondria affected by APP upregulation. Furthermore, we show that Nebula upregulation protects against axonal transport defects by restoring calcineurin and GSK-3β signaling altered by APP overexpression, thereby preserving cargo-motor interactions. As impaired transport of essential organelles caused by APP perturbation is thought to be an underlying cause of synaptic failure and neurodegeneration in AD, our findings imply that correcting calcineurin and GSK-3β signaling can prevent APP-induced pathologies. Our data further suggest that upregulation of Nebula/DSCR1 is neuroprotective in the presence of APP upregulation and provides evidence for calcineurin inhibition as a novel target for therapeutic intervention in preventing axonal transport impairments associated with AD. Virtually all Down syndrome (DS) adults develop progressive neurodegeneration as seen in Alzheimer' s disease (AD), and overexpression of the amyloid precursor protein (APP), a gene located on chromosome 21, is thought to contribute to AD in DS [1]–[3]. Consistently, duplication of a normal copy of APP is sufficient to cause familial AD [4], [5], confirming that it is a key gene in AD neuropathologies seen in DS. This well-known connection between AD and DS provides a unique opportunity to identify the genetic and molecular pathways contributing to AD. In addition to APP, another gene likely to play a crucial role in both AD and DS is the Down syndrome critical region 1 gene (DSCR1, also known as RCAN1). Intriguingly, post-mortem brains from AD patients show increased DSCR1 both at mRNA and protein levels [6]–[8]. Studies have also shown that oxidative stress and Aβ42 exposure can induce DSCR1 expression [8], [9]. DSCR1 is located on human chromosome 21 and encodes a highly conserved calcineurin inhibitor family called calcipressin [10]–[15]. DSCR1 has been implicated paradoxically in both promoting cell survival in response to oxidative stress and in inducing apoptosis [8], [9], [16], [17]. The role of DSCR1 in AD thus remains unclear and an important question is whether DSCR1 contributes to AD or plays a role in combating the toxic effects of APP overexpression. To elucidate the role of DSCR1 in modulating APP-induced phenotypes, we used Drosophila as a model system, which has been used successfully to investigate various human neurodegenerative diseases including AD, Parkinson' s, and polyglutamine-repeat diseases [18]–[27]. Overexpression of APP in both fly and mouse models have previously been shown to cause age-dependent neurodegeneration and axonal transport defects [28]–[31]. Furthermore, impaired transport of essential organelles and synaptic vesicles caused by APP perturbation is thought to be an underlying cause of synaptic failure and neurodegeneration in AD [32]–[34]. However, mechanisms for how APP induces transport defects remain unclear. Here, we show that Nebula, the fly homolog of DSCR1, delays neurodegeneration and reduces axonal transport defects caused by APP overexpression. We report that Nebula enhances anterograde and retrograde axonal trafficking as well as the delivery of synaptic proteins to the synaptic terminal. We find that APP upregulation elevates calcineurin activity and GSK-3β signaling, but Nebula co-upregulation corrects altered signaling to restore axonal transport. Together, our results indicate that Nebula/DSCR1 upregulation is neuroprotective in the presence of APP overexpression and further suggest that Nebula/DSCR1 upregulation may delay AD progression. In addition, our results for the first time link defective calcineurin signaling to altered axonal transport and imply that restoring calcineurin and GSK-3β signaling may be a feasible strategy for treating AD phenotypes caused by APP upregulation. To examine the role of DSCR1 in modulating APP-induced neurodegeneration and axonal transport defects, we generated transgenic flies containing UAS-APP (APP) in the presence or absence of UAS-nebula (nlat1) [15]. Targeted expression of human APP in the fly eyes using the Gmr-GAL4 driver caused age-dependent degeneration of the photoreceptor neurons, consistent with a previous report by Greeve et al [35]. As seen in Fig. 1A, staining with an antibody specific for the photoreceptor neurons (24B10) and antibody against the APP protein (6E10) revealed the presence of vacuoles in the retina (arrow). Surprisingly, overexpression of nebula together with APP (APP; nlat1) reduced neurodegeneration (as determined by calculating the fold change in the percentage of area lost), suggesting that Nebula upregulation is neuroprotective (Figs. 1A and 1B). By 45-days of age, flies expressing both nebula and APP started to show increased vacuole formation, but the extent of degeneration was significantly reduced compared to that of APP overexpression, further implying that Nebula delays the onset of neurodegeneration rather than completely preventing it. To confirm that Nebula indeed protects against neurodegeneration caused by APP upregulation, we expressed APP in nla1, a previously characterized nla hypomorphic mutant [15]. Note that because nebula null alleles are lethal [15], nebula hypomorphs were examined. Fig. 1 shows that decreasing Nebula level enhanced APP-induced neurodegeneration in the retina (APP; nla1), thus highlighting the importance of endogenous Nebula protein in conferring neuroprotection. We did not detect significant neurodegeneration in nla1 mutant and nla overexpression flies even by 45 days of age (data not shown), indicating that APP is necessary for the observed phenotype. In addition, mitigation of photoreceptor degeneration by Nebula upregulation is not due to altered expression level of APP, since UAS-LacZ transgene was included to balance out the number of transgenes (we found Gmr-GAL4 is particularly sensitive to number of transgenes). The level of APP protein in each fly line is also further confirmed by staining with the 6E10 antibody (Fig. 1A) and Western blot analyses (Fig. S1). Comparable level of APP was detected in all transgenic lines, suggesting that rescue by nebula overexpression is not due to altered APP level. We next determined if Nebula rescues functional defects in photoreceptor by measuring the ability of flies to see light. Flies are normally phototactic and will move toward light when placed in test tubes with light source on the opposite end [36]. We find that the severity of the vacuole phenotype was paralleled by impairments in phototactic behavior (Fig. 1C). Flies overexpressing APP showed age-dependent decline in phototaxis that is delayed by APP and nebula expression (Fig. 1C). Taken together, these results imply that nebula overexpression protects neurons structurally as well as functionally against the toxic effects of APP overexpression. We also noticed that APP overexpression caused formation of APP aggregates in the photoreceptor axons as detected by 6E10 antibody (Fig. 1D; yellow arrow head). Previous studies have shown that APP phosphorylated on threonine 668 (pT668-APP) is preferentially transported in axons [37], we thus further monitored the distribution of pT668-APP. We found that overexpression of APP led to pT668-APP accumulations in the photoreceptor axons, whereas APP and nebula co-overexpression significantly enhanced the delivery of pT668-APP to synaptic terminals in the medulla (Fig. 1D). These results suggest that APP overexpression may lead to blocked transport that is alleviated by Nebula. Axonal transport abnormalities are thought to precede the onset of AD [30], and APP overexpression has been shown to cause synaptic vesicle accumulations indicative of blocked axonal transport [28], [29]. We thus further investigated the role of Nebula in modulating APP-induced vesicle aggregation in larval motor axons, which is an excellent system for monitoring vesicle transport because of the long axons and stereotypical innervation of the neuromuscular junction (NMJ). As seen in Fig. 2A, APP overexpression in neurons using the Elav-GAL4 driver caused synaptic vesicle accumulation as detected by synaptotagmin staining in the motor axons, suggesting abnormal vesicle transport. Staining using the 4G8 antibody to detect APP revealed that APP aggregates frequently colocalized with synaptotagmin aggregates, implying that synaptotagmin and APP are either comparably inhibited by physical blockade within the nerve or that they are transported together as suggested by recent reports [38], [39]. Co-upregulation of Nebula and APP significantly prevented APP-induced synaptotagmin and APP accumulations. Decreasing Nebula by crossing it into nla1 background increased the number of synaptotagmin and APP aggregates slightly, although not significantly (Fig. 2B). As nla1 only reduces Nebula level by about 30% and that nla null alleles are lethal [15], we used RNAi strategy to further decrease Nebula level (Fig. S2). Figs. 2A–2B show that greater reduction in Nebula level using the UAS-nla-RNAi transgene (RNAi-nla) further exacerbated the APP-induced aggregation phenotype. To ensure that the observed rescue in phenotype is not due to altered APP overexpression, we monitored the level of neuronal APP protein, as well as Nebula, in different fly lines. As seen in Fig. S3, APP level was unaltered in flies containing different number of transgenes, and Nebula manipulations in APP overexpression background showed the expected changes. Similar results were obtained when performing western blot analyses using brains dissected from 3rd instar larvae (Fig. S4). Together, these results confirm that rescue of APP phenotype by Nebula is not due to altered APP expression. In addition, we examined the effect of altering Nebula levels alone on vesicle accumulation. Manipulations of Nebula levels alone did not cause synaptotagmin aggregate accumulation in nerves, suggesting the observed phenotype is APP-dependent (Figs. S5A and S5B). To verify that the synaptotagmin aggregate accumulation phenotype is not due to a non-specific effect of expressing human APP, we also monitored the effect of Nebula on modulating endogenous fly Appl gene function. Fig. 2C shows that upregulation of APPL in neurons also caused synaptotagmin accumulation in axons. Nebula co-upregulation significantly reduced the number of synaptotagmin aggregates, whereas Nebula reduction using RNAi significantly exacerbated the phenotype (Figs. 2C and 2D). Together, our results support earlier finding that mammalian APP and Drosophila APPL are functionally conserved [40], and further indicate that APP and APPL-induced axonal transport defects are regulated by Nebula in a similar fashion. To determine to what degree aggregate accumulation corresponded to altered delivery of synaptic proteins to the synaptic terminal, we evaluated the levels of both synaptotagmin and APP in the NMJ. As demonstrated in Figs. 3A–3B, APP upregulation significantly reduced the level of average synaptotagmin intensity in the synapse while nebula co-overexpression enhanced the delivery of both synaptotagmin and APP to the synaptic terminal. This change is not due to altered overall synaptotagmin or APP levels (Figs. S4 and S5C). Note that the 4G8 antibody does not detect endogenous fly APPL; therefore, we normalized the level of APP delivered to the synapse to flies overexpressing APP and nebula. We found Nebula reduction did not further reduce the amount of synaptotagmin reaching the terminal (Fig. 3B), albeit it did increase the number of APP-induced aggregates in the axon (Fig. 2B). This result indicates that either retrograde transport of synaptotagmin is altered, or the increase in aggregate number has not yet reached a critical threshold for further impairment. In addition, although no detectable synaptotagmin aggregate was seen in flies with Nebula reduction alone, a decrease in synaptotagmin staining was detected in the synapse (Figs. S5B and S5D). This result suggests that Nebula itself may be required for reliable axonal transport. We also examined the effect of abnormal aggregate accumulations and reduced delivery of synaptic proteins on locomotor behavior. Overexpression of APP dramatically impaired larval movement (Fig. 3C and Movie S1). Nebula co-overexpression significantly rescued this locomotor defect, in further support of the hypothesis that Nebula upregulation exerts beneficial effects on synaptic functions by alleviating abnormal aggregate accumulations. Note that further reduction of Nebula in APP overexpression background did not significantly worsen the locomotor defect of APP overexpressing larvae, perhaps due to a threshold effect. Reducing Nebula alone was sufficient to induce a mild defect in locomotor activity (Fig. S5E), suggesting delivery of synaptic proteins to the synaptic terminals is crucial for normal synaptic function. Similar to APP overexpression, upregulation of APPL decreased the delivery of synaptotagmin to the synapse. APPL and Nebula co-upregulation showed a higher level of synaptotagmin in the NMJ, confirming Nebula interacts genetically with APPL to rescue impaired in transport (Fig. S6A and S6B). We also found that similar to RNAi-nla larvae, Appl null mutant (Appld) displayed a slight decrease in the level of synaptotagmin at the synapse independent of aggregate accumulation (Figs. S6B and S6C). Reducing Nebula in neurons of Appld larvae with the RNAi-nla transgene driven by the pan-neuronal nSyb-GAL4 driver (Appld; RANi-nla/nSyb-GAL4) did not further enhance the phenotype, suggesting that the two proteins act in the same pathway to modulate axonal transport. While monitoring synaptotagmin levels at the NMJ, we also noticed that APP overexpression triggered changes in synaptic morphology as previously reported [41], [42]. Fig. 4 shows presynaptic terminals stained with HRP to outline the presynaptic terminals, which revealed an increase in the total number of boutons and satellite boutons brought upon by APP overexpression. Nebula co-upregulation also rescued APP-induced synapse proliferation phenotype, but not the number of satellite boutons (Fig. 4B and 4D). Manipulating levels of Nebula alone without APP did not influence bouton number or morphology, suggesting that the satellite bouton phenotype is dependent on the presence APP in the synapse. Since reducing Nebula levels alone decreased the delivery of synaptotagmin to the synaptic terminal without altering synaptic morphology, axonal transport problems are not secondary consequences of altered synaptic morphology. A plausible mechanism by which Nebula suppresses the APP-induced over-proliferation phenotype is that Nebula co-upregulation restores the delivery of proteins required for normal synaptic growth such as Fasciclin II (FasII), a cell adhesion molecule shown to influence synaptic morphology [43], [44]. Previous reports suggest that changes in FasII levels differentially affect synaptic growth [42]–[44], and that increasing FasII levels presynaptically can significantly suppress the increase in bouton number observed in APPL overexpression synapses [42]. We therefore quantified FasII levels in the NMJ (Fig. S7). We found that overexpression of APP reduced the level of FasII in the NMJ, whereas APP and nebula co-overexpression restored it (Fig. S7). While APP upregulation may play other roles in synapse formation, these results together with previous reports imply that depletion of FasII in the presynaptic terminal could partially contribute to the hyper-growth phenotype. Furthermore, our data reveal that Nebula upregulation is effective in protecting against multiple phenotypes caused by APP overexpression, including age dependent photoreceptor neurodegeneration, vesicle accumulations in axons, and changes in synaptic morphology. To directly evaluate the effect of Nebula on APP transport and to determine whether the observed axonal aggregates correspond to defective axonal transport, we performed live-imaging of human APP tagged with yellow fluorescent protein (APP-YFP). APP-YFP vesicles in larval motor axons displayed movement in both the anterograde and retrograde directions over the 2-minute imaging period as represented by kymographs depicting distance traveled and time in the x- and y-directions, respectively (Fig. 5A). Nebula co-overexpression had a mild, but significant, effect on APP-YFP movement. Nebula co-upregulation increased the percentage of anterograde moving vesicles and resulted in reduced number of stationary APP-YFP; knockdown of Nebula using RNAi increased the number of stationary APP-YFP (Figs. 5A and 5B). Quantification of the average speed of APP-YFP movement revealed that overexpression of nebula also increased the speed of APP-YFP movement in both the anterograde and retrograde directions (Fig. 5C). Together, these results suggest that Nebula upregulation enhances the transport of APP, consistent with the decreased aggregate accumulations of APP in axons and increased APP staining in the NMJ when Nebula is co-expressed (Figs. 2A and 3A). To further confirm that Nebula facilitates synaptic vesicle movement in the presence of APP and to better assess the role of endogenous Nebula in regulating transport, we also monitored synaptotagmin movement in the motor axons of larvae expressing GFP-tagged synaptotagmin (GFP-SYT). We find the movement of GFP-SYT to be highly dynamic with anterograde, retrograde, and bi-directional movement (Fig. 6A). Overexpression of APP dramatically reduced the percentage of vesicles moving in both the anterograde and retrograde directions while nebula co-overexpression significantly facilitated synaptotagmin transport in both directions (Figs. 6A and 6B), albeit retrograde transport was more effectively restored by Nebula. Reducing Nebula using RNAi further diminished APP-induced synaptotagmin transport in both directions, confirming interaction between Nebula and APP. Reduction in the overall movement was also accompanied by a decrease in anterograde and retrograde velocity (Fig. 6C). Together, these results suggest that APP overexpression slows down the overall movement of vesicles, which may lead to accumulation of transported proteins. Nebula co-overexpression with APP partially restores the defect by increasing the movement and speed of transport in both the anterograde and retrograde directions. To understand the role of endogenous Nebula in axonal transport, we examined the effect of Nebula manipulations on GFP-SYT movement in the absence of APP overexpression. We find that Nebula upregulation alone did not significantly influence transport; decreasing Nebula through RNAi was sufficient to reduce the number of moving synaptotagmin vesicle in both directions, as well as the speed of anterograde transport (Fig. 6). This result is consistent with the decrease in synaptotagmin staining in the NMJ seen in static images, and further confirms that Nebula is required for efficient transport of synaptic proteins. To further determine if general axonal transport is affected by APP and Nebula upregulation, we also monitored mitochondrial transport. Proper distribution of mitochondria is vital for normal cell functions and defects in mitochondrial transport can adversely affect cell survival [45]–[47]. Time-lapse live imaging was performed in larvae with GFP targeted to mitochondria (mito-GFP) for the indicated genotypes (Fig. 7). APP upregulation severely impaired the movement of mitochondria in both the anterograde and retrograde directions both in terms of percent in motion and the speed of movement (Figs. 7B and 7C). Nevertheless, the APP-induced mitochondrial transport defect was partially restored by Nebula co-upregulation (Fig. 7 and Movie S2), similar to what was observed for synaptic vesicle transport. Manipulations in the level of Nebula did not significantly alter the overall mitochondrial movement, except that nebula overexpression alone seemed to enhance both the proportion and the speed of mitochondria transported in the retrograde direction. This result is consistent with our observation that Nebula co-upregulation was more effective in restoring retrograde GFP-SYT transport. Together, our results suggest that Nebula influences general axonal transport that extends beyond synaptic proteins. Mitochondria are dynamic organelles whose distribution is tightly regulated to meet the energy demands within the polarized neuron [45], [48]. We find that despite the decrease in mitochondrial movement in flies overexpressing APP, the distribution and density of mitochondria within the proximal axon where imaging was performed did not vary across genotypes (Fig. S8A). These results imply that impaired synaptic vesicle transport is not likely caused by local depletion of mitochondria within the axon. Furthermore, mitochondria did not accumulate near the site of synaptotagmin aggregate formation in the axons (Fig. S8B), suggesting that mitochondria are either able to move past the stalled synaptic vesicle accumulations or that mitochondria travel on other non-blocked microtubule tracks. Despite increasing evidence linking defective trafficking of presynaptic proteins, mitochondria, and signaling molecules to neuropathologies of AD, mechanisms for how APP overexpression affects axonal transport remain unclear. We first tested the possibility that APP upregulation impairs axonal transport by influencing overall microtubule integrity. To this end, we stained the axonal nerves and NMJs with antibodies against acetylated tubulin, β-tubulin, and Futsch (Fig. 8). Acetylated tubulin is a marker for stable microtubules [49]; Futsch is a microtubule binding protein homolog to human MAP1B and is involved in maintaining microtubule integrity at presynaptic terminals during NMJ growth [50]. Our data revealed that APP overexpression did not cause fragmentation of microtubules as revealed by both acetylated tubulin and β-tubulin staining in the axons (Fig. 8A), and filamentous acetylated tubulin staining in the synaptic terminals across all genotypes (Fig. 8B). Note that in Fig. 8B, we also highlighted the presynaptic boutons by HRP staining (red), since acetylated tubulin in the muscles are also detected in the background. Western blot analyses of dissected larval brains further confirmed that the overall level of acetylated tubulin is not altered by APP overexpression (Fig. 8C). Closer examination of Futsch staining also did not reveal differences in overall microtubule integrity (Fig. 8D). Together, these results suggest that APP overexpression does not cause axonal transport problems by influencing microtubule stability, which is consistent with a recent report that showed normal microtubule stability and acetylated tubulin level in larvae overexpressing APP-YFP [51]. Nebula encodes an inhibitor of calcineurin that is highly conserved across species [15], we therefore tested the hypothesis that calcineurin inhibition is an underlying mechanism for Nebula-mediated rescue of APP phenotypes. To this end, we genetically altered calcineurin activity in neurons using the UAS/GAL4 strategy. To elevate calcineurin activity, we expressed a constitutively active calcineurin (CaNAct) with its auto-inhibitory domain deleted (Figs. S9A and S9B). To reduce calcineurin activity, RNAi strategy against the calcineurin B gene (RNAi-CaNB), an obligatory subunit necessary for calcineurin activity, was used. We find that similar to Nebula upregulation, decreasing calcineurin using RNAi-CaNB in the presence of APP significantly reduced synaptotagmin aggregate accumulations and synaptic depletion, as well as restored larval locomotor behavior (Figs. S9C–E). Overexpression of CaNAct together with APP further exacerbated the APP-induced phenotypes (Figs. 9A and 9B), whereas co-overexpression of CaNAct and nebula diminished the ability of Nebula to protect against APP-induced transport defects. Similar to larvae with reduced levels of Nebula (RNAi-nla), larvae expressing CaNAct did not show aggregate accumulations in axons but displayed a reduced level of synaptotagmin staining in the synapse (Figs. S9D), indicating active calcineurin overexpression alone only has modest effect on axonal transport. As shown above, synaptotagmin aggregate accumulation in nerves and depletion in the synaptic terminals are reliable indicators of significant transport deficiencies; our results thus indicate that Nebula protects against APP-induced defects through inhibition of calcineurin. Furthermore, our data present for the first time that APP upregulation influences axonal transport through activation of calcineurin. This conclusion is further supported by direct measurement of calcineurin activity, in which we find that APP upregulation significantly elevated calcineurin activity but is further restored close to normal in flies overexpressing APP and nebula, or APP and RNAi-CaNB (Fig. 9C). Overexpression of APP, CaNAct, and nebula together showed an intermediate phenotype in both calcineurin activity and aggregate accumulations, suggesting that the severity of aggregate accumulation correlated with the level of calcineurin when APP is upregulated. How does APP upregulation trigger calcineurin activation? Because calcineurin phosphatase activity is dependent on intracellular calcium concentration [52], we examined the possibility that APP overexpression elevates calcium levels. Using a genetically encoded fluorescent calcium sensor (Case12) previously shown to detect calcium with high sensitivity [53], [54], we compared Case12 signal across different genotypes. Fig. S10 shows that larval brain expressing Case12 displayed a significant increase in signal following application of calcimycin, a calcium ionophore, confirming that the Case12 construct can indeed detect increases in calcium. Overexpression of APP alone or overexpression of APP and nebula also caused a significant elevation in Case12 signal in the larval brain and the ventral ganglion (where the motor neuron cell bodies are located) as compared to the control (Figs. 9D and 9E). These data imply that an APP-mediated increase in calcium is triggering the increase in calcineurin activity. Furthermore, observations that co-overexpression of APP and nebula increased calcium while simultaneously restoring calcineurin activity indicate that Nebula is influencing axonal transport through calcineurin inhibition rather than acting at a step modulating calcium influx. Mechanisms by which calcineurin regulates axonal transport are not well understood, but one potential pathway is through regulation of GSK-3β activity. Aberrant activation of GSK-3β has been associated with AD and calcineurin has been shown to activate GSK-3β through dephosphorylation of Ser9 of GSK-3β in vitro [55]–[58]. It was suggested that GSK-3β may negatively influence axonal transport by altering microtubule stability through hyperphosphorylation of tau, by inhibiting kinesin motor binding to the cargo through phosphorylation of the kinesin light chain (KLC), or by altering the kinesin motor activity [51], [59]–[61]. These previous findings led us to investigate the possibility that Nebula restores APP-dependent transport problems through calcineurin-mediated regulation of GSK-3β in vivo. The activity of GSK-3β is regulated by phosphorylation and dephosphorylation: dephosphorylation of Ser9 by a number of phosphatases including calcineurin is required to activate GSK-3β [56], [62], and phosphorylation at Tyr216 site is necessary to enhance GSK-3β activity [63], [64]. Interestingly, phosphorylation of GSK-3β at Ser9 can both inhibit GSK-3β activity and override the increase in activity even when phosphorylated at Tyr216 [65]. Because these phosphorylation sites are conserved between fly and human, we took advantage of phospho-specific antibodies to monitor GSK-3β activity. Western blot analyses using an antibody specific for phosphorylated Ser9 (pSer9) of GSK-3β revealed that APP upregulation indeed reduced the level of pSer9-GSK-3β while APP and Nebula co-upregulation partially restored the level to normal (Fig. 10A). This suggests APP upregulation leads to GSK-3β activation that is inhibited by Nebula upregulation. To verify that GSK-3β activation is due to calcineurin activation, we reduced calcineurin activity in APP overexpressing flies using RNAi-CaNB (Fig. 10A). We find that APP and RNAi-CaNB co-overexpression in neurons, which was sufficient to restore calcineurin activity, completely prevented GSK-3β dephosphorylation at Ser9 site. This result indicates that APP-induced GSK-3β dephosphorylation at Ser9 is dependent on calcineurin activation in vivo. Note that we did not detect enhanced GSK-3β dephosphorylation when APP is expressed together with constitutively active calcineurin (CaNAct), suggesting that calcineurin may in part directly influence transport through GSK-3β-independent pathways. Our data strongly implicate activation of calcineurin and subsequent GSK-3β induction to be a mechanism underlying APP-induced aggregate phenotype. Because activation of calcineurin alone did not result in synaptotagmin aggregate accumulation, we further hypothesized that APP upregulation also enhances GSK-3β activity through phosphorylation at Tyr216. Western blot analyses show that the level of phosphorylated GSK-3β at Tyr214 (conserved Tyr216 site in Drosophila) is indeed elevated in flies overexpressing APP or APP and nebula (Fig. 10B). Overexpression of CaNAct alone, however, failed to induce phosphorylation at Tyr214, suggesting that phosphorylation of Tyr214 is not affected by calcineurin and dependent on the presence of APP. Together, our data demonstrate that in addition to activating GSK-3β by relieving inhibition through calcineurin, APP upregulation further enhances GSK-3β activity through phosphorylation at Y214 in fly. Active GSK-3β had been shown to phosphorylate KLC, leading to detachment of the cargo from the motor [59], [66]. Since synaptotagmin transport was severely inhibited by APP overexpression, and that synaptotagmin transport can depend on kinesin 3 [67], [68] and kinesin 1 (both KLC and kinesin 1 heavy chain) [69]–[73], we tested the possibility that APP overexpression perturbs KLC and synaptotagmin interaction via immunoprecipitation. APP overexpression indeed reduced synaptotagmin (cargo) and KLC interaction while overexpression of APP and nebula preserved this interaction (Fig. 10C). These results suggest that Nebula is likely to restore APP-induced axonal transport defects by correcting GSK-3β signaling and stabilizing cargo-motor interaction. Having demonstrated that APP activates calcineurin signaling to regulate GSK-3β phosphorylation, we next examined if reducing GSK-3β can restore axonal transport. In the presence of APP upregulation, decreasing Shaggy (Sgg; fly homolog of GSK-3β) in flies with APP overexpression (sgg1; APP) resulted in significant suppression of the APP aggregate phenotype (Figs. 10D and 10E). This result is consistent with a recent report demonstrating mild enhancement of APP-YFP movement when GSK-3β is reduced [51]. Surprisingly, normal calcineurin activity was detected in these flies (1. 00±0. 16 fold of control for Sgg1; APP vs. 1. 75±0. 25 fold of control for APP). This result suggests the existence of feedback regulation of calcineurin activity and further implies that either a change in calcineurin activity or GSK-3β signaling could be responsible for the observed rescue. We therefore generated flies expressing APP and constitutively active calcineurin in sgg1 background (sgg1; APP/CaNAct). Note that we used the hypomorphic allele sgg1 because sgg null animals are lethal [74]. Consistent with GSK-3β being downstream of calcineurin, reducing Sgg diminished the effect of CaNAct in enhancing APP phenotype (Figs. 9B and 10E). We also expressed the constitutively active Sgg (sggS9A) together with APP, which surprisingly showed the same phenotype as APP overexpression. Calcineurin activity assay showed an unexpected decrease in calcineurin activity (0. 74±0. 06 fold of control) in these flies, suggesting that constitutive GSK-3β activation in the absence of calcineurin activation is sufficient to disrupt axonal transport potentially through phosphorylation of KLC. Interestingly, we find that overexpression of the constitutively active Sgg in neurons alone was sufficient to induce aggregate accumulation similar to flies with APP overexpression (Figs. 10D and 10E). Calcineurin activity assay revealed that these flies showed an increase in overall calcineurin activity (1. 65±0. 30 fold of control). This increase in calcineurin activity by active Sgg may be due to GSK dependent phosphorylation of Nebula, which has been shown to cause activation of calcineurin [75]. Since over-activation of calcineurin and GSK-3β pathway in the absence of APP upregulation fully replicated the aggregate accumulation phenotype, it suggests that abnormal activation of both the GSK-3β and calcineurin pathways are necessary for the severe axonal transport defect and aggregate accumulation phenotypes. Although upregulation of APP had been shown to negatively influence axonal transport in mouse and fly models 28–31, mechanisms by which APP upregulation induces transport defects are poorly understood. Several hypotheses have been proposed, including titration of motor/adaptor by APP, impairments in mitochondrial bioenergetics, altered microtubule tracks, or aberrant activation of signaling pathways [76]. The motor/adaptor titration theory suggests that excessive APP-cargos titrates the available motors away from other organelles, thus resulting in defective transport of pre-synaptic vesicles [29]. Our finding that Nebula co-upregulation enhanced the movement and delivery of both synaptotagmin and APP to the synaptic terminal argues against this hypothesis. In addition, earlier finding suggest that Nebula upregulation alone impaired mitochondrial function and elevated ROS level [77], thus implying that Nebula is not likely to rescue APP-dependent phenotypes by selectively restoring mitochondrial bioenergetics. Furthermore, consistent with a recent report showing normal microtubule integrity in flies overexpressing either APP-YFP or activated GSK-3β [51], our data revealed normal gross microtubule structure in flies with APP overexpression. Together, these results suggest that changes in gross microtubule structure and stability is not a likely cause of APP-induced transport defects. Instead, our results support the idea that Nebula facilitates axonal transport defects by correcting APP-mediated changes in phosphatase and kinase signaling pathways. First, we find that APP upregulation elevated intracellular calcium level and calcineurin activity, and that restoring calcineurin activity to normal suppressed the synaptotagmin aggregate accumulation in axons. The observed increase in calcium and calcineurin activity is consistent with reports of calcium dyshomeostasis and elevated calcineurin phosphatase activity found in AD brains [78]–[80], as well as reports demonstrating elevated neuronal calcium level due to APP overexpression and increased calcineurin activation in Tg2576 transgenic mice carrying the APPswe mutant allele [81], [82]. Second, APP upregulation resulted in calcineurin dependent dephosphorylation of GSK-3β at Ser9 site, a process thought to activate GSK-3β kinase [56]. APP upregulation also triggered calcineurin-independent phosphorylation at Tyr216 site, which has been shown to enhance GSK-3β activity [64], [65]. The kinase (s) that phosphorylates APP at Tyr216 is currently not well understood, it will be important to study how APP leads to Tyr216 phosphorylation in the future. Based on our results, we envision that APP overexpression ultimately leads to excessive calcineurin and GSK-3β activity, whereas nebula overexpression inhibits calcineurin to prevent activation of GSK-3β (Fig. S11). Our findings that nebula co-overexpression prevented GSK-3β activation and enhanced the transport of APP-YFP vesicles are consistent with a recent report by Weaver et al., in which they find decreasing GSK-3β in fly increased the speed of APP-YFP movement [51]. Furthermore, consistent with our result that APP upregulation triggers GSK-3β enhancement and severe axonal transport defect, Weaver et al. did not detect changes in GFP-synaptotagmin movement in the absence of APP upregulation. Active GSK-3β has been shown to influence the transport of mitochondria and synaptic proteins including APP, although the exact mechanism may differ between different cargos and motors [51], [83], [84]. One mechanism proposed for GSK-3β-mediated regulation of axonal transport is through phosphorylation of KLC1, thereby disrupting axonal transport by decreasing the association of the anterograde molecular motor with its cargos [59]. Accordingly, we find that APP reduced KLC-synaptotagmin interaction while Nebula upregulation preserved it. Synaptotagmin transport in both the anterograde and retrograde directions were affected, consistent with previous reports showing that altering either the anterograde kinesin or retrograde dynein is sufficient affected transport in both directions [85], [86]. Our results also support work suggesting that synaptotagmin can be transported by the kinesin 1 motor complex in addition to the kinesin 3/imac motor [67]–[73]. As kinesin 1 is known to mediate the movement of both APP and mitochondria [37], [86]–[88], and that phosphorylation of KLC had been shown to inhibit mitochondrial transport [89], detachment of cargo-motor caused by GSK-3β mediated phosphorylation of KLC may lead to general axonal transport problems as reported here. However, GSK-3β activation may also perturb general axonal transport by influencing motor activity or binding of motors to the microtubule tract. Interestingly, increased levels of active GSK-3β and phosphorylated KLC and dynein intermediate chain (DIC), a component of the dynein retrograde complex, have been observed in the frontal complex of AD patients [90]. Genetic variability for KLC1 is thought to be a risk factor for early-onset of Alzheimer' s disease [91]. There is also increasing evidence implicating GSK-3β in regulating transport by modulating kinesin activity and exacerbating neurodegeneration in AD through tau hyperphosphorylation [21], [51], [55]. It will be interesting to investigate if Nebula also modulates these processes in the future. Although calcineurin had been shown to regulate many important cellular pathways, the link between altered calcineurin and axonal transport, especially in the context of AD, had not been established before. We show that calcineurin can regulate axonal transport through both GSK-3β independent and dependent pathways. This is supported by our observation that the severity of the aggregate phenotype was worse for flies expressing APP and active calcineurin than it was for flies expressing APP and active GSK-3β. These findings point to a role for calcineurin in influencing axonal transport directly, perhaps through dephosphorylation of motor or adaptor proteins. Our data also indicate that calcineurin in part modulates axonal transport through dephosphorylation of GSK-3β as discussed above; however, upregulation of APP is necessary for the induction of severe axonal transport problems, mainly by causing additional enhancement of GSK-3β signaling. GSK3 inhibition is widely discussed as a potential therapeutic intervention for AD, our results suggest that perhaps calcineurin is a more effective target for delaying degeneration by preserving axonal transport. DSCR1 and APP are both located on chromosome 21 and upregulated in DS [4], [10]. Overexpression of DSCR1 alone had been contradictorily implicated in both conferring resistance to oxidative stress and in promoting apoptosis [8], [9], [16], [17]. Upregulation of Nebula/DSCR1 had also been shown to negatively impact learning and memory in fly and mouse models through altered calcineurin pathways [15], [92]. How could upregulation of DSCR1 be beneficial? We propose that DSCR1 upregulation in the presence of APP upregulation compensates for the altered calcineurin and GSK-3β signaling, shifting the delicate balance of kinase/phosphatase signaling pathways close to normal, therefore preserving axonal transport and delaying neurodegeneration. We also propose that axonal transport defects and synapse dysfunction caused by APP upregulation in our Drosophila model system occur prior to accumulation of amyloid plaques and severe neurodegeneration, similar to that described for a mouse model [30]. DS is characterized by the presence of AD neuropathologies early in life, but most DS individuals do not exhibit signs of dementia until decades later, indicating that there is a delayed progression of cognitive decline [2], [93]. The upregulation of DSCR1 may in fact activate compensatory cell signaling mechanisms that provide protection against APP-mediated oxidative stress, aberrant calcium, and altered calcineurin and GSK3-β activity. Flies were cultured at 25°C on standard cornmeal, yeast, sugar, and agar medium under a 12 hour light and 12 hour dark cycle. The following fly lines were obtained from the Bloomington Drosophila Stock Center: Gmr-GAL4, UAS-APP695-N-myc (6700), sgg1/FM7a, UAS-sggS9A (Sgg constitutively active), UAS-nla-RNAi (27260), UAS-CaNB-RNAi (27307), UAS-syt. eGFP (6925), UAS-APP. YFP (32039), and UAS-mitoGFP. Elav-GAL4 stock was kindly provided by Dr. Feany (Harvard University), UAS-nlat1, and nla1 flies were reported previously [15]. UAS-ΔCaNAct construct (constitutively active calcineurin) was generated by deleting the autoinhibitory domain of the CaNA gene Pp2B-14D and subcloned into the pINDY6 vector similar to that described [94]. UAS-Case12 was generated by inserting Case12 (from Evrogen) into pINDY6 vector [53]. Transgenic flies were generated by standard germline transformation method [95]. Adult Drosophila of 0,15,30 and 45 days of age were collected, decapitated and had their proboscis removed. Heads were incubated in Mirsky' s fixative for 30 minutes, washed with PBS, and post-fixed in 4% paraformaldehyde for 20 minutes. Fly heads were then transferred to 25% sucrose overnight at 4°C and were subsequently embedded in Tissue-Tek O. C. T Compound for cryostat sectioning (10 µm). Photoreceptor axons were immunostained with 24B10 (1∶10; Developmental Studies Hybridoma), Phosphorylated APP (1∶400; Sigma), and 4G8 (1∶500; Signet). Flies were placed in 2 clear round bottom test tubes joined at the opening. After allowing 2 minutes for the flies to acclimate to the tubes, flies were lightly tapped and the percentage of flies that moved toward light in horizontal position within 30 seconds was counted. Wandering 3rd instar larvae were dissected in cold calcium-free dissection buffer and fixed with 4% paraformaldehyde in PBS for 25 minutes at room temperature (RT). Samples were blocked in 5% normal goat serum in PBS+0. 1% triton for 1 hour at RT and then incubated with primary antibodies overnight at 4°C. Antibodies included synaptotagmin (1∶1,000; gift from H. Bellen) and mAb 4G8 (1∶1,000; Signet), β-tubulin (1∶1000; DSHB), acetylated tubulin (1∶500, Abcam), Cy3-conjugated HRP (1∶200, Jackson ImmunoResearch). Alexa-conjugated secondary antibodies were applied at 1∶500 and samples mounted in Pro -long Gold Antifade reagent (Invitrogen). Images of motor axons and synaptic terminals from NMJ 6/7 in segment A2 or A3 were captured in a z-series using Zeiss LSM5 scanning confocal. The number of aggregates was determined manually by counting the number of punctate staining with intensity above background and size greater than 0. 2 µm2. For quantification of antibody staining intensities at the NMJ, dissected larvae were stained together using the same condition. Images were captured in a z-series and parameters were set to minimize saturation of pixel intensity. Intensity of Z-projected images was analyzed using ImageJ and fold changed calculated by comparing to the control. Wandering 3rd instar larvae expressing APP-YFP or GFP-SYT in combination with other transgenes were dissected in calcium free dissection buffer: 128 mM NaCl, 1 mM EGTA, 4 mM MgCl2,2 mM KCl, 5 mM HEPES, and 36 mM sucrose. Live imaging of GFP-SYT was done as described [96]. For imaging of mito-GFP, dissected larvae were bathed in HL-3 solution [97]. Time-lapse images were acquired at 5-s intervals using a Zeiss LSM5 confocal using minimum laser intensity to prevent photobleaching and damage to the tissues. Images were acquired for 5 minutes with a 63× lens and a zoom of 1. 7. All live imaging experiments were completed within 15 minutes starting from the time of dissection in order to ensure health of the samples. The Manual tracking Plugin in ImageJ was used to track individual vesicle and mitochondria movement. At least 10 frames (>50 s) were used to calculate the average speed of movement. Percentage of movement was determined by counting the percentage of moving vesicles over the imaging period. A vesicle is labeled as moving if it moved in three consecutive frames (over a 15-s period) over a distance of at least 0. 1 µm. Direction of movement is determined by direction of net displacement of the vesicle at the start of imaging. Average speed was determined by tracking a vesicle for an uninterrupted run in either the anterograde or retrograde direction. The total distance of movement was divided by the total duration of movement in a specific direction. Student' s t-test was used to determine statistical significance. Deficits in larval locomotor behavior were assessed as described previously [98]. Briefly, larvae were washed with PBS and placed in 60 mm petri dish filled with 1% agarose. Using a moistened paint brush, 3rd instar larvae were collected and allowed to habituate for 30 seconds. The number 0. 5 cm2 boxes entered was counted for a 60-s period. Drosophila adults (1–2 days) were collected on dry ice. Heads were removed and homogenized in cold RIPA buffer. The brains of 3rd instar larvae were dissected and collected on dry ice. Equal amount of protein per genotype (10–20 µg) was run on SDS polyacrylamide gel and transferred to nitrocellulose membrane. Blocking for phosphorylated antibodies was performed using 5% BSA in PBS+0. 1% tween (PBS-TW). Blocking for non-phosphorylated antibodies was done using 5% milk in PBS-TW for one hour at RT. Membranes were incubated with the following primary antibodies overnight at 4°C: N-APP (1∶5,000; Sigma), β-tubulin (1∶500; Developmental Studies Hybridoma Bank), Nebula (1∶7,000), Fasciclin II (1∶50 Developmental Studies Hybridoma), acetylated tubulin (1∶1,000, Cell Signaling), phospho-GSK3β Ser9 (1∶1000, Cell Signaling), phospho-GSK3β Tyr126 (1∶1000, Cell Signaling), and GSK3 α/β (1∶2,000, Cell Signaling). Secondary antibodies used were: anti-mouse Alexa 680 (Invitrogen), anti-rabbit Dylight 800 (Piercenet), anti-mouse coupled HRP or anti-rabbit coupled HRP. HRP signals were detected using ECL Reagents (GE Healthcare). Alexa 680 and Dylight 800 signals were detected using Odyssey Imaging system (LI-COR Biosciences). For reprobing, membranes were stripped using Reblot Plus strong antibody stripping solution (Millipore) and reprobed. NIH Image J software was used to measure signal intensity, and the fold change in specific protein level was normalized to a loading control and compared to the control flies. Fly heads were collected over dry ice, decapitated, and homogenized in lysis buffer (10 mM Tris pH 7. 5,1 mM EDTA, 0. 02% Sodium Azide). Calcineurin phosphatase activity was determined using the Ser/Threonine Phosphatase Assay Kit (Promega) following the manufacturer' s protocol as done previously [15]. 5 µg of protein per genotype was used. Flies heads were collected on dry ice by passing through molecular sieves and homogenized in lysis buffer (10 mM HEPES, 0. 1 M NaCl, 1% NP-40,2 mM EDTA, 50 mM NaF, 1 mM NA3VO4) plus Complete Mini protease inhibitor cocktail (Roche). Lysates were pre-cleared by incubating fly extract with magnetic A/G beads (Thermo Scientific) for 1 hour at 4°C. Pre-cleared extract was then used for IP using GFP antibody conjugated to magnetic beads (MBL International). Western blot analysis using an antibody against the kinesin light chain (1∶200; Novus Biologicals) was used to confirm interaction. To determine the efficiency of GFP pull down, an antibody against GFP (1∶1000, Abnova) was also used. To eliminate signal contamination from IgG, we used HRP conjugated TrueBlot anti-rabbit IgG (1∶1000, ebioscience) that is specific for native IgG as secondary antibody. SUMMARY: [/INST] Alzheimer' s disease (AD) is a debilitating neurodegenerative disease characterized by gradual neuronal cell loss and memory decline. Importantly, Down syndrome (DS) individuals over 40 years of age almost always develop neuropathological features of AD, although most do not develop dementia until at least two decades later. These findings suggest that DS and AD may share common genetic causes and that a neuroprotective mechanism may delay neurodegeneration and cognitive decline. It has been shown that the amyloid precursor protein (APP), which is associated with AD when duplicated and upregulated in DS, is a key gene contributing to AD pathologies and axonal transport abnormalities. Here, using fruit fly as a simple model organism, we examined the role of Down syndrome critical region 1 (DSCR1), another gene located on chromosome 21 and upregulated in both DS and AD, in modulating APP phenotypes. We find that upregulation of DSCR1 (Nebula in flies) is neuroprotective in the presence of APP upregulation. We report that nebula overexpression delays the onset of neurodegeneration and transport blockage in neuronal cells. Our results further suggest that signaling pathways downstream of DSCR1 may be potential therapeutic targets for AD. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: White House press secretary Sean Spicer speaks during the daily press briefing, Thursday, Feb. 2, 2017, in the briefing room of the White House in Washington. (AP Photo/Evan Vucci) (Associated Press) White House press secretary Sean Spicer speaks during the daily press briefing, Thursday, Feb. 2, 2017, in the briefing room of the White House in Washington. (AP Photo/Evan Vucci) (Associated Press) White House press secretary Sean Spicer speaks during the daily press briefing, Thursday, Feb. 2, 2017, in the briefing room of the White House in Washington. (AP Photo/Evan Vucci) (Associated Press) White House press secretary Sean Spicer speaks during the daily press briefing, Thursday, Feb. 2, 2017, in the briefing room of the White House in Washington. (AP Photo/Evan Vucci) (Associated Press) WASHINGTON (AP) — The Trump administration on Friday imposed sanctions on 13 people and a dozen companies in response to Iran's recent ballistic missile test, increasing pressure on Tehran without directly undercutting a landmark nuclear deal with the country. Those targeted by the Treasury Department's action include various agents, companies and associates involved in procuring ballistic missile technology for Iran. Iranians, Lebanese, Chinese and Emirati individuals and companies also are now blacklisted from doing any business in the United States or with American citizens. "Iran's continued support for terrorism and development of its ballistic missile program poses a threat to the region, to our partners worldwide and to the United States," John E. Smith, the Treasury Department's acting sanctions chief, said in a statement. "We will continue to actively apply all available tools, including financial sanctions, to address this behavior," Smith said. The sanctions are the first against Iran in Donald Trump's new presidency, reflecting his desire to take a tougher stance toward Tehran. Throughout his campaign, Trump accused the Obama administration of being weak on Iran and vowed to crack down if elected. In a tweet Friday morning, Trump said: "Iran is playing with fire — they don't appreciate how 'kind' President Obama was to them. Not me." None of the new sanctions appear to reverse the Obama administration's suspension of sanctions as part of the 2015 nuclear deal. Nevertheless, the action will almost surely increase tensions with Iran. The Islamic republic has insisted that new sanctions violate the deal and that it has the right to conduct ballistic missile tests now that its nuclear program has been sharply curtailed. The U.S. and Western countries argue otherwise, noting that Tehran agreed to an eight-year extension of a ban on ballistic work in nuclear negotiations two years ago. That agreement was concluded in parallel, but separately to the nuclear accord. "This is fully consistent with the Obama administration's commitment to Congress that the nuclear deal does not preclude the use of non-nuclear sanctions," said Mark Dubowitz, CEO of the Foundation for Defense of Democracies, which advocates for a hard-line U.S. position on Iran. The sanctions come after Trump and his aides issued cryptic warnings about potential retaliation against Tehran for testing a ballistic missile and for supporting Shiite rebels in Yemen known as the Houthis. The U.S. accuses Iran of arming and financing the rebels, who this week claimed a successful missile strike against a warship belonging to a Saudi-led coalition fighting to reinstall Yemen's internationally recognized government. Iran denies arming the Houthis. "As of today, we are officially putting Iran on notice," Trump's national security adviser, Michael Flynn, said earlier this week. Trump then backed up that statement in a tweet. ___ Associated Press writers Josh Lederman and Julie Pace contributed to this report. Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more SUMMARY: [/INST] The Trump administration on Friday imposed sanctions on 13 people and a dozen companies in response to Iran's recent ballistic missile test, reports the AP. Those targeted by the Treasury Department include various individuals and companies involved in procuring ballistic missile technology for Iran. They include Iranians, Lebanese, Chinese, and Emirati individuals, all of whom are now blacklisted from doing business in the US or with US citizens. Under the landmark nuclear deal struck with Iran under President Obama, the US cannot impose nuclear-related sanctions, and it says these don't violate that agreement. In a tweet Friday morning, Trump said: "Iran is playing with fire-they don't appreciate how 'kind' President Obama was to them. Not me!" The action will almost surely increase tensions with Iran. Tehran insists it has the right to conduct ballistic missile tests now that its nuclear program has been sharply curtailed. The US and Western countries say Tehran agreed to an eight-year extension of a ban on ballistic work in nuclear negotiations two years ago. That agreement was concluded in parallel, but separately to the nuclear accord. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: DHS Has Developed a Strategic Plan for GNDA, but It Does Not Yet Discuss Key Elements for Addressing Gaps In our past work on GNDA, we made recommendations about the need for a strategic plan to guide the development of the GDNA. Among other things, in July 2008, we recommended that DHS develop an overall strategic plan for the GNDA that (1) clearly defines the objectives to be accomplished, (2) identifies the roles and responsibilities for meeting each objective, (3) identifies the funding necessary to achieve those objectives, and (4) employs monitoring mechanisms to determine programmatic progress and identify needed improvements. In January 2009, we also recommended that DHS develop strategies to guide the domestic aspects of the GNDA including establishing time frames and costs for addressing previously identified gaps in the GNDA—land border areas between ports of entry, international general aviation, and small maritime vessels. DHS concurred with our 2008 recommendation to develop an overall strategic plan and did not comment on our 2009 recommendation to develop a plan for the domestic portion of the GNDA, but noted that it aligned with DNDO’s past, present, and future actions. In December 2010, DNDO issued a strategic plan for the GNDA. The strategic plan establishes a broad vision for the GNDA, identifies cross- cutting issues, defines several objectives, and assigns mission roles and responsibilities to the various federal entities that contribute to the GNDA. For example, the Department of Energy has the lead for several aspects of enhancing international capabilities for detecting nuclear materials abroad, DHS has the lead for detecting nuclear materials as they cross the border into the United States, and the Nuclear Regulatory Commission has the lead on reporting and sharing information on lost or stolen domestic radiological material. In addition, earlier this year, DNDO released the Global Nuclear Detection Architecture Joint Annual Interagency Review 2011. This review describes the current status of GNDA and includes information about the multiple federal programs that collectively seek to prevent nuclear terrorism in the United States. However, neither the strategic plan nor the 2011 interagency review identifies funding needed to achieve the strategic plan’s objectives nor establishes monitoring mechanisms to determine programmatic progress and identify needed improvements—key elements of a strategic plan that we previously identified in our recommendations. Furthermore, while the plan and the 2011 interagency review discuss previously identified gaps in the domestic portion of the architecture, neither discusses strategies, priorities, timeframes, or costs for addressing these gaps. In our view, one of the key benefits of a strategic plan is that it is a comprehensive means of establishing priorities, and using these priorities to allocate resources so that the greatest needs are being addressed. In times of tight budgets, allocating resources to address the highest priorities becomes even more important. Accordingly, while DNDO’s new strategic plan represents an important step forward in guiding the development of the GNDA, DNDO could do more to articulate strategies, priorities, timeframes and costs in addressing gaps and further deploying the GNDA in order to protect the homeland from the consequences of nuclear terrorism. In discussing these issues with DHS officials, they indicated that they will be producing a GNDA implementation plan later this year that will address several of these issues. DHS Continues to Make Progress in Deploying Radiation Detection Equipment As we reported in June 2010, DHS has made significant progress in deploying both radiation detection equipment and developing procedures to scan cargo and conveyances entering the United States through fixed land and sea ports of entry for nuclear and radiological materials, deploying nearly two-thirds of the radiation portal monitors identified in its deployment plan. According to DHS officials, the department scans nearly 100 percent of the cargo and conveyances entering the United States through land borders and major seaports. However, as we reported, DHS has made less progress scanning for radiation in (1) railcars entering the United States from Canada and Mexico; (2) international air cargo; and (3) international commercial aviation aircraft, passengers, or baggage. Fixed Land and Sea Ports of Entry According to DHS officials, since November 2009, almost all non-rail land ports of entry have been equipped with one or more radiation detection portal monitors and 100 percent of all cargo, conveyances, drivers, and passengers driving into the United States through commercial lanes at land borders are scanned for radiation, as are more than 99 percent of all personally operated vehicles (non commercial passenger cars and light trucks), drivers, and passengers. Similarly, at major seaports, according to DHS officials, the department scans nearly all containerized cargo entering U.S. seaports for nuclear and radiological materials. DHS has deployed radiation portal monitors to major American seaports that account for the majority of cargo entering the United States. However, some smaller seaports that receive cargo may not be equipped with these portal monitors. DHS officials stated that current deployment plans have been in place to address all the remaining gaps in the deployment of portal monitors to seaports but that current and future budget realities require a re-planning of the deployment schedule. International Rail DHS has made much less progress scanning international rail. As we reported in June 2010, there is limited systematic radiation scanning of the roughly 4,800 loaded railcars entering the United States each day from Canada and Mexico. Much of the scanning for radioactive materials that takes place at these ports of entry is conducted with portable, hand- held radioactive isotope identification devices. According to DHS officials, international rail traffic represents one of the most difficult challenges for radiation detection systems due to the nature of trains and the need to develop close cooperation with officials in Mexico and Canada. In addition, DHS officials told us that rail companies resist doing things that might slow down rail traffic and typically own the land where DHS would need to establish stations for primary and secondary screening. DHS is in the early stages of developing procedures and technology to feasibly scan international rail traffic. International Air Cargo and Commercial Aviation As we reported in 2010, DHS is in the early stages of addressing the challenges of scanning for radioactive materials presented by air cargo and commercial aviation. DHS officials are also developing plans to increase their capacity to scan for radioactive materials in international air cargo conveyed on commercial airlines. DHS officials stated that their experience in scanning air cargo at a few major international airports in the United States has helped them develop scanning procedures and inform current and future deployment strategies for both fixed and mobile radiation detection equipment. These officials said that they believe that further operational experience and research is necessary before they can develop practical mobile scanning strategies and procedures. DHS is also developing plans to effectively scan commercial aviation aircraft, passengers, and baggage for radioactive materials. DHS Has Had Difficulty in Developing New Technologies to Detect Nuclear Materials Since 2006, we have reported that DHS faces difficulties in developing new technologies to detect nuclear and radiological materials. Specifically, we have reported on longstanding problems with DNDO’s efforts to deploy advanced spectroscopic portal (ASP) radiation detection monitors. The ASP is a more advanced and significantly more expensive type of radiation detection portal monitor to replace the polyvinyl toluene (PVT) portal monitors in many locations that the Customs and Border Protection (CBP), an agency within DHS, currently uses to screen cargo at ports of entry. We have issued numerous reports regarding problems with the cost and performance of the ASPs and the lack of rigor in testing this equipment. For example, we found that tests DNDO conducted in early 2007 used biased test methods that enhanced the apparent performance of ASPs and did not use critical CBP operating procedures that are fundamental to the performance of current radiation detectors. In addition, in 2008 we estimated the lifecycle cost of each standard cargo version of the ASP (including deployment costs) to be about $822,000, compared with about $308,000 for the PVT portal monitor, and the total program cost for DNDO’s latest plan for deploying radiation portal monitors to be about $2 billion. Based in part on our work, DHS informed this Committee in February 2010, after spending over $280 million, that the department had scaled back its plans for the development and use of ASP technology. In September 2010, we also reported that DNDO was simultaneously engaged in the research and development phase while planning for the acquisition phase of its cargo advanced automated radiography system (CAARS) to detect certain nuclear materials in vehicles and containers at CBP ports of entry. DNDO pursued the deployment of CAARS without fully understanding that it would not fit within existing inspection lanes at ports of entry and would slow down the flow of commerce through these lanes, causing significant delays. DHS spent $113 million on the program since 2005 and cancelled the acquisition phase of the program in 2007. As we reported in September 2010, no CAARS machines had been deployed, and CAARS machines from various vendors were either disassembled or sitting idle without being tested in a port environment. DNDO’s problems developing the ASP and CAARS technologies are examples of broader challenges DHS faces in developing and acquiring new technologies to meet homeland security needs. Earlier this month, we testified that DHS has experienced challenges managing its multibillion-dollar acquisition efforts, including implementing technologies that did not meet intended requirements and were not appropriately tested and evaluated, and has not consistently completed analysis of costs and benefits before technologies were implemented. In June 2011, DHS reported to us that it is taking steps to strengthen its investment and acquisition management processes across the department. For example, DHS plans to establish a new model for managing departmentwide investments, establish new councils and boards to help ensure that test and evaluation methods are appropriately considered, and is working to improve the quality and accuracy of program cost estimates. As we testified, we believe these are positive steps and, if implemented effectively, could help the department address many of its acquisition challenges. However, it is still too early to assess the impact of DHS’s efforts to address these challenges. Going forward, we believe DHS will need to demonstrate measurable, sustained progress in effectively implementing these actions. Chairman Lungren, Ranking Member Clarke, and Members of the Subcommittee, this concludes my prepared statement. I would be pleased to respond to any questions that you may have at this time. GAO Contacts and Staff Acknowledgements For questions about this statement, please contact David C. Maurer at (202) 512-9627 or maurerd@gao.gov or Gene Aloise at (202) 512-3841 or aloisee@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this statement. Individuals making key contributions to this statement include Ned Woodward and Kevin Tarmann. Related GAO Products Homeland Security: DHS Could Strengthen Acquisitions and Development of New Technologies, GAO-11-829T (Washington, D.C.: July 15, 2011). DHS Science and Technology: Additional Steps Needed to Ensure Test and Evaluation Requirements Are Met, GAO-11-596 (Washington, D.C.: June 15, 2011). Supply Chain Security: DHS Should Test and Evaluate Container Security Technologies Consistent with All Identified Operational Scenarios To Ensure the Technologies Will Function as Intended, GAO-10-887 (Washington D.C.: Sept. 29, 2010). Combating Nuclear Smuggling: Inadequate Communication and Oversight Hampered DHS Efforts to Develop an Advanced Radiography System to Detect Nuclear Materials, GAO-10-1041T (Washington D.C.: Sept. 15, 2010). Department of Homeland Security: Assessments of Selected Complex Acquisitions. GAO-10-588SP (Washington, D.C.: June 30, 2010). Combating Nuclear Smuggling: Lessons Learned from DHS Testing of Advanced Radiation Detection Portal Monitors, GAO-09-804T (Washington, D.C.: June 25, 2009). Combating Nuclear Smuggling: DHS Improved Testing of Advanced Radiation Detection Portal Monitors, but Preliminary Results Show Limits of the New Technology. GAO-09-655 (Washington, D.C.: May 21, 2009). Nuclear Detection: Domestic Nuclear Detection Office Should Improve Planning to Better Address Gaps and Vulnerabilities, GAO-09-257 (Washington D.C.: Jan. 29, 2009). Combating Nuclear Smuggling: DHS’s Program to Procure and Deploy Advanced Radiation Detection Portal Monitors Is Likely to Exceed the Department’s Previous Cost Estimates, GAO-08-1108R (Washington DC: Sept. 22, 2008). Nuclear Detection: Preliminary Observations on the Domestic Nuclear Detection Office’s Efforts to Develop a Global Nuclear Detection Architecture, GAO-08-999T (Washington, D.C.: July 16, 2008). Combating Nuclear Smuggling: Additional Actions Needed to Ensure Adequate Testing of Next Generation Radiation Detection Equipment, GAO-07-1247T (Washington, D.C.: Sept. 18, 2007). Customs Service: Acquisition and Deployment of Radiation Detection Equipment, GAO-03-235T (Washington, D.C.: Oct. 17, 2002). This is a work of the U.S. government and is not subject to copyright protection in the United States. The published product may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately. SUMMARY: [/INST] This testimony discusses our past work examining the Department of Homeland Security's (DHS) progress and efforts in planning, developing, and deploying its global nuclear detection architecture (GNDA). The overall mission of the GNDA is to use an integrated system of radiation detection equipment and interdiction activities to combat nuclear smuggling in foreign countries, at the U.S. border, and inside the United States. Terrorists smuggling nuclear or radiological material into the United States could use these materials to make an improvised nuclear device or a radiological dispersal device (also called a "dirty bomb"). The detonation of a nuclear device in an urban setting could cause hundreds of thousands of deaths and devastate buildings and physical infrastructure for miles. While not as damaging, a radiological dispersal device could nonetheless cause hundreds of millions of dollars in socioeconomic costs as a large part of a city would have to be evacuated--and possibly remain inaccessible--until an extensive radiological decontamination effort was completed. Accordingly, the GNDA remains our country's principal strategy in protecting the homeland from the consequences of nuclear terrorism. The GNDA is a multi-departmental effort coordinated by DHS's Domestic Nuclear Detection Office (DNDO). DNDO is also responsible for developing, acquiring, and deploying radiation detection equipment to support the efforts of DHS and other federal agencies. Federal efforts to combat nuclear smuggling have largely focused on established ports of entry, such as seaports and land border crossings. However, DNDO has also been examining nuclear detection strategies along other potential pathways and has identified several gaps in the GNDA, including (1) land border areas between ports of entry into the United States; (2) international general aviation; and (3) small maritime craft, such as recreational boats and commercial fishing vessels. Developing strategies, technologies, and resources to address these gaps remains one of the key challenges in deploying the GNDA. Some progress has been made, but DHS and other federal agencies have yet to fully address gaps in the global nuclear detection architecture. Specifically, this testimony discusses DHS's efforts to (1) address our prior recommendations to develop a strategic plan for the GNDA, including developing strategies to prevent smuggling of nuclear or radiological materials via the critical gaps DNDO identified, (2) complete the deployment of radiation detection equipment to scan all cargo and conveyances entering the United States at ports of entry, and (3) develop new technologies to detect nuclear or radioactive materials. This testimony is based on our prior work on U.S. government efforts to detect and prevent the smuggling of nuclear and radiological materials issued from October 2002 through September 2010. We updated this information in July 2011 to reflect DHS's efforts to address our prior recommendations by meeting with DNDO officials and reviewing recent DNDO documents, such as the 2010 GNDA Strategic Plan and the 2011 GNDA Joint Annual Interagency Review. In summary, since December 2010, DNDO has issued both a strategic plan to guide the development of the GNDA and an annual report on the current status of the GNDA. The new strategic plan addressed some key components of what we previously recommended be included in a strategic plan, such as identifying the roles and responsibilities for meeting strategic objectives. However, neither the plan nor the annual report identifies funding needed to achieve the strategic plan's objectives or employs monitoring mechanisms to determine programmatic progress and identify needed improvements. DHS officials informed us that they will address these missing elements in an implementation plan, which they plan to issue before the end of this year. As we reported in September 2010, DHS has made progress in deploying both radiation detection equipment and developing procedures to scan cargo entering the United States through land and sea ports of entry for nuclear and radiological materials. For example, according to DHS officials, the department scans nearly 100 percent of the cargo and conveyances entering the United States through land borders and major seaports. However, as we reported in July 2011, DHS has experienced challenges in developing new technologies to detect nuclear and radiological materials, such as developing and meeting key performance requirements. DHS has plans to enhance its development and acquisition of new technologies, although it is still too early to assess their impact on addressing the challenges we identified in our past work. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: [0001] This application is a continuation-in-part of U.S. application Ser. No. 09/841,851, filed Apr. 24, 2001. FIELD OF THE INVENTION [0002] The present invention generally relates to an intramedullary system for coupling first and second bone portions across a fracture therebetween and, more specifically, to an intramedullary hip pinning system for rigidly interconnecting a femoral head to the remaining portion of the femur and across a fracture in the area of the femoral neck. BACKGROUND OF THE INVENTION [0003] The intramedullary nail was introduced in the 1930 's. This device was inserted into the intramedullary canal of the femur resulting in immediate fixation of fractures, early mobilization of the patient, and a lower morbidity and mortality. A number of nails have been introduced for fracture fixation about the femur in proximal end, including the Jewett Nail and Enders Nail. [0004] Intramedullary nails were also inserted down the entire length of the femoral canal to provide a basis for the construct. Threaded wires, standard bone screws or cannulated bone screws were then inserted through or along side the proximal nail and into the femoral head to provide fixation and rotational stability. Compression of the proximal bone fragments against each other was not available and in longer nails the distal tip of the nail tends to rotate out of plane which forces the surgeon to locate the distal screw holes using fluoroscopy by a method commonly known as “free-handing”. [0005] In the 1960s, the compression hip screw was introduced, resulting in improved fixation of the proximal femur. A lag screw assembly was inserted into the femoral head, a plate was attached to the lateral femur, and a compression screw joined the two. These implants provided a more rigid structure for the patient and allowed the surgeon to compress the fractured fragments against each other thereby decreasing the time to mobility. A number of compression hip screws have been introduced for fracture fixation about the proximal femur. [0006] During implantation typical compression hip screws require an incision at least equal to the length of plate being used which extends operative time and blood loss. The side plate also creates a protuberance on the lateral side which provides an annoyance to the patient. Compression hip screw systems also fail to provide adequate compression in oseteogenic patients because the lag screw threads fail to obtain sufficient purchase due to poor bone stock. Poor purchase is known to contribute to nonunion, malunion and the lag screw assembly eroding through the superior bone of the head of the femur in a condition known as “cut out”. Additionally, many patients are dissatisfied with the results of compression hip screw surgery because of the excessive sliding to a medial displacement and shortening position which leads to a change in gait. [0007] Newer devices and inventions explored additions to the nail and lag screw assembly to improve the fixation and ease or eliminate the need to locate the distal screw holes. These newer devices are commonly classified as “expanding devices” and expand in size, after placement, to fill the intramedullary cavity. Freedland, U.S. Pat. Nos. 4,632,101, 4,862,883 and 4,721,103, Chemello, U.S. Pat. No. 6,077,264 and Davis, U.S. Pat. No. 5,057,103 describe a method of fixation which provides points which contact the internal cortical wall. In these patents a mechanism is actuated deploying arms or anchor blades through the cancellous bone to contact the inner cortical wall. These methods are complex, do not deploy through the cortical bone and are difficult to retract should the nail or lag screw assembly require extraction. [0008] Other expanding devices provide surface contact with the internal cortical wall resulting in a wedge effect. Kurth, U.S. Pat. No. 4,590,930, Raftopoulos, U.S. Pat. No. 4,453,539 and Aginski, U.S. Pat. No. 4,236,512 among others have described mechanisms which deploy or expand with a molly bolt concept. These methods are complex and difficult to retract should the nail or lag screw assembly requires extraction and do not deploy through the cortical bone. [0009] Bolesky, U.S. Pat. No. 4,275,717, was the first to discuss engagement within the cortical wall. However, Bolesky's invention does not address controlled penetration into the wall and required permanent implantation of the actuation rod. In addition, Bolesky does not address the fundamental problem of the actuation rod's protrusion extramedullarly into the surrounding musculature. [0010] In earlier patents, U.S. Pat. Nos. 5,976,139 and 6,183,474 B1, both incorporated herein by reference, Bramlet describes a surgical anchor which has deployable tangs. These tangs are simple design, internally positioned, yet easily deployed into, and if desired through, the cortical bone providing improved purchase for compression of a fracture; especially in osteogenic bone. These tangs are just as easily retracted should the device require explantation. [0011] In 1988 Lawes, et. al., U.S. Pat. No. 5,176,681, disclosed a method of combining desirable aspects of both intramedullary nails and compression hip screws. Lawes described a method for joining the lag screw and nail to resist loosening or moving of the lag screw during the operation. Approximately 10 years ago Howmedica (Rutherford, N.J., United States) was the first to produce the “Gamma Nail”, named for its similarity in shape to the Greek letter, as an intramedullary hip compression screw device and other designs soon followed. [0012] In 1990 Durham, et. al., U.S. Pat. No. 5,032,125, disclosed an intramedullary hip compression screw system which incorporated a sleeve for slidably receiving the lag screw. A set screw was then used to engage the sleeve thereby preventing translation and rotation of the sleeve. This device allowed for reduction of the proximal fragment using the same method as conventional hip screw assemblies. Shortly thereafter Smith & Nephew Richards (Memphis, Tenn., ReUnited States) produced the “Intramedullary Hip Compression Screw”. [0013] These intramedullary hip compression screw systems required a few small incisions, allowed capture of the most proximal fragments of the femur, rigid fixation of the most proximal and distal fragments, and a sliding lag screw assembly which allows reduction of the fragments as the patient ambulates or begins to bear weight on the fractured limb. These nails are typically held in place on the distal end through interference forces with the intramedullary canal and through the use of locking screws. [0014] The typical intramedullary hip compression screw's shape accommodates the relative shape of the greater trochanter and femoral shaft, neck and head fragments. Therefore, the shape of the hip is preserved. Indications for use of a compression hip screw are expanded because fractures to the subtrochanteric region of the proximal femur, as well as reverse obliquity fractures can be treated more efficiently. Additionally, the bulk of an intramedullary hip screw blocks excessive sliding of the proximal fragment. [0015] Current intramedullary compression hip screw systems continue to suffer from some of the same problems exhibited in those of its predecessors. Osteogenic bone still provides a poor medium for purchase of the lag screw assembly thread inhibiting adequate compression and rotational stability. Longer nails continue to see the distal tip of the nail rotating out of plane forcing the surgeon to locate the distal screw holes by the free-hand method. The free-handing technique leads to an increased surgical time and exposes the surgeon and patient to increased radiation dosages. [0016] Current intramedullary compression hip screw systems also provide new limitations that hamper their effectiveness. One such limitation is evident in both Lawes' and Durham's designs. These designs require the use of a set screw to prevent rotation of the lag screw; the set screw in the Lawes patent interacts directly with the lag screw, while Durham's is indirect with the lag screw. To ensure proper mating takes place the Smith & Nephew Richards' systems provides a torque wrench, while Howmedica's system requires tightening of the set screw to full engagement and then backing it off. Over time, loss of calibration of the torque wrench and improper engagement by the surgeon user could lead to an unsatisfactory engagement and decreased usefulness. [0017] Clearly a need exists for a system that is superior to the conventional compression hip screws while minimizing the surgical insult to the human body. SUMMARY OF THE INVENTION [0018] Therefore, it is an object of this invention to teach a simple, effective and controllable fixation device which allows greater purchase of the lag screw assembly within the femoral head resulting in improved compression across the fracture line. [0019] It is another object of this invention to teach a system with rotational stability both in the femoral head and in the femoral shaft, and that offers to minimize, if not eliminate the need for additional distal incisions to locate and place locking screws. [0020] It is yet another objective of this invention to teach an intramedullary hip nail system that provides for a more positive, and more repeatable engagement mechanism for allowing the lag screw to slide during fracture reduction and healing. [0021] It is a further objective of this invention to teach a system designed to allow the surgeon a choice of penetration distance within the femoral head and femoral shaft fixation based upon the injuries presented and the desired level of treatment. [0022] It is a still further objective of this invention to teach a system that allows explantation to occur as easily as implantation. [0023] An intramedullary nail system for coupling first and second bone portions across a fracture therebetween may be provided as a kit of several assembled subassemblies. The subassemblies of the intramedullary nail system according to the invention are combined X-for installation within the medullary canal of a fractured bone, such as a femur. [0024] In one embodiment of the present invention, the intramedullary nail system includes an intramedullary nail body having an internally threaded trailing end and a leading end with portals which allow passage of cortical screws. The nail body has a transverse bore near the trailing end in communication with the cannulated axial bore for recieving a lag screw assembly. The lag screw assembly has a leading end with an externally threaded portion with portals which allow passage of anchoring tangs and internally deployable and retractable anchoring tangs. The lag screw assembly has internal threads on the trailing end. A slotted sleeve slidably passes through the transverse clearance bore of intramedullary nail and freely telescopes over the lag screw assembly while preventing rotation of lag screw assembly, but allowing axial translation of the lag screw. A compression screw has a shoulder contacting the trailing end of the slotted sleeve and engages the internal threads of the lag screw assembly trailing end providing axial translation of the lag screw assembly within the sleeve. A sleeve lock passes through the axial bore of the intramedullary nail and along the slotted sleeve through its slot(s) thereby preventing rotation and axial translation of the sleeve, but allowing axial translation of the lag screw assembly. An end cap assembly with external threads engages the internal threads of the trailing end of the intramedullary nail. [0025] A preferred embodiment combines the intramedullary nail, the sleeve lock and the end cap assembly into an intramedullary nail assembly. When presented as such, the surgeon or surgical assistant will not have to enjoin these items during the surgical procedure. [0026] The end cap assembly preferably contains a patch of ultra-high molecular weight poly-ethylene (UHMWPE) within the threads. This provides constant positive engagement between the end cap external threads and the intramedullary nail internal threads. [0027] With the intramedullary nail placed into position within the intramedullary canal the lag screw assembly is then placed into position in a manner consistent with common technique. The unique tang assembly is actuated and the tangs are deployed to any desired position thereby achieving the desired level of fixation based upon the quality of the bone. [0028] The lag screw assembly preferably contains a permanently placed anchoring tang assembly stored in a retracted position within the leading end. The tangs are deployed or retracted from the trailing end of the lag screw assembly. [0029] The slotted sleeve is coaxially inserted over the lag screw assembly's trailing end and through the intramedullary nail. The slotted sleeve is aligned to accept the sleeve lock. [0030] The sleeve lock is actuated via a mechanism in the intramedullary nail insertion instrument. The sleeve lock moves from its primary position to its final position. In its final position the sleeve lock passes through the slotted sleeve slots preventing rotation and axial translation of the slotted sleeve. [0031] The compression screw passes through the sleeve and engages the lag screw assembly. As the compression screw is tightened the lag screw assembly and associated first bone portion are pulled against the intramedullary nail and second bone portion resulting in compressive forces being applied across the fracture. [0032] The compression screw preferably contains a patch of ultra-high molecular weight poly-ethylene (UHMWPE) within the threads. This provides constant positive engagement between the compression screw external threads and the lag screw assembly internal threads. [0033] The cortical screws are then placed into position through the bone and through the intramedullary nail in a manner consistent with common technique. [0034] In another embodiment of the present invention the intramedullary nail system includes a intramedullary nail with portals at the leading end which allow passage of cortical screws and/or anchoring tangs. When the intramedullary nail is placed into position the anchoring tang assembly is actuated to deploy the tangs out from their stowed position into the cortical bone. The tangs are deployed to any desired position thereby achieving a desired fixation and rotation prevention based upon the quality of the bone. Should the system require additional load carrying capability, cortical screws may be placed to enjoin the intramedullary nail with the surrounding cortical bone. [0035] The intramedullary nail of this alternate embodiment is preferably cannulated to allow passage of one or more anchoring tang assemblies. These anchoring tang assemblies are inserted from the trailing end towards the leading end and the tangs deployed by means of an actuator driver. An alternate embodiment of the intramedullary nail has a retracted anchoring tang assembly, which is permanently placed within the leading end of the intramedullary nail and is deployed or retracted by means of an actuator driver from the trailing end of the intramedullary nail. [0036] The anchoring tang assembly contains arcurate shaped tangs that are permanently attached to the assembly's main body. These tangs are initially formed into a prescribed position for storage. As the assembly is actuated, and the tangs deploy, the tangs are formed into their final shape through interaction with the portal of either the intramedullary nail or the lag screw assembly. [0037] The lag screw assembly preferably contains a permanently placed anchoring tang assembly stored in a retracted position within the leading end. The tangs are deployed or retracted from the trailing end of the lag screw assembly. [0038] The anchoring tang assembly within the lag screw is similar in design to that within the intramedullary nail in that it contains arcurate shaped tangs that are permanently attached to the assembly's tang body. These tangs are initially formed into a prescribed position for storage. As the assembly is actuated, and the tangs deploy, the tangs are formed into their final shape through interaction with the portal of either the intramedullary nail or the lag screw assembly. [0039] The end cap preferably contains a patch of ultra-high molecular weight poly-ethylene (UHMWPE) within the threads. This provides constant positive engagement between the end cap external threads and the intramedullary nail internal threads. In its final position the end cap locks the sleeve and inhibits the sleeve from sliding or rotating out of a prescribed position. [0040] The intramedullary nail system may be supplied as a kit with subassemblies to be combined into the complete system during the surgical procedure. DESCRIPTION OF THE DRAWINGS [0041] [0041]FIG. 1, is a longitudinal view of the preferred embodiment Intramedullary Nail System in an exploded state; [0042] [0042]FIG. 2, is a view, partially in longitudinal cross section, of the Intramedullary Nail System placed in the intramedullary canal of a fractured bone using cortical screws as a method of fixation; [0043] [0043]FIG. 3, is an enlarged, cross section view of the proximal portion of the Intramedullary Nail System in FIG. 2; [0044] [0044]FIG. 4, is an enlarged view of the proximal portion of the Intramedullary Nail System of FIG. 2; [0045] [0045]FIG. 5, is an enlarged view of the proximal portion of the Intramedullary Nail System of FIG. 3; [0046] [0046]FIG. 6, is a top view of the Intramedullary Nail System of FIG. 2; [0047] [0047]FIG. 7, is a top view of FIG. 8; [0048] [0048]FIG. 8, is an isometric view of the Sleeve Lock; [0049] [0049]FIG. 9, is a front view of FIG. 8; [0050] [0050]FIG. 10, is a side view of FIG. 8; [0051] [0051]FIG. 11, is an isometric view of the Slotted Sleeve; [0052] [0052]FIG. 12, is a top view of FIG. 11; [0053] [0053]FIG. 13, is a section view of FIG. 11; [0054] [0054]FIG. 14, is a front view of FIG. 11; [0055] [0055]FIG. 15, is a side view of FIG. 11; [0056] [0056]FIG. 16, is an isometric view of the End Cap Assembly; [0057] [0057]FIG. 17, is a top view of FIG. 16; [0058] [0058]FIG. 18, is a side view of FIG. 16; [0059] [0059]FIG. 19, is a top view of FIG. 21; [0060] [0060]FIG. 20, is a section view of FIG. 21; [0061] [0061]FIG. 21, is a front view of the Intramedullary Nail; [0062] [0062]FIG. 22, is an enlarged, partial side view of FIG. 21; [0063] [0063]FIG. 23, is an isometric view of the Snap Ring; [0064] [0064]FIG. 24, is a top view of FIG. 22; [0065] [0065]FIG. 25, is a view, partially in longitudinal cross section, of the alternate embodiment Intramedullary Nail System placed in the intramedullary canal of a fractured bone using cortical screws as a method of fixation; [0066] [0066]FIG. 25A, is an enlarged view of the distal portion, of the alternate embodiment Intramedullary Nail System in FIG. 25 using the talon as a method of fixation; [0067] [0067]FIG. 26, is an enlarged view of the distal portion, of the alternate embodiment Intramedullary Nail System in FIG. 25 during Tang Assembly deployment; [0068] [0068]FIG. 27, is an enlarged, partial view of the Tang Actuator Assembly of FIG. 26; [0069] [0069]FIG. 28, is an enlarged view of the stowed Tang Assembly from FIG. 25A; [0070] [0070]FIG. 29, is an enlarged proximal view of the alternate embodiment Intramedullary Nail System of FIG. 25; [0071] [0071]FIG. 30, is an enlargement of the Tang Assembly in FIG. 32; [0072] [0072]FIG. 31, is a front view of the deployed Tang Assembly; [0073] [0073]FIG. 32, is a front view of the stowed Tang Assembly; [0074] [0074]FIG. 33, is an isometric view of the alternate embodiment Sleeve Lock; [0075] [0075]FIG. 34, is a top view of FIG. 33; [0076] [0076]FIG. 35, is a front view of FIG. 33; and [0077] [0077]FIG. 36, is a cross section view of FIG. 33 DETAILED DESCRIPTION [0078] The individual components of the assembly, as illustrated in FIG. 1, are constructed of implantable grade stainless steel alloys in the preferred embodiment but could also be constructed of implantable grade titanium alloys or polymeric materials such as nylon, carbon fibers and thermoplastics, as well. These components consist of the lag screw assembly 4, the nail body 1, the sleeve 3, the compression screw 6, the end cap 8, snap ring 7, sleeve lock 2 and the cortical screws 5 (FIG. 1). [0079] The lag screw assembly 4 is described in detail in U.S. Pat. No. 6,183,474 B1, as is compression screw 6. The external features of the lag screw assembly 4 are indicated in FIG. 4 and include the threads 28, the tang 12, the body 30 and the flats 29 on the body 30. The threads 28 engage the cancellous bone within the femoral head on the proximal side of the fracture line; the tang body 23 ′ carries the tang 12 which is also located on the proximal side of the fracture line and engages cortical bone as shown in FIG. 2 deployed in the femur. However, the tang 12 is fully retracted into the body of the lag screw in its as delivered state and remains that way until the lag screw assembly is fully positioned within the femoral head. When deployed in the femoral head, the tang 12 extends through exit hole 40 ′ and penetrates the cortical bone, greatly increasing purchase axial fixation and rotational stability of the lag screw assembly. The tang is fully reversible if removal of the lag screw is ever required. The body 30 of lag screw assembly 4 has with two flats 29 180 degrees apart (FIG. 4) which interfaces with bore 38 and end configuration flats 17 (FIGS. 11, 12, 13 ) of the sleeve 3 in such a way as to allow axial translation or slide of the lag screw while preventing rotation relative to the sleeve 3. This sliding prevents penetration of the femoral head by the proximal end of the lag screw as the fracture compresses from patient load bearing. [0080] The nail body 1 is designed for antegrade insertion into the intramedullary canal of the femur. It is anatomically shaped to the axis of the canal and has a mediolateral bend angle H (FIG. 20). The proximal outside diameter A of the body is greater than the distal outside diameter E due to narrowing of the canal and to allow the lag screw cylindrical clearance bore 33 (FIG. 20) to be large enough to pass the thread 28 of the lag screw assembly 4 and provide a sliding fit to the outside diameter of the sleeve 3. The axis of clearance bore 33 is at an angle V with respect to the proximal diametral axis (FIG. 2). This angle V allows proper positioning of lag screw assembly 4 within the femoral head. The nail proximal bore 32, distal bore 31 and distal end bore 24 are of circular cross section. Bores 32, 31 and distal end bore 24 are sized to permit a clearance and sliding fit, respectively, with a guide pin (not illustrated) during installation of the nail body 1 into the intramedullary canal. The clearance holes 25 of nail body 1 pass through the distal outside surface and wall of the nail body 1, into the distal bore 31 and continue on the same axis through the opposite wall and outer diameter. Their diameter is such as to allow passage of the threaded portion of the cortical screw 5. (FIG. 2). The nail body 1 is secured both in axial translation and rotation within the intramedullary canal by cortical screws 5 when they are installed through the lateral cortex, clearance holes 25, and the medial cortex of the femur as illustrated in FIG. 2. [0081] The internal threads 37 (FIG. 20) at the proximal end of the nail body 1 provide for instrument interface and end cap 8 retention. The threads 37 are used for attachment of a nail removal instrument (not shown). The internal threads 37 also engage the external threads 15 (FIG. 16) of end cap 8. A slot 26 (FIG. 19, 22) extends through the proximal nail body wall and internal threads 37 breaking into the nail proximal bore 32. Slot 26 is utilized for instrument interface and instrument and end cap 8 anti-rotation. The sleeve lock anti-rotation groove 36 (FIG. 19, 20) is located in the nail proximal bore 32 and 180 degrees around the nail body proximal diameter from slot 26. Groove 36 extends from the surface of the nail proximal internal bore 32 into the nail proximal wall a given constant depth but not through the wall. It extends axially a given distance, through threads 37 and exits the proximal end of nail body 1 (FIG. 19, 20). Also located in the nail body 1 proximal bore 32, are proximal circumferential groove 34 and distal circumferential groove 35 (FIG. 20). [0082] The sleeve lock 2 (FIG. 1), has a basic cylindrical cross section with two integral locking tabs 10 (FIGS. 8, 9, 10 ). Each locking tab 10 has a semi-circular cross section, with the radius being the same as that of the cylindrical body section. A circumferential groove 14 is located in the cylindrical body section and is sized to accept snap ring 7 (FIG. 1). An anti-rotation tab 11 (FIGS. 7, 8, 9, 10 ) is an integral part of sleeve lock 2, which protrudes radially and axially from the cylindrical body section and is sized for a sliding fit within nail body 1 anti-rotation groove 36. A threaded bore 13 (FIGS. 7, 8) extends axially through the cylindrical body section. The outside diameter of sleeve lock 2 is sized for a sliding fit with proximal bore 32 of nail body 1. The snap ring 7 (FIG. 1), is a toroid of circular cross section with an outside diameter B and inside diameter C (FIGS. 23, 24) a gap 41 is provided in the circumference of snap ring 7 to allow radial flexure which either increases or decreases diameters B and C depending on the direction of force. The snap ring 7 is sized in such a way as to loosely fit within groove 14 of sleeve lock 2 (FIGS. 9, 10). When installed into groove 14 snap ring diameter B is larger than the outside diameter of sleeve lock 2, however, if compressed, diameter B becomes equal or less than the outside diameter of sleeve lock 2. [0083] The end cap 8 (FIG. 1) is of a cylindrical cross section with a threaded outside diameter 15 and threaded internal bore 16 (FIG. 16). Two compound anti-rotation grooves run axially in the outside diameter and are located radially 180 degrees apart. The grooves consist of two sections 20 and 50 (FIGS. 16, 17, 18 ). Section 20 extends into, but not through the wall of end cap 8 whereas section 50 extends through the wall and breaks into threaded bore 16. The outside threads of end cap 8 are sized to interface with nail body 1 internal threads 37. [0084] The nail body 1, sleeve lock 2, snap ring 7 and end cap 8 may be pre-assembled by the manufacturer and supplied to surgery as a kit assembly. The pre-assembly consists of the following steps: the snap ring 7 is expanded and placed into groove 14 of sleeve lock 2. The sleeve lock/snap ring assembly inserts into proximal bore 32 of nail body 1 with locking tabs 10 leading. Since the outside diameter B of snap ring 7 is greater than the nail body 1 proximal bore 32, snap ring 7 will stop when it contacts the proximal end of nail body 1. The sleeve lock/snap ring assembly is then rotated axially to align the sleeve lock anti-rotation tab 11 with nail body anti-rotation groove 36. The sleeve lock/snap ring assembly is inserted further into nail body 1 proximal bore 32 at which time bore 32 acts on snap ring 7 compressing it within groove 14 of sleeve lock 2 allowing the sleeve lock/snap ring assembly to slide in bore 32 and sleeve lock anti-rotation tab 11 to engage nail body 1 sleeve lock anti-rotation groove 36. As insertion continues, snap ring 7 encounters nail body 1 proximal circumferential groove 34 at which time snap ring 7 assumes its original diameter B as it expands into circumferential groove 34, locking or “detenting” the sleeve lock 2 in this position. Additional insertion force causes the snap ring 7 diameter B to interact with bore 32 compressing it back into sleeve lock 2 groove 14, allowing the sleeve lock/snap ring assembly to slide in bore 32 towards nail body 1 distal circumferential groove 35. Upon contacting circumferential groove 35, snap ring 7 will expand into groove 35 locking or “detenting” the sleeve lock 2 in this position. With the sleeve lock 2 in this position, end cap 8 can be threaded into nail body 1 internal threads 37 with groove section 20 leading. The end cap 8 is installed until its trailing end is as close to flush with the nail body 1 proximal end as practical with the end cap 8 slots 20 / 50 aligned radially with nail body 1 instrument interface slot 26 and nail body 1 anti-rotation slot 36. The sleeve lock 2, is now pulled from its “detented” position, with snap ring 7 located at distal circumferential groove 35 (FIG. 20), by use of an instrument (not shown) passed through end cap threaded bore 16 and threaded into sleeve lock 2 threaded bore 13. The force causes snap ring 7 to be compressed into sleeve lock 2 groove 14 which allows sleeve lock 2 to translate towards proximal circumferential groove 34. As sleeve lock 2 translates, anti-rotation tab 11 slides in nail body 1 sleeve lock anti-rotation groove 36 thus preventing relative rotation between sleeve lock 2 and the nail body 1. Since end cap 8 slots 20 / 50 were aligned with nail body 1 sleeve lock anti-rotation slot 36, sleeve lock anti-rotation tab 11 is aligned with end cap 8 slots 20 / 50. As sleeve lock 2 continues to translate towards end cap 8, sleeve lock anti-rotation tab 11 enters/mates with end cap slots 20 / 50 and snap ring 7 enters nail body proximal circumferential groove 34 “detenting” sleeve lock 2 into position. With sleeve lock 2 in this position, nail body anti-rotation slot 36, sleeve lock tab 11 and end cap slots 20 / 50 are in a mated condition (FIG. 6). This prevents any relative rotation of nail body 1, sleeve lock 2 and end cap 8 during handling or attachment of the installation instrumentation. The nail assembly is supplied for surgery in this condition. This preassembled condition saves surgical time over current intramedullary nail systems that require an end cap and setscrew to be added during surgery. [0085] Sleeve 3 (FIG. 1) is utilized to secure lag screw assembly 4 into nail body bore 33 after implantation of the lag assembly 4 and nail body 1 in the femur. The outside diameter D (FIG. 12) is sized for a sliding fit in bore 33. The sleeve 3 has a circular bore 38 and a small length of bore having oppositely disposed flats 17 at the leading end (FIGS. 11, 12, 13 ). These are sized for a sliding fit with the body 30 and flats 29 of lag screw assembly 4 thus allowing axial translation of lag screw assembly 4 but not allowing relative rotation. The sleeve 3 contains two locking slots 9 (FIGS. 11, 14), which continue through sleeve 3 wall thickness and are located opposite each other (180 degrees radially) on the sleeve 3 body. These slots 9 are comprised of two features in addition to the opening into the sleeve bore 38. They are the flats 39 and the anti-translation bosses 18. The distance X (FIG. 14) between flats 39 of each slot 9 is sized for a sliding fit in the space Y between locking tabs 10 of sleeve lock 2 (FIG. 9). The anti-rotation bosses 18 are configured and spaced in such a way as to provide a sliding fit when sleeve 3 and sleeve lock 2 are mated at a relative angle V as shown in FIG. 5. The locking slots 9 configuration still functions when angle V is varied over a small range. A counterbore 19 is provided in the end of sleeve 3 opposite that of the flats 17 and has the configuration as shown in FIG. 13. It is sized and configured for mating with compression screw 6 as shown in FIG. 2. [0086] The nail assembly consisting of nail body 1, sleeve lock 2, snap ring 7 and end cap 8 is inserted in an antegrade fashion into the femur. Prior to insertion, an instrument is attached to the proximal end of the nail assembly. The instrument (not shown) utilizes the threaded bore 16 of end cap 8 for attachment and incorporates a protruding feature which mates simultaneously with slot 26 of nail body 1 and slot 50 of end cap 8. This provides angular alignment between the instrument and the nail body 2 and provides anti-rotation of end cap 8 within nail body 1 during attachment/torqueing of the instrument into threaded bore 16 of end cap 8. The nail assembly is inserted into the femur and the lag screw assembly 4 is then inserted through nail body bore 33. Instrumentation assures proper insertion depth of lag screw assembly 4 and alignment of the plane of lag screw flats 29 parallel to the nail body proximal bore 32 longitudinal axis. After the lag screw 4 is implanted in its proper position within the femur, its trailing end protrudes partially or fully through nail body 1 bore 33. The leading end of sleeve 3 containing flats 17 is inserted into bore 33 and the bore 38 of sleeve 3 aligned, with the aid of instrumentation (not shown) with the similarly shaped lag screw body 30. The sleeve 3 is inserted further into bore 33 thus mating with lag screw 4. Since, as described previously, sleeve flats 17 interact with lag screw flats 29 preventing relative rotation between lag screw 4 and sleeve 3 and the plane of lag screw flats 29 are already aligned parallel to nail proximal bore 32 longitudinal axis the plane of the sleeve flats 39 are now also aligned parallel with the nail proximal bore 32 longitudinal axis. Instrumentation (not shown) has also located the centerline of sleeve 3 slots 9 coincident to the longitudinal axis of nail body proximal bore 32 and therefore also coincident with sleeve locking tab 10 longitudinal axis. The sleeve lock 2, snap ring 7, sleeve 3 and lag screw 4 are now in the relative positions as shown in FIG. 4. [0087] The sleeve lock 2 and snap ring 7 are now translated by instrumentation (not shown), as previously described, such that snap ring 7 moves from nail body proximal circumferential groove 34 to nail body distal circumferential groove 35 and sleeve locking tabs 10 mate into sleeve slots 9 as shown in FIG. 5. With sleeve 3, sleeve lock 2, snap ring 7 and lag screw 4 assembled as shown in FIG. 5 within nail body 1, sleeve 3 is fixed in rotation by interaction of locking tabs 10 and sleeve flats 39 and in translation by interaction of locking tabs 10 with sleeve anti-translation bosses 18. Since sleeve 3 is now fixed in rotation, lag screw 4 is also fixed in rotation by the interaction of sleeve flats 17 and lag screw flats 29 but not fixed in translation. The end cap 8 remains in position and is utilized to prevent bony ingrowth into nail body internal threads 37, which are used for removal instrument interface, if nail assembly removal is required in the future. [0088] With sleeve 3 and lag screw 4 fixed in rotation, tangs 12 of lag screw 4 can be deployed as described in U.S. Pat. No. 6,183,474 B1. After tang 12 deployment, compression screw 6 is inserted through bore 38 of sleeve 3 mating its threaded end with internal threads within lag screw 4 and its head with sleeve counterbore 19. As compression screw 6 is tightened, its head contacts sleeve counterbore 19, and since sleeve 3 is fixed in translation by locking tabs 10, lag screw 4 is drawn toward nail body 1 thereby compressing the fracture. [0089] One or two cortical screws 5 can now be used to fix nail body 1 both in translation and rotation within the intramedullary canal. The cortical screws 5 are placed through the lateral femoral cortex and through clearance holes 25 in the nail body 1, then through the medial femoral cortex (FIG. 2). [0090] The nail assembly can be removed by removing cortical screws 5, compression screw 6, retracting tangs 12, as described in detail in U.S. Pat. No. 6,1834,74 B1, removing end cap 8, releasing sleeve 2 by translating sleeve lock 2 and snap ring 7 to nail body proximal circumferential groove 34, removing sleeve 2 and lag screw 4 and utilizing nail body internal threads 37 to interface a nail body 1 removal instrument (not described) and pull the nail body from the intramedullary canal. [0091] In an alternate kit embodiment (FIG. 25), sleeve lock 2, end cap 8 and snap ring 7 are replaced by sleeve lock assembly 42 (FIG. 33). The alternate configuration of sleeve lock 42 results in the nail body 1 not requiring sleeve lock anti-rotation groove 36, proximal and distal circumferential grooves 34 and 35. In this embodiment, no implant components are assembled into the nail body 1 prior to its insertion into the femur. [0092] End cap assembly 42 consists of two parts, end cap 43 and bifurcated sleeve lock 44 (FIG. 33). The end cap 43 contains drive interface 46 (FIG. 34) which provides a means to drive the end cap with an instrument and an external thread 49 (FIG. 35) sized to interface with nail body internal thread 37 (FIG. 20). The bifurcated sleeve lock 44 incorporates a cylindrical peened interface 48 (FIG. 36) which protrudes through a clearance hole in end cap 43 and into drive interface 46 where it is peened over in such a way as to retain end cap 43 to bifurcated sleeve lock 44 but allow relative rotation of the two parts. Locking tabs 47 have a semicircular cross section with a radius equal to that of the body of the bifurcated sleeve lock 44 sized to provide a sliding fit in proximal bore 32 of nail body 1 and a width sized to provide a sliding fit between sleeve anti-rotation bosses 18 when the parts are assembled at angle V as shown in FIG. 29. Angle V can vary over a range and the fit will still be maintained. Distance Z (FIG. 35) is such as to provide a sliding fit over dimension X of sleeve 3. [0093] Unlike the preferred embodiment, sleeve lock assembly 42 is not pre-assembled into nail body but is instead installed as a last step in the procedure. The nail body 1 is inserted into the intramedullary canal of the femur, the lag screw 4, sleeve 3, compression screw 6 are installed as well as the cortical screws 5. The nail body 1 insertion instrument (not shown) is then removed from the proximal end of nail body 1 and the locking tab 47 (FIG. 33) end of sleeve lock assembly 42 is inserted into the proximal bore 32 of the nail body 1. It must be manipulated to align with sleeve 3 slots 9. Note that this manipulation could be eased through the addition of a keying feature between the bifurcated sleeve lock 44 and the nail proximal bore 32. Once aligned, locking tabs 47 will enter and mate with sleeve slots 9 allowing the sleeve lock assembly to translate far enough for threads 49 of end cap 43 to mate with nail body internal threads 37. Since the peened interface between end cap 43 and bifurcated sleeve lock 44 allow relative rotation, drive interface 46 can be used to fully engage threads 49 and 37. The sleeve is now fixed in rotation and translation as previously described. The nail assembly can be removed by reversing the assembly order. [0094] This alternate embodiment also allows another method for rotational and translational locking of the nail assembly distally in the intramedullary canal. Instead of cortical screws 5, use of a distal tang 55 would be optional (FIG. 25A). Note that this distal tang 55 would have to be inserted prior to the installation of the sleeve 3, lag screw assembly 4 and compression screw 6. [0095] In this embodiment, the distal end of nail body 1 would incorporate an end hole of square cross section 27 (FIG. 25A) and four tang exit holes 40 in addition to the cortical screw holes 25. Distal bore 31 is sized to permit a sliding fit with the tang body 58 (FIG. 31). Four tang exit holes 40 (FIG. 28) are located on a 90 degree radial spacing penetrating from the distal outside diameter E into the distal bore 31, on axes which form an angle J (FIG. 25A). The clearance holes 25 pass through the distal outside surface and wall into the distal bore 31 and continue on the same axis through the opposite wall and outer diameter. Their diameter is such as to allow passage of the threaded portion of the cortical screw 5 (FIG. 1). A frustro-conical feature 59 (FIG. 25A) provides a transition between the circular bore 31 and the square bore 27. The square bore 27 serves three purposes. It provides clearance through the leading end of the nail body for passage of a guide pin, used during fracture alignment and installation of the of the nail body into the intramedullary canal, it provides a sliding fit for the square forward protrusion 23 (FIG. 31) of tang 3, and it acts as a “vent” hole for any organic material within the bore 31 which is being pushed ahead of the tang during tang installation. It must be noted that the forward most clearance holes 25 also intersect the frustro-conical feature 59 and will act as vents for organic material during tang insertion after the square protrusion 23 has engaged and filled square bore 27. [0096] The tang 55 has four equally sized and radially spaced legs which are preformed to radius R. The radius R (FIG. 32) on each leg 21 results in a dimension between the trailing ends of opposing legs which is greater than the outside diameter of tang body 58 and the bore diameter 31 of nail body 2. The tang body 58 is circular in cross section and sized for a sliding fit within nail body bore 31 with a leading edge chamfer 57 which transitions into the leading protrusion 23 which has a square cross section and leading end taper 56. Tang body 58 contains an internally threaded bore 22 which is the instrument interface for the instrument 51 used to insert and deploy the tang. It must be noted that threaded bore 22 is not needed for tang retraction. FIG. 31 illustrates the deployed shape of tang 55 which is the shape it assumes after the legs 21 have been forced through the tang exit holes 40 of nail body 1. [0097] Insertion/deployment of the tang 55 occurs after insertion of the nail body into the intramedullary canal. The insertion/deployment instrument 51 (FIG. 27) has threads 52 that are mated with tang 55 threaded bore 22. The tang 55 is now inserted through nail body bore 32 and into nail body bore 31. The insertion/deployment instrument 51 has a self-centering bushing 53 to help orient the tang 55 for proper insertion. Since the distance between opposing tang legs 21 is greater than the bore diameter 31 due to radius R, the interference with bore 31 forces the legs 21 inward in an elastic manner and insertion continues with some resistance. As the tang travels down bore 31, any organic material which has accumulated in bore 31 is pushed ahead and forced out through square bore 27 of nail body 1 and through cortical screw clearance holes 25. Further insertion causes the tang 55 leading square taper 56 to contact the square bore 27 of the nail body 1. Since both cross sections are square, no engagement will occur until they are radially aligned which may or may not occur without some slight rotation of the tang 55 using the insertion/deployment instrument 51 (FIG. 27). After alignment occurs and by virtue of this alignment, the tang leading protrusion 23 will slide freely in square bore 27 and the tang legs 21 and the nail body 1 tang exit holes 40 will now be aligned. The tang 55 continues past tang exit holes 40 and is fully inserted when the tang body leading edge chamfer 57 makes contact with the nail body frustroconical feature 59 at point K (FIG. 28). In this position, the leading end of tang 55 protrudes through the end of nail body 1 to point N and the trailing end of the tang legs 21 are just past tang exit holes 40. The tang is now in position to be deployed. To deploy the tang, an axial force is exerted by the insertion/deployment instrument 51 in the opposite direction as for insertion. This causes the tang 55 to translate back up bore 31 and the sharp ends of tang legs 21 to encounter tang exit holes 40. Since the tang legs 21 were elastically compressed inward by bore 31 they will now spring outward forcing the sharp end of tang legs 21 into tang exit holes 40. Further translation of the tang 55 forces the tang legs through the tang exit holes 40. Due to the diameter and angle of the tang exit holes 40, the tang legs 21 are formed in such a manner as to emerge almost perpendicular to the femoral cortex (FIG. 25A). Continued translation of the tang 55 causes the tang legs 21 to penetrate the femoral cortex. During this time, tang leading square protrusion 23 is still engaged by the nail body square bore 27 thus preventing rotation of tang 55 in bore 31 during deployment and preventing unwanted twisting of the tang legs 21. The tang 55 can be deployed fully or partially and is self-locking in any position due to the almost perpendicular entry angle into the femoral cortex. After deployment, the insertion/deployment instrument 51 is unthreaded from tang threaded bore 25 and removed. The nail body 1 is now fixed axially and rotationally in the intramedullary canal. FIG. 26 shows the tang 55 in the fully deployed position having translated a distance from point N (FIG. 28) to point M (FIG. 26). The tang 55 is fully retractable. It is retracted by applying a force on the tang 55 with instrumentation in the opposite direction as deployment until the tang 55 comes to rest at points K and N as shown in FIG. 28. [0098] Note that at the surgeon's discretion, distal fixation of the nail body 1 can still be accomplished without use of tang 55. This is accomplished by using the cortical screws 5 (FIG. 1) as described in the preferred embodiment. The cortical screws 5 are placed through the lateral femoral cortex and through clearance holes 25 in the nail body 1, and through the medial femoral cortex (FIG. 25). The cortical screws are not used in conjunction with distal tang fixation and cannot be passed through clearance holes 25 if there is a tang 55 inserted into nail body 1. [0099] It should be noted that this description is directed at only one possible alternate embodiment and that many others are possible ending with the same results without departing from the spirit and scope of the invention. As examples, tang 55 could have any number of legs 21, square protrusion 23 could take on any keyed polygon shape, sleeve lock 2 could be made with 1 leg 10 and the lag screw may or may not have tangs. SUMMARY: [/INST] The intramedullary nail system includes an intramedullary nail for insertion in the femur. The nail has an axial bore and an intersecting transverse bore. A lag screw is inserted through the transverse bore and turned into the head of the femur. A slotted sleeve is inserted over the lag screw and through the transverse bore with the slots aligned with the axial bore. A sleeve lock is inserted into the axial bore and has a locking tab which engages the slots in the sleeve preventing rotational and longitudinal movement between the sleeve and the nail. A compression screw is turned into the trailing end of the lag screw and engages the encircling sleeve to provide longitudinal translation between the lag screw and sleeve to apply compressive force across a fracture. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SUMMARY OF THE INVENTION The new and distinctive perennial Monarda (Bee Balm) variety of the present invention was the result of a breeding program involving open pollinated and controlled crosses that was carried out at Morden, Manitoba, Canada. The initial female parent (i.e., the seed parent) was Monarda didyma `Cambridge Scarlet` (non-patented in the United States) and the initial male parent (i.e., the pollen parent) was Monarda fistulosa menthaefolia (non-patented in the United States). The initial cross created the `Souris` variety (non-patented in the United States). Plants designated `60-1`, `62-0`, `64-8`, `66-1`, `76-1` and `75-1` were created in subsequent generations through the open pollination of the `Souris` variety and offspring that were derived from the `Souris` variety. Plants `76-1` and `75-1` next were crossed to create a plant designated `78-1`. The open polination of plant `78-1` resulted in the creation of the `Marshall's Delight` variety (non-patented in the United States). See, HortScience, 24(3):525 (1989) where the `Marshalls Delight` variety is discussed. Next, the `Marshall's Delight` variety was open pollinated to form a plant designated `86-2`. Plant `86-2` subsequently was open pollinated to form offspring from which the new variety of the present invention was selected during 1988. The single plant of the new variety found among the offspring initially was designated `88-12`. It was found that the new Monarda variety of the present invention: (a) forms attractive light pink-purple to light purple blossoms, (b) exhibits attractive dense dark green and glossy foliage, (c) exhibits a dwarf growth habit that can be readily distinguished from that of the `Marshall's Delight` variety, and (d) exhibits good winter hardiness. The low-growing dwarf growth habit of the new variety of perennial Monarda plant of the present invention is particularly noteworthy, and can be used to quickly differentiate the new variety from previously known varieties, such as the `Marshall's Delight` variety. The flowers, stems, and foliage of the new variety are aromatic and typical in this regard to that of other Monarda didyma and Monarda fistulosa plants. The shiny dark green foliage of the new variety contrasts well with the light purple blossoms. The new variety well meets the needs of the horticultural industry and can be grown as attractive ornamentation in parks, gardens, public areas, and residential landscapes. Large mass plantings are particularly attractive. Floral designs can be sculpted using the new variety in combination with other low-growing herbaceous plants. The new variety can be included in traditional formal beds where it provides an attractive mid- to late-season bloom. The plants of the new variety also can be used as specimen plants or as borders dividing sections of floral beds or to define a boundary in a planting area. The characteristics of the new variety have been found to be homogeneous and stable and have been shown to be transmissble by asexual reproduction using rhizome and softwood stem cuttings, division, and tissue culture. It is been found that propagation by the use of rhizome cuttings is very successful when applied to the new variety and can be as a means to rapidly multiply the new variety. Approximately 30 rhizome cuttings can be obtained from two or three year-old plants. Rhizome segments having a length of approximately 2.5 to 5 cm. can be harvested in early spring or fall possessing approximately 0.5 to 1 cm. of terminal growth, inserted into a potting media, and grown in a greenhouse or outdoors while protected. For best results rhizome cuttings should be selected that have minimal vegetative leaf growth. Softwood stem cuttings can be taken early in the growing season and rooted under intermittent mist. It has been found that rooting success drops dramatically when propagation using stem cuttings is attempted during mid-summer. It is not essential to utilize a hormone during rooting; however, such hormone usage has been found to accelerate the rooting speed. A two-year old plant commonly will yield approximately six divisions. The new variety has been named `Petite Delight`. BRIEF DESCRIPTION OF THE PHOTOGRAPHS The accompanying photographs show, as nearly true as it is reasonably possible to make the same in color illustrations of this character, typical specimens of the plant parts of the new variety. The Monarda plants described herein were approximately two years of age and were photographed while growing outdoors during mid-summer 1995 at Morden, Manitoba, Canada. FIG. 1 illustrates a flowering plant of the new variety while growing in the landscape. The compact dwarf stature, dense dark green glossy foliage, and light pink-purple to light purple blossoms are apparent. FIG. 2 illustrates an enlarged view of typical specimens of the blossoms and foliage of the new variety. DETAILED DESCRIPTION The chart used in the identification of the colors is that of The Royal Horticultural Society (R.H.S. Colour Chart). Common color terms are to be accorded their ordinary dictionary significance. The description is based on the observation of two year-old plants of the new variety while being grown outdoors in the landscape during the summer at Morden, Manitoba, Canada. Botanical classification: Monarda didyma×Monarda fistulosa menthaefolia, cv. `Petite Delight`. Plant: Growth habit.--Dwarf, compact, and round to oval in configuration. Size.--Commonly approximately 25 to 30 cm. in height and width. This can be compared to a height and width of approximately 50 to 60 cm. for the `Marshall's Delight` variety. Foliage: Size.--Leaves commonly measure approximately 6 cm. in length and approximately 3.5 cm. in width. The leaf size commonly is variable depending upon the location along the stem. The leaf shape varies from ovate-lanceolate to chordate with the more chordate leaves being present towards the tip of the stem. The leaflets tend to be truncate at the base with an attenuate tip. The leaflet texture is moderately coarse due to the presence of pubescence. The leaflet aspect commonly changes from substantially horizontal at the base to more ascending at the tip. The leaves commonly tend to be somewhat smaller with shorter internode lengths than those of the `Marshalls Delight` variety. More specifically, the internode distance is approximately 20 mm. shorter than that of the `Marshall's Delight` variety. For instance, when measured at the lower portion of a main stem, the internode distance averaged 29.92 mm. vs. 49.0 mm. for the `Marshall's Delight` variety. Margins.--Serrate. General appearance.--Dense, dark green and glossy. The foliage typically is more glossy than that of the `Marshall's Delight` variety. When viewed from a distance the appearance is similar to that of a bedding Chrysanthemum plant. More specifically, from a distance the new variety is mounding with terminal influorescence, multipe main stems and exhibits a dense appearance. Color.--Dark green, Yellow-Green Group 147A on the upper surface and Green Group 137 A on the under surface. Venation.--Is typical for the genus with a central midrib and commonly 10 to 12 veins in a predominantly opposite arrangement. The veins appear to be slightly sunken on the upper surface and slightly protruding on the under surface. However, such difference is slight. Very small veins commonly are visible which connect the main veins of the leaf. Pubescence tends to be slightly longer on the veins and on the midrib than on the remaining leaf tissue. Tiny hairs also commonly are visible along the left margins. Stems.--Four-sided, pubescent, and near Yellow-Green Group 144A in coloration. Stem lengths vary with growing conditions and the stems commonly are approximately 25 to 30 cm. in length. Inflorescence: Buds.--The coloration changes as the buds develop. Initially the buds are green and of substantially the same coloration as the stems. They next gradually lighten in coloration to a light yellow-green coloration prior to full maturation. Flowers.--Typical of the species with respect to size and configuration. Borne.--Terminally, and dense compound (verticillaster). Size.--Approximately 6 to 6.5 cm. in diameter. Color.--Light pink-purple to light purple with shades of Red-Purple Group 64A, Red-Purple Group 72B, and Red-Violet Group 80A. The coloration varies somewhat depending upon the age of the blossoms and the season of the year. For instance, the intensity of the coloration tends to diminish and to become lighter with blossom age. This can be compared to a typical blossom coloration of Red-Purple Group 63B for the `Marshall's Delight` variety. Flower duration.--Approximatley 6 to 8 weeks beginning during mid-August at Morden, Manitoba, Canada. Reproductive organs.--Typical of the species. Viable pollen is formed and the flowers are fertile. Fragrance.--The aroma is typical of the species. The leaves and stems also are fragrant. Development: Vegetation.--Good vigor. The growth rate is generally equivalent to that of the species. Even though the plant is a genetic dwarf, it is not slow growing. The early spring growth commonly reaches full size in approximately six weeks. Culture.--Plants should be cut back in the spring to remove older foliage and to promote new growth. Care should always be exercised so as not to damage the crown of the plant. The plants preferably are dead-headed after flowering to improve visual appearance. The regrowth of the foliage after flowering is good thereby serving to maintain a fresh green appearance late in the growing season and throughout the fall. Disease resistance.--During the course of observations to date powdery mildew has not posed a major problem. Some rust (Puccinia menthol Pers.) has been observed, but such rust involvement generally has taken place late in the season and was not severe. In comparative trials the new variety was rated very good for disease resistance when compared to other commonly-grown Monarda varieties. Hardiness.--Plants are hardy to at least Agriculture Canada Zone 3 with no winter protection other than naturally occuring snowfall. See Ouellette and Sherk, Woody Ornamental Plant Zonation III, Suitability Map for Probable Winter Survival of Ornamental Trees and Shrubs, Can. J. Plant Sci., 47:3513-3518(1967). Due to low-growing habit of the new variety, natural snow cover is believed likely to be capable of extending the growing range to even colder regins. SUMMARY: [/INST] A new and distinct variety of perennial Monarda or Bee-Balm plant is provided that exhibits a unique dwarf stature and good winter hardiness. The blossoms exhibits an attractive light pink-purple to light purple coloration (as illustrated). Dense dark green and glossy foliage is formed that contrasts well with the blossom coloration. The low-growing growth habit of the new variety can readily be distinguished from that of the 'Marshalls Delight' variety (non-patented in the United States). </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to packaging for skis which serves to protect them and which allows for their display for commercial sale. It relates more particularly to a type of packaging and its process of manufacture. 2. Description of Background and Relevant Information After the manufacture of skis, but before the skis leave the factory and enter into commerce, it is known to package them for protection from possible deterioration before their final sale to the user. The most common technique consists of wrapping the skis with sheets of thick and opaque polyethylene, which may or may not be folded at the two ends of the skis to form small pouches which are then stapled closed. Thus prepared, the skis have an appearance which is far from being attractive. Also, it is not uncommon that the skis are placed in an exposed fashion in the retail shop well before their sale to the purchaser, which leaves them in a situation which risks damage. Even if this is not the case, and the user wants to mount the bindings before carrying off his skis, it is necessary to remove the skis from their package for the operation of mounting the bindings. Besides the fact that this operation may possibly damage the exposed skis, it is no longer possible, after mounting the bindings, to reintroduce the skis in their protective package, which then exposes them to the risk of deterioration by handling or transport. SUMMARY OF THE INVENTION The disadvantages mentioned above with regard to the prior art of packaging skis are overcome by the present invention which includes a closed envelope, made of thermo-shrunk plastic material for protecting and surrounding the ski, wherein the envelope includes at least one zone defined by a tear line corresponding to the location for the mounting of the bindings. According to the present invention, the plastic material is preferably transparent and can be made of, for example, polyvinylchloride. The thickness of the plastic material, prior to its being thermo-shrunk, is approximately 40-60 microns. Further, the plastic material is bidirectional and has an initial thermo-shrinking ability of approximately 5-8% longitudinally and approximately 40% transversely. According to a further aspect of the present invention, each of the zones includes at least a tongue which facilitates the removal of the zone. This tongue is preferably glued or welded at each zone and extends over the remainder of the packaging. According to a further aspect of the present invention, each zone is defined by a tear line situated under the sole of the ski and, according to a further aspect of the present invention, a zone is defined by a tear line localized at a lateral side of the ski. According to a still further aspect of the present invention, a protective plate is positioned at least at one of the zones, positioned between the ski and the envelope. The plate can include indicators which correspond to the locations where holes for mounting of the ski bindings are to be formed. The plates can further be made of cardboard material. The process according to the present invention includes at least the steps of: introducing a ski into a sleeve of thermal-shrinkable plastic material having a length and width greater than that of the ski; welding the sleeve closed at least at one end; and passing the ski wrapped in the sleeve through a thermo-shrinking apparatus. According to one aspect of the process, the step of welding closes the sleeve along directions which converge from the side of the spatula of the ski. According to a further aspect of the process, the process includes the step of forming a tear line in the packaging to define at least one zone corresponding to areas for receiving the bindings of the ski. According to a further aspect of the process, the process includes the step of providing a tongue on at least one of the zones to facilitate the tearing of the packaging in that zone. According to a still further aspect of the process, the process includes, before the step of welding the sleeve, the step of positioning a plate on at least one zone to protect the surface of the ski during the step of forming the zone. In summary, the apparatus and process of the present invention results in a sleeve for protecting the ski, wherein the sleeve comprises at least one portion which includes means for facilitating the removal of that portion while leaving the remainder of the sleeve intact. The sleeve is formed of plastic, preferably heat-shrinkable material, in which the means for facilitating the removal of the portion includes a portion of the sleeve which has been treated to form an area of reduced resistance to tearing. This area of reduced resistance can include at least one line, which can be perforated, or merely a line of lessened thickness in the sleeve. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described with reference to certain characteristics and advantages which will become clear from the description which follows whose understanding will be facilitated with reference to the annexed drawings in which: FIGS. 1-5 illustrate the respective steps in producing the ski packaging according to the invention; FIGS. 6 and 7 illustrate the mounting of the bindings without the removal of the packaging, except in the zone adapted for the binding. FIGS. 8-10 illustrate a particular embodiment of the packaging; FIGS. 11-14 illustrate an improved embodiment of the packaging according to FIGS. 5-7; and In FIGS. 15-18 illustrate alternative embodiments. DESCRIPTION OF PREFERRED EMBODIMENTS The present invention attempts to overcome the disadvantages of the present state of the art by proposing an attractive packaging whose protective role extends from the time the skis are finished until their retail sale, or even, until their first use, i.e., even after the mounting of the bindings. The packaging protects the surfaces of the ski against damage such as scratches, dust, or dirt which might otherwise result from exposure of the ski prior to, during, as well as after sale of the skis. The packaging of a ski according to the invention includes an envelope which is closed at all sections and protects and likewise surrounds all of the parts of the ski. This envelope is constituted of a thermo-shrinkable plastic material. Preferably, this material is transparent, permitting the ski to remain constantly visible to the user. Polyvinylchloride lends itself extremely well to this use, and particularly the "crystal" type, which assures an excellent aesthetic appearance and thus a high attractiveness, particularly at the place of distribution. This packaging protects the ski, as well as its undersurface, against dust and scratches, and the transparency of the packaging guarantees at all times that the ski will maintain all the characteristics of its initial finishing upon leaving the factory. This packaging also protects against the corrosion of the edges of the ski. This conditioning is achieved in the manner illustrated in FIGS. 1-4. In FIG. 1 there is shown a ski 1 in its form as a finished product. It is introduced into a sleeve 2 of appropriate plastic material, of a predetermined width, when flat, and of a length greater than that of the ski 1. Sleeve 2 can be precut or fed by a roller (as shown) and then cut to the desired length. The precut sleeve 2 containing ski 1 is then welded closed at its two ends by a known manner of welding, transversely to the side of the heel of the ski, and preferably, in a converging fashion from the side of the spatula of the ski, to correspond to the shape of the ski and, ultimately, to mate with it. The result shown in FIG. 2 is thus obtained. Ski 1 packaged in sleeve 2 then passes, as illustrated in FIG. 3, through a conventional heat shrink tunnel 3, with hot air convection, to come out packaged as in FIG. 4 where the sleeve 2 is shrunk to press perfectly against all of the parts of the ski 1, without any folds. Excellent results are obtained with a sleeve 2 having an original thickness of approximately 40-60 microns in a material which is preferably bi-oriented and having initially a transverse shrinking ability of about 40% and a longitudinal shrinking ability of about 5-8%. An original flat width of about 100-120 millimeters is thus appropriate for a normal ski. Under these conditions, a thermo-shrink tunnel 3 of a length on the order of 1.10 meters with a speed of transit on the order of 11 meters per minute, and a working temperature on the order of 150° C. is perfectly appropriate for the result sought. Ski 1 thus packaged in sleeve 2 can be offered for sale and taken away by the purchaser in this condition illustrated in FIG. 4. If in a retail store the buyer would like to have bindings mounted, the retail technician can, by cutting it away adjacent the surface necessary for the binding mounting operations, eliminate the protective film constituted by the original sleeve 2, now forming the package, without removing the film over the remainder of the ski. The protective package 2 will continue to maintain the surface of ski 1 protected from accidents, such as scratches, which the binding mounting operation may otherwise cause by the carelessness of the operator or other circumstances. Once the mounting has been performed, the purchaser can carry away his skis 1 still protected, except in the zone or zones where the binding elements 7 have been attached. To facilitate the partial removal of the packaging in the one or more zones for the mounting of the bindings, without the deterioration of the packaging more than is necessary or useful, one can, according to the invention, predefine this zone or zones by tear lines. This is illustrated in FIGS. 5-7. In FIG. 5, the packaged ski of FIG. 4 is shown undergoing the operation of forming a tear line, which defines a mounting zone 5 of the bindings of ski 1. The process of forming a tear line per se is well known to one of ordinary skill in the art who packages with plastic film for other products. The present invention, however, includes the application of the process for this particular field of endeavor with its specific and particular requirements. A tool 4 which is constituted and appropriately configured is used against the upper surface of the packaged ski 1, 2 to define an area of reduced resistance of the package 2, defining the zone 5 provided for the mounting of the bindings. According to the option selected, this area can be formed by the working tool 4 by means of a succession of points, small segments or short lines, perforations, or by a continuous line of reduced resistance which takes the form of a line recessed in the surface of the package 2. Preferably, one can give to this area the shape of a corner, positioned, as in FIG. 5, in front and/or to the rear, to facilitate the tearing without destruction of the package when it is no longer necessary or desired. FIG. 6 illustrates this removal operation, which is performed by the tearing away of this single zone 5 in the direction of arrow 6, without damaging the rest of the packaging 2. In FIG. 7, the mounting of binding 7 is illustrated, where zone 5 of the packaging 2 is torn away, exposing the upper surface of the ski. To facilitate the removal of zone 5 of packaging 2, without removing the remainder of the packaging, as described above, it is advantageous to provide zone 5 with a tongue 8 affixed, for example by gluing or welding or the like, and extending the tongue 8 by a free end over the rest of the package 2 of ski 1. The removal operation, symbolized by the arrow 6, is illustrated in FIGS. 8 and 9. FIG. 10 illustrates the details of the tongue 8 affixed before removal of zone 5, and bordering on and extending freely beyond its other end on the package 2. Depending upon the final thickness of the package 2, the tool 4 utilized, and the skill of the operator performing the cut-away operation or the precutting of zone 5 provided for the mounting of binding 7, within the packaging operation itself of ski 1 a supplemental form of protection can be provided. To achieve this, as illustrated in FIG. 11, a protective plate 9, or more than one plate, is placed upon ski 1 at locations adapted for the positioning of the binding elements, before introduction of ski 1 into sleeve 2. The welding operations of the ends of sleeve 2 and the thermal shrinking in appropriate tunnel 3 occur as previously described. The one or more plates 9 offer a supplemental protection to the upper surface of the packaged ski for the operation of defining the one or more zones 5 adapted for an ultimate preliminary removal prior to the mounting of the binding elements 7. Thus, as illustrated in FIG. 12, by forming the area of lesser resistance of the one or more zones 5, the tool 4 can in no case, even by the carelessness of the operator, damage the upper surface of ski 1. Preferably, the one or more small plates 9 can be made from cardboard sheet material. The remaining operations for the ultimate mounting of the bindings remain substantially identical to those previously described. However, after removal of zone 5 in the direction of arrow 6, as illustrated in FIG. 13, the plate 9 is removed before the placement of the binding elements 7 in position on the upper ski surface, as illustrated in FIG. 14. The cardboard plate has a dimension greater than the cut-away surface such that it can be ensured that the cardboard plate can be positioned at least where the cutting away occurs. The cardboard can preferably include indicators 90 corresponding to the locations where holes are to be formed in the ski for the mounting of the bindings. FIG. 15 schematically illustrates the case where the binding elements can be mounted on the ski at a plurality of separate locations or zones. All which has been previously stated applies to this case without any difficulty, whatever the number and the surface of the zones to be removed for the mounting of any elements, bindings, or for any other reason, and without affecting the protective package 2 of the ski according to the invention. FIGS. 16, 17, and 18 illustrate variations according to the present invention. FIG. 16 is a perspective view of a wrapped ski in which the precut tear zone 5 is such that the precut formed by the tear lines 50 surrounds the ski. FIG. 17 is a perspective view showing, more particularly, the bottom of the ski and showing a variation in which one or more precut tear zones 5 are made on the side of the sole of the ski. This arrangement makes it possible at these zones, after shrinkage of the package, to be able to verify the state and the preparation of the sole. FIG. 18 is a view similar to FIG. 17 showing a variation according to which a precut zone 5 is positioned both on the sole of the ski and on the lateral side thereof. This arrangement makes possible, after shrinkage of the package, to be able to verify at the precut zone the state and the preparation of the edges. Although the invention has been described with reference to particular means, materials and embodiments, it is to be understood that the invention is not limited to particulars disclosed and extends to all equivalents within the scope of the claims. SUMMARY: [/INST] Packaging for a ski and a process of packaging the ski. The packaging provides an attractive envelope for the ski and protects the ski from the time it is manufactured until its retail sale, and further, until the ski is first used, i.e., even after the bindings are mounted thereon. The packaging protects and surrounds all parts of the ski and includes a sleeve of thermo-shrinkable plastic material. At areas upon which the ski bindings are to be mounted, zones of reduced resistance to tearing are produced so that, at the place of distribution of the skis, such zones can be conveniently removed without the removal of the remainder of the packaging. The process includes the steps of introducing a ski into a sleeve; closing the ends of the sleeve by, e.g., welding; and passing the ski wrapped in the sleeve through a thermo-shrinking tunnel. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: A Hollywood skin specialist to the stars accused of plotting to kill her main competitor in a'murder-for-hire' scheme is now accused of trying to hire neo-nazis to take the man out. A Los Angeles Police detective testified Monday in court that Dawn DaLuise, 55, tried to hire a white supremacist group to kill rival esthetician Gabriel Suarez because he is a 'double minority.' Suarez, a gay Latino, told KTLA outside the courtroom that 'it's just really scary... the hate this person could have. Scroll down for video. Smile for the camera!: Dawn DaLuise cracks a grin while sitting during a Monday court hearing. The victim: Gabriel Suarez told reporters outside court the though of someone wanting him dead is'really scary' DaLuise smiled as she walked into the courtroom wearing a blue jail jumpsuit. The hearing was to determine if she would face a trial on one count of solicitation of murder. The half-day hearing featured testimony from a number of people, including an LAPD detective who caught on to her scheme and averted possible tragedy. 'In one instance … she asked him if he could get her in contact with a white supremacist group, and the phrase from that point was, in essence, to find somebody to take out a ‘double minority Mexican gay,’ said the officer. The troubled woman also tried to make it appear as if Suarez was stalking her online, jurors were told. The problems started. when Suarez opened an office in the same Santa Monica building as. her salon, Skin Refinery. Previous reports suggested DaLuise, who has counted Jennifer Aniston, Sarah. Michelle Gellar and Christian Slater among clients, made Craigslist postings inviting men to turn up unannounced at the home of Gabriel Suarez for 'trysts', according to a series of text messages seen by RadarOnline. Dawn DaLuise, (left in her mugshot) a skincare specialist to the stars,. allegedly posted fake gay sex ads about her competitor GabrielSuarez (right), it was previously revealed. It was previously reported that DaLuise hired a former Detroit Lions player Chris Geile as a hit man to kill the competitor. He has not been arrested or charged and denies involvement. The explosive allegations revealed that DaLuise texted a friend: 'I’m putting a posting up abt (sic) him. wanting sex on CL [Craigslist] this week (only well hung black men need. apply!).' Edward Feinsteini, 28, has been arrested for alleged cyber-stalking. In another she allegedly wrote: 'I am putting together a CL (Craigslist) ad to run soon directing guys to Gabriel’s front door. No need to call. first! Just show up; I’ll be waiting in bed with an (sic) blindfold on!' DeLuise allegedly told the friend that in the ad, she encouraged men to barge into Suarez's home and claimed that he would be waiting in bed wearing a blindfold. DaLuise also reportedly told her friend that she intended to go to Starbucks to set up the Craigslist ads so that her IP address could not be traced. According to the Radar report, she also suggested stalking Suarez's sister. In a bizarre twist, the friend to whom DaLuise sent the text messages, Edward Feinstein, 28, has been arrested for stalking her. Feinstein allegedly made flyers with a sexually explicit photo of DaLuise's face, home address, phone number and distributed them publicly. He is also accused of making his own fake Craigslist ads pretending that DaLuise wanted men to help her act out a 'rape fantasy', according to the Los Angeles County Sheriff. Feinstein was released on bond and is due to appear in court on May 14. DaLuise believed that the person who made the ads about her was Suarez - and the threat to her and her daughters' safety was her motivation for the murder-for-hire plot, she has claimed. Well-connected: DaLuise is pictured with actor Gary Busey in Beverly Hills in November 2010. Fans: DaLuis counts Kyra Sedgwick, left, and Bridget Moynahan, right, among her skin-care clients. A representative for DaLuise previously told MailOnline they did not have a comment. According to her website, DaLuise moved to California to become a model in the 1980s. Driven. by her own sun-damaged skin, she enrolled in beauty school in the 1990s. and treats clients with electrical muscule stimulation, rather than.'steams and creams'. Her. Electrical Muscle Stimulation facials cost $125 a session and claim to. help dru skin, wrinkles or damage from chemical peels. A 40-minute. facial costs $80, while wax treatments cost up to $90. DaLuise also includes Freddie Prinze Jr., Alicia Silverstone, Alyson Hannigan, Christina Ricci, Kyra Sedwick and Bridget Moynahan among her clients. Mr Suarez's Smooth Cheeks Salon (pictured) opened on the same Santa Monica block as DaLuise's store allegedly enraging her SUMMARY: [/INST] Dawn DaLuise, 55, tried to hire a white supremacist group to kill a rival esthetician who had moved into the same building as her office. She also allegedly posted fake ads looking for sex with Suarez's address. DaLuise 'texted friend Edward Feinstein about the sex ad postings' Feinstein arrested on Wednesday for stalking DaLuise and allegedly making a fake flier of HER saying that she wanted to act out 'rape fantasy' DaLuise claims she thought Suarez made ad about her - motivating her'murder-for-hire plan' Jennifer Aniston, Sarah Michelle Gellar and Alicia Silverstone are among her past clients. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: BACKGROUND OF THE INVENTION 1. Field of the Invention This invention relates to a weight attachable to a fishing line. The weight comprises a weighted body which comprises a longitudinal hole therethrough or a circumferential groove there around or a longitudinal channel therein. A first elastomer, having at least one attachment means such as a loop, is disposed within the longitudinal hole. The loop functions to securely attach the weighted body to the fishing line. A second elastomer, having at least one attachment means such as a loop, is disposed within the circumferential groove. A third elastomer, having an elastomer groove, is disposed within the longitudinal channel. The elastomer groove functions to guide the fishing line and frictionally holed it therein. 2. Description of the Prior Art Fishing weights which are removably attachable to a fishing line are well known in the art. Fisherman utilize different weights depending on the type of fishing and the environmental conditions at the time of fishing. For example, in fishing in rapidly moving currents, a heavier weight is utilized but the amount of weight utilized is directly proportional to the amount of insensitivity a fisherman has in determining if a fish is eating his bait. Therefore, when fishing in tidal waters it is desirable to have a fishing weight which is easily changeable in weight depending upon the current which is relative to the tide. At slack tide, the water is almost stagnant and it is desirable for the fisherman to utilize a lesser weight. At mid-tide, the current is moving maximally and it desirable for the fisherman to utilize a more weight. The present invention permits the fisherman to easily attach and detach different weights to his fishing line in response to fishing conditions. In U.S. Pat. No. 3,982,350, Titled, Fishing Line Weight, by inventor, Heckathorn, describes a device for attaching a stone or rock to a fishing line. The patented invention differs from the present invention because it has a protuberance (18) and a flange member (24) which is lacking in the present invention. The present invention specifically claims a naturally occurring stone as part of the invention. The stone is altered to include either a cylindrical hole extending through the diameter of the stone or a groove circumscribing the periphery of the stone. A flexible band as consisting of rubber or some other elastomeric material is inserted into the groove circumscribing the stone, thereby securing the band to the stone. In the Heckathorn patent, an elastic strap is meant to secure any rock encircled within, strictly by means of elastic friction. Clearly, the present invention, containing a groove within the stone, utilizes a more secure means of attaching an elastic band to a stone. The Heckathorn patent is inferior for use as a sinker weight, since the stone is much more likely to become dislodged, before the stone sinks to the desired depth. The present invention is better adapted for use as a sinker weight, since the groove in the stone is much more likely to retain the flexible band, thereby allowing the stone to sink to the desired depth. As previously noted, the Heckathorn patent, utilizes an elastic strap relying strictly on means of elastic friction to secure any rock encircled within. Clearly, the present invention, containing a groove within the stone, utilizes a more secure means of attaching an elastic band to a stone. During casting, the Heckathorn patent is likelier to result in dislodging of the rock, thereby resulting in serious injury to the fisherman or to passersby, caused by rocks acting as uncontrolled projectiles. However, the present invention incorporates a grooved system which represents a safety enhancement to the public and serves their best interests. An additional embodiment of the present invention includes a cylindrical hole extending through the diameter of the stone. A flexible strand as consisting of rubber or some other elastomeric material is inserted into the hole within the stone. The strand is attached to the stone by means of top and bottom nodules which secure the flexible strand in place. However, the Heckathorn patent, relies on an elastic strap meant to secure any rock encircled within, strictly by means of elastic friction. Clearly, the present invention, containing a hole within the stone, utilizes a more secure means of attaching an elastic strand to the stone. The Heckathorn patent is inferior for use as a sinker weight, since the stone is much more likely to become dislodged, before the stone sinks to the desired depth. The present invention is better adapted for use as a sinker weight, since the hole in the stone in addition to the nodules on the strand, are more likely to retain the flexible strand, thereby allowing the stone to sink to the desired depth. As previously noted, the Heckathorn patent, utilizes an elastic strap relying strictly on means of elastic friction to secure any rock encircled within. Clearly, the present invention, containing a hole within the stone in addition to the nodules on the strand, utilizes a more secure means of attaching an elastic strand to a stone. During casting, the Heckathorn patent is likelier to result in dislodging of the rock, thereby resulting in serious injury to the fisherman or to passersby, caused by rocks acting as uncontrolled projectiles. However, the present invention incorporates a hole and nodule system which represents a safety enhancement to the public and serves their best interests. The Heckathorn patent relies on the immediate availability of rocks with which to attach to the strap. However, the present invention provides for the rock being pre-attached to the band or strand. Therefore the present invention is easier to use and therefore provides increased utility for the average consumer. Therefore, the present invention is more likely to be adopted by the general public because of its greater overall In Danish Patent No. 14776 a concrete sinker with a preformed hole therein is disclosed which differs from the present invention because it has a fluted hole whereas the present invention has a cylindrical hole bored therethrough. In Norwegian Patent No. 15840 a weight is described which contains a hole therethrough. In 1983 French Patent No. 2520973 a colorless elongated glass weight is described with a longitudinal hole in the center. The patented inventions lack an elastomer as described and claimed in the present invention. In 1989 German Patent No. 3728581 suggested a pebble weight of purely organic material with a hole therein adapted to retain a U-shaped loop of rigid wire which lacks an elastomer as described and claimed in the present invention In French patent, 855,584 describes a fishing weight having grooves. The present invention specifically claims a stone acting as a weight which is altered to include either a cylindrical hole extending through the diameter of the stone or a groove circumscribing the periphery of the stone. An attachment means is attached to the stone either by utilizing a hole or in an alternative embodiment, a groove. The France 855,584 patent provides for a groove on the surface of a float, not a weight as in the present invention. However the France 855,584 patent does not provide for attachment by means of a cylindrical hole extending through the diameter of the float. Consequently, the present invention provides an alternative means of attachment which the France 855,584 patent does not. As such the consumer is provided with a wider selection of fishing weights from which to choose from. In U.S. Pat. No. 5,054,227, titled, LOOSENER, by inventor Lin, a device which permits automatic release of a plummet or sinker is described. The Lin patent teaches a detachable plummet, and as such differs from the concept of the Lippincott invention in that the present invention is meant to securely hold the weight and is designed as such, not with detachability in mind. In order to comply with the objective of being detachable, the Lin patent does not teach a second nodule or loops. In U.S. Pat. No. 2,884,735, titled, LEADER WITH RELEASABLE SINKER, by inventor C. D. Ticer, a sinker having a flexible element whereby the sinker may be detachably and releasably connected thereto is described. The Ticer teaches a releasable sinker whereby a flexible loop is used to secure a weighted object within. The Ticer patent, utilizes a flexible loop relying strictly on means of elastic friction to secure any stone or other weighted object encircled within. Clearly, the present invention, containing a hole within the stone in addition to the nodules on the strand, utilizes a more secure means of attaching an elastic strand to a stone. During casting, the Ticer patent is likelier to result in dislodging of the stone or other weighted object encircled within, thereby resulting in serious injury to the fisherman or to passersby, caused by weighted objects acting as uncontrolled projectiles. However, the present invention incorporates a hole and nodule system as well as a loop and groove system, which represents a safety enhancement to the public and serves their best interests. U.S. Pat. No. 2,687,592, titled, CASTING APPARATUS, by inventor Purcell, teaches a casting apparatus whereby a rope is used to secure a stone within. The Purcell patent, utilizes a flexible loop relying strictly on means of elastic friction to secure a stone within. Clearly, the present invention, containing a hole within the stone in addition to the nodules on the strand, or containing an elastic band attached to a groove, utilizes a more secure means of attaching an elastic strand to a stone. During casting, the Purcell patent is likelier to result in dislodging of the stone encircled within, thereby resulting in serious injury to the fisherman or to passersby, caused by the stone acting as an uncontrolled projectile. However, the present invention incorporates a hole and nodule system as well as a loop and groove system, which represents a safety enhancement to the public and serves their best interests. U.S. Pat. No. 5,435,095, titled, AUTOMATICALLY DETACHABLE CASTING WEIGHT, by inventor, Crumrine, teaches a bored rigid split shot sinker. A split shot sinker has the disadvantage of attaching to the line directly and being difficult to remove once attached. Additionally, the stainless steel used to manufacture the sinkers, does not provide the environmental benefit which is provided by use of stones. Consequently, the present invention is more environmentally friendly, and thus more likely to be adopted for use by the public. U.S. Pat. No. 3,426,469 issued to Lee et al. in 1969, suggested a weight carrier for casting a fishing line with a stone, which carrier has an abutment and a water soluble element yieldingly urged against the abutment by a pin. The carrier and the pin form a loop which receives a line carrying a weight. Upon dissolution of the water soluble element, the line for the weight is released whereby the weight is released. The weight is detached from the fishhook or lure almost immediately after the fishhook or lure falls into the water, whereby the fishhook or lure can rise to the surface or adjacent thereto almost immediately after it falls into the water. Weight releasing means for a fish line as characterized above which is capable of utilizing scrap materials, such as nuts, bolt pieces of stone or concrete or the like, whereby the loss upon release of the weight is substantially insignificant. The patented invention differs from the present invention because it is simply a releasible means rather than an attachment means for a sinker as described and claimed in the present invention. In 1967 U.S. Pat. No. 3,346,986 issued to Tiikkainen for a weight retaining attachment for a fishing line comprising a plurality of relatively short flexible strands disposed to naturally form an enclosure when separate having integrally secured ends whereby a self removable weight is carried for casting a fishing line. The patented invention differs from the present invention because it is simply a cradling means to release a weight upon casting rather than an attachment means for a sinker as described and claimed in the present invention. Numerous innovations for fishing weights have been provided in the prior art that are adapted to be used. Even though these innovations may be suitable for the specific individual purposes to which they address, they would not be suitable for the purposes of the present invention as heretofore described. SUMMARY OF THE INVENTION This invention relates to a weight attachable to a fishing line. The weight comprises a weighted body which comprises a longitudinal hole therethrough or a circumferential groove there around or a longitudinal channel therein. A first elastomer, having at least one attachment means such as a loop, is disposed within the longitudinal hole. The loop functions to securely attach the weighted body to the fishing line. A second elastomer, having at least one attachment means such as a loop, is disposed within the circumferential groove. A third elastomer, having an elastomer groove, is disposed within the longitudinal channel. The elastomer groove functions to guide the fishing line and frictionally holed it therein. This invention relates to a weight attachable to a fishing line, comprising a flexible strand made of rubber or an elastomeric substance disposed in a slot or other equivalent retaining means formed in a natural stone of granite, quartzite, limestone, sandstone, shale or the like; the strand having at least one integrally appended loop or attaching means whereby a removable weight is carried for attachment to a fishing line for casting. The invention is an environmentally safe fishing weight made of naturally occurring stone and rubber or an elastomer. A pebble made of stone is adapted as a fishing weight by either a hole formed therein or a groove or slot circumscribed about the periphery of the pebble. Either the slot or the hole engages and retains a flexible band altered with knots tied at each end after the flexible band is stretchably extended in the slot and around the pebble. One of the knots forms a secondary loop which is used to attach the pebble to a fishing line. A primary object of the invention is to provide a fishing weight that is not capable of chemically contaminating natural water resources or poisoning wild life. A secondary object of the invention is to provide a fishing weight which can be manufactured in a very cost effective manner using easily available items such as rubber or elastomer bands and rocks. Another object of the invention is to provide a kit containing a variety of grooved and drilled stones and rubber or elastomer bands whereby the user can select the desired weight and incorporate it using the flexible bands and tools provided to insert a flexible band through a hole in the stone. BRIEF LIST OF REFERENCE NUMERALS UTILIZED IN THE DRAWING Common Components to All Embodiments 18--fishing line (18) First Elastomer 116--first elastomer (116) 116A--first elastomer top nodule (116A) 116B--first elastomer bottom nodule (116B) 116C--first elastomer middle (116C) 116D--first elastomer loop (116D) Second Elastomer 216--second elastomer (216) 216A--second elastomer top nodule (216A) 216B--second elastomer bottom nodule (216B) 216C--second elastomer middle (216C) 216DA--second elastomer top loop (216DA) 216DB--second elastomer bottom loop (216DB) Third Elastomer 316--third elastomer (316) 316A--third elastomer top nodule (316A) 316B--third elastomer band (316B) 316C--third elastomer loop (316C) Forth Elastomer 416--forth elastomer (416) 416A--forth elastomer top nodule (416A) 416B--forth elastomer bottom nodule (416B) 416C--forth elastomer band (416C) 416CA--forth elastomer top loop (416CA) 416CB--forth elastomer bottom loop (416CB) Fifth Elastomer 516--fifth elastomer (516) 516A--fifth elastomer top nodule (516A) 516B--fifth elastomer bottom nodule (516B) 516C--fifth elastomer band (516C) 516D--fifth elastomer groove (516D) Sixth Elastomer 616--sixth elastomer (616) 616A--sixth elastomer left side (616A) 616B--sixth elastomer right side (616B) 616C--sixth elastomer groove (616C) First Embodiment 110--first environmentally safe fishing weight (110) 112--first holed weight (112) 114--first hole (114) Second Embodiment 210--second environmentally safe fishing weight (210) 212--second grooved weight (212) 214--second groove (214) Third Embodiment 310--third environmentally safe fishing weight (310) 312--third holed weight (312) 314--third hole (314) Forth Embodiment 410--forth environmentally safe fishing weight (410) 412--forth grooved weight (412) 414--forth groove (414) Fifth Embodiment 510--fifth environmentally safe fishing weight (510) 512--fifth weight (512) 514--fifth channel (514) BRIEF DESCRIPTION OF THE DRAWING FIG. 1 is a side view of a first holed weight (112) exhibiting a first hole (114) bored therethrough. FIG. 2 is a side view of a first holed weight (112) exhibiting a first elastomer (116) contained within the first hole (114). FIG. 3 is a side view of a first holed weight (112) exhibiting a second elastomer (216) contained within the first hole (114). FIG. 4 is a side view of a second grooved weight (212) exhibiting a second groove (214). FIG. 5 is a side view of a second grooved weight (212) exhibiting a third elastomer (316) within the second groove (214). FIG. 6 is a side view of a second grooved weight (212) exhibiting a forth elastomer (416) within the second groove (214). FIG. 7 is a side view of a third holed weight (312) exhibiting a third hole (314) bored therethrough. FIG. 8 is a side view of a third holed weight (312) exhibiting a first elastomer (116) contained within the third hole (314). FIG. 9 is a side view of a third holed weight (312) exhibiting a second elastomer (216) contained within the third hole (314). FIG. 10 is a side view of a forth grooved weight (412) exhibiting a forth groove (414). FIG. 11 is a side view of a forth grooved weight (412) exhibiting a third elastomer (316) contained within the forth groove (414). FIG. 12 is a side view of a forth grooved weight (412) exhibiting a forth elastomer (416) contained within the forth groove (414). FIG. 13 is a side view of a first elastomer (116). FIG. 14 is a side view of a second elastomer (216). FIG. 15 is a front view of a third elastomer (316). FIG. 16 is a front view of a forth elastomer (416). FIG. 17 is a side view of a fifth elastomer (516). FIG. 17A is a front view of a fifth elastomer (516). FIG. 18 is a side view of a second grooved weight (212), attached to a fishing line (18), having a fifth elastomer (516) contained within the second groove (214). FIG. 18A is a front view of a second grooved weight (212), attached to a fishing line (18), having a fifth elastomer (516) contained within the second groove (214). FIG. 19 is a side view of a fifth weight (512), attached to a fishing line (18), having a sixth elastomer (616) contained within the fifth channel (514). FIG. 19A is a top view of a fifth weight (512), attached to a fishing line (18), having a sixth elastomer (616) contained within the fifth channel (514). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Firstly, referring to FIG. 1 which is a side view of a first holed weight (112) exhibiting a first hole (114) bored therethrough, FIG. 2 which is a side view of a first holed weight (112) exhibiting a first elastomer (116) contained within the first hole (114), FIG. 3 which is a side view of a first holed weight (112) exhibiting a second elastomer (216) contained within the first hole (114), FIG. 13 which is a side view of a first elastomer (116), and FIG. 14 which is side view of a second elastomer (216). The first elastomer (116) comprises a first elastomer top nodule (116A) connected to a first elastomer bottom nodule (116B) having a first elastomer middle (116C) therebetween. A first elastomer loop (116D) which functions as a fishing line (18) attachment means is securely fastened to the first elastomer top nodule (116A). The first elastomer top nodule (116A) and the first elastomer bottom nodule (116B) function to prevent accidental release of the weight from the first elastomer (116). The second elastomer (216) comprises a second elastomer top nodule (216A) connected to a second elastomer bottom nodule (216B) having a second elastomer middle (216C) therebetween. A second elastomer top loop (216DA), which functions as a fishing line (18) attachment means, is securely attached to the second elastomer top nodule (216A) and a second elastomer bottom loop (216DB), which functions as a fishing line (18) attachment means, is securely attached to the second elastomer bottom nodule (216B). The second elastomer top nodule (216A) and the second elastomer bottom loop (216DB) function to prevent accidental release of the weight from the second elastomer (216). Referring to FIG. 4 which is a side view of a second grooved weight (212) exhibiting a second groove (214), FIG. 5 which is a side view of a second grooved weight (212) exhibiting a third elastomer (316) within the second groove (214), FIG. 6 which is a side view of a second grooved weight (212) exhibiting a forth elastomer (416) within the second groove (214), FIG. 15 which is a front view of a third elastomer (316), and FIG. 16 which is a front view of a forth elastomer (416). The third elastomer (316) comprises a third elastomer top nodule (316A) having a third elastomer band (316B) attached thereto. A third elastomer loop (316C), which functions as a fishing line (18) attachment means, is securely fastened to the third elastomer top nodule (316A). The third elastomer band (316B) is complimentary in shape to the second groove (214) having a slightly lesser diameter than the diameter of the second grooved weight (212) which functions to secure holding means. The forth elastomer (416) comprises a forth elastomer top nodule (416A) connected to a forth elastomer bottom nodule (416B) by a pair of forth elastomer bands (416C). A forth elastomer top loop (416CA), which functions as a fishing line (18) attachment means, is securely connected to the forth elastomer top nodule (416A) and a forth elastomer bottom loop (416CB), which functions as a fishing line (18) attachment means, is securely connected to a forth elastomer bottom nodule (416B). The forth elastomer bands (416C) are complimentary in shape to the second groove (214) having a slightly lesser diameter than the diameter of the second grooved weight (212) which functions to secure holding means. Now referring to FIG. 7 which is a side view of a third holed weight (312) exhibiting a third hole (314) bored therethrough, FIG. 8 which is a side view of a third holed weight (312) exhibiting a first elastomer (116) contained within the third hole (314), and FIG. 9 which is a side view of a third holed weight (312) exhibiting a second elastomer (216) contained within the third hole (314). The shape of the third holed weight (312) is double tapered cylindrical which functions to lessen aerodynamic drag when casting. The third elastomer (316) comprises a third elastomer top nodule (316A) having a third elastomer band (316B) attached thereto. A third elastomer loop (316C), which functions as a fishing line (18) attachment means, is securely fastened to the third elastomer top nodule (316A). The third elastomer band (316B) is complimentary in shape to the second groove (214) having a slightly lesser diameter than the diameter of the second grooved weight (212) which functions to secure holding means. Referring to FIG. 10 which is a side view of a forth grooved weight (412) exhibiting a forth groove (414), FIG. 11 which is a side view of a forth grooved weight (412) exhibiting a third elastomer (316) contained within the forth groove (414), and FIG. 12 which is a side view of a forth grooved weight (412) exhibiting a forth elastomer (416) contained within the forth groove (414). The forth elastomer (416) comprises a forth elastomer top nodule (416A) connected to a forth elastomer bottom nodule (416B) by a pair of forth elastomer bands (416C). A forth elastomer top loop (416CA), which functions as a fishing line (18) attachment means, is securely connected to the forth elastomer top nodule (416A) and a forth elastomer bottom loop (416CB), which functions as a fishing line (18) attachment means, is securely connected to a forth elastomer bottom nodule (416B). The forth elastomer bands (416C) are complimentary in shape to the forth groove (414) having a slightly lesser diameter than the diameter of the forth grooved weight (412) which functions to secure holding means. Referring to FIG. 17 which is a side view of a fifth elastomer (516), FIG. 17A which is a front view of a fifth elastomer (516), FIG. 18 which is a side view of a second grooved weight (212), attached to a fishing line (18), having a fifth elastomer (516) contained within the second groove (214), and FIG. 18A which is a front view of a second grooved weight (212), attached to a fishing line (18), having a fifth elastomer (516) contained within the second groove (214). The fifth elastomer (516), having a circumferential fifth elastomer groove (516D) which functions as a fishing line holding means (18), comprises a fifth elastomer top nodule (516A) connected to a fifth elastomer bottom nodule (516B) by a pair of fifth elastomer bands (516C). The fifth elastomer bands (516C) are complimentary in shape to the second groove (214) having a slightly lesser diameter than the diameter of the second grooved weight (212) which functions to secure holding means. Lastly, referring to FIG. 19 which is a side view of a fifth weight (512), attached to a fishing line (18), having a sixth elastomer (616) contained within the fifth channel (514) and FIG. 19A which is a top view of a fifth weight (512), attached to a fishing line (18), having a sixth elastomer (616) contained within the fifth channel (514). The sixth elastomer (616) comprises a sixth elastomer left side (616A) connected to a sixth elastomer right side (616B) forming a sixth elastomer groove (616C) therebetween. The sixth elastomer groove (616C) functions to frictionally hold the fishing line (18). The elastomers (116, 216, 316, 416, 516, 616) are manufactured from a stretchable material selected from a group consisting of rubber, rubber composite, plastic and plastic composite. The weights (112, 212, 312, 412, 512) are manufactured from a material selected from a group consisting of stone, concrete, metal, metal alloy, rubber, and rubber composite. It will be understood that each of the elements described above, or two or more together, may also find a useful application in other types of constructions differing from the type described above. While the invention has been illustrated and described as embodied in an environmentally-safe slotted weighting attachment for a fishing line, it is not intended to be limited to the details shown, since it will be understood that various omissions, modifications, substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing in any way from the spirit of the present invention. Without further analysis, the foregoing will so fully reveal the gist of the present invention that others can, by applying current knowledge, readily adapt it for various applications without omitting features that, from the standpoint of prior art, fairly constitute essential characteristics of the generic or specific aspects of this invention. What is claimed as new and desired to be protected by Letters Patent is set forth in the appended claims. SUMMARY: [/INST] A fishing line weight comprising a natural weight and an elastomer, all of which are devoid of any environmentally harmful substances such as lead. In one embodiment, the weight has a hole through its body which serves to hold the elastomer which after passing through the hole is fixed to the weight by nodules at each end upon which loops are attached to the fishing line. In an alternative embodiment, a groove is circumscribed around the weight with an elastomeric band placed within the groove. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Mario Stojka has been jailed for 3 years for a violent street robbery of a 78-year-old woman in Bradford and had similar previous convictions in Slovakia. A violent robber who mugged an elderly woman in the street and tried to tear off her jewellery had been allowed into Britain despite a string of previous convictions in his native Slovakia. Mario Stojka, 30, tried to rip off Jean Crowther's watch and rings before he snatched £200 in cash from her handbag as the 78-year-old desperately tried to defend herself with her walking stick in Bradford, west Yorkshire. The pensioner is now too scared to go out alone to do her weekly shop or go to bingo with friends. Stojka, who has been cautioned twice for shoplifting since he came to the UK, has also served time in prison in Slovakia for theft, credit fraud and dangerous and threatening behaviour, Bradford Crown Court heard. MPs have called for the Slovakian to be deported and for people coming to the UK to have criminal record checks, which does not currently happen as a matter of course on people coming to the UK from the EU. Stojka admitted robbing the pensioner on February 4 and was jailed for three years and four months. The court heard that on this day Mrs Crowther was waiting for a taxi home after her latest weekly shopping trip. Stojka, who is known to have personality issues, was wearing make-up and a headscarf at the time and approached the pensioner and complimented her. He then grabbed the cross and chain round her neck and tried to rip off her rings and watch before snatching the money she had just withdrawn. Charlotte Eastwood, prosecuting, said: 'He asked if she was okay and if she needed help. 'He complimented her on her scarf and then tried to tug off her jewellery. She was fighting back by pushing him with her walking stick but it had no effect.' The attack was witnessed by passers-by Safdar Yousaf and Mushtak Ahmed, who retrieved Mrs Crowther's money and gave chase - but Stojka got away. They were commended by Judge Neil Davey QC for their efforts. In her victim impact statement, Mrs Crowther, now 79, said she was too afraid to make her weekly shopping trip to the centre of Bradford and her trips out to bingo were a struggle. She was nervous at home, had difficulty sleeping and feared that any noise in the night was Stojka 'coming to get her.' The court heard that Stojka had'matters outstanding' against him in Slovakia but no direction was made to deport him by the judge. After the case, MP George Galloway, whose constituency includes Bradford city centre, called for Stojka to be deported when he serves his sentence. Bradford Crown Court heard that Stojka had a string of previous convictions for similar crimes in Slovakia. 'It is entirely wrong that such criminals should be allowed to stay in Britain and efforts should be made to check the criminal records of people wanting to come to the UK,' he said. Under current Home Office rules people coming into the UK are checked against security, police and immigration 'watch lists.' Responsibility for adding serious crimes to watch lists lies with the country where they are committed. Philip Davies, Conservative MP for Shipley said the case was another reason why he felt Britain should leave the EU. He said: 'He is clearly a despicable piece of work. He should be kicked straight out of the country when he comes out of prison. 'This is the problem of being in the EU. The free movement of people opens the door to criminals. This man is one of many.' Detective Inspector Richard Partis, from West Yorkshire Police, said: 'Stojka pretended to show concern for his vulnerable victim, before attempting to rob her of her possessions. 'We would like to thank the members of the public who intervened and brought this to the attention of our officers. 'Violent crimes such as robbery will not be tolerated in Bradford District and police will look to take the strongest action possible against offenders.' SUMMARY: [/INST] Mario Stojka mugged 78-year-old woman in street in Bradford, Yorkshire. He complimented her before trying to tear off jewellery and taking £200. Jean Crowther tried to fight off 30-year-old Stojka with her walking stick. Members of public helped and got her money but Stojka fled the scene. He admitted robbery and was jailed for three years and four months. Stojka has previous convictions for theft and fraud in his native Slovakia. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: MCALLEN, Texas — Federal authorities have awarded a $145 million contract to a Texas company to build 6 miles of wall along the U.S.-Mexico border in the Rio Grande Valley. U.S. Customs and Border Patrol said Friday that SLSCO will begin construction of an 18-foot reinforced concrete levee wall in February in the agency's McAllen Station region. The company will also increase the height of existing fences. It will be the first section of President Trump's border barriers in the Rio Grande Valley, the busiest corridor for illegal crossings. The government recently completed construction of a 2-mile, 30-foot tall section of fencing along the border in California. Mr. Trump has been ramping up anti-immigration rhetoric heading into Tuesday's midterm elections and has ordered troops to the border to meet a caravan of Central American migrants slowly traveling through Mexico. Secretary of State Mike Pompeo defended Mr. Trump's plan to send troops to the southern border, dismissing criticism that the move is motivated by politics ahead of the midterm elections. "We've made clear to them they need to undertake every effort they can to stop this illegal migration from entering the United States, and the president's made very clear they will not be permitted to enter our country unlawfully," Pompeo said on "Face the Nation" Sunday. He disputed that Mr. Trump's emphasis on hardening his immigration policies in recent weeks was aimed at rallying his base. "I've been involved in scores of conversations about stopping illegal immigration from Mexico and never once has there been a discussion of the political impact in U.S. domestic politics," Pompeo said. "It has always been about securing the safety of the American people and securing our southern border." A Texas company has been granted a $145 million federal contract to build six miles of wall along the U.S.-Mexico border in the Rio Grande Valley. Galveston-based SLSCO will start construction of an 18-foot, reinforced concrete levee wall in February, the U.S. Customs and Border Patrol said. The project, which will take place in the agency's McAllen Station region, will also raise the height of existing fences. The wall will be the first section of President Donald Trump's border barriers in the Rio Grande Valley, which is the busiest corridor for illegal crossings. SUMMARY: [/INST] A Texas company has become the recipient of a US-Mexico border wall contract as federal authorities fulfill President Trump's first and most contentious campaign promise. Per CBS News, US Customs and Border Protection said Friday that the $145 million contract was awarded to Galveston-headquartered construction company SLSCO. The wall will be built of reinforced concrete and reportedly stand at 18 feet tall and span six miles of border in the Rio Grande Valley. The wall will be the first built under Trump in the Rio Grande Valley, a hot spot for illegal border crossings. According to the Dallas News, SLSCO will begin construction in February. A similar project was previously undertaken at California's border with Mexico, where two miles of 30-foot-high fencing were recently completed. SLSCO will reportedly also add to existing fencing as part of its contract. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The search began when an anxious Englishman named John White waded ashore on North Carolina’s Roanoke Island 425 years ago this month. Appointed governor of the fledgling Roanoke colony by Sir Walter Raleigh, White was returning from England with desperately needed supplies. View Images NG MAPS But when he stepped ashore on August 18, 1590, he found the settlement looted and abandoned. The vanished colonists had left behind only two clues to their whereabouts: the word “Croatoan” carved on a prominent post and “Cro” etched into a tree. Ever since, explorers, historians, archaeologists, and enthusiasts have sought to discover the fate of the 115 men, women, and children who were part of England’s first attempt to settle the New World. Efforts to solve America’s longest running historical mystery, dubbed the Lost Colony, produced dozens of theories but no clear answers. Now two independent teams say they have archaeological remains that suggest at least some of the abandoned colonists may have survived, possibly splitting into two camps that made their homes with Native Americans. Pull Quote The evidence is that they assimilated with the Native Americans but kept their goods. Mark Horton, archaeologist A collection of newly discovered European objects, including a sword hilt, broken English bowls, and a fragment of a slate writing tablet still inscribed with a letter, could point to the presence of the colonists on Hatteras Island, some 50 miles (80 kilometers) southeast of their settlement on Roanoke Island, as well as at a site on the mainland 50 miles to the northwest. “The evidence is that they assimilated with the Native Americans but kept their goods,” says Mark Horton, an archaeologist at Britain’s Bristol University, who heads the excavation on Hatteras. Meanwhile, at the mainland site on the Albemarle Sound near Edenton, N.C., Nick Luccketti of the First Colony Foundation believes that his group has unearthed pottery used by the lost colonists after they deserted their Roanoke settlement. Members of both teams admit they can’t yet claim to have solved the vexing riddle. And many of their colleagues are skeptical that the artifacts can be definitively tied to the ill-fated colonists, given difficulties in dating them precisely. “You have more work to do,” warned Ivor Noel Hume, a former Colonial Williamsburg archaeologist who excavated at Roanoke Island in the 1990s. Hume met with Horton and Luccketti last month to discuss their finds. View Images Governor John White’s 1585 map of the area from today’s Cape Henry, Virginia, to Cape Lookout, North Carolina, was remarkably accurate. In 2012 researchers discovered a symbol hidden beneath a patch that may have marked the location of a fort. © The Trustees of the British Museum But the digs signal an important shift away from Roanoke Island, where researchers have found frustratingly few signs of an early European presence. A Gentleman’s Ring “Hey, a chunk of iron!” exclaims Margaret Dawson, a nurse and volunteer excavator, as she sorts through black earth at a site on Hatteras Island called Cape Creek. She and her husband Scott, a local teacher, founded the Croatoan Archaeological Society —named after the island’s native inhabitants—in 2009 and have sponsored Horton’s annual digs ever since. Hidden in a live oak forest close to Pamlico Sound, Cape Creek was the site of a major Croatoan town and trade hub. Under Horton’s supervision, volunteers are busy searching through fine-mesh screens filled with mud from a nearby trench. The Dawson’s two young daughters are quick to spot tiny Venetian glass beads. During a two-day excavation in July, the sieves produced ample Native American as well as European materials, including deer and turtle bones, homemade and imported brick, Native American pottery, hunks of European iron, parts of a 16th century gun, and a tiny copper eyelet that may have been used in clothing. In 1998, archaeologists from East Carolina University found a ten-carat gold signet ring here engraved with a prancing lion or horse, an unprecedented find in early British America. The well-worn object may date to the 16th century and was almost certainly owned by an English nobleman. Like most of the European finds at Cape Creek, however, the artifact was mixed in with objects that date to the mid-17th century, a full lifetime after the Roanoke colony was abandoned. Horton argues that members of the lost colony living among the Croatoan may have kept their few heirlooms even as they slowly adopted Indian ways. View Images A gold signet ring excavated from the Cape Creek site on Hatteras Island, engraved with a prancing lion or horse, may have belonged to a prominent member of the Roanoke colony. Photograph by Mark Thiessen, National Geographic One of the most unusual recent discoveries is a small piece of slate that was used as a writing tablet, along with a lead pencil. A tiny letter “M” can just be made out on one corner. A similar, though much larger, slate was found at Jamestown. “This was owned by somebody who could read or write,” Horton says. “This wasn’t useful for trade, but was owned by an educated European.” Another artifact unearthed recently at Cape Creek is part of the hilt of a rapier, a light sword of a type used in England in the late 16th century. In addition, a large copper ingot, a long iron bar, and German stoneware show up in what appear to be late 16th century levels. These may be signs of metallurgical work by Europeans—and possibly by Roanoke settlers—since Native Americans lacked this technology. “There are trade items here,” Horton says, gesturing at the artifacts. “But there is also material that doesn’t come from trade.” Were these the personal possessions of the colonists? Does X Mark the Spot? If the gold ring inspired Horton’s digs on Hatteras, then a 1585 watercolor map drawn by White prompted the First Colony Foundation to turn its attention to the mainland. Known as La Virginea Pars map and part of the British Museum’s permanent collection, the document made headlines in 2012 when researchers discovered a tiny, four-pointed star hidden under a patch layered atop the map. One theory is that the symbol may have marked the location of an inland fort. Pull Quote “We think this represents the Roanoke colonists,” says Luccketti, holding out two slivers of green pottery. If such a fort was built in that location, or even planned or discussed, then it might have been a logical destination for at least some of the displaced colonists. “We think this represents the Roanoke colonists,” says Luccketti, holding out two slivers of green pottery. The shards were found on a recent weekend excavation at what the First Colony Foundation calls Site X, on the Albemarle Sound. View Images Pieces of English pottery called Border Ware recently found at a site near Edenton, North Carolina, may shed light on the Lost Colony's fate. The dig by the First Colony Foundation led by archaeologist Nick Luccketti follows new revelations from the 1585 White map. Photograph by Mark Thiessen, National Geographic In 2006, Luccketti and his colleague Clay Swindell from the Museum of the Albemarle investigated a site in the vicinity of the fort icon spotted later on White’s map. There they found a massive quantity of Indian pottery. Archaeologists suspect the site is a small Native American town named Mettaquem. More recently, in an area adjacent to the village, the First Colony team uncovered English pottery similar to that dug up on Roanoke Island and common at Jamestown—but not typical in the second half of the 17th century, when English settlers filtered south from Virginia to settle North Carolina. Other pottery typical of the later 17th century is absent. Excavators also found a metal hook possibly used to stretch hides or tents, as well as an aglet, a tiny copper tube used to secure wool fibers. Aglets were largely replaced with hook and eyes in the first half of the 17th century. They’ve shown up on Roanoke Island and at Cape Creek as well. In all the team has found 275 pounds (125 kilograms) of Indian pottery covering several centuries of settlement, Swindell says. The English material—called Border Ware —accounts for a few dozen pieces amount to three or four pots. He notes that the first recorded English settler in the area did not arrive until about 1655. Luccketti adds that, unlike the Cape Creek site, there are no obvious trade goods that suggest exchange instead of resident colonists. He thinks that the colonists may have moved here to live among Indian allies after White’s departure. View Images Archaeologist Mark Horton oversaw a recent dig at the Cape Creek site on Hatteras Island. He argues that many of the European artifacts discovered here may be associated with the lost colonists. Photograph by Mark Thiessen, National Geographic But Brett Riggs, an archaeologist at the University of North Carolina at Chapel Hill not involved with the dig, notes that Native Americans were quick to scavenge any material left by Europeans. “Anything of utility they took back to their homes,” he says. “They would vacuum it all up.” Even bottle glass was valuable for shaping arrowheads. He warns that European goods don’t equate to European settlers. Foundation volunteers admit they have not clinched their case. “What we’ve found is tantalizing,” says Martha Williams, as she pauses from her work sifting soil on a recent morning at Site X. “I would love to see some definitive evidence, but what we have is fragmentary.” Pull Quote We still don’t know what happened, and we are waiting to be persuaded. Charles Ewen, archaeologist, East Carolina University Dating material within a few decades to distinguish lost colonists from later settlers is difficult. Radiocarbon and other dating methods are not precise enough, and pottery styles don’t change uniformly over time and space. For example, remains of a Border Ware pot found across the river in Edenton date to the late 17th century. “I couldn’t date artifacts between 1590 and 1630,” says Hume, a respected expert in colonial material. “Did someone keep something for six weeks or six years? It is very hard to know.” Amid the new finds and trenches yet to be dug, archaeologists say they are hopeful new clues may yet crack the case of the missing colonists. “There is still a lot of dirt to move,” says Swindell. And none of the groups have yet published detailed scholarly articles analyzing and cataloguing their discoveries. “We still don’t know what happened, and we are waiting to be persuaded,” says Charles Ewen, an archaeologist at East Carolina University who is not part of either team. “I don’t think anything is off the table.” View Images Roanoke Colony was found abandoned without a trace of the colonists—but some researchers might have uncovered some clues. Illustration by North Wind Picture Archives/Alamy It's a mystery that has intrigued Americans for centuries: What happened to the lost colonists of North Carolina's Roanoke Island? (See "America's Lost Colony.") The settlers, who arrived in 1587, disappeared in 1590, leaving behind only two clues: the words "Croatoan" carved into a fort's gatepost and "Cro" etched into a tree. Theories about the disappearance have ranged from an annihilating disease to a violent rampage by local Native American tribes. Previous digs have turned up some information and artifacts from the original colonists but very little about what happened to them. Until now. View Images MAGGIE SMITH, NG STAFF. SOURCE: FIRST COLONY FOUNDATION Illustration by North Wind Picture Archives/Alamy Thanks to technological advances and a cover-up on a map, researchers are getting closer to finding out what happened to the lost colony of Roanoke Island. What Do We Know? The lost colonists were the third group of English arrivals on North Carolina’s Roanoke Island, settling near the modern-day town of Manteo. The first group to arrive, in 1584, came to explore and map the land for future groups. A second group, which arrived in 1585, was charged with a military and scientific mission. But this second group's trip was far from peaceful. "That's where tensions begin [with the local Native American tribes]," said Clay Swindell of the Museum of the Albemarle in Elizabeth City, North Carolina, a member of the archaeology team investigating the colony. He says that this second group was driven out in 1586 by local tribes angry that the colonists were taking up good land and resources. The third group arrived in 1587. Entire families came with children—17 women and 11 children accompanied a party of 90 men. That meant the group wanted to settle in the New World and was not a military excursion, which would have included only male explorers. A Map With Secrets A clue uncovered in a long-forgotten, centuries-old map of the area called "La Virginea Pars"—drawn by the colony's governor John White—kicked off a reexamination of the fate of the lost colonists. An artist and employee of explorer Sir Walter Raleigh, White was later appointed governor of the new lands; he was also the grandfather of Virginia Dare, the first English child born in the New World. A clue uncovered in a long-forgotten map kicked off a reexamination of the fate of the lost colonists. Two patches on the map made Brent Lane of the First Colony Foundation (the group behind the latest archaeological trip and whose work is supported by National Geographic and the Waitt Grants Programs) in Durham, North Carolina, wonder if they might hide something beneath. Scientists at the British Museum looked into the patches and discovered a tiny red-and-blue symbol. Could it have indicated a fort or a secret emergency location? "Our best idea is that parts of Raleigh's exploration in North America were a state secret, and the map 'cover-up' was an effort to keep information from the public and from foreign agents," said Eric Klingelhofer of Mercer University in Macon, Georgia, a historian and the principal investigator on the project. Disappearing Act Most researchers think the colonists likely encountered disease—caused by New World microbes their bodies had never encountered before—or violence. The research team thinks that when the crisis—whatever that may have been—hit, the colonists split up into smaller groups and dispersed. No single Indian tribe or village could have supported them. They would be even larger than some villages. Eric Klingelhofer historian and principal investigator at Mercer University "It's a good strategy," he said, explaining that the previous group from 1585 had been ordered to do so if disaster struck. "We don't definitely know that they do, but it's obvious that that's the only way they could have survived. No single Indian tribe or village could have supported them. They would be even larger than some villages—I mean, they were over a hundred people." The prevailing theory has been that the colonists abandoned Roanoke and traveled 50 miles south to Hatteras Island, which was then known as Croatoan Island. But, Klingelhofer said, what if they went in another direction? What if some of the colonists traveled west via Albemarle Sound to the mouth of the Chowan River, to a protected inlet occupied by a sympathetic tribe? (See "What 'Sleepy Hollow' Didn't Tell Us About Roanoke's Lost Colony.") Furthermore, archaeologists have identified the nearby site of a small Native American town named Mettaquem, which may have adopted some of the colonists. Klingelhofer said that while researchers don't know much about the Native American town and its inhabitants, its existence has been verified. "It's a very strategic place, right at the end of Albemarle Sound," he said. "You can go north up the Chowan River to Virginia or west to the Blue Ridge Mountains. They were big trading partners" with other Native American tribes. After the map's secret was revealed, Klingelhofer, along with the First Colony Foundation, which studies the first attempts at colonization in the New World, proposed a return trip to the area, with a twist. This time, shovels would have 21st-century helpers—magnetometers and ground-penetrating radar (GPR). Using Modern Technology Malcolm LeCompte, a research associate at Elizabeth City State University in North Carolina, was responsible for the addition of GPR in the archaeological search for what happened to the lost colonists of Roanoke. The process began earlier this year with a satellite survey of the site. "What we do is we get the oldest maps we can find—so we can get a historic sense of what was there and what's there now—and orient them," LeCompte said. The point is to compare "what may have been there in the past to what is there now." Researchers look for similarities between the old maps and the current geography of the area. Once they identify where the spots on the map correspond with today's landscape, a painstaking process of laying out a grid and systematically searching it with their GPR ensues. The technology emits radio waves into the ground and measures the echo as the signal bounces off of various things buried underground. Essentially, it measures the depth that signals travel before hitting something that causes a measurable bounce back. In other words, signals potentially indicate a hidden object underground. Metal objects—like the iron cannons that have been found at the site—act like "giant antennas." Graves and coffins are also detectable, because they contain voids with different densities and poorer conductive properties than the surrounding soil. LeCompte and his colleagues found a previously undetected pattern that may indicate the presence of one or more structures, possibly made of wood, under about three feet (a meter) of soil. "I don't know if it's one or a group [of structures]," he said, adding that they "could be joined or they could be close together." Perhaps the wood of the structures collapsed over time, leaving impressions in the surrounding soil, LeCompte speculated. The Museum of the Albemarle's Swindell suggested the use of a proton magnetometer to enable the researchers to double-check their GPR findings. Much more sensitive than a metal detector, the device can spot objects buried about 13 feet (four meters) underground. The device measures distortions of the Earth's magnetic field due to the presence of various objects buried underground. "We're looking for anything that affects the local magnetic field," Swindell stressed. "That could be things like burn pits." Swindell, for his part, thinks there may also be remains of a palisades that would have been used by farmers to keep wild animals away from crops. The presence of the buried structure and the fence strongly indicate that there was some sort of colonial presence in the area. What complicates the story further is the presence of later colonial sites in the area through the 1700s. Unfortunately, neither piece of technology has shed light on the role of Native American populations in the area. That's a puzzle that remains to be solved. It's Complicated In the days of the Roanoke Colony, relations with the local Native Americans were mixed. Roanoke was geographically located in the crux of sociopolitical friction between the Secotan—who held sway over Roanoke—and the Chowanoke, who controlled the nearby waterways. Tensions were especially high between the colonists and the Secotan tribe. "There is no doubt that there was a lot of hostility," Klingelhofer said. "Not all the tribes were hostile, but some of them were hostile. They felt imposed upon. There was fighting between [the groups]"—both among the tribes, and between some of the native peoples and the English settlers. The area does seem to hold clues to contact between local tribes and European colonists in the 16th and 17th centuries. It didn't help that the English attempted to explore the area multiple times. The group that arrived prior to the lost colonists were driven back to England, which meant when the ill-fated third group of colonists showed up, some sour feelings remained. "It would not surprise me that the Secotan would want to be done and get rid of the English," Swindell said. Whether groups of Secotan banded together to rid themselves of what they saw as interlopers is anyone's guess, he said. The area does seem to hold clues to contact between local tribes and European colonists in the 16th and 17th centuries. The next step in solving this age-old American mystery? "We have to go in and dig some holes, I guess," Swindell said. SUMMARY: [/INST] The mystery of Roanoke Island may be one for the books. Two archaeological teams have dug up new evidence pointing to the fate of English colonists who mysteriously vanished from the North Carolina island 425 years ago, National Geographic reports. One collection of items appears to support the long-held theory that some colonists moved to Hatteras Island, about 50 miles southeast of Roanoke. "The evidence is that they assimilated with the Native Americans but kept their goods," says chief archaeologist Mark Horton. Among the Hatteras Island finds: a small bit of a slate writing tablet marked by the letter "M," a rapier hilt likely dating to the late 16th century, and pieces of iron, ingot, and stoneware apparently dating to the same period. What's more, the name of a native American settlement on Hatteras Island- "Croatoan"-was found etched into a post in 1590 when all the colonists had vanished. For the second find, archaeologists used a map drawn by colony governor John White in 1585. The map includes an "X" obscured by a patch and may have been a "'cover-up'... to keep information from the public and from foreign agents," a historian told National Geographic two years ago. The "X" marked a site on Albemarle Sound, an estuary in North Carolina, where archaeologists recently discovered dozens of pottery pieces that resemble others found on Roanoke Island. So is this finally proof? Not really, because it's hard to date items precisely or know how they got there. "What we've found is tantalizing," a volunteer says. "I would love to see some definitive evidence, but what we have is fragmentary." </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: From an Italian prince and a Spanish gigolo to a Russian billionaire and a priest at the Vatican, Bambi Smyth has certainly 'dated' her fair share of interesting men. In fact, the 55-year-old from Melbourne spent three months going on 75 blind dates in 22 countries - and it was all in a mission to find 'The One'. Ms Smyth's jam-packed itinerary led her to dine with some 'extraordinary and interesting' men, which she then tried to match with a dish unique to their culture. Scroll down for video. Bambi Smyth spent three months going on 75 blind dates in 22 countries - and it was all in a mission to find 'The One. 'It was a cross between speed dating and a smorgasbord,' she told Daily Mail Australia. 'I was trying to get to know as many (men) as I could, but sometimes I only had one day in a country and I was meeting with two or three men.' 'It was hard work, but exciting too.' Of her 75 dates, an Italian Stallion named Stefano topped Ms Smyth's list. 'Stefano was one of the most extraordinary men I've met. He's a naval architect and he was charm on steroids,' she said. 'He was the most interesting man, generous of nature, highly intelligent and very warm. 'To say I fell head over heels for him is an understatement.' Bambi, who was 47 at the time, travelled to 22 different countries, including the Arab United Emirates to dine with various men. But, like several of the men Ms Smyth met on her travels, Stefano was married. Ms Smyth decided to combine her search for love with gaining an insight into the cultural differences involved in dating and she chronicled her adventures for her new book, Men On The Menu. Before leaving Melbourne, Ms Smyth emailed everyone she knew telling them she was writing a book about food and men and needed a 'date' in various countries. She said they should be 'preferably single' and aged roughly between 25 to 55. In a matter of two weeks she had a list of blind dates across the world. But not all were what she expected. 'There was a fellow in Hungary who was kind enough to cook dinner for me in his small apartment,' she said. 'He was chopping up chicken fillets in the kitchen... and he suddenly turns to me and says if I had another career I'd probably be a good serial killer because I like chopping and I'm very neat. 'Needless to say I was gripping my chair in this seventh floor apartment in god knows where.' Ms Smyth, pictured here with one of her Scottish dates Lorne, tried to match with a dish unique to their culture to the man she was dining with. Ms Smyth said her trip was filled with positive and negative dates, but she had no regrets. She also met a gigolo in Monaco. 'Well I'm 99 percent sure he was a gigolo. I was having a drink with a friend and he gestured for us to come over. He was asking how many stars our hotel had, obviously trying to work out how much money I had. 'I didn't fall for it, in case you're wondering.' In Germany, a man who took Ms Smyth to lunch thought it would be funny to feed her cheese that had less than desirable side effects. '(The cheese) was called The Musician... when I asked why and he "You'll see",' she said. 'I farted for three full days and by the end of it I could sound out the whole Oom Pah Pah. He was just watching me (eat) with a little smile on his face!' While her favourite date was in Italy with a man named Stefano, some dates left Ms Smyth with a sour taste in her mouth. Ms Smyth, who after 75 dates ended up meeting a man named Greg when she returned to Australia, said she opened up during the experience and learned a few things about herself. While her time in Italy with Stefano was the stuff dreams are made of, some dates left Ms Smyth with a sour taste in her mouth. 'In England, I was hoping for something interesting. My cousin had set me up with her ex-boyfriend Ben. But it was horrible. I think he told me I was stupid 37 times. I had to sit there while he was tearing me to shreds,' she said. 'Paulo was my very first date overseas in Brazil. He was a very weird person. He obviously didn't think I left a big enough tip so leant across and took more money out of my wallet. But then he sang to me… he tried to seduce me!' But Ms Smyth said she had no regrets during her whirlwind trip. Ms Smyth, who was the first Westerner Naoki from Japan had met, emailed basically everyone she knew telling them she was writing a book about food and men and needed a 'date' in various countries. She said she opened up during the experience of meeting random men, like Lorne from Scotland, and learned a few things about herself along the way. 'They were all interesting and worth recording. They all added some to the smorgasbord, even though some gave me indigestion,' she said. Ms Smyth, who after 75 dates ended up meeting a man named Greg when she returned to Australia, said she opened up during the experience and learned a few things about herself. 'I became less judgemental and became open to different possibilities. I went over lacking confidence but I ended up feeling good about myself,' she said. 'I've learned to give people an opportunity to show your true side... you definitely can't judge a book by its cover and you can't judge a man by his wallet.' Men on the Menu (The Five Mile Press, $32.95) is available 1 October at good book stores and online at www.fivemile.com.au. Bambi Smyth chronicled her adventures for her new book, Men On The Menu, released on October 2 SUMMARY: [/INST] Bambi Smyth spent three months travelling across the world to date men. The 55-year-old from Melbourne gave her friends a list of countries and asked them to set her up on dates, preferably with'single men' She wanted to learn about cultural differences of dating in her search to find 'The One' Bambi tried to match each of her 75 dates with a food specific to their culture so she could write a memoir on food, travel and men. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Leon Watson. Tormented: Helen Cowan, 26, fell victim to John Robertson, 45, when she was just eight years old. A woman has told how a secret letter she penned to an agony aunt revealing her uncle had sexually abused her helped to jail him. Helen Cowan, 26, fell victim to John Robertson, 45, when she was just seven years old. The abuse took place at her grandmother's farmhouse during holidays in Kilmacolm, Renfrewshire. Miss Cowan, of Edinburgh, wrote a letter begging for help and detailing her years of abuse to More magazine when she was 14. She wrote: 'For the last seven years John Robertson has sexually abused me. I am ashamed and embarrassed. Can you help me?' The note was never sent and lay hidden in her bedroom until her anxious parents discovered it. They contacted the police and Miss Cowan was interviewed about the allegations but no charges were brought against Robertson, her mother's brother. But after other victims came forward in 2011 police spoke to Miss Cowan again and her evidence has now helped jail her abuser. Miss Cowan, who has waived her legal right to anonymity, has told of her relief after her attacker was jailed for 12 years at the High Court in Glasgow this month. She said: 'I had a great childhood and loved going on holiday to my gran's farm. But my perfect family holidays soon turned into my worst nightmare. 'We were a close family and I always looked up to my uncle who lived with my gran as he was nearly 20 years older than me. 'I felt I could trust him because he was my mum's brother and he'd say I was his favourite niece and he let me sleep in his room. 'One day, when we were alone he came up and kissed me fully on the mouth. I didn't know what was happening and as time progressed so did his abuse.' Miss Cowan's agony saw her withdraw into herself and her behaviour became more erratic. She added: 'As the years went on my behaviour changed completely and I became withdrawn. When I got to 14 I decided to write a letter to an agony aunt in a magazine saying my uncle had been abusing me for years and asked for help. Convicted: John Robertson, 45, abused Helen Cowan when she was just eight years old. 'I didn't have a stamp so I hid the letter. But my parents were so worried about me they decided to search my room and found the note I'd hidden. 'I came home from school and my parents confronted me about it and I burst into tears admitting it was true. It divided my entire family.' Detectives quizzed Miss Cowan and Robertson about the allegations but said there was not enough evidence to press charges. But despite the set back and dealing with her own personal demons Miss Cowan steeled herself to face Robertson again after three other girls claimed he abused them. Miss Cowan, of Edinburgh, wrote a letter begging for help and detailing her years of abuse to a teen magazine when she was 14. Detectives quizzed Miss Cowan and Robertson about the allegations but said there was not enough evidence to press charges. She said: 'The police contacted me and told me other victims had come forward. I was terrified of dragging up the past but I knew I had to speak out so I could finally get justice.' Robertson forced his victims to appear in court after denying he raped or sexually abused them between 1990 and 2002. He was found guilty of sexually abusing Miss Cowan and another girl and of raping two others. Brave: Miss Cowan when she was aged around 12 (left) and 16-years-old (right) Miss Cowan said: 'I couldn't believe he pled not guilty. I was so nervous but when asked if I wanted to sit behind a screen I said no as I wanted to face him. 'And for the first time in years I looked him straight in the eye and thought, â€˜You took so much away from me and you deserve to be punished.' 'When I heard he had been found guilty, I wept with joy and relief. No amount of time will make up for what he took away but now he will lose years of his life like the ones he took from me.' Judge Michael O'Grady QC told Robertson: 'You have been convicted of an appalling course of conduct. You spent years preying on children. 'Two of them were raped on seven occasions. With some of your victims you have blighted their young lives and with some you have ruined and haunted their adult lives.' Miss Cowan added: 'Now I have seen justice done, I feel I can close that chapter in my life. I have a good family who have supported me through everything. I'm looking to the future and moving on with my life.' A Police Scotland spokeswoman said: 'Helen was very brave to come forward and report this crime. 'Even after the passage of time all reports of sexual abuse will be thoroughly investigated and we would encourage any person who has been a victim to report this to the police.' Sorry we are not currently accepting comments on this article SUMMARY: [/INST] John Robertson abused Helen Cowan when she was seven. First attack took place at her grandmother's farmhouse. Miss Cowan, now 26, wrote to a magazine begging for help. The note was never sent and lay hidden in her bedroom. Then her parents discovered it and contacted police. Robertson was finally jailed last month after she gave evidence. Brave Miss Cowan has waived her right to anonymity to tell story. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Ethics in Foreign Lobbying Act of 1995''. SEC. 2. PROHIBITION OF CONTRIBUTIONS AND EXPENDITURES BY MULTICANDIDATE POLITICAL COMMITTEES OR SEPARATE SEGREGATED FUNDS SPONSORED BY FOREIGN-CONTROLLED CORPORATIONS AND ASSOCIATIONS. Title III of the Federal Election Campaign Act of 1971 (2 U.S.C. 441 et seq.) is amended by adding at the end the following new section: ``prohibition of contributions and expenditures by multicandidate political committees sponsored by foreign-controlled corporations and associations ``Sec. 324. (a) Notwithstanding any other provision of law-- ``(1) no multicandidate political committee or separate segregated fund of a foreign-controlled corporation may make any contribution or expenditure with respect to an election for Federal office; and ``(2) no multicandidate political committee or separate segregated fund of a trade organization, membership organization, cooperative, or corporation without capital stock may make any contribution or expenditure with respect to an election for Federal office if 50 percent or more of the operating fund of the trade organization, membership organization, cooperative, or corporation without capital stock is supplied by foreign-controlled corporations or foreign nationals. ``(b) The Commission shall-- ``(1) require each multicandidate political committee or separate segregated fund of a corporation to include in the statement of organization of the multicandidate political committee or separate segregated fund a statement (to be updated annually and at any time when the percentage goes above or below 50 percent) of the percentage of ownership interest in the corporation that is controlled by persons other than citizens or nationals of the United States; ``(2) require each trade association, membership organization, cooperative, or corporation without capital stock to include in its statement of organization of the multicandidate political committee or separate segregated fund (and update annually) the percentage of its operating fund that is derived from foreign-owned corporations and foreign nationals; and ``(3) take such action as may be necessary to enforce subsection (a). ``(c) The Commission shall maintain a list of the identity of the multicandidate political committees or separate segregated funds that file reports under subsection (b), including a statement of the amounts and percentage reported by such multicandidate political committees or separate segregated funds. ``(d) As used in this section-- ``(1) the term `foreign-owned corporation' means a corporation at least 50 percent of the ownership interest of which is controlled by persons other than citizens or nationals of the United States; ``(2) the term `multicandidate political committee' has the meaning given that term in section 315(a)(4); ``(3) the term `separate segregated fund' means a separate segregated fund referred to in section 316(b)(2)(C); and ``(4) the term `foreign national' has the meaning given that term in section 319.''. SEC. 3. PROHIBITION OF CERTAIN ELECTION-RELATED ACTIVITIES OF FOREIGN NATIONALS. Section 319 of the Federal Election Campaign Act of 1971 (2 U.S.C. 441e) is amended by adding at the end the following new subsection: ``(c) A foreign national shall not direct, dictate, control, or directly or indirectly participate in the decisionmaking process of any person, such as a corporation, labor organization, or political committee, with regard to such person's Federal or non-Federal election-related activities, such as decisions concerning the making of contributions or expenditures in connection with elections for any local, State, or Federal office or decisions concerning the administration of a political committee.''. SEC. 4. ESTABLISHMENT OF A CLEARINGHOUSE OF POLITICAL ACTIVITIES INFORMATION WITHIN THE FEDERAL ELECTION COMMISSION. (a) There shall be established within the Federal Election Commission a clearinghouse of existing public information regarding the political activities of foreign principals and foreign agents (as defined by the Foreign Agents Registration Act of 1938, as amended). The information comprising this clearinghouse shall include and be solely limited to the following: (1) Existing publicly disclosed registrations and quarterly reports required by the Federal Regulation of Lobbying Act (2 U.S.C. 261-270). (2) Existing publicly disclosed registrations and quarterly reports required by the Foreign Agents Registration Act, as amended (22 U.S.C. 611-621). (3) The catalogue of public hearings, hearings witnesses and witness affiliations as printed in the Congressional Record. (4) Existing public information disclosed pursuant to House and Senate rules regarding honoraria, the receipt of gifts, travel, earned and unearned income, post-congressional employment, and conflict of interest regulations. (5) Existing public information disclosed pursuant to the requirements of the Federal Election Campaign Act of 1971 (2 U.S.C. 431 et seq.). (b) Notwithstanding any other provision of law, the disclosure by the clearinghouse of any information other than that set forth in subsection (a) shall be prohibited except by Act of Congress. (c) A Director shall administer and manage the responsibilities and all activities of the clearinghouse. (d) The Director shall be appointed by the Federal Election Commission. (e) The Director shall serve a single term not to exceed 5 years. (f) There shall be authorized such sums as necessary to conduct activities of the clearinghouse. SEC. 5. DUTIES AND RESPONSIBILITIES OF THE DIRECTOR OF THE CLEARINGHOUSE. (a) In General.--It shall be the duty of the Director-- (1) to develop a filing, coding, and cross-indexing system to carry out the purposes of this Act (which shall include an index of all persons identified in the reports, registrations, and other existing public disclosures filed under this Act); (2) notwithstanding any other provision of law, to make copies of registrations, reports and public disclosures filed with him under this Act available for public inspection and copying, commencing as soon as practicable, and to permit copying of any such registration or report by hand or by copying machine or, at the request of any person, to furnish a copy of any such registration or report upon payment of the cost of making and furnishing such copy; but no information contained in such registration or report shall be sold or utilized by any person for the purpose of soliciting contributions or for any profit-making purpose; (3) to compile and summarize, for each calendar quarter, the information contained in such registrations, reports, and other existing public disclosures required by this Act in a manner which facilitates the disclosure of political activities, including, but not limited to, information on-- (A) political activities pertaining to issues before the Congress and issues before the executive branch; and (B) the political activities of individuals, organizations, foreign principals, and foreign agents who share an economic, business, or other common interest; (4) to make the information compiled and summarized under paragraph (3) available to the public within 30 days after the close of each quarterly period, and to publish such information in the Federal Register at the earliest practicable opportunity; (5) not later than 150 days after the date of the enactment of this Act and at any time thereafter, to prescribe, in consultation with the Comptroller General of the United States, rules, regulations, and forms, in conformity with the provisions of chapter 5 of title 5, United States Code, as are necessary to carry out the provisions of this Act in the most effective and efficient manner; (6) at the request of any Member of the Senate or the House of Representatives, to prepare and submit to such Member a special study or report relating to the political activities of any person, such report to consist solely of the information in the registrations, reports, and other publicly disclosed information required in this Act; (7) to require the accurate, timely, and complete transfer of information required under section 1 of this Act to the clearinghouse; and (8) to refer to the Comptroller General for investigation any instances where registrations, reports, and political information required in section 1 of this Act are not forwarded to the clearinghouse in an accurate, timely, and complete fashion. (b) Definitions.--As used in this section-- (1) the term ``issue before the Congress'' means the total of all matters, both substantive and procedural, relating to (A) any pending or proposed bill, resolution, report, nomination, treaty, hearing, investigation, or other similar matter in either the Senate or the House of Representatives or any committee or office of the Congress, or (B) any action or proposed action by a Member, officer, or employee of the Congress to affect, or attempt to affect, any action or proposed action by any officer or employee of the executive branch; and (2) the term ``issue before the executive branch'' means the total of all matters, both substantive and procedural, relating to any action or possible action by any executive agency, or by any officer or employee of the executive branch, concerning (A) any pending or proposed rule, rule of practice, adjudication, regulation, determination, hearing, investigation, contract, grant, license, negotiation, or the appointment of officers and employees, other than appointments in the competitive service, or (B) any issue before the Congress. SEC. 6. AMENDMENTS TO THE FOREIGN AGENTS REGISTRATION ACT OF 1938, AS AMENDED. (a) Section 2(b) of the Foreign Agents Registration Act of 1938, as amended, is amended in the first sentence by striking out ``, within thirty days'' and all that follows through ``preceding six months' period'' and inserting in lieu thereof ``on January 31, April 30, July 31, and October 31 of each year, file with the Attorney General a supplement thereto on a form prescribed by the Attorney General, which shall set forth regarding the three-month periods ending the previous December 31, March 31, June 30, and September 30, respectively, or if a lesser period, the period since the initial filing,''. (b) Section 3(g) of the Foreign Agents Registration Act of 1938, as amended, is amended by inserting after ``whether formal or informal.'' the following: ``Notwithstanding any other provision of law, persons covered by this subsection shall be exempt only upon filing with the Attorney General an affirmative request for exemption.''. (c) Section 8 of the Foreign Agents Registration Act of 1938, as amended, is amended by adding at the end thereof the following: ``(i)(1) Any person who is determined, after notice and opportunity for an administrative hearing-- ``(A) to have failed to file a registration statement under section 2(a) or a supplement thereto under section 2(b), ``(B) to have omitted a material fact required to be stated therein, or ``(C) to have made a false statement with respect to such a material fact, shall be required to pay a civil penalty in an amount not less than $2,000 or more than $5,000 for each violation committed. In determining the amount of the penalty, the Attorney General shall give due consideration to the nature and duration of the violation. ``(2)(A) In conducting investigations and hearings under paragraph (1), administrative law judges may, if necessary, compel by subpoena the attendance of witnesses and the production of evidence at any designated place or hearing. ``(B) In the case of contumacy or refusal to obey a subpoena lawfully issued under this paragraph and, upon application by the Attorney General, an appropriate district court of the United States may issue an order requiring compliance with such subpoena and any failure to obey such order may be punished by such court as contempt thereof.''. SUMMARY: [/INST] Ethics in Foreign Lobbying Act of 1995 - Amends the Federal Election Campaign Act of 1971 to prohibit contributions and expenditures in Federal elections by multicandidate political committees or separate segregated funds sponsored by foreign-controlled (at least 50 percent owned by a non-U.S. citizen or foreign national) corporations and associations. Sets forth ownership and operating fund reporting requirements. Prohibits a foreign national from participating in the decision-making process of any person's (such as a corporation, labor organization, or political committee) election-related activities. Establishes within the Federal Election Commission a clearinghouse of existing public information regarding foreign principals' and agents' political activities. Amends the Foreign Agents Registration Act of 1938, as amended, to: (1) revise foreign agents' supplemental reporting requirements; and (2) provide civil penalties for specified reporting violations. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Streptococcus suis is the most common cause of meningitis in pork consuming and pig rearing countries in South-East Asia. We performed a systematic review of studies on S. suis meningitis to define the clinical characteristics, predisposing factors and outcome. Studies published between January 1,1980 and August 1,2015 were identified from main literature databases and reference lists. Studies were included if they were written in West-European languages and described at least 5 adult patients with S. suis meningitis in whom at least one clinical characteristic was described. We identified 913 patients with S. suis meningitis included in 24 studies between 1980 and 2015. The mean age was 49 years and 581 of 711 patients were male (82%). Exposure to pigs or pork was present in 395 of 648 patients (61%) while other predisposing factors were less common. 514 of 528 patients presented with fever (97%), 429 of 451 with headache (95%), 462 of 496 with neck stiffness (93%) and 78 of 384 patients (20%) had a skin injury in the presence of pig/pork contact. The case fatality rate was 2. 9% and hearing loss was a common sequel occurring in 259 of 489 patients (53%). Treatment included dexamethasone in 157 of 300 (52%) of patients and was associated with reduced hearing loss in S. suis meningitis patients included in a randomized controlled trial. S. suis meningitis has a clear association with pig and pork contact. Mortality is low, but hearing loss occurs frequently. Dexamethasone was shown to reduce hearing loss. Bacterial meningitis is a severe infectious disease with a high mortality and morbidity. The estimated incidence is 2. 6–6 per 100,000 adults per year in developed countries and several times higher in low-income settings [1]. Most pathogens causing bacterial meningitis are transmitted between humans (e. g., Streptococcus pneumoniae and Neisseria meningitidis), while others can be acquired through food ingestion (e. g., Listeria monocytogenes) [1,2]. Transmission of pathogens causing bacterial meningitis can also occur directly from animals to humans, a condition referred to as zoonotic bacterial meningitis. One of the most common zoonotic pathogens causing bacterial meningitis is Streptococcus suis. This pathogen has its natural reservoir in pigs and may cause meningitis, endocarditis and sepsis in humans after contact with pig or pork [3,4]. Due to high pork consumption and frequent small scale pig rearing, S. suis infection is endemic in South-East Asia, where several outbreaks and cohort studies of S. suis meningitis have been reported [5–8]. Nevertheless, cases of S. suis meningitis occur all over the world [9], particularly in patients having occupational contact with pigs or pork, such as abattoir workers and butchers [10]. The clinical manifestations, epidemiology and outcome of S. suis infection in humans were described in a recent systematic review and meta-analysis [9]. This review included studies through 2012 and did not review characteristics of S. suis meningitis separately (the condition comprised 68% of cases). We performed a systematic review on studies on S. suis meningitis to define the clinical characteristics, risk factors and outcome of S. suis meningitis. We searched the main databases (PubMed, ScienceDirect, Google scholar) for published articles describing cases of S. suis meningitis, published from January 1980 to August 2015. We used the search terms “Streptococcus suis AND meningitis”, and searched the literature for cohort studies using the term “Streptococcus suis”. We also searched the reference lists of the articles identified by this search strategy and selected those that we judged to be relevant. Articles written in English, Dutch, French, German, Spanish, Italian and Portuguese were included. Articles describing at least 5 patients with S. suis meningitis were included if at least one clinical characteristics or ancillary investigation was described, unless no sub-analysis for S. suis meningitis was performed (e. g. S. suis infection or streptococcal meningitis). All articles meeting the inclusion criteria were read and systematically processed into a database of clinical data. The variables were as follows: patient characteristics, predisposing factors, clinical presentation, ancillary investigations, and outcome. Predisposing factors were defined as 1) Contact with pigs or pork, defined as preparing pork, consumption of raw pork or other swine materials (e. g. raw pig blood), occupations related to pigs or pork (e. g. abattoir workers, butchers), or breeding pigs at home [4], and/or 2) An immunocompromised status for bacterial meningitis caused by infection with Human Immunodeficiency Virus (HIV), a history of immunosuppressive medication, cancer, splenectomy, or alcoholism [2]. When patients were reported to be ‘not immunocompromised’, we assumed no immunosuppressive medication, splenectomy or HIV-infection in these patients. Skin injury was defined as cuts or scrapes, since skin rash could be misidentified as bruises (as seen in meningococcal sepsis). As data description was heterogeneous between studies, all data are presented as number for which a characteristic was present out of the total number for which the characteristic was evaluated. We described the relevant characteristics using proportions with 95% confidence intervals (CIs) for categorical factors (sex, predisposing factors), and mean with standard deviation (SD) for continuous factors (age, laboratory parameters). For the latter, medians were converted to means by using proposed formulas [11]. In total, 382 articles were screened for eligibility (375 by searching the databases and 7 by cross-checking references) (Fig 1). 54 articles did not meet the inclusion criteria as they described S. suis infection in animals. 304 articles were excluded from the review as no cases were described (183 articles), reporting less than 5 cases (88 articles), no sub-analysis possible for S. suis meningitis (10 articles), no S. suis infection described (9 articles), no meningitis described (7 articles), foreign language (5 articles) and duplicate articles (3 articles). The 24 articles included in the review described 913 patients [7,8, 10,12–32]. The number of included patients per study varied between 5 and 151 (median 21). The median described time-period of the studies was 6 years (ranging from 1 to 23 years). Studies were performed in Thailand (8 studies), Vietnam (6 studies), Hong Kong (5 studies), the Netherlands (3 studies), China (1 study) and Japan (1 study). Studies composed 10 single center studies, 4 multi-center studies and 10 nationwide studies. 11 studies included patients prospectively and 13 were retrospective studies. The pooled mean age was 48. 8 years (SD 3. 9, reported in 715 cases) and 581 of 711 patients (82%, 95% CI 79–85%) were male (Table 1). Predisposing factors consisted of exposure to pig or pork in 395 of 648 patients (61%, 95% CI 57–65%), alcoholism in 60 of 322 patients (19%, 95% CI 15–23%), diabetes mellitus in 11 of 209 patients (5%, 95% CI 2–8%), cancer in 5 of 85 patients (6%, 95% CI 1–11%), splenectomy in 5 of 507 patients (1%, 95% CI 0–2%) and immunosuppressive medication in 2 of 593 patients (0. 3%, 95% CI 0–0. 8%). The clinical presentation of S. suis meningitis was characterized by fever in 514 of 528 patients (97%, 95% CI 96–98%), headache in 429 of 451 patients (95%, 95% CI 93–97%), neck stiffness in 462 of 496 patients (93%, 95% CI 91–95%), an altered consciousness in 35 of 113 patients (31%, 95% CI 23–39%) and nausea or vomiting in 210 of 321 patients (65%, 95% CI 60–70%). The classic meningitis triad of fever, neck stiffness and altered consciousness was present in 4 out of 43 patients (9%, 95% CI 0–18%) [2]. Skin injury in the presence of pig/pork contact was present in 78 of 384 patients (20%, 95% CI 16–24%). The mean blood leukocyte count was 17. 4 x 109/L (SD 0. 9, reported in 322 cases). The mean blood thrombocyte count was 166. 3 x 109/L (SD 19. 1, reported in 213 cases). The mean cerebrospinal fluid (CSF) leukocyte count was 1920/mm3 (SD 757); it was reported in 395 patients and abnormal in all 913 patients. The mean CSF protein was 2. 4 g/L (SD 0. 8, reported in 380 patients) and the mean CSF glucose was 1. 09 mmol/L (SD 0. 60, reported in 177 patients). Data on cerebrospinal fluid cultures were reported in all 913 patients, and were positive in 758 (83%, 95% CI 81–85%). Blood cultures were positive in 288 of 435 cases (66%, 95% CI 62–70%). Results of cranial CT were noted in 3 studies describing 27 patients [23,28,32] and consisted of cerebral edema in 8 of 27 patients (30%, 95% CI 10–50%). The majority of patients was treated with ceftriaxone (250 patients) or penicillin (102 patients) monotherapy; no antibiotic resistance for these antibiotics was found in the 182 cases where the resistance pattern was determined. Antibiotic resistance for tetracycline was reported in 2 studies [7,33]. In some studies, patients were treated with either penicillin or ceftriaxone (101 patients), but the exact number of patients receiving either treatment was not reported [23,24,29,31]. In 454 patients, the type of antibiotic treatment was unknown. 157 of 300 patients (52%, 95% CI 44–60%) received adjunctive dexamethasone. The majority of these patients were included in a randomized controlled trial in which 71 patients received adjunctive dexamethasone and 69 patients received placebo [7]. In the other studies, dexamethasone was given at the discretion of the treating physician. The case fatality rate was 2. 9% (17 of 581 patients, 95% CI 1. 9–3. 9%) and 116 of 320 patients (36%, 95% CI 31–41%) recovered without sequelae. An association between dexamethasone and death could not be established because numbers of patients who died were small. Data from the RCT showed no patients died in dexamethasone group versus three in the placebo group [34]. Hearing loss was present in 259 of 489 patients (53%, 95% CI 49–57%). 68 of these patients were screened at admission for hearing loss and this was present in 60 patients (88%, 95% CI 80–96%). According to a study describing 41 patients with hearing loss in S. suis meningitis, 38 had hearing loss on admission and 3 developed hearing loss during admission [23]. Another study described 16 patients with S. suis meningitis and hearing loss, with hearing loss persisting in 7 patients (44%) [28]. Other neurological sequelae were present in 35 of 286 patients (12%, 95% CI 8–16%) and consisted of ataxia in 19 patients, cognitive impairment in 2, tinnitus in 2, and were not specified in 12. A randomized controlled trial showed that dexamethasone was significantly associated with a reduction in hearing loss in at least one ear (38% to 12%, p = 0. 003) and a reduction in severe (>80 dB) hearing loss (odds ratio 0. 23 [95% CI, 0. 06–0. 78]), using a multivariate analysis including age >50 and CSF bacterial load [7]. A recent case series from the Netherlands showed that despite dexamethasone treatment 6 out of 7 patients with S. suis meningitis had hearing loss upon discharge [32]. Meningitis is the most frequently described presentation of S. suis infection, occurring in approximately 50–60% of reported S. suis infected patients [9]. Despite the geographical distribution, there were no significant differences for clinical presentation and outcome in S. suis meningitis between the different studies and low-/high-income countries. In our meta-analysis the main risk factor for S. suis meningitis was exposure to pigs or raw pork. This confirms the findings by a single center case-control study from Vietnam of 101 patients with S. suis infection which showed an odds ratio of 6. 33 for occupations related to pigs [16]. Another previously reported potential risk factor was alcoholism, which we identified in 16% of patients. Alcoholism was not an independent risk factor for contracting S. suis meningitis when corrected for other predisposing factors in Vietnam [16]. However, alcoholism has been associated with an increased risk of infection in general and of an unfavorable outcome of bacterial meningitis [35]. Skin injury in the presence of pig/pork contact was described in 20% of the cases, which is similar to the previously observed 25% skin injuries in all types of S. suis infections [9]. S. suis may directly pass into the blood stream after exposure to pigs or pork in the presence of skin injuries, even without visible wound infection [10,16,36]. Patients with an increased risk of infection, e. g. because of splenectomy or use of immunosuppressive medication, should avoid direct pig or pork contact when skin lesions, particularly on the hands, are present. Skin protection has been suggested to reduce the incidence of S. suis infection [16]. Direct exposure to pigs or pork was described for 61% of meningitis cases. Direct pig exposure was documented in the majority of the European cases of S. suis infection, but was reported in less than half of the Asian cases, suggesting that other mechanisms may be involved in those patients [16]. A recent study showed that the gastro-intestinal tract is an entry site for S. suis [37], supporting the epidemiological evidence that ingestion of S. suis contaminated food is a risk factor for infection [9,16,38]. The sensitivity of the classic triad of bacterial meningitis consisting of fever, neck stiffness, and altered mental status was low (9%). This was mainly due to the low frequency of altered mental status, since other symptoms and signs of bacterial meningitis were present in a large proportion of patients. In patients with a history of regular pig exposure or pork consumption, hearing loss and these symptoms, meningitis due to S. suis should be suspected, and CSF examination should be performed to get diagnostic certainty [3]. We found that the mortality of S. suis meningitis was low (3%), especially when compared to pneumococcal meningitis (20%) and Listeria monocytogenes meningitis (36%) [39,40]. The mortality rate was also lower than reported for general invasive infection caused by S. suis (13%) [12]. The difference between mortality in S. suis meningitis and other types of S. suis infection (such as sepsis) has been noted before [6,8, 9,19], but the mechanism causing this difference needs to be further elucidated [9]. Similar differences between meningitis and sepsis case fatality rates have been reported for invasive meningococcal disease [41]. The mortality rate was low but many surviving patients have sequelae. The most common sequel is hearing loss occurring in 53% of the patients; variable rates of hearing loss have been reported in other types of bacterial meningitis, with 8% in meningococcal meningitis and 22% in pneumococcal meningitis [2]. Hearing loss in S. suis meningitis may be a presenting symptom or develop during admission [23], and does not always persist [28]. Different hypotheses for hearing loss in S. suis meningitis are described in the literature such as direct infection of the auditory nerve and suppurative labyrinthitis [42]. For patients with meningitis in whom S. suis is identified, it is important to consult the otorhinolaryngologist early in the clinical course for audiometry and evaluate whether cochlear implantation is possible [43]. Dexamethasone has been shown to decrease mortality in pneumococcal meningitis and to decrease hearing loss and neurological sequelae in all bacterial meningitis cases [44,45]. For S. suis meningitis, an effect on mortality has not been established [34]. One randomized controlled trial on dexamethasone in bacterial meningitis, performed in Vietnam, included a substantial number of S. suis meningitis [34]. A subsequent analysis of all S. suis patients showed dexamethasone reduced hearing loss in a multivariate analysis [7]. As a recent case-series showed, hearing loss is still observed in patients treated with dexamethasone [32], additional randomized clinical trials on the effect of dexamethasone in S. suis meningitis would be desirable to further evaluate whether there is a benefit. However, it is unlikely such a trial is going to be performed for practical and financial reasons. Based on the available evidence, dexamethasone treatment in regions with high rates of S. suis as cause of meningitis appears reasonable to potentially reduce the very high rate of post-meningitic hearing impairment. This review has several limitations. First, most included studies show a selection bias due to a retrospective character. A recent study showed evidence of publication bias in S. suis meningitis [9]. S. suis meningitis is probably underreported, and often in numbers of less than 5 cases, which was an exclusion criterion for this study. Second, reporting of clinical characteristics, ancillary investigations and outcome was highly diverse between the included studies. We have presented the total number of patients in whom the specific characteristic was reported, but we could not perform a risk factor analysis due to heterogeneity in data. Third, cases of S. suis meningitis might have been missed due to a negative CSF culture caused by pre-treatment with antibiotics. In conclusion, S. suis meningitis is predominantly seen in men after contact with pigs or pork and is endemic in pig rearing and pork consuming countries such as Vietnam, Thailand and China. The typical clinical presentation consists of hearing loss, fever, headache and neck stiffness, and skin injury in the presence of pig/pork contact is present in 20% of the cases. Although the mortality of S. suis meningitis is low compared to S. suis infection in general and other causes of bacterial meningitis, 53% of patients end up with hearing loss. SUMMARY: [/INST] Meningitis is a common manifestation of Streptococcus suis infection. S. suis is endemic in pork consuming and pig rearing countries. We systematically reviewed the clinical characteristics, predisposing factors and outcome of S. suis meningitis. We identified 913 patients included in 24 studies, with a mean age of 49 years and a majority of male patients (82%). Exposure to pigs or pork was present in 61%, with a skin injury being present in 20%. Fever was present in 97% of patients, headache in 95%, neck stiffness in 93%. The mortality was 2. 9% and hearing loss was common occurring in 53% of patients. Dexamethasone was associated with reduced hearing loss. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: French authorities said Monday that two men arrested for the brutal killing in Paris of an 85-year-old Jewish woman, Holocaust survivor Mireille Knoll, would be charged with an anti-Semitic murder. The Paris prosecutor’s office said the two suspects have been put in custody. It said it was asking investigating judges to charge the pair with premeditated murder of a vulnerable person for anti-Semitic motives. They will face possible charges of “murder related to the victim’s religion, real or imagined” as well as aggravated robbery and destruction of property, judicial sources said. Get The Times of Israel's Daily Edition by email and never miss our top stories Free Sign Up The prosecutor’s office asked that the two be placed in preventive custody. One of the men was a regular visitor of Knoll whom she treated “like a son” and who had visited her that day, her son Daniel said. “We are really in shock. I don’t understand how someone could kill a woman who has no money and who lives in a social housing complex,” her son added. Israel’s Hadashot news reported that this suspect was a former neighbor of Knoll’s who was jailed for sexually assaulting the daughter of a woman who helped look after her. After his release from jail, Knoll complained that he had been threatening her, the TV report said. The French foreign minister, who is visiting Israel, said it was likely that the motive for her killing was anti-Semitic, and that his country must continue to fight against anti-Semitism. Jean-Yves Le Drian, meeting with Prime Minister Benjamin Netanyahu in Jerusalem, said he had a “moving and difficult moment” when he heard about “the outrageous murder” of Holocaust survivor Knoll in Paris, just after ending his visit to Yad Vashem. “We cannot yet say if the motive for the murder was anti-Semitism, but it is reasonable to assume,” Le Drian said. “Therefore, this only strengthens the fact that this struggle has not ended, and that we will need to continue fighting against anti-Semitism.” The chief rabbi of Paris, Haim Korsia, wrote on Twitter that he was “horrified” by the killing. Two men have been arrested over the killing of Knoll, whose stabbed body was found after her Paris apartment was set ablaze, police sources said. One suspect was identified as a 29-year-old man. No details were given on the second suspect. An autopsy conducted on Knoll, who lived alone, showed her charred body also had at least 11 stab wounds. A forensic examination of the apartment showed that an arsonist started a fire in at least five distinct areas of that space, the report also said. The Paris prosecutor’s office said that it had not yet determined a motive, but “is not excluding any hypothesis.” “A preliminary examination of the elements of the crime does not reveal an anti-Semitic characteristic, but this possibility has not been discounted as police investigate further,” said a spokesperson for the Jewish Community Protection Service (SPCJ), which works closely with the French police. The National Bureau for Vigilance Against Anti-Semitism, or BNVCA, wrote in a statement Sunday that the suspected murder “is reminiscent of the crime committed against Sarah Halimi,” a 66-year-old Jewish teacher and physician, whom prosecutors say was murdered by her Muslim neighbor in April, partly in connection with her Jewish identity A granddaughter of Knoll, Noa Goldfarb, wrote on Facebook that her grandmother was murdered by a neighbor who is a Muslim. “Twenty years ago, I left Paris knowing that neither my future nor that of the Jewish People is to be found there,” wrote Goldfarb, who lives in Herzliya, Israel. “But who would’ve thought that I was leaving my relatives where terrorism and cruelty would lead to such a tragedy. Grandmother was stabbed to death 11 times by a Muslim neighbor she knew well, who made sure to set fire to her home and left us not even one object, a letter, a photograph, to remember her by. All we have are our tears and each other.” A Paris lawmaker who spoke with one of the woman’s sons said she had managed as a child to evade the notorious 1942 roundup of over 13,000 Jews in Paris during World War II. Fewer than 100 of those who were detained at the so-called Vel d’Hiv cycling track and then sent to the Nazi death camps survived. The CRIF umbrella grouping of French Jewish organizations urged “the fullest transparency” by the authorities investigating the killing, “so that the motive of this barbarous crime is known as quickly as possible.” France’s half-a-million-plus Jewish community has voiced increasing concern over a rise in violent anti-Semitic acts. “The barbarity of this murder sends us back to that of Sarah Halimi, just one year ago,” Francis Kalifat, president of the CRIF umbrella of French Jewish communities, said in a statement Monday. Halimi was a 66-year-old Jewish teacher and physician, whom prosecutors say was murdered by her Muslim neighbor in April partly in connection with her Jewish identity. Anti-Semtisim was included in the indictment against Halimi’s suspcted killer, Kobili Traore, 28, after CRIF and BNVCA vocally protested its absence from the draft document. “CRIF expects total transparency in the current investigation, so that the motives for this barbaric crime are known by all as fast as possible,” Kalifat added in the statement about Knoll. Image copyright AFP Image caption The attack took place in Mireille Knoll's home in a block of flats in the 11th arrondisement of Paris French prosecutors are treating the murder of an 85-year-old Jewish woman, whose body was found in her burned-out Paris flat, as an anti-Semitic attack. Mireille Knoll was stabbed several times before Friday's blaze. In 1942, she escaped the notorious Vel d'Hiv round up of some 13,000 Jews in Paris, who were then deported to Nazi death camps. Two men, aged 22 and 29, have been arrested and placed under formal investigation over the murder. A police source told French media that one of them had previously been convicted of molesting a 12-year-old girl who had been staying at Mireille Knoll's flat. She had also complained to police that a neighbour had threatened to set fire to her home, according to reports. "We are really in shock. I don't understand how someone could kill a woman who has no money and who lives in a social housing complex," her son, who was not named, told AFP news agency. On Sunday, investigators said they were "not excluding any hypothesis" as to the motive for the attack. But a day later the Paris prosecutor said it was believed to be anti-Semitic. French lawmaker Meyer Habib wrote on Facebook that the pensioner had escaped Vel d'Hiv in 1942 thanks to her mother's Brazilian passport. In a statement (in French), France's Jewish umbrella organisation Crif expressed "anger and concern" at the attack. It urged "the fullest transparency" by the authorities "so that the motive of this barbaric crime is known as quickly as possible". France's Jewish community has voiced increasing concern over a rise in violent anti-Semitic acts in the country. Last month, a judge confirmed that the murder last year of Sarah Halimi, a 65-year-old Orthodox Jewish woman who was beaten and thrown out of her window, was driven by anti-Semitism. Mireille Knoll, who managed to flee a mass roundup of Jews in Paris during World War II, was found dead Friday in her apartment in the east of the French capital, where she lived alone. An autopsy showed she had been stabbed several times before the apartment was set on fire. Two men were arrested over her killing on Monday and were to be brought before a magistrate to face possible charges of "murder related to the victim's religion, real or imagined" as well as aggravated robbery and destruction of property, judicial sources told AFP. One of the men was a regular visitor of Knoll's whom she treated "like a son" and who had visited her that day, her son told AFP, asking not to be named. The apartment block in the 11th arrondissement of Paris where the alleged murder took place. Photo: AFP "We are really in shock. I don't understand how someone could kill a woman who has no money and who lives in a social housing complex," her son added. Speaking during a visit to Jerusalem on Monday, Foreign Minister Jean-Yves Le Drian said it was "plausible" that Knoll was killed because of her religion and her death showed the need for a "fundamental and permanent" fight against anti-Semitism. The chief rabbi of Paris, Haim Korsia, wrote on Twitter that he was "horrified" by the killing. READ ALSO: Photo: AFP After meeting one of Knoll's sons French MP Meyer Habib wrote a Facebook post that began with the words: "The nightmare continues for French Jews". "The authorities are being cautious and seem reluctant to recognize at this stage the anti-Semitic character [of the murder]. But for the family it's almost a certainty," said Habib. Investigators had initially said on Sunday they were "not excluding any hypothesis" with regard to the motives for her murder. But Jewish organisations in France have been keen to make sure French police looked into the possible anti-Semitic nature of the murder. "The investigation does not reveal any anti-Semitic elements, however, this path has not been ruled out to date and needs to be further explored," said the Protection Service for the Jewish Community (Service de protection de la communauté juive, SPCJ) a body which keeps close watch an anti-Semitic acts in France. France's leading Jewish umbrella group CRIF (Representative Council of French Jewish Institutions), said in a statement that it "expects the authorities to operate with the utmost transparency in the ongoing investigation so that the motives for this barbaric crime are known to everyone as soon as possible." Although the investigation is at an early stage, the killing has echoes of the murder of Sarah Halimi, an Orthodox Jewish woman who was brutally murdered in her own home, also in the 11th arrondissement, by her neighbour in April 2017. Amid shouts of "Allah Akbar" (God is great), Koranic verses and insults, her attacker beat Halimi before throwing her out of the window. In February, a French judge finally ruled that the brutal murder was an anti-Semitic act The president of Jewish community group the Consistoire Israelite, Joel Mergui, told AFP that he wanted to "understand what happened and not let the same silence that followed the murder of Sarah Halimi a year ago in the same arrondissement happen again." Paris woman’s brutal murder declared anti-Semitic act: After initially balking at ascribing killing of Sarah Halimi to anti-Jewish sentiment, magistrate now accepts hate crime element in indictment against Kobili Traore https://t.co/AOfI3FwVHk TimesofIsrael pic.twitter.com/Gfs4yKO0Y4 — Jewish Community (@JComm_BlogFeeds) February 28, 2018 Anti-Semitic violence The most recent figures available show that anti-Semitic violence increased by 26 percent last year in France and that criminal damage to Jewish places of worship and burials increased by 22 percent. A record 7,900 French Jews emigrated to Israel in 2015 following the deadly jihadist shooting at a Parisian kosher supermarket two days after the attack on satirical magazine Charlie Hebdo. That exodus has since slowed, but a spate of anti-Semitic attacks since have continued to frighten one of Europe's biggest Jewish communities, numbering an estimated half a million. A global study in 2014 found that one in three French people held anti-Semitic views, although experts suggested the figure exaggerated the problem of anti-Semitism in France. "Stating 18 million French people show signs of anti-Semitic attitudes seems excessive to me," Marc Knobel, head of studies at CRIF told The Local at the time. "I have never seen a figure like that before." "I don't doubt that anti-Semitism exists in certain categories of the French population, and there is anti-Semitic violence in France, but France is not an anti-Semitic country," he said. SUMMARY: [/INST] An 85-year-old Jewish woman who survived the Holocaust was murdered and her body burned in what Paris police are now investigating as a hate crime. Mireille Knoll was stabbed at least 11 times before her Paris apartment was set ablaze Friday, report the Local and the BBC. Two male suspects, aged 22 and 29, were arrested Monday and face possible charges of anti-Semitic murder, aggravated robbery, and destruction of property, reports the Times of Israel. On Facebook, Knoll's granddaughter describes one of the men as "a Muslim neighbor [Knoll] knew well." Knoll's son says she treated the man "like a son." Local media, however, report the man had threatened to set fire to Knoll's home following his release from prison for molesting the 12-year-old daughter of a woman who looked after Knoll. "We are really in shock," says Knoll's son, noting his mother had "no money" to tempt her alleged killers. Authorities initially said they were "not excluding any hypothesis" regarding the motive of the killing. But on Monday, the Paris prosecutor's office said anti-Semitism was likely to blame. "For the family, it's almost a certainty," French MP Meyer Habib said in a Facebook post after speaking with Knoll's relatives, per the Local. She noted Knoll escaped a roundup of 13,000 Jews in Paris in 1942-almost all of whom would later die in Nazi death camps-thanks to her mother's Brazilian passport, per the BBC. Many are now pointing out similarities in the case of 66-year-old Jewish woman Sarah Halimi, murdered in Paris last April. In February, the murder was ruled an anti-Semitic crime. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Japanese encephalitis (JE), caused by a mosquito-borne flavivirus, is endemic to the entire south-east Asian and adjoining regions. Currently no therapeutic interventions are available for JE, thereby making it one of the most dreaded encephalitides in the world. An effective way to counter the virus would be to inhibit viral replication by using anti-sense molecules directed against the viral genome. Octaguanidinium dendrimer-conjugated Morpholino (or Vivo-Morpholino) are uncharged anti-sense oligomers that can enter cells of living organisms by endocytosis and subsequently escape from endosomes into the cytosol/nuclear compartment of cells. We hypothesize that Vivo-Morpholinos generated against specific regions of 3′ or 5′ untranslated regions of JEV genome, when administered in an experimental model of JE, will have significant antiviral and neuroprotective effect. Mice were infected with JEV (GP78 strain) followed by intraperitoneal administration of Morpholinos (5 mg/kg body weight) daily for up to five treatments. Survivability of the animals was monitored for 15 days (or until death) following which they were sacrificed and their brains were processed either for immunohistochemical staining or protein extraction. Plaque assay and immunoblot analysis performed from brain homogenates showed reduced viral load and viral protein expression, resulting in greater survival of infected animals. Neuroprotective effect was observed by thionin staining of brain sections. Cytokine bead array showed reduction in the levels of proinflammatory cytokines in brain following Morpholino treatment, which were elevated after infection. This corresponded to reduced microglial activation in brain. Oxidative stress was reduced and certain stress-related signaling molecules were found to be positively modulated following Morpholino treatment. In vitro studies also showed that there was decrease in infective viral particle production following Morpholino treatment. Administration of Vivo-Morpholino effectively resulted in increased survival of animals and neuroprotection in a murine model of JE. Hence, these oligomers represent a potential antiviral agent that merits further evaluation. The genus Flavivirus is composed of more than 70 different closely related species [1]. Many flaviviruses are arthropod-borne and causes significant human diseases. Among these, the four serotypes of dengue virus (DENV), yellow fever virus (YFV), West Nile virus (WNV) and Japanese encephalitis virus (JEV) are categorized as emerging global pathogens [2]. JEV is a mosquito-borne, positive sense, single stranded RNA virus, responsible for frequent epidemics of encephalitis, predominantly in children, in most parts of Southeast Asia and adjoining regions. It is the causal factor for 30,000–50,000 cases of encephalitis occurring every year and accounts for about 10,000 deaths annually with serious neurological squeal in the survivors [3]. JEV has been expanding its ‘geographical footprint’ into previously non-endemic regions and with several billion people at risk, Japanese encephalitis (JE) represents an internationally emerging concern in tropical and sub-tropical countries. Currently three types of JE vaccine are in use- the inactivated mouse-brain derived, the inactivated cell-culture derived and the live attenuated cell-culture derived. However, there are limitations for their usage in terms of availability, cost and safety [4]. At present, chemotherapy against JEV is largely supportive and not targeted towards the virus. A lot of avenues has been explored in the past and are also being currently tried, so as to develop a safe and effective molecule that would be able to prevent the virus from replicating within the host. The JEV genome is approximately 11 kb in length that carries a single long open reading frame (ORF) flanked by a 95-neucleotide 5′ untranslated region (5′ UTR) and a 585-neucleotide 3′ UTR. The ORF encodes a polyprotein which is processed by viral and cellular proteases into three structural and seven non structural proteins [5], [6]. The 5′ and 3′ UTRs of the JEV genome contain conserved sequence elements and can form conserved stem loop structure. 5′ UTR contain secondary structures which are required for the formation of translation pre-initiation complex [7]. JEV requires long range RNA-RNA interaction between 5′ and 3′ regions of its genome for efficient replication; one such interaction occurs between a pair of 10 complementary nucleotides, located in coding sequence for the capsid protein at 136–146 nucleotides from 5′ end of the genome, and 3′ cyclization sequence, commonly denoted as 3′CSI (3′ conserved sequence I) located at 104–114 nucleotides from 3′ end of the genome [8], [9]. The 3′CSI is highly conserved across members of JEV serocomplex, indicating the possibility that RNA elements within the 5′ and 3′ UTRs in JEV genome are essential for its replication. Anti-sense oligonucleotides have been shown to be effectively used as therapeutic agents against viral infection. In one such study siRNA generated against the cd loop-coding sequence in domain II of the viral Envelope protein (which is highly conserved among all flaviviruses because of its essential role in membrane fusion) has been found to protect against lethal encephalitis [10]. Similarly siRNAs has also been generated against various nonstructural proteins of JEV and were found to be effective in inhibiting viral replication [11], [12]. Anti-sense approach has also been employed to inhibit flaviviral replication by generating anti-sense molecules against RNA elements within the 5′ and 3′ UTRs in flaviviral genome. In one such approach, DNAzyme against 3′ UTR of JEV genome has be found to be effective in controlling virus infection in a murine model [13]. Under the same approach but with different kind of anti-sense oligonuleuotide called Morpholino, flaviviral replication has been inhibited in cultured cells as well as in animal models [14], [15]. Morpholino oligomers are single stranded DNA analogues containing same nitrogenous bases as DNA but joined by backbone consisting of morpholine rings and phosphorodiamidate linkages [16]. For efficient delivery into cells these Morpholino are often conjugated with arginine rich peptide [17]. However, in the current study we have used a different type of Morpholino oligomer called Vivo-Morpholino against 3′CSI and one of the secondary structures present in 5′ UTR of the JEV genome. Vivo-Morpholino are specialized type of non-peptide Morpholino oligomers, conjugated with a new transport structure that provides effective delivery into a wide variety of tissues in living animals, thereby raising the possibilities of their use as therapeutic agents. The transporter comprises of a dendritic structure assembled around a triazine core which serves to position eight guanidinium head groups in a conformation effective to penetrate cell membranes. Vivo-Morpholinos have also been shown to effectively enter and function within cultured cells [18]. Vivo-Morpholinos are also cost effective, non immunogenic, and stable under physiological conditions as compared to other types of Morpholinos. This study was designed to evaluate whether the use of Vivo-Morpholinos as therapeutic agents, is possible in an experimental model of JE. We intend to show that these specifically designed Vivo-Morpholinos are effective in countering the viral load in the body, thereby imparting significant protection to the animals that were infected with a lethal dose of JEV. All animal experiments were approved by the institutional animal ethical review board named “Institutional Animal and Ethics Committee of National Brain Research Centre”. The animal experiment protocol approval no. is NBRC/IAEC/2007/36. Animals were handled in strict accordance with good animal practice as defined by Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Ministry of Environment and Forestry, Government of India. Vero cells (a kind gift from Dr. Guruprasad Medigeshi, Translational Health Science and Technology Institute, Gurgaon, India) and Neuro2A (obtained from National Centre for Cell Science, Pune, India) cells were grown in DMEM (Dulbecco' s modified Eagles medium, supplemented with 10% fetal bovine serum (FBS) and antibiotics. The GP78 strain of JEV was propagated in suckling BALB/c mice and their brains were harvested when symptoms of sickness were observed. A 10% tissue suspension was made in MEM (minimum essential medium), followed by centrifugation at 10,000× g and finally filtered through a 0. 22 µ sterile filter [19]. JEV was titrated by plaque formation on Vero cell monolayer. Vero cells were seeded in six-well plates to form semi-confluent monolayer in about 18 h. Cell monolayer were inoculated with 10-fold serial dilutions of virus samples made in MEM containing 1% FBS and incubated for 1 h at 37°C with occasional shaking. The inoculum was removed by aspiration and the monolayers were overlaid with MEM containing 4% FBS, 1% low-melting-point agarose and a cocktail of antibiotic–antimycotic solution (Gibco, Invitrogen Corporation, Grassland, NY, USA) containing penicillin, streptomycin, and amphotericin B. Plates were incubated at 37°C for 72–96 h until plaques became visible. To allow counting of the plaques, the cell monolayer was stained with crystal violet after fixing the cells with 10% formaldehyde. All Vivo-Morpholino (MO) oligos were commercially procured from Gene Tools LLC, (Philomath, OR, USA). MOs were designed to be complementary to sequences in the JEV (GP78 strain) genome, as shown in Table 1. These oligonucleotides targeted specific regions in the 3′ and 5′ UTRs of the JEV genomic RNA (Figure 1). A 21 base scrambled MO of random sequence (SC-MO) was used as a negative control in all the experiments. All MO sequences were screened with BLAST (http: //www. ncbi. nlm. nih. gov/BLAST) against primate and murine mRNA sequences and the SC-MO was additionally screened against all flaviviral sequences. All MOs were procured in 300 nanomole quantities as a liquid of 0. 5 mM stock (approximately 4 mg/mL) in buffered saline. They were diluted with sterile 1× PBS to achieve desired concentrations, and stored at 4°C as aliquots. Five to six weeks old BALB/c mice of either sex were randomly distributed into 5 groups- Sham, JEV-infected, JEV-infected and treated with scrambled Morpholino (JEV+SC-MO), JEV-infected and treated with Morpholino against viral 3′ conserved region (JEV+3′ MO) and JEV-infected and treated with Morpholino against secondary structure in the 5′UTR of viral RNA (JEV+5′ MO). Initially each group contained 8 animals. Animals belonging to all groups except Sham were infected with 3×105 plaque forming units (PFU) of JEV (GP78 strain) and that day was considered as day zero [20]. Animals of Sham group received equal volume of filtered MEM. Starting from 3 h post infection on day zero, 100 µg of SC-MO, 3′ MO and 5′ MO, diluted in 0. 1 mL of sterile 1× PBS (corresponding to 5 mg/kg body weight), were administered to animals belonging to JEV+SC-MO, JEV+3′ MO and JEV+5′ MO groups respectively, once per day, for 5 consecutive days. Animals belonging to the Sham-treatment group received equal volumes of sterile 1× PBS only. Survivality of animals in each group following JEV infection and Morpholino treatment were monitored daily upto 15 days post JEV infection (or till their death, whichever was earlier). Toxicity of the Morpholinos in mice was evaluated by weight loss and abnormal behavioral & clinical observations (including tremors, ruffled fur, hunching, ataxia, gait abnormalities), in a masked manner to minimize bias [14], [20]. Mouse cytokine bead array (CBA) kits were used to quantitatively measure cytokine levels in mouse whole-brain lysates. 50 µL of bead mix containing a population of beads with distinct fluorescence intensities that have been coated with capture antibodies for different cytokines, and 50 µL of whole-brain lysates were incubated together, along with equal volume of phycoerythrin (PE) -conjugated detection antibodies, for 2 h at room temperature, in dark. The beads were then washed and re-suspended in 300 µL of supplied 1× wash buffer. The beads were acquired using Cell Quest Pro Software in FACS Calibur and analyzed using BD CBA software (Becton Dickinson, San Diego, CA). Standard curve was prepared by incubating 50 µL of supplied mouse inflammation standards with 50 µL of bead mix and PE-conjugated detection antibodies [21]. Protein concentrations of whole brain lysates were estimated by Bradford method. Sample volumes containing 20 µg of protein were electrophoresed on polyacrylamide gel and transferred onto nitrocellulose membrane. After blocking with 7% skimmed milk, the blots were incubated overnight at 4°C with primary antibodies against JEV E-glycoprotein (Abcam, USA), and JEV NS5 (a kind gift from Dr. Chun-Jung Chen, Taichung Veterans General Hospital, Taichung, Taiwan), iNOS (Upstate-Chemicon, USA), HSP-70, SOD-1 (Santa Cruz Biotechnology, CA, USA), TRX (AB Frontiers, Korea; a kind gift from Dr. Ellora Sen, NBRC), phospho NFκB, phospho ERK1/2, total ERK1/2 and phosphoP38 MAP kinase (Cell Signaling, USA) at 1∶1000 dilutions. After extensive washes with PBS–Tween, blots were incubated with appropriate secondary antibodies conjugated with peroxidase (Vector Laboratories, CA, USA). The blots were again washed with PBS–Tween and processed for development using chemiluminescence reagent (Millipore, USA). The images were captured and analyzed using Chemigenius, Bioimaging System (Syngene, Cambridge, UK). The blots were stripped and reprobed with anti-β-tubulin (Santa Cruz Biotechnology, USA) to determine equivalent loading of samples [22]. For immunohistochemical staining, brains from scarified animals were excised following repeated transcardial perfusion with ice-cold saline and fixed with 4% paraformaldehyde. Twenty micron thick cryosections were made with the help of Leica CM3050S cryostat and processed for immunohistochemical staining to detect presence of JEV antigen in the brain and to label activated microglia. Sections were incubated overnight at 4°C with mouse anti-JEV antigen (Nakayama, 1∶250) (Chemicon, CA, USA) and rabbit anti-Iba-1 (1∶ 500; Wako, Osaka, Japan), respectively. After washes, slides were incubated with FITC-conjugated anti-mouse or anti-rabbit secondary antibodies (Vector laboratories Inc. Burlingame, USA) and following final washes, sections were sections were cover slipped after mounting with 4′-6-diamidino-2-phenylindole (DAPI, Vector laboratories Inc.). The slides were observed under Zeiss Axioplan 2 fluorescence microscope and Zeiss Apotome microscope (Zeiss, Gottingen, Germany), respectively [21]. Cryosections of brain from Sham-treated, JEV-infected and JEV-infected and MO treated animals were rinsed in de-ionized water followed by incubation with the thionin dye. The excess dye was washed off and the slides were immersed in alcohol-dioxane (1∶1) solution for differentiation. After two changes in xylene the slides were mounted with DPX and observed under a Leica 4000 DB light microscope (Leica Microsystems, USA) [23]. The level of ROS produced within brain tissue of each treatment groups were measured by the cell permeable, non-polar, H2O2-sensitive probe 5 (and 6) -chlromethyl-20,70-dichlorodihydrofluoresceindiacetate (CM-H2DCFDA; Sigma, USA). CM-H2DCFDA diffuses into cells, where its acetate groups are cleaved by intracellular esterases, releasing the corresponding dichlorodihydrofluorescein derivative. Subsequent oxidations of CM-H2DCFDA yields a fluorescent adduct dichlorofluorescein that is trapped inside the cell. Brain homogenates were treated with 5 µM solution of CM-H2DCFDA followed by incubation in dark at room temperature for 45 min and then the relative fluorescence intensity were measured with the help of Varioskan Flash multimode reader (Thermo Electron, Finland) at excitation 500 nm and emission 530 nm. The fluorescence intensity of intracellular CM-H2DCFDA is a linear indicator of the amount of H2O2 in the cells. The measured mean fluorescence intensity was then normalized to equal concentrations of protein in each sample [23]. Nitric oxide released from brain homogenates following MO treatment was assessed using Griess reagent as described previously. Briefly, 100 µL of Griess reagent (Sigma, St. Louis, USA) was added to 100 µL of brain homogenate and incubated in dark for 15 min. The intensity of the color developed was estimated at 540 nm with the help of a Benchmark plus 96-well ELISA plate reader (Biorad, CA, USA). The amount of nitrite accumulated was calculated (in µM) from a standard curve constructed with different concentrations of sodium nitrite [21]. Mouse neuroblastoma cells (N2a) were plated in five 60 mm plates at a density of 5×105 cells/plate, and were cultured for 18 h. After 6 h in serum free DMEM, cells were either mock-infected with sterile 1× PBS or infected with JEV at multiplicity of infection (MOI) of 5. After 1½ h, cells were washed twice with sterile 1× PBS to remove non-internalized virus. Three of the four plates that were infected with JEV, were treated with SC-MO, 3′ MO and 5′ MO at 10 µM concentrations and all plates were incubated for 24 h in serum free media. After two washes with 1× PBS, cells were first fixed with BD cytofix solution (BD Biosciences) for 15 min and permeabilized by resuspending in permeabilization buffer (BD Cytoperm plus; BD Biosciences) and incubated at 25°C for at least 10 min. Cells were then washed twice in wash buffer (PBS containing 1% bovine serum albumin) then resuspended in wash buffer at 1×106 cells per 100 µL. Primary antibody (JEV Nakayama strain; Chemicon, USA) were added in 1∶100 dilutions and incubated for 30 min at 25°C. The cells were washed with wash buffer and pelleted by centrifugation followed by incubation with FITC conjugated secondary antibody for 30 min. After final wash with wash buffer, cells were resuspended in 400 µL FACS buffer and analyzed on a FACS Calibur. The percentage of population of JEV-positive cells was calculated after gating the populations on a Dot plot using Cell Quest Pro Software (BD Biosciences). Statistical analysis was performed using SIGMASTAT software (SPSS Inc., Chicago, IL, USA). Data were compared between groups using one-way analysis of variance followed by post hoc test. Differences upto p<0. 05 were considered significant. MO treatment conferred significant protection to mice following JEV infection. The survival of mice following JEV infection was dramatically increased with treatments of both 3′ and 5′ MO. Approximately 90% of all the animals that were treated with 3′ MO survived as compared to 75% survival of those animals that were treated with 5′MO, post infection with JEV (Figure 2A). Infection with JEV was accompanied with distinct symptoms and weight loss whereas treatments with both 3′ and 5′ MO post JEV infection, prevented animals from suffering. Not much considerable changes in the average body weights of JEV-infected animals treated with both 3′ and 5′ MO were observed when compared to animals belonging to JEV and JEV+ SC-MO groups showing significant reductions in their body weights 6 days post infection (Figure 2B). The symptoms associated with JE in murine model were observed on daily basis and scores were attributed accordingly. The animals that had most symptoms received the highest scores. It was observed that 3′ and 5′ MO treated animals scored lesser than those belonging to the JEV-infected or JEV+SC-MO groups (Figure 2C). To assess whether the MOs has any effect on reduction of viral load in brain, homogenized brain samples from all the treatment groups were subjected to plaque assay as described in materials and methods section. Number of PFU/mL of the brain homogenate was found to be significantly higher in both JEV and JEV+SC-MO groups when compared to Sham (p<0. 001). Viral PFUs were found to be significantly reduced following 3′ MO and 5′ MO treatment when compared to only JEV-infected or JEV+SC-MO group (p<0. 001) (Figure 3A). To further validate the results obtained from the plaque assay, immunoblot for some of the JEV-specific proteins were performed. The expression of NS5, a non structural protein of JEV, was significantly increased in JEV and JEV+SC-MO groups when compared to Sham (p<0. 01), but its level were found to be significantly reduced after both 3′ and 5′ MO treatments when compared to JEV-infected group (p<0. 01). Similarly, E glycoprotein level showed significant increase in JEV-infected and JEV+SC-MO groups when compared to Sham (p<0. 01) which were then drastically reduced following 3′ and 5′ MO treatments (p<0. 01) (Figure 3B–D). Immunostaining of brain sections showed greater presence of JEV antigen in JEV-infected and JEV+SC-MO groups, whereas 3′ and 5′ MO treatments resulted in lesser presence (Figure 3E). To further characterize the inhibitory effects of MO on JEV-induced neuronal death, brain sections from all the treatment groups were subjected to thionin staining. Numerous healthy cells were seen in sections obtained from Sham, JEV+3′ MO and JEV+5′ MO groups when compared to sections belonging to only JEV-infected or JEV+SC-MO groups which contained numerous unhealthy/dying neurons with altered morphology (Figure 4A). Microglial activation and increased proinflammatory cytokine production are the hallmarks of JEV infection [24]. To see whether MO treatment helps in vitiation of these effects, immunostaining for microglial specific marker Iba-1 was performed in brain sections of all treatment groups. In brain sections of JEV and JEV+SC-MO groups the number of activated microglia with characteristic morphology, appeared to be more frequent when compared to sections belonging to Sham, JEV+3′ MO and JEV+5′ MO groups (Figure 4B). CBA performed to check the proinflammatory cytokines levels in the brain homogenates obtained from different treatments showed that levels of MCP-1, IFN-γ, TNF-α, and IL-6 were found to be significantly increased in both JEV and JEV+SC-MO groups when compared to Sham infected groups (p<0. 01). The elevated levels of these proinflammatory cytokines were drastically reduced with 3′ and 5′ MO treatments (p<0. 01) (Figure 4C–F). Increased oxidative stress in CNS is a major outcome of JEV infection [20]. To evaluate whether MO treatment of mice resulted in abrogation of oxidative stress following JEV infection, we measured ROS and NO levels in brain homogenate obtained from all treatment groups. Two fold increases were observed in the ROS levels in the brain samples of JEV and JEV+SC-MO groups when compared to Sham (p<0. 01), significant reduction in the ROS levels were observed in JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected groups (p<0. 01). Although ROS levels has decreased in JEV+3′ MO group when compared to JEV group, it remained significantly higher than that of Sham (p<0. 01) (Figure 5A). Superoxide dismutase 1 (SOD-1) and Thioredoxin (TRX-1) are the proteins associated with oxidative stress. SOD-1 levels were found to be elevated approximately 2- and 3-fold in JEV-infected and JEV+SC-MO groups respectively when compared to Sham (p<0. 01). Its levels in JEV+3′ MO and JEV+5′ MO groups were reduced significantly when compared to JEV-infected group (p<0. 01). TRX-1 levels were also found to be increased significantly in JEV-infected and JEV+SC-MO groups when compared to Sham (p<0. 01) but it were significantly reduced in brain samples obtained from JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected groups (p<0. 01) (Figure 5B, D&E). HSP-70 is a heat shock protein that has been associated with intracellular stress. Significant twelve fold increases in the levels of HSP-70 were observed in JEV and JEV+SC-MO groups when compared to Sham (p<0. 01), this drastic increases in the levels of HSP-70 in JEV and JEV+SC-MO groups were reduced in JEV+3′ MO and JEV+5′ MO groups (p<0. 01) (Figure 5B&C). JEV infection leads to increased nitric oxide (NO) production in CNS [25]. Significant two fold increases were seen in the NO levels in brain samples obtained from JEV-infected and JEV+SC-MO groups when compared to those obtained from Sham (p<0. 01). NO levels subsequently got down to significantly lower levels following 3′ and 5′MO treatments (p<0. 01) (Figure 5F). Immunoblot analysis showed nearly 8-fold increases in levels of iNOS in JEV-infected and JEV+SC-MO groups when compared to Sham (p<0. 01). iNOS levels showed significant decreases in JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected groups (p<0. 01) (Figure 5G&H). Western blot analysis demonstrated a significant inhibition in the expression of different stress related proteins whose levels were elevated following JEV infection. Upon MO treatments there were approximately 4-fold increases in the levels of pNFκB in JEV and JEV+SC-MO groups when compared to Sham (p<0. 01). The levels of pNFκB were found to be significantly reduced in JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected groups (p<0. 01) (Figure 6A&B). Phospho p38 MAPK levels also showed significant 3-fold increases in JEV and JEV+SC-MO groups when compared to Sham (p<0. 01), its levels were also found to be reduced significantly following treatment with 3′ and 5′ MO when compared to only JEV-infected groups (p<0. 01) (Figure 6A&C). Both phospho ERK1 and ERK2 levels were found to be significantly increased in JEV and JEV+SC-MO groups when compared to Sham (p<0. 01). The levels of phospho ERK1 and ERK2 showed considerable decreases in JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected groups (p<0. 01) (Figure 6A&D). To assess whether MO has any effect on viral load in vitro N2a cell lysates from all the treatment groups were subjected to plaque assay. PFU/mL of the cell lysates was found to be significantly higher in both JEV and JEV+SC-MO groups when compared to mock-infected cells (p<0. 01). Viral loads were found to significantly reduced in both JEV+3′ MO and JEV+5′ MO groups when compared to only JEV-infected group (p<0. 01) (Figure S1A). To further ascertain the results obtained from plaque assay, intracellular staining of JEV antigen in N2a was performed and number of JEV-positive N2a cells was then counted by flow cytometry. Only 16% and 9% of the total gated cells were found to be positive for JEV antigen in JEV+3′ MO and JEV+5′ MO groups respectively as compared to 30% in JEV-infected group, and 34% in JEV+SC-MO group (Figure S1B). Use of anti-sense molecules for targeted inhibition of viral replication has been under investigation for quite sometime. Though the application of these molecules has raised the possibilities of their future use as novel therapeutic agents, there are many issues regarding their effectiveness in terms of their stability and delivery to targeted cells. Recent studies are involved in developing techniques to minimize or eliminate these issues so that anti-sense therapy can be employed to a wide variety of intractable diseases such as splice-modifying genetic defects and viral diseases. The role of various anti-sense molecules in the inhibition of replication of JEV has been reported with positive outcomes [10], [11], [12], [13], [26]. Morpholino oligomers are single stranded anti-sense molecules that exert their action by steric blocking of complementary RNA. Unlike other types of anti-sense oligonucleotides, Morpholinos provide all the desired properties of stability, nuclease resistance, high efficacy, long-term activity, water solubility, low toxicity, and exquisite specificity. Morpholino oligomers has been used previously for the inhibition of flaviviral replication [14], [27] including JEV [15] though all of them has utilized peptide based Morpholinos. The peptide based Morpholinos contain delivery moiety evolved from natural peptides whose active components are 6–9 arginine residues in a bio-available 6-aminohexanoic-spaced structure [28]. However, these arginine-based peptides are not commercially available for research purposes and their greatest efficacies have been in delivering Morpholinos to the cytosol of tissues like liver [29] or leaky muscle [30], which would be considered as easily deliverable. As a result, the reach of peptide based Morpholinos into a wide spectrum of tissues remains questionable [18]. Also, owing to the peptidic nature, degradation of the peptide portion of the conjugates was found to be time and tissue dependent [31]. Furthermore, the applications of the arginine-rich peptide transporters are limited due to their high cost, scalability and stability. Added to that are the risks of immune responses against the peptides which limits repeated administrations for diseases requiring long-term treatment [32]. To minimize the problems encountered by the peptide-conjugated Morpholinos, octaguanidinium dendrimer-conjugated Morpholino oligomers have been developed that are commonly referred to as Vivo-Morpholino (MO). These custom-sequence anti-sense molecules have been reported to enable Morpholino applications in adult animals. MO was our choice of anti-sense molecule as this enabled us to test the specifically designed oligonucleotides in both animal as well as cell culture models. Though ‘outstanding’ results have been reported to be achieved by intravenous (i. v.) administration of the MO, we preferred the intraperitoneal route via which modest systemic delivery can be achieved. This was so done because brain has been reported to be an ineffective tissue when MOs are administered i. v. [33], though there is no direct evidence showing that MOs can cross blood brain barrier, when administered via other routes. According to the manufacturer' s (Gene Tools LLC) instructions the maximum suggested dosage in mammals is 12. 5 mg/kg in a 24 hour period. Our aim was to determine the minimum dose at which our desired effects could be achieved. Initially we had chosen two doses of 5 mg and 10 mg per kg body weight (b. w.) of the animals. We found that there was no significant difference between the survival rate of JEV-infected and MO treated mice in either dose (data not shown for 10 mg/kg b. w.). The survival rate was approximately 90% in those JEV-infected animals that were treated with 3′ MO and 75% in animals treated with 5′ MO. Thus we decided to proceed with the 5 mg/kg b. w. dose for all subsequent experiments. Plaque assay from the brain homogenates of animals of all groups revealed that the number of infective viral particle production was dramatically reduced following 3′ and 5′ MO treatment. The 3′ MO was generated against the 3′ CSI region of the JEV genome that interacts with 5′ CS region located in coding sequence for capsid protein at 136–146 nucleotides from 5′ terminal of the genome. This interaction results in cyclization of JEV genome that is necessary for its efficient replication. The 5′ MO was targeted towards one of the secondary structures of the 5′ UTR that are required for the formation of translation pre-initiation complex. Blocking of these two sites in the JEV genome leads to the most likely effect, i. e. inhibition of replication and translation of viral genome. This was further corroborated by the decrease in the expressions of viral proteins (NS5, E glycoprotein and general flaviviral envelop protein) in the brain. Flaviviral NS5 is known to possess guanylyltransferase activity that helps in the synthesis of methylated cap structure at the 5′ end of the viral genome that plays a crucial role in the translation and stability of mRNAs [34]. The JEV E glycoprotein is believed to be involved in viral adhesion and entry into host cells, hemagglutination, cellular tropism, viral virulence, and the induction of protective immune responses [35]. Decreased expression of these proteins indicates that viral replication and production of new infective viral particles are inhibited due to the MOs. Immunohistochemical staining for viral antigen also provided visual confirmation of the fact that JEV antigen was detected at much lower amounts in the brain following MO treatment. However, these data does not prove that MOs directly inhibit infective viral particle production in the brain itself, as it cannot be conclusively stated whether the MOs can reach brain. These data merely suggests that the number of replication-competent infective JEV in the brain was significantly reduced, which subsequently leads to neuroprotection. It is well known that JEV infection causes microglial activation. Activated microglia releases an array of chemical mediators that are detrimental for the neurons in brain [24]. Since there was reduction in the production of infective viral particles following 3′ and 5′ MO treatments, we studied the effect on microglial pathophysiology in mouse brain. Our results show that there was significantly reduced number of activated microglia in the brain sections of both 3′ and 5′ MO-treated animals as compared to only JEV-infected or JEV-infected and SC-MO treated animals. Since there were little or no activation of microglia, proinflammatory cytokine levels in the brain were found to be significantly downregulated. Histochemical staining also revealed that neuronal population and morphology remained largely unaffected in 3′ and 5′ MO-treated animals' brains as compared to only JEV-infected or JEV-infected and SC-MO treated animals. Generation of ROS with the generation of oxidative damage has been implicated in neurodegenerative diseases and in the degradation of nervous system functions and are also reported to increase following JEV infection [22]. Increase in ROS levels initiates various responses within the cell, including damage to proteins, DNA and lipid [36]. In this study, ROS levels were found to be many-fold increased in JEV-infected or JEV-infected and SC-MO treated animals that were then found to be counteracted by the treatment of 3′ and 5′ MO. The levels of stress related proteins such as SOD-1, HSP-70 and TRX where also found to be positively modulated following 3′ and 5′ MO treatment. NO is a known antagonist of JEV. It has been shown that NO inhibits JEV infection by preventing viral replication [37]. In our study NO levels were increased in the brain in response to JEV infection possibly due to the upregulation of inducible nitric oxide synthase (iNOS). Treatments with 3′ and 5′ MO caused a decrease of NO to basal levels as observed in Sham-treated animals. Activation of pNFκB regulates apoptotic genes, especially the TRAF1 and TRAF2, and thereby checks the activities of the caspases, which are central to most apoptotic processes. JEV is known to activate pNFκβ via a PI3K-dependent pathway in the brain of infected animals, which is associated with apoptosis [38]. JEV infection has also been shown to activate stress kinases, which in turn results in activation of ERK1/2, and p38 MAPK pathway leading to apoptotic death of neurons [39]. In accordance with the established results, here also we found that there was similar activation pattern of these molecules in JEV-infected and JEV-infected and SC-MO treated animal brain samples. Treatment with the MOs resulted in abrogation of those changes that led to greater survivality of brain neurons as observed by histochemical staining. Activation of p38MAPK is also related to the transcriptional activation of proinflammatory genes in the brain [40]. Thus the decrease in phophoP38 MAPK levels correlates with the decreased levels of proinflammatory cytokine levels in obtained from the brain. To confirm the anti-viral and neuroprotective property of the MOs observed in in vivo models, cultured neuroblastoma cells were infected with JEV, followed by MO treatment. Though the MOs are specifically developed for in vivo studies, they are also known to be taken up by cells in culture conditions [18]. There was a significant decrease in viral titer in samples obtained from the cells that were treated with 3′ and 5′ MOs as compared to either JEV-infected or JEV-infected and SC-MO treated cells, as revealed by plaque assay. This data was supported by FACS analysis following intracellular staining for JEV antigen. This study was undertaken to determine the antiviral and neuroprotective efficacy of Vivo-Morpholinos in an experimental model of JE so that it can be considered as a therapeutic agent in the near future. There have been studies regarding the anti-JEV effects of other types of Morpholino oligomers though none of them are yet to be considered for therapeutic purposes. This is the first study that investigates the role of Morpholino oligomers specially designed for effective delivery into live animal models. Generally, the i. p route of administration of any drug is preferred in animal studies over any other routes. However, the efficacy of these antisense molecules needs to be checked by administering through other applicable routes, as i. p. administration in humans is uncommon, though not unheard of. The amounts of oligomers required and the route of administration in this study marks these molecules as practicable therapeutic agents in JE, though further studies are required before these can be recommended for clinical trials. SUMMARY: [/INST] Japanese encephalitis (JE) is caused by a flavivirus that is transmitted to humans by mosquitoes belonging to the Culex sp. The threat of JE looms over a vast geographical realm, encompassing approximately 10 billion people. The disease is feared because currently there are no specific antiviral drugs available. There have been reports where other investigators have shown that agents that block viral replication can be used as effective therapeutic countermeasures. Vivo-Morpholinos (MOs) are synthetically produced analogs of DNA or RNA that can be modified to bind with specific targeted regions in a genome. In this study the authors propose that in an animal model of JE, MOs specifically designed to bind with specific region of JE virus (JEV) genome, blocks virus production in cells of living organisms. This results in reduced mortality of infected animals. As the major target of JEV is the nerve cells, analysis of brain of experimental animals, post treatment with MOs, showed neuroprotection. Studies in cultured cells were also supportive of the antiviral role of the MOs. The potent anti-sense effect in animals and lack of obvious toxicity at the effective dosage make these MOs good research reagents with future therapeutic applications in JE. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Francesca Chambers. Bill Clinton was once paid an astonishing $1.3 million for two days worth of speeches, an analysis of Clinton's finances published today shows. On another occasion he hauled in $1.4 million for speeches given during a a seven-day sprint across Europe. A comprehensive look at Clinton's post presidency pay day by The Washington Post reveals Bill really has been working'very hard' to bring in the bacon for his family, giving 542 paid speeches since his term ended. The Post determined that Clinton made $104.9 million off of his speeches between 2001 and early 2013. Post presidential payday: Former President Bill Clinton, pictured here at the closing session of the Clinton Global Initiative America, in Denver, Colorado, on Wednesday, was once paid $750,000 for one speech. In 2012 alone Clinton gave an impressive 72 paid speeches, bringing in $16.3 million. 'I’m shocked that people still want me to come give talks,' Clinton told Meet the Press host David Gregory in an interview this week at the fourth annual Clinton Global Initiative America meet-up in Denver. Data for Clinton's speeches after the beginning of 2013 is unavailable. Bill was required to file financial disclosure forms throughout his wife Hillary's tenure as a U.S. Senator and as Secretary of State, but when she left the Obama administration last year, that information became private. If Hillary ran for president in 2016, their tax information would likely become public again, giving Americans a clearer picture of how much of a boon the speaking circuit has been on the power couple's finances. Interest in the Clinton's wealth has piqued in the last month after Hillary told ABC's Diane Sawyer that she and Bill were 'not only dead broke, but in debt' when they departed the White House in 2001, and that is why they charge so much for individual speeches. May 28, 2011: Achmea, $600,000. November, 12, 2011: Ericsson, $750,000. November 13, 2011: Hualua, $550,000. March 25, 2011: THISDAY, $700,000. February, 13, 2012: THISDAY, $700,000. 'You know, it was not easy,' Hillary said. 'Bill has worked really hard — and. it's been amazing to me — he's worked very hard.' The remark has inspired a round of attacks from Republicans, including 'I Wish I Was As Broke As The Clintons' t-shirts and bumper stickers created by political action committee America Rising. The Clintons have been coy about how much they regularly receive to make remarks, but the number was thought to be around $200,000. WaPo's analysis of Bill's speeches indicate that it could be more. In 2011 and 2012 Bill was paid a respective average of $248,333 and $226,736 per speech. 'There’s not a lot of negotiating room,' Chuck Carr, a vice president of the Institute of Scrap Recycling Industries told the Washington Post of his organization's experience hiring Bill to speak in 2009. 'You are offered a contract and there’s very little in the contract that you can change.' Nice work if you can get it: On another occasion Clinton made $1.4 million in seven days for speaking to European business and political leaders. Bill's pay day has seen an increase throughout the last three years as a result of several high stakes speeches. Swedish. communications technology provider Ericsson paid Clinton $750,000 for a. November 12, 2011, speech he made in Hong Kong, China, setting the. record for most amount of money a former U.S. president has received to. give remarks. THISDAY. Newspaper Group paid Clinton $700,000 for a Lagos, Nigeria speech on. March 25, 2011. The organization paid Clinton an additional $700,000 for. a February 13, 2012 speech. Clinton's biggest fans have come from the financial services industry, which has paid the former president $19.6 million since 2001 to grace 102 functions with his presence. TD Bank, an affiliate of TD Ameritrade, has paid Clinton $1.8 million for 10 speeches. Goldman Sachs has brought Clinton in to speak eight times to the tune of $1.35 million. The 42nd president has also been very popular abroad, collecting $56.3 million from foreign institutions, primarily in China, Japan, Canada and the United Kingdom. Hillary Clinton is also in high demand, if not higher demand than her husband, as a speaker. Much of the information about her speeches is private, but Mother Jones posits that Hillary has made more than $5 million off her speeches since last year SUMMARY: [/INST] Former President Bill Clinton gave 542 speeches between 2001, when his term ended, and 2013. He has earned more than $104.9 for his speeches, once making $1.3 million in a two-day period. His biggest fans are in the financial industry, which has paid him $19.6 million for 102 speeches. Clinton's biggest single pay day was a November, 12, 2011 speech to Swedish communications technology company Ericsson, for which Clinton was paid $750,000. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Joel Christie. PUBLISHED:. 13:36 EST, 3 March 2014. \|. UPDATED:. 16:00 EST, 3 March 2014. He's no stranger to filing lawsuits himself, once successfully stopping Playgirl from publishing some full-frontal naked photos. But now Leonardo DiCaprio has found himself the defendent for producing the 2013 film Out Of The Furnance - purportedly based on the Ramapo Mountain people of New Jersey - with members of the community saying they were wrongly portrayed as violent, drug-using 'inbreds' and 'hillbillies' and that the movie has caused them emotional distress. According to court documents obtained by RadarOnline, eight members of the Ramapo Mountain community filed a defamation lawsuit in early January over the film, which starred Casey Affleck, Christian Bale and Woody Harrelson. The film is about two hard-up brothers - Bale and Affleck - in Rust Belt Pennsylvania, with Affleck's character getting messed up with one of the most ruthless crime rings in the Northeast. Scroll down for video. Sued: Out Of The Furnace producer Leonardo DiCaprio - along with seven other people affiliated with the 2013 drama - are being sued by the Ramapo Community of New Jersey, who claim they are portrayed in the film as violent, inbred hillbillies. The claims in the lawsuit center mostly around a character played by Woody Harrelson named Harlen DeGroat, a psychopathic 'inbred' crime boss who deals hard drugs in the Ramapo Mountains. Out Of The Furnace also stars Casey Affleck as an unemployed Pennsylvanian who gets into trouble with a ruthless Ramapo drug ring. The suit specifically refers to Harrelson's psycopathic characer, Harlen DeGroat, the 'Ramapo ringleader' who deals hard drugs and is 'the most awful human being walking'. Documents says the movie uses characters with standard Ramapo surnames - such as a DeGroat, Van Dunk and Mann - with seven of the eight plaintiffs in the lawsuit carrying such names. The suit claims that 'by using DeGroat and Van Dunk surnames in an extremely negative manner and by making several negative comments regarding the Ramapo people in the movie which result in the negative association between the Plaintiffs and the movie'. The group claims they have been left embarassed and 'continue to suffer emotional and psychological damages'. 'Plaintiffs and their family members are harassed and discriminated against. The children are teased at school. The conduct of the defendants constitutes defamation,' the papers claim. Leader of the Ramapo - or Ramapough - Mountain community, Dwaine Perry, said Out Of The Furnace was a 'hate crime' upon his people when it was released late last year. However Perry is not listed as one of the plaintiffs on the lawsuit against the filmmakers. 'The Plaintiffs are not the worst people, do not live in trailer homes, are not involved in an underground bare-knuckle fight ring, and do not live in a self-contained world of drugs and violence.' The group are claiming the movie showed Ramapo Mountain people as 'inbred mountain folk from Jersey' who 'have fights' and are 'nasty' and 'crazy'. The New York Post has also been named as a defendant for a movie review that was published. They are asking for a jury to award them restitution in 'an amount to be determined by a jury'. After seeing the Out Of The Furnace - which has grossed $11.3 million - upon its release, Ramapough Indian Chief Dwaine Perry described the film as a 'hate crime' that'stepped over the boundaries of decency', according to NJ.com. 'It eats up and destroys one's self-esteem, particularly for the children,' Chief Perry said. 'You can't really measure the destruction. It's a massive social humiliation. Not only is it a hate crime, it's an extremely violent crime.' DiCaprio, along with the seven other listed plaintiffs - including celebrated director Ridley Scott - are yet to comment on the suit. Out Of The Furnace, starring Christian Bale, was released in December last year and has so far grossed $11.3 million at the box office. According to a 2010 article in The New Yorker, the Ramapo people call themselves Ramapough Mountain Indians or the Ramapough Lenape Nation, referring to old spelling of the river that cuts through the Hudson and North Jersey Highlands. The Ramapoughs number a few thousand, marry largely among themselves, and are concentrated in three primary settlements: on and around Stag Hill, in Mahwah; in the village of Hillburn, New York, in the hollow below Stag Hill’s northern slope; and, west of Stag Hill, in Ringwood, New Jersey, in the remains of an old iron-mining complex. Despite spanning two states and three counties, the Ramapough settlements are essentially connected if travelling through the woods, by foot or by A.T.V, the article said SUMMARY: [/INST] Out Of The Furnace, a drama-thriller starring Christian Bale, Casey Affleck and Woody Harrelson, was released in December. Plot centers around a ruthless and lawless crime gang set in the Ramapo - or Ramapough - Mountain community of New Jersey. Eight community members have filed a lawsuit claiming the film and its portrayal of Ramapo people has caused them 'emotional distress' and 'embarrassment' They say the film depicts them as 'inbreds' and 'hillbillies' who are 'violent' and 'crazy' Leonardo DiCaprio, a producer on the film, along with eight others affiliated with the movie have been sued. The film has grossed $11.3 million. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: BACKGROUND [0001] In some settings, endoscopic surgical instruments may be preferred over traditional open surgical devices since a smaller incision may reduce the post-operative recovery time and complications. Consequently, some endoscopic surgical instruments may be suitable for placement of a distal end effector at a desired surgical site through a cannula of a trocar. These distal end effectors may engage tissue in a number of ways to achieve a diagnostic or therapeutic effect (e.g., endocutter, grasper, cutter, stapler, clip applier, access device, drug/gene therapy delivery device, and energy delivery device using ultrasound, RF, laser, etc.). Endoscopic surgical instruments may include a shaft between the end effector and a handle portion, which is manipulated by the clinician. Such a shaft may enable insertion to a desired depth and rotation about the longitudinal axis of the shaft, thereby facilitating positioning of the end effector within the patient. Positioning of an end effector may be further facilitated through inclusion of one or more articulation joints or features, enabling the end effector to be selectively articulated or otherwise deflected relative to the longitudinal axis of the shaft. [0002] Examples of endoscopic surgical instruments include surgical staplers. Some such staplers are operable to clamp down on layers of tissue, cut through the clamped layers of tissue, and drive staples through the layers of tissue to substantially seal the severed layers of tissue together near the severed ends of the tissue layers. Merely exemplary surgical staplers are disclosed in U.S. Pat. No. 4,805,823, entitled “Pocket Configuration for Internal Organ Staplers,” issued Feb. 21, 1989; U.S. Pat. No. 5,415,334, entitled “Surgical Stapler and Staple Cartridge,” issued May 16, 1995; U.S. Pat. No. 5,465,895, entitled “Surgical Stapler Instrument,” issued Nov. 14, 1995; U.S. Pat. No. 5,597,107, entitled “Surgical Stapler Instrument,” issued Jan. 28, 1997; U.S. Pat. No. 5,632,432, entitled “Surgical Instrument,” issued May 27, 1997; U.S. Pat. No. 5,673,840, entitled “Surgical Instrument,” issued Oct. 7, 1997; U.S. Pat. No. 5,704,534, entitled “Articulation Assembly for Surgical Instruments,” issued Jan. 6, 1998; U.S. Pat. No. 5,814,055, entitled “Surgical Clamping Mechanism,” issued Sep. 29, 1998; U.S. Pat. No. 6,964,363, entitled “Surgical Stapling Instrument having Articulation Joint Support Plates for Supporting a Firing Bar,” issued Nov. 15, 2005; U.S. Pat. No. 6,978,921, entitled “Surgical Stapling Instrument Incorporating an E-Beam Firing Mechanism,” issued Dec. 27, 2005; U.S. Pat. No. 6,988,649, entitled “Surgical Stapling Instrument Having a Spent Cartridge Lockout,” issued Jan. 24, 2006; U.S. Pat. No. 7,000,818, entitled “Surgical Stapling Instrument Having Separate Distinct Closing and Firing Systems,” issued Feb. 21, 2006; U.S. Pat. No. 7,111,769, entitled “Surgical Instrument Incorporating an Articulation Mechanism having Rotation about the Longitudinal Axis,” issued Sep. 26, 2006; U.S. Pat. No. 7,143,923, entitled “Surgical Stapling Instrument Having a Firing Lockout for an Unclosed Anvil,” issued Dec. 5, 2006; U.S. Pat. No. 7,303,108, entitled “Surgical Stapling Instrument Incorporating a Multi-Stroke Firing Mechanism with a Flexible Rack,” issued Dec. 4, 2007; U.S. Pat. No. 7,367,485, entitled “Surgical Stapling Instrument Incorporating a Multistroke Firing Mechanism Having a Rotary Transmission,” issued May 6, 2008; U.S. Pat. No. 7,380,695, entitled “Surgical Stapling Instrument Having a Single Lockout Mechanism for Prevention of Firing,” issued Jun. 3, 2008; U.S. Pat. No. 7,380,696, entitled “Articulating Surgical Stapling Instrument Incorporating a Two-Piece E-Beam Firing Mechanism,” issued Jun. 3, 2008; U.S. Pat. No. 7,404,508, entitled “Surgical Stapling and Cutting Device,” issued Jul. 29, 2008; U.S. Pat. No. 7,434,715, entitled “Surgical Stapling Instrument having Multistroke Firing with Opening Lockout,” issued Oct. 14, 2008; U.S. Pat. No. 7,721,930, entitled “Disposable Cartridge with Adhesive for Use with a Stapling Device,” issued May 25, 2010; and U.S. Pat. No. 7,455,208, entitled “Surgical Instrument with Articulating Shaft with Rigid Firing Bar Supports,” issued Nov. 25, 2008. The disclosure of each of the above-cited U.S. patents is incorporated by reference herein. While the surgical staplers referred to above are described as being used in endoscopic procedures, it should be understood that such surgical staplers may also be used in open procedures and/or other non-endoscopic procedures. [0003] While various kinds of surgical stapling instruments and associated components have been made and used, it is believed that no one prior to the inventor(s) has made or used the invention described in the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS [0004] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention, and, together with the general description of the invention given above, and the detailed description of the embodiments given below, serve to explain the principles of the present invention. [0005] FIG. 1A depicts a perspective view of an articulating surgical instrument with an end effector in a nonarticulated position; [0006] FIG. 1B depicts a perspective view of the surgical instrument of FIG. 1A with an end effector in an articulated position; [0007] FIG. 2 depicts a perspective view of an opened end effector of the surgical instrument of FIGS. 1A-1B ; [0008] FIG. 3A depicts a side cross-sectional view of the end effector of FIG. 2, taken along line 3 - 3 of FIG. 2, with the firing bar in a proximal position; [0009] FIG. 3B depicts a side cross-sectional view of the end effector of FIG. 2, taken along line 3 - 3 of FIG. 2, but showing the firing bar in a distal position; [0010] FIG. 4 depicts an end cross-sectional view of the end effector of FIG. 2, taken along line 4 - 4 of FIG. 2 ; [0011] FIG. 5 depicts an exploded perspective view of the end effector of FIG. 2 ; [0012] FIG. 6 depicts a perspective view of the end effector of FIG. 2, positioned at tissue and having been actuated once in the tissue; [0013] FIG. 7 depicts an exemplary therapeutic agent end effector and an associated dedicated device; [0014] FIG. 8 depicts a side cross-sectional view of the end effector of FIG. 7 ; [0015] FIG. 9 depicts an exploded perspective view of an exemplary alternative cartridge assembly for an end effector; and [0016] FIG. 10 depicts a perspective view of an end effector with the cartridge assembly of FIG. 9, the end effector positioned at and actuated within the tissue. [0017] The drawings are not intended to be limiting in any way, and it is contemplated that various embodiments of the invention may be carried out in a variety of other ways, including those not necessarily depicted in the drawings. The accompanying drawings incorporated in and forming a part of the specification illustrate several aspects of the present invention, and together with the description serve to explain the principles of the invention; it being understood, however, that this invention is not limited to the precise arrangements shown. DETAILED DESCRIPTION [0018] The following description of certain examples of the invention should not be used to limit the scope of the present invention. Other examples, features, aspects, embodiments, and advantages of the invention will become apparent to those skilled in the art from the following description, which is by way of illustration, one of the best modes contemplated for carrying out the invention. As will be realized, the invention is capable of other different and obvious aspects, all without departing from the invention. Accordingly, the drawings and descriptions should be regarded as illustrative in nature and not restrictive. [0019] I. Exemplary Surgical Stapler [0020] FIGS. 1-6 depict an exemplary surgical stapling and severing instrument ( 10 ) that is sized for insertion, in a nonarticulated state as depicted in FIG. 1A, through a trocar cannula passageway to a surgical site in a patient for performing a surgical procedure. Surgical and stapling and severing instrument ( 10 ) includes handle portion ( 20 ) connected to implement portion ( 22 ), the latter further comprising shaft ( 23 ) distally terminating in an articulating mechanism ( 11 ) and a distally attached end effector ( 12 ). Once articulation mechanism ( 11 ) and distally end effector ( 12 ) are inserted through the cannula passageway of a trocar, articulation mechanism ( 11 ) may be remotely articulated, as depicted in FIG. 1B, by articulation control ( 13 ). Thereby, end effector ( 12 ) may reach behind an organ or approach tissue from a desired angle or for other reasons. It should be understood that terms such as “proximal” and “distal” are used herein with reference to a clinician gripping handle portion ( 20 ) of instrument ( 10 ). Thus, end effector ( 12 ) is distal with respect to the more proximal handle portion ( 20 ). It will be further appreciated that for convenience and clarity, spatial terms such as “vertical” and “horizontal” are used herein with respect to the drawings. However, surgical instruments are used in many orientations and positions, and these terms are not intended to be limiting and absolute. [0021] End effector ( 12 ) of the present example includes a lower jaw ( 16 ) and a pivotable anvil ( 18 ). Handle portion ( 20 ) includes pistol grip ( 24 ) toward which closure trigger ( 26 ) is pivotally drawn by the clinician to cause clamping, or closing, of the anvil ( 18 ) toward lower jaw ( 16 ) of end effector ( 12 ). Such closing of anvil ( 18 ) is provided through an outmost closure sleeve ( 32 ), which longitudinally translates relative to handle portion ( 20 ) in response to pivoting of closure trigger ( 26 ) relative to pistol grip ( 24 ). A distal closure ring ( 33 ) of closure sleeve ( 32 ) is indirectly supported by frame ( 34 ) of implement portion ( 22 ). At articulation mechanism ( 11 ), a proximal closure tube ( 35 ) of closure sleeve ( 32 ) communicates with the distal portion (closure ring) ( 33 ). Frame ( 34 ) is flexibly attached to lower jaw ( 16 ) via articulation mechanism ( 11 ), enabling articulation in a single plane. Frame ( 34 ) also longitudinally slidingly supports a firing drive member (not shown) that extends through shaft ( 23 ) and communicates a firing motion from firing trigger ( 28 ) to firing bar ( 14 ). Firing trigger ( 28 ) is farther outboard of closure trigger ( 26 ) and is pivotally drawn by the clinician to cause the stapling and severing of clamped tissue in end effector ( 12 ), as will be described in greater detail below. Thereafter, release button ( 30 ) is depressed to release the tissue from end effector ( 12 ). [0022] FIGS. 2-5 depict end effector ( 12 ) employing an E-beam firing bar ( 14 ) to perform a number of functions. As best seen in FIGS. 3A-3B, firing bar ( 14 ) includes a transversely oriented upper pin ( 38 ), a firing bar cap ( 44 ), a transversely oriented middle pin ( 46 ), and a distally presented cutting edge ( 48 ). Upper pin ( 38 ) is positioned and translatable within an anvil pocket ( 40 ) of anvil ( 18 ). Firing bar cap ( 44 ) slidably engages a lower surface of lower jaw ( 16 ) by having firing bar ( 14 ) extend through channel slot ( 45 ) (shown in FIG. 3B ) that is formed through lower jaw ( 16 ). Middle pin ( 46 ) slidingly engages a top surface of lower jaw ( 16 ), cooperating with firing bar cap ( 44 ). Thereby, firing bar ( 14 ) affirmatively spaces end effector ( 12 ) during firing, overcoming pinching that may occur between anvil ( 18 ) and lower jaw ( 16 ) with a minimal amount of clamped tissue and overcoming staple malformation with an excessive amount of clamped tissue. [0023] FIG. 2 shows firing bar ( 14 ) proximally positioned and anvil ( 18 ) pivoted to an open position, allowing an unspent staple cartridge ( 37 ) to be removably installed into a channel of lower jaw ( 16 ). As best seen in FIGS. 4-5, staple cartridge ( 37 ) of this example includes a cartridge body ( 70 ), which presents an upper deck ( 72 ) and is coupled with a lower cartridge tray ( 74 ). As best seen in FIG. 2, a vertical slot ( 49 ) is formed through part of staple cartridge ( 37 ). As also best seen in FIG. 2, three rows of staple apertures ( 51 ) are formed through upper deck ( 70 ) on one side of vertical slot ( 49 ), with another set of three rows of staple apertures ( 51 ) being formed through upper deck ( 70 ) on the other side of vertical slot ( 49 ). Referring back to FIGS. 3-5, a wedge sled ( 41 ) and a plurality of staple drivers ( 43 ) are captured between cartridge body ( 70 ) and tray ( 74 ), with wedge sled ( 41 ) being located proximal to staple drivers ( 43 ). Wedge sled ( 41 ) is movable longitudinally within staple cartridge ( 37 ); while staple drivers ( 43 ) are movable vertically within staple cartridge ( 37 ). Staples ( 47 ) are also positioned within cartridge body ( 70 ), above corresponding staple drivers ( 43 ). In particular, each staple ( 47 ) is driven vertically within cartridge body ( 70 ) by a staple driver ( 43 ) to drive staple ( 47 ) out through an associated staple aperture ( 51 ). As best seen in FIGS. 3A-3B and 5, wedge sled ( 41 ) presents inclined cam surfaces that urge staple drivers ( 43 ) upwardly as wedge sled ( 41 ) is driven distally through staple cartridge ( 37 ). [0024] With end effector ( 12 ) closed as depicted in FIG. 3A, firing bar ( 14 ) is advanced in engagement with anvil ( 18 ) by having upper pin ( 38 ) enter a longitudinal anvil slot ( 42 ). A pusher block ( 80 ) is located at the distal end of firing bar ( 14 ), and is configured to engage wedge sled ( 41 ) such that wedge sled ( 41 ) is pushed distally by pusher block ( 80 ) as firing bar ( 14 ) is advanced distally through staple cartridge ( 37 ). During such firing, cutting edge ( 48 ) of firing bar ( 14 ) enters vertical slot ( 49 ) of staple cartridge ( 37 ), severing tissue clamped between staple cartridge ( 37 ) and anvil ( 18 ). As shown in FIGS. 3A-3B, middle pin ( 46 ) and pusher block ( 80 ) together actuate staple cartridge ( 37 ) by entering into a firing slot within staple cartridge ( 37 ), driving wedge sled ( 41 ) into upward camming contact with staple drivers ( 43 ) that in turn drive staples ( 47 ) out through staple apertures ( 51 ) and into forming contact with staple forming pockets ( 53 ) on the inner surface of anvil ( 18 ). FIG. 3B depicts firing bar ( 14 ) fully distally translated after completing severing and stapling tissue. [0025] FIG. 6 shows end effector ( 12 ) having been actuated through a single stroke through tissue ( 90 ). As shown, cutting edge ( 48 ) has cut through tissue ( 90 ), while staple drivers ( 43 ) have driven three alternating rows of staples ( 47 ) through the tissue ( 90 ) on each side of the cut line produced by cutting edge ( 48 ). Staples ( 47 ) are all oriented substantially parallel to the cut line in this example, though it should be understood that staples ( 47 ) may be positioned at any suitable orientations. In the present example, end effector ( 12 ) is withdrawn from the trocar after the first stroke is complete, spent staple cartridge ( 37 ) is replaced with a new staple cartridge, and end effector ( 12 ) is then again inserted through the trocar to reach the stapling site for further cutting and stapling. This process may be repeated until the desired amount of cuts and staples ( 47 ) have been provided. Anvil ( 18 ) may need to be closed to facilitate insertion and withdrawal through the trocar; and anvil ( 18 ) may need to be opened to facilitate replacement of staple cartridge ( 37 ). [0026] It should be understood that cutting edge ( 48 ) may sever tissue substantially contemporaneously with staples ( 47 ) being driven through tissue during each actuation stroke. In the present example, cutting edge ( 48 ) just slightly lags behind driving of staples ( 47 ), such that a staple ( 47 ) is driven through the tissue just before cutting edge ( 48 ) passes through the same region of tissue, though it should be understood that this order may be reversed or that cutting edge ( 48 ) may be directly synchronized with adjacent staples. While FIG. 6 shows end effector ( 12 ) being actuated in two layers ( 92, 94 ) of tissue ( 90 ), it should be understood that end effector ( 12 ) may be actuated through a single layer of tissue ( 90 ) or more than two layers ( 92, 94 ) of tissue. It should also be understood that the formation and positioning of staples ( 47 ) adjacent to the cut line produced by cutting edge ( 48 ) may substantially seal the tissue at the cut line, thereby reducing or preventing bleeding and/or leaking of other bodily fluids at the cut line. Various suitable settings and procedures in which instrument ( 10 ) may be used will be apparent to those of ordinary skill in the art in view of the teachings herein. [0027] It should be understood that instrument ( 10 ) may be configured and operable in accordance with any of the teachings of U.S. Pat. No. 4,805,823; U.S. Pat. No. 5,415,334; U.S. Pat. No. 5,465,895; U.S. Pat. No. 5,597,107; U.S. Pat. No. 5,632,432; U.S. Pat. No. 5,673,840; U.S. Pat. No. 5,704,534; U.S. Pat. No. 5,814,055; U.S. Pat. No. 6,964,363; U.S. Pat. No. 6,978,921; U.S. Pat. No. 6,988,649; U.S. Pat. No. 7,000,818; U.S. Pat. No. 7,111,769; U.S. Pat. No. 7,143,923; U.S. Pat. No. 7,303,108; U.S. Pat. No. 7,367,485; U.S. Pat. No. 7,380,695; U.S. Pat. No. 7,380,696; U.S. Pat. No. 7,404,508; U.S. Pat. No. 7,434,715; U.S. Pat. No. 7,721,930; and/or U.S. Pat. No. 7,455,208. As noted above, the disclosures of each of those patents are incorporated by reference herein. Additional exemplary modifications that may be provided for instrument ( 10 ) will be described in greater detail below. Various suitable ways in which the below teachings may be incorporated into instrument ( 10 ) will be apparent to those of ordinary skill in the art. Similarly, various suitable ways in which the below teachings may be combined with various teachings of the patents cited herein will be apparent to those of ordinary skill in the art. It should also be understood that the below teachings are not limited to instrument ( 10 ) or devices taught in the patents cited herein. The below teachings may be readily applied to various other kinds of instruments, including instruments that would not be classified as surgical staplers. Various other suitable devices and settings in which the below teachings may be applied will be apparent to those of ordinary skill in the art in view of the teachings herein. [0028] II. Exemplary Modular End Effector [0029] FIGS. 7-8 show an exemplary modular end effector ( 100 ) for delivery of a therapeutic agent onto tissue after use of a stapling device, such as instrument ( 10 ). As shown in FIG. 8, end effector ( 100 ) includes exterior walls ( 102 ) defining proximal portion ( 104 ) and distal portion ( 106 ), distal portion ( 106 ) including mixing space ( 108 ) and tip ( 110 ). By way of example only, tip ( 110 ) and exterior walls ( 102 ) may be constructed and operable in accordance with the teachings of U.S. Patent App. Pub. No. 2008/0121657, entitled “Adhesive Dispenser for Surgery”, published May 29, 2008, the disclosure of which is incorporated by reference herein. [0030] End effector ( 100 ) also includes reservoirs or capsules of separate reagents on separate sides of interior wall ( 112 ) along proximal portion ( 104 ) of end effector ( 100 ) to prevent premature mixing of the reagents. For example, first agent ( 114 ) is disposed in first holding space ( 116 ) on one side of wall ( 112 ) and second agent ( 118 ) is disposed in second holding space ( 120 ) on the other side of wall ( 112 ). As will be described below, application of distally directed force against piston ( 122 ) will allow for the reagents to mix at distal portion ( 106 ) of end effector ( 100 ) and be applied to tissue at a desirable location via expulsion through an orifice formed at tip ( 110 ). [0031] Such reagents may include but are not limited to medical fluid components such as thrombin, platelet poor plasma (PPP) platelet rich plasma (PRP), starch, chitosan, alginate, fibrin, polysaccharide, cellulose, collagen, gelatin-resorcin-formalin adhesive, oxidized cellulose, mussel-based adhesive, poly (amino acid), agarose, amylose, hyaluronan, polyhydroxybutyrate (PHB), hyaluronic acid, poly(vinyl pyrrolidone) (PVP), poly(vinyl alcohol) (PVA), polylactide (PLA), polyglycolide (PGA), polycaprolactone (PCL), and their copolymers, VICRYL® (Ethicon, Inc., Somerville, N.J.), MONOCRYL material, PANACRYL (Ethicon, Inc., Somerville, N.J.), and/or any other material suitable to be mixed with biological material and introduced to a wound or defect site, including combinations of materials. Other suitable compounds, materials, substances, etc., that may be used in a medical fluid will be apparent to those of ordinary skill in the art in view of the teachings herein. [0032] In some versions, a medical fluid may be suspended in a biocompatible carrier. [0033] Suitable carriers may include, for example, a physiological buffer solution, a flowable gel solution, saline, and water. In the case of gel solutions, the tissue repair composition may be in a flowable gel form prior to delivery at the target site, or may form a gel and remain in place after delivery at the target site. Flowable gel solutions may comprise one or more gelling materials with or without added water, saline, or a physiological buffer solution. Suitable gelling materials include biological and synthetic materials. Exemplary gelling materials include the following: proteins such as collagen, collagen gel, elastin, thrombin, fibronectin, gelatin, fibrin, tropoelastin, polypeptides, laminin, proteoglycans, fibrin glue, fibrin clot, platelet rich plasma (PRP) clot, platelet poor plasma (PPP) clot, self-assembling peptide hydrogels, Matrigel or atelocollagen; polysaccharides such as pectin, cellulose, oxidized regenerated cellulose, chitin, chitosan, agarose, or hyaluronic acid; polynucleotides such as ribonucleic acids or deoxyribonucleic acids; other materials such as alginate, cross-linked alginate, poly(N-isopropylacrylamide), poly(oxyalkylene), copolymers of poly(ethylene oxide)-poly(propylene oxide), poly(vinyl alcohol), polyacrylate, or monostearoyl glycerol co-Succinate/polyethylene glycol (MGSA/PEG) copolymers; and combinations of any of the foregoing. In addition to providing a flowable carrier solution for tissue fragments, a gelling agent(s) may also act as an adhesive that anchors the tissue repair composition at the target site. In some versions, an additional adhesive anchoring agent may be included in the tissue repair composition or medical fluid. Also, one or more cross-linking agents may be used in conjunction with one or more gelling agents in order to cross-link the gelling agent. [0034] Modular end effector ( 100 ) may be used as a replaceable and removably attachable end effector ( 100 ) with a device such as instrument ( 10 ) or may be used with a dedicated device, such as device ( 124 ) shown in FIG. 7. End effector ( 100 ) may be sized for receipt through conventional trocars of various inner diameters. Referring back to FIG. 7, end effector ( 100 ) is positioned at a distal end of shaft ( 134 ), which is configured to removably receive end effector ( 100 ) via ring ( 126 ). End effector ( 100 ) is inserted into ring ( 126 ) in the direction of arrow (A) shown in FIG. 7. End effector ( 100 ) is removably attached to ring ( 126 ) at the distal end of device ( 124 ), with extended ends or protrusions ( 136 ) for example, which may be received into corresponding notches (not shown) of ring ( 126 ). Conversely, ring ( 126 ) may include protrusions received into corresponding notches of end effector ( 100 ) to attach ring ( 126 ) to end effector ( 100 ). Of course, ring ( 126 ) and end effector ( 100 ) may include a variety of other components or features that are operable to removably secure end effector ( 100 ) to shaft ( 134 ) of device ( 124 ). [0035] Device ( 124 ) of the present example includes trigger ( 128 ) to apply force against piston ( 122 ) disposed at a proximal end of end effector ( 100 ), as shown in FIG. 8, to move piston ( 122 ) in a distal direction. Additionally, a knob ( 130 ) is disposed at a proximal, upper portion of device ( 124 ) on handpiece ( 125 ). Knob ( 130 ) is connected to articulation segment ( 132 ) at the distal end of shaft ( 134 ) such that articulation or actuation of knob ( 130 ) provides a corresponding articulation of articulation segment ( 132 ), allowing ring ( 126 ) and attached end effector ( 100 ) to be moved to a desired position above staples ( 47 ). Articulation segment ( 132 ) may articulate in a horizontal plane along which a longitudinal axis of shaft ( 134 ) of device ( 124 ) is positioned and/or a vertical plane transverse to the horizontal plane. A horizontal or vertical articulation of knob ( 130 ) (e.g., by a user's thumb) effects a corresponding, respective horizontal or vertical articulation of articulation segment ( 132 ). Alternatively, a clockwise or counter-clockwise rotation of knob ( 130 ) may effect a corresponding articulation in a selected plane (either the horizontal or vertical plane, for example). End effector ( 100 ) and/or shaft ( 134 ) of device ( 124 ) may also be rotatable relative to the handpiece ( 125 ) about a longitudinal axis defined by shaft ( 124 ). [0036] Application of force to trigger ( 128 ) results in an application of force in the direction of arrow (B) of FIG. 8 to apply force to piston ( 122 ) of end effector ( 100 ). Various suitable components and configurations that may be used to convert actuation of trigger ( 128 ) into actuation of piston ( 122 ) will be apparent to those of ordinary skill in the art in view of the teachings herein. While handpiece ( 125 ) is formed as a pistol grip with pivoting trigger ( 128 ), it should be understood that handpiece ( 125 ) and trigger ( 128 ) may have any other suitable configuration. [0037] Piston ( 122 ) may comprise a single plunger with aperture ( 138 ) to receive wall ( 112 ) of end effector ( 100 ) or may include a dual plunger formation with each side movable down a side of wall ( 112 ). Piston ( 122 ) moves distally along wall ( 112 ) to apply force against proximal ends of reservoirs or agents ( 114, 118 ) on either side of wall ( 112 ) to move agents ( 114, 118 ) distally towards tip ( 110 ). Distal portion ( 106 ) of end effector ( 100 ) includes tip ( 110 ), which has an aperture through which a spray or other liquid form may be dispelled, for example. Tip ( 110 ) also includes mixing space ( 108 ) defined by end ( 140 ) of wall ( 112 ) and exterior walls ( 102 ) of end effector ( 100 ). Agents ( 114, 118 ), one of which may be fibrin and the other of which may be thrombin, for example, are moved towards and past end ( 140 ) of wall ( 112 ) to mix together in mixing space ( 108 ) before being expelled through the aperture of tip ( 110 ) onto staples ( 47 ) of tissue ( 90 ), for example, as shown in FIG. 10, as therapeutic agent or tissue repair composition ( 142 ). [0038] Use of end effector ( 100 ) either with an instrument such as instrument ( 10 ) described further above or dedicated device ( 124 ) may prevent waste of reagents during delivery, which may occur where reservoirs of material are located near a handle portion of the associated instrument or device. In such locations, reagents may travel further along a lumen within the shaft of the respective instrument or device and have portions remain in the lumen as waste during such travel. Along with a reduced amount of waste, use of end effector ( 100 ) may allow for a reduced amount of reagent to be used within the reservoirs or capsules than would otherwise be used if the reagent was positioned near a handle portion of an instrument or device used to expel such reagent onto tissue. [0039] III. Exemplary Foam Block Integral with End Effector Cartridge [0040] In another version shown in FIG. 9, cartridge ( 37 A) as described above may include an integral foam block ( 144 ) containing an agent, such as a hemostatic agent, to assist with the reduction of bleeding associated with the severing and stapling of tissue via end effector ( 12 ), as described above. FIG. 9 shows an exploded view of cartridge ( 37 A) for removable installation into a channel of lower jaw ( 16 ) of instrument ( 10 ), which operates to sever and/or staple tissue as described above. Cartridge bottom ( 146 ) includes chamber ( 148 ) defined by peripheral walls of cartridge bottom ( 146 ) into which foam block ( 144 ) is inserted. Staples ( 47 ) may be pre-installed into foam block ( 144 ). Alternatively, block ( 144 ) may be positioned between staples ( 47 ) and the underside of a cartridge deck, such as lid ( 150 ). Staples ( 47 ) may comprise a material selected from iron, nickel titanium alloy, stainless steel, and/or titanium. Of course, any other suitable material(s) may be used to form staples ( 47 ). [0041] The material for foam block ( 144 ) may comprise, for example, adjunct or hemostatic agents such as fibrin or thrombin or those described above that assist to coagulate blood and reduce the amount of bleeding at the surgical site. The hemostatic abilities of such adjuncts may also contribute to the use of such adjuncts as adhesives and sealants. The agents may assist to coagulate blood at a surgical site which allows tissue surrounding such blood to stick together and may prevent leaks along the stapled tissue site, for example. [0042] While a foam block is described in the example herein, the material may alternatively comprise a fibrous pad, a matrix, a mesh, or another structure, in accordance with the teachings of, by way of example, U.S. Patent App. Pub. No. 2009/0120994, entitled “Surgical Fastening Device with Initiator Impregnation of a Matrix or Buttress to Improve Adhesive Application”, published May 14, 2009, the disclosure of which is incorporated by reference herein. The material may comprise, for example, a biocompatible material that is a buttress, a matrix having a plurality of openings therein, an open cell foam, a closed cell foam, and/or a fabric pad. The material may have a plurality of openings and may be a foam material containing such openings, or a mesh, or a threadlike structure, and may include porosities that induce a wicking feature to drawing adhesive into the material and ensure the openings remain clear of the adhesive, allowing tissue growth through the openings after application to tissue [0043] Cartridge ( 37 A) may have a greater height with an integral foam block ( 144 ) than without such a foam block, allowing for staples of longer leg length to be used. Lid ( 150 ) includes apertures ( 152 ) through which staples ( 47 ) may be driven and an elongated slot through which firing bar ( 14 ) may be fired, as described above. Lid ( 150 ) is disposed over foam block ( 144 ) and may be snap fit to cartridge bottom ( 146 ) of cartridge ( 37 A), for example. Alternatively, lid ( 150 ) may be molded to cartridge bottom ( 146 ) of cartridge ( 37 A). Other suitable relationships between lid ( 150 ) and cartridge bottom ( 146 ) will be apparent to those of ordinary skill in the art in view of the teachings herein. [0044] As shown in FIG. 10, when end effector ( 12 ) including cartridge ( 37 A) is used, reagent is applied to tissue ( 90 ) during the driving of staples ( 47 ) into tissue ( 90 ) as staples ( 47 ) are advanced through foam block ( 144 ) for receipt against anvil ( 18 ) and form into closed staples ( 47 ) capturing tissue ( 90 ). Cartridge ( 37 A) and/or anvil ( 18 ) may additionally include a separate layer of adjunct or agent that may activate upon receiving the foam of the coated staples to allow the adjunct to spread onto tissue ( 90 ) along with receipt of the staples ( 47 ) onto tissue ( 90 ). For example, one of thrombin or fibrin may be included and freeze dried with saline in foam block ( 144 ) and may activate upon being mixed with the other of thrombin or fibrin when staples ( 47 ) from within foam block ( 144 ) are driven up towards anvil ( 18 ), which may be coated with the other reagent. [0045] As staples ( 47 ) are driven up towards anvil ( 18 ), staples ( 47 ) may be kept substantially vertically oriented by initial placement in such a direction when embedded in foam block ( 144 ). Alternatively, if staples ( 47 ) are disposed below foam block ( 144 ) in chamber ( 148 ) of cartridge bottom ( 146 ), staples ( 47 ) may be kept substantially vertically oriented as staples ( 47 ) are driven up towards anvil ( 18 ) in a similar manner as described above for staples ( 47 ) in cartridge ( 37 ). Chamber ( 148 ) of cartridge bottom ( 146 ) may include internal vertical walls, similar to those shown in FIG. 4, defining vertical slots configured to receive staples ( 47 ) and keep staples ( 47 ) substantially vertically oriented prior to and during the driving of staples ( 47 ) up towards anvil ( 18 ). In particular, each staple ( 47 ) is driven vertically within the body of cartridge ( 37 A) by a staple driver ( 43 ) to drive staple ( 47 ) out through an associated staple aperture ( 152 ). Wedge sled ( 41 ) presents inclined cam surfaces that urge staple drivers ( 43 ) upwardly as wedge sled ( 41 ) is driven distally through staple cartridge ( 37 A). [0046] To accommodate the presence of foam block ( 144 ) in cartridge ( 37 A), wedge sled ( 41 ) and/or staple drivers ( 43 ) may be modified to be increased in size or in the strength of material used to form wedge sled ( 41 ) and/or staple drivers ( 43 ). The modifications may be made to provide an additional force sufficient to drive staples ( 47 ) through foam block ( 144 ) and out through staple apertures ( 152 ) of 11 d ( 150 ) and into forming contact with staple forming pockets ( 53 ) on anvil ( 18 ). The increases in size and/or material strength properties would be comparative to the respective amounts used for wedge sled ( 41 ) and/or staple drivers ( 43 ) to drive staples ( 47 ) in cartridge ( 37 ) out through staple apertures ( 51 ) and into forming contact with staple forming pockets ( 53 ) on anvil ( 18 ), as described above. [0047] It should be understood that any one or more of the teachings, expressions, embodiments, examples, etc. described herein may be combined with any one or more of the other teachings, expressions, embodiments, examples, etc. that are described herein. [0048] The following-described teachings, expressions, embodiments, examples, etc. should therefore not be viewed in isolation relative to each other. Various suitable ways in which the teachings herein may be combined will be readily apparent to those of ordinary skill in the art in view of the teachings herein. Such modifications and variations are intended to be included within the scope of the claims. [0049] Versions of the devices described above may have application in conventional medical treatments and procedures conducted by a medical professional, as well as application in robotic-assisted medical treatments and procedures. [0050] Versions of described above may be designed to be disposed of after a single use, or they can be designed to be used multiple times. Versions may, in either or both cases, be reconditioned for reuse after at least one use. Reconditioning may include any combination of the steps of disassembly of the device, followed by cleaning or replacement of particular pieces, and subsequent reassembly. In particular, some versions of the device may be disassembled, and any number of the particular pieces or parts of the device may be selectively replaced or removed in any combination. Upon cleaning and/or replacement of particular parts, some versions of the device may be reassembled for subsequent use either at a reconditioning facility, or by a user immediately prior to a procedure. Those skilled in the art will appreciate that reconditioning of a device may utilize a variety of techniques for disassembly, cleaning/replacement, and reassembly. Use of such techniques, and the resulting reconditioned device, are all within the scope of the present application. [0051] By way of example only, versions described herein may be sterilized before and/or after a procedure. In one sterilization technique, the device is placed in a closed and sealed container, such as a plastic or TYVEK bag. The container and device may then be placed in a field of radiation that can penetrate the container, such as gamma radiation, x-rays, or high-energy electrons. The radiation may kill bacteria on the device and in the container. The sterilized device may then be stored in the sterile container for later use. A device may also be sterilized using any other technique known in the art, including but not limited to beta or gamma radiation, ethylene oxide, or steam. [0052] Having shown and described various versions in the present disclosure, further adaptations of the methods and systems described herein may be accomplished by appropriate modifications by one of ordinary skill in the art without departing from the scope of the present invention. Several of such potential modifications have been mentioned, and others will be apparent to those skilled in the art. For instance, the examples, versions, geometrics, materials, dimensions, ratios, steps, and the like discussed above are illustrative and are not required. Accordingly, the scope of the present invention should be considered in terms of the following claims and is understood not to be limited to the details of structure and operation shown and described in the specification and drawings. SUMMARY: [/INST] A modular end effector delivers a therapeutic agent onto tissue that has been severed and/or stapled. The end effector is removably attached to a device. The device applies force to a piston of the end effector. The force causes a distal movement of a piston along a wall disposed within the end effector. The piston engages with agents stored on opposite sides of the wall, moving the agents distally to a mixture space. The agents are mixed in the mixture space and expelled through a tip. Staples may be embedded in or disposed below a foam block, which is disposed within a staple cartridge. Via an endoscopic stapling device, coated staples are driven through tissue while interacting with another agent on the device or the cartridge. The interaction forms a tissue restoring material that is applied onto the tissue. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The yeast Saccharomyces cerevisiae undergoes a dramatic growth transition from its unicellular form to a filamentous state, marked by the formation of pseudohyphal filaments of elongated and connected cells. Yeast pseudohyphal growth is regulated by signaling pathways responsive to reductions in the availability of nitrogen and glucose, but the molecular link between pseudohyphal filamentation and glucose signaling is not fully understood. Here, we identify the glucose-responsive Sks1p kinase as a signaling protein required for pseudohyphal growth induced by nitrogen limitation and coupled nitrogen/glucose limitation. To identify the Sks1p signaling network, we applied mass spectrometry-based quantitative phosphoproteomics, profiling over 900 phosphosites for phosphorylation changes dependent upon Sks1p kinase activity. From this analysis, we report a set of novel phosphorylation sites and highlight Sks1p-dependent phosphorylation in Bud6p, Itr1p, Lrg1p, Npr3p, and Pda1p. In particular, we analyzed the Y309 and S313 phosphosites in the pyruvate dehydrogenase subunit Pda1p; these residues are required for pseudohyphal growth, and Y309A mutants exhibit phenotypes indicative of impaired aerobic respiration and decreased mitochondrial number. Epistasis studies place SKS1 downstream of the G-protein coupled receptor GPR1 and the G-protein RAS2 but upstream of or at the level of cAMP-dependent PKA. The pseudohyphal growth and glucose signaling transcription factors Flo8p, Mss11p, and Rgt1p are required to achieve wild-type SKS1 transcript levels. SKS1 is conserved, and deletion of the SKS1 ortholog SHA3 in the pathogenic fungus Candida albicans results in abnormal colony morphology. Collectively, these results identify Sks1p as an important regulator of filamentation and glucose signaling, with additional relevance towards understanding stress-responsive signaling in C. albicans. Multiple fungal species exhibit complex morphological changes in response to environmental conditions, generating multicellular forms or structures critical to the respective life cycles of these organisms [1]–[3]. These morphological transitions have been linked to virulence in several human and plant fungal pathogens, including Candida albicans, Cryptococcus neoformans, Aspergillus fumigates, and Ustilago maydis [4]–[6]. In particular, several lines of study have established that the formation of hyphal filaments is required for virulence in the opportunistic human fungal pathogen C. albicans [7]–[10]. The budding yeast Saccharomyces cerevisiae also exhibits a morphogenetic transition from its typical form to a filamentous state [11], and the study of this dimorphism in S. cerevisiae has contributed considerably to our understanding of important cell signaling mechanisms, while also providing insight into the molecular basis of fungal pathogenicity [3]. The morphological transition in S. cerevisiae is pronounced: yeast cells undergoing pseudohyphal growth are elongated and remain connected after cytokinesis, forming multicellular chains, or filaments [11]–[15]. These filaments of connected cells can spread out along the surface of a solid growth substrate as well as invade the substrate [11] and are referred to as pseudohyphae, since they resemble the hyphae of other fungal species but lack the structure of a true hyphal tube [16]. Strains of S. cerevisiae competent to undergo pseudohyphal growth (e. g., the Σ1278b strain used here) initiate this transition in response to conditions of nitrogen limitation and/or glucose limitation [11], [17], [18]. Consequently, pseudohyphal growth is considered to be an adaptive mechanism, enabling non-motile yeast cells to forage for nutrients when local resources become limited [19]. The morphological changes associated with pseudohyphal growth are driven by a host of altered developmental processes, including a delay in the G2/M cell-cycle transition that produces the elongated cell morphology [20]–[22], a switch to a unipolar budding pattern [11], [20], and increased cell-cell adhesion [11]. At least 700 single gene deletions in the filamentous Σ1278b strain of S. cerevisiae result in pseudohyphal growth phenotypes [23], [24], and classic studies have established three well-studied signaling pathways as regulators of pseudohyphal differentiation: the mitogen-activated protein kinase (MAPK) pathway, the cAMP-dependent protein kinase A (PKA) pathway, and the sucrose non-fermentable (SNF) pathway. The yeast pseudohyphal growth MAPK pathway consists of the MAPKKK Ste11p, the MAPKK Ste7p, and the MAPK Kss1p [12], [13], [25]–[27]. Ste11p is phosphorylated by the p21-activated kinase Ste20p [28], and Kss1p phosphorylates the key heterodimeric transcription factor Ste12p/Tec1p [29], [30]. In S. cerevisiae, PKA consists of the regulatory subunit Bcy1p and one of three catalytic subunits, Tpk1p, Tpk2p, and Tpk3p [31], [32]. Deletion of TPK2 results in a loss of pseudohyphal growth, and Tpk2p has been implicated most extensively in filamentation and the response to nitrogen stress [31]. Tpk2p phosphorylates the transcription factor Flo8p, which is required for pseudohyphal growth [32], [33]. Snf1p is a member of the AMP-activated kinase family and regulates transcriptional changes associated with glucose derepression [34], [35]. Snf1p regulates the key pseudohyphal growth effector FLO11 through repression of the negative regulators Nrg1p and Nrg2p [35]. The Kss1p MAPK pathway and PKA also activate FLO11 transcription through Ste12p/Tec1p and Flo8p, respectively [36]–[38]. Notably, each pathway above is involved in the cellular response to nutrient availability [18], [39], [40]. In particular, glucose, the preferred carbon source of budding yeast, effects changes in transcription principally through the Ras/PKA pathway [41], and glucose limitation activates the heterotrimeric Snf1p kinase complex through phosphorylation of T210 in Snf1p [42], [43]. The mechanisms by which these signals are then propagated and executed to elicit pseudohyphal differentiation, however, are still under investigation. Studies from Bisson and colleagues [44] identified the SKS1 gene, encoding a Ser/Thr kinase, as a multicopy suppressor of snf3Δ; mutants deleted for SNF3 are defective in high-affinity glucose transport and cannot grow by fermentation on low-glucose medium. Yang and Bisson also demonstrated that Sks1p kinase activity was required for phenotypic suppression of snf3Δ. Recent work in our lab indicated that Sks1p undergoes a localization shift to the nucleus during butanol-induced pseudohyphal growth and that its kinase activity is required for wild-type localization of Ksp1p, a stress granule-associated protein with pseudohyphal growth deletion phenotypes [45]. Thus, SKS1 may regulate both glucose-responsive signaling and pseudohyphal development, with the potential to serve as an integrator between these interrelated signaling processes. We initially assessed the role of Sks1p in pseudohyphal growth through a series of phenotypic studies analyzing pseudohyphal filamentation in SKS1 mutants under conditions of nitrogen limitation. For this work, we constructed homozygous diploid sks1Δ/Δ, and sks1-K39R/sks1-K39R mutants in the filamentous Σ1278b genetic background, with the latter strain containing a site-directed mutation yielding greatly diminished kinase activity. On low-nitrogen (SLAD) media, loss of either the gene or its kinase activity resulted in decreased surface-spread filamentation relative to an isogenic wild-type strain (Figure 1A). The introduction of a centromeric plasmid bearing wild-type SKS1 under transcriptional control of its native promoter was able to rescue the loss of pseudohyphal growth exhibited by the sks1Δ/Δ mutant, while introduction of a similar plasmid bearing the kinase-dead variant of SKS1 (sks1-K39R) was unable to restore wild-type filamentation (Figure 1B). Overexpression of SKS1 from a high-copy 2μ plasmid induced hyper-filamentation under conditions of nitrogen limitation (Figure 1C). To determine the molecular basis of Sks1p kinase regulation of peudohyphal growth, we analyzed the Sks1p kinase signaling network by quantitative phosphoproteomics. Our approach was straightforward; we implemented a mass spectrometry-based method utilizing stable isotope labeling of amino acids in cell culture (SILAC) to identify proteins differentially phosphorylated upon loss of Sks1p kinase activity [46], [47]. As outlined in Figure 2A, a strain that was wild-type with respect to SKS1 and an otherwise isogenic strain carrying the sks1-K39R allele in the filamentous Σ1278b background were made auxotrophic for arginine and lysine; the wild-type and sks1kinase-dead strains were subsequently grown in triplicate for five cell doublings in media containing unlabeled or labeled arginine and lysine, respectively, in the presence of butanol to induce pseudohyphal growth. Prepared proteins from both sets of samples were enriched for phosphopeptides, and differences in phosphopeptide abundance between the wild-type and kinase-dead samples were determined by mass spectrometry. By this approach, we profiled 903 phosphorylation sites across the yeast proteome, identifying 114 phosphopeptides differentially abundant upon enrichment from the sks1 kinase-dead strain relative to wild-type (Figure 2B). These peptides correspond to 91 proteins in total, encompassing phosphorylation events directly and indirectly dependent upon the presence of Sks1p kinase activity. Interestingly, by comparing the phosphorylation sites determined in this study against S. cerevisiae phosphorylation sites reported in public databases, we identified 39 new phosphorylation sites in the yeast proteome. Table 1 presents novel phosphorylation sites in peptides differentially abundant upon phosphopeptide enrichment from the sks1-K39R mutant relative to wild type. A listing of phosphopeptides is presented in Dataset S1, and the full mass spectrometry dataset can be accessed at ProteomeXchange (dataset identifier PXD000414). The set of Sks1p-dependent phosphoproteins identified in this study is statistically enriched (p-value of 10−2) for the cellular pathway enabling glycolysis and gluconeogenesis (Figure 3A), as defined in the KEGG database; the glycolysis and gluconeogenesis pathway is annotated in KEGG as sce00010. To gain a better understanding of the means through which Sks1p-dependent glucose signaling impacts additional cell processes and pathways, we used the glycolysis/gluconeogenesis pathway as a starting point for the construction of an interaction network. In brief, reported genetic and physical interactions with components of the KEGG glycolysis/gluconeogenesis pathway were incorporated and expanded until Sks1p was included in the network as well as MAPK signaling and cell cycle pathways known to be required for wild-type pseudohyphal growth (Figure 3B and C). The resulting interaction network structure indicates two points. First, the clusters of genes enriched in MAPK signaling and cell cycle control exhibit a greater number of genetic and physical interactions between each other than with the cluster of genes enriched for glycolysis/gluconeogenesis; this is evident visually from the dark blue lines in Figure 3A indicating increased interaction density connecting the MAPK- and cell cycle-enriched clusters. Second, the network distance of Sks1p to proteins exhibiting Sks1p-dependent phosphorylation in the glycolysis/gluconeogenesis-enriched cluster is typically small and establishes a stronger interconnection between Sks1p and this cluster than with clusters enriched for MAPK signaling and cell cycle regulation. This result is consistent with the observed enrichment for the KEGG glycolysis/gluconeogenesis pathway in the set of proteins exhibiting Sks1p-dependent phosphorylation. The interactions used to construct this network are presented in Dataset S2. As a first step towards identifying the phosphorylation events responsible for the filamentation defect observed in sks1-K39R, we screened a panel of yeast proteins exhibiting Sks1p-dependent phosphorylation for phenotypes similar to those of genes whose deletion affects pseudohyphal growth. Genes were selected by cross-referencing the list of phosphoproteins identified by our mass spectrometry study with genes identified as having pseudohyphal growth phenotypes [23], [24]. For this analysis, we prioritized genes with a role in glucose signaling. Homozygous diploid gene deletions were generated and screened for surface-spread filamentation under conditions of nitrogen limitation (SLAD medium) and nitrogen/glucose limitation (SLALD medium). Wild-type S. cerevisiae of the Σ1278b genetic background exhibits surface-spread filamentation on both SLAD and SLALD medium, and the homozygous sks1Δ/Δ mutant displays a loss of filamentation on both media. Figure 4A indicates deletion mutants exhibiting pseudohyphal growth phenotypes under these conditions. Strains deleted for BUD6, ITR1, MDS3, NPR3, and PDA1 displayed significantly decreased pseudohyphal growth on both SLAD and SLALD medium; lrg1Δ/Δ mutants exhibited decreased pseudohyphal growth under conditions of nitrogen/glucose limitation. These genes contribute to pathways and cell processes required for pseudohyphal growth. MDS3 and NPR3 are TOR pathway components [48], [49], and LRG1 encodes a putative GTPase-activating protein involved in the Pkc1p signaling pathway controlling cell wall integrity [50]. Bud6p is a polarity protein required for budding [51], and Itr1p is a myo-inositol transporter [52]; Pda1p is a subunit of the pyruvate dehydrogenase complex and will be discussed below. As indicated in Figure 4A, deletion of the HXT1 gene encoding a low-affinity glucose transporter yielded hyperactive pseudohyphal growth on SLAD and SLALD media. Deletion of RCK2 encoding a kinase responsive to oxidative and osmotic stress resulted in increased pseudohyphal growth; a similar phenotype has been observed upon decreased activity of the osmo-responsive Hog1p MAPK pathway [53]. To assess the functional significance of Sks1p-dependent phosphorylation sites, we constructed homozygous diploid strains containing chromosomal point mutations in BUD6, ITR1, LRG1, NPR3, and PDA1, substituting a non-phosphorylatable residue for the Sks1p-dependent phosphorylation site (Figure 4B). Corresponding phosphopeptides for each phosphorylation site exhibited decreased abundance upon zirconium dioxide enrichment in the kinase-dead sks1-K39R mutant. These integrated point mutants were assayed for fitness in SLAD and SLALD media, and each mutant exhibited a fitness defect relative to wild-type (Figure 4C and D), indicating that the mutated residues are necessary for optimal response to nitrogen and nitrogen/glucose limitation. Growth and growth rates for these strains in synthetic complete (SC) media are provided in Tables S5 and S6. Of the point mutants assayed above, strains with mutations in PDA1 exhibited pseudohyphal growth defects on low-nitrogen medium, with a much less acute growth defect in SC media. As indicated in Figure 5A and B, two distinct point mutations in PDA1, the Y309A and S313A alleles, yield a dramatic fitness defect and loss of pseudohyphal differentiation in nitrogen-limiting conditions. Pda1p is a subunit of the mitochondrial pyruvate dehydrogenase complex involved in the conversion of pyruvate to acetyl-CoA [54]. Cells lacking PDA1 demonstrate diminished growth on glucose from a respiratory deficiency due to mitochondrial DNA loss [55]. We found no noticeable difference in protein levels for either single point-mutant (Y309A and S313A) or the double mutant (Y309A-S313A) relative to a wild-type strain (Figure 5C), indicating that the observed phenotypes were not due to instability of Pda1p. Interestingly, when each mutant was screened on glycerol-containing media that forced respiratory growth, the S313A mutant grew as well as wild-type, while the Y309A mutant exhibited a phenotype analogous to the pda1Δ/Δ mutant [55] (Figure 5D). The double Y309A-S313A mutant shared the respiratory deficiency of the Y309A mutant. We also investigated whether the mutation of these residues altered mitochondrial structure or mitochondrial DNA. By live-cell DAPI staining, no abnormal mitochondrial DNA phenotypes were observed between the wild-type strain, the pda1Δ/Δ mutant, or any of the site-directed mutants (Figure 5E, lower). However, staining with the membrane-potential-dependent dye MitoTracker illustrates dramatic differences in mitochondrial membrane potential or structure between these mutants and wild-type (Figure 5E, middle). The wild-type and pda1-S313A strains exhibit similar mitochondrial staining, while the pda1Δ, pda1-Y309A, and pda1-Y309A-S313A mutants all demonstrate a mitochondrial membrane phenotype. Collectively, both the Y309A and S313A mutations result in the abolishment of pseudohyphal growth in conditions of low nitrogen, and the Y309A mutation also yields phenotypes indicative of impaired respiration. The studies presented here support a role for Sks1p in enabling wild-type glucose signaling and pseudohyphal growth; however, the molecular context and genetic relationships of SKS1 with respect to the corresponding signaling pathways is unclear. Consequently, we performed epistasis experiments examining the phenotypic consequences of over-expressing SKS1 in diploid S. cerevisiae strains deficient for components of both glucose signaling pathways and pseudohyphal signaling networks (Figure 6A and B). Here, we examined whether SKS1 could act as a high-copy suppressor of mutations in cAMP signaling (gpr1Δ/Δ, ras2Δ/Δ, and tpk2Δ/Δ), MAPK signaling (ste20Δ/Δ), or Snf1p signaling (snf1Δ/Δ). Each of these mutations generates a yeast strain deficient in pseudohyphal differentiation under conditions of limiting nitrogen. We found that over-expression of SKS1 was able to suppress the gpr1Δ/Δ phenotype (Figure 6C). Interestingly, a ras2Δ/Δ mutant also demonstrated a moderate phenotypic rescue from overexpression of SKS1; however, SKS1 overexpression did not restore pseudohyphal growth in a tpk2Δ/Δ mutant, indicating that SKS1 acts downstream of GPR1 and RAS2 but upstream of or at the level of TPK2 (Figure 6D). Overexpression of SKS1 in the gpr1Δ/Δ and ras2Δ/Δ backgrounds did not result in filamentation on media with normal levels of nitrogen. SKS1 did not suppress mutations in STE20 or SNF1. Consistent with this STE20 result, the sks1Δ/Δ mutant exhibited no loss of pseudohyphal MAPK signaling under conditions of nitrogen limitation (data not shown), as assessed using a PFRE (TEC1) -lacZ reporter system that is specifically responsive to the MAPK signaling components required for filamentous growth [26]. We also tested whether deletion of SKS1 could affect the hyper-filamentous phenotype of strains deleted for PDE1, which encodes a phosphodiesterase that degrades cAMP [56], and strains deleted of GPB1, which encodes a Gβ-subunit of the Gpa2p heterotrimeric G protein [57]. In each case, the double deletion mutants remained hyperfilamentous, indicating no clear genetic relationship between SKS1 and these genes. In complement to our analysis of Sks1p kinase activity, we also investigated whether known transcriptional regulators of pseudohyphal development influenced the expression of SKS1. Analysis of SKS1 transcription via quantitative real-time (qRT) PCR identified several results, as follows. First, SKS1 mRNA levels were responsive to nitrogen and glucose limitation in wild-type S. cerevisiae of the filamentous Σ1278b background. SKS1 transcript levels increased by nearly 180% under conditions of nitrogen limitation coupled with glucose limitation (SLALD medium) (Figure 7A). A comparison of SKS1 transcript levels between mutants deleted for known transcriptional regulators of pseudohyphal differentiation (flo8Δ/Δ, mfg1Δ/Δ, mga1Δ/Δ, mss11Δ/Δ, phd1Δ/Δ, phd1Δ/Δ, and tec1Δ/Δ) and wild-type S. cerevisiae found that the transcription factor Mss11p, involved in glucose signaling, invasive growth, and starch degradation, as well as Flo8p, the well-known filamentous growth transcriptional activator, exhibited minor decreases in SKS1 mRNA levels under the indicated extracellular conditions (Figure 7B). The flo8Δ/Δ mutant displayed an approximate 30% reduction in SKS1 transcript levels relative to a wild-type strain in both standard and low nitrogen/glucose SLALD media. Mss11p demonstrated a reduction in SKS1 mRNA levels of nearly 65%, but only in standard media promoting vegetative growth. We also examined the SKS1 transcriptional response in a diploid strain deleted for RGT1, encoding a glucose-responsive transcriptional regulator known to repress the expression of many HXT genes [58], [59]. Compared to the wild-type control, the rgt1Δ/Δ mutant demonstrated a marked increase in SKS1 transcript abundance under conditions of low nitrogen coupled with glucose limitation (Figure 7B). Candida albicans is both a successful commensal and pathogen of humans, sharing with S. cerevisiae the ability to undergo morphological transitions in response to appropriate environmental cues [7], [60]–[62]. The importance of this morphological differentiation is underscored by the fact that hyphal development is required for virulence in C. albicans. The S. cerevisiae SKS1 gene is conserved in C. albicans, and considering the strong conservation of pathway structure between these organisms, we hypothesized that the SKS1 ortholog in C. albicans may serve a similar function in integrating environmental cues to regulate fungal morphology. To test this hypothesis, we generated a heterozygous deletion of the SKS1 ortholog SHA3 in the C. albicans strain BWP17. SHA3 shares approximately 33% sequence identity with SKS1 and also encodes a kinase involved in glucose transport and glucose-responsive signaling [63] (Figure 8A). On Spider growth medium in which mannitol is the carbon source, the C. albicans SHA3 heterozygous mutant displayed a decrease in colony wrinkling relative to an isogenic wild-type strain (Figure 8B). Consistent with this result, Uhl et al. [64] found that a heterozygous mutant containing a transposon insertion upstream of SHA3 in its promoter region exhibited decreased hyphal growth on Spider medium. In liquid culture, cell morphology is wild type in the SHA3 heterozygous deletion mutant (Figure 8C), but the mutant does exhibit a statistically significant decrease in biofilm formation on Spider medium (Figure 8D). The ratio of biofilm formation on Spider media versus control RPMI buffer also indicates an approximately three-fold decrease in the sha3Δ/SHA3 strain relative to wild type. Since the heterozygous sha3 mutant exhibits a phenotype on Spider medium, we examined if colony morphology was affected on media containing other carbon sources. As indicated in Figure 8E, the sha3Δ/SHA3 mutant exhibits a colony morphology distinct from wild type on medium with glucose as the carbon source and a slight phenotype on media containing sucrose. Cellular adaptation to nitrogen or carbon deprivation in S. cerevisiae requires the remodeling of cellular metabolism and the precisely coordinated restructuring of cellular morphology. Here, we identify the glucose-responsive Sks1p kinase as a signaling protein required for pseudohyphal growth induced by nitrogen limitation and nitrogen limitation coupled with glucose limitation. Ninety-one proteins undergo Sks1p-dependent phosphorylation, and the functional scope of these phosphoproteins identifies Sks1p contribution to glucose signaling as well as additional processes and pathways required for pseudohyphal growth, including mitochondrial function. Epistasis studies indicate that SKS1 acts downstream of GPR1 and RAS2, consistent with Sks1p regulation of or by glucose-responsive cAMP signaling. SKS1 transcript levels are dependent upon Mss11p and Rgt1p. SKS1 is conserved, and the SKS1 ortholog SHA3 in C. albicans is required for wild-type colony morphology on glucose-containing medium and on Spider medium with mannitol as a carbon source. Collectively, these results are consistent with a function for Sks1p kinase activity in the integration of glucose-responsive signaling and filamentous development – an example of signaling crosstalk that has not been extensively studied or well understood. In this study, we utilized a SILAC-based mass spectrometry approach to identify phosphorylation events dependent upon Sks1p kinase activity. In S. cerevisiae, several phosphoproteomic strategies have been utilized recently to profile differential phosphorylation [65]–[68]. In particular, Bodenmiller et al. [69] implemented a label-free mass-spectrometry approach to investigate the global phosphoproteomic response of S. cerevisiae to the systematic deletion of protein kinases and phosphatases. Trade-offs exist in considering the relative advantages of both label-free and labeling strategies. Label-free methods have been shown to identify a larger number of proteins than label-based methods; however, SILAC-based strategies typically enable better quantification and identification of differentially abundant proteins, while also providing greater reproducibility across samples [70]. It is important to bear in mind that both label-free and SILAC-based interventional phosphoproteomic methods identify direct and indirect phosphorylation events; consequently, the studies here are intended to identify the broad scope of cell processes and pathways encompassed within the Sks1p signaling network. Notably, the study by Bodenmiller and colleagues did address the Sks1p signaling network in a non-filamentous strain under vegetative growth conditions, and approximately 30% of the proteins detected in this analysis were also identified by label-free methods in that work. Further, the overlap between the datasets is striking, in that nine proteins exhibiting Sks1p-dependent phosphorylation in a non-filamentous strain under vegetative conditions were also identified as being differentially phosphorylated in our analysis of sks1-K39R in a filamentous strain under conditions inducing pseudohyphal growth; these phosphoproteins include Cdc37p, Crp1p, Fyv8p, Hxt1p, Mrh1p, Mtc1p, Pda1p, Pil1p, Ptr2p, Rck2p, Zuo1p, and Ymr196w. The proteins Hxt1p, Rck2p, and Pil1p are stress-responsive, and Mrh1p, Pil1p, and Pda1p have been reported to localize to mitochondria, highlighting important processes and functions required for wild-type glucose signaling and pseudohyphal growth. The dependence of Pda1p phosphorylation upon Sks1p and phenotypic analysis of Pda1 Y309A and S313A mutants underscores that wild-type mitochondrial membrane structure and function is interconnected with Sks1p kinase signaling. Interestingly, signaling pathways that regulate filamentation, cAMP-PKA and Snf1p, have also been shown to target mitochondria [71]–[73], and genetic screens of pseudohyphal deficient mutants have identified genes required for mitochondrial function [17], [23], [74]. The S313 residue of Pda1p is a known phosphorylation site, and phosphorylation of S313 inhibits Pda1p activity in vitro [75], [76]. Further, Oliveira et al. [77] report that the S313A mutant exhibits increased flux through pyruvate dehydrogenase during growth on glucose in a non-filamentous strain. As reported here, a filamentous strain containing the S313A mutation is able to grow on medium with glycerol as the sole carbon source. Interestingly, however, both the Pda1p S313 and Y309 residues are required for pseudohyphal growth. Sks1p is a Ser/Thr kinase; consequently, the Y309 residue in Pda1p is not expected to be a direct phosphorylation target of Sks1p. Further, Pda1p is a mitochondrial protein, and our previous analysis of Sks1p-YFP subcellular distribution did not identify mitochondrial localization [45]. Rather, we expect that Sks1p is required for wild-type phosphorylation of Pda1p Y309 because it functions in a signaling network that results in this phosphorylation event. Ongoing investigations are directed towards identifying the kinase that phosphorylates Pda1p Y309 and the mechanism by which the Y309 and S313 residues contribute to pseudohyphal growth. Our results indicate that SKS1 mRNA levels are glucose-regulated in the filamentous Σ1278b strain and that this regulation in SLALD medium is carried out in part by Rgt1p. Two lines of evidence support this result. First, analysis of the yeast transcriptional response to glucose by Wang et al. [41] indicated that SKS1 mRNA levels increase more than two-fold when cells are switched from galactose to glucose-containing media. Second, the snf3Δ phenotype is subject to high copy number suppression by the SKS1 promoter sequence, which titrates Rgt1p [78], [79]. In addition to possessing binding sites for Rgt1p, the SKS1 promoter is reportedly bound by Mss11p and Flo8p [24], [80], although we observe that the relative individual contributions of these transcription factors to the establishment of SKS1 mRNA levels is modest under conditions of nitrogen limitation and nitrogen/glucose limitation. Considered collectively, transcriptional regulation of SKS1 likely results from the combinatorial contributions of numerous transcription factors. Under conditions of glucose limitation, Rgt1p actively binds target promoters to repress transcription of glucose-induced genes, and the observed increase in SKS1 transcript levels upon RGT1 deletion under low-glucose conditions is consistent with this observation. However, SKS1 mRNA levels increase upon growth in SLALD media, indicating that Rgt1p cannot be predominantly responsible for the establishment of overall SKS1 transcript levels. Additional factors, including Mss11p and Flo8p, must contribute to this transcriptional control as well, presenting a more complex picture of SKS1 transcriptional control. Coupling findings from this study with previous work, we suggest that Sks1p mediates cellular response to glucose limitation and nitrogen limitation by signaling through Gpr1p and the cAMP-PKA pathway. In this study, we demonstrate that SKS1 is a high-copy suppressor of pseudohyphal-deficient gpr1Δ/Δ and ras2Δ/Δ mutants. Both Gpr1p and Ras2 are components of the cAMP-dependent PKA pathway. Gpr1p is a nutrient sensor that activates cAMP in response to low-levels of extracellular glucose [81] and regulates pseudohyphal differentiation in S. cerevisiae [82]. Overexpression of SKS1 failed to restore pseudohyphal growth in a strain deleted for TPK2. Tk2p is one of three catalytic subunits of PKA; TPK2 is required for pseudohyphal growth, and its function is required for the phosphorylation of Flo8p and additional key signaling events necessary for pseudohyphal differentiation [32], [83]. Thus, Sks1p may contribute to the regulation of Tpk2p or may be regulated indirectly by Tpk1p or Tpk3p. Sks1p has not been identified as a phosphoprotein, and any such mechanisms of Sks1p regulation have not been identified to date. Pseudohyphal growth in S. cerevisiae is an excellent model of related processes of filamentous development in the principal opportunistic human fungal pathogen Candida albicans. In C. albicans, a variety of culture conditions, including growth on Spider medium with mannitol as a carbon source, results in the development of pseudohyphae and true hyphal tubes [9]. Orthologs of many S. cerevisiae pseudohyphal growth genes play similarly important roles in C. albicans hyphal development, and we find that the SKS1 ortholog SHA3 is required for wild-type colony morphology in C. albicans on Spider medium. The cAMP-PKA pathway is required for hyphal development and virulence in C. albicans, exhibiting structural similarity to the orthologous pathway in S. cerevisiae. Notably, GPR1 is conserved, and Ras1p in C. albicans contributes to the production of cAMP through adenylate cyclase in response to various stimuli [84]. The PKA catalytic subunits Tpk1p and Tpk2p have been identified in C. albicans, and it will be interesting to determine if the functional relationship between SHA3 and this cAMP-PKA pathway is similar to that which we observe in S. cerevisiae. The strains used in this study are listed in Table S1 and are isogenic derivatives of the Σ1278b strain [11], [85]. All strains were generated from the MATa haploid strain Y825 (ura3-52 leu2Δ) and the MATα haploid strain HLY337 (ura3-52 trp1-1). Standard yeast media and microbiological techniques were used [86]. Briefly, standard growth media consisted of YPD (1% yeast extract, 2% peptone, 2% glucose) or Synthetic Complete (SC) (0. 67% yeast nitrogen base (YNB) without amino acids, 2% glucose, and 0. 2% of the appropriate amino acid drop-out mix). Nitrogen deprivation and filamentous phenotypes were assayed using Synthetic Low Ammonium Dextrose (SLAD) medium (0. 17% YNB without amino acids, 2% glucose, 50 µM ammonium sulfate and supplemented with appropriate amino acids) and Synthetic Low Ammonium Low Dextrose (SLALD) medium (0. 17% YNB without amino acids, 0. 05% glucose, 50 µM ammonium sulfate and supplemented with appropriate amino acids) [11], [87], [88]. Respiratory competency was assayed using YPG (1% yeast extract, 2% peptone, 3% glycerol). For plates, autoclaved 2% agar was added to the media. To promote C. albicans vegetative growth, 80 µg/mL of uridine was added to all media unless otherwise noted. Hyphal growth was induced in C. albicans via growth in Spider medium and/or 10% serum-containing medium for the indicated times at 37°C [89]. Plasmids used in this study are listed in Table S2. Plasmids pFRE-lacZ and pSKS1-K39R-vYFP were constructed as described [26], [45]. To overexpress SKS1, the SKS1 open reading frame was amplified from genomic DNA and cloned into XmaI-XhoI-digested p426GPD [90]. The GPD promoter was then replaced with the ADH1 promoter amplified from genomic DNA (−1464 to 0) and cloned into SacI-XmaI-digested p426-GPD-SKS1 to generate plasmid pCK020. Gene deletion mutants were constructed in strains Y825 and HLY337 using a one-step PCR-based gene-disruption strategy [91], [92] with the G418 resistance cassette from plasmid pFA6a-KanMX6 [93]. Integrated point mutations were generated using the one-step site-directed mutagenesis strategy described in Zheng et al. [94]. After confirming the haploid mutants via PCR and site-directed mutants via sequencing, the strains were allowed to mate on YPD+G418 plates for approximately 20 hours at 30°C. Mated cells were then streaked on SC-Trp-Leu plates to select for Y825×HLY337 diploids. All yeast transformations were performed according to standard lithium acetate-mediated protocols [95]–[97]. Defects in surface spread filamentation were assessed as described [98]. In brief, yeast strains were grown overnight and were subsequently diluted to an OD600 of approximately 0. 2 in fresh media. Cells were grown for at least two doublings, to an OD600 of approximately 0. 6–1. 0. Approximately 1 mL of each cell culture was transferred to a microcentrifuge tube, where the cultures were washed twice with sterile water before suspending in 1 mL sterile water and serially diluting such that the density of plating was approximately102–103 cells per plate; high-density plating has been shown to decrease the rate at which cells transition to the filamentous form [99]. Diluted cultures were then spread on SLAD and/or SLALD plates supplemented with appropriate amino acids and incubated at 30°C for 3 or more days. Cells were imaged using a Photometrics CoolSnapES2 digital camera mounted on a Nikon Eclipse 80i upright microscope. Colony morphology was imaged using a 4× objective, while cellular morphology was imaged with a 100× oil-immersion objective. S. cerevisiae Y825 control and sks1-K39R mutant cells were isotopically labeled with medium (Lys-4/Arg-8) amino acids during cell culture (SILAC). Cell cultures were lysed by bead beating in lysis buffer; the lysis buffer was composed of 50 mM tris buffer (pH 8. 2), 8 M urea, and protease inhibitors (Roche) and phosphatase inhibitors (50 mM NaF, 50 mM beta-glycerophosphate, 1 mM sodium vanadate, 10 mM sodium pyrophosphate, 1 mM phenylmethylsulfonyl fluoride). Frozen cells were suspended in 400 µl lysis buffer and were lysed by applying three cycles of bead beating (for one minute each) with a 2-minute rest on ice between cycles. Supernatants containing protein extract were recovered by centrifugation at 14,000 g for 10 minutes, and protein concentrations were measured by Bradford assay. Equal amounts of protein from three SILAC-labeled cells were combined, treated for disulfide reduction and alkylation, and digested with TMPK-treated trypsin (Worthington Biochemical Corp., Lakewood, NJ) at a trypsin∶protein ratio of 1∶10 at 37°C overnight. Peptide mixtures were desalted with C18 (Waters) and separated into 12 strong cation exchange (SCX) fractions on a PolySulfoethyl A column (PolyLC, 150×4 mm) over a 48 minute salt gradient with two mobile phases: 100% solvent A (5 mM KH2PO4,30% acetonitrile, pH 2. 7) for 5 minutes, a linear gradient of 0–40% solvent B (250 mM KH2PO4,30% acetonitrile, pH 2. 7) in the following 35 min, a stiff increase of 40–100% B in 3 min, and flushing with 100% B for 5 min. Collected SCX fractions were desalted with C18 (Waters) and subjected to selective phosphopeptide enrichment using ZrO2 (Glygen, 50 µm i. d. resin) under acidic conditions in the presence of 2,5-dihydroxy benzoic acid [100], [101]. Phosphopeptides selectively bound on ZrO2 were eluted with 4% NH4OH. The ZrO2 eluate of enriched phosphopeptides and the flow-through of each SCX fraction were analyzed by nanoLC-tandem mass spectrometry (MSMS). NanoLC-MSMS experiments were performed on a hybrid type mass spectrometer (Thermo, LTQ-Orbitrap XL) coupled to a nanoLC system (Eksigent, 2D nanoLC). Samples were separated on a custom capillary column (150 mm×75 µm, 3 µm Sepax HP-C18) using a 120 min linear aqueous gradient (9–90% acetonitrile, 0. 01% formic acid) delivered at 250 nL/min. The eluent was introduced on-line to the LTQ-Orbitrap via an electrospray device (Advion, TriVersa NanoMate) in positive ion mode. The LTQ-Orbitrap was operated in a data-dependent mode alternating a full MS scan (300–1700 m/z at 60,000 resolution power at 400 m/z) in the Orbitrap analyzer and collision-induced dissociation scans (CID-MSMS) for the 7 most abundant ions with signal intensity above 500 from the previous MS scan in LTQ. Recurring precursor ions were dynamically excluded for 30 sec by applying charge-state monitoring, ions with 1 or unassigned charge states were rejected to increase the fraction of ions producing useful fragmentation. Lock mass ([ (Si (CH3) 2O) 6]1+, m/z = 445. 120029) was used for internal calibration. Each sample was analyzed by two LC-MS experiments. Raw LC-MS data file sets were processed, database searched, and quantified using MaxQuant (ver 1. 0. 13. 8) [102] and the Mascot search engine together. Mascot database searches were performed against a composite database of forward and reverse sequences of verified yeast open reading frames from the Saccharomyces Genome Database. Variable modifications were allowed for oxidation (M) and phosphorylations (STY), as well as a fixed modification of carbamidomethylation (C). Peptide, protein, and phosphorylation site identifications were filtered at a false discover rate of 5%. The MaxQuant normalized M/L (medium/light) ratios with significance B scores less than 0. 05 were considered statistically significant. 1068 peptides were identified, corresponding to 552 distinct proteins. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium (http: //proteomecentral. proteomeexchange. org) via the PRIDE partner repository [103] with the dataset identifier PXD000414. A network scaffold was constructed was constructed using interactions from the publicly available Kyoto Encyclopedia of Genes and Genomes (KEGG), GeneMania and BioGrid databases [104]–[106]. KEGG xml files for the glycolysis/gluconeogenesis (accession sce00010), cell cycle (accession sce04111), meiosis (accession sce04113) and MAPK signalling pathways (accession sce04011) were downloaded and parsed using an in-house program to create a network. The genes in the resulting network were then uploaded to GeneMania in order to retrieve additional genetic and physical interactions. Finally, the interactions for SKS1 were downloaded from BioGrid and appended to the network. Differentially phosphorylated proteins, identified by their differentially abundant phosphopeptides upon enrichment, were first filtered using the significance of the medium/light isotope ratios; we implemented a significance (A) cut off at or below 0. 05. The resulting protein list was mapped on to the network scaffold using Cytoscape [107]. The network was clustered by node attributes to reflect the pathways from which the genes originated. As expected, the network consisted of three groups/sub-networks (glycolysis/gluconeogenesis, cell cycle/meiosis, and MAPK signaling sub-networks). Yeast strains were inoculated in 5 mL SC and incubated overnight at 30°C with constant shaking (250 rpm). Cell cultures were subsequently diluted in 6 mL of SC, SLAD, and SLALD to an OD600 of approximately 0. 1 and incubated at 30°C with constant shaking (250 rpm) for approximately 15 hours. OD600 measurements were collected approximately every 3 hours from the time of dilution. Full growth curve datasets for the analysis of mutants in SLAD and SLALD media are provided in Tables S3 and S4, respectively. Assays for respiratory deficiency were implemented as follows. Single colonies were inoculated in 5 mL YPD media and incubated with continuous agitation overnight. Cell cultures were diluted to an OD600 of approximately 0. 3 in fresh YPD media and grown at 30°C with shaking for at least two doublings, to an OD600 of approximately 1. 0. Each yeast cell culture was then adjusted to an identical OD600 and serially diluted 10−1,10−2,10−3, and 10−4, respectively. Subsequently, 5 µL of each diluted yeast culture was spotted onto YPD and YPG plates and incubated at 30°C for three to five days. Yeast strains were inoculated in 5 mL SC and incubated overnight at 30°C with constant shaking (250 rpm). Cell cultures were diluted to an OD600 of approximately 0. 3 in fresh SC, SLAD, and SLALD media and grown at 30°C with shaking for 4 hours. Afterward, cell cultures were collected by centrifugation at 3000 g for 5 minutes; the supernatant was removed, and cell pellets were flash frozen in a dry ice/ethanol bath. Total RNA was extracted using the RiboPure Yeast Kit (Ambion) following the manufacturer' s protocol. First-strand cDNA synthesis was performed using the Superscript II Reverse Transcriptase Kit (Invitrogen) with 2 µg of total RNA as template and Oligo d (T) 12–18 as primers according to the manufacturer' s protocol. Quantitative real-time assays were performed in triplicate with a Mastercycler EP Realplex4 S (Eppendorf) using SYBR Green I dye-based detection (Life Technologies). Each reaction contained 10 µL SYBR Green PCR Master Mix (Life Technologies), 0. 2 µM of the appropriate primers, and 120 ng of cDNA template in a total volume of 20 µL. The real time PCR reactions were performed at 95°C for 5 minutes followed by 40 cycles of 30 seconds at 95°C, 30 seconds at 60°C, and a final step at 72°C for 30 seconds. Relative differences in RNA levels were normalized against ACT1 levels using the delta delta CT method [108]. Yeast strains were analyzed by Western blotting according to standard protocols [109]. For Western analysis, 10 µL of protein sample were separated via SDS-PAGE and transferred to Immun-Blot PVDF (Bio-Rad) using standard methods. Protein detection was carried out using antibodies against Hemagglutinin (HA) (1∶2000; Abcam) in TBS+0. 1% Tween20 and 5% milk. After immunodetection of Hemagglutinin, the membrane was stripped using Stripping Buffer (62. 5 mM Tris pH 6. 8,100 mM β-mercaptoethanol, and 2% SDS) at 65°C for 30 minutes with occasional agitation. Normalization of loading was achieved by probing the original membrane with antibodies against yeast 3-phosphoglycerate kinase Pgk1p (1∶5000; Invitrogen) in the buffer conditions used previously. Mitochondrial morphology was scored using MitoTracker CMXR (Molecular Probes) for labeling the mitochondrial membrane and 4′, 6-diamidino-2-phenylindole (DAPI) for labeling mitochondrial DNA. MitoTracker was added to 1 mL aliquots of each cell culture to a final concentration of 0. 5 µM, and the samples were incubated at 30°C for 30 minutes similar to Nunnari et al. [110]. 3 µL of stained culture was then mixed with 3 µL of DAPI mounting media (9. 25 mM p-Phenylenediamine (Sigma), 0. 18 µM DAPI (Sigma), in glycerol) on a glass slide [111]–[113]. The cell suspension was then covered with a glass coverslip and imaged using a Photometrics CoolSnapES2 digital camera mounted on a Nikon Eclipse 80i upright microscope. Construction of the heterozygous C. albicans sha3: : CdHIS1/SHA3 and homozygous sha3: : CdHIS1/sha3: : ARG4 deletion mutants was performed using the transformation methods described in Walther et al. [114]. Wild-type and mutant colonies were grown overnight at 30°C in 3 ml YPD or SC media minus the appropriate amino acids and supplemented with uridine. To assess colony morphology, cell cultures were diluted to an OD600 of approximately 0. 25 in fresh YPD+uri and grown at 30°C with shaking for at least two doublings, to an OD600 of approximately 0. 6–1. 0. 5 µl of each culture was spotted onto YPD+uri, YPD+uri+10% serum, and Spider plates. After drying on the bench, YPD+uri plates were incubated at 30°C and YPD+uri+10% serum and Spider plates were incubated at 37°C for 3–5 days. For the study and measurement of C. albicans biofilm development, we used a metabolic 2,3-bis (2-methoxy-4-nitro-5-sulfophenyl) -2H-tetrazolium-5-carboxanilide (XTT) reduction assay as described in Pierce et al. [115] with slight modifications. Briefly, triplicate cell cultures were grown overnight at 30°C in SC media. The cultures were centrifuged, washed twice with 1× PBS and then resuspended in pre-warmed (37°C) medium (RPMI 1640-MOPS or Spider) at a final concentration of OD520 = 0. 38, a cell concentration that was demonstrated to correlate with optimum biofilm formation [116]. Subsequently, 100 µL of each culture was added in triplicate to a 96-well plate. The plate was then incubated at 37°C with shaking (100 rpm) for 24 hours. After 24 hours, the wells were washed 3 times with 1× PBS, and100 µL of pre-warmed SC media was added to each well followed by shaking (100 rpm) at 37°C for an additional 8 hours. Post incubation, the media was removed and the XTT assay performed as described [115]. SUMMARY: [/INST] Eukaryotic cells respond to nutritional and environmental stress through complex regulatory programs controlling cell metabolism, growth, and morphology. In the budding yeast Saccharomyces cerevisiae, conditions of limited nitrogen and/or glucose can initiate a dramatic growth transition wherein the yeast cells form extended multicellular filaments resembling the true hyphal tubes of filamentous fungi. The formation of these pseudohyphal filaments is governed by core regulatory pathways that have been studied for decades; however, the mechanism by which these signaling systems are integrated is less well understood. We find that the protein kinase Sks1p contributes to the integration of signals for nitrogen and/or glucose limitation, resulting in pseudohyphal growth. We implemented a mass spectrometry-based approach to profile phosphorylation events across the proteome dependent upon Sks1p kinase activity and identified phosphorylation sites important for mitochondrial function and pseudohyphal growth. Our studies place Sks1p in the regulatory context of a well-known pseudohyphal growth signaling pathway. We further find that SKS1 is conserved and required for stress-responsive colony morphology in the principal opportunistic human fungal pathogen Candida albicans. Thus, Sks1p is part of the mechanism integrating glucose-responsive cell signaling and pseudohyphal growth, and its function is required for colony morphology linked with virulence in C. albicans. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Visceral leishmaniasis (VL) is hypoendemic in the Mediterranean region, where it is caused by the protozoan Leishmania infantum. An effective vaccine for humans is not yet available and the severe side-effects of the drugs in clinical use, linked to the parenteral administration route of most of them, are significant concerns of the current leishmanicidal medicines. New drugs are desperately needed to treat VL and phenotype-based High Throughput Screenings (HTS) appear to be suitable to achieve this goal in the coming years. We generated two infrared fluorescent L. infantum strains, which stably overexpress the IFP 1. 4 and iRFP reporter genes and performed comparative studies of their biophotonic properties at both promastigote and amastigote stages. To improve the fluorescence emission of the selected reporter in intracellular amastigotes, we engineered distinct constructs by introducing regulatory sequences of differentially-expressed genes (A2, AMASTIN and HSP70 II). The final strain that carries the iRFP gene under the control of the L. infantum HSP70 II downstream region (DSR), was employed to perform a phenotypic screening of a collection of small molecules by using ex vivo splenocytes from infrared-infected BALB/c mice. In order to further investigate the usefulness of this infrared strain, we monitored an in vivo infection by imaging BALB/c mice in a time-course study of 20 weeks. The near-infrared fluorescent L. infantum strain represents an important step forward in bioimaging research of VL, providing a robust model of phenotypic screening suitable for HTS of small molecule collections in the mammalian parasite stage. Additionally, HSP70 II+L. infantum strain permitted for the first time to monitor an in vivo infection of VL. This finding accelerates the possibility of testing new drugs in preclinical in vivo studies, thus supporting the urgent and challenging drug discovery program against this parasitic disease. Neglected Tropical Diseases (NTDs) are severe scourges that affect the less protected layer of the poorest population of low-income countries [1,2]. Their neglected consideration implies a poor attention by most of the actors involved in their eradication including Pharma Industries, which are more concerned about those diseases affecting people from more developed countries [3]. The fight against these diseases is mainly based on preventive measures, but when the latter fails and a sudden outbreak emerges, no effective vaccines exist and treatment is based on the administration of drugs [4]. However, due to the low investments in R & D to develop new compounds most of them are outdated, toxic in many cases, full of undesirable side effects and their route of administration requires hospitalization [5,6]. All these are major drawbacks for the frequently overwhelmed health systems of these countries. Recent drug discovery programs sponsored by public or private initiatives pursue a crushing defeat of major NTDs during this decade. Visceral leishmaniasis (VL) is one of the diseases that accomplish all the conditions to be a NTD. Unfortunately, no effective vaccine candidates, either prophylactic or preventive, are under clinical trials [7], the treatment is still mainly based on old-fashioned antimony derivatives and the administration route of these drugs is parenteral. To overcome these gaps, several Big Pharma companies have made available to academic researchers and supranational institutions myriads of small molecules to be tested on Leishmania on recently developed High Throughput target-based and target-free Screenings platforms (HTS) [8,9]. High Content Screening (HCS) image-based readouts using confocal microscopy, or genetically modified parasites expressing easily detectable reporters are in the pipeline of target-free (phenotypic) in vitro screenings [10,11]. The use of transgenic light-emitting parasites has an additional advantage since they permit a further scaling up to in vivo preclinical trials using rodent models of both visceral and cutaneous infections for monitoring parasite loads by means of bioimaging devices [12]. So far, luminescent transgenic parasites that express genes encoding the firefly or Renilla sp. luciferases are the only systems that permit a rapid readout in vitro under HTS conditions and the assessment of parasitic burdens in internal organs of living mice [13–15]. The major pitfall of luminescence is the need of adding a light-emitting substrate–luciferin or coelenterazine–that is time-consuming and significantly increases the cost of the analysis. For this reason, standard fluorescent proteins are more suitable for in vitro assays [16]. There are many drug screening systems using GFP, RFP or mCherry-transformed parasites that have been useful to evaluate libraries of compounds on Leishmania promastigotes and amastigotes [17–19]. Moreover, the appraisal of in vivo infections by using these genetically-modified strains is currently limited to cutaneous leishmaniasis (CL) models. However, fluorescence emission in the visible spectrum has low tissue penetration to be recorded by the standard optical imaging platforms [20]. This drawback has been overcome by the arising of a new developed protein (IFP 1. 4) from the bacteriophytochrome of Deinococcus radiodurans, whose emission in the near-infrared region prevents any background interference derived from organs or tissues [21]. This protein has been successfully used to image the in vivo infection of the adenovirus serotype 5 (Ad5) that specifically infects the mouse liver in vivo. More recently, a new-engineered infrared fluorescent protein (iRFP) from the photosynthetic bacterium Rhodopseudomonas palustris showed a clear superiority over IFP 1. 4 to evidence the viral load of Ad5 in mouse liver [22]. In this report, we have established for the first time a platform based on the comparative analysis of IFP 1. 4- and iRFP- transfected L. infantum BCN 150 amastigote-infecting splenocytes ex vivo to perform phenotypic screenings with several drug collections of small molecules. In addition, the latter strain was used to monitor the development of an in vivo infection of VL, showing the higher tissue penetration of iRFP over IFP 1. 4, which represents a useful tool to assess the parasite load by non-intrusive bioimaging techniques. Female BALB/c mice (6–8 weeks old) were obtained from Harlan Interfauna Iberica SA (Barcelona, Spain) and housed in specific-pathogen-free facilities for this study. L. infantum (strain MCAN/ES/96/BCN 150) promastigotes were obtained from J. M. Requena (Centro de Biología Molecular Severo Ochoa, Madrid, Spain). Parasites were routinely cultured at 26ºC in M199 medium supplemented with 25 mM HEPES pH 6. 9,10 mM glutamine, 7. 6 mM hemin, 0. 1 mM adenosine, 0. 01 mM folic acid, 1x RPMI 1640 vitamin mix (Sigma), 10% (v/v) heat-inactivated foetal calf serum (FCS) and antibiotic cocktail (50 U/ml penicillin, 50 μg/ml streptomycin). The 987-bp IFP1. 4 coding region was amplified by PCR from pENTR1A vector, a kindly gift from Dr. Roger Y. Tsien, Departments of Pharmacology and Chemistry & Biochemistry, UCSD (USA). The oligonucleotides used as primers (RBF696 and RBF687 in Table 1) introduced NcoI-NotI as restriction sites. The 948-bp iRFP coding region was digested with BglII and NotI from pShuttle CMV-iRFP vector obtained from Dr. Vladishlav V. Verkhusha −Department of Anatomy and Structural Biology and Gruss-Lipper Biophotonics Center, Albert Einstein College of Medicine, Bronx, New York (USA). The successful cloning of these ORFs in pLEXSY-hyg2 (Jena Bioscience) yielded pLEXSY-IFP1. 4-HYG and pLEXSY-iRFP-HYG vectors, respectively. Parasites expressing IFP1. 4 and iRFP reporters were obtained after electroporation of L. infantum BCN150 promastigotes with the linear SwaI-targeting fragment obtained from the above described vectors. Subsequent plating on semisolid media containing 200 μg/ml hygromycin B, allowed the isolation of individual clones that were subcultured in liquid media with antibiotic pressure. Correct integration of each fragment into the 18S rRNA locus of the resulting clones (IFP 1. 4+L. infantum and iRFP+L. infantum) was confirmed by PCR amplification analysis, using appropriate primers (Table 1). To achieve a higher stability of the reporter mRNAs 3’-untranslated regions (3’-UTRs) and intergenic regions (IR) were also included. For this purpose, three fragments derived from L. donovani A2 (LinJ. 22. 0670) (3400 bp) [23], L. infantum AMASTIN (LinJ. 34. 1010) (1200 bp) [24] and HSP70-II (LinJ. 28. 3060) (1600 bp) [25], were amplified using forward primers, which introduced a 5’-NotI site, and reverse primers that introduced a 3’-XbaI site (Table 1). Each amplicon was NotI/XbaI-digested and ligated into the parental construct pLEXSY-iRFP-HYG previously cut with the same enzymes to remove the urt2, thus yielding pLEXSY-iRFP-A2-HYG, pLEXSY-iRFP-AMASTIN-HYG and pLEXSY-iRFP-HSP70-HYG, respectively. Electroporation and semisolid selection, as well as correct integration, were done as described above. Several clones from each electroporation were grown in liquid medium in the presence of antibiotic selection and those clones with higher infrared fluorescent emission were selected after flow cytometry analysis (Cyan ADP, Dako). In addition, each L. infantum modified strain was used to infect mice in order to recover the lost infectivity after cloning and plating. We will hereafter refer to these strains as A2+L. infantum, AMASTIN+L. infantum and HSP70+L. infantum. The human acute leukemia monocyte cell line (THP-1, ATCC TIB-202), was cultivated in RPMI medium supplemented with 10% heat-inactivated FCS and 1% streptomycin/penicillin at 37ºC and 5% CO2. The cultures were diluted every 3 or 4 days to maintain the cell density between 105 cells/ml and 8 x 105 cells/ml. THP-1 cells at 5 x 105 cells/ml were differentiated with 50 ng/ml of phorbol 12-myristate 13-acetate (PMA) for 48 h at 37ºC and 5% CO2. Stationary promastigotes of each infrared strain (5–6 day cultures) freshly transformed from lesion amastigotes were added to differentiated-macrophages at 10: 1 ratio for 24 h at 37ºC. Then, the parasites that have not been internalized were removed by washing with phosphate-buffered saline (PBS). Intracellular infrared signal was analyzed after 72 h post-infection by flow cytometry (Cyan ADP, Dako). Female BALB/c mice (5 animals per group) were injected intraperitoneally with either 107 infective-stage metacyclic promastigotes of L. infantum BCN 150 wild type, IFP 1. 4+, iRFP+, A2+, AMASTIN+ and HSP70+L. infantum strains. Metacyclic parasites were purified from stationary cells freshly transformed from lesion amastigotes by negative selection with peanut agglutinin [26]. At different times post-infection, five animals were euthanized and their spleens and livers were aseptically recovered, washed in cold PBS and placed in Petri dishes. Spleens were used for evaluating the proliferative response of spleen cells after concanavalin A (Con A) addition. Briefly, small pieces were obtaining by using a scalpel. In order to obtain a single cell suspension, the tissue was incubated with 2 ml of collagenase D (Roche) at 2 mg/ml of buffer (10 mM HEPES pH 7. 4,150 mMNaCl, 5 MmKCl, 1 mM MgCl2,1. 8 mM CaCl2) for 20 min at 37ºC. The cell suspension and remaining tissue fragments were gently passed through a 100 μm-cell strainer to remove the tissue fragments. After erythrocyte lysis, splenocytes were washed 3x with PBS by centrifugation (500 x g for 7 min at 4ºC). Splenocytes were seeded at a density of 2 x 105 cells/well in 96-wells plates in RPMI medium, 20% FCS, 1 mM sodium pyruvate, 1x RPMI vitamins, 10 mM HEPES and 100 U/ml penicillin and 100 μg/ml streptomycin supplemented with 50 μM 2-mercaptoethanol. Cells were cultured in medium alone (control) or stimulated with Con A (5 mg/ml) for 3 days. One μCi of [3H]-thymidine was added for the final 16 to 18 h of the culture. Subsequently, cells were washed, lysed and [3H]-thymidine incorporation was measured onto glass fiber filters for scintillation counting. The splenocyte stimulation index was determined by dividing the cpm of Con A-stimulated and non-stimulated splenocytes [27]. The total number of living parasites in the organs was calculated from single-cell suspensions that were obtained by homogenization of the tissue through a wire mesh. Briefly, liver and spleen homogenates (100 mg/ml) were serially diluted in complete Schneider’s medium and distributed in 96-well plates at 26ºC. After 10 days, each well was examined and categorized as positive or negative according to the presence of viable promastigotes. The number of parasites was calculated as follows: Limit Dilution Assay Units (LDAU) = (geometric mean of titer from quadruplicate cultures) x (reciprocal fraction of the homogenized organ added to the first well). The titer was the reciprocal of the last dilution in which parasites were observed [28]. Intracellular amastigotes were purified from infected THP-1 macrophages and from spleen tissues in order to evaluate the infrared emission of intracellular parasites and for developing a standard curve up to the fifth week post-infection (5 wpi) in mice. On the one hand, 72 h post-infection THP-1 macrophages were washed twice with cold PBS, and scraped off using a rubber policeman. On the other hand, the spleens at different time points were collected and a splenocyte suspension was obtained by passing the spleen through a wire mesh. Both cellular suspensions from in vitro infections and from splenocytes were disrupted by passing sequentially through 27G1/2 and 30G1/2 needles, and polycarbonate membrane filters having pore sizes of 8 μm, 5 μm and 3 μm (Isopore, Millipore) [29]. Released amastigotes (free of host cells), were washed twice with PBS (3000 x g for 10 min at 4ºC) and counted by direct microscopy. The standard curves were developed using microscopic quantification of amastigotes and the corresponding infrared signal at 2-fold serial dilutions. Several parameters were included in the development of the explant culture. i) Parasite infection rate is not equal in all animals from the same batch, thus in order to normalize the ex vivo culture, only spleens with weights ≥ 0. 7 g were selected to prepare the ex vivo explants. ii) The starting cell density was adjusted in terms of fluorescence emission in a wide range of arbitrary units (0. 25,0. 5,1. 0, and 2. 0 x 105 AU). Since we intend to evaluate the drug inhibition in ex vivo cultures for at least 4 days, the initial number of AU that matched this condition was chosen. iii) Discrimination between drug-treated and untreated control cells was assessed by adding amphotericin B (AmpB) to the explants cultures. iv) To prevent the edge effect caused by evaporation from outer wells in assays with multi-day incubations, the top and bottom rows as well as the first and last columns were filled with ddH2O. In addition, the positive and negative controls were symmetrically distributed through the columns [30]. A total of 298 compounds belonged to three distinct collections including i) indenoisoquinolines obtained from Dr. Mark S. Cushman, Department of Medicinal Chemistry and Molecular Pharmacology (Purdue University, Indiana, USA.); ii) podophylotoxin and quinones were a kindly gift from Dr. Arturo San Feliciano, Deparment of Química Farmacéutica (Universidad de Salamanca, Spain) and iii) carbolins obtained from Dr. Sankaran Murugeshan, Department of Pharmacy, (Birla Institute of Technology & Science, Pilani, India). Stock solutions consisted of test compound at a concentration of 200 μM in 20% DMSO. The 200 μM master plates were further diluted by transferring aliquots of 5 μl into black 384-well plates with clear bottom containing 45 μl of culture medium. The final concentration of DMSO in both assay and control wells not exceeded 1% (v/v). Splenocytes obtained from infected mice (50 μl), were added to Testing Plates (containing the compounds to be test at single 10 μM concentration) and Control Plates (containing positive and negative controls). The plates were incubated at 37ºC and 5% CO2 and at 0,24,48 and 72 h the infrared signal was recorded using the Odyssey infrared system (LI-COR, USA). The anti-leishmanial reference drugs were amphotericin B, miltefosine, and paromomycin sulfate. The antileishmanial effect of the compounds was calculated as the percentage inhibition in relation to AmpB and DMSO as follows: (mean of 1%DMSO–Experimental Value) / (mean of 1%DMSO–mean of AmpBEC100) x 100. The positive control (10 μM AmpB), and the negative control (1% DMSO), placed in columns 2 and 23, were included in all Testing Plates. To normalize compound activity in relation to plate-to-plate variations in the assay signal, and to calculate Z’-factors, Control Plates containing also 10 μM AmpB and the vehicle 1% DMSO (in alternating fashion) were also included [30]. The quality of the assay was given by Z’ factor that was calculated as 1 –[ (3SD positive controls + 3SD negative controls) / (mean of the positive controls–mean of the negative controls) ]. Data from plates were used only if Z’ factors were > 0. 5 [31]. Primary hits were defined as compounds displaying 60% inhibition of signal readout. To test the toxicity of the identified hit compounds we established splenic ex vivo explant cultures of uninfected BALB/c mice. Briefly, the animals were euthanized and the spleens were aseptically removed and homogenized as described above. The cell suspension culture was conducted in RPMI medium, 10% FCS, 1 mM sodium pyruvate, 1x RPMI vitamins, 10 mM HEPES and 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were microscopically counted and distributed into clear 96-well plates; 50 μl of uninfected splenocytes were added to each well (5 x 105 cells), containing 50 μl of serial 2-fold dilutions of the test compounds (200–0. 1 μM) or the DMSO control. After 72 h of incubation at 37ºC and 5% CO2, the viability of the cells was assessed using the Alamar Blue assay according to manufacturer’s recommendations (Invitrogen). Mice infected with wild type and HSP70+L. infantum parasites were imaged using an intensified charged coupled device camera of the In Vivo Imaging System (IVIS 100, Xenogen). To minimize background when imaging in the near infrared, the normal diet was replaced by a purified diet during 7 days (AIN-93M, LabDiet, UK), since chlorophyll fluoresces naturally, emitting between 675 and 685 nm, and is detected in the 700 nm channel. Nevertheless, animals were fasted overnight, although water was allowed freely before acquiring the images in order to assure that faeces were removed from intestines. The animals were shaved to reduce background signal due to the fur. The animals were then lightly anesthetized with 2. 5–3. 5% isoflurane (then reduced to 1. 5–2. 0%), placed in the camera chamber, and the fluorescence signal was acquired for 1 s. Fluorescence determinations, recorded by the IVIS 100 system, were expressed as a pseudocolour on a grey background, with yellow colour denoting the highest intensity and dark red the lowest one. Aimed to create stably-integrated infrared L. infantum BCN 150 strains we electroporated wild-type promastigotes with the lineal 6156 and 6110 bp SwaI-SwaI fragments containing the ORFs encoding IFP 1. 4 and iRFP, respectively, as well as the selection marker of the pLEXSY-hyg2 plasmid. We will refer to them as IFP 1. 4+L. infantum and iRFP+L. infantum. After selection on semisolid plates containing 200 μg/ml hygromycin B, individual colonies were seeded in M199 liquid medium supplemented with 10% FCS and hygromycin B. Genomic DNA isolated from these cultures was used to confirm the correct integration of the target sequence into the 18S rRNA locus of L. infantum genome (data not shown). Fig. 1A shows that the genomic manipulation of the engineered strains did not affect the growth rate of the parasites compared to wild-type promastigotes. Further comparative studies aimed to characterize the two infrared strains were performed. In order to measure the fluorescence emission of both strains, we employed logarithmic promastigotes of IFP 1. 4+L. infantum and iRFP+L. infantum (Fig. 1B), as well as intracellular amastigotes isolated from infected THP-1 cells in vitro (Fig. 1C), and lesion-derived amastigotes obtained from infected spleens of BALB/c mice at 5 wpi (Fig. 1D). A clear positive correlation was observed between the fluorescence signal and the number of logarithmic promastigotes placed in 96-well plates (Fig. 1B). Surprisingly, intracellular parasites expressing both infrared reporters (1C and 1D) displayed higher differences than promastigote cultures. All results clearly showed the superior fluorescence signal of the iRFP protein over IFP1. 4, particularly at the really relevant stage of the parasite life cycle, the amastigotes, both isolated from THP-1 macrophages and from lesions. Moreover, the stability of iRFP expression was monitored over a period of 6 months after transfection and no change was observed in fluorescence intensity during this period, even in the absence of hygromycin B (Fig. 1B). Once the iRFP reporter was chosen, we optimized the expression by replacing the original utr2 from pLEXSY-hyg2 vector with three sequences containing both 3’UTRs and IR (we will refer to as downstream regions, DSR). Two of these DSR belong to stage-regulated genes in the amastigote stage, the A2 and AMASTIN genes [23,24]. The third DSR belongs to the HSP70 II gene of L. infantum, a sequence involved in mRNA stability at 37ºC [25]. Fig. 2A shows the schematic view of the different constructs containing the iRFP reporter gene. In a similar way to IFP 1. 4 and iRFP-expressing parasites, we proceeded to compare the fluorescent signal of iRFP+, A2+, AMASTIN+ and HSP70+L. infantum strains. A clear correlation between the fluorescence emission and the number of parasites was also detected by using logarithmic promastigotes (Fig. 2B). Interestingly, replacement of the utr2 from pLEXSY vector with the corresponding DSR sequences from the A2 and AMASTIN genes resulted in a reduction of the fluorescent levels in the promastigotes. However, using the same strains but isolating the intracellular amastigote stage, from both infected THP-1 cultures (Fig. 2C) and lesions (Fig. 2D), we observed a 2–2. 5-fold increase in fluorescence emission. Nevertheless, the most significant increase (p<0. 001) was obtained with amastigotes carrying the plasmid including HSP70 II as DSR. Infection of laboratory mice with either L. infantum or L. donovani vary markedly between different organs. In the liver, the infection can resolve, unlike in the spleen, where Leishmania parasites may persist [32]. Therefore, we established a model of visceral L. infantum infection that allowed us to collect large numbers of naturally-infected cells from spleen to use as ex vivo explant. Infected mice were euthanized at different times post-infection. The spleens were weighed, processed to obtain a cellular suspension culture and the burden parasite and the proliferative response of mouse spleen cells were evaluated. There was a dramatic increase in spleen size, up to 1. 0 g (Fig. 3A), splenocyte culture, (up to 12 x 108 cell/spleen, Fig. 3B), and parasite burden (up to 25 x 106/100 mg tissue, Fig. 3C), whereas the proliferative response dropped to basal levels at five wpi (Fig. 3D). Consequently, for drug screening we established five wpi as the time point for the ex vivo splenic explant culture. Finally, to be sure that fluorescence signal was stable in infected animals throughout all this time, parasites from infected spleens were also isolated and amastigote standard curves were prepared at 3,4 and 5 wpi (Fig. 3E). As previously described by other authors, the loss of fluorescent signal during the evaluated period of time was not significant [18,33]. In addition, the amastigote standard curves provided us the number of amastigotes that were used during the screening assays. Firstly, we checked the fluorescence dynamic range in which we could assure the effective and quantifiable replication of intracellular parasites inside macrophages in the absence of active drug over the course of the ex vivo culture. However, since there were individual-to-individual differences in parasite load, we first needed to establish the appropriate starting cell-density well that allowed the detection of parasite proliferation. For this purpose, we fixed the fluorescence level per well, instead of adjusting the number of cells. We followed the replication of the amastigotes within the splenic culture each 24 h during 5 days, using four different starting densities ranging from 0. 25 x 105 to 2. 0 x 105 arbitrary units (AU). The signal was measured in black 384-well plates with clear bottom using the infrared imager Odyssey (LI-COR). After 5 days of culture, only those wells containing 2. 0 x 105 AU at the beginning of the assay supported the active replication of the parasite in the absence of active drug over the whole experiment, indicating ongoing multiplication of the amastigote cells (Fig. 4A). The next step was to assure that the selected starting cell density was accurate to guarantee the correct discrimination between drug-treated and untreated control wells. For doing this, different concentrations of AmpB (20,6. 6,2. 2,0. 74 μM) were added to the explant and the reduction in parasite load was measured by quantifying the loss of infrared fluorescence for 72 h (Fig. 4B). To confirm these results, and also to establish the AmpBEC100, as well as the appropriate period of incubation, ten serial 2-fold AmpB dilution steps covering a range from 10 to 0. 02 μM were assayed against three starting cell densities (from 1. 0,2. 0 and 4. 0 x105 AU). Readouts were harvested at 72 and 96 h. Surprisingly, IC50 values at 72 h were very similar in all the starting cell densities, ranging between 0. 27–0. 38 μM, (Fig. 4C-E) which corresponded with data collected by other authors [10,34]. These results suggest that all these conditions allow the screening of compounds. To confirm the quality of the assay in discriminating active from inactive compounds, we calculated the Z prime (Z’) factor in 3 different screening experiments using 6 different plates. All Z’ were higher than 5. 0, which demonstrated the correct reproducibility and the suitable quality of the assay [31]. Fig. 4F shows the fluorescence image of a 384-well plate containing the ex vivo culture treated with different compounds, where the red colour shows different intensities, which reflects the viability of the amastigotes in each well. The course of the ex vivo infection was followed over a period of 72 h by measuring the absolute fluorescence of the infection and the percentage of infected macrophages by classical Giemsa staining to determine parasite load (data not shown, Fig. 4G). No differences between both methods were accounted, thus pointing to the suitability of fluorescence analyses to assess the infectivity of HSP70+L. infantum strain on mouse macrophages. Moreover, intracellular forms were analyzed by confocal microscopy at 633 nm, after 5 wpi. A strong red fluorescence emission from round-shaped HSP70+L. infantum-emitting amastigotes was observed inside parasitophorous vacuoles in the cytoplasm of the infected macrophages (Fig. 5), confirming that the fluorescent signal was not lost during the ongoing proliferation of intracellular amastigotes. A library of 295 compounds comprising three collections of chemically distinct structures was screened at a concentration of 10 μM. The threshold for selecting hits was set as inhibitory activity of ≥ 60% after 3 independent assays. Twenty-four primary hits were obtained out of the 295 compounds (8%). Our next goal was to select, amongst the 24 confirmed hits, the best candidates for further investigation. Firstly, compounds were tested in dose-response curves using 7–8 concentrations 2-fold diluted from 50 μM, 100 mM and 2. 5 mM respectively for combrestatins, carbolins and indenoisoquinolins. Then, the cytotoxicity of these compounds was tested in different concentrations with a 3-day assay on non-infected ex vivo explant cultures (CC50) using Alamar Blue (data not shown). Five out of the 24 hits were selected based on a threshold of Selective Index (SI = CC50/IC50), score of ≥30. They included combrestatins (8%; 2/24), carbolins (8%; 2/24) as well as indenoisoquinolines (4%; 1/24) (Table 2). Finally, the applicability of the HSP70+L. infantum for imaging in BALB/C mouse was tested. Animals (n = 10) were inoculated intraperitoneally with 107 stationary-phase HSP70+L. infantum promastigotes. The mice were imaged at 0,10 and 20 wpi. A bright and intense signal was detected after parasite injection allowing even to trace the needle entry site. The transitory hepatic episode (14 days post-infection) was out of the scope of this experiment. On the contrary, spleen colonization was evidenced after 10 wpi and until the end of the experiment (Fig. 6A). Five animals were euthanized and after removal of the overlying skin (Fig. 6B top) and peritoneum (Fig. 6B down), increasing fluorescence signal was detected, confirming the above-mentioned results. The dissected organs were entirely fluorescent (Fig. 6C). Because of a lower parasite burden in the hepatic organ, the high level of fluorescence emitted by amastigotes in the spleen might have blocked the detection of parasites in the liver when imaging both organs at the same time. In order to tackle a future drug trial in vivo, the appraisal of infection was monitored for up to 2 wpi, showing that the fluorescent signal was still visible in the remaining group of mice (Fig. 6A). These results support future long-treatment schedules to tackle in vivo drug trials against VL. In this work we present a potent tool based on infrared fluorescent proteins to achieve a double goal; on the one hand a robust platform for HTS screening of compounds and on the other hand an in vivo imaging of visceral Leishmania infections. Firstly, we chose between two different sources of infrared fluorescent proteins (Deinococcus radiodurans and Rhodopseudomonas palustris) [21,22], and then we optimised the expression level by introducing different DSR of well-known virulence factors and heat shock proteins. Initially, we compared the suitability of two fluorescent infrared stably-modified strains, in terms of brightness and fluorescence-emission properties in promastigotes and amastigotes of L. infantum BCN 150. iRFP+L. infantum reached significantly higher emission than IFP1. 4+L. infantum throughout the different stages of L. infatnum life cycle. Fluorescent levels varied 2–3 times between both strains, and allowed the detection of as little as 100 intracellular amastigotes. In general, the intracellular stage has a lower emission due to their low metabolism, a fact that has been previously pointed out by other authors [35,36]. Unlike other fluorescent reporters whose emission wavelengths are in the visible spectrum, near infrared fluorescent proteins have improved optical properties since the absorbance of haemoglobin, protein and lipids, as well as light-scattering, is minimal [21]. Thereafter, optimization of the vector was achieved by including different sequences; two of them previously described as virulence factors [23,24], and the third one having a protection role against heat and oxidative stress in VL [25]. The highest levels of expression were associated with HSP70+L. infantum, which contains the downstream sequences from HSP70-II gene, with influence on transcript stability at conditions that facilitate the survival of the parasites within mammalian hosts [37]. Furthermore, the fluorescence emission of this reporter has been enhanced via stable integration into 18S rRNA locus, which represents an efficient and effective strategy that enables expression of proteins, avoiding the need of drug selection for both in vitro screenings and in vivo infections as previously described [17,18,35,38,39,40,41,42]. Once the tool was selected, its applicability for drug discovery in VL in terms of searching new hits was assessed. Leishmania represents an enormous challenge as an intracellular parasite, since the drug must kill the parasite without affecting the host cells. Recently, HCS using image-based microscopy have been proposed as a robust platform for evaluating intracellular infections [10,36]. In this system, axenically parasite cultures are used to infect macrophage’s cell lines. However, this approximation has several drawbacks: i) it is highly complex, ii) axenic parasites have notable differences with amastigotes [43], and when they have been used in screening assays a high false-positive rate was associated [36], and iii) the use of macrophage lines as host cell has also been questioned [34]. A novel approach based on the physiological and immunological environment of the infection site has been proposed [29]. Ex vivo explant is a primary culture that contains the full variety of cells that allow the parasite progression in the infected organ, and not only inside macrophages. Moreover, the infection is not recently established, but installed several weeks before the addition of the drug and the evaluation of its effect, and thus it greatly resembles human infections. From the lab point of view, the manipulation is minimal and a large number of test wells are easily prepared from a single infected animal. In this work, the ex vivo splenic explant used for drug screening was developed in BALB/c mice infected with L. infantum, showing the typical features of VL with enlargement of spleens, high parasite burden, and loss of proliferation in splenic cells. The system congregates the basic rules previously defined for drug-screening systems for trypanosomatids [44]. i) it uses dividing populations of the mammalian stages of the parasite, ii) the drug activity is readily quantified by changes in infrared fluorescence signal, iii) a standard drug for VL (AmpB) showed activity at concentrations near to the one reached in serum [45,46]. A crucial point was to establish the signal discrimination referred to the number of amastigotes in the infected cells per well. The system was assessed with a selected set of compounds coming from three different collections and well-known active drugs were also included. The system adaptation presented here, allows for rapid identification of active compounds without the requirement of substrate reagents to get the readouts, and hence, the cost is reduced compared to other systems. The model uses a stable-modified Leishmania with no significant loss of reporter signal after more than 20 wpi. The fluorescence signal of the infected splenic explant has lineal correlation with the number of amastigotes, which makes the system easily adaptable to quantitative assays. Furthermore, there is no need of expensive infrastructure, such as the HCS, which are not affordable for some labs. Since the assay could be performed in 384-well plates, a single infected animal could be enough to screen more than 500 compounds. However, host factors involved in the pharmacokinetics and pharmacodynamics of drugs are out of the scope of in vitro drug screening, consequently in vivo drug assays are still necessary. Using the same tool, parasite dissemination in an in vivo chronic model of VL has been traced for the first time based on infrared fluorescence signal. At 5 wpi, the animals were imaged, but not clear fluorescence signal was recorded. After 10 wpi an undisputed infrared signal was achieved, showing that the splenomegaly had been already established time before. Many studies initiate drug administration trials after one or two weeks post-infection assessing the effect against the liver infection time with a peak in the parasite burden [47]. However, our goal was to use this model for longer times in order to perform future drug administrations against spleen infection, so the animals were pictured after 20 wpi and the fluorescence signal was still strongly detected. Therefore, this in vivo imaging model could be used without significant loss of reporter emission, allowing the appraisal of chronic infections after drug treatments. In conclusion, the near-infrared fluorescent L. infantum strain used in the current work represents an important step forward in bioimaging research of VL, providing a robust model of phenotypic screening suitable for HTS of collections or libraries of small molecules in the amastigote form of mouse splenic explants. In addition, this novel L. infantum strain could be used in preclinical in vivo studies of potential lead compounds against visceralizing Leishmania species. SUMMARY: [/INST] Visceral leishmaniasis (VL), caused by Leishmania infantum or L. donovani, is still one of the most threatening diseases affecting poor people in developing countries, with a fatality rate as high as 100% in two years in infected and untreated people. With no vaccine available and ineffective and toxic chemotherapy, the search for new potential drugs that accelerate the urgent drug discovery process are highly needed. A novel technology that addresses this important issue has been developed, by performing High Throughput Screening (HTS) assays in 384-well plates format in combination with an infrared L. infantum-expressing strain. The system was further validated to identify active compounds against VL in an ex vivo splenic culture. In addition, in vivo non-invasive imaging of the visceral infection in BALB/c mice was achieved for the first time by using transgenic fluorescent parasites. These findings open up the possibility of testing vast amounts of potential compounds and allow in vivo screening of drug candidates against this severe parasitic disease in an attempt to speed up the vital drug discovery program. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: BACKGROUND OF THE INVENTION [0001] 1. Field of the Invention [0002] The present invention generally relates to medical equipment for ligament repair, and more particularly to a graft attachment device for cruciate ligament reconstruction. [0003] 2. Description of the Related Art [0004] The method of ligament repair is positioning the patient's knee at an half-crooked angle, using a bore to bore and penetrate the femur and tibia simultaneously to form a 6 mm through hole, burying the ligament or insert member in the 6 mm through hole, and using any kinds of the graft attachment device to fix two ends of the ligament or insert member in the femur and tibia for replacing the damage cruciate ligament, so that the patient's bone and ligament or insert member are able to be healed gradually to recover the original functions of the knee with rehabilitation after surgery. However, the types of the known graft attachment device for fixing the ligament or insert member in the femur and tibia are of many different kinds, which the common seen is endo-button disclosed as U.S. Pat. No. 6,099,568 (ACL graft fixation device and method). The U.S. Pat. No. 6,099,568 is disclosed that the two ends of ligament or insert member wanted to be grafted are connected an endo-button respectively by using surgical suture. When the endo-button passes through in the pre-bored through hole of femur and tibia, the endo-button is using its side of smaller lateral cross-sectional area to pass through in the through hole, and then to turn over the endo-button after passing through out the openings of two ends of femur and tibia, so that the side of endo-button's largest cross-sectional area is locked at the openings of two ends of femur and tibia for fixing the ligament or insert member in femur and tibia. The endo-button is able to reduce wounds resulting from surgery, and by turning over the endo-button is able to fix the ligament or insert member in femur and tibia. But, two sides of the ligament or insert member connect the endo-button by elastic fiber cord or surgical suture. For having turn-over space after the endo-button passes through out the through hole, the endo-button must be pulled to tense the ligament or insert member to turn over, and then released, so that the endo-button elastically presses and closely combines at the opening of the through hole. The action mentioned as above could not make the ligament or insert member be tensed and fixed entirely in the bone, and rested a small depletion space at the part of the elastic fiber cord or surgical suture in the through hole connected with the ligament or insert member, so that the space could make the bone and ligament be healed more slowly. Moreover, when touching patient's skin after surgery, patient would have alien feeling. [0005] There is another method for using interference screw to fix ligament or insert member disclosed as U.S. Pat. No. 6,589,245. This method is not able to rest more over depletion space compared to the endo-button mentioned as above, the surgical wound is small, and the patient is not able to have alien feeling after surgery. Furthermore, the interference screw is using inner fixing method, so as to make sure to pull tightly and position the ligament or insert member. However, since the method for fixing the ligament or insert member by interference screw is using the interference screw to oppress the ligament or insert member in the inner wall of the through hole of the bone and the portion of the ligament or insert member contacted the bone only has a surface, the ligament or insert member is made to be flat, so as to produce a gap after the interference screw is assimilated by human body and be not sure if the bone is able to grow into the gap and combine with the ligament or insert member entirely. And the structure and process of the tools for positioning and releasing the interference screw are complicated, so as to make the surgery process un-convenient, and the graft attachment device interfere the tools each other. SUMMARY OF THE INVENTION [0006] It is an objective of the present invention to provide a graft attachment device for cruciate ligament reconstruction which has the advantages of convenient surgery operation and preventing the graft attachment device form twisting. [0007] To achieve the above objectives, the present invention provides a graft attachment device for cruciate ligament reconstruction, comprising a body, having a screw portion disposed at an outer edge of the body and the screw portion having a threading area corresponding to a front end of the body; a connection member, fixed at the front end of the body, and a gap between the connection member and a corresponding portion of the body providing one rope-type member pass through; and a pivoting member, having a front end rotatably pivoted at a rear end of the body, and a connection portion disposed at a rear end of the pivoting member for installing a ligament thereon. [0008] After the graft attachment device is inserted into the bones, operators can rotate the front end of the graft attachment device by an adaptive tool and the front end can be locked in the bone from inside to outside while the front end does not interfere the ligament connected at the rear end of the graft attachment device, so as to achieve the advantages of surgical wounds miniaturization and preventing the ligament form twisting and the tools from interfering with the graft attachment device while operating. BRIEF DESCRIPTION OF THE DRAWINGS [0009] All the objects, advantages, and novel features of the invention will become more apparent from the following detailed descriptions when taken in conjunction with the accompanying drawings. [0010] FIG. 1 shows a schematic diagram of an embodiment in accordance with the invention; [0011] FIG. 2 shows a sectional drawing of the body of the embodiment in accordance with the invention; [0012] FIG. 3 shows a sectional drawing of the graft attachment device of the embodiment in accordance with the invention; [0013] FIG. 4 shows an isometric drawing of the connecting rod of the embodiment in accordance with the invention; [0014] FIG. 5 shows an enlarged drawing of the distal end of the connecting rod of the embodiment in accordance with the invention; [0015] FIG. 6 shows an enlarged drawing of the clamped portion of the connecting rod of the embodiment in accordance with the invention; [0016] FIG. 7 shows a sectional drawing of the handle of the embodiment in accordance with the invention; and [0017] FIG. 8 shows a schematic diagram of the embodiment when operating in accordance with the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT [0018] Please refer to corresponding drawings. The invention is disclosed a graft attachment device for cruciate ligament reconstruction, including a body 20, and a connection member 30 and a pivoting member 40 disposed at the front end and the rear end of the body 20 respectively. The graft attachment device can cooperate with a connecting rod 50 and a handle 60 when operating. [0019] The body 20 with predetermined length is hollow, shown as FIGS. 2 and 3, and has a screw portion 22 formed at the outer edge of the body 20 including a threading area 24 corresponding to the front end of the body 20 for screwing on a bone when the body 20 moves forward and rotates axially, and two fixing portions 26 with through hole shape disposed adjacent to the front end of the body 20 respectively and spaced apart 180 degree and penetrated the inner edge and the outer edge of the body 20. The inner edge of the hollow rear end of the body 20 has a large diameter portion disposed adjacent to the distal end of the inner edge of the hollow rear end of the body 20, a small diameter portion disposed adjacent to the inside of the inner edge of the hollow rear end of the body 20, and a shoulder portion bridged therebetween. [0020] The body 20 formed a hollow shape is for the consideration of preventing from over weight and volume. For the combination with other elements and operation method described next, it is also available for two blind holes disposed at the front end and the rear end of the body 20 to accommodate the connection member 30 and pivoting member 40 therein respectively. [0021] The connection member 30, referring to FIGS. 2 and 3, is rod-shaped and two ends of the connection member 30 is disposed at the front end of the body 20 and embedded in the corresponding two fixing portions 26 respectively. Since the outer diameter of the connection member 30 is smaller than the inner diameter of the hollow front end of the body 20, a gap is formed between the outer edge of the connection member 30 and the inner wall of the body 20 for providing a rope-type member to pass through. [0022] The pivoting member 40, referring to FIGS. 2 and 3, is rod with predetermined length. A stop portion 42 with a larger outer diameter is disposed at the front end of the pivoting member 40 which is stopped by the shoulder portion 28 to make the pivoting member 40 freely rotate axially but not to break away out of the body 20 after the stop portion 42 extends to inside the rear end of the body 20. A long-shaped through hole 44 is disposed at the rear end of the pivoting member 40 for installing a ligament thereon. [0023] The diameter of the connecting rod 50 is smaller than the outer diameter of the body 20. The connecting rod 50 of this embodiment is inserted in the body 20. A pair of flanges are extended axially and disposed at one end of the connecting rod 50, shown as FIG. 5, and a cutout 52 is defined between the two flanges and bridged on the outer edge of the connection member 30. A clamped portion 54 is formed at the other end of the connecting rod 50 with flat hook shape, shown as FIG. 6. Two grooves 56 are disposed at the outer edge of the connecting rod 50 and extended axially and one end of each groove is extended out of the distal end of the two flanges respectively. A concave portion 58 is disposed at the outer edge of the connecting rod 50 and across one of the two grooves 56. [0024] The handle 60, shown as FIG. 7, for easily connected with the clamped portion 54 or released is including a shell body 61, a first through hole 611 penetrated the shell body 61, a second through hole 612 perpendicular to the first through hole 611 and extended inwardly from the outer edge of the shell body 61 and pass through the first through hole 611, a sliding member 62 disposed and reciprocated in the first through hole 611, a press button 63 connected one end of the sliding member 62, and a spring 64 disposed in the shell body 61 and constantly forced the press button 63 outwardly to make the press button 63 slightly protrude out of the shell body 61 via the first through hole 611, wherein a third flat through hole 621 is disposed at the sliding portion 62 corresponding to the second through hole 612, and a hook 622 is pre-set in the third through hole 621 corresponding to the clamped portion 54. [0025] The graft attachment device 10 must be combined with the connecting rod 50 first and a ligament 90 must be fixed in the long-shaped through 44 of the rear end of the pivoting member 44 in advance. The cutout 52 disposed at the distal end of the connecting rod 50 is bridged on the connection member 30, so that the connecting rod 30 is able to drive the body 20 to rotate with. And then, two ends of a rope-type member 70 (the steel wire is the best in this embodiment) are embedded at the two grooves respectively, and the distal end is fixed by a fix hole 561 pre-set on the connecting rod 50, wherein the middle portion pass through the gap between the connection member 30 and the body 20 and gone round the outer edge of the connection member 30, so that the connecting rod 30 is able to drive the body 20 to reciprocate with. [0026] The operation method is boring a step hole from tibia to femur 80 in advance and making the inner diameter of the distal end 801 of the through disposed above the femur 80 smaller than the outer diameter of other portions and the body 20, shown as FIG. 1, and making the clamped portion 50 of the connecting rod 50 insert in tibia and out of femur with assembled body 20 and connecting rod 50 but the body 20 connected at the distal end be not able to pass through the distal end of the through hole 801. The operator is able to rotate the connecting rod 50 right away and screw therein by the threading area 24 disposed at the front end of the screw portion 22 when keeping inserting deeply in femur. After the depth which the body 20 is screwed in femur 80 is conformed to requirement by observation, the operator is able to cut the rope-type member 70 at the concave portion 58 by wire nippers, and then remove the connecting rod 50 and leave the graft attachment 10 in femur. [0027] The handle 60 is for easily pulling and rotating the connecting rod 50 by operator, and the distal end (the portion is shown in FIG. 6 ) is inserted in the second through hole 612 and the third through hole 621 and locked by the hook 622 with hook shape after the clamped portion 54 pass out of femur. So that the operator pulls and rotates the connecting rod 50 by forcing outwardly and the femur 80 corresponding to the distal end 801 of the through hole is threaded and screwed therein by the graft attachment device 10. When the graft attachment device 10 is positioned, shown as FIG. 8, the operator is able to release the connecting rod 50 by pushing the press button 63. [0028] By the above mentioned elements' cooperation of this invention, the connecting rod 50 for driving the graft attachment device 10 to thread and fix is connecting at the front end, and the ligament for accepting the construction is disposed at the rear end which do not interfere each other. Since the ligament 90 is freely pivoted at the rear end of the graft attachment device 10, the ligament 90 do not rotate with the connecting rod 50 to become twist in operation process, so as to prevent from damaging. [0029] Although the invention has been explained in relation to its preferred embodiment, it is not used to limit the invention. It is to be understood that many other possible modifications and variations can be made by those skilled in the art without departing from the spirit and scope of the invention as hereinafter claimed. SUMMARY: [/INST] The present invention discloses a graft attachment device for cruciate ligament reconstruction comprises a body having a screw portion with a threading area on the front end of the body, a connection member disposed on the front end, a gap formed between the front end and a predetermined portion of the body adapted for a rope-type member pass through, a pivoting member pivoted on the rear end of the body with its front end, the rear end of the pivoting member having a juncture portion for fixing a ligament, thereby the device could be screwed and fixed on a bone when rotating the device, and seamed a ligament on the rear end of the device. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS-REFERENCE TO RELATED APPLICATIONS Not Applicable STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT Not Applicable THE NAMES OF THE PARTIES TO A JOIN RESEARCH AGREEMENT Not Applicable INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ON A COMPACT DISC Not Applicable BACKGROUND OF THE INVENTION 1. Field of Invention The instant invention relates to a novel method and means for the efficient, safe, and economic decontamination of the interior of a physical structure, such as a building, and/or articles contained therein that are contaminated by microorganisms. 2. Description of Related Art U.S. Pat. No. 5,044,141 disclosed a method for the sterile packaging and wetting of articles in a bottle, bag, or other sealable container utilizing a solution, usually but not necessarily an aqueous solution, of a standard anti-bacterial agent. The method allows for partially filling the container with such a solution, and placing in the container those items to be sterilized then the container is sealed so that an air (or gas) space is formed above the liquid. Thereafter the container and its contents are heated to a temperature well below the boiling point of the liquid and at a pressure of about one atmosphere. The heating operation is continued until all organisms, including spores, are killed. Finally, the container and its contents are cooled to below the dew point of the air (or gas) so as to allow the humidified air (or gas), as produced during the heating step, to condense the solution on to the surfaces inside the container which are in the air space and not submerged under the liquid solution. The cooling operation depends upon the heating operation because the dew point temperature is relative to the humidity and temperature of the air (or gas) in the space which is created by the heated air (or gas). U.S. Pat. No. 5,345,746 disclosed a method of regulating the amount of anti-bacterial agent present in the air space inside a container during the sterilization processes as disclosed in U.S. Pat. No. 3,857,677, U.S. Pat. No. 3,725,003 and U.S. Pat. No. 5,044,141. The sterilization process required the container and all its contents to be heated in order for the sterilization to take place. The U.S. Pat. No. 5,345,746 patent allowed a means for controlling how long it takes for sterilization to occur with precision and eliminated the need for testing to be performed during the heating process to check for consistent results and, as such, the wetting of articles as disclosed in U.S. Pat. No. 5,044,141 could be done with uniformity because the amount of anti-bacterial agent being condensed into an aqueous solution, that being the wetting step, upon the articles within the package is consistent or known every time the heat process is performed. U.S. Pat. No. 5,007,232 disclosed a method comprising the steps of providing a housing with means for providing the passage of a container between the interior and the exterior of the housing, introducing a container into the housing, heating, vaporizing and then dispensing vaporized hydrogen peroxide into the container, dispensing an article into the container, and sealing the container. This method allows for the use of hydrogen peroxide as a sterilant that is easily formed into a vapor at one atmosphere and below the boiling point of liquid hydrogen peroxide and further sterilizes the air with which it is mixed. U.S. Pat. No. 7,153,471 disclosed a method of decontaminating a structure contaminated by pathogenic microorganisms such as bacillus anthracis and its spores, B. subtilis var niger and its spores, and B. stearothermophilus and its spores including the steps of sealing a contaminated structure sufficiently to enable retention of a gas, introducing methyl bromide gas into sealed contaminated structure to a concentration of methyl bromide in an amount sufficient to deactivate said pathogenic microorganisms and to disable germination of pathogenic bacteria spores, and maintaining said sealed contaminated structure with said concentration of methyl bromide at a sufficient temperature for a sufficient period of time, and deactivating said pathogenic microorganisms and disabling germination of said pathogenic bacteria spores associated with said contaminated structure. A problem with these processes as claimed and disclosed is that they do not allow for the heating, cooling and humidity control of only the sealed interior of a building which is necessary because attempting to heat, cool or control humidity from the exterior is difficult because buildings are insulated between the interior and exterior walls thereby rejecting heat transfer and humidity infusion or removal. A further problem with these processes as claimed and disclosed is that they do not allow a way to uniformly distribute disinfectant in the interior of a building utilizing a vaporous sterilizing solution because there is no way to regulate the amount of sterilizing agent in the vapor. Another problem is that these processes as claimed and disclosed do not allow for the uniform wetting of articles with controlled amounts of disinfectant and then the removal of the condensed solution and vaporous disinfectant from the interior of the building at atmospheric conditions nor does it allow for the wetting of the surfaces with water after the sterilant is condensed onto the surfaces in order to prevent or lessen any corrosive effects of the residue left behind on the disinfected surfaces. Another problem is that there is no way to prevent any lethal disinfecting gas leaking to the outside of the building from dispersing in the air because it is in the superheated range at one atmosphere. Despite the great need for an efficient treatment method of reasonable cost that will eradicate microorganisms in the interior surfaces of a building and articles therein, thereby to effectively sterilize said surfaces, the use of regulated vaporous disinfecting agent in aqueous solution by conditioning the air only in the interior of the building and removal there from has not been reported. BRIEF SUMMARY OF THE INVENTION The main aspect of this invention concerns a method of distributing a uniform amount of vaporous anti-bacterial agent inside of a building at or about one atmosphere pressure by isolating the interior of the building from the outside environment then conditioning the air inside the building to a specific temperature and humidity usually within the range of 50 to 60 degrees F and 30 to 40 percent relative humidity then introducing a vaporous anti-bacterial agent present in an aqueous solution into the air that is heated to a higher temperature usually to between 80 and 110 degrees F and specific humidity usually between 85 to 95 percent relative humidity for a period of time sufficient to disinfect the air or uniformly distribute vaporous antibacterial agent into it, then cooling and dehumidifying the interior air of the building usually to within the range of 50 to 60 degrees F and between 30 to 40 percent relative humidity until the vaporous anti-bacterial agent present in the air condenses onto the surfaces present inside the building and disinfects it then optionally introducing water vapor into the air that is heated to a higher temperature usually between 80 and 110 degrees F and specific humidity usually between 85 to 95 percent relative humidity then cooling water vapor usually to within the range of 50 to 60 degrees F and between 30 to 40 percent relative humidity onto the surfaces to condense it and to dilute the anti-bacterial agent then heating the air inside the building usually to between 90 and 110 degrees F to evaporate the anti-bacterial agent into the air and then removing it from the interior of the building then conditioning the air inside the building to a specific temperature and humidity usually to within the range of 50 to 60 degrees F and between 30 to 40 percent relative humidity then introducing water vapor into the air that is heated to a higher temperature usually to between 90 and 110 degrees F and specific humidity usually between 85 to 95 percent relative humidity then cooling the interior air usually to within the range of 50 to 60 degrees F and between 30 to 40 percent relative humidity until the water vapor condenses onto the surfaces present inside the building so that any anti-bacterial solution residue on the surfaces is diluted and then heating the air inside the building usually between 90 and 110 degrees F to evaporate the water into the air and then removing it from the interior of the building. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS Not Applicable DETAILED DESCRIPTION OF THE INVENTION The present invention comprises methods of using hydrogen peroxide, sodium hypochlorite or any other anti-microbial agent that are in aqueous solution at atmospheric conditions in the decontamination of whole structures or articles that have been contaminated, or may be contaminated, with microorganisms such as bacterial spores. The anti-bacterial agents used in connection with the present method are conventional. Of the numerous agents known to have anti-bacterial properties and which are believed suitable for use in connection with the invention, several have been previously disclosed in the aforementioned U.S. patents. On the basis of this previous disclosure of anti-bacterial agents, it is believed that the following general conditions are applicable. Example I Where the anti-bacterial agent is sodium ethylmercurithiosalicylate in aqueous solution, a concentration within the range of 1:100 to 1:2000 has been found effective. After isolating the interior of the building from the outside environment, the air should be brought to a temperature of 50.degrees. F. and humidified to a range of 30% to 40% relative humidity for two hours then introduce said anti-bacterial agent in aqueous solution into the air that is heated to 90 degrees. F. by means of a cool mist humidifier, atomizer or vaporizer and allow it to vaporize until a relative humidity of 95% is attained for a period of 4 hours then cool the interior air of the building to a temperature of 50 degrees. F. and a range of 30% to 40% relative humidity for 2 hours after the vaporous anti-bacterial agent present in the air condenses onto the surfaces present inside the building and disinfects it then heat the air inside the building to 90 degrees. F. for 2 hours after the anti-bacterial agent present on said surfaces evaporates into the air and then remove said vaporous anti-bacterial agent from the interior of the building then bring the interior air to 50 degrees. F and a range of 30% to 40% relative humidity for two hours then introduce water vapor into the air that is heated to 90 degrees F. by means of a cool mist humidifier, atomizer or vaporizer and allow it to vaporize until a relative humidity of 95% is attained then cool the interior of the building to a temperature of 50 degrees F. for 2 hours after condensation onto the interior surfaces to dilute any residue of anti bacterial agent remaining on the surfaces and then heat the air inside the building to 90 degrees F. for two hours after the water on the interior surfaces evaporates into the air and then remove said water vapor from the interior of the building. Example II Where the anti-bacterial agent is aqueous iodophor solution, an iodine concentration within the range of 0.0012 to 3.0 percent has been found effective. After isolating the interior of the building from the outside environment, the air should be brought to a temperature of 50.degrees. F. and humidified to a range of 30% to 40% relative humidity for two hours then introduce said anti-bacterial agent in aqueous solution into the air that is heated to 90 degrees. F. by means of a cool mist humidifier, atomizer or vaporizer and allow it to vaporize until a relative humidity of 95% is attained for a period of 4 hours until the air is disinfected then remove said water vapor containing the anti-bacterial agent from the interior of the building. Example III Where the anti-bacterial agent is aqueous hydrogen peroxide solution, a hydrogen peroxide concentration of 2.5 to 3.0 percent has been found effective. After isolating the interior of the building from the outside environment, the air should be brought to a temperature of 50.degrees. F. and humidified to a range of 30% to 40% relative humidity for two hours then introduce said anti-bacterial agent in aqueous solution into the air that is heated to 80 degrees. F. by means of a cool mist humidifier, atomizer or vaporizer and allow it to vaporize until a relative humidity of 95% is attained for a period of 4 hours then cool the interior air of the building to a temperature of 50 degrees. F. and a range of 30% to 40% relative humidity for 2 hours after the vaporous anti-bacterial agent present in the air condenses onto the surfaces present inside the building and disinfects it then heat the air inside the building to 80 degrees. F. for 2 hours after the anti-bacterial agent present on said surfaces evaporates into the air and then remove said vaporous anti-bacterial agent from the interior of the building then bring the interior air to 50 degrees. F and a range of 30% to 40% relative humidity for two hours then introduce water vapor into the air that is heated to 90 degrees F. by means of a cool mist humidifier, atomizer or vaporizer and allow it to vaporize until a relative humidity of 95% is attained then cool the interior of the building to a temperature of 50 degrees F. for 2 hours after condensation onto the interior surfaces to dilute any residue of anti bacterial agent remaining on the surfaces and then heat the air inside the building to 90 degrees F. for two hours after the water on the interior surfaces evaporates into the air and then remove said water vapor from the interior of the building. Example IV Where the anti-bacterial agent is aqueous sodium hypochlorite solution, a sodium hypochlorite concentration of 2.5 to 5.25 percent has been found effective. After isolating the interior of the building from the outside environment, the air should be brought to a temperature of 50 to 60 degrees. F. and humidified to a range of 30% to 40% relative humidity for two hours then introduce said anti-bacterial agent in aqueous solution by means of a cool mist humidifier, atomizer or vaporizer into the air that is heated to 90 to 104 degrees F. and allow it to vaporize until a relative humidity of 85% to 95% is attained for a period of 1 to 4 hours then cool the interior air of the building to a temperature of 50 to 60 degrees F. and a range of 30% to 40% relative humidity for 1 to 4 hours after the vaporous anti-bacterial agent present in the air condenses onto the surfaces inside the building and disinfects it then bring the interior air to 50 to 60 degrees F and a range of 30% to 40% relative humidity for 1 to 4 hours then introduce water vapor by means of a cool mist humidifier, atomizer or vaporizer into the air that is heated to 90 to 104 degrees F and allow it to vaporize until a relative humidity of 85% to 95% is attained then cool the interior of the building to a temperature of 50 to 60 degrees F for 1 to 4 hours to condense the water vapor onto the interior surfaces to dilute the anti bacterial agent on the surfaces then heat the air inside the building to 90 to 104 degrees F for 1 to 4 hours to allow the anti-bacterial agent present on said surfaces to evaporate into the air and then remove said vaporous anti-bacterial agent from the interior of the building then bring the interior air to 50 to 60 degrees. F and a range of 30% to 40% relative humidity for 1 to 4 hours then introduce water vapor by means of a cool mist humidifier, atomizer or vaporizer into the air that is heated to 90 to 104 degrees F. and allow it to vaporize until a relative humidity of 85% to 95% is attained then cool the interior of the building to a temperature of 50 to 60 degrees F for 1 to 4 hours after condensation onto the interior surfaces to dilute any residue of anti bacterial agent remaining on the surfaces and then heat the air inside the building to 90 to 104 degrees F for 1 to 4 hours after the water on the interior surfaces evaporates into the air and then remove said water vapor from the interior of the building. Best Mode of the Invention The interior of a building is sealed then air inside the building is brought to a temperature of 50 degrees F and humidified to 30% relative humidity for two hours then an aqueous solution of sodium hypochlorite with a concentration of 5.25% is vaporized through an atomizer into the air as the air is heated to 100 degrees F until a relative humidity of 90% at 100 degrees F air temperature is attained for 2 hours then cool the interior air to a temperature of 50 degrees F and 30% relative humidity for 2 hours after the anti bacterial agent in the air has condensed onto the surfaces inside the building disinfecting it then water vapor is vaporized through a cool mist dehumidifier as the air is heated to 100 degrees F until a relative humidity of 90% at 100 degrees F interior air temperature is attained for 2 hours then the air is cooled to 50 degrees F and a relative humidity of 30% for 2 hours after the water vapor condenses onto the interior surfaces then the interior air is heated to 100 degrees F for 2 hours until the water and anti bacterial agent evaporates and then the vaporous anti bacterial agent is removed from the interior air then the interior air is cooled to a temperature of 50 degrees F and 30% relative humidity for 2 hours after the anti bacterial agent has been removed from the air then water vapor is vaporized through a cool mist dehumidifier as the air is heated to 100 degrees F until a relative humidity of 90% at 100 degrees F interior air temperature is attained for 2 hours then the air is cooled to 50 degrees F and a relative humidity of 30% for 2 hours after the water vapor has condensed onto the interior surfaces then the interior air is heated to 100 degrees F for 2 hours until the water is evaporated into the air and then the water vapor is removed from the interior air. SUMMARY: [/INST] A method of disinfecting and wetting the inside of a building and articles therein at or about one atmospheric pressure which involves the steps of sealing the interior of the building, then conditioning the air inside of the building to a specific temperature and humidity, then heating said air and introducing any of a number of anti-bacterial agents in aqueous solution into said air until a higher specific temperature and humidity are achieved causing the air to be disinfected then optionally condensing the humid air and antibacterial agent until all of the interior surfaces are wetted and disinfected and condensing water vapor onto the interior surfaces then evaporating the liquid wetting said surfaces then condensing said vapor into a disposal tank or sewer and then condensing water again onto the interior surfaces and evaporating it then disposing of the vaporized water. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: As if they don't get to enough on the red carpet, Halloween is always an excuse for Hollywood to strut their stuff and sex up their images with revealing and risque costumes. And this year proved to be one of the most provocative, as the stars pulled out all the stops for their 'trick or tease' attires. From Kim Kardashian's skeletal body suit to Kate Hudson's sexy biker and Lea Michele's naughty little red riding hood, it was all about the flesh. But the one who managed to garner the most attention was Australian rapper Iggy Azalea who, after being compared to one of the cross-dressing characters of the film White Chicks by Snoop Dogg two weeks - sparking an onslaught of cyber bullying - decided to dress up as just that. Tweeting a photo of herself as the character played by Marlon Wayans in the 2004 comedy, it was a playful shut down to all that had criticized her. Scroll down for video. Flaunting it: Kim Kardashian was less scary and more sexy in a skin tight one piece that showed off her curves on Friday. Nice lips: The 34-year-old cover girl had what was made to look like stitches on her face. Lovely in green: Even as a turtle, Rihanna added sex appeal to her outfit in a gold bustier. Queen of Halloween: Heidi Klum threw her annual costume bash in a brightly-coloured butterfly number. Meanwhile Rihanna was making trick or treaters everywhere green with envy when she stepped out in a top Teenage Mutant Ninja Turtles outfit. Halloween must come pretty easy to pop stars that have costume designers on-call at all times. Painted from head-to-toe in scales and green body paint, the singer gave her high-effort outfit a touch of sex appeal by baring her chest in a gold bralet. She was recognizable from her fierce red lipstick but pulled a green wig of shiny locks off her face into a low ponytail. Glamorous: Khloe Kardashian posted about her Sheik friends and her pussycat ensemble on Instagram. The queen of Halloween, Heidi Klum, also opted for a costume not too far from the reptile world with an iridescent butterfly. The star threw another of her famous scary season parties and could barely be recognized as the host in her brightly-colored costume. Behati Prinsloo looked fetching in an eighties style aerobics outfit complete with headband and big hair for her husband Adam Levine's annual bash. Iggy Azalea dressed up as one of the lead characters from the 2004 comedy White Chicks for Halloween. After all the cyber bullying she received from rapper Snoop Dogg, Iggy Azalea shut down his comments with a clever Halloween costume. Naughty naughty: Jennifer Lopez with Demi Lovato (left) as Lucille Ball and Iggy Azalea (right) as one of the men from White Chicks. She's single, all right: The 45-year-old superstar looked fetching in her selfie. Jennifer Lopez went naughty with a sexy red devil outfit. Her jumpsuit was zipped down far showing off her decolletage and she wore a tight hoodie with horns that accented her heavily lined eyes. She was also seen with Iggy Azalea and Demi Lovato, done up as Lucille Ball. Azaela's clever costumewas fierce but funny, showing off her sense of humor in light of the recent cyber attacks. Social media erupted over her outfit and quickly declared her the best-dressed celebrity. Pink looked very different as she dressed up as a sexy clown (smoking a cigarette) with husband Carey Hart. Unrecognizable: Pink looked very different as she dressed up as a sexy clown (smoking a cigarette) with husband Carey Hart. Let's get physical: Model Behati Prinsloo wore an eighties style aerobics outfit that channeled Olivia Newton-John from her hit single while her husband Adam Levine looked like a rocker at their fete. Bark-worthy: Paris Hilton dressed as her white Pomeranian Prince for her event at 1OAK on Friday; she even had a dog collar on. Paris Hilton dressed up as a Pomeranian in a white fluffy mini dress and little dog ears for her event at 1OAK. Lea Michele turned to the fairytales for her sexed up Halloween costume as she attended Kate Hudson's LA bash in a Little Red Riding Hood outfit. She teased fans on Instagram with a picture in her smalls as she slipped into a corset and stockings for the storybook character. Getting into character, the Glee star donned a scarlet hooded cape that covered her from behind. What a treat: Glee star Lea Michelle attends Kate Hudson's Halloween bash as Little Red Riding Hood. Tease: Beneath her cape, the actress showed off her enviable frame in just a saucy corset. In true Kardashian style, Kim made numerous outfit changes throughout the day on Friday. The brunette first showed her curves as a skeleton, blacking out her face and flaunting her figure in a skin tight one piece with the bones drawn on. She also opted for a funny costume, dressing as US Vogue Editor At Large Anna Wintour, whom Kim secured her first Vogue cover with this year. But it wasn't just the mum-of-one who was able to get into the spirit of the scary season this year. Meow: Joanna Krupa slipped into a nude and leather Catwoman suit when she attended Adam Lambert's soiree at Bootsy Bellows in West Hollywood on Friday. Boo: Lady Gaga was first in a pink dress then she slipped a white tablecloth over her head while out to dinner in Paris. Kim took great pleasure in dressing up her daughter North West in a string of adorable outfits from the dressing up box. First the Keeping Up With The Kardashians star put her mini-me in a skunk costume and later dressed her in a little black cape dress. Kim said North West was excited for her daddy North West to see her various costumes. Lady Gaga was in Paris for the big night. First she stepped out in a pink dress. Later, she wrapped a tablecloth over her head. Good thing two holes were cut out so she could see where she was walking. Dream team: Kim dressed her clan in Vogue costumes as Anna Wintour, Grace Coddington, Karl Lagerfeld and Andre Leon Talley. A little family: The E! star's Chanel suit didn't look to quite fit her as she stood behind North who had greyish locks. Mummy bear: Kourtney Kardashian steps out in a fur-lined Gorilla costume with her children dressed up. This is how models party on Halloween: Kendall Jenner wore a Super Mario Bros. outfit to hang with her pals. And since Halloween is supposed to be about the children, Nicole Richie was also bringing it back to the kids when she - dressed as Cruella De Vil - Instagrammed a sweet snap with her two little ones dressed as dalmatian puppies. The Simple Life star captioned the picture '101 Maddens' after her husband Joel Madden. Nicole headed to Kate Hudson's party in Brentwood on Friday night without her adorable look-a-like children. Getting them involved: Nicole Ritchie - as Cruella De Vil - posed with her children as dalmatians on Instagram. Taylor Swift put on a white winged unicorn outfit when she stopped by the Elvis Duran show in NYC on Friday. Rita Ora was a mass of pink on Friday night as she attended the star-studded Death Of A Geisha party as Barbie. The pink princess wore a diamonte crown with fuchsia lipstick and carried a little white dog under one arm. The main attraction was her show-stopping dress however, as she slipped on a cut away dress that showcased her shape and later ditched her underwear to leave nothing to the imagination. Now we've seen it all! Taylor Swift had on a white winged unicorn outfit as she stopped by the Elvis Duran show in NYC on Friday. In a Barbie world: Singer Rita Ora pulled together everything pink for a Barbie get up alongside her blonde locks. Also leaving nothing to the imagination in her Halloween get up was actress Kate Hudson who threw a Sons Of Anarchy party in a leather crop top and hot pants. She teamed up with 68-year-old mother Goldie Hawn who stuck on her leathers to show off her own flawless figure. The pair added the sex appeal to the party, looking more like sisters than mother and daughter. Like mother, like daughter: Kate Hudson held a Sons Of Anarchy party where she and mother Goldie Hawn got leathered up for the occasion. Keeping up with the anarchic theme, Jessica Alba could barely be recognised in a black wig as Slash in a rock and roll T-shirt and black jeans. She wore a top hat alongside her blonde-haired friend as Axl Rose of Guns 'N Roses fame. The pair wore fake tattoos on their arms as they arrived at the well-attended party on Friday night. Who's that girl? Jessica Alba dressed as Slash and Axl with her blonde-haired friend at Kate's friend. Being able to see the funnier side of dressing up, Katy Perry took the mickey out of herself when she attended Kate's bash in a Cheetos costume. In all-orange, Katy was a hard sight to miss, leaving just a face hole for her to see and be seen at the guest list only event in Brentwood. Too complement her ensemble, but also make her costume identifiable, the singer carried a bag of Cheetos as a handbag too. Seeing the funny side: Katy Perry poked fun at herself when she stepped out to Kate's party as a Cheeto. Silly singer: The Firework singer left just a face hole for her to see and be seen on Thursday night. Beyonce opted for something more cultured however, when she paid homage to Mexican painter Frida Kahlo. She wore butterflies in her hair and fanned out her eye brows for a dead-ringer look and dressed her curves in a floral dress. The Crazy In Love singer made it a family occasion as she spent the Halloween evening with husband Jay Z and her sweet daughter Blue Ivy. Ali Larter and her son wore matching pirates outfits as they were spotted in LA. Sophisticated: Beyonce wore a floral dress and fanned out her eyebrows as Frida Kahlo. Cultured: The Halloween fan paid homage to the Mexican painter with her elegant get up. What a wench! Ali Larter wore a comely pirates outfit as did her son as they headed out in LA. Witchy woman: Mischa Barton in black and sneakers for Levine's party which was held at The Sportsman Lodge in Sherman Oaks. An early start: Jenny McCarthy wore a 'bad' Sandy outfit from Grease when visiting Sirius XM on Wednesday SUMMARY: [/INST] Hollywood's Halloween proved to be one of most provocative this year. Kate Hudson, Lea Michele and Paris Hilton were some of the other stars that went for sexy outfits. Iggy Azalea used the night to show up her cyber bullies. Two weeks ago Snoop Dogg compared her to one of the cross-dressing characters of the film White Chicks. She dressed up as the character portrayed by Marlon Wayans in 2004. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: When the two top teams in Serie A met on Sunday night, it was always going to be a feisty encounter. That it was settled by a piece of brilliance, rather than a refereeing howler, was reassuring, but not entirely fitting. Not only do these two teams not like each other, but there was also a huge amount at stake - neither side had dropped a point yet in the league this season. But few could have predicted just how much controversy would be crammed into this clash, during which referee Gianluca Rocchi awarded three penalties in the first half and showed two red cards in the closing stages, nor the source of the stunning winner. VIDEO Scroll down to watch Juventus 3-2 Roma: Pictorial highlights. Roma's Konstantinos Manolas is shown a red card by referee Gianluca Rocchi in the closing stages. Juventus manager Massimiliano Allegri pulls Alvaro Morata away as tensions rise in TUrin. Roma's Manolas and Morata, of Juventus, go head to head on the touchline as Allegri jumps in. Juventus players jump up and celebrate a narrow 3-2 win over Roma in Serie A on Sunday night. Bonucci unleashes his late volley from just outside the box to win the game for Juventus. Carlos Tevez scores his first of two penalties to put Juventus into the lead after a controversial decision. Roma coach Rudi Garcia was sent to the stands by the referee for his reaction to the first penalty. With just four minutes remaining, centre half Leonardo Bonucci unleashed an unstoppable volley from the edge of the box to win the game, connecting beautifully with a cleared corner. It was a goal worthy of winning any game, but this match will be remembered for so much more. The controversy began with a Juventus freekick in the 26th minute. Pirlo struck it, and it struck defender Maicon on the arm, seemingly just outside the box. Rocchi awarded a freekick, but, once the Juventus players had pointed to his magic spray line, clearly inside the area, changed his mind. Carlos Tevez dispatched the penalty, Rudi Garcia was sent to the stands for his reaction, apparently immitating playing a violin. The referee brandishes a yellow card as Roma are awarded a penalty for a clear foul by Lichsteiner. Juventus had still not conceded in their five league games this season, and would have been confident that Tevez's penalty was a significant advantage. But Roma are a different prospect, and this game had much more drama to come. Just five minutes after going ahead, Juventus shot themselves in the foot, Swiss defender Stephan Lichsteiner inexplicably wrestling Francesco Totti to the floor inside the box. If Rocchi was looking for an opportunity to level things up, he could not have asked for a more blatant one. Totti, like Tevez, made no mistake from twelve yards. Francesco Totti, who had been wrestled to the ground, picked himself up to level the scores from the spot. Juan Iturbe celebrates his goal which put Roma in the lead shortly before half time, after Gervinho's pass. Now it was Roma who had a spring their step, and a minute before half time they were ahead. Gervinho, the danger-man so often since his move from Arsenal, drove at the defence before slipping in Juan Iturbe, who finished nicely. The home support were getting restless - they are not used to being behind - but Mr Rocchi was on hand to level things up again just a minute later. Paul Pogba cut in from the left hand side, and as he passed Seydou Keita, the French midfielder went to ground. Contact, if there was any, was minimal. Where it occured, if anywhere, was the subject of much debate, but Rocchi decided it was just inside, rather than just outside, the box. Cue Tevez again. Same corner. Same result. Two goals each at half time. Iturbe's goal was the stand-out moment of quality in a first half packed with controversy. The Roma players can't believe it as Rocchi awards Juventus a second controversial penalty before half-time. Carlos Tevez made no mistake, converting for the second time into the same corner to make it 2-2. In truth, the second half looked like it might not be living up to the drama of the first. Both sides pushed for the win, but neither looked particularly likely to get it before Bonucci stepped up. However, it was only right, in a game like this, that the last word should go to the referee. Kostas Manolas, superb until this moment of madness, squared up to Alvaro Morata. The two clashed heads, but, in truth, neither needed more than a yellow card for what was more handbags than a true fight. Rocchi decided otherwise though. Both players were dismissed. The referee was back in centre stage. Veteran Italian stars Totti and Andrea Pirlo exchange words as Gioanluca Rocchi runs to the scene. The Italian defender got some way off the ground before unleashing the powerful low volley. Lonardo Bonucci celebrates his stunning late winner which keeps Juventus top of Serie A. Bonucci leads the celebrations as Juventus maintained their 100% record at the expense of Roma's SUMMARY: [/INST] Carlos Tevez puts Juventus ahead from penalty spot after referee changes his mind. Francesco Totti equalises five minutes later with another penalty. Roma take the lead through Juan Iturbe after brilliant Gervinho assist. Tevez makes it 2-2 on the stroke of half time after THIRD penalty. Leonardo Bonucci volleys home winner in 86th minute from 20 yards. Kostas Manolas and Alvaro Morata see red in final minute. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Ashley Collman for MailOnline. Legal battle: Debra Mandelbaum (pictured) is in the midst of a bitter divorce from husband Michael, who says the two were never married to begin with. The multi-milionaire son of a Minnesota Vikings owner is trying to get out of a costly divorce by arguing that he was never married to his wife of 20 years to begin with. Michael and Debra Mandelbaum separated late last year, after he allegedly pushed her down a flight of stairs during a fight at their Warren, New Jersey home. The couple are currently in the middle of a protracted divorce, thanks to a technicality in their 1993 wedding ceremony. The Mandelbaums applied for a marriage license on December 10, 1993, and were married two days later in a Jewish ceremony. But the marriage license wasn't actually issued until December 21. Though they lived together as husband and wife for more than two decades, and share three children, Mr Mandelbaum says he was never legally married and therefore exempt from divorce and the traditional dividing of property. Mr Mandelbaum filed a motion to dismiss the divorce in May. The case has continued after his estranged wife submitted evidence to the court of their relationship. Among the documents are joint tax returns, deeds and anniversary cards where Mr Mandelbaum wrote 'For my wife' and 'after 20 years, I'd marry you all over again'. The couple are due back in court early next month. At stake is the Mandelbaum's estimated $2million six-bedroom home in Warren. 50/50 split? The couple shared this estimated $2million home in Warren, NJ prior to their break-up. Last December, police were called to the house where they found Mrs Mandelbaum half-conscious at the bottom of the stairs. In a strange tie to the current NFL scandal involving Ray Rice, Mr Mandelbaum was accepted into the same pretrial intervention program for hitting his wife last year. Candidates accepted into the program can have the charges dropped if they successfully complete the course. Dad: Michael Mandelbaum is the son of David Mandelbaum (pictured), one of the wealthiest men in America and a minority owner of the Minnesota Vikings. Rice went through the program, which many considered too light a sentence after video was released, showing him punching then-fiancée Janay Palmer. Mandelbaum's wife obtained a temporary restraining order against her husband after he pushed her down a set of stairs at their house last December. Police responding to the scene found Mrs Mandelbaum half-conscious at the bottom of the stairs. Mr Mandelbaum was charged with aggravated assault in the third degree before being accepted into the intervention program. Mr Mandelbaum is the son of David Mandelbaum, one of the wealthiest people in America. According to Forbes, David Mandelbaum and his family made $900million last year. In addition to a minority ownership in the Minnesota Vikings, David Mandelbaum has stakes in Vornado Realty Trust. His son Michael 'handles the legal affairs of the family' SUMMARY: [/INST] Michael and Debra Mandelbaum were married in December 1993, but the marriage license wasn't issued until after their ceremony. Mr Mandelbaum argues that since they were never legally married, they can't get divorced. The couple have been separated since last December, when Mrs Mandelbaum was found half-conscious after a fight. Mr Mandelbaum is the son of David Mandelbaum - a minority owner of the Minnesota Vikings and one of the wealthiest people in America. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Daily Mail Reporter. PUBLISHED:. 16:09 EST, 30 December 2013. \|. UPDATED:. 18:33 EST, 30 December 2013. A sinkhole in Louisiana that is already the size of 20 football fields is eating up more of the Earth after the level surrounding it cracked for the second time in less than two months. The 26 acre Bayou Corne sinkhole developed in August 2012, when a salt dome operated by Texas Brine Co. collapsed deep underground. A levee was built soon after to keep the salty and sometimes oily water out of the surrounding freshwater swamps but it is now oval with growth zones heading northeast and southwest. Scroll down for videos. Growing: A sinkhole in Louisiana that is already the size of 20 football fields has gotten even bigger after the level surrounding it cracked for the second time in less than two months. Muck: The water expanse is full of oil. In late October, the earth-and-limestone levee sank some and cracks developed. The Parish Office of Homeland Security and Emergency Preparedness director John Boudreaux said Monday that a new hairline crack was discovered Sunday in exactly the same spot as the largest crack, that stretched about a foot wide, from October. The new crack had spread from a few feet on the levee top on Sunday to all the way across it by Monday, he said, adding that a second crack had formed along the inner side of the southern levee where the previous round of tremors had caused the levee to sink. Boudreaux said its shape suggests a small section of levee top may slide into the sinkhole. Huge: Boudreaux said its shape suggests a small section of levee top may slide into the sinkhole. Enormous: The 26 acre Bayou Corne sinkhole developed in August 2012, when a salt dome operated by Texas Brine Co. collapsed deep underground. Since last week, micro-earthquakes have been increasing until around 180 per day were recorded near the sinkhole by Sunday. This has halted work to fight the growing water mass. Louisiana state is suing Texas Brine as it tries to recoup $12 million spent in an attempt to deal with the sinkhole, including bringing in a team of scientists. While no homes have yet been sucked in, officials warn that the gases being emitted could ignite, which would leave the Louisiana swamp looking like 'the gates of Hell'. Boudreaux filmed the sinkhole in August, uploading the iPhone video to YouTube showing it burping and sucking in trees in the throes of a violent growth spurt. Tremors: Since last week, micro-earthquakes have been increasing near the sinkhole and the failed Texas Brine cavern, halting work on the sinkhole and totaling 180 per day by Sunday. Levee: A levee was built soon after to keep the salty and sometimes oily water out of the surrounding freshwater swamps but it has cracked multiple times. 'They're going down,' Boudreaux says on the viral video of a grove of cypress trees. This week he spoke to Newsweek about the frightening expanse, which has largely emptied the town of Bayou Corne. 'How often do you see a tree go straight down?' he asked. State officials guess the sinkhole will expand from its current size to at least 40 acres over the next several years. It's currently 750 feet deep in some points and has methane bubbling up from it. The sinkhole is located in a stretch of about 100 miles between New Orleans and Baton Rouge that is not-so-affectionately known as Cancer Alley for its 150 or so petrochemical plants and high incidences of cancer among residents. It is one of the most industrialized and polluted areas of the county, Newsweek reported SUMMARY: [/INST] The 26 acre Bayou Corne sinkhole developed in August 2012, when a salt dome operated by Texas Brine Co. collapsed deep underground. A levee was built soon after to keep the salty and sometimes oily water out of the surrounding freshwater swamps but it keeps growing, heading towards Louisiana Highway 70 and the Bayou Corne waterway. In late October, the earth-and-limestone levee sank a bit and cracks developed and new cracks have emerged as more residents leave the area. Louisiana state is suing Texas Brine as it tries to recoup $12 million spent in an attempt to deal with the sinkhole. While no homes have yet been sucked in,. officials warn the gases being emitted could ignite, leaving the Louisiana swamp looking like an inferno. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The loss of HIV-specific CD8+ T cell cytolytic function is a primary factor underlying progressive HIV infection, but whether HIV-specific CD8+ T cells initially possess cytolytic effector capacity, and when and why this may be lost during infection, is unclear. Here, we assessed CD8+ T cell functional evolution from primary to chronic HIV infection. We observed a profound expansion of perforin+ CD8+ T cells immediately following HIV infection that quickly waned after acute viremia resolution. Selective expression of the effector-associated transcription factors T-bet and eomesodermin in cytokine-producing HIV-specific CD8+ T cells differentiated HIV-specific from bulk memory CD8+ T cell effector expansion. As infection progressed expression of perforin was maintained in HIV-specific CD8+ T cells with high levels of T-bet, but not necessarily in the population of T-betLo HIV-specific CD8+ T cells that expand as infection progresses. Together, these data demonstrate that while HIV-specific CD8+ T cells in acute HIV infection initially possess cytolytic potential, progressive transcriptional dysregulation leads to the reduced CD8+ T cell perforin expression characteristic of chronic HIV infection. CD8+ T cells play a central role in the control of HIV replication. During acute infection the emergence of HIV-specific CD8+ T cells correlates with resolution of peak viremia [1,2], and in the nonhuman primate model experimental depletion of CD8+ T cells prior to infection with simian immunodeficiency virus delays resolution of acute viremia until the CD8+ T cell pool is reconstituted [3]. Further evidence of the immunologic pressure exerted by CD8+ T cells is manifest by CTL escape mutations throughout all phases of HIV infection and the association of certain MHC class I alleles with superior control of viral replication [4–9]. However, for the vast majority of infected individuals control is incomplete and ultimately fails in the absence of therapy. A better understanding of the CD8+ T cell response to HIV may inform the design of vaccines, therapeutics, or eradication strategies designed to stimulate or potentiate the natural response to infection resulting in better, if not complete, control. The CD8+ T cell response to viral infection is multifaceted, including the ability to proliferate, produce multiple cytokines and chemokines, degranulate, and induce cytolysis upon contact with infected targets [10]. During chronic progressive infection, HIV-specific CD8+ T cells have impaired proliferative potential [11–13], are less capable of multifunctional responses [14,15], and have reduced cytotoxic capacity [16–20]. The primary mechanism by which CD8+ T cells kill virally infected cells is via exocytosis of granules containing the cytolytic proteins perforin and granzyme B [21,22]. Control of HIV viremia has been associated with the ability of CD8+ T cells from chronically HIV-infected donors to upregulate these cytotoxic effector molecules following in vitro culture [18], and we have shown that CD8+ T cell cytotoxic potential, defined by the ability to rapidly upregulate perforin following brief stimulation ex vivo, correlates inversely with viral load [16]. Effector CD8+ T cell development is coordinated by an array of transcription factors [23]. Murine studies have identified the T-box transcription family members T-bet and eomesodermin (Eomes) as important regulators of the differentiation and function of cytotoxic effector T cells [24–26]. T-bet positively regulates genes associated with effector functions including perforin, granzyme B, and IFN-γ [27,28], whereas Eomes is associated with the expression of perforin as well as proteins involved in maintenance of memory CD8+ T cells [24,26,29,30]. While previous studies suggested a level of redundancy in the gene targets of these transcription factors, recent data show that the balance of T-bet and Eomes expression within a cell is a determinant of the differentiation pathway and functionality of the cell [30–34]. In the context of chronic HIV infection, HIV-specific CD8+ T cells with high levels of T-bet demonstrate greater overall functionality and maintain the ability to express perforin whereas cells with a T-betLoEomesHi phenotype are less differentiated, less functional, exhausted, and express little to no perforin [28,32]. Notably, during chronic progressive infection the T-betLoEomesHi phenotype dominates the HIV-specific CD8+ T cell pool [32]. It remains unclear if low T-bet levels and the associated deficiency in perforin expression results from progressive loss on the part of responding HIV-specific CD8+ T cells or if responding cells are inherently dysfunctional throughout the infection period. Much of our current knowledge regarding the dynamics of CD8+ T cell responses during acute infection is derived from murine models, particularly following infection with lymphocytic choriomeningitis virus, gammaherpesvirus, or influenza [35–37]. Infection by these viruses induces rapid and substantial activation and expansion of antigen-specific CD8+ T cells. Following resolution of acute viremia, the virus-specific population contracts, giving rise to memory cells that provide long-term protection. Human antiviral CD8+ T cell responses have primarily been assessed in the context of chronic infection, after the memory pool has been established [10,38–41]. Recent studies have examined development of human CD8+ T cell responses to a range of primary infections, including attenuated yellow fever virus, attenuated vaccinia virus, influenza, tick-borne encephalitis virus (TBEV), hantavirus, and Epstein-Barr virus [42–47], demonstrating that antigen-specific cells have immediate cytotoxic capacity directly ex vivo during the acute phase of these infections. The few studies to examine the earliest responses to HIV showed that HIV-specific CD8+ T cells have limited functionality during the acute phase of infection but did not assess cytotoxic potential or regulation by T-bet or Eomes [48,49], leaving the question unresolved as to whether these effector molecules are induced during acute infection. Here, we examined the temporal dynamics of the CD8+ T cell effector response in peripheral blood of subjects experiencing acute primary HIV infection. We found that infection elicited a robust and highly activated response with immediate cytotoxic potential within the peripheral CD8+ T cell pool and that cells responding to short in vitro stimulation with HIV peptides were able to degranulate and rapidly upregulate perforin de novo. However, HIV-specific CD8+ T cells rapidly lost the ability to upregulate perforin following resolution of peak viremia. Loss of perforin expression coincided with a concurrent reduction in the expression of T-bet, but not Eomes, on a per-cell basis. Our data provide evidence of a robust and physiologically appropriate response during the earliest phase of acute HIV infection that is rapidly lost during progressive chronic infection, due in part to an inability to express sufficient levels of T-bet to properly drive effector differentiation. Longitudinal samples were obtained from 32 subjects experiencing primary HIV infection (Fig 1A), 28 of whom had at least one acute time point (36 time points total; median 54 d from infection, range 23–100 d) and 23 with at least one chronic time point (40 time points total; median 551 d, range 367–880 d). Samples were drawn from three separate cohorts of acutely infected individuals: the CHAVI001 acute-infection cohort, the Montreal Primary Infection cohort, and the RV217/ECHO cohort. These cohorts provided broad geographical representation including North America, East Africa, Malawi, and Thailand (S1 Table). Subjects were antiretroviral therapy naïve at all time points, consistent with the standard of care at the time of study, and none controlled viral load to undetectable levels (Fig 1B). The mean peak viral load was 5. 2 log10 RNA copies/ml for the entire study population (7. 0 log10 RNA copies/ml for the better-characterized RV217 donors) and 4. 42 log10 RNA copies/ml at set point. Peripheral blood CD4+ T cell counts and CD8+ T cell counts both declined over the study period (average rates of 80 cells/mm3 per year and 75 cells/mm3, respectively; Fig 1C and 1D). Samples from 41 seronegative healthy donors, including pre-infection time points for the 11 RV217 acute subjects (median -210 d from infection, range -41 to -478 d; Fig 1A and S1 Table), were analyzed for comparison. To determine if different phases of infection were associated with changes in circulating CD8+ T cell differentiation and activation, we assessed the size and composition of the memory CD8+ T cell pool (S1 Fig). Relative to HIV-negative donors, HIV-infected subjects had a significantly larger memory (non-CCR7+CD45RO-) CD8+ T cell pool in both the acute and chronic phases of infection (Fig 2A and 2B). Of note, the frequency of total memory CD8+ T cells at the earliest post-infection time points inversely correlated with peak viral load, but not with set point viral load (Figs 2C and S2A). In addition to the larger memory pool we also observed a shift in the distribution of memory subsets in infected subjects, with significantly higher proportions of central memory (CCR7+CD45RO+) and, predominately, effector memory (CCR7-CD45RO-) subsets during acute infection (Fig 2D). Only the effector memory pool remained significantly elevated into the chronic phase. There was no difference in the proportion of the effector cell pool (CCR7-CD45RO-) during either phase of infection, although the relative frequency of these cells did appear to be larger as infection progressed (Fig 2D). When we examined the activation state of the memory pool for four RV217 subjects by measuring surface expression of HLA-DR, we found massive levels of activation within the memory CD8+ T cell compartment following HIV infection (Fig 2E), in agreement with recent data from Ndhlovu et al. [48]. To determine if this population of highly activated cells expressed cytolytic molecules directly ex vivo we measured perforin content. We found that almost all HLA-DR+ cells expressed perforin during the acute phase (Fig 2F). In addition, we observed a significantly greater proportion of perforin+ cells in both acute and chronic phases of infection compared to healthy donors (Fig 2G). There was, however, no significant association between the frequency of perforin+ CD8+ T cells and viral load at any time point (S2B Fig). Together, these data show that during acute HIV infection a large proportion of the peripheral CD8+ T cell pool is highly activated and primed to exert cytotoxic effector activity but the absolute magnitude of total cytotoxic CD8+ T cells does not predict set point viral load. We next examined if the large frequency of cytotoxic CD8+ T cells observed during acute HIV infection was consistent across other acute viral infections. We compared the total CD8+ T cell responses of subjects from the RV217 cohort with those of HIV-negative individuals who were vaccinated with attenuated vaccinia virus (VV) or attenuated yellow fever virus (YFV) -17D, or experimentally infected with a H1N1 strain of influenza virus (S3A–S3C Fig). Vaccination with VV or YFV elicits a robust and highly specific CD8+ T cell response that peaks approximately two weeks after inoculation and is largely resolved by four weeks [46]. The peripheral CD8+ T cell response to influenza is less robust, peaks at 1–2 weeks, and resolves by four weeks post-infection [43]. Consistent with the comparison between healthy donors and acute phase HIV infection (Fig 2B), both the total memory CD8+ T cell pool and the effector memory subset increased significantly from pre- to acute HIV infection (Figs 3A and S4E). There was also a significant increase in the proportion of perforin+ cells over the first thirty days of infection, with almost all (>90%) circulating memory CD8+ T cells expressing perforin in some donors (Fig 3E). When we examined the CD8+ T cell responses to in vivo stimulation following vaccination with VV or YFV, or infection with influenza, we did not observe significant changes in the size or distribution of the peripheral memory pool (Figs 3B–3D and S4). We did find increased levels of activated HLA-DR+ cells in some donors after vaccination with VV and YFV, but frequencies of perforin+ cells remained relatively stable throughout the entire vaccine course (Figs 3F, 3G and S5A–S5D). Only infection with influenza resulted in a slight but significant increase in perforin+ cells at d28 post-infection (Fig 3H). While these models of acute viral infections do have limitations in their use as comparators for our HIV-infected donors (e. g. different antigen loads, different localizations, and more precise timing of infection), overall these data show the dramatic increase in cytotoxic cells that takes place in the peripheral blood of HIV acutely infected subjects is significantly more pronounced compared to live-attenuated vaccination or influenza infection. We next sought to determine if the cytotoxic potential of HIV-specific cells demonstrated similar dynamics to the total memory CD8+ T cell pool during acute to chronic HIV infection. To identify HIV-specific cells we focused on the detection of IFN-γ production and CD107a-marked degranulation following a short-term in vitro stimulation with peptides derived from the HIV-1 Gag and Nef proteins [15,48–50]. In agreement with previous studies that evaluated HIV-specific cells longitudinally by functional responses or tetramer staining [49,51], we found no difference in the absolute magnitude of responding cells for either protein over time (Figs 4A and S6A). Consistent with the memory distribution of the total CD8+ T cell pool, Gag-specific cells largely had an effector memory phenotype in the acute phase of infection but became more equally distributed between effector and effector memory subsets for early chronic time points (Fig 4B and 4C). Also in agreement with previous data, cells tended to degranulate more readily than upregulate IFN-γ in the acute phase of infection (Figs 4D and S6B) [48,49]. The high proportion of degranulating cells suggested that the HIV-specific response might be cytotoxic over the course of infection, as analysis of the total CD8+ T cell pool had indicated. However, degranulation is not an absolute surrogate of cytolytic potential [16,52], nor does it indicate whether the cells will continue to be cytotoxic following the initial granule release [53]. To assess cytotoxic potential more directly, we measured perforin expression levels within the Gag- and Nef- specific cells (Figs 4E and S6C). The majority of cells that responded to direct ex vivo stimulation rapidly upregulated perforin during the earliest time points following infection, suggesting that the early HIV-specific response was likely highly cytotoxic. In contrast to the bulk memory CD8+ T cell pool, however, as acute viremia was resolved there was a rapid loss of perforin expression by both HIV-1 Gag- and Nef-specific CD8+ T cells (Figs 4F and S6D). A large proportion of HIV-specific CD8+ T cells have previously been shown to upregulate β-chemokines independently of degranulation during acute HIV infection [49]. To determine if β-chemokine-producing cells similarly expressed perforin, we assessed expression of MIP-1α by responding cells in a subset of subjects. Inclusion of MIP-1α did not significantly change the overall magnitude of Gag-specific cells detected over time, though it did identify a subset of cells not captured by IFN-γ or CD107a (S7A–S7C Fig). Importantly, the dynamics with which expression of perforin by Gag-specific cells was lost was the same with or without MIP-1α (S7D and S7E Fig). Combined, these data show similarities in the total and Gag-specific CD8+ T cell responses in both differentiation state and cytotoxic potential, suggesting the bulk of activated cells during acute HIV infection could be comprised of HIV-specific CD8+ T cells. Studies in both murine models and humans have strongly linked the transcription factors T-bet and Eomes to the regulation of effector CD8+ T cell differentiation and function, including the expression of perforin [24–26,28,30,42,54]. To gain further insight into the evolution of the cytotoxic CD8+ T cell response to HIV we assessed the expression of T-bet and Eomes over the course of infection. For healthy donors, including HIV pre-infection time points, perforin expression was directly associated with T-bet and/or Eomes expression such that the majority of perforin+ cells were either T-bet+Eomes+ or T-bet+Eomes- (Fig 5A and 5B). In contrast, acutely HIV-infected individuals showed marked dissociation between perforin and both T-bet and Eomes resulting in significantly lower proportions of T-bet+Eomes+ and T-bet+Eomes- perforin+ cells (Fig 5A and 5B), and an expansion of perforin+ cells expressing neither T-bet nor Eomes. By the chronic stage these subsets had largely, though incompletely, returned to their normal distributions. When we analyzed T-bet and Eomes expression longitudinally for perforin+ CD8+ T cells within the HIV-infected cohort we found the proportion of T-bet+Eomes+ cells decreased over the first 30 days of infection and T-bet-Eomes- cells increased over the first 60 days before gradually returning to pre-infection levels (Fig 5C and 5D). We have previously shown that the level of T-bet expression within peripheral CD8+ T cells is directly associated with perforin expression, where perforin was found predominantly within T-betHi cells [28]. Consistent with those findings, perforin was most highly associated with a T-betHiEomes+ expression pattern in HIV negative donors and this subset experienced the largest drop during acute HIV (S8 Fig). Despite these shifts in expression patterns that appeared to coincide with the rise and fall plasma viremia, there was no association between the acute frequencies of T-bet or Eomes subsets and acute or set point viral loads (S9A–S9D and S10A–S10D Figs). However, frequencies of T-bet+ and T-bet-Eomes- CD8+ T cells at set point time points were inversely or directly associated with set point viral load, respectively (S9A and S9D Fig). To determine if the dissociation between perforin, T-bet, and Eomes was unique to HIV, we examined T-bet and Eomes expression within total perforin+ cells following YFV and VV vaccination. While we found almost no dissociation for YFV, there was a transient dissociation following vaccination with vaccinia, although not to the same extent as observed during acute HIV (S11A and S11B Fig). We next examined expression of T-bet and Eomes within HLA-DR+ cells throughout the different vaccine courses. As noted above, during acute HIV infection the vast majority of HLA-DR+ cells are also perforin+ (Fig 2E); thus, it was unsurprising to find that perforin+ and HLA-DR+ cells showed almost identical dynamics in the loss of T-bet and Eomes expression for HIV (S11C Fig). Similarly, for both YFV and VV, activated cells showed a transient increase in the frequency of T-bet-Eomes- cells at day 14 post-vaccination. Together these data suggest that the transient expansion of highly activated bulk effector CD8+ T cells during acute viral infection in humans may not require expression and/or maintenance of T-bet and Eomes. To determine if the transient loss of T-bet and Eomes within the bulk activated CD8+ T cell memory pool during acute HIV infection extended to HIV-specific CD8+ T cells, we assessed expression of these transcription factors in Gag-specific CD8+ T cells. In marked contrast to the highly activated bulk CD8+ T cell effector population during acute HIV infection, HIV-specific CD8+ T cells expressed T-bet and/or Eomes at the earliest detectable time point and throughout the course of infection (Fig 6A–6C). This indicates that despite their phenotypic similarities total and HIV-specific CD8+ T cells may be primed quite differently during acute infection and raises the possibility that the majority of expanded effector CD8+ T cells in early HIV infection may not be specific for HIV. We next examined whether loss of perforin expression was related to changes in the level of T-bet expression during early HIV infection. Interestingly, the distribution of T-bet within Gag-specific CD8+ T cells changed over time from acute to chronic infection (Fig 6D). In the acute phase, responding cells were equally distributed between T-betHiEomes+ and T-betLoEomes+ expression patterns, which during the chronic phase began to be dominated by T-betLoEomes+ cells (Fig 6D). Furthermore, T-betHiEomes+ HIV-specific CD8+ T cells continued to express perforin as infection progressed, whereas T-betLoEomes+ cells gradually lost perforin expression over time (Fig 6E and 6F). Finally, in contrast to the recent findings by Ndholuvu, et al. [48], we did not find the magnitude, proportion perforin+, or any T-bet- or Eomes-expressing subset of responding HIV-1 Gag-specific CD8+ T cells to be predictive of peak or set point viral load (S12 and S13 Figs). Despite this, our data suggest that in the earliest phase of infection, HIV-specific CD8+ T cells have both the transcriptional and functional properties associated with long-term control of HIV replication [16,28], and that the inability to durably maintain high-level T-bet expression contributes to a qualitatively inferior response as infection progresses. Mechanisms underlying the inability of CD8+ T cells to fully control HIV replication have remained unclear. Failure of antiviral immunity has been attributed in part to qualitative defects in total and HIV-specific CD8+ T cells [15,16,20,55,56]. However, the dysfunction observed within the CD8+ T cell pool has largely been defined in the context of chronic infection when the success or failure of the presumed response has already been determined. The question of whether CD8+ T cells in progressive infection were intrinsically less functional from the outset or if dysfunction arose over time has remained unanswered. To address this issue, we assessed the longitudinal CD8+ T cell responses of a diverse cohort of individuals experiencing acute/early HIV infection. We show that acute HIV infection elicits a robust cytotoxic CD8+ T cell response characterized by cells that express the cytolytic effector molecule perforin and the effector-associated transcription factors T-bet and Eomes. Importantly, the quality of the response quickly waned following the resolution of acute viremia, with a significant decrease in perforin expression by HIV-specific CD8+ T cells that was at least partially accounted for by a shift from T-betHiEomes+ cells to T-betLoEomes+ cells. The attenuation of the cytolytic response may help explain the failure of CD8+ T cells to control HIV replication in the long-term. It is well documented that CD8+ T cell responses are elicited early in HIV infection and are associated with control of viral replication [1,2, 48,57]. Some of the strongest evidence of the CD8+ T cell-mediated immunologic pressure exerted during this period is the rapid emergence of viral escape mutations within known CD8+ T cell epitopes [4,6, 9]. We found that HIV-specific cells had high cytotoxic potential at the earliest time points following HIV infection, but rapidly lost this function as disease progressed. This suggests a mechanism through which CD8+ T cells may exert a strong direct selective pressure on the virus resulting in the rapid selection of escape variants early in infection that ultimately have a reduced capacity to stimulate cytolytic CD8+ T cell responses [6,9, 58,59]. It should be noted that whereas perforin expression was lost over time almost all HIV-specific responding cells continued to produce MIP-1α. Thus, while cytotoxic CD8+ T cells play an important role in the resolution of acute viremia, as they lose their ability to express perforin they may be able to keep the virus partially in check through a combination of the remaining cytotoxic response and non-cytotoxic inhibitory effects exerted via the continued expression of β-chemokines or other non-cytolytic mechanisms [60]. This would be consistent with models suggesting CD8+ T cell cytotoxic mechanisms do not account for the entirety of CD8+ T cell-mediated viral suppression during chronic progressive SIV infection [61,62]. It remains unclear if maintenance of perforin expression following acute infection would further enhance the level of control over viral replication CD8+ T cells provide as we would predict it should based on studies of CD8+ T cell responses in the chronic phase of infection [16,18,19]. Unfortunately, we were unable to find any direct associations between HIV-1 Gag-specific perforin, T-bet, or Eomes expression and the level of plasma viremia or CD4+ T cell numbers. T-bet and Eomes are important regulators of effector CD8+ T cell differentiation and function for both mice and humans [24–26,28,30,31,33,34,42,54]. Expression patterns of these transcription factors have been described for CD8+ T cells in the context of various human viral infections, including CMV, EBV, HBV, HCV, HIV, and TBEV [28,32,34,42,54,63–66]. These studies demonstrated a high degree of variability in the relative levels of T-bet and Eomes expressed by virus-specific CD8+ T cells depending on time from infection, whether the infection was controlled, and tissue localization. CMV-specific cells express T-bet and Eomes during both acute and chronic phases of infection, but control of viral replication in the acute phase is associated with a higher ratio of T-bet+ versus Eomes+ cells [64,66]. EBV- and TBEV-specific cells also express T-bet and Eomes during the earliest phase of their respective infections, but EBV-specific cells lose expression of both during convalescence whereas TBEV-specific cells retain T-bet expression and show a gradual reduction in Eomes [42,63]. HCV-specific cells are T-bet+ in acute/resolving HCV infection and T-bet-Eomes- during acute/non-resolving infection. Post-acute phase, HCV-specific cells in the peripheral blood are T-bet-Eomes- for both resolved and non-resolved HCV infection, but T-bet+ within the livers of subjects with resolved infection and Eomes+ in livers of chronically infected subjects [34,65]. Together, these results suggest expression of T-bet during the acute phase is a critical determinant of viral infection outcome. The differential outcomes associated with Eomes were also reflective of the relative expression level of T-bet, suggesting Eomes may not be as important for the resolution of acute viremia. Rather, Eomes expression may determine whether antigen-specific cells are fated to form a stable memory pool or become exhausted subsequent to the acute phase, dependent on whether or not the infection is ultimately cleared [34,67]. Similar associations between T-bet, Eomes, and outcome have been demonstrated in chronic HIV infection. In this context, a high level of T-bet expression was associated with greater overall functionality of HIV-specific CD8+ T cells, including cytotoxic potential, and relative control of viral replication, whereas low T-bet levels and continued Eomes expression has been associated with lower overall functionality and persistent viremia [28,32]. Our data show that HIV-specific cells have high cytotoxic potential during acute infection, but lose the ability to express or rapidly upregulate perforin in chronic infection. This loss of cytotoxic potential over time can at least partially be explained by a change in the relative expression levels of T-bet and Eomes: HIV-specific cells were equally T-betHiEomes+ and T-betLoEomes+ during acute infection and both subsets efficiently upregulated perforin initially but the proportion of T-betLoEomes+ cells increased significantly as infection progressed and cells with this phenotype had an inferior capacity to express perforin compared to T-betHiEomes+ cells. The expression of perforin by either phenotype during acute infection may be reflective of the high degree of inflammation and activation during this phase, a differential role for Eomes at different stages of infection, and/or the result of additional transcription factors not assessed here. Whatever the case may be, T-betHiEomes+ HIV-specific CD8+ T cells retain the ability to upregulate perforin following resolution of acute viremia and this subset declines during chronic progressive infection. Recent data from Ndhlovu et al. suggests HIV infection elicits a massive antigen-specific CD8+ T cell response with limited bystander activation [48]. Similar observations have been reported after vaccination with vaccinia and yellow fever virus [46]. The similarities in differentiation state, activation, and immediate cytotoxic potential between total peripheral memory and Gag-specific cells reported here support the idea of a robust and specific response to HIV infection. However, we found a significant discrepancy between transcriptional control of HIV-specific CD8+ T cells versus the bulk activated perforin+ memory CD8+ T cell population. The degree to which these differences reflect a true lack of specificity, dysfunction on the part of the bulk activated cells, an inability to identify an appropriate functional marker, or an attempt by the host to mitigate immune-mediated pathology remains unclear. It is likely there area many more circulating HIV-specific CD8+ T cells than indicated by our findings using in vitro stimulation with only two HIV-1 proteins and a limited number of functional parameters to identify responding cells. However, it should be noted that CD8+ T cell bystander activation has been reported during acute HIV and EBV infection in humans and it is possible at least a subset of CD8+ T cells are activated non-specifically in our cohort [44,68]. T cell receptor stimulation is required for upregulation of T-bet [69], but a large proportion of bulk activated perforin+ cells during acute HIV infection appear to express neither T-bet nor Eomes whereas all Gag-specific cells expressed one or the other. In addition, perforin can be upregulated in the absence of direct antigenic stimulation via exposure to IFN-α [70], levels of which are highly elevated during acute HIV infection [71]. Thus, the difference in T-bet and Eomes expression we observed between bulk perforin+ and responding HIV-specific CD8+ T cells raises the possibility that a significant number of bystander-activated cells are being induced in response to HIV infection. Alternatively, given the association between activation and the size of the T-bet-Eomes- pool across infections with vaccinia, yellow fever, and HIV, the absence of T-bet and Eomes expression in the bulk perforin+ CD8+ T cell pool may be a characteristic of the contraction phase that typically follows the initial CD8+ T cell response. This would be consistent with the pro-apoptotic phenotype of the majority of cells following peak HIV viremia and the timing of our samples [48]. Whether HIV-specific or bystander, the lack of T-bet and Eomes expression by these cells suggests they would be unable to sustain perforin expression upon encountering infected target cells. This may in part explain the inability of bulk peripheral CD8+ T cells from acutely HIV infected individuals to efficiently inhibit viral replication in vitro and further suggests they would not make a meaningful contribution to long-term control of viral replication in vivo [72,73]. These data show how the peripheral CD8+ T cell response to HIV evolves over the course of progressive infection. HIV-specific CD8+ T cells are able to upregulate perforin and T-bet initially but begin to lose this capacity soon after peak viremia, demonstrating for the first time that there is not an initial intrinsic inability of HIV-specific CD8+ T cells to upregulate these molecules. It remains unclear how or if these responses differ from those of CD8+ T cells from subjects who go on to spontaneously control viral replication to very low levels in the chronic phase. While we did find frequencies of T-bet+ and T-bet-Eomes- total memory CD8+ T cells at set point time points were inversely or directly associated with set point viral load, respectively, we did not find any associations between viral load and the size of the total peripheral perforin+ pool or the magnitude or cytotoxic potential of HIV-1 Gag-specific cells at any time point. Nor did we find any subset of total memory or Gag-specific cells to be predictive of set point viral load for this group of subjects, possibly due to the limited number of very early time points and relatively narrow range of viral loads at set point. However, the fact that the initial phenotype of HIV-specific cells is similar to that associated with control during the chronic phase of infection suggests induction and maintenance of cells capable of upregulating high levels of T-bet and perforin could lead to subsequent control. Eliciting HIV-specific cells with these characteristics might serve as an important target for vaccination or therapeutic modalities seeking to fully control early viral replication or eradicate the chronic viral reservoir. Blood specimens were acquired with the written informed consent of all study participants and with the approval of the institutional review board at each respective institution where patient materials were collected: University of Pennsylvania (IRB# 809316), McGill University Health Centre (REB# GEN-10-084), Human Subjects Protection Branch (RV217/WRAIR#1373), Kenya Medical Research Council (KEMRI/RES/7/3/1), The United Republic of Tanzania Ministry of Health and Social Welfare (MRH/R. 10/18/VOLL. VI/85), Tanzanian National Institute for Medical Research (NIMR/HQ/R. 8aVol. 1/2013), Royal Thai Army Medical Department (IRBRTA 1810/2558), Uganda National Council for Science and Technology–National HIV/AIDS Research Committee (ARC 084), Uganda National Council of Science and Technology (HS 688), East London and City and the Southwest and Southwest Hampshire Ethics Review Committees, Duke University (IRB# Pro00006579 and IRB# Pro00007558), Emory University (IRB# 00009560), Oregon Health and Science University (IRB# 2470 and IRB# 2832). The study was conducted in accordance with the principles expressed in the Declaration of Helsinki. Eleven HIV-1 acutely infected participants were enrolled as part of the RV217 Early Capture HIV cohort, nine were enrolled in the CHAVI 001 acute infection cohort, and twelve were enrolled in the Montreal Primary Infection cohort. Participant demographics are summarized in S1 Table. Acute HIV-1 infection was determined by measuring plasma HIV RNA content and HIV-specific antibodies using ELISA and Western blot. Fiebig staging [74] immediately following the first positive visit or at the screening visit was used to characterize the timing of infection for RV217 and CHAVI participants, respectively. The only exception was RV217 donor 40067 for which the estimated date of infection was taken as the midpoint between the last negative and first positive visit. For the Montreal Primary Infection cohort the following guidelines proposed by the Acute HIV Infection Early Disease Research Program sponsored by the National Institutes of Health were used to estimate the date of infection: the date of a positive HIV RNA test or p24 antigen assay available on the same day as a negative HIV enzyme immunoassay (EIA) test minus 14 days; or the date of the first intermediate Western blot minus 35 days. In addition, information obtained from questionnaires addressing the timing of high-risk behavior for HIV transmission was taken into account in assigning a date of infection when consistent with biological tests. The timing of visits relative to estimated date of infection for all acutely HIV infected donors used in this study is provided in Fig 1A. Study participants were antiretroviral therapy naïve at all time points analyzed, consistent with the standard of care at the time of study. HIV-1 viral loads were measured using the Abbot Real-Time HIV-1 assay (RV217; Abbot Laboratories, Abbott Park, IL), COBAS AMPLICOR HIV-1 monitor test, version 1. 5 (CHAVI; Roche Diagnostics, Branchburg, NJ), or the UltraDirect Monitor assay (Montreal; Roche Diagnostics, Branchburg, NJ). HIV set point viral loads were defined as the average of all viral load measurements between 90 and 365 days post-infection in the absence of therapy with the requirement for at least two viral load measurements during this period. For HIV-negative cohorts, volunteers were administered the live-attenuated YFV-17D vaccine (YF-Vax, Sanofi Pasteur), the live vaccinia smallpox vaccine (Dryvax, Wyeth Laboratories), or challenged with influenza A/Brisbane/59/07. YF-Vax was administered subcutaneously in the arm, Dryvax was administered by scarification of the upper arm with three pricks of a bifurcated needle, and influenza A virus was administered intra-nasally. Peripheral blood mononuclear cells (PBMCs) from pre-vaccination or pre-infection time points were available for most donors along with several time points post-vaccination or infection (S3A–S3C Fig). Pre-infection time points from all cohorts, including RV217 participants, along with PBMCs obtained from fifteen healthy human subjects through the University of Pennsylvania’s Human Immunology Core were combined for a total of 41 healthy donor data points. Potential T cell epitope (PTE) peptides corresponding to the HIV-1 Gag and Nef proteins were obtained from the NIH AIDS Reagent Program (NIH, Bethesda, Maryland, USA). PTE peptides are 15 amino acids in length and contain naturally occurring 9 amino acid sequences that are potential T cell determinants embedded in the sequences of circulating HIV-1 strains worldwide, including subtypes A, B, C, D and circulating recombinant forms (CRF). As such, these peptide pools provided the coverage necessary for the T cell stimulation assays performed in this study given the broad geographical distribution of our study participants and diversity of infecting viruses (S1 Table). Lyophilized peptides were dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich, St Louis/Missouri, USA), combined into two pools at 400 μg/ml, and stored at -20°C. Cryopreserved PBMCs were thawed and rested overnight at 2x106 cells/ml in RPMI medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin. Cell viability was checked both immediately after thawing and after overnight rest by trypan blue exclusion. Costimulatory antibodies (anti-CD28 and anti-CD49d, 1 μg/mL each; BD Biosciences) and pre-titrated fluorophore conjugated anti-CD107a was included at the start of all stimulations. PBMCs were incubated for 1 hour at 37°C and 5% CO2 prior to the addition of monensin (1 μg/mL; BD Biosciences) and brefeldin A (10 μg/mL; Sigma-Aldrich) followed by an additional 5 hour incubation at 37°C and 5% CO2. For peptide stimulations, peptides from the two Gag PTE pools were added to a single tube of cells such that each individual peptide was at a final concentration of 1 μg/ml. As a negative control, DMSO was added to the cells at an equivalent concentration to the one used for peptide stimulation. Antibodies for surface staining included CCR7 APC-Cy7 (clone G043H7; Biolegend), CCR7 APC-eFluor780 (clone 3D12; eBioscience), CD4 PE-Cy5. 5 (clone S3. 5; Invitrogen), CD8 BV711 (clone RPA-T8; Biolegend), CD8 Qdot 605 (clone 3B5; Invitrogen), CD14 BV510 (clone M5E2; Biolegend), CD14 Pacific Blue (clone M5E2; custom), CD14 PE-Cy5 (clone 61D3; Abcam), CD14 PE-Cy7 (clone HCD14; Biolegend), CD16 Pacific Blue (clone 3G8; custom), CD16 PE-Cy5 (clone 3G8; Biolegend), CD16 PE-Cy7 (clone 3G8; Biolegend), CD19 BV510 (clone HIB19; Biolegend), CD19 Pacific Blue (clone HIB19; custom), CD19 PE-Cy5 (clone HIB19; Biolegend), CD19 PE-Cy7 (clone HIB19; Invitrogen), CD45RO ECD (clone UCHL1; Beckman Coulter), CD45RO PE-CF594 (clone UCHL1; BD Biosciences), CD107a PE-Cy5 (clone eBioH4A3; eBioscience), CD107a PE-Cy7 (clone H4A3; Biolegend), and HLA-DR Pacific Blue (clone LN3; Invitrogen). Antibodies for intracellular staining included CD3 BV570 (clone UCHT1; Biolegend), CD3 BV650 (clone OKT3; Biolegend), CD3 Qdot 585 (clone OKT3; custom), CD3 Qdot 650 (clone S4. 1; Invitrogen), Eomes Alexa 647 (WD1928; eBioscience), Eomes eFluor 660 (WD1928; eBioscience), IFN-γ Alexa 700 (clone B27; Invitrogen), Perforin BV421 (clone B-D48, Biolegend), Perforin Pacific Blue (clone B-D48; custom), Perforin PE (clone B-D48, Cell Sciences), T-bet FITC (clone 4B10; Biolegend), and T-bet PE (clone 4B10; eBioscience). At the end of the stimulations, cells were washed once with PBS prior to be being stained for CCR7 expression for 15 min at 37°C in the dark. Cells were then stained for viability with aqua amine-reactive viability dye (Invitrogen) for 10 min at room temperature in the dark followed by addition of a cocktail of antibodies to stain for surface markers for an additional 20 min. The cells were washed with PBS containing 0. 1% sodium azide and 1% BSA, fixed and permeabilized using a Cytofix/Cytoperm kit (BD Biosciences), and stained with a cocktail of antibodies against intracellular markers for 1 h at room temperature in the dark. The cells were washed once with Perm Wash buffer (BD Biosciences) and fixed with PBS containing 1% paraformaldehyde. Fixed cells were stored at 4°C in the dark until acquisition. Antibody capture beads (BD Biosciences) were used to prepare individual compensation controls for each antibody used in the experiment. ArC Amine Reactive beads (ThermoFisher Scientific) were used to generate a singly stained compensation control for the aqua amine-reactive viability dye. For each stimulation condition, a minimum of 250,000 total events were acquired using a modified LSRII (BD Immunocytometry Systems). Data analysis was performed using FlowJo (TreeStar) software. Gating strategy is provided in the supplementary materials (S1 Fig). Reported antigen-specific data have been corrected for background based on the negative (no peptide) control, and only responses with a total frequency twice the negative control and above 0. 01% of total memory CD8+ T cells (after background subtraction) were considered to be positive responses. By analyzing the data in this way, we examined cytolytic protein production resulting from antigen-specific stimulation and ensured that its expression was considered only within responding CD8+ T cells expressing at least one other functional parameter. Whereas IFN-γ, CD107a, and MIP-1α were used to identify antigen-specific CD8+ T cells for some donors, only IFN-γ and CD107a were used consistently for all donors and figures depicting antigen-specific data were derived from analysis of cells expressing these two markers unless otherwise noted. All statistical analysis was performed using Stata (version 14. 0). Graphs were generated using Stata or GraphPad Prism (version 5. 0a). Generalized estimating equations (GEEs) with robust variances were used to test for changes while adjusting for repeated measurements on the same individuals [75]. In instances where many values were at 100% a random-effects tobit regression model was used to do a combined analysis of the percent of data points at 100% versus differences in values for data points below 100%. P values were Holm-adjusted for multiple comparisons. Bars represent approximations of the means generated by the models. Lowess smoothers were used to represent the mean over time for longitudinal data. Correlations were determined using Spearman’s rank correlation test (non-parametric; two-tailed). SUMMARY: [/INST] Previous studies have demonstrated that HIV-specific CD8+ T cells are critical for the initial control of HIV infection. However, this control is typically incomplete, being able to neither clear infection nor maintain plasma viremia below undetectable levels. Mounting evidence has implicated CD8+ T cell cytotoxic capacity as a critical component of the HIV-specific response associated with spontaneous long-term control of HIV replication. CD8+ T cell cytotoxic responses are largely absent in the vast majority of HIV chronically infected individuals and it is unclear when or why this functionality is lost. In this study we show that HIV-specific CD8+ T cells readily express the cytolytic protein perforin during the acute phase of chronic progressive HIV infection but rapidly lose the ability to upregulate this molecule following resolution of peak viremia. Maintenance of perforin expression by HIV-specific CD8+ T cells appears to be associated with the expression level of the transcription factor T-bet, but not with the T-bet paralogue, Eomes. These findings further delineate qualitative attributes of CD8+ T cell-mediated immunity that may serve as targets for future HIV vaccine and therapeutic research. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Networks of interacting transcription factors are central to the regulation of cellular responses to abiotic stress. Although the architecture of many such networks has been mapped, their dynamic function remains unclear. Here we address this challenge in archaea, microorganisms possessing transcription factors that resemble those of both eukaryotes and bacteria. Using genome-wide DNA binding location analysis integrated with gene expression and cell physiological data, we demonstrate that a bacterial-type transcription factor (TF), called RosR, and five TFIIB proteins, homologs of eukaryotic TFs, combinatorially regulate over 100 target genes important for the response to extremely high levels of peroxide. These genes include 20 other transcription factors and oxidative damage repair genes. RosR promoter occupancy is surprisingly dynamic, with the pattern of target gene expression during the transition from rapid growth to stress correlating strongly with the pattern of dynamic binding. We conclude that a hierarchical regulatory network orchestrated by TFs of hybrid lineage enables dynamic response and survival under extreme stress in archaea. This raises questions regarding the evolutionary trajectory of gene networks in response to stress. All organisms encounter reactive oxygen species (ROS) originating from biotic and abiotic sources. ROS are produced at relatively low levels as natural byproducts of aerobic respiration, Fenton reactions, or other biotic sources [1], [2]. In contrast, abiotic sources include environmental toxins such as solar UV radiation, pollutants, and excessive metals, which damage macromolecules [3]. In each case, oxidants must be neutralized and macromolecular damage repaired at the cellular level to enable survival. Enzymes such as superoxide dismutase and thioredoxin reductase are induced to neutralize oxidants and restore redox balance in the cell [4]. The production of these oxidant response proteins is typically transient and precisely controlled to enable rapid restoration of homeostasis following oxidant clearance and damage repair [5]. Such regulation is accomplished by a diversity of strategies throughout the microbial world. For instance, complexes of transcription factor (TF) proteins coordinate ROS-induced cell cycle block with production of repair enzymes in yeast [6]. In bacteria, TFs [7], [8] or their bound cofactors [9], [10] are directly and reversibly oxidized in the presence of ROS, altering DNA binding specificity to induce repair enzyme-coding genes [5], [11]. Relative to the other domains of life, the function of TFs that control the oxidant response in archaea remain understudied. To our knowledge, only a few transcription factors have been characterized to date [12]–[16]. Generally, components of archaeal transcription complexes are hybrid between the bacterial and eukaryal domains. For example, the basal transcriptional machinery in archaea, like that of eukaryotes, consists of transcription factor II B (Tfb), a TATA binding protein (TBP), and an RNA-Pol II-like polymerase [17]. The proteins that modulate transcription (e. g. stress-responsive TFs) typically resemble those of bacteria at the amino acid sequence level [18]. This class of TFs, like those of bacteria, can sense stressors or metabolites directly [14], [19], [20]. Recent evidence also suggests that these “bacterial-like” TFs can bind together on DNA combinatorially to expand their repertoire of gene regulation [21], [22]. Machine-learning efforts to reconstruct gene regulatory networks in archaea also suggest combinatorial regulation [16], [23], [24]. More generally, it remains an open question how networks of transcription factors interact dynamically to enact genome-scale regulation during stress response across the domains of life. Here we use the salt-loving archaeon H. salinarum as a model, both to characterize the genome-wide binding dynamics of an ROS-responsive transcription factor, and to analyze regulatory network function during ROS stress in archaea. This hypersaline adapted archaeal model organism encounters high levels of abiotic oxidants in its natural salt lake environment, where intense solar radiation and desiccation are frequent [25]. Halophilic archaea use several complementary strategies to protect against, respond to, and repair damage induced by ROS. These include the natural protective capacity of cytoplasmic salt inclusions [26], multiple copies of repair enzymes [27], and an extensive transcription regulatory network that has been hypothesized to respond to oxidative damage [16]. However, this network was computationally inferred from gene expression data. To experimentally characterize TFs with putative involvement in this network, our previous work identified the winged helix-turn-helix DNA-binding TF RosR. This TF dynamically regulates expression of more than 300 genes in response to oxidative stress in H. salinarum [13]. RosR is required for survival of oxidants from multiple sources (e. g. H2O2 and paraquat). Genes directly and indirectly controlled by RosR in response to oxidant encode macromolecular repair functions. In the current study, we ask which of these genes are direct targets of RosR regulation. Integrated analysis of genome-wide binding location time course data with gene expression data demonstrates that RosR binds and regulates over 100 target genes. These encode molecular repair functions and a surprisingly high number of other TFs. RosR binds many of these sites in the absence of stress. Upon exposure to H2O2, RosR disengages from DNA at most loci. However, at other loci, RosR-DNA binding is dynamic following peroxide exposure, with locus-specific differences in TF occupancy over time. RosR binding is mediated via a 20-bp palindromic cis-regulatory binding sequence. Integration of data generated here in the context of other existing systems biology datasets reveals extensive combinatorial binding of RosR with multiple Tfb proteins throughout the regulon. We conclude that RosR is a master regulator of a hierarchy of TFs that performs global, dynamic physiological readjustment in response to oxidative stress. Previous work demonstrated that the RosR transcription factor is required for the differential expression of genes in response to ROS [13]. To differentiate direct from indirect targets of RosR transcriptional regulation, we mapped DNA binding locations genome-wide in the presence and absence of H2O2 over time (see Methods). A total of 189 regions (252 genes, including operons and divergently transcribed genes) were significantly enriched for RosR binding throughout the genome in the absence of stress, with fewer sites bound over time upon exposure to H2O2 (Fig. 1A, S2 Table). Upon clustering, four major RosR-DNA binding profiles were detected: (1) nearly one-third of sites (88 genes) is significantly enriched for RosR binding under standard, non-stress conditions (Fig. 1B, middle and Fig. 2A, Cluster 1). Binding enrichment at these loci fell below the statistical threshold upon the addition of H2O2 and remained low for the duration of the time course. (2) At other sites (90 genes), RosR binding was initially lost in the presence of H2O2, but binding recovered within 60 minutes (Fig. 1B, right and Fig. 2A, Cluster 2). (3) RosR binding to fewer sites (29 genes) was detectable above statistical threshold only after the addition of H2O2 and RosR remained bound to these sites for the duration of the time course (Fig. 1B, left and Fig. 2A, Cluster 3). (4) At the remainder of observed sites (45 genes), binding was more dynamic, with variability in binding enrichment throughout the time course (Fig. 2A, Cluster 4). Similar dynamic categories were observed for each of the two other genomic elements (megaplasmids) of the H. salinarum genome (S2 Table). Dynamic binding patterns for representative loci were validated by ChIP-qPCR as shown in Fig. 2B (cluster 2 Spearman correlation = 0. 4; cluster 3 Cs = 0. 8). RosR binding ability in the absence of stress (clusters 1 and 4 at the 0 time point) was previously validated by ChIP-qPCR [13]. Together, these experiments suggest that RosR-DNA binding distributions are dynamic and reproducible genome-wide over time in response to oxidant treatment. To determine if RosR-DNA binding results in functional consequences in gene expression, we asked whether genes nearby binding loci were also differentially expressed over time. ChIP-chip binding profiles were compared to previously published gene expression data from H. salinarum Δura3 parent vs ΔrosR exposed to oxidative stress over time (0,10,20, and 60 min relative to H2O2 addition; [13]). Of the 252 genes (including operon members) within 250 bp of a binding locus, 51 exhibit differential expression in response to H2O2 and/or deletion of rosR when all time points are considered together [13]. To uncover additional putative functional binding events, the correlation of RosR-DNA binding with gene expression was calculated for all 252 genes associated with binding loci. Patterns of RosR binding occupancy nearby 70 genes are strongly correlated with expression profiles (“GE-ChIP correlation”, Cs≥0. 6, Fig. 3A, left graphs). Binding time course patterns at 52 other sites were anticorrelated with gene expression profiles (Cs≤−0. 6, Fig. 3A, right graphs). The remaining sites were uncorrelated, which suggests that these sites represent non-specific DNA interactions and/or that other factors may be required for significant change in gene expression at these sites [28], [29]. The four clusters observed for binding profiles alone were also detected for genes exhibiting strongly correlated or anticorrelated gene expression and binding patterns (Figs. 2 and 3A). Across the distribution of strong GE-ChIP correlations and anticorrelations, deletion of rosR significantly alters the relationship between binding and gene expression, with a trend toward uncorrelated gene expression and binding relationships in this strain (Fig. 3B). Because the time scale of TF-DNA binding is faster than that of transcript synthesis (<1 minute vs >5 minutes, respectively; [30]), binding and expression would appear simultaneous with the resolution of the time course experiments herein (Fig. 3A). Therefore, we reasoned that the relationships between gene expression and binding profiles detected are consistent with RosR activity, with activated genes exhibiting correlated binding and expression, and repressed genes showing anticorrelated binding and expression. Together, these results suggest that: (a) dynamic binding events are strongly associated with a change in gene expression before and/or after oxidant exposure; and (b) RosR is required for direct and dynamic activation or repression of over 100 genes in response to oxidative stress in H. salinarum. A key component of gene network function is the specific cis-regulatory binding sequence for a TF. To provide further support for RosR direct activation and repression of these target genes, we next sought to determine this binding sequence consensus for RosR. In previous work, a putative cis-regulatory sequence was computationally predicted from promoters of genes differentially expressed in response to deletion of rosR (direct and indirect RosR target genes; [13]). This sequence consisted of a 7 bp inverted repeat palindrome with the consensus TCGnCGA. To gain additional refinement in these predictions, the cis-regulatory sequence search was repeated using only direct RosR targets detected here by binding location analysis (S3 Table). The resultant consensus motif contained a 20 bp imperfect palindrome sequence TCGnCGACGAGnTCGnCGAC (Fig. 4A, p<3. 5×10−12), which was detected nearby 37 of RosR-bound loci (∼15%; p<10−37), but not detectable elsewhere in the genome (S5 Table). Some loci contain more than one motif. Of these 37 loci with motifs detected, 40% also exhibited strong ChIP-GE associations (Cs≥\|0. 6\|; Fig. 3). On average, motifs were located within 18 bp of ORF start sites (Fig. 4B). To validate the function of this computationally predicted binding site experimentally, the native genomic promoter (TATA box and putative cis-regulatory sequence) of VNG2094G (trh4, a TF-coding gene) was fused to GFP. Promoter activity was assayed in the ΔrosR vs parent strain in the absence of stress, when RosR binding activity was evident in ChIP-chip experiments for these promoters. Ptrh4 activity is significantly higher in the ΔrosR strain relative to the parent and the empty vector background control (Fig. 4C). This suggests that the predicted cis-regulatory sequence is required for RosR-mediated repression of this promoter, consistent with the genome-wide data (Figs. 1–4, S2 Table). Together, these data suggest that (a) the computationally predicted motif is biologically relevant; (b) RosR binds to the predicted cis-regulatory sequence in vivo to regulate gene expression; and (c) this cis-regulatory sequence carries significant importance in the function of the RosR regulatory network. To gain additional insight into RosR function in the cell, we calculated statistical enrichment in archaeal clusters of orthologous genes functional ontology categories [31] for RosR target genes (those bound in binding location assays). These genes are significantly enriched for stress response functions (e. g. genes encoding heat shock proteins hsp4 and hsp5, peroxidase perA), translation (e. g. genes encoding ribosomal protein), DNA replication, cell growth and division, and transcription (e. g. RNA polymerase subunits, TFIIB family member tfbB, LRP family homolog trh4; Table 1). In general, the direction of regulation corresponds with the function of these gene products. For example, genes associated with translation (e. g. eif2B) are downregulated upon ROS exposure, whereas stress response genes (e. g. perA, hsp5) are upregulated (S2 Table; [16]). This analysis confirms previous results implicating RosR in the regulation of genes whose products serve stress repair functions [13], but also expands the RosR regulon. The functional enrichment analysis revealed novel RosR targets, notably 21 genes encoding TFs and 4 other putative regulators involved in signal transduction and DNA binding (Table 1, Tables S2 and S3). Cis-regulatory sequences were detected in the vicinity of the translation start site for 14 of these TF-coding genes, including rosR itself (Table 2, Fig. 5, S5 Table). This could explain why direct RosR binding was not detected for many genes affected by deleting rosR [13] (i. e. RosR binding not detected here). For example, nearly 25% of RosR indirect gene regulation appears to be mediated through TfbB, whose encoding gene is among the TFs directly regulated by RosR (Fig. 6; [32]). Dynamic ChIP-chip profiles for seven of the 14 TF-coding genes with cis-regulatory sequences nearby were anticorrelated with their gene expression profiles (Table 2). Closer inspection of binding and gene expression profiles revealed that these seven TFs are repressed by RosR during optimum growth in the absence of stress but de-repressed in response to H2O2 (Fig. 5A). These sites were bound again within 60 minutes. Temporally coherent binding profiles resulted in two waves of time-resolved expression of TF-coding genes, with the majority of RosR-regulated TFs expressed in the late wave (Fig. 5A, S2 Table). Taken together, these results suggest that RosR regulates a hierarchy of TFs, the majority of which are transiently de-repressed in a RosR-dependent manner during oxidative stress. We reasoned that such TF-TF regulation might contribute to H. salinarum survival of extreme oxidative stress. To test this, we generated strains deleted in-frame of two of the TF-coding genes regulated by RosR (VNG0194H and hrg). Relative to the isogenic parent strain, both TF knockout strains are significantly impaired for growth in response to oxidative stress induced by addition of H2O2 to the cultures (Fig. 5B). These phenotypes are significantly complemented when the corresponding wild type copy of the TF gene is supplied in trans on a plasmid. These phenotypes are similar to that previously observed for the ΔrosR mutant strain (Fig. 5B; [13]). Together, these results implicate new TFs in oxidative stress survival in H. salinarum, suggest important physiological consequences for RosR regulation of other TFs, and validate hypotheses generated from systems-level datasets. RosR regulates many genes encoding TFs, a subset of which is required for oxidant survival. However, we reasoned that RosR might not be the only regulator of these TFs, since the phenotyping results described above are inconsistent with a classical epistatic relationship with TFs downstream of RosR in a linear regulatory cascade. To identify candidates for such co-regulation, RosR binding positions were compared to those for Tfb proteins from previously published high-resolution genome-wide DNA binding location experiments [32], [33]. Similar to RosR, Tfb binding sites are detected under standard, non-stress conditions, providing comparable physiological conditions. At 82 of each of the 252 RosR-bound loci, we also detected binding for five of seven H. salinarum Tfb proteins (TfbA, B, D, F, G, S4 Table). A single Tfb bound together with RosR at just over half of these loci (Fig. 6A). In contrast, 2 or more Tfbs co-bound at the same locus with RosR at 40 loci. At least four Tfbs together with RosR occupied 10 of these 40 loci (Fig. 6A, 6B). Whether the different Tfb proteins bind simultaneously or one at a time together with RosR remains unclear. While TfbA was underrepresented for co-binding with RosR, TfbG alone was significantly enriched for co-binding with RosR. At other loci, TfbF and TfbG together were enriched for co-binding with RosR (Fig. 6B). Also among the total 82 co-bound loci were 12 of the 21 RosR-regulated TF-coding genes (S4 Table, Fig. 6C). Previous studies suggest that sequence-specific TFs in archaea activate gene expression by binding upstream of the transcription pre-initiation complex [PIC, includes TATA-binding protein (TBP) and TFIIB (Tfb) ]. In contrast, most repressor TFs inhibit gene expression by binding downstream of the PIC [34]–[37]. To test this model and the mechanism of RosR gene regulation, the RosR-to-Tfb binding locus distance was calculated for the 82 RosR sites where Tfb binding was also detected (see Methods). These distances were compared to RosR activity using the GE-ChIP correlation as a proxy. Interestingly, the distance between RosR and Tfb binding loci was strongly and significantly anticorrelated with RosR activity. That is, if RosR binding upstream of Tfb is considered as a negative distance, then positive GE-ChIP correlation, or activation, is observed and vice versa. When these sites are binned into distance cut-offs (absolute value of 5 bp), a peak association is detected at distances of 65–75 bp (Fig. 6D). This relationship is abrogated in the ΔrosR mutant background (Fig. 6D, light grey trace) and is significantly different from random distributions across the distance scale (Fig. 6D, dark grey dotted trace). Together, this integrated analysis of RosR and general transcription factor networks: (a) suggests extensive and unexpected combinatorial control of gene expression between Tfb proteins and RosR; (b) provides further support for the biological significance of the GE-ChIP dynamic correlations (Fig. 3); and (c) supports the hypothesis that the relative binding position and distance between Tfb proteins and sequence-specific transcription factors dictates the activation or repression of target genes. We next assessed how predictions of statistically inferred gene regulatory network models (“environmental gene regulatory influence network (EGRIN) ”; [16], [23]) compared to the RosR regulatory network determined from the experiments described here. Of the 252 experimentally observed direct RosR-gene interactions, 15% were predicted from EGRIN (p<5. 68×10−3; see Methods for p-value calculation and S2 Table for a list of genes with validated predictions). Further, the correspondence between predicted and observed target gene lists subject to combinatorial control by RosR-TfbB or RosR-TfbG was significant (p<2. 05×10−4 for TfbB; p<2. 16×10−7 for TfbG). In contrast, predictions from the model did not match experimental observations regarding combinatorial control by RosR-TfbD and RosR-TfbF pairs (S4 Table). Of all RosR regulated genes that were both predicted and observed, genes encoding TFs and functions in transcription are most highly enriched (arCOG category enrichment p<1. 77×10−5; see also Fig. 6C). This analysis suggests that network topological predictions from the EGRIN model are accurate for RosR regulatory influences, especially for those genes that encode functions in transcriptional regulation. Data and analyses presented here suggest that H. salinarum RosR is a bifunctional regulator that directly controls a large hierarchy of transcription factors in combination with Tfb proteins to enable extreme oxidative stress survival. The majority of these sites are bound in the absence of stress, with RosR released from DNA in the presence of oxidant. A subset of loci exhibits the opposite binding pattern. We show that RosR binds to a ∼20 bp imperfect palindrome cis-regulatory sequence and directly activates or represses genes encoding functions in transcription, macromolecular repair and central cellular physiology. We demonstrate that RosR regulates genes encoding TFs that are also required for oxidative stress survival. Such regulation is conducted in concert with Tfb proteins. We conclude that RosR plays an important role in a large transcriptional network that enables a rapid response to extreme oxidative stress followed by re-establishment of homeostasis. The function of gene products in the RosR regulon reported here reflects the observations from our previous work [13]. Here we expand this regulon, differentiating between direct and indirect control of gene expression by RosR, including new gene targets whose products are involved in central cellular functions such as translation, transcription, and DNA replication. RosR regulation of specific genes encoding such functions is also accurately predicted from a computationally inferred gene regulatory network for H. salinarum [23] (S2 and S4 Tables S2; Fig. 6D). However, the RosR cis-regulatory binding sequence we detected and validated here was not predicted from the model, nor was combinatorial control of gene expression by RosR and Tfbs D and F, possibly because the inference model predicts regulatory interactions primarily based on gene expression [23]. Recent evidence suggests that such predictions can be improved by the incorporation of TF-DNA binding data (e. g. ChIP-seq or ChIP-chip, [38]). Therefore, the current work also pinpoints specific areas for model refinement. The integrated genome-wide analysis presented here suggests hypotheses for the RosR biochemical mechanism. Dynamic TF-DNA binding analysis suggests a differential preference in RosR promoter occupancy, as some promoters are re-bound while homeostasis is restored, whereas a small subset of other sites are bound only in the presence of peroxide (Fig. 2, Cluster 3). Binding to slightly different cis-regulatory sequences could enable promoter binding under both conditions, similar to transcription factors that use Fe-S clusters as cofactors in bacteria [39]. However, we observed only one significant motif in our computational analysis (S5 Table), suggesting that other co-factors may be involved (e. g. Tfb proteins, Fig. 6). It remains unclear how and whether RosR itself senses oxidant, since no cysteines are present in the protein. Further biochemical studies are required. In contrast to RosR targets in Cluster 3, a significant fraction of sites are bound in the absence of H2O2 and re-occupied by RosR within 60 minutes of oxidant exposure (Fig. 2, Cluster 2). Clearance of oxidant from the cell by detoxification enzymes (e. g. perA, sod2) may enable RosR to re-bind. For example, ΔperA mutants experience high intracellular H2O2 concentrations during mid-log phase growth, whereas H2O2 is cleared from the H. salinarum parent strain within the time frame tested here [16]. The gene encoding PerA is a direct target of RosR regulation (S2 and S3 Tables). Dynamic patterns of differential promoter occupancy observed in yeast suggest that the probability of productive gene expression correlates with longer TF-DNA dwell times [40]. The addition of stress in the experiments reported here links these dynamic events to environmental perturbation. For example, TF-coding genes are found almost exclusively in dynamic binding cluster 2, which are re-bound at the earliest time point following ROS exposure (S2 Table, Fig. 2). Binding at these sites correlates well with gene expression dynamics and TF knockout strains are more sensitive to H2O2 challenge than the parent strain (Table 2, Fig. 5). The pattern of binding in cluster 2 is therefore consistent with an immediate need for TFs to work with RosR to restore homeostasis following stress exposure. Taken together, these dynamic genome-wide data point to a non-canonical mechanism for RosR regulation in response to oxidant. Integrated analysis of several genome-wide binding location and gene expression datasets for TFIIB homologs [32], [33] with those presented here suggests a surprising degree of RosR-Tfb combinatorial control of gene expression in response to oxidant (Fig. 6). RosR combinatorial control contrasts with the H. salinarum nutritional regulator TrmB, which regulates far fewer TFs (only 4 for TrmB vs. 21 for RosR) and binds together with only one other Tfb protein at its target promoters [36]. Similarly, H. salinarum iron regulators Idr1 and Idr2 only regulate one other TF each [22]. Further regulatory interactions were observed between TFs, including TfbB regulation of RosR, setting up a potential feedback loop (Fig. 6D; [32]). Taken together, these data are consistent with the hypothesis that the regulatory reach of RosR under oxidative stress conditions is extended significantly via TF-TF network interactions. Systems-level studies suggest that extensive TF-TF interactions may be a conserved feature of transcriptional regulation of stress response across the domains of life. For example, hierarchical regulation in response to oxidant has been observed in Escherichia coli, where SoxS regulates at least four other TF-coding genes (fur, marA, marR, rob; [41]), some of which in turn regulate other TF-coding genes. However, RosR control of more than 20 other TF-coding genes is closer to the order of the global nutritional regulator, CRP, which controls the expression of at least 50 other TF-coding genes. Such extensive inter-TF regulation in H. salinarum is also reminiscent of multi-TF regulatory networks in yeast that coordinate the cell cycle with DNA damage repair [6]. Thus, RosR appears to possess unique functional features, resembling a eukaryotic-like TF in global activation of gene expression (Fig. 1), control of a large network of TFs (Figs. 5,6, Table 2), and extensive coordinate control of gene expression (Fig. 6; [33]). However, some features of RosR also resemble a bacterial-type TF, with its DNA binding sequence specificity (Fig. 4), repression of gene expression (Fig. 4C), and stress-specific alteration of its binding activity (Fig. 1). Strains of Halobacterium salinarum NRC-1 used in this study are listed in S1 Table. Cultures were routinely grown in complex medium (CM; 250 g/L NaCl, 20 g/L MgSO4 7H2O, 3 g/L sodium citrate, 2 g/L KCl, 10 g/L peptone). Δura3, the parent strain, and transcription factor deletion strain derivatives thereof, were grown in CM supplemented with 0. 05 mg/mL uracil to complement the auxotrophy. In-frame gene deletion strains (Δura3ΔVNG0194H, Δura3Δhrg) were constructed using the pop-in/pop-out gene deletion strategy described previously [42]. Δura3ΔrosR, referred to throughout as ΔrosR for brevity, was constructed previously [13]. H. salinarum strains harboring plasmids were cultured in CM supplemented with 20 µg/mL mevinolin for plasmid maintenance. H2O2 was added to mid-logarithmic phase cultures to 25 mM or at inoculation at 5 or 6 mM to test oxidative stress response as displayed in the figures. Time course profiles of processed ChIP-chip binding data were grouped using Spearman correlated complete linkage hierarchical clustering to identify various dynamic binding patterns. To determine the dynamic relationship between binding and gene expression, each gene in each dynamic binding cluster was correlated to expression data under the same culturing conditions as ChIP-chip from a previous study [13] (mid-logarithmic phase cultures exposed to 25 mM H2O2 at 0,10,20, and 60 min; GEO accession GSE33980). These correlations are referred to throughout as “GE-ChIP correlations”. GE-ChIP correlations were calculated separately for each of the ΔrosR deletion and isogenic parent backgrounds as an additional metric for the impact of RosR binding on gene expression. Significance of the difference in GE-ChIP correlations between the parent and ΔrosR strains was calculated using Student' s t-test. Genes with strong GE-ChIP correlations (Cs≥0. 6) were interpreted as directly activated by RosR, whereas anticorrelations (Cs≤−0. 6) were interpreted as repressed. Statistical overrepresentation in archaeal clusters of orthologous genes (arCOG) functional categories [31] for RosR-bound genes was calculated for using the hypergeometric test. Enriched categories are listed in Table 1. Detailed arCOG annotations, GE-ChIP correlation values, and significance of correlations for each of the 252 genes nearby RosR binding sites are listed in S3 Table. The code repository containing the pipeline used for binding location data analysis and correspondence to gene expression can be accessed at github. com/amyschmid/rosr-chip-utils. To detect RosR-Tfb combinatorial control, or “co-binding”, high resolution ChIP-chip binding data for TfbA and TfbF [33], [44] and ChIP-seq binding data for TfbB, G, and D [32] were analyzed. Genes located within 250 bp of a Tfb protein binding site with ChIP enrichment significance of p<0. 01 were selected using the R bioconductor MeDiChI package [44]. Sites meeting the following criteria were considered to be co-bound by RosR and a Tfb protein: (a) both RosR and Tfb binding sites were detected within 250 bp of the same gene; (b) RosR and Tfb binding positions were at most 250 bp away from each other. Venn diagram was constructed using the VennDiagram package in R [48] and RosR-Tfb gene regulatory network shown in Fig. 6D was constructed using BioTapestry [49]. Distances from RosR to Tfb binding sites for each of the co-bound genes are listed in S4 Table. The relationship between Tfb-to-RosR binding site distances with RosR GE-ChIP activity values was calculated using Spearman correlation. These correlations were calculated separately for each strain background (parent and ΔrosR). Significance of these correlations was computed from by comparing 10,000-fold resampled data to actual data (S4 Table) at each distance cutoff in 50 bp sliding windows. The negative log10 transform of resultant p-values are reported. Simulated data was generated from the random normal distribution with the same mean, standard deviation, and number of samples in the actual data set (S4 Table). All other p-values of significance listed in the text, including comparisons to EGRIN predictions, combinatorial control, arCOG functional enrichments, etc., were calculated using the hypergeometric test against the genome-wide background distribution unless indicated otherwise. To validate RosR binding patterns from ChIP-chip time course experiments, representative binding sites from dynamic binding pattern groups were selected. Chromatin immunoprecipitation (ChIP) samples were prepared over the time course described above and subjected to quantitative real-time PCR analysis (qPCR) using SYBR green as previously described [22], [50]. Primers used are listed in S1 Table. H. salinarum Δura3 parent, TF deletion strains Δura3ΔVNG0194 and Δura3Δhrg (deletion of VNG0917G), and the complementation strains (see S1 Table for strain details) were pre-grown in CM containing 0. 05 mg/mL uracil (and 20 µg/mL mevinolin for complementation strains), then tested for growth phenotypes in high throughput as previously described [13]. Strains were diluted to OD600 ∼0. 1 and H2O2 was added to final concentrations of 0,5, or 6 mM. Absorbance at an optical density of 600 nm was measured every 30 minutes using the Bioscreen C (Growth Curves USA, Piscataway, NJ). Growth rates were calculated from the slope of the log2 transformed data during logarithmic growth. Reported in the figures are ratios of the growth rates of each strain under H2O2 stress relative to the same strain' s growth rate without stress. All growth data are provided in S6 Table. Regions of the H. salinarum genome sequence 250 bp upstream and downstream of each of the 189 ChIP-chip binding loci (nearby 252 genes including operons, S2 Table) were searched for a cis-regulatory consensus binding motif for RosR using MEME [51]. The output of the search was constrained to three motifs, any number of repeats per sequence, forward or reverse strand, and maximum motif width of 20 bp. Palindromic motifs were not enforced. Similar cis-regulatory sequences were detected using varying subsets of the input sequences. Motif significance was determined using the Wilcoxon signed rank test comparing randomized input sequences to actual sequences. Resultant significance of the top-scoring motif is reported in the text. Details regarding motif genomic positions, E-value of significance of similarity to consensus, and sequence are listed in S5 Table. To validate the predicted cis-regulatory binding sequence, a 200-bp region containing the putative cis-sequence and TATA box of VNG2094G was cloned into the pMTF1044GFP plasmid [36], [52] by Gibson assembly [53] using primers listed in S1 Table. The maximum cloned DNA fragment size was kept to 200 bp to reduce signal from other cryptic promoter elements. H. salinarum Δura3 parent and ΔrosR strains transformed with the fusion vector were grown to mid-logarithmic phase (OD600 ∼0. 3–0. 6) in the absence of stress in 50 mL CM. Samples were collected, washed and fixed as previously described [54] except for fixing temperature (4°C). Resultant samples were measured for fluorescence in an FLx800 fluorimeter (BioTek). Δura3 harboring the empty vector (i. e. GFP-encoding gene with no promoter) or vector containing GFP-encoding gene driven by the strong constitutive Pfdx promoter [33] were used as negative and positive controls, respectively (S1 Table). For each strain, at least five biological replicate cultures with 2 to 4 technical replicates each were tested. Resultant raw fluorescence values were normalized to the cell density of each culture. The mean of these normalized values and standard error of the mean are presented in the figures. SUMMARY: [/INST] Complex circuits of genes rather than a single gene underlie many important processes such as disease, development, and cellular damage repair. Although the wiring of many of these circuits has been mapped, how circuits operate in real time to carry out their functions is poorly understood. Here we address these questions by investigating the function of a gene circuit that responds to reactive oxygen species damage in archaea, microorganisms that represent the third domain of life. Members of this domain of life are excellent models for investigating the function and evolution of gene circuits. Components of archaeal regulatory machinery driving gene circuits resemble those of both bacteria and eukaryotes. Here we demonstrate that regulatory proteins of hybrid ancestry collaborate to control the expression of over 100 genes whose products repair cellular damage. Among these are other regulatory proteins, setting up a stepwise hierarchical circuit that controls damage repair. Regulation is dynamic, with gene targets showing immediate response to damage and restoring normal cellular functions soon thereafter. This study demonstrates how strong environmental forces such as stress may have shaped the wiring and dynamic function of gene circuits, raising important questions regarding how circuits originated over evolutionary time. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By Andy GreenWorld Land Speed Record Holder Not long back from Los Angeles, where I went to launch a movie. OK, so the film was only three minutes long, but still, I can claim a Hollywood film launch! The Future of Speed was made in a Bentley Mulsanne at 190mph on Bonneville Salt Flats (and at 190mph, three minutes is a long time). The really fun bit though was doing an interview with Jay Leno in his world-famous garage. If I ever win the Lottery (which is unlikely - I don't buy any tickets) then I'd have a garage like that, perhaps with less cars and more aeroplanes, but the same general idea. While I was in LA, our senior engineer Brian Coombs and veteran aerodynamicist Ron Ayers were hard at work on the Bloodhound track. The rainy season will start anytime soon on Hakskeen Pan, in the Northern Cape of South Africa, so this was their last chance for a few months. They were there to test the desert/wheel interaction, and they learned a lot more than we had expected (have a look at Ron's article for more detail). Unfortunately, it's not all good news, but if breaking the World Land Speed Record was easy, everyone would be doing it. The team mounted two wheels to a purpose-built trailer, which was the result of a truly amazing effort from three engineers in South Africa - our huge thanks go Fabian, Hentie and Colin for working through the night, followed by a 25-hour non-stop drive to get it there in time. They then filled "Max Max" (a good name for a collection of spare parts running on a desert!) with water to a total of 3.8 tonnes - half the mass of the fully fuelled 1,000mph car. Towing the trailer along the desert would then tell us how deep the wheels dig into the desert, the width of the V-shaped grooves would show how consistent the surface is, and the changes over the new repairs would show how well the desert was recovering. First, the good news. We've been debating how wide the wheels need to be, estimating somewhere between 90mm and 120mm at the rim, to support the full weight of the car. The tracks left on the desert were mostly around 70mm wide, which means that 90mm should be more than enough. Narrow wheels equals light-weight rims equals reduced loads at peak speeds. To give you some idea, peak speed for the wheels is 10,300rpm at 1000mph, which gives a peak load of 50,000 times the force of gravity at the wheel rim. To try and picture this acceleration force, if we put a 1kg bag of sugar on the wheel rim, it would exert a force of 50 tonnes (more than the weight of a fully loaded articulated lorry) at full speed. So reducing the total load on the wheel is a very good thing - and narrower, lighter wheels will do just that. Next, the not-quite-so-good news. The surface hardness is a little uneven, with the recent repairs rather softer than the rest of the surface. I was surprised to find that the causeway repair, where the old man-made road was graded down to its original level, is actually harder than the surrounding lake bed surface. That means that the car may have a tendency to jump upwards slightly as it hits the causeway - at around 600mph. However, the "jump" should only be around 10mm, as the wheels will be "planing" on the surface at that speed, and 10mm is well within the suspension travel of +/-50mm. So far, so good. Now the thing that could worry us the most. As the V-shaped keels are pressed into the surface with nearly two tonnes of load each, the small stones embedded just below the surface are forced against the aluminium surface and dig in. This was the same effect that we saw 15 years ago with Thrust SSC running on the stony surface of a Jordanian Desert. However, the damage on Hakskeen seems to be worse, particularly when we ran the trailer over the (harder) causeway surface. We've got several options to consider. The damage should not be as bad on the final forgings, which will be a harder alloy than these test wheels. We can reduce the load on the point of the wheel by reducing the angle of the "V", spreading the load over more of the tread. We can make our early runs south of the causeway (which still gives us almost 10 miles of track), to check the damage once the car is running at speed, when the wheel rut will be shallower and the stone impacts less deep. Finally, if this is a major problem after we've done our first season of testing this year, we can look at making the wheels from steel if we need to - we know that they can be made thin enough, and steel should be more than hard enough. All this could look quite worrying - but this is exactly what an "Engineering Adventure" is all about. If we hadn't made a trailer and tested the wheels, we wouldn't know about any of this until we arrived with a ready-to-run car later this year. As it is, the more problems we know about, the more solutions we can take with us. It makes the engineering task more challenging, but if breaking the World Land Speed Record was easy… The build of the car is progressing nicely. The rear lower-chassis has now been delivered to the Bloodhound Technical Centre in Bristol, while the rear sub-frame (the strong bit at the back that supports the rocket and rear suspension) is being manufactured. The team at Nuclear AMRC are doing impressive bits of machining to deliver some beautiful bits for the back end of the car. The upper rear-chassis, which carries the jet engine and supports the fin (have you put your name on the fin yet? Over 13,000 people already have!) is now about to be manufactured. The Hyde engineers have been working closely with the Bloodhound team on the design of the fin, which includes the stress analysis. This looks at the loads on the structure, as well as the natural frequencies (the rate at which each part will "vibrate" under load) - and the challenge is to make sure that the different frequencies on the car don't interfere with each other! For example, the frequency of the fin is around 45 Hertz - that's 45 oscillations per second when it's being buffeted by supersonic airflow. Another major input is the airflow around the airbrakes, so we need to make sure that the airbrake frequency is nowhere near 45 Hz. Bloodhound stress engineer Roland has been looking at two options for making the airbrakes, aluminium (frequency - 45 Hz!) and carbon fibre (frequency - 80 Hz), so the need to avoid 45 Hz makes the choice fairly simple. Add in the difference in mass between aluminium (88kg) and carbon fibre (18kg) and there's no contest - we're having carbon fibre panels for the airbrakes. URT is busy laying up the carbon fibre monocoque - which forms the structure around my 1,000mph office - and has already delivered some fibreglass test pieces ("splashes") so that we can start fitting out the cockpit. It's starting to feel very real now - but that didn't stop our computational fluid dynamics expert Ben from jumping into the upper cockpit splash as it arrived, just to try it out. Following our very successful rocket firing in October, we've conducted an independent review to confirm the results and the choice of rocket for us. We're grateful that some of the UK's leading rocket scientists found the time to mark our homework - and the rocket scored well! The review panel confirmed that the Falcon hybrid rocket concept would be capable (with some development, of course) of getting us to 1,000mph. However, the panel did not agree with our measured thrust figure of 6.5 tonnes: they felt that, from their assessment of the rocket parameters, the thrust should be even higher than that - hope they're right! The next set of rocket firing tests will be in the New Year, so we'll know soon enough. Just in case we haven't got enough going on right now, the Bloodhound Technical Centre is about to move. With the build of the car ramping up, plus a lot of support equipment and vehicles arriving soon, we need more room! We're staying in the Bristol area, and will probably move at the end of February. The bigger Centre should also give us more room for visitors, so if you want to come and see the world's first 1,000 mph car, join our 1K Supporters' Club and come to one of our open days - we'd love to see you there. Have a truly supersonic New Year. We plan to! SUMMARY: [/INST] A British team is developing a car that will capable of reaching 1,000mph (1,610km/h). Powered by a rocket bolted to a Eurofighter-Typhoon jet engine, the Bloodhound SSC (SuperSonic Car) vehicle will mount an assault on the land speed record. Wing Commander Andy Green, world land-speed record holder, is writing a diary for the BBC News website about his experiences working on the Bloodhound project and the team's efforts to inspire national interest in science and engineering. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Les candidats officiels du Parti socialiste dans l'ex-bassin minier ont repoussé aussi bien la star du Front de gauche, Jean-Luc Mélenchon, que le rebelle socialiste Jean-Pierre Kucheida. Dans la 11e, c'est toutefois Marine Le Pen (FN) qui écrase le débat (42,36 %) devant le PS Philippe Kemel (23,5 %) et M. Mélenchon (21,48 %). Dans la 12e, le dissident Kucheida (21,72 %), maire de Liévin, appelle à voter pour le maire de Wingles, Nicolas Bays (PS, 24,55 %), devancé par la frontiste Charlotte Soula (25,69 %). Comme dans le Nord, ce sont des femmes qui seront présentes au second tour pour le FN : dans la 10e, Monique Lamarre (21,65 %) sera opposée au PS Serge Janquin (45,08 %). Sur la côte, le ministre délégué aux transports, Frédéric Cuvillier, député et maire de Boulogne-sur-Mer, a été réélu avec 50,66 %.Département PAS-DE-CALAIS Saint-Pol-sur-Ternoise (1re) Ballottage INSCRITS : 103 104 - VOTANTS : 63 733 ABSTENTIONS : 38,19 % - EXPRIMÉS : 62 258 Jean-Jacques Cottel, c.g., m. de Beaulencourt, PS, 23 132 (37,16) ; Michel Petit, c.g., m. de Berles-au-Bois, UMP, 18 439 (29,62) ; Jean-Pierre D'Hollander, FN, 12 081 (19,40) ; Xavier Schmidt, FG, 3 445 (5,53) ; Bruno Duverge, c.g., m. d'Hamelincourt, MoDem-Le Centre, 2 680 (4,30) ; Serge Ravaux, EELV, 1 435 (2,30) ; Dominique Durand, LO, 534 (0,86) ; Jérémy Lautour, NPA, 502 (0,81) ; Michel Legrand, ext. g., 10 (0,02). 1er tour prd. 2012 : I., 103 048 ; A., 15,12 % ; E., 85 807 ; Sarkozy, UMP, 22 877 (26,66) ; Le Pen, FN, 22 076 (25,73) ; Hollande, PS, 21 638 (25,22) ; Mélenchon, FG, 8 113 (9,45) ; Bayrou, MoDem, 6 551 (7,63) ; Dupont-Aignan, DLR, 1 600 (1,86) ; Poutou, NPA, 1 120 (1,31) ; Joly, EELV, 920 (1,07) ; Arthaud, LO, 749 (0,87) ; Cheminade, SP, 163 (0,19). Arras (2e) Ballottage INSCRITS : 84 287 - VOTANTS : 50 962 ABSTENTIONS : 39,54 % - EXPRIMÉS : 49 732 Jacqueline Maquet, d., c.r., PS, 21 345 (42,92) ; Jean-Marie Prestaux, UMP, 12 961 (26,06) ; Dalila Decobert, FN, 8 440 (16,97) ; Laure Olivier, EELV, 2 377 (4,78) ; Sandra Dusautoir, PCF, 2 286 (4,60) ; Véronique Loir, DLR, 1 222 (2,46) ; Pascale Tillier, POI, 304 (0,61) ; Colette Bellettre, NPA, 232 (0,47) ; Abmajid Belhadj, LO, 219 (0,44) ; Matthieu Fontana, SP, 199 (0,40) ; Terence Hien, ext. g., 147 (0,30). 1er tour prd. 2012 : I., 84 252 ; A., 17,36 % ; E., 68 196 ; Hollande, PS, 20 639 (30,26) ; Sarkozy, UMP, 17 237 (25,28) ; Le Pen, FN, 13 030 (19,11) ; Mélenchon, FG, 7 143 (10,47) ; Bayrou, MoDem, 6 356 (9,32) ; Joly, EELV, 1 211 (1,78) ; Dupont-Aignan, DLR, 1 188 (1,74) ; Poutou, NPA, 813 (1,19) ; Arthaud, LO, 424 (0,62) ; Cheminade, SP, 155 (0,23). Lens (3e) Ballottage INSCRITS : 87 348 - VOTANTS : 46 418 ABSTENTIONS : 46,86 % - EXPRIMÉS : 45 336 Guy Delcourt, d., m. de Lens, PS, 15 325 (33,80) ; Freddy Baudrin, c.r., FN, 11 190 (24,68) ; Bruno Troni, c.g., m. de Billy-Montigny, FG, 7 695 (16,97) ; Sophie Gauthy, UMP, 5 298 (11,69) ; Jean-François Caron, c.r., m. de Loos-en-Gohelle, EELV, 3 129 (6,90) ; Bénoni Delvallez, div., 1 076 (2,37) ; Monique Delevallet, PF, 589 (1,30) ; Michel Darras, LO, 582 (1,28) ; Antoine Froissart, NPA, 197 (0,43) ; Razika Abchiche, div. d., 183 (0,40) ; Didier Gayant, ext. g., 72 (0,16). 1er tour prd. 2012 : I., 87 303 ; A., 24,73 % ; E., 64 369 ; Hollande, PS, 19 797 (30,76) ; Le Pen, FN, 18 899 (29,36) ; Mélenchon, FG, 10 448 (16,23) ; Sarkozy, UMP, 9 573 (14,87) ; Bayrou, MoDem, 2 559 (3,98) ; Poutou, NPA, 877 (1,36) ; Dupont-Aignan, DLR, 844 (1,31) ; Joly, EELV, 673 (1,05) ; Arthaud, LO, 572 (0,89) ; Cheminade, SP, 127 (0,20). Berck, Etaples (4e) Ballottage INSCRITS : 87 379 - VOTANTS : 53 683 ABSTENTIONS : 38,56 % - EXPRIMÉS : 52 674 Daniel Fasquelle, s., d., m. du Touquet-Paris-Plage, UMP, 23 116 (43,89) ; Vincent Lena, c.r., PS, 18 321 (34,78) ; Francis Leroy, FN, 6 785 (12,88) ; Laurence Sauvage, c.r., FG, 2 307 (4,38) ; Alexandre Poiret, EELV, 1 036 (1,97) ; Laurent Weill, div. d., 365 (0,69) ; Patrick Macquet, LO, 345 (0,65) ; Odette Goulois-Lampin, DLR, 306 (0,58) ; Pierre Fiquet, MAR, 87 (0,17) ; Armelle Gayant Deprez, ext. g., 6 (0,01). 1er tour prd. 2012 : I., 87 406 ; A., 17,50 % ; E., 70 705 ; Sarkozy, UMP, 22 217 (31,42) ; Hollande, PS, 18 371 (25,98) ; Le Pen, FN, 15 146 (21,42) ; Mélenchon, FG, 6 091 (8,61) ; Bayrou, MoDem, 5 158 (7,30) ; Dupont-Aignan, DLR, 1 291 (1,83) ; Poutou, NPA, 850 (1,20) ; Joly, EELV, 844 (1,19) ; Arthaud, LO, 581 (0,82) ; Cheminade, SP, 156 (0,22). Boulogne-sur-Mer (5e) Frédéric Cuvillier (PS) réélu INSCRITS : 89 827 - VOTANTS : 50 634 ABSTENTIONS : 43,63 % - EXPRIMÉS : 49 750 Frédéric Cuvillier, s., min., d., m. de Boulogne-sur-Mer, PS, 25 202 (50,66) ; Laurent Feutry, m. du Portel, div. d., 11 980 (24,08) ; Antoine Golliot, FN, 7 325 (14,72) ; Brigitte Passebosc, c.r., FG, 3 189 (6,41) ; Fanny Puppinck, EELV, 1 188 (2,39) ; Nicolas Fournier, LO, 500 (1,01) ; Malika Hamiani, AEI, 322 (0,65) ; Malick Zeghdoudi, ext. g., 44 (0,09). 1er tour prd. 2012 : I., 89 811 ; A., 21,12 % ; E., 69 786 ; Hollande, PS, 22 547 (32,31) ; Sarkozy, UMP, 15 927 (22,82) ; Le Pen, FN, 15 526 (22,25) ; Mélenchon, FG, 7 746 (11,10) ; Bayrou, MoDem, 4 390 (6,29) ; Dupont-Aignan, DLR, 1 065 (1,53) ; Joly, EELV, 1 010 (1,45) ; Poutou, NPA, 881 (1,26) ; Arthaud, LO, 545 (0,78) ; Cheminade, SP, 149 (0,21). Lumbres, Marquise (6e) Ballottage INSCRITS : 89 029 - VOTANTS : 55 744 ABSTENTIONS : 37,39 % - EXPRIMÉS : 54 350 Brigitte Bourguignon, PS, 15 035 (27,66) ; Frédéric Wacheux, UMP, 13 345 (24,55) ; Hervé Poher, c.g., div. g., 11 300 (20,79) ; Olivier Delbe, c.r., FN, 10 125 (18,63) ; Betty Charles, FG, 1 550 (2,85) ; Miguel Torres, MEI, 925 (1,70) ; Thierry Ansel, MoDem-Le Centre, 614 (1,13) ; Vincent Magniez, LO, 394 (0,72) ; Claudine Durand-Blauwart, DLR, 385 (0,71) ; Philippe Hamain, div., 356 (0,66) ; Catherine Playe, NPA, 317 (0,58) ; Fanny Lepadellec, ext. g., 4 (0,01) ; Djamel Ouadah, AEI, 0 (0,00). 1er tour prd. 2012 : I., 88 973 ; A., 14,75 % ; E., 74 394 ; Hollande, PS, 21 426 (28,80) ; Le Pen, FN, 18 764 (25,22) ; Sarkozy, UMP, 18 513 (24,89) ; Mélenchon, FG, 6 437 (8,65) ; Bayrou, MoDem, 5 281 (7,10) ; Dupont-Aignan, DLR, 1 509 (2,03) ; Poutou, NPA, 946 (1,27) ; Joly, EELV, 815 (1,10) ; Arthaud, LO, 580 (0,78) ; Cheminade, SP, 123 (0,17). Calais (7e) Ballottage INSCRITS : 92 413 - VOTANTS : 47 986 ABSTENTIONS : 48,07 % - EXPRIMÉS : 47 148 Yann Capet, PS, 15 860 (33,64) ; Philippe Mignonet, UMP, 8 806 (18,68) ; Françoise Vernalde, c.r., FN, 7 330 (15,55) ; Jacky Henin, d.e., FG, 6 946 (14,73) ; Michel Hamy, c.g., m. de Coquelles, div. d., 2 640 (5,60) ; Edith Fournier, m. de Fréthun, div. d., 2 498 (5,30) ; Véronique Boutin, EELV, 857 (1,82) ; Philippe Blet, MRC, 831 (1,76) ; Charles Francois, PRG, 532 (1,13) ; Françoise Millot, LO, 333 (0,71) ; Bernard Playe, NPA, 274 (0,58) ; Jérôme Debuire, AEI, 234 (0,50) ; Nadine Baude, ext. g., 7 (0,01). 1er tour prd. 2012 : I., 92 272 ; A., 22,86 % ; E., 69 894 ; Hollande, PS, 20 413 (29,21) ; Le Pen, FN, 17 922 (25,64) ; Sarkozy, UMP, 14 974 (21,42) ; Mélenchon, FG, 8 694 (12,44) ; Bayrou, MoDem, 4 283 (6,13) ; Dupont-Aignan, DLR, 1 101 (1,58) ; Poutou, NPA, 939 (1,34) ; Joly, EELV, 858 (1,23) ; Arthaud, LO, 552 (0,79) ; Cheminade, SP, 158 (0,23). Saint-Omer (8e) Ballottage INSCRITS : 93 221 - VOTANTS : 55 013 ABSTENTIONS : 40,99 % - EXPRIMÉS : 53 850 Michel Lefait, s., d., c.g., PS, 26 144 (48,55) ; François Decoster, NC, 11 857 (22,02) ; Evelyne Geronnez, FN, 8 461 (15,71) ; René Hocq, c.g., m. de Burbure, FG, 4 596 (8,53) ; Dany Masset-Mallevaes, MoDem-Le Centre, 1 068 (1,98) ; Catherine Glinatsis, MEI, 1 017 (1,89) ; Laure Bourel, LO, 543 (1,01) ; Armelle Lorvellec, ext. g., 164 (0,30). 1er tour prd. 2012 : I., 93 137 ; A., 19,54 % ; E., 73 480 ; Hollande, PS, 23 131 (31,48) ; Le Pen, FN, 17 915 (24,38) ; Sarkozy, UMP, 15 585 (21,21) ; Mélenchon, FG, 8 034 (10,93) ; Bayrou, MoDem, 4 825 (6,57) ; Dupont-Aignan, DLR, 1 313 (1,79) ; Poutou, NPA, 944 (1,28) ; Joly, EELV, 850 (1,16) ; Arthaud, LO, 718 (0,98) ; Cheminade, SP, 165 (0,22). Béthune (9e) Ballottage INSCRITS : 79 278 - VOTANTS : 46 781 ABSTENTIONS : 40,99 % - EXPRIMÉS : 45 354 André Flajolet, s., d., c.r., m. de Saint-Venant, UMP, 13 702 (30,21) ; Stéphane Saint-Andre, m. de Béthune, PRG, 10 159 (22,40) ; Aurélia Beigneux, FN, 7 658 (16,88) ; Alain Delannoy, c.g., m. de Lapugnoy, div. g., 4 929 (10,87) ; Pascal Barois, m. de Lillers, FG, 3 526 (7,77) ; Daniel Boys, div. g., 3 370 (7,43) ; Anne Ecuyer, EELV, 861 (1,90) ; Charline Turpin, LT-MHAN, 501 (1,10) ; Marie-Danièle Duquenne, LO, 380 (0,84) ; Abdellah Baiic, écol., 214 (0,47) ; Anne Fiquet, MAR, 37 (0,08) ; Martine Vampouille Daver, ext. g., 17 (0,04). 1er tour prd. 2012 : I., 79 240 ; A., 19,66 % ; E., 62 502 ; Hollande, PS, 17 614 (28,18) ; Sarkozy, UMP, 15 008 (24,01) ; Le Pen, FN, 14 876 (23,80) ; Mélenchon, FG, 6 763 (10,82) ; Bayrou, MoDem, 4 792 (7,67) ; Dupont-Aignan, DLR, 1 116 (1,79) ; Joly, EELV, 898 (1,44) ; Poutou, NPA, 750 (1,20) ; Arthaud, LO, 522 (0,84) ; Cheminade, SP, 163 (0,26). Bruay-la-Buissière (10e) Ballottage INSCRITS : 89 878 - VOTANTS : 47 605 ABSTENTIONS : 47,03 % - EXPRIMÉS : 46 501 Serge Janquin, s., d., PS, 20 985 (45,13) ; Monique Lamare, FN, 10 053 (21,62) ; Maureen Leuleu, UMP, 6 831 (14,69) ; Thomas Boulard, FG, 4 606 (9,91) ; Lisette Sudic-Taillieu, EELV, 835 (1,80) ; Davy Carincotte, LT-MHAN, 591 (1,27) ; Elodie Milot, MoDem-Le Centre, 550 (1,18) ; Daniel Mouton, DLR, 544 (1,17) ; Flore Lataste, LO, 530 (1,14) ; Gérard Cailliau, NPA, 338 (0,73) ; Martine Lefebure, MPF, 306 (0,66) ; Annick Charlety, NC, 245 (0,53) ; Olivier Bouly, ext. g., 87 (0,19). 1er tour prd. 2012 : I., 89 751 ; A., 23,25 % ; E., 67 499 ; Hollande, PS, 21 000 (31,11) ; Le Pen, FN, 18 749 (27,78) ; Sarkozy, UMP, 11 479 (17,01) ; Mélenchon, FG, 9 098 (13,48) ; Bayrou, MoDem, 3 586 (5,31) ; Dupont-Aignan, DLR, 1 081 (1,60) ; Poutou, NPA, 960 (1,42) ; Joly, EELV, 727 (1,08) ; Arthaud, LO, 674 (1,00) ; Cheminade, SP, 145 (0,21). Hénin-Beaumont (11e) Ballottage INSCRITS : 94 135 - VOTANTS : 53 768 ABSTENTIONS : 42,88 % - EXPRIMÉS : 52 595 Marine Le Pen, d.e., c.r., FN, 22 280 (42,36) ; Philippe Kemel, m. de Carvin, PS, 12 358 (23,50) ; Jean-Luc Melenchon, d.e., FG, 11 299 (21,48) ; Jean Urbaniak, c.g., m. de Noyelles-Godault, MoDem-Le Centre, 4 163 (7,92) ; Marine Tondelier, EELV, 858 (1,63) ; Michel Vast, div. d., 488 (0,93) ; Murielle Richet, LT-MHAN, 330 (0,63) ; Nathalie Hubert, LO, 326 (0,62) ; Séverine Duval, NPA, 177 (0,34) ; Michèle Dessenne, ext. g., 92 (0,17) ; Mohamed Bousnane, écol., 85 (0,16) ; Rachida Sahraoui, c.r., PRV, 78 (0,15) ; Pierre Rose, ext. g., 61 (0,12) ; Daniel Cucchiaro, écol., 0 (0,00). 1er tour prd. 2012 : I., 94 027 ; A., 23,80 % ; E., 70 292 ; Le Pen, FN, 22 089 (31,42) ; Hollande, PS, 20 210 (28,75) ; Sarkozy, UMP, 11 100 (15,79) ; Mélenchon, FG, 10 441 (14,85) ; Bayrou, MoDem, 3 201 (4,55) ; Dupont-Aignan, DLR, 942 (1,34) ; Poutou, NPA, 815 (1,16) ; Joly, EELV, 735 (1,05) ; Arthaud, LO, 588 (0,84) ; Cheminade, SP, 171 (0,24). Liévin (12e) Ballottage INSCRITS : 94 597 - VOTANTS : 51 321 ABSTENTIONS : 45,75 % - EXPRIMÉS : 49 968 Charlotte Soula, FN, 12 839 (25,69) ; Nicolas Bays, PS, 12 296 (24,61) ; Jean-Pierre Kucheida, s., d., m. de Liévin, div. g., 10 811 (21,64) ; Frédéric Lamand, UMP, 6 099 (12,21) ; Christian Champire, m. de Grenay, FG, 4 595 (9,20) ; Hervé Rubin, EELV, 756 (1,51) ; Régis Scheenaerts, LO, 713 (1,43) ; Michel Richet, LT-MHAN, 580 (1,16) ; Anne Delpech, MoDem-Le Centre, 572 (1,14) ; Jacques Kleinpeter, NPA, 263 (0,53) ; Laëtitia Matiatos, NC, 199 (0,40) ; Habiba Benherrat, div., 146 (0,29) ; Charlotte Albrun, ext. g., 99 (0,20). 1er tour prd. 2012 : I., 94 508 ; A., 22,08 % ; E., 72 215 ; Hollande, PS, 23 185 (32,11) ; Le Pen, FN, 21 761 (30,13) ; Sarkozy, UMP, 11 142 (15,43) ; Mélenchon, FG, 8 966 (12,42) ; Bayrou, MoDem, 3 372 (4,67) ; Dupont-Aignan, DLR, 1 072 (1,48) ; Poutou, NPA, 1 053 (1,46) ; Joly, EELV, 774 (1,07) ; Arthaud, LO, 741 (1,03) ; Cheminade, SP, 149 (0,21). SUMMARY: [/INST] Sortants: Jacqueline Maquet (PS) ; Catherine Genisson (PS) ; Jean-Claude Leroy (PS) ; Daniel Fasquelle (UMP) ; Frédéric Cuvillier (PS) ; Jack Lang (PS) ; Gilles Cocquempot (PS) ; Michel Lefait (PS) ; André Flajolet (UMP) ; Serge Janquin (PS) ; Odette Duriez (PS) ; Jean-Pierre Kucheida (PS) ; Guy Delcourt (PS) ; Albert Facon (PS) </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Great Lakes Environmental Restoration Act''. SEC. 2. FINDINGS. Congress finds that-- (1) the Great Lakes and the connecting channels of the Great Lakes form the largest freshwater system in the world, holding \1/5\ of the fresh surface water supply of the world and \9/10\ of the fresh surface water supply of the United States; (2) 30 years after the date of enactment of the Federal Water Pollution Control Act (33 U.S.C. 1251 et seq.), water quality in the Great Lakes has improved, but the Great Lakes remain in a degraded state; (3) evidence of the degraded environment of the Great Lakes includes-- (A) a record 599 closings of Great Lakes beaches in 2001; (B) an increase to 20 percent in the percentage of Great Lakes shoreline that contains polluted sediments; and (C) the issuance by State and local authorities of 1,400 fish consumption advisories relating to the Great Lakes; (4) the Great Lakes are sources of drinking water for approximately 40,000,000 people in the United States and Canada; (5) in the years since the Great Lakes Water Quality Agreement was signed and the United States and Canada agreed to ``restore and maintain the chemical, physical, and biological integrity of the waters of the Great Lakes Basin and give priority attention to the 43 designated Areas of Concern'', no sites have been restored in the United States; (6) it is the responsibility of the Federal Government and State and local governments to ensure that the Great Lakes remain a clean and safe source of water for drinking, fishing, and swimming; and (7) while the total quantity of resources needed to restore the Great Lakes is unknown, additional funding is needed now to augment existing efforts to address the known threats facing the Great Lakes. SEC. 3. DEFINITIONS. In this Act: (1) Board.--The term ``Board'' means the Great Lakes Environmental Restoration Advisory Board established by section 5(a). (2) Council.--The term ``Council'' means the Great Lakes Federal Coordination Council established by section 6(a). (3) Great lake.--The term ``Great Lake'' means-- (A) Lake Erie; (B) Lake Huron (including Lake Saint Clair); (C) Lake Michigan; (D) Lake Ontario; (E) Lake Superior; and (F) the connecting channels of those Lakes, including-- (i) the Saint Marys River; (ii) the Saint Clair River; (iii) the Detroit River; (iv) the Niagara River; and (v) the Saint Lawrence River to the Canadian border. (4) Great lakes state.--The term ``Great Lakes State'' means each of the States of Illinois, Indiana, Ohio, Michigan, Minnesota, New York, Pennsylvania, and Wisconsin. (5) Program.--The term ``Program'' means the Great Lakes Environmental Restoration Grant Program established by section 4(a). (6) Program office.--The term ``Program Office'' means the Great Lakes National Program Office of the Environmental Protection Agency. SEC. 4. GREAT LAKES RESTORATION GRANTS. (a) Establishment.--There is established a Great Lakes Environmental Restoration Grant Program, to be administered by the Program Office. (b) Grants.-- (1) In general.--In coordination with the Board, the Program Office shall provide to States, municipalities, and other applicants grants for use in and around the Great Lakes in carrying out-- (A) contaminated sediment cleanup; (B) wetland restoration; (C) invasive species control and prevention; (D) coastal wildlife and fisheries habitat improvement; (E) public access improvement; (F) water quality improvement; (G) sustainable water use; (H) nonpoint source pollution reduction; or (I) such other projects and activities to restore, protect, and assist the recovery of the Great Lakes as the Board may determine. (2) Distribution.--In providing grants under this section for a fiscal year, the Program Office shall ensure that-- (A) at least 1 project or activity is funded in each Great Lakes State for the fiscal year; (B) the amount of funds received by each Great Lakes State under this section for the fiscal year is at least 6 percent, but not more than 30 percent, of the total amount of funds made available for grants under this section for the fiscal year; (C) each project or activity for which funding is provided results in 1 or more tangible improvements in the Great Lakes watershed; and (D) each project or activity for which funding is provided addresses 1 or more priority issue areas identified by the Board for the fiscal year. (3) Grant evaluation.-- (A) In general.--In evaluating grant proposals, the Program Office shall give great weight to the ranking of proposals by the Board under section 5(c)(3). (B) Decision not to fund.--If the Program Office decides not to fund a grant proposal ranked by the Board as 1 of the top 10 proposals meriting funding, the Program Office shall provide to the Board, not later than 30 days after the date of the determination, a written statement explaining the reasons why the proposal was not funded. (4) Funding limitations.--Funds provided under the Program shall not be used for any of the following: (A) Design, construction, or improvement of a road except as required in connection with a sewer upgrade. (B) Design, implementation, or evaluation of a research or monitoring project or activity except as required in connection with a project or activity that will result in a tangible improvement to the Great Lakes watershed. (C) Design or implementation of a beautification project or activity that does not result in a tangible improvement to the Great Lakes watershed. (D) Litigation expenses, including legal actions to address violations of the Federal Water Pollution Control Act (33 U.S.C. 1251 et seq.), the Endangered Species Act of 1973 (16 U.S.C. 1531 et seq.), or any other environmental law or regulation. (E) Lobbying expenses (as defined in section 2 of the Lobbying Disclosure Act of 1995 (2 U.S.C. 1602)). (c) Authorization of Appropriations.-- (1) In general.--There is authorized to be appropriated to carry out this section $600,000,000 for each of fiscal years 2004 through 2013. (2) Cost sharing.--The Federal share of the cost of any project or activity carried out using funds made available under paragraph (1) shall not exceed 80 percent. (3) In-kind contributions.--The non-Federal share of the cost of any project or activity carried out using funds made available under paragraph (1) may be provided in cash or in kind. SEC. 5. GREAT LAKES ADVISORY BOARD. (a) Establishment.--There is established a committee to be known as the ``Great Lakes Environmental Restoration Advisory Board''. (b) Membership.-- (1) In general.--The Board shall be composed of 21 voting members (or designees of the members), of whom-- (A) 8 shall be the Governors of the Great Lakes States; (B) 1 shall be Director of the Great Lakes National Program Office; (C) 1 shall be the Secretary of the Interior; (D) 1 shall be the Director of the National Oceanic and Atmospheric Administration; (E) 1 shall be the Chief of Engineers; (F) 1 shall be the Secretary of Agriculture; and (G) 8 shall be chief executives of cities, counties, or municipalities in the Great Lakes basin and selected by the Steering Committee of the Great Lakes Cities Initiative, including 1 member from each Great Lakes. (2) Observers.--The Board may include observers, including-- (A) the Premiers of the Canadian Provinces of Ontario and Quebec; (B) a representative of the Government of Canada; (C) a representative of the State Department; (D) 8 representatives of environmental organizations (with 1 member appointed by the Governor of each Great Lakes State), including-- (i) Great Lakes United; (ii) the Lake Michigan Federation; (iii) the National Wildlife Federation; (iv) the Sierra Club; and (v) The Nature Conservancy; (E) 5 representatives of industry selected by the chairperson of the Board; (F) the Chairman of the United States section of the International Joint Committee; (G) the Vice Chair of the United States section of the Great Lakes Fishery Commission; (H) the Chairman of the Great Lakes Commission; and (I) 3 representatives of Native Americans selected by the President. (3) Date of appointments.--The appointment of each member of the Board shall be made not later than 90 days after the date of enactment of this Act. (4) Term; vacancies.-- (A) Term.--A member of the Board shall be appointed for 5 years. (B) Vacancies.--A vacancy on the Board-- (i) shall not affect the powers of the Board; and (ii) shall be filled in the same manner as the original appointment was made. (5) Meetings.--The Board shall meet at the call of the chairperson. (6) Chairperson.--The Board shall select a chairperson of the Board from the members appointed under paragraph (1)(A). (c) Duties.-- (1) In general.--Before the beginning of the fiscal year, the Board shall determine by majority vote, and shall submit to the Program Office, the funding priority issue areas that shall apply to all grants provided under section 4 during the fiscal year. (2) Great lakes goals.--The priorities shall be based on environmental restoration goals for the Great Lakes that-- (A) are prepared by the Governors of Great Lakes States; and (B) identify specific objectives and the best methods by which to produce a tangible improvement to the Great Lakes. (3) Grants.-- (A) Program office.--The Program Office shall provide to the Board, in a timely manner, copies of grant proposals submitted under section 4. (B) Board.--The Board shall-- (i) review the grant proposals; and (ii) provide to the Program Office, by a date specified by the Program Office, a list of the grant applications that the Board recommends for funding, ranked in order of the applications that most merit funding. SEC. 6. GREAT LAKES FEDERAL COORDINATING COUNCIL. (a) Establishment.--There is established, in the executive branch, the Great Lakes Federal Coordinating Council. (b) Membership.-- (1) In general.--The Council shall consist of-- (A) the Secretary of the Interior; (B) the Secretary of Agriculture; (C) the Secretary of Commerce; (D) the Secretary of State; (E) the Secretary of Transportation; (F) the Secretary of Health and Human Services; (G) the Administrator of the Environmental Protection Agency, acting through the Great Lakes National Program Office Director; (H) the Secretary of the Army, acting through the Chief of Engineers; and (I) such additional members as are appointed under paragraph (2). (2) Additional members.--With the concurrence of a majority of the members of the Council, the chairperson of the Council may appoint additional members to the Council from among individuals who are officers or employees of the Federal Government with significant responsibilities concerning the environmental restoration and protection of the Great Lakes. (c) Chairperson.--The Director of the Great Lakes National Program Office shall serve as chairperson of the Council. (d) Meetings.--The Council shall meet at the call of the chairperson, but not less often than 3 times in each calendar year. (e) Duties.-- (1) In general.--The Council shall ensure that the efforts of Federal agencies concerning environmental restoration and protection of the Great Lakes are coordinated, effective, complementary, and cost-efficient. (2) Duties.--To carry out subsection (a), the Council shall-- (A) ensure that Federal agencies implement the policies and priorities identified by the Council through appropriate actions, including working in cooperation with Federal agencies on development of budgets for the annual submission by the President to Congress of the budget of the United States Government under section 1105 of title 31, United States Code; and (B) develop and submit to the appropriate committees of Congress and the Director of the Office of Management and Budget-- (i) an annual list of priorities for implementation, ranked in high, medium, and low categories, under Federal efforts and programs; and (ii) a description of accomplishments under-- (I) the Program; and (II) as the Council considers appropriate, other federally funded grant programs that benefit the Great Lakes. (f) Authorization of Appropriations.--There is authorized to be appropriated to carry out this section $100,000 for each of fiscal years 2004 through 2006. SEC. 7. GREAT LAKES WATER QUALITY INDICATORS AND MONITORING. (a) In General.--Section 118(c)(1) of the Federal Water Pollution Control Act (33 U.S.C. 1268(c)(1)) is amended by striking subparagraph (B) and inserting the following: ``(B)(i) not later than 2 years after the date of enactment of this clause, in cooperation with Canada and appropriate Federal agencies (including the United States Geological Survey, the National Oceanic and Atmospheric Administration, and the United States Fish and Wildlife Service), develop and implement a set of science-based indicators of water quality and related environmental factors in the Great Lakes, including, at a minimum, measures of toxic pollutants that have accumulated in the Great Lakes for a substantial period of time, as determined by the Program Office; ``(ii) not later than 4 years after the date of enactment of this clause-- ``(I) establish a Federal network for the regular monitoring of, and collection of data throughout, the Great Lakes basin with respect to the indicators described in clause (i); and ``(II) collect an initial set of benchmark data from the network; and ``(iii) not later than 2 years after the date of collection of the data described in clause (ii)(II), and biennially thereafter, in addition to the report required under paragraph (10), submit to Congress, and make available to the public, a report that-- ``(I) describes the water quality and related environmental factors of the Great Lakes (including any changes in those factors), as determined through the regular monitoring of indicators under clause (ii)(I) for the period covered by the report; and ``(II) identifies any emerging problems in the water quality or related environmental factors of the Great Lakes.''. (b) Authorization of Appropriations.--Section 118 of the Federal Water Pollution Control Act (33 U.S.C. 1268) is amended by striking subsection (h) and inserting the following: ``(h) Authorization of Appropriations.-- ``(1) In general.--There is authorized to be appropriated to carry out this section (other than subsection (c)(1)(B)) $25,000,000 for each of fiscal years 2004 through 2008. ``(2) Great lakes water quality indicators and monitoring.--There are authorized to be appropriated to carry out subsection (c)(1)(B)-- ``(A) $4,000,000 for fiscal year 2004; ``(B) $6,000,000 for fiscal year 2005; ``(C) $8,000,000 for fiscal year 2006; and ``(D) $10,000,000 for fiscal year 2007.''. SUMMARY: [/INST] Great Lakes Environmental Restoration Act - Establishes a Great Lakes Environmental Restoration Grant Program in the Great Lakes National Program Office of the Environmental Protection Agency (EPA). Allocates funds among the Great Lakes States, requiring the funding of at least one project or activity per Great Lakes State per fiscal year. Stipulates that these projects result in tangible improvements in the Great Lakes watershed and address at least one of the priority issues identified by the Great Lakes Environmental Restoration Advisory Board. Prohibits the use of restoration grant funds for: (1) roads not connected with a sewer upgrade; (2) research, monitoring or beautification projects unrelated to tangible improvements to the watershed; or (3) litigation and lobbying expenses. Establishes the Great Lakes Environmental Restoration Advisory Board which includes Federal, State, and local members as well as Canadian and environmental organization observers. Establishes the Great Lakes Federal Coordinating Council. Amends the Federal Water Pollution Control Act to require the Administrator of EPA to: (1) develop and implement science-based indicators of water quality and related environmental factors in the Great Lakes, including measures of accumulated toxic pollutants; (2) establish a Federal network to regularly monitor and collect this data; and (3) make a report available to Congress and the public describing the water quality and related environmental factors of the Great Lakes. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Just One More Thing... We have sent you a verification email. Please check your email and click on the link to activate your Statesman.com profile. If you do not receive the verification message within a few minutes of signing up, please check your Spam or Junk folder. Close A bizarre scene aboard a United Airlines flight bound for San Francisco International Airport on Saturday evening showcased a pilot dressed in street clothes ranting about politics and her personal life before descending into tears. Christie Smith reports. A bizarre scene aboard a United Airlines flight bound for San Francisco International Airport on Saturday evening showcased a pilot dressed in street clothes ranting about politics and her personal life before breaking into tears, according to passengers. United Airlines Flight 455 was parked at Austin-Bergstom International Airport when the pilot took control of the intercom and began discussing her divorce and firing off about the recent election, according to Randy Reiss, a passenger on the airplane. Reiss, who tweeted that he felt unsafe and uncomfortable during that point of the rant, proceeded to storm off of the plane. About half of the other passengers followed suit, passenger Sylvia Nguessan said. Nguessan added that the pilot was originally agitated when she began her speech before being overcome by tears. Former President George H.W. Bush Dead at 94 The former president died less than a year after his wife's passing. (Published Friday, Nov. 30, 2018) United Airlines confirmed that the pilot was removed the airplane when it issued a statement regarding the ordeal. "We hold our employees to the highest standards and replaced this pilot with a new one to operate the flight," the statement read in part. "We apologize to our customers for the inconvenience." Reiss, while waiting in the airport for his flight to depart, eventually ran into the pilot. He said that she was crying and that she apologized for her actions. Reiss said he wished her well, and he later issued a statement backing up that hope. "Being a pilot is a tough and stressful job," the statement read. "This particular pilot did not seem emotionally equipped to do that job today. I hope she gets the help she probably needs." Nguessan echoed a similar sentiment. "It was sad and by the end (the pilot) was in tears," she said. "I talked to her and hugged her because she was having a nervous breakdown." Flight 455 eventually departed from Austin roughly two hours late, United Airlines said in a statement. SUMMARY: [/INST] A pilot appeared to suffer something akin to a nervous breakdown aboard a United Airlines jet-but fortunately it hadn't taken off yet. Passengers aboard a plane on the runway in Austin, Texas, say a pilot clad in civilian clothes began addressing them via the intercom about her divorce and the presidential election (she called both candidates liars) before breaking into tears, reports the Austin American-Statesman. The plane was still parked at the gate as she spoke, and about half the passengers got up and left, reports NBC Bay Area. "We hold our employees to the highest standards and we removed that pilot from that flight," says a spokesman for United. "We brought in a new crew and they operated that flight." In a since-deleted video posted by a passenger, the pilot can be heard saying, "Don't worry, I'm going to let my co-pilot fly (the airplane)." Afterward, the passengers bound for San Francisco seemed more concerned about the pilot than their delay. "It was sad and by the end (the pilot) was in tears," says one. "I talked to her and hugged her because she was having a nervous breakdown." </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Canine Visceral leishmaniasis (CVL) is a serious public health problem, thus for its control, the Ministry of Health in Brazil recommends the rapid diagnosis and euthanasia of seropositive dogs in endemic areas. Therefore, our group had previously selected six recombinant proteins (rLci1, rLci2, rLci4, rLci5, rLci8, and rLci12) due to their high potential for CVL diagnostic testing. The present study aims to produce an immunodiagnostic test using the aforementioned antigens, to improve the performance of the diagnosis of CVL recommended by Brazilian Ministry of Health. To evaluate the recombinant proteins in the serological assays, positive and negative samples were selected based on parasitological test (culture) and molecular test (qPCR) of splenic aspirate. Initially, we selected 135 dog serum samples, 73 positives (symptomatic and asymptomatic) and 62 negatives to screen recombinant proteins on ELISA platform. Then, for rLci5 ELISA validation, 361 serum samples collected in a cross-sectional study were selected, being 183 positives (symptomatic and asymptomatic) and 178 negatives. In the screening of the recombinant proteins, rLci5 was the only protein to present a performance statistically higher than the performance presented by EIE-LVC test, presenting 96% (IC 95%; 85–99%) vs. 83% (IC 95%; 69–92%) of sensitivity for symptomatic dogs, 71% (IC 95%; 49–97%) vs. 54% (IC 95%; 33–74%) for asymptomatic dogs and 94% (IC 95%; 83–99%) vs, 88% (IC 95%; 76–95% of specificity. Thus, the rLci5 protein was selected to compose a final ELISA test. Validation of rLci5 ELISA showed 87% (IC 81–91%) of sensitivity, 94% (IC 95%; 90–97%) of specificity and 90% accuracy. Testing the EIE-LVC with the same validation panel, we observed a lower performance when compared to ELISA rLci5 (sensitivity of 67% (IC 95%; 59–74%), specificity of 87% (IC 95%; 81–92%), and accuracy of 77%). Finally, the performance of current CVL diagnostic protocol recommended by Brazilian Ministry of Health, using DPP-LVC as screening test and EIE-LVC as confirmatory test, was compared with a modified protocol, replacing EIE-LVC by rLci5 ELISA. The current protocol presented a sensitivity of 59% (IC 95%; 52–66%), specificity of 98% (IC 95%; 95–99%) and accuracy of 80% (IC 95%; 76–84%), while the modified protocol presented a sensitivity of 71% (IC 95%; 63–77%), specificity of 99% (IC 95%; 97–100%) and accuracy of 86% (IC 95%; 83–89%). Thus, we concluded that rLci5 ELISA is a promising test to replace EIE-LVC test and increase the diagnostic performance of CVL in Brazil. Visceral Leishmaniasis (VL) caused by Leishmania infantum (syn Leishmania chagasi) in Brazil, is a zoonotic disease and infected dogs are considered the main urban reservoir [1–4]. Diagnosis and euthanasia of infected dogs are one of the main strategies for VL control recommended by the Brazilian Ministry of Health. Thus, accurate diagnosis is essential to correctly identify animals infected with L. infantum [5,6]. In 2012, a rapid immunochromatographic test (DPP-LVC) based on the rK28 protein has recently become the preferred diagnostic method for screening in Brazil, followed by ELISA (EIE-LVC) as a confirmatory test. Recent studies have shown that EIE-LVC presents a highly variable sensitivity and specificity in diagnosing canine visceral leishmaniasis (CVL), varying between 72% to 97% for sensitivity, and 26% to 84% for specificity [7,8]. Additionally, EIE-LVC are known to present a low sensitivity in the detection of asymptomatic dogs [9,10], indicating current diagnostic tests of CVL need to be replaced. For improving VL control measures, the identification of novel recombinant antigens may contribute to enhance test sensitivity and specificity. Therefore, six recombinant antigens (Lci1A, Lci2B, Lci4, Lci5, Lci8 and Lci12) were previously selected from a cDNA and a genomic library of Leishmania infantum by our group, as described by Oliveira et al. [11], Teixeira et al. [12] and Magalhães et al. [13], and screened by a Multi-antigen print immunoassay (MAPIA) technique [14] due to their strong potential as candidates in diagnostic testing. Previous results obtained by Oliveira et al. [11] and Souza et al. [15] demonstrated by ELISA the potential of some of these recombinant antigens for the development of a diagnostic test. Moreover, two of these proteins was already tested in a DPP platform, an immunochromatographic rapid test prototype based on the dual path platform. The sensitivity of the DPP Prototype with Lci1A and Lci2B evaluated in a multi-centric study was 87%, similarly to the 88% of sensitivity from the test currently provided by the Brazilian Minister of Health, DPP-LVC [16]. The present study aimed to evaluate the accuracy of the recombinant antigens (Lci1A, Lci2B, Lci4, Lci5, Lci8 and Lci12) of Leishmania infantum for the serodiagnosis of dogs infected by L. infantum, which were selected by its highest accuracy to compose a final ELISA test, and validate the use of this test to improve the diagnostic protocol for CVL currently in use by Brazilian Minister of Health in Brazil. All serological samples were obtained according to the procedures approved by the Institutional Review Board for Animal Research (CEUA, protocol no. 03/2013) at the Federal University of Bahia in Salvador, Bahia-Brazil. A set of six recombinant L. infantum antigens (rLci1A, rLci2B, rLci4, rLci5, rLci8, rLci12) was previously selected from a cDNA and a genomic library of Leishmania infantum based on antibody reactivity using a pool of sera from culture-positive dogs and human patients with VL [11,16]. These recombinant antigens were screened using a multi-antigen print immunoassay (MAPIA) [14] technique to verify potential as viable candidates in diagnostic testing. Antigen production and purification was carried out at the Instituto Carlos Chagas (ICC-Paraná), Universidade Federal de Minas Gerais (UFMG) and Instituto Oswaldo Cruz (IOC-Rio de Janeiro). Escherichia coli BL21 (DE3) pLysS (Invitrogen) was transformed with pRSET plasmids (Invitrogen) containing the Lci1, Lci2, Lci4, Lci5, Lci8 or Lci12 L. infantum gene insert [11]. Transformed bacteria were grown in Lysogeny broth medium and induced using 0. 1 mM of isopropyl β- d -thiogalactoside overnight at 15°C to express Lci1, Lci4, Lci5, or at 37°C for 3h for Lci2 and Lci12 expression. Affinity chromatography was used to purify the proteins rLci1, rLci2, rLci5 and rLci8 from the soluble extract of proteins, while the crude extract was used to purify the rLci4 and rLci12 proteins, both using a HisTrap HP column (GE Healthcare, Piscataway, NJ) connected to an AKTAprime chromatography system (GE Healthcare, USA). rLci2 and rLci8 were submitted to a second purification step by ion-exchange chromatography using a Hitrap Q HP column (GE Healthcare, Piscataway, NJ) connected to an AKTAprime chromatography system. The performance of the CVL diagnosis protocol (DPP-LVC and EIE-LVC) recommended by Brazilian Ministry of Health was evaluated after rLci5 ELISA evaluation. Validation sera panel was tested using DPP-LVC and EIE-LVC tests. As recommended by the diagnostic protocol, DPP-LVC was used as screening test and EIE-LVC as confirmatory test (current protocol). Using the same sera sample panel, the performance of an alternative protocol employing rLci5 ELISA as a confirmatory test in place of EIE-LVC was evaluated and compared to the performance of the protocol currently recommended by the Ministry of Health. All diagnostic testing was performed under blinded conditions, which means that test readers interpreted the results obtained from each diagnostic technique for a given sample without knowledge of the results of other tests. Data were encoded, analyzed and presented using scatter plot graphing software (GraphPad Prism version 6, San Diego-CA, USA). All analyses were two-tailed, and a p-value of less than 5% was considered significant (p < 0. 05). For the recombinant antigens ELISA, the cut-off pertaining to optimal sensitivity and specificity was established using a Receiver Operator Curve (ROC curve), while the EIE-LVC cut-off was obtained in accordance with the manufacturer’s recommendation (i. e. twice the average of the negative control). All results were expressed by plotting the obtained values in an index format representative of the ratio between a given sample’s OD and the cut-off OD pertaining to each microplate, referred to as reactivity index (RI), with all results <1. 00 considered negative. Each serodiagnostic test was evaluated with respect to sensitivity, specificity, area under the curve (AUC) and accuracy. For comparisons among the diagnostic tests, differences were detected using the McNemar test and considered statistically significant when p < 0. 05. Diagnostic odds ratio was calculated to show the ratio of the odds of disease in test positives relative to the odds of disease in test negatives. Confidence intervals (CI) were calculated using a confidence level of 95%. Each one of the following recombinant antigens of Leishmania, rLci1, rLci2, rLci4, rLci5, rLci8 and rLci12, was evaluated in an ELISA protocol to identify which of them offered highest performances in comparison to EIE-LVC, the confirmatory CVL diagnostic test recommended by Brazilian Ministry of Health. Fig 1 illustrates the performance parameters and reactivity index (RI) distributions obtained by ELISA using the recombinant antigens in addition to EIE-LVC. rLci1, rLci2 and rLci12 presented the highest RI differences between positive and negative samples. When testing samples from symptomatic dogs in comparison to asymptomatic animals, higher RI results were obtained using rLci1, rLci4, rLci5, rLci8 and the EIE-LVC test. None of these antigens demonstrated potential for use as a serological marker capable of differentiating a given animal’s clinical status based on RI differences. The diagnostic performance of each recombinant antigen under ELISA, in addition to the EIE-LVC test, are summarized in Table 1. The recombinant antigens offering the best performance with regard to CVL diagnosis were rLci5 (92% accuracy), rLci12 (87% accuracy), rLci1 and rLci2 (84% accuracy), rLci4 (81% accuracy) and rLci8 (75% accuracy). Moreover, rLci5 ELISA also offered the greatest sensitivity with respect to detecting symptomatic dogs, in addition to the second highest sensitivity regarding asymptomatic dogs. Comparisons between the sensitivity results showed that rLci5 ELISA offered a statistically significant higher sensitivity in comparison to EIE-LVC (p < 0. 05; OR = 2. 6; CI: 1. 02–7. 28) (Table 1). ROC curve analysis of the area under the curve (AUC) (Fig 2) confirmed the superior performance of the rLci5 ELISA protocol (AUC = 0. 934) in comparison to the rLci12 ELISA (AUC = 0. 929) and EIE-LVC (AUC = 0. 889) tests. Recombinant antigen screening results identified rLci5 as the Leishmania protein offering the best CVL diagnostic performance for use in an ELISA commercial kit. Validation results for the rLci5 ELISA kit confirmed higher sensitivity (87%) than both EIE-LVC (67%), the confirmatory test recommended by Ministry of Health in Brazil, and DPP-LVC (74%), the screening test currently endorsed by the Brazilian Ministry of Health (Table 2). Additionally, rLci5 ELISA presented higher sensitivity in the detection of symptomatic dogs (85%) and asymptomatic dogs (93%) than either DPP-LVC (70% and 87%) or EIE-LVC (66% and 69%). Stratification of the validation panel considering only samples with positive culture results with positive or negative qPCR (155 dogs) indicated slightly higher test sensitivity for rLci5 ELISA (95%), followed by 83% for DPP-LVC and 78% for EIE-LVC. However, when evaluating sera from dogs with only positive qPCR results (24 dogs), test sensitivity decreased drastically: 42% for Lci5 ELISA, 19% for DPP-LVC and 11% for EIE-LVC (Table 3). With regard to test cross-reactivity using serum samples from dogs experimentally infected with Trypanosoma cruzi, DPP-LVC presented the highest specificity (90%), followed by rLci5 ELISA (65%) and EIE-LVC (56%). Using the validation serum panel, a comparison of diagnostic performance assessing reactivity index and the area under the curve (AUC) revealed superior performance by Lci5 ELISA (AUC = 0. 910) compared to EIE-LVC (AUC = 0. 785) (Fig 3), despite the higher RI values obtained under EIE-LVC with regard to symptomatic sera samples (p < 0. 05). Finally, we compared the diagnostic performance of the current protocol recommended by the Brazilian Ministry of Health to an alternate protocol that replaces the EIE-LVC test developed by Bio-Manguinhos with rLci5 ELISA. While the current protocol offered 59% sensitivity, 98% specificity and an overall accuracy of 80%, the altered protocol presented higher sensitivity (71%), specificity (99%) and accuracy (86%) (Table 4). The present study demonstrates the relatively low sensitivity offered by the current protocol recommended by the Brazilian Ministry of Health for CVL diagnosis, versus an alternate protocol implementing an ELISA using rLci5, a recombinant protein of Leishmania, in place of the EIE-LVC test. Previous studies have reported satisfactory performance regarding rLci1 (a protein homologous to members of the cytoplasmic HSP70 family) and rLci2 (fragments of the protein belonging to the kinesin superfamily of motor proteins) for the diagnosis of CVL using different platforms [11–16]. While these proteins demonstrated acceptable performance in our recombinant antigen screening protocol, offering high accuracy (84% for both proteins) and high AUC (0. 877 and 0. 919 for rLci1 and rLci2, respectively), the rLci5 protein (flagellar member protein) and rLci12 (conserved hypothetical protein) provided superior performance: 92% and 87% accuracy, and 0. 934 and 0. 929 AUC, respectively. Thus, rLci5 was selected for use in a commercial ELISA kit since this protein offered the best isolated performance of those evaluated. In fact, rLci5 was the only protein that presented significantly better performance (OR = 2. 8; 1. 06–8. 77) in comparison to EIE-LVC. The ELISA test was chosen as a final platform to rLci5 antigen instead an immunochromatographic platform, since there is a necessity of replacement of EIE-LVC due to some limitations of the test. For example, the difficulty in producing the antigen used in the test (lysate of Leishmania major) and the difficulty in produce reproducible lots. Our validation of the performance of rLci5 in an ELISA using a larger sample indicated higher sensitivity and accuracy (87% and 90%, respectively) compared to both DPP-LVC and EIE-LVC (74% and 84%, 67% and 77%, respectively). Although the present performance parameters for rLci5 are lower than those reported in other studies, this difference may be due to the fact that our serum selection process did not consider previous serodiagnostic results; i. e., samples were included based exclusively on previous parasitological or molecular testing, which stands in contrast to results presented in the literature. Our criterion was based on recommendations by Peixoto et al. [19], who identified methodological problems in many studies evaluating diagnostic tests for CVL. In this systematic review, it is noteworthy that the majority of the evaluated studies used as the selection criterion of the sample panel with previous positive results in serologic assays. Thus, the accuracy of these tests could have been overestimated. The chance of bias decreases by not basing serum selection on previously obtained serological results [19,20], the fact that molecular test results were considered for inclusion could compromise sensitivity, as was observed herein (Table 3). The low rate of detection using serological techniques in the canine population with positive results only in qPCR (n = 28/183,15%) might reflect the presence of low quantities or even the absence of anti-Leishmania antibodies in the sample set. In this population, with only qPCR results positive, the rLci5 ELISA was the technique with the highest sensitivity (42%) (Table 3), increasing the detection of dogs that would not be detected by other serological tests (DPP-LVC and EIE-LVC). The higher sensitivity in the detection of in otherwise undetected samples by another serological tests, reflects in a good detection rate of asymptomatic dogs, however it was lower than the sensitivity on diagnose symptomatic dogs, in agreement with studies that showed a correlation between the level of antibodies and clinical manifestation [21,22]. These results of lower detection of asymptomatic dogs comparing with symptomatic dogs are consistent with those obtained by Grimaldi et al. [23] using DPP, and Porrozi et al. [24] using recombinant antigen in an ELISA assay. In rLci5 ELISA validation, sensitivity showed an increase between the development phase when rLci5 ELISA was evaluated using a reference sample panel (71%) and validation phase (83%). The sera of asymptomatic dogs in both panels presents positive results for qPCR and culture of spleen aspirate, so this improvement may have occurred due to the optimization of the protocol with the use of an antigen stabilizing and blocking reagent (Well-Champion) and a ready-to-use substrate for colorimetric detection reagent (TMB-Plus), the same reagents used in EIE-LVC. Evaluating rLci5 protein sequence in GeneDB databases, it was identified that this protein is present in the flagellum of promastigote forms and the flagellar button of amastigotes of Leishmania [25]. Better performance of rLci5 in comparison with other antigens may be related to the fact that it is more exposed to the immune system of the host, increasing the chances of antibody production against this protein. The cross-reactivity against sera from dogs infected by T. cruzi found in the present study (35. 5%) could be explained by the fact of this protein be conserved in the genus Trypanosoma. However, this cross-reactivity is not a problem in the use of rLci5 ELISA in the diagnostic protocol combined with DPP-LVC since the rLci5 ELISA will be used as the confirmatory test performed in the laboratory and, consequently, only samples detected positive by DPP-LVC in the screening will be evaluated in rLci5 ELISA. The specificity observed in this protocol in our study was 99% using sera from non-infected dogs with Leishmania and dogs infected by T. cruzi. Additionally, our next steps will be the evaluation of the use of synthetic peptides derived from Lci5 in an immunochromatographic test to improve the accuracy and decrease the cross-reactivity of the test. Regarding the performance evaluation of the diagnostic protocol recommended by the Brazilian Ministry of Health, the values of sensitivity and accuracy (59% and 80%) obtained in the present study were lower than the results obtained by Fraga et al. [8] that were 73% and 94% for sensitivity and accuracy, respectively. This difference might have occurred due to the use of latent class as gold standard [8]. In summary, our findings showed that rLci5 ELISA presented a higher performance when compared to EIE-LVC and DPP-LVC and these data presented herein strongly support the idea that the replacement of EIE-LVC by rLci5 ELISA as a confirmatory test in the CVL diagnostic protocol can increase sensitivity and accuracy of the diagnostic protocol recommended by Ministry of Health in Brazil, contributing to improve CVL diagnosis and consequently improving the control of VL in Brazil. Nevertheless, this modification in the CVL diagnostic protocol should only be implemented after a multicentric study using representative samples of different regions in Brazil confirming the results obtained in this study. SUMMARY: [/INST] Visceral leishmaniasis is a tropical disease caused by the protozoan parasite Leishmania infantum, which is transmitted to humans through the bite of infected sand flies. Infected dogs are considered the main urban reservoir of parasite. Identification and euthanasia of infected dogs is one of the main strategies for VL control recommended by the Brazilian Ministry of Health. Hence, to improve the efficacy of control measures, it is essential an accurate diagnose of naturally infected dogs in endemic areas. Herein, we sought to produce a new immunodiagnostic test using recombinant antigens of Leishmania infantum to improve the performance of the diagnosis of CVL recommended by Brazilian Ministry of Health. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: GM has plans to put a Cadillac on the road in two years that won't require drivers to hold a steering wheel or put their foot on the gas. GM is calling the new technology 'Super Cruise,' promising it will be able to master steering, acceleration, stopping-and-going in gridlocked traffic, and braking at highway speeds of 70 miles per hour. Chief Executive Officer Mary Barra described the groundbreaking model in a speech to the Intelligent Transport System World Congress in Detroit. Scroll down for video. GM will introduce the groundbreaking V2V, or'vehicle-to-vehicle' tech in the 2017 Cadillac CTS sedan. Bloomberg reports that Barra boasted her company will become the first automaker to make a. GM's new communications system could help cars avoid crashing and reduce gridlock by having cars within 300 meters of each other communicate basic safety information. These vehicles could advise each other on speed, the direction cars are traveling, and location. If a driver ahead of your vehicle slams on their brakes, the information can be transmitted to other drivers to prepare for the sudden halt in traffic. Those safety features will be even more useful when GM finishes developing its first intelligent highways in Detroit. Those roads will feature cameras and sensors to warn cars about upcoming traffic. However, to operate these systems without using the steering wheel or pedals themselves, drivers must remain alert to take the wheel when traffic conditions need real judgement. model featuring V2V, or'vehicle-to-vehicle,' technology within the next two years. The Super Cruise will initially be featured in the 2017 Cadillac CTS sedan, according to Road and Track. That feature will enable cars to communicate with other cars, warn of traffic hazards, and ideally make roads safer. 'With Super Cruise, when there’s a congestion alert on. roads like California's Santa Monica Freeway, you can let the. car take over and drive hands free and feet free through the. worst stop-and-go traffic around,” Barra said. 'If the mood strikes you on the high-speed road from Barstow, California, to Las Vegas, you can take. a break from the wheel and pedals and let the car do the work. Having it done for you -- that’s true luxury.' CBS Boston notes that today's autonomous vehicles are required to have all the same manual controls that are found in normal vehicles, and a licensed driver operating the car must be able to take over at any moment. GM is cautioning that this technology is not a self-driving car, and that drivers must be alert and able to take the wheel when traffic conditions require it. 'We’re rolling out active safety technology today. We’re. not going to wait until we have a driverless vehicle that can. work in 100 per cent of situations,' said Jon Lauckner, GM's chief technology officer. 'There’s a. lot that can be done before we get to the perfect driverless. technology.' GM's new communications system could help cars avoid crashing and reduce gridlock by having cars within 300 meters of each other communicate basic safety information. GM is cautioning that this technology is not a self-driving car, and that drivers must be alert and able to take the wheel when traffic conditions require it. The Super Cruise will be available on in the second half of 2016. GM is also partnering with Ford Motor Co., the University of Michigan, and the Michigan Department of Transportation to build 120-miles of 'intelligent highways' in Detroit. The roads will be able to communicate with vehicles and warn of upcoming hazards using sensors and cameras. GM officials promise any information gathered by the sensors will not be given to police to ticket drivers, and the Michigan Department of Transportation is calling it 'the largest deployment of connected vehicle and highway technology in the world.' GM also partnering with University of Michigan and Michigan Department of Transportation to build 'intelligent' roads around Detroit that capture and transmit traffic information using cameras and sensors. It's uncertain when the project will be completed. The vehicle-to-vehicle communication protocols are being developed in conjuction with the NHTSA. That's the same organization that's overseen GM's record 29 million recalls this year. However industry analysts note that some buyers will worry about the car's safety features, especially after GM produced faulty ignition switches linked to 13 deaths. 'There is still a concern by consumers about the safety of. their vehicles because there’s been so many recalls,' said Michelle Krebs, an analyst with AutoTrader. 'This is going to take a while to win the confidence of. consumers.' Barra tells reporters she knows the technology must be perfect to be a success. 'It’s critical that it works flawlessly every single. time,' Barra told reporters. 'When you look at what has got to. come together to make this happen -- not just for straight. driving on a section of highway, but for every city situation. you can imagine -- there’s quite a bit of technology that has to. come together to make this work.' However industry analysts note that some buyers will worry about the car's safety features, especially after GM produced faulty ignition switches linked to 13 deaths. If GM, or any of the automakers competing to get the first self-driving car to consumers, can get the technology bug-free they might lower traffic fatalities and reduce gridlock. In the U.S. alone, the cost of economic and social impact of car crashes is more than $870 billion annually, GM stated, citing figures from the National Highway Traffic Safety Administration. 'It’s a chicken-and-egg technology,' said John Capp, GM’s. director of global safety strategies and vehicle programs. 'If nobody in two years from now. puts out a V2V car, then the first CTS off the line will have to. wait for the next CTS to talk to.' SUMMARY: [/INST] 'Autonomous' vehicles must have a driver capable of taking control of the vehicle at any moment to be legally operated. GM's 'Super Cruise' technology will master steering, acceleration, stop-and-go in gridlocked traffic, and braking at highway speeds of 70 mph. Technology will allow car to trade information about traffic conditions with vehicles up to 300 meters away. GM also partnering with University of Michigan and Michigan Department of Transportation to build 'intelligent' roads around Detroit that capture and transmit traffic information using cameras and sensors. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Background From 1962 through 1991, HHS’ system for protecting human research subjects was created, piece by piece, largely in response to disclosures of dangerous or controversial biomedical and behavioral research. (See app. II for more historical information.) The tragic consequences of thalidomide use in the United States and revelation of the Tuskegee syphilis study shocked the public and convinced national policymakers that unregulated biomedical research represented a clear threat to research subjects. Two expressions of this concern were the passage of the National Research Act and the promulgation of human subject protection regulations by the Department of Health, Education, and Welfare (HEW) in 1974. The act also established the National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research to guide federal human subject protection policy. When the core of the human subject protection regulations was adopted by 15 other departments and agencies in 1991, it became known as the Common Rule. The Common Rule requires research institutions receiving federal support and federal agencies conducting research to establish committees to review research proposals for risk of harm to human subjects and to perform other duties to protect human research subjects. It also stipulates requirements related to informed consent—how researchers must inform potential subjects of the risks to which they, as study participants, agree to be exposed. (See fig. 1 for Basic Elements of Informed Consent.) HHS regulations contain additional protections not included in the Common Rule for research involving vulnerable populations—namely, pregnant women, fetuses, subjects of in vitro fertilization research, prisoners, and children. In the late 1970s and early 1980s, HHS considered but did not adopt recommendations by two national commissions for specific regulations to protect institutionalized mentally disabled subjects. A statement stipulating that research is involved, what the purpose of the research is, what the duration of the subject's involvement will be, and what procedures the subject will undergo. A description of foreseeable risks or discomforts to the subject. A description of expected benefits, if any, to the subject and others. The disclosure of alternative procedures or courses of treatment. A statement describing the extent to which confidentiality of records identifying the subject will be maintained. For research that poses more than minimal risk to subjects, an explanation of the availability and nature of any compensation or medical treatment if injury occurs. Names of people to contact for further information about the research, the subjects’ rights, and notification of research- related injury. A statement stipulating that participation is voluntary and no penalties will be imposed for refusal to participate in research; subject can choose to discontinue participation at any time. Within the HHS oversight system, OPRR and FDA are the key federal entities overseeing compliance with informed consent and other human subject protection regulations. Both entities carry out oversight functions central to the operation of the human subject protection system, including policy setting, prevention, monitoring, and enforcement. Institutional review boards (IRB)—that is, review panels that are usually associated with a particular university or other research institution—are responsible for implementing federal human subject protection requirements for research conducted at or supported by their institutions. OPRR is located within the National Institutes of Health (NIH), the principal federal agency responsible for supporting biomedical and behavioral research. About one-half of OPRR’s 28 full-time employees are responsible for overseeing protections in the approximately 16,000 HHS awards involving human subjects. The other half are devoted to ensuring the humane care and use of laboratory animals. Three physician volunteers augment OPRR’s human subject protection staff. OPRR has an annual budget of $1.9 million, about one-half of which is targeted to human subject protection activities. FDA is responsible for protecting the rights of human subjects enrolled in research with products it regulates—drugs, medical devices, biologics, foods, and cosmetics. Our review focused on oversight activities of FDA’s Center for Drug Evaluation and Research, which carries out most of FDA’s human subject protection activities. At CDER, responsibility for human subject protection activities is shared between the Office of Drug Evaluation and the Division of Scientific Investigations. The Office of Drug Evaluation reviews manufacturers’ and researchers’ requests to conduct drug studies on human subjects. The Division of Scientific Investigations reviews FDA’s field inspection reports on IRBs and investigators and makes final determinations regarding compliance violations. Routine and for-cause on-site inspections are conducted by field staff, who are also responsible for examining the integrity of research data, assessing compliance with good manufacturing practices, and examining other issues related to FDA’s oversight of all its regulated products. Within research institutions, oversight is done primarily by IRBs responsible for examining research proposals and ongoing studies. No data exist on the exact number of IRBs in the country but estimates range from 3,000 to 5,000. Most are found at universities, hospitals, and private research facilities; a few are free standing. Human subject research conducted by NIH itself, for example, is governed by the 14 IRBs of the NIH Intramural Research Program. In general, IRBs are composed chiefly of scientists at their respective institutions. They are required to have a minimum of five members, at least one of whom is a scientist, one a nonscientist, and one a person not otherwise affiliated with the research institution. They are also required to have a diverse membership; in determining membership, consideration must be given to race, gender, and cultural background. Preventive Efforts Have Been Important in Reducing Likelihood of Abuses The presence of local review bodies and federal oversight agencies appears to have heightened the awareness and sensitivity of the research community to the importance of respecting subjects’ rights and welfare. Written commitments, which bind research institutions to comply with human subject protection requirements, are an important element of the protection system. By requiring individual researchers and IRBs to uphold their institution’s commitments, the system works to prevent harm to participants in most experimental studies. However, the effectiveness of the HHS human subject protection regulations in ensuring compliance by institutions and individual researchers has not been systematically studied. Assurances Commit Institutions to Uphold Human Subject Protection Requirements Research institutions must commit to uphold human subject protection requirements before engaging in research with human subjects conducted or funded by any of the departments or agencies that adopted the Common Rule. To be eligible to receive such funding, an institution must enter into a contract-like agreement, called an assurance. This is the written promise of an institution housing research studies to comply with federal ethical conduct standards. OPRR, the federal office within NIH that approves assurances for research funded by HHS, requires assurances to (1) include a statement of ethical conduct principles, (2) stipulate that a review board has been designated to approve and periodically review the institution’s studies, and (3) specify the review board’s membership, responsibilities, and process for reviewing and approving proposals. Assurances serve as one of the system’s chief preventive measures. OPRR’s authority to require assurances derives from the 1974 National Research Act, which formalized the practice of obtaining from institutions receiving HHS funding written assurances of their commitment to the ethical conduct of research. When the legislation was enacted, NIH had already developed assurance-type documents with many universities, which OPRR reviewed. Approving an assurance involves no site visits by OPRR to the institution; rather, negotiations are handled through correspondence and telephone calls with institution officials. OPRR assurances are of several types. Multiple project assurances are approved for universities and other major research centers that conduct a substantial number of studies and have demonstrated a willingness and the expertise to comply with human subject protection requirements. Through a multiple project assurance, an institution does not need to reapply through OPRR for eligibility to receive HHS funds for each new study approved by its IRB. An assurance covers the institution’s human subject studies for 3 years, at which time the institution must renew its assurance. Renewals are for a 5-year period. As a practical matter, multiple project assurances allow institutions to conduct research with no further OPRR involvement until the assurance is up for renewal. As of November 1995, 451 active OPRR multiple project assurances covered more than 500 research institutions. These institutions receive most of HHS’ funding for research with human subjects. Primary responsibility for negotiating all multiple project assurances in OPRR rests with a retired physician who used to be employed for this purpose by OPRR. Since retiring, she has continued this work on an unpaid, part-time basis. Currently, the assurance branch chief is responsible for approving all multiple project assurances OPRR negotiates. At institutions without a multiple project assurance, an assurance agreement must be negotiated with OPRR for each individual study. These are called single project assurances and require OPRR to review, for each study, documentation similar to that required for a multiple project assurance. In addition, OPRR reviews the study’s informed consent form before approving a single project assurance. As of November 1995, OPRR had 3,063 active single project assurances. Primary oversight of these assurances rests with three full-time staff in OPRR’s assurance branch. A third type of assurance—the cooperative project assurance—recognizes that research is frequently conducted at multiple sites under joint institutional sponsorship. One example is the National Surgical Adjuvant Project for Breast and Bowel Cancers, sponsored by the National Cancer Institute and conducted at over 300 sites. OPRR requires each participating institution to have a cooperative project assurance for all its joint research, regardless of other assurances held by the institution. For projects conducted under cooperative project assurances, OPRR designates reviewers to approve each research protocol and a prototype informed consent form. IRBs at the participating institutions must also approve the protocol and the informed consent document. IRBs can require additional explanations to be included in the informed consent document. However, they cannot modify the core elements of the protocol, which is to be consistent across all sites. Nor can they delete or substantially modify the discussion of risks and alternative treatments in the prototype consent document without notice and justification. As of November 1995, OPRR had 1,333 active cooperative project assurances. Assurance branch staff responsible for single project assurances also review cooperative assurances with additional support provided by other OPRR staff and others. FDA Requires Commitment to Human Subject Protection Standards FDA also works to prevent the occurrence of human subject protection violations in the drug research it regulates. Before permitting drug research with human subjects, FDA requires researchers to submit a brief statement that they will uphold ethical standards and identify the institutional review board that will examine the study. Sponsors are required to provide the results of chemical and animal studies with the new drug, submit the proposed study procedures for using human subjects, and commit to ensuring that a properly constituted IRB will review the proposed study. FDA reviews this information to ensure the study poses no unacceptable risks to subjects, is ethically sound, and is likely to achieve the study objectives. FDA can request modifications to or reject proposals deemed to present unacceptable risk. FDA’s prevention efforts overlap OPRR’s if the drug study is supported by HHS funds. Federal Entities’ Education of Research Community Is Another Preventive Measure Both OPRR and FDA educate the research community on issues related to protecting human research subjects. Both respond directly to questions from individual researchers, IRBs, and institutional officials. They cosponsor about four human subject protection workshops annually across the country that are attended on a voluntary basis by IRB members, research institution officials, and researchers. OPRR also issues written guidance that defines terms and clarifies ambiguities in human subject protection requirements. OPRR may provide additional information to individual institutions during its negotiation of assurances. FDA also provides guidelines on informed consent, research proposal review, and recordkeeping to IRBs, research sponsors, and researchers. IRBs Serve as Gatekeepers in Approving Research Federal officials and the research community alike commonly cite IRBs as a key line of defense protecting patients and healthy volunteers participating in research. Federal regulations authorize IRBs to approve, approve with modification, or withhold approval from new research projects. Researchers must get approval from the appropriate IRB associated with their institution before beginning research with human subjects. IRBs are required to review ongoing projects annually or more often depending on the level of risk. HHS will not fund new human subject research or authorize ongoing research to continue without the local IRB’s approval. Specifically, IRBs are required to ensure that, for each project reviewed, risks are minimized and reasonable in relation to anticipated benefits, subjects are properly informed and give consent to participate, and the rights and welfare of subjects are maintained in other ways as well. IRBs are required to include scientists and nonscientists as members. IRBs must also consider gender, racial, and ethnic diversity in their membership selection in order to be sensitive to a broad range of social as well as scientific issues. IRB members are also expected to recognize that certain research subjects—such as children, prisoners, the mentally disabled, and individuals who are economically or educationally disadvantaged—are likely to be vulnerable to coercion or undue influence. The local nature of most IRBs enables members to be familiar with the research institution’s resources and commitments, the investigators’ capabilities and reputations, and the prevailing values and ethics of the community and subject population. In deciding whether to approve new research, IRBs are required to determine that a study’s procedures are consistent with sound research design and do not unnecessarily expose subjects to risk. In addition, IRBs are required to examine the study investigators’ efforts to obtain subjects’ consent, including examining the informed consent document when applicable. They do this to ensure that the document specifies the procedures the subject will undergo in language and terminology the subject can understand, the risks to the subject, and alternative treatments available and that the document makes explicit, among other things, the right of individuals to decline to participate in the study or to withdraw at any time. IRB members told us that they spend most of their time reviewing the informed consent document associated with a study. IRB reviews generally do not involve direct observation of the research study or of the process in which a subject’s consent is obtained, however. As a result, IRBs must rely on investigators’ and consent monitors’ assessments of subjects’ reading skills, fluency in English, and mental capacity. An IRB can authorize the use of a consent monitor to observe the delivery of informed consent, for example, when potential subjects might not have the mental capacity to understand all aspects of the consent process. IRBs are also required to review previously approved research periodically. The purpose of these continuing reviews is for IRBs to keep abreast of a study’s potential for harm and benefit to subjects so that IRBs can decide whether the study should continue. Principal investigators must therefore report the presence of adverse effects on study subjects, which allows the IRB to assess whether the seriousness of risk has changed. IRBs should also consider whether advances in knowledge or technology have occurred that would require reconsidering the appropriateness of the study’s purpose or protocol. In addition, they should review such details as whether the number of subjects in the study corresponds to the number initially approved. Federal Monitoring and Enforcement Identify and Address Human Subject Protection Violations No system of prevention is foolproof—indeed, FDA’s and OPRR’s monitoring identifies abuses and other evidence of noncompliance. Federal monitoring efforts for human subject protection violations include reviews of study documentation, IRB operations, and allegations of misconduct. Federal enforcement activities serve to stem further adverse consequences. In fact, FDA officials, researchers, and drug industry representatives we interviewed told us that the FDA’s oversight of drug research motivates researchers and IRBs to follow proper human subject protection procedures. FDA Has a Variety of Monitoring Activities and Enforcement Options FDA monitors drug research for compliance with human subject protections. By conducting on-site inspections of IRBs, reviewing progress reports from researchers and sponsoring drug companies, and making on-site inspections of clinical studies and investigators, FDA becomes aware of noncompliance with federal regulations. FDA officials told us that most institutions and researchers respond quickly and positively to inspection findings, and the presence of an FDA inspection process deters human subject protection violations. FDA’s inspection of IRBs is its primary monitoring tool for human subject protection. FDA inspects IRBs to determine their adherence to federal human subject protection requirements. FDA inspections of IRBs consist primarily of an on-site examination of the IRBs’ minutes, written operating procedures, and other documentation that substantiates initial and continuing review and proper IRB membership. During these inspections, FDA interviews the chair or the administrator of the IRB to learn details about the IRB’s operation. FDA also determines whether consent forms contain all required elements and are signed by subjects. FDA has three levels of priority for inspecting the roughly 1,200 IRBs that oversee drug research. FDA gives top priority to the reinspection of IRBs for which it found serious deficiencies in the IRBs’ review of studies. FDA’s next priority is examining IRBs that were unknown to FDA until identified by researchers in their applications to begin drug studies with human subjects. FDA’s lowest priority is the routine reinspection of IRBs. Between fiscal years 1990 and 1995, CDER issued each year, on average, the results of 158 inspections of IRBs overseeing drug research. Between January 1993 and November 1995, FDA issued 31 Warning Letters to institutions regarding significant deficiencies in the performance of their IRBs’ oversight of drug research. These Warning Letters imposed sanctions—until CDER received adequate assurance that the IRB had taken corrective action—on the IRBs’ ability to approve new studies, allow entry of new subjects into ongoing studies, or both. Among the more serious violations cited were the following: researchers participated as IRB members in the review of their own studies; institutional officials falsely claimed no trials had been conducted that would have required IRB review; IRBs had no process to track ongoing studies; IRBs used expedited rather than full review to approve major study changes; IRBs failed to correct deficiencies noted during a previous FDA inspection; IRBs failed to ensure that required elements of informed consent were contained in consent documents; and IRBs allowed their members to vote by telephone instead of convening the board. FDA officials told us that FDA has never had to invoke its ultimate sanction—disqualification—for seriously deficient IRBs. On about 60 occasions, institutions disbanded their IRBs upon FDA’s findings of serious noncompliance. In most of these instances, the research projects approved by the IRBs had already been completed. FDA’s examination of individual drug studies is another component of its human subject protection monitoring. Before a manufacturer can receive FDA approval to market a drug, it must satisfy FDA that it has complied with FDA’s human subject protection regulations during clinical trials. The monitoring includes reviews of progress reports and on-site inspections. Although FDA examines documentation on protection matters, its principal focus in these efforts is to verify the accuracy and completeness of study data as well as the researcher’s adherence to the approved protocol. When researchers begin clinical trials, FDA’s Office of Drug Evaluation requires them, through their sponsors, to submit annual progress reports and also to report within 10 working days any serious and unexpected adverse incidents involving subjects as well as major changes to the study protocol. If these reports indicate potential or actual harm to subjects, FDA can suspend or terminate the study. FDA’s on-site inspections of drug studies generally occur after clinical trials have concluded. There are two types of inspections: routine and for-cause. Routine inspections are conducted after a manufacturer has completed its clinical trials and submits a new drug application (NDA) to FDA for approval to market the product. During fiscal years 1990 through 1995, FDA issued each year, on average, the results of about 265 routine inspections of drug studies. The sites visited are typically university-based research facilities, independent testing laboratories, and the offices of physicians participating in drug trials. Inspections of drug studies also include an assessment of how well subjects were protected during the study: whether the consent document, study protocol, and required revisions to them were reviewed and approved by an IRB before enrolling subjects; whether signed consent forms were obtained from each enrolled subject; whether adverse incident and status reports were submitted to the IRB once research began; and whether subjects were recruited properly. FDA inspectors look for evidence that researchers reported all safety-related information to the sponsor, reasons why subjects dropped out of the study, and other matters related to the integrity of study data. In addition, FDA often interviews researchers and sometimes interviews subjects. While routine inspections generally occur after completion of clinical trials, for-cause inspections can occur at any time during the course of drug testing with humans. FDA conducts for-cause inspections when its review of status reports submitted by researchers indicates possible misconduct, or when it receives allegations of serious misconduct. FDA conducts about a dozen for-cause inspections annually. Most of the violations FDA identifies through its routine inspections of individual drug studies are relatively minor. From 1977 to 1995, about one-half of the violations related to the adequacy of the informed consent forms. For example, FDA frequently found violations of the requirement to specify in the informed consent document whom subjects can contact if they have concerns about research, subjects’ rights, or research-related injury. FDA also identified more serious violations in its routine and for-cause inspections. We reviewed 69 of the 84 letters describing deficiencies that FDA issued to drug researchers between April 1980 and November 1995. These letters cited instances of serious misconduct, including failure to obtain informed consent; forgery of subjects’ signatures on informed consent forms; failure to inform patients that a drug was experimental; fabrication of data to make subjects eligible for study; submission of false electrocardiograms, X rays, and lab test results to the company underwriting the research; failure to report subjects’ adverse reactions to drugs under study, including a subject’s death; failure to obtain informed consent and an IRB’s approval for a study touting a human growth hormone as a cure for Alzheimer’s disease; proceeding with a cancer study after FDA had suspended it for protocol deficiencies; and failure to inform patients that a drug sold to them was experimental and contained a steroid. Since 1980, FDA has taken 99 actions against 84 clinical investigators regarding their conduct of drug research with human subjects. FDA has used four types of actions to enforce its regulations: (1) obtaining a promise from a researcher to abide by FDA requirements for conducting drug research; (2) invoking a range of restrictions on a researcher’s use of investigational drugs; (3) disqualifying a researcher from using investigational drugs; and (4) criminally prosecuting a researcher. OPRR Investigates Allegations of Noncompliance and Requires Corrective Action OPRR also responds to inquiries and investigates allegations, but few investigations result in site visits; inquiries and investigations are largely handled by telephone and correspondence. OPRR receives complaints about human subject protection issues from a variety of sources, including NIH inspection teams, FDA, subjects and their families, staff from research institutions, news media, and the Congress. The majority of noncompliance reports come from the institutions themselves, which are required to report unanticipated problems, such as injuries and serious or continuing noncompliance, to OPRR as part of the assurance agreement. The number of compliance cases investigated by OPRR grew from 32 open cases in January 1993 to 107 cases under investigation in June 1995. OPRR officials and others attribute the increase to a heightened awareness of human subject protection issues and more extensive media coverage of untoward research events rather than to an increase in the actual occurrence of noncompliance. Over the past 5 years, OPRR’s compliance staff of four full-time employees and two volunteers have investigated several studies for allegations involving serious human subject protection violations. One such example was OPRR’s investigation of whether informed consent procedures clearly identified the risk of death to volunteers in the tamoxifen breast cancer prevention trial. OPRR found that informed consent documents at some sites failed to identify some of tamoxifen’s potentially fatal risks, such as uterine cancer, liver cancer, and embolism. In another instance, OPRR compliance investigators found deficiencies in informed consent and in IRB review procedures in a joint NIH-French study of subjects who had tested positive for the human immunodeficiency virus (HIV) in Zaire. In a third case, OPRR compliance staff investigated a study of schizophrenia at a major university because of complaints from families of two subjects associated with the study. In that investigation, OPRR found that the informed consent documents failed to adequately describe the research procedures, research risks, and alternative courses of treatment. In addition, OPRR found that the researchers inappropriately obtained the subjects’ oral consent rather than written consent as required by HHS regulations. Among cases currently under investigation, OPRR is reviewing allegations that researchers at a university-based fertility clinic transferred eggs from unsuspecting donors to other women without the consent of the donors. Our review of OPRR files showed that OPRR found such deficiencies as the failure of an IRB to give full review of projects at a convened meeting or to adequately review ongoing research. OPRR also found IRB approval of informed consent documents that did not clearly state the study’s purpose, did not identify the study’s risks of the research, and did not present information that would be understandable to the subjects. In many cases, OPRR has required institutions to take corrective action. In some instances, OPRR has suspended an institution’s authority to conduct further research in a particular area until problems with its IRBs were fixed. From 1990 to mid-1995, there were 17 instances in which OPRR imposed some type of restriction on an institution’s authority to conduct human subject research. For example, in some cases, OPRR suspended the enrollment of new subjects; in others, OPRR excluded certain types of research from coverage by multiple project assurances, thereby requiring single project assurances and the direct involvement of OPRR in reviewing each study’s informed consent forms and other documents. To document corrective actions, institutions are generally required to submit quarterly reports to OPRR. OPRR lifts a restriction when it is satisfied that the institution has taken appropriate corrective actions—in most cases, after receiving quarterly reports for about a year to 18 months. Multiple Factors Weaken Institutional and Federal Human Subject Protection Efforts Oversight systems are by nature limited to minimizing, rather than fully eliminating, the potential for mishap, and HHS’s system for protecting human subjects is no exception. Various factors reduce or threaten to reduce the system’s effectiveness. IRBs face the pressure of heavy workloads and competing professional demands. OPRR is often remote from the institutions it oversees. FDA’s processes, while including on-site inspections, may permit human subject protection violations to go undetected. Moreover, the complexity and volume of research under review and the difficulty of ensuring that individuals truly understand the risks they may experience as research subjects can weaken the effectiveness of human subject protections. Workload and Other Demands Impair IRB Oversight Federal officials, experts, and research community members we interviewed consistently mentioned several concerns about the operations of IRBs. First, IRB reviews are labor intensive and time consuming, forcing boards to balance the need to make reviews thorough against the need to get them done. IRB members are usually physicians, scientists, university professors, and hospital department heads who are not paid for their IRB service. Board members themselves told us they face a heavy workload, and others in the research community have raised concerns that heavy workload impairs IRB review. In some cases, the sheer number of studies necessitates that IRBs spend only 1 or 2 minutes of review per study. FDA found one IRB that had reviewed as many as 200 proposals and ongoing studies at a meeting. Several experts told us of other instances in which IRBs had reviewed 100 to 150 studies in one meeting. In many such cases, one, two, or several individuals—known as “primary reviewers”—may be assigned to examine a study comprehensively in advance of the IRB meeting, often held monthly. In these cases the other IRB members rely on the conclusions drawn by the primary reviewers and may be less prepared to identify and discuss potential problems with proposals. In addition, IRB members and researchers told us that, given the time constraints, a good portion of the meetings is devoted to assessing the adequacy of the consent forms at the expense of reviewing research designs. Second, federal officials and experts in IRB issues have been particularly concerned with IRBs’ conduct of continuing reviews. They assert that these reviews are typically either superficial or not done at all. According to OPRR officials, IRBs have not always understood the requirements for continuing review, and, in other cases, IRB workload demands have reduced the quality of this review. In some cases, IRB administrative staff with no scientific expertise—not IRB members themselves—review continuing review forms, ensuring only that the information has been provided. Heavy workload also necessitates that IRBs rely largely on investigators’ self-assessments in conducting continuing reviews. That is, IRBs review statements completed by the study’s investigators and, with rare exceptions, do not verify the accuracy of the reported information. Although experts disagree on the desired level of IRB verification, its value was demonstrated recently in a report by HHS’ Office of Inspector General. The report cited one instance in which nine researchers failed to notify their IRBs, as required, of major deviations from a study protocol. In another instance, a surgeon reported to the IRB the implantation of an experimental device in 37 subjects. The HHS review team found that this surgeon and his coinvestigators had actually implanted the device in 258 subjects, thus far exceeding the limit of 75 subjects specified in the research protocol and approved by the IRB. In cases such as these, the possibility exists that a researcher could selectively report favorable results. Third, experts we interviewed raised concerns about the independence of IRB reviews. For example, they told us that close collegial ties with researchers at their institutions, pressures from institution officials to attract and retain government or corporate research funding, financial ties to the research study, and reluctance to criticize studies led by leading scientists can compromise the independence of IRB reviews. Although most experts we interviewed agreed that instances of these problems occur, they did not have enough evidence to determine the frequency or the extent of the problem. Finally, some IRBs are viewed by their institutions and by researchers as a low-priority administrative hurdle. As a result, these IRBs have difficulty securing the administrative and computer support they require. For example, OPRR has found instances of IRB staff working in office space insufficient to conduct review board business effectively, manual filing systems too primitive to ensure that continuing reviews were conducted at the required times, and lack of privacy for IRB staff to take the sensitive telephone calls of subjects who may want to register complaints. At such institutions, researchers may not always follow IRB requirements, such as revising informed consent forms or reporting adverse events. Various Factors May Hamper OPRR Oversight OPRR’s reliance on the assurance process for preventing the violation of human subject protections requires that OPRR have sufficient basis for judging an institution’s ability to satisfy human subject protection requirements. At times, however, OPRR’s assurance negotiation process falls short of that goal. OPRR staff are rarely direct observers of the institutions they oversee. They make no site visits during assurance negotiations, but instead review solely an institution’s written application and conduct written or oral follow-up. Usually, document review does not include an examination of the manuals that detail the human subject protection procedures that the institution requires its IRBs and researchers to follow. Similarly, almost all of OPRR’s compliance investigations— reviews in response to allegations of misconduct—are carried out through correspondence. In the 5 years preceding April 1995, OPRR made 15 site visits as part of the 202 compliance investigations it completed. What OPRR has found in its site visits made in the course of investigating allegations of violations illustrates the value of such visits. For example, when we accompanied OPRR on a compliance site visit to a major research university, OPRR learned details about the institution’s IRB operations and reporting chain idiosyncrasies that it was previously unaware of despite having reviewed the institution’s assurance documents. This visit resulted in the temporary suspension of the human subject research under the surveillance of one of the university’s two IRBs. OPRR officials told us that they lack the time and funds for more site visits for assurance negotiations or compliance. They acknowledged, however, that when they did make site visits, their investigations were significantly enhanced by communicating face-to-face with officials, researchers, and the administrative staff assigned to the institution’s IRB. On-site investigations have also been more thorough and expeditious because OPRR had ready access to study files and IRB records and could quickly follow leads. Site visits also provided OPRR the opportunity to educate institutional staff about ethical conduct practices by enabling OPRR staff to be immediately available to discuss and answer questions about human subject protection issues. Through these exchanges, OPRR staff learned about problems, such as those with continuing review, that other institutions could be experiencing. Experts we interviewed also said that OPRR’s prevention efforts would be more effective if it were to make site visits to institutions in the process of approving and renewing assurances. In addition, NIH’s organizational structure may hamper OPRR’s independent oversight and enforcement of human subject protection regulations, although we found no specific instance in which this occurred. Although OPRR is located within the Office of Extramural Research, OPRR is responsible for enforcing compliance with human subject protection regulations for research conducted or supported by both the Office of Intramural Research and the Office of Extramural Research. Under this structure, the OPRR Director reports to the Deputy Director for Extramural Research, who, in turn, reports to the Director of NIH. Because the Deputy Director for Intramural Research also reports to the Director of NIH, OPRR has no direct authority over the research conducted by the intramural program. As a result, when OPRR cited NIH’s Office of Intramural Research in 1991 for compliance violations, for example, OPRR had to depend on that office’s good will and professional conduct to implement the corrective action plan proposed by OPRR, since OPRR did not have direct authority to require NIH to correct violations. According to OPRR, NIH will complete implementation of the plan by April 1996, 5 years after the problems were noted. From a broader organizational perspective, a potential weakness exists because NIH is both the regulator of human subject protection issues as well as an institution conducting its own human subject research. The Director of NIH, therefore, has responsibility for both the success of NIH’s intramural research program and for the enforcement of human subject protection regulations by OPRR. FDA Oversight Has Certain Limitations In some instances, FDA’s oversight efforts may permit violations of human subject protections to go undetected. For example, researchers who use human subjects in drug research are required to submit to their sponsor periodic progress reports during the course of the trials. These reports include adverse events, project status, and changes to the research protocol. The sponsor, in turn, reports adverse events to FDA. The reporting process, however, is a passive one in which FDA relies on researchers and their sponsors to report potential or actual adverse medical events during clinical trials. Violations of subjects’ rights, such as inadequate informed consent or IRB review, however, are not required to be reported. Two gaps in FDA’s inspection of drug studies have implications for human subject protections. First, FDA only conducts routine on-site inspections after clinical trials have concluded and subjects have completed their participation. Second, FDA officials told us that because of resource limitations, FDA does not inspect all studies; instead, it concentrates its efforts on those products that both are likely to be approved for consumer use and could pose high risk to consumers. FDA officials told us that the primary reason for these inspections is to review the integrity of the study’s data before initiating a review of the drug’s safety and effectiveness. In essence, then, FDA’s inspection program is geared more toward protecting the eventual consumer of the drug than the subjects on whom the drug was tested. Gaps also exist in FDA’s inspection of IRBs. CDER annually issues the results of about 158 inspections of the approximately 1,200 IRBs reviewing drug studies, although its goal has been to complete and issue reports on about 250 inspections each year. We found that in one of FDA’s 21 districts—a district that contains several major research centers conducting studies with human subjects—12 IRBs had not been inspected for 10 or more years on behalf of CDER, CBER, or CDRH. Furthermore, although FDA’s policy is to accelerate the timetable for reinspecting IRBs found to have significant problems, we noted instances in which FDA conducted its reinspection 3 to 5 years later. FDA officials told us that, because of resource constraints, IRB inspections receive lower priority than inspections of FDA-regulated products or manufacturing practices. Finally, experts we interviewed raised concerns about the unevenness of FDA inspectors’ expertise, which they believe could enable human subject protection violations to go undetected. FDA officials acknowledge that some inspectors may be inadequately prepared to understand the human subject protection implications of drug studies and to ask meaningful follow-up questions on the research protocols they review. FDA officials also noted that some inspectors lack practical experience in reviewing drug studies because they work in districts with few bioresearch sites and therefore usually inspect other types of regulated products. Other Pressures in the Research Environment May Weaken Oversight Effectiveness Several additional pressures make guaranteeing the protection of human subjects difficult. Many of the experts we interviewed raised concerns about the growing complexity of science, the increasing number of multicenter trials, and the vulnerability of certain subject populations. The extent of these problems, however, has not been studied. First, the increasing complexity of research makes it difficult for IRBs to assess human subject protection issues when members are not conversant with the technical aspects of a proposed study. In such cases, the IRB’s ability to assess the risks or benefits posed to subjects and the adequacy of language found in the consent document is questionable. In addition, cutting edge science can present new ethical dilemmas for IRBs to confront. Experimental human reproductive techniques and ownership of genetic material, for example, have raised ethical questions that thus far have not been satisfactorily resolved. Second, the growing number of large-scale trials carried out at multiple research sites presents other problems for IRBs, both at initial and continuing review. Proposals for multicenter trials are reviewed by an IRB associated with each local research site. If most involved IRBs have approved a proposed study—that is, determined that the study is safe, ethical, and appropriately described in consent forms—then remaining IRBs at other institutions may feel pressured to mute their concerns about the study. Furthermore, during the course of a multicenter trial, each participating IRB receives numerous reports of adverse events from other research sites. Because of the volume of reports, IRB members may have difficulty discerning which adverse events are both relevant and serious enough to warrant their taking note of them. “...patient-subjects who have serious illnesses may have unrealistic expectations both about the possibility that they will personally benefit by being a research subject and about the discomforts and hardships that sometimes accompany research.” Volunteers who want to be included in biomedical or behavioral studies because they believe in the advancement of science or because researchers offer financial incentives are another group whose personal stake in the research may go unnoticed by IRBs and researchers, thereby weakening oversight. Fourth, an inherent conflict of interest exists when physician-researchers include their patients in research protocols. If the physicians do not clearly distinguish between research and treatment in their attempt to inform subjects, the possible benefits of a study can be overemphasized and the risks minimized. Fifth, pressures to recruit subjects can lead researchers and IRBs to overlook deficiencies in efforts to inform subjects of potential risks. This problem has been exacerbated, a consultant to IRBs told us, by NIH and FDA guidelines that now require that subjects selected for the studies over which the agencies have jurisdiction reflect the gender and racial composition of potentially affected populations. These guidelines are in place for the purpose of generalizing research results to the widest possible range of population groups. Finally, the line between research and medical treatment is not always clear to clinicians. Controversy exists regarding whether certain medical procedures should be categorized as research. For example, in some cases physicians may use an innovative but unproven technique to treat patients without considering the procedure to be research. From the standpoint of the physicians, they are providing treatment to individual patients rather than conducting a clinical trial. Given this view, they do not seek IRB approval. From the standpoint of experts we interviewed, however, such treatments could constitute unregulated research and place people at risk of harm from unproven techniques. Conclusions With the issuance of federal regulations covering much human subject research and the maturation of the HHS oversight system, researchers have become more aware of ethical conduct standards and more often comply with them. Because no oversight system can be designed to guarantee complete protection for each individual, holes inevitably exist in the regulatory net. Federal and IRB reviewers rarely observe the interaction between researchers and subjects during the informed consent process or throughout the course of the study. Whether research institutions are examined by OPRR for eligibility to receive HHS funding, research studies are assessed by IRBs for their compliance with HHS regulations, or applications to conduct drug trials are reviewed by FDA, oversight is present, but at a distance. There is consensus among experts and regulators about the benefits of first-hand review, but continuous on-site inspections of every research institution and its studies are neither feasible nor desirable because of the regulatory burden this would impose on both the research community and regulators. Finding the balance, however, between that extreme and a process that relies almost exclusively on paper reviews is the fundamental challenge facing regulators and IRBs in the current HHS oversight system. Individuals participating in biomedical and behavioral research are essential to the advancement of science and medicine. Federal regulators and research institutions, therefore, continually strive to improve the protection of human participants without imposing an unwieldy, burdensome regulatory apparatus. To continue to prevent the occurrence of human subject protection violations and to identify and correct violations that do occur remain essential objectives of the system. Given the many pressures that can weaken the effectiveness of the protection system, continued vigilance is critical to ensuring that subjects are protected from harm. Agency Comments NIH and FDA reviewed a draft of this report and provided comments, which are reproduced in appendixes III and IV. NIH and FDA found the report to be generally accurate and suggested revisions to clarify specific aspects of our discussion of the human subject protection system. We incorporated these as appropriate, basing the changes in some instances on further discussions with officials from each agency. In its comments, NIH recognized the importance of on-site visits to research institutions by OPRR staff and noted that the number of technical assistance visits would be increased to 12 to 24 per year. This action should help strengthen human subject protection efforts by institutions and investigators as well as improve OPRR’s assurance, monitoring, and enforcement efforts. In its comments, NIH also stated that OPRR’s independent oversight and authority to enforce human subject protection regulations within NIH are not compromised by OPRR’s location within the NIH organizational structure. NIH said that the lines of authority of the NIH Deputy Director for Intramural Research and the OPRR Director do not cross within NIH and, therefore, that OPRR’s authority is not compromised. We disagree with NIH’s conclusion and believe that a potential weakness exists in OPRR’s ability to enforce human subject protection regulations within NIH. This weakness results from the chain of command within NIH and the NIH Director’s dual responsibilities for the success of the intramural research program and OPRR’s enforcement of human subject protection regulations. We have amplified our discussion of these issues in the report. In its comments on our draft report, FDA raised concerns that our work understates FDA’s accomplishments and the efforts to protect human subjects of product testing by the industries regulated by FDA. Because human subject protection activities in drug research account for most of FDA’s efforts in this area, we limited the scope of our work to an examination of CDER’s oversight. We have modified the report to acknowledge the human subject protection activities of the Center for Biologics Evaluation and Research and the Center for Devices and Radiological Health. Furthermore, we have clarified that the inspection reports and actions to enforce regulations we discuss are for CDER’s oversight of IRBs and drug studies, and we have included additional information FDA provided on fiscal year 1995 activities. FDA also focused on our presentation of aspects of its IRB inspection programs. FDA commented that (1) the IRB inspection program is the principal way in which FDA addresses the issue of human subject protection, (2) IRB inspections can enhance protection for subjects in specific studies, and (3) an IRB inspection conducted for one center—for example, CDER—can serve to protect subjects in studies regulated by CBER and CDRH. We have modified the report to address these points. As agreed with your office, unless you publicly announce its contents earlier, we plan no further distribution of this report until 7 days from the date of this letter. At that time, we will send copies of this report to the Secretary of HHS, the Director of NIH, the Commissioner of FDA, and other interested parties. This report was prepared under the direction of Mark V. Nadel, Associate Director for National and Public Health Issues. If you or your staff have any questions, please call me at (202) 512-7119 or Bruce D. Layton, Assistant Director, at (202) 512-6837. Other major contributors to this report include Frederick K. Caison, Linda S. Lootens, and Hannah F. Fein. Scope and Methodology We focused our work on the Department of Health and Human Services (HHS)—the federal department sponsoring biomedical and behavioral research with the largest human subject research budget, over $5 billion in fiscal year 1995. Within HHS, we examined the policy and oversight roles of the two entities with primary responsibility for protecting human research subjects: the National Institutes of Health’s (NIH) Office for Protection from Research Risks (OPRR) and the Food and Drug Administration (FDA). OPRR is responsible for enforcing compliance with HHS human subject protection regulations when human subject research is conducted or supported by HHS. FDA is responsible for protecting the rights of human subjects enrolled in research with products it regulates—drugs, medical devices, and biologics. We limited our review to FDA’s Center for Drug Evaluation and Research (CDER) because drug research is the largest segment of biomedical research. Because of this volume, FDA conducts more oversight activities in the drug products area than it does for medical devices and biological products, with CDER carrying out most of FDA’s human subject protection activities. Although FDA’s Center for Biologics Evaluation and Research and Center for Devices and Radiological Health also have programs to protect human subjects, these Centers were not included in our review. To gather information about the federal role in protecting human subjects, we interviewed NIH, OPRR, and FDA officials and reviewed regulations, policies, procedures, guidelines, and educational materials the entities provide to institutional review boards (IRB) and researchers. To learn about the nature of OPRR findings and corrective actions, we reviewed 40 of the 166 compliance case files handled by OPRR from 1988 through March 1995, including 30 files we randomly selected and 10 files OPRR officials selected as representing the most serious violations. We accompanied OPRR staff on a compliance site visit to a major research institution and reviewed OPRR site visit reports from compliance visits conducted from September 1990 through December 1994. We also reviewed examples of inspection files, 69 of the 84 letters describing deficiencies that FDA issued to drug researchers from April 1980 through November 1995, and all 31 Warning Letters issued to IRBs regarding their oversight of drug research between January 1993 and November 1995. In addition, we reviewed correspondence between FDA and institutions in cases where FDA inspections found that IRBs did not comply with human subject protection regulations. To examine how local level protections work, we reviewed the professional literature, including the reports of presidential and congressional commissions; interviewed research institution officials, IRB members, and researchers; and reviewed research documents, such as institutional guidelines for IRBs and researchers, IRB minutes, and informed consent forms. We attended an IRB meeting to observe an IRB review of proposed research. We interviewed numerous experts from across the nation with experience in bioethics, medicine, social science, law, and human subject protection issues. These experts included university and hospital researchers, subjects’ rights advocates, IRB members, human subject protection consultants, and representatives from the drug industry. We performed our field work from September 1994 to December 1995 in accordance with generally accepted government auditing standards. Landmark Events Affecting the Development of HHS’ Human Subject Protection System HEW issues first federal human subject protection regulations. President orders creation of National Bioethics Advisory Commission. Congress enacts National Research Act (P.L. 93-348) requiring written assurances from research institutions and IRB review. Presidential Advisory Committee on Human Radiation Experiments formed to investigate Cold War radiation experiments. National Commission established by Congress to make recommendations on bioethical issues. Fifteen other federal agencies adopt regulations based on the core of the HHS regulations, known as the Common Rule. NIH institutes require awardees to provide statement of responsibilities for conduct of hazardous research. HHS and FDA human subject protection regulations made substantially identical. Surgeon General issues subject protection policy for all Public Health Service-supported research. HHS adopts regulations for research involving fetuses, pregnant women, human in vitro fertilization, and prisoners. HHS adopts regulations for research involving children. Public Health Service concedes that in a 40-year study in Tuskegee, Alabama, treatment was withheld from black men with syphilis. Previously classified Cold War- era human radiation experiments revealed. Advisory Committee on Human Radiation Experiments reports deficiencies in current human protection system and recommends specific improvements. Human radiation experiments at University of Cincinnati in which adequacy of informed consent is questioned. Study commissioned by NIH finds that few research institutions have effective subject protections. Unsuspecting patients given investigational drug thalidomide, causing severe birth defects in children. Comments From the National Institutes of Health Comments From the Food and Drug Administration The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 6015 Gaithersburg, MD 20884-6015 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (301) 258-4066, or TDD (301) 413-0006. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists. SUMMARY: [/INST] Pursuant to a congressional request, GAO reviewed the federal oversight systems for protecting human subjects in federally sponsored scientific experiments, focusing on whether the oversight procedures: (1) have reduced the likelihood of abuses of human subjects; and (2) have weaknesses that could limit their effectiveness. GAO found that: (1) federal efforts to prevent the abuse of human research subjects include establishing institutional review boards, educating the research community, and requiring written commitments from researchers to comply with standards for the protection of human subjects; (2) although these efforts work to prevent harm to participants in most experimental studies, the effectiveness of those standards in ensuring compliance has not been systematically studied; (3) federal monitoring activities for the protection of human research subjects include on-site inspections and reviews of study documentation, institutional review board operations, and allegations of misconduct; (4) actions to enforce the human research subject protection requirements include research restrictions, researcher disqualification, criminal prosecution, and suspensions from conducting further research; and (5) the oversight procedures are impaired by institutional review boards' heavy workloads and competing demands, limited funds for on-site inspections, the complexity and volume of research under review, and reliance on researchers' self-assurances that they are complying with requirements. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Alex Greig. A 17-year-old girl is lucky to be alive after falling out of a moving party bus that was making its way to her high school prom onto a California highway. The unusual sight of young people in formal wear running across the southbound lanes of the 73 Freeway greeted alarmed Orange County drivers on Saturday at around 7:30pm as friends of Charlotte Boyse rushed to her aid. The Corona Del Mar High School student was on her way to Mission Viejo with 55 other teens to their prom when a window on the bus suddenly opened and she fell out onto the road. Prom night in hospital: Charlotte Boyse was lucky to survive a fall from a bus taking her to her high school prom Saturday. The Orange County Register reports that Boyse leaned back against a window for someone to squeeze past her when it popped open. Two of her friends tried to grab onto Boyse when they realized what was happening, and managed to pull her upright so that she didn't fall on her head, possibly saving her life. The two girls grabbed Charlotte and 'prevented her from landing on the back of her head, and instead righted her so she landed on her backside,' Conrad Boyse told the Register. Shockingly, the driver of the bus was oblivious to Boyse's accident and despite pleas from students to stop, continued driving for about a quarter mile. Quick-thinking: Two friends grabbed Boyse (circled in this pre-accident prom photo) as she fell from a bus window, managing to pull her upright so that she fell on her backside rather than her head, possibly saving her life. Freeway fall: Boyse, seen in her hospital bed with friend Payton Gronnerud, crawled to the median and managed to avoid being hit by a car, suffering only cuts and grazes. Multi-lane freeway: Witnesses say Boyse crawling across this stretch of road to the median, and police say it was fortunate she fell early on Saturday night when traffic was light. When he did stop, he wouldn't let students off the bus on the freeway, so several students jumped out of the open window Charlotte Boyse had fallen from and ran to help her. The students didn't know if Boyse was dead or alive. The girl had. managed to get herself to the median where she had waited for about 10. minutes before being able to flag down a couple who called 911. A driver who was about 20 seconds behind the bus saw a girl crawling across the road toward the center divider and other students running towards her. 'I noticed a girl kind of crawling off the freeway, into the center-divider area, and there were, I think, two boys, at that point, who were just getting to her,' witness Colleen Kreuger told KTLA. 'I was running toward where the girl was, and one of the boys started heading toward me. I asked him what had happened. He said, "My friend fell out of the window of the bus."' A prom to remember: Boyse was released from hospital Sunday after spending prom night in hospital with some friends who elected to stay with her. Boyse suffered serious cuts and abrasions but initially felt no pain. 'I was in complete shock,' she said. 'My shoe broke off, my phone flew from me.' She was taken by ambulance to the Children's Hospital of Orange County and released late Sunday. Several of Boyse's friends skipped prom to spend the night in hospital with her, and Conrad Boyse is eternally grateful to the girls who helped his daughter. 'She would unquestionably be dead without them,' he told the OC Register. 'We are so grateful for the quick thinking and heroic actions of these kids, and for the outpouring of love and support for Charlotte.' Boyse's parents said the teens were not drinking, and no alcohol was found on the bus. The bus was rented by about 30 couples attending the prom from a company in Anaheim called Party Bus Limo Rentals. KCal9 News reports that a spokesperson for the company said the bus had gone through safety checks before picking the teens up for prom SUMMARY: [/INST] Charlotte Boyse, 17, was on her way to prom in a party bus with 55 other students. She leaned back against a window to let someone pass her and it popped open. Boyse fell backwards and was grabbed by friends who managed to right her, preventing her falling on her head. She fell onto the freeway and miraculously avoided being hit by a car as she made her way to the median. The driver of the bus didn't believe other students that she'd fallen, only stopping after another quarter-mile. Boyse flagged down a car and the driver called 911. She suffered only minor cuts and abrasions and spent prom night in hospital. Boyse's parents said the teens were not drinking, and no alcohol was found on the bus. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Tax Incentives Relative to Energy Production The following sections estimate the value of tax incentives relative to the level of energy produced using fossil and renewable energy resources. Before proceeding with the analysis, some limitations are outlined. The analysis itself requires qu antification of energy production and energy tax incentives. Once data on energy production and energy tax incentives have been presented, the value of energy tax incentives can be evaluated relative to current levels of energy production. Limitations of the Analysis The analysis below provides a broad comparison of the relative tax support for fossil fuels as compared to the relative support for renewables. Various data limitations prevent a precise analysis of the amount of subsidy per unit of production across different energy resources. Limitations associated with this type of analysis include the following: Current-year tax incentives may not directly support current-year production Many of the tax incentives available for energy resources are designed to encourage investment, rather than production. For example, the expensing of intangible drilling costs (IDCs) for oil and gas provides an incentive to invest in capital equipment and exploration. Although the ability to expense IDCs does not directly support current production of crude oil and natural gas, such subsidies are expected to increase long-run supply. Differing levels of federal financial support may or may not reflect policy rationale s Various policy rationales may exist for federal interventions in energy markets. Interventions may be designed to achieve various economic, social, or other policy objectives. Although analysis of federal financial support per unit of energy production may help inform the policy debate, it does not directly consider why various energy sources may receive different levels of federal financial support. Tax expenditures are estimates The tax expenditure data provided by the Joint Committee on Taxation (JCT) are estimates of federal revenue loss associated with a specific provision. These estimates do not provide information on actual federal revenue losses, nor do these estimates reflect the amount of revenue that would be raised should the provision be eliminated. Tax expenditure data are not specific to energy source Many tax incentives are available to a variety of energy resources. For example, the tax expenditure associated with the expensing of IDCs does not distinguish between revenue losses associated with natural gas versus those associated with oil. The tax expenditure for five-year accelerated depreciation also does not specify how much of the benefit accrues to various eligible technologies, such as wind and solar. A number of tax provisions that support energy are not energy specific The U.S. energy sector benefits from a number of tax provisions that are not targeted at energy. For example, the production activities deduction (§ 199) benefits all domestic manufacturers. For the purposes of the § 199 deduction, oil and gas extraction is considered a domestic manufacturing activity. Certain energy-related activities may also benefit from other tax incentives that are available to non-energy industries, such as the ability to issue tax-exempt debt, the ability to structure as a master limited partnership, or tax incentives designed to promote other activities, such as research and development. Energy Production The Energy Information Administration (EIA) provides annual data on U.S. primary energy production. EIA defines primary energy as energy that exists in a naturally occurring form, before being converted into an end-use product. For example, coal is considered primary energy, which can be converted to synthetic gas and later electricity. This report relies on 2013 data on U.S. primary energy production (see Table 1 and Figure 1 ). Coal and natural gas are the two largest primary energy production sources, representing 24.4% and 30.5% respectively of primary energy production in 2013. Crude oil constituted 19.3% of primary energy production. Taken together, fossil energy sources were used for 78.5% of 2013 primary energy production. The remaining U.S. primary energy production is attributable to nuclear electric and renewable energy resources. Overall, 10.1% of 2013 U.S. primary energy was produced as nuclear electric energy. Renewables (including hydro-electric power) constituted 11.4% of 2013 U.S. primary energy production. Excluding hydro-electric power, renewable energy resources constituted approximately 8.2% of primary energy production in 2013. Biomass was the largest source of production amongst the renewables in 2013, accounting for 5.6% of overall primary energy production or nearly half of renewable energy production. This was followed by hydro-electric power at 3.1% of primary energy production. The remaining three resources, wind, geothermal, and solar were responsible for 1.9%, 0.3%, and 0.4% of 2013 primary energy production, respectively (see Table 1 and Figure 1 ). Primary energy produced using biomass can be further categorized as biomass being used to produce biofuels (e.g., ethanol) and biomass being used to generate biopower. Of the 4.6 quadrillion Btu of energy produced using biomass, about 2.0 quadrillion Btu, or 43.4%, was used in the production of biofuels., Energy Tax Incentives The tax code supports the energy sector by providing a number of targeted tax incentives, or tax incentives only available for the energy industry. In addition to targeted tax incentives, the energy sector may also benefit from a number of broader tax provisions that are available for energy and non-energy-related taxpayers. These broader tax incentives are not included in the analysis, since tax expenditure estimates do not indicate how much of the revenue loss associated with these generally available provisions is associated with energy-related activities. Joint Committee on Taxation (JCT) tax expenditure estimates are used to tabulate federal revenue losses associated with energy tax provisions. The tax expenditure estimates provided by the JCT are forecasted revenue losses. These revenue losses are not re-estimated on the basis of actual economic conditions. Thus, revenue losses presented below are projected, as opposed to actual revenue losses. The JCT advises that individual tax expenditures cannot be simply summed to estimate the aggregate revenue loss from multiple tax provisions. This is because of interaction effects. When the revenue loss associated with a specific tax provision is estimated, the estimate is made assuming that there are no changes in other provisions or in taxpayer behavior. When individual tax expenditures are summed, the interaction effects may lead to different revenue loss estimates. Consequently, aggregate tax expenditure estimates, derived from summing the estimated revenue effects of individual tax expenditure provisions, are unlikely to reflect the actual change in federal receipts associated with removing various tax provisions. Thus, total tax expenditure figures presented below are an estimate of federal revenue losses associated with energy tax provisions, and should not be interpreted as actual federal revenue losses. Table 2 provides information on revenue losses and outlays associated with energy-related tax provisions between 2010 and 2014. In 2010, the tax code provided an estimated $20.0 billion in support for the energy sector. In 2011, the estimated amount was $22.7 billion. In 2012, the estimated amount was $24.2 billion. Between 2011 and 2012, the cost of excise tax credits for alcohol fuels fell, as the primary tax incentives for ethanol were allowed to expire. Increased outlays for Section 1603 grants, however, served to partially offset this decline. In 2013, the tax code provided an estimated $23.3 billion in support for the energy sector. More than a third of the 2013 total, $8.1 billion, was due to the Section 1603 grants in lieu of tax credits for renewables. In 2014, the estimated amount of tax-related financial support for the energy sector was $16.7 billion. The two largest energy-related provisions, in terms of federal revenue loss, over the 2010 through 2014 period, expired at the end of 2011. Between 2010 and 2014, the Section 1603 grants in lieu of tax credits program cost $24.0 billion. Over the same time period, excise tax credits for alcohol fuels cost $15.8 billion. The expiration of a number of energy-related tax incentives means that, under current law, a substantial shift in balance of energy tax incentives across different types of energy resources is projected to occur (see the section " Energy Tax Incentive Trends " below). In 2014, tax incentives for renewables (including renewable electricity and renewable fuels) constituted an estimated 52.8% of the estimated total revenue loss associated with energy tax provisions. Revenue losses associated with fossil-fuels-related tax incentives were an estimated $4.5 billion, or 26.8% of the estimated cost of energy tax incentives. Fossil Fuels versus Renewables: Relative Production and Tax Incentive Levels Table 3 provides a side-by-side comparison of fossil fuel and renewable production, along with the cost of tax incentives supporting the two types of energy resources. During 2013, 78.5% of U.S. primary energy production could be attributed to fossil fuel sources. Of the federal tax support targeted to energy in 2013, an estimated 20.4% of the value of tax incentives went towards supporting fossil fuels. During 2013, an estimated 11.4% of U.S. primary source energy was produced using renewable resources. Of the federal tax support targeted to energy in 2013, an estimated 57.4% went towards supporting renewables. Energy generated using hydro-electric power technologies might be excluded from the renewables category, as most existing hydro-generating capacity was established in the past (84% of 2010 hydro-electric generating capacity was installed before 1980; 99% was installed before 1996). Thus, there is no current federal tax benefit for most electricity currently generated using hydropower. Further, with many of the best hydro sites already developed, there is limited potential for growth in conventional hydropower capacity. There is, however, potential for development of additional electricity-generating capacity through smaller hydro projects that could substantially increase U.S. hydro-electric generation capacity. Excluding hydro from the renewables category, non-hydro renewables accounted for 8.2% of 2013 primary energy production. During 2013, certain tax expenditures for renewable energy did, however, benefit taxpayers developing and operating hydro-electric power facilities. Specifically, development of hydro-electric facilities has been supported with clean renewable energy bonds (CREBs). Additionally, certain hydro-electric installations may be eligible for the renewable energy production tax credit (PTC) or the Section 1603 grants in lieu of tax credits program. Given that hydro is supported by 2013 tax expenditures, one could also argue that hydro should not be excluded from the renewables category. It may also be instructive to consider incentives that generally support renewable electricity separately from those that support biofuels. Of the estimated $23.3 billion in energy tax provisions in 2013, an estimated $1.6 billion, or 6.9%, went toward supporting biofuels. Excluding tax incentives for biofuels, 50.5% of energy-related tax incentives in 2013 were attributable to renewables. In other words, excluding biofuels from the analysis reduces the share of tax incentives attributable to renewables from 57.4% to 50.5%. Excluding biofuels from the analysis has a smaller impact on renewables' share of primary energy production. When biofuels are excluded, the share of primary energy produced in 2013 attributable to renewables falls by 2.5 percentage points, from 11.4% to 8.9%. In 2013, 10.1% of primary energy produced was from nuclear resources. The one tax benefit for nuclear with a positive tax expenditure in 2013 was the special tax rate for nuclear decommissioning reserve funds. At $1.1 billion in 2013, this was 4.7% of the value of all tax expenditures for energy included in the analysis. Like many other energy-related tax expenditures, the special tax rate for nuclear decommissioning reserve funds is not directly related to current energy production. Instead, this provision reduces the cost of investing in nuclear energy by taxing income from nuclear decommissioning reserve funds at a preferred rate (a flat rate of 20%). Energy Tax Incentive Trends Over time, there have been substantial shifts in the proportion of energy-related tax expenditures benefitting different types of energy resources (see Figure 2 ). From the 1980s through 2011, most of the tax-related federal financial support for renewable energy was for renewable fuels, mainly alcohol fuels (i.e., ethanol). Starting in 2008, the federal government incurred outlays associated with excise tax credits for biodiesel and renewable diesel. The tax credits for alcohol fuels (including ethanol) expired at the end of 2011, while the tax credits for biodiesel and renewable diesel expired at the end of 2014. Thus, after 2014, under current law, there are no projected costs associated with tax incentives for renewable fuels. Expired tax incentives may be extended, however, as part of the "tax extenders." Beginning in the mid-2000s, the cost of energy tax incentives for renewables began to increase. From 2009 onwards, the increased costs associated with incentives for renewable electricity are largely attributable to the Section 1603 grants in lieu of tax credit program. The Section 1603 grant option is not available for projects that began construction after December 31, 2011. However, since grants are paid out when construction is completed and eligible property is placed in service, outlays under the Section 1603 program are expected to continue through 2017. Revenue losses for tax incentives supporting energy efficiency are also projected to decline through 2018. Most of the increase in revenue losses for efficiency-related provisions between 2008 and 2014 was associated with tax incentives for homeowners investing in certain energy-efficient property. The primary tax incentive for energy efficiency improvements to existing homes expired at the end of 2014. Extension of expired tax incentives for energy efficiency would increase the cost of energy efficiency-related tax incentives. As was noted above, much of the projected cost of energy-related tax incentives in the out years is associated with expired or expiring provisions. Costs for certain provisions may extend beyond expiration for a number of reasons. In the case of the Section 1603 grant program, since outlays occur when property is placed in service, costs for this program will continue to be incurred long past its 2011 expiration date. Another example is the renewable energy production tax credit (PTC). The PTC is available for the first 10 years of production from a qualified facility. Thus, property placed in service in 2012 may claim production tax credits through 2022. Even with the expiration of the PTC for wind at the end of 2014, wind energy facilities that were under construction before December 31, 2014, may receive production credits for 10 years after it is placed in service. Revenue losses associated with tax provisions can also extend beyond a provision's expiration when taxpayers are allowed to carry forward unused tax credits, using credits to offset liability in future tax years. Accounting for expired provisions has additional implications for trends in tax-related support for different types of energy resources. Between 2013 and 2018, the cost of tax-related provisions that support renewable energy (both renewables and renewable fuels) is projected to decline from $13.4 billion to $5.0 billion (see Figure 3 ). The majority of the $5.0 billion cost in 2018 is associated with the PTC for wind, which expired at the end of 2014. Thus, in 2018, these incentives will no longer be available for new investments in renewable electricity. Of the $5.0 billion projected cost for renewable electricity provisions in 2018, $4.0 billion is from expired incentives while $1.0 billion is from incentives available for new projects in 2018. Extension of certain tax incentives for renewable energy, such as the production tax credit, would change this analysis. For fossil fuels, the cost of energy-related tax provisions was roughly $5.2 billion in 2013 (see Figure 3 ). This cost is projected to be $4.8 billion in 2018. Most of the tax incentives that support fossil fuels are permanent features of the tax code, and thus are not scheduled to expire. This explains why the projected cost of tax provisions that support fossil fuels is expected to remain relatively steady over the next few years. Subsidies Relative to Production: The Energy Information Administration (EIA) Studies Other studies have examined federal financial support (e.g., "subsidies") across various energy resources. Some of this research is similar to what has been presented thus far, in that it examines federal financial support relative to energy produced across different energy sources. Using an alternative approach, other research has compared the subsidization of different energy resources using effective tax rates (see Appendix B for an overview of effective tax rate studies). In recent years, the Energy Information Administration (EIA) has released studies providing analysis of energy and electricity production subsidies. In this work, the EIA defines subsidies to include spending and tax expenditure provisions. On the spending side, the EIA includes direct expenditures that result in payments to energy producers or consumers as well as energy-related federal research and development (R&D) funding. The EIA analysis also includes certain energy-related federal loan guarantees and federal electricity support programs in their tabulation of federal energy subsidies. On the tax side, the EIA study includes tax expenditures. The analysis presented earlier focuses exclusively on energy subsidies provided through the tax code, and does not examine spending-side energy subsidies. In contrast to the EIA studies, the earlier analysis includes Section 1603 grants in lieu of tax credits as a tax-related provision. EIA lists the Section 1603 grants in lieu of tax credits as a direct expenditure. To estimate energy subsidies per unit of electricity production across different energy resources, the EIA employs the following methodology. First, the EIA defines electricity production that is supported by federal subsidies. Next, the analysis examines all energy subsidies, categorizing these subsidies into those that support electricity production and those that support other uses of energy. The analysis then allocates electricity-related energy subsidies by fuel type. Using this information on electricity production and federal subsidies, the EIA is able determine the share of electricity or energy attributable to a specific fuel, relative to the share of federal financial support received by that fuel. The results of EIA's analyses covering 2013, 2010, and 2007 are summarized in Table 4, Table 5, and Table 6 respectively. Coal continues to be the largest fuel source for electricity and receives a relatively small share of federal financial support. In 2013, 39.0% of generation was from coal, while coal received 6.0% of federal financial incentives. In 2010, 44.9% of generation was from coal, while coal received 10.0% of the total federal financial support for electricity production. In 2007, 47.6% of generation was from coal, while 12.7% of total federal financial support for electricity was provided to coal. The shares of electricity produced using natural gas and petroleum liquids has been trending up in recent years, increasing from 22.5% in 2007, to 25.0% in 2010, to 28.0% in 2013. The share of federal financial support for electricity produced using natural gas and petroleum liquids was 3.4% in 2007, 5.5% in 2010, and 4.0% in 2013. The share of electricity produced using nuclear has remained stable between 2007 and 2013, ranging between 19.4% and 19.6%. Between 2010 and 2013, the estimated share of federal financial support decreased substantially. The share of federal financial assistance for electricity going to nuclear decreased from 21.0% to 10.0% between 2010 and 2013. There were subsidy costs for nuclear loan guarantees in 2010, but not in 2013, which explains this decline. Both the share of electricity produced using renewables and the share of federal financial support for electricity supporting renewables increased between 2007 and 2013. In 2007, 8.8% of electricity generated came from renewable resource. By 2010, this share had increased to 10.3%, and by 2013, to 13.1%. In 2007, 14.9% of federal financial support for electricity went to renewables. In 2010, this figure was 55.3%. In 2013, 72.0% of federal financial support for electricity supported renewables. The increase in the share of federal financial support for renewables is largely due to the Section 1603 grants in lieu of tax credits program. Taxpayers that otherwise would have been eligible for the production tax credit (PTC), and would have received this tax credit over 10 years, may now choose to claim one-time lump sum grants. Investment tax credit (ITC)-eligible taxpayers, including solar, may also claim Section 1603 grants. The EIA studies also evaluate subsidies and support for energy that is not related to electricity production. EIA estimates that in 2013, $5.2 billion of the $29.3 billion in total energy-related subsidies supported fuels used outside the electric-power sector. Non-electricity-related energy subsidies support fuels in the transportation sector, as well as primary end-use consumption or energy in the residential, commercial, and industrial sectors. Table 7, Table 8, and Table 9 summarize EIA's findings on energy subsidies relative to energy production for energy not related to electricity production. Most of the fuel production that is used outside of the electricity sector is natural gas and petroleum liquids (81.7% in 2013). The share of federal financial support for energy not related to electricity production going to natural gas and petroleum liquids fell increased between 2010 and 2013, from 20.7% to 31.8%. The overall value of these subsidies fell, however, from $2.2 billion to $1.7 billion. Overall, federal financial incentives for energy not related to electricity production declined between 2010 and 2013, from $10.4 billion to $5.2 billion. Much of the decrease in federal financial incentives for non-electricity fuels between 2010 and 2013 can be explained by the expiration of certain incentives for biofuels (specifically, ethanol). Federal financial support for non-electricity biomass and biofuels was $7.6 billion (73.2% of federal financial support for non-electricity fuels) in 2010 and $2.3 billion (44.7% of federal financial support for non-electricity fuels) in 2013. Over this same time period, the share of non-electricity fuels produced from biomass or biofuels increased from 3.87 quadrillion Btu to 4.15 quadrillion Btu, with the share of non-electricity energy production attributable to biomass or biofuels declining more than a percentage point, from 10.9% to 9.5%, over the same time period. Although the results of the EIA study are not directly comparable to the analysis of federal tax support across different energy resources presented above, similar patterns emerge. Most federal financial support for energy, through the tax code or otherwise, supports renewables. The majority of energy produced comes from fossil fuels. Despite recent reductions in incentives for biofuels, a large share of federal financial incentives for fuels not related to electricity production continued to go to biofuels in 2013. However, this type of analysis does not indicate whether the distribution of federal financial support across various energy resources is consistent with energy policy goals. Energy policy may be designed to be consistent with certain national security, environmental, or economic objectives that might require that the distribution of federal financial support for energy not be aligned with the distribution of energy production across various energy resources. Concluding Remarks The majority of energy produced in the United States continues to come from fossil energy sources. In recent years, the majority of energy tax incentives have served to benefit renewable energy resources. The data presented in this report illustrate that, relative to production levels, federal financial support for renewable energy exceeds support for fossil sources of energy. However, since the primary tax provisions supporting renewables have expired, tax-related support for renewables has fallen in recent years, and is projected to continue to decline. Variation in the amount of federal financial support relative to energy produced across energy resources may be consistent with various environmental or economic objectives. For example, tax incentives designed to reduce reliance on imported petroleum may be consistent with energy security goals. Tax incentives that promote renewable energy resources may be consistent with certain environmental objectives. Energy tax incentives can also be used to support emerging technologies and encourage commercialization of high-risk innovations. While subsidy per unit of production or subsidy relative to production level calculations may provide a starting point for evaluating energy tax policy, a complete policy analysis might consider why the level of federal financial support might differ across various energy technologies. Comparing Energy Production to Energy Tax Incentives: 2009 and 2010 While the proportion of primary energy production attributable to certain energy resources changes slowly over time, there are often substantial changes in the estimated value of energy-related tax incentives for certain types of energy resources from year to year. For example, in 2009, 77.4% of energy-related tax incentives benefitted renewables ( Table A-1 ). By 2010, the share of energy-related tax incentives attributable to renewables had declined to 68.1% (see Table A-2 ). The primary reason for this decline is that in 2009, "black liquor" qualified for fuels-related tax incentives. Thus, the tax expenditure estimate for tax credits for alcohol fuels was substantially higher in 2009 ($6.5 billion) than in 2010 ($0.1 billion). Annual changes in the estimated cost of energy-related tax incentives can result in substantial year-to-year changes in the proportion of energy-related tax incentives attributable to various energy resources. The value of total tax incentives for renewables excluding hydro-electric power is less than the total value of tax incentives when those available for hydro-power are included. However, the difference is small. JCT estimates that in 2010, the tax expenditures for qualified hydropower under the PTC are less than $50 million. During 2010, two awards totaling $88,000 were paid to hydropower facilities under the Section 1603 grant program. Hydropower has also received less in CREB financing than was awarded to solar and wind technologies. During 2010, the tax expenditure for CREBs was an estimated $0.1 billion across all technologies. An Alternative Method for Evaluating the Value of Energy Tax Incentives across Technologies: The Effective Tax Rate Approach Another way to measure the relative subsidization of various energy resources is to use an effective tax rate approach. Effective tax rates, in the context presented below, are used to evaluate how the tax system affects incentives for capital investment. Lower effective tax rates on capital investment can promote investment in certain sectors. The remainder of this section summarizes the results of a 2010 study analyzing energy-related tax incentives and investment. This study uses the 2007 tax code to evaluate its impact on the inventive to invest in different types of energy capital. As was the case with the EIA study presented earlier, the effective tax rate analysis here does not incorporate energy tax policy changes under ARRA. Nonetheless, this analysis highlights the incentives for investment created by provisions in the tax code related to energy investment and production. What Is an "Effective" Tax Rate The effective tax rates measures the impact of the tax system on investment decisions. In the context of this report, an effective tax rate is defined as. In this equation, is the real before-tax return on the marginal investment and r is the real return paid to investors after taxes. Assume that investors require an after-tax rate of return of 6% for a given investment. Assume next that a project must have a real before-tax rate of return of 9% to cover taxes, depreciation, and payments to investors. Under these conditions, the effective tax rate would be 33%. Negative effective tax rates indicate that the tax code is actually subsidizing investment to the point where taxpayers are willing to accept a before-tax rate of return that is less than the after-tax rate of return for an investment. Effective tax rates provide a single measure for the impact of the tax system on capital investments. Thus, there are many provisions in the tax code that can affect effective tax rates. In the energy sector, depreciation rules, investment and production tax incentives, and tax rules specific to the oil and gas sector are all important in the calculation of effective tax rates. Effective Tax Rates for Energy-Related Capital Investments Effective tax rates in the energy sector suggest that the tax code provides greater incentives for certain types of energy-related capital investments. In 2007, the tax code created the largest incentive for capital investment in solar thermal energy generation facilities. In 2007, solar benefitted from a 30% investment tax credit as well as five-year accelerated depreciation. The 2007 effective tax rate for capital investments in solar thermal was estimated at -244.7% (see Table B-1 ). Wind, which benefitted from the production tax credit (PTC) as well as five-year accelerated depreciation, was estimated to face an effective tax rate of -163.8%. These effective tax rates suggest that the tax code creates strong incentives for direct capital investment in wind and solar energy resources. Overall, the effective tax rates for renewables and nuclear are substantially lower than the effective tax rates for coal and gas. Empirical evidence suggests that energy-related investments may in fact be influenced by tax incentives. Metcalf (2010) finds that investment in wind capacity is "strongly influenced by tax policy." Provisions in the tax code may distort investment decisions for other types of energy resources. The effective tax rate for capital investment in nuclear electric generation (-99.5%) also provides strong investment incentives. The Energy Policy Act of 2005 (EPACT05; P.L. 109-58 ) introduced a production tax credit for new commercial nuclear reactors. Despite these incentives, new nuclear facilities have been slow to develop. Various tax incentives available to the oil and gas industry also influence effective tax rates on oil and gas investment. Effective tax rates on investments made by non-integrated oil and gas firms are lower than for integrated firms. The primary reason for this difference is that non-integrated producers are able to fully expense intangible drilling costs (IDCs) and are able to take advantage of percentage depletion. Integrated producers can only expense 70% of IDCs and must claim cost rather than percentage depletion. SUMMARY: [/INST] The U.S. tax code supports the energy sector by providing a number of targeted tax incentives, or tax incentives only available for the energy industry. As Congress evaluates the tax code and contemplates tax reform, there has been interest in understanding how energy tax benefits are distributed across different domestic energy resources. For example, what percentage of energy-related tax benefits support fossil fuels (or support renewables)? How much domestic energy is produced using fossil fuels (or produced using renewables)? And how do these figures compare? In 2013, the value of federal tax-related support for the energy sector was estimated to be $23.3 billion. Of this, $4.8 billion (20.4%) can be attributed to tax incentives supporting fossil fuels. Tax-related support for renewables was an estimated $13.4 billion in 2013 (or 57.4% of total tax-related support for energy). While the cost of tax incentives for renewables has exceeded the cost of incentives for fossil fuels in recent years, the majority of energy produced in the United States continues to be derived from fossil fuels. In 2013, fossil fuels accounted for 78.5% of U.S. primary energy production. The remaining primary energy production is attributable to nuclear electric and renewable energy resources, with shares of 10.1% and 11.4%, respectively. The balance of energy-related tax incentives has changed over time, and it is projected to continue to change, under current law, in coming years. Factors that have contributed to recent changes in the balance of energy-related tax incentives include The expiration of tax-related support for renewables fuels. Tax-related support for renewable fuels declined substantially after the tax credits for alcohol fuels was allowed to expire at the end of 2011. Other fuels-related incentives also expired at the end of 2014 (although these may be extended as part of the "tax extenders"). The Section 1603 grants in lieu of tax credits program. A major source of tax-related support for renewables in recent years has been the Section 1603 grant program. This program is not available for projects beginning construction after the end of 2011. While outlays for this program increased through 2013, as qualified property was placed in service, outlays for Section 1603 grants have begun to decline. Expired tax incentives for renewables and energy efficiency. Several other incentives for renewables and energy efficiency have expired (again, these may be extended as part of the tax extenders). Since tax-related support for fossil fuels is expected to remain roughly constant under current law, the expiration of renewables- and efficiency-related incentives means the share of tax incentives for these sectors is expected to decline in future years, under current law. While subsidy per unit of production or subsidy relative to production level calculations may be one starting point for evaluating energy tax policy, a complete policy analysis might consider why the level of federal financial support differs across various energy technologies. Tax incentives for energy may support various environmental or economic objectives. For example, tax incentives designed to reduce reliance on imported petroleum may be consistent with energy security goals. Tax incentives that promote renewable energy resources may be consistent with certain environmental objectives. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Travelers who acquire dengue infection are often routes for virus transmission to other regions. Nevertheless, the interplay between infected travelers, climate, vectors, and indigenous dengue incidence remains unclear. The role of foreign-origin cases on local dengue epidemics thus has been largely neglected by research. This study investigated the effect of both imported dengue and local meteorological factors on the occurrence of indigenous dengue in Taiwan. Using logistic and Poisson regression models, we analyzed bi-weekly, laboratory-confirmed dengue cases at their onset dates of illness from 1998 to 2007 to identify correlations between indigenous dengue and imported dengue cases (in the context of local meteorological factors) across different time lags. Our results revealed that the occurrence of indigenous dengue was significantly correlated with temporally-lagged cases of imported dengue (2–14 weeks), higher temperatures (6–14 weeks), and lower relative humidity (6–20 weeks). In addition, imported and indigenous dengue cases had a significant quantitative relationship in the onset of local epidemics. However, this relationship became less significant once indigenous epidemics progressed past the initial stage. These findings imply that imported dengue cases are able to initiate indigenous epidemics when appropriate weather conditions are present. Early detection and case management of imported cases through rapid diagnosis may avert large-scale epidemics of dengue/dengue hemorrhagic fever. The deployment of an early-warning surveillance system, with the capacity to integrate meteorological data, will be an invaluable tool for successful prevention and control of dengue, particularly in non-endemic countries. Dengue outbreaks initiated by international tourists, immigrants, and foreign workers have been reported in numerous developed areas and countries [1], [2], [3]. Nevertheless, the interplay between infected travelers, climate, vectors, and indigenous dengue incidence remains unclear [3], [4]. Historically, the link between imported cases and indigenous cases has been established through phylogenetical analysis and viral sequence comparisons [5], [6]. However, these retrospective studies are not capable of providing timely, relevant information about transmission dynamics, nor do they provide quantitative insight for disease control strategies in a broader context. For example, epidemiological data has indicated that imported dengue cases enter Taiwan almost every month from other countries (Figure 1B) but have not always resulted in local dengue epidemics [6], [7]. This suggests that the timing of imported dengue' s entrance may have considerable effect on domestic dengue epidemics [3], [8]. However, the role of these foreign-origin cases in local dengue epidemics has not yet been quantitatively assessed [9]. The aims of this study were to clarify the relationship between imported dengue, local weather, and domestic epidemics of dengue, and to further identify the role of imported cases (in different phases) during a dengue epidemic in non-endemic areas such as Taiwan. The study used data of all imported and indigenous dengue cases nationwide that had been confirmed by the Centers for Disease Control in Taiwan (Taiwan-CDC) [10], [11], Republic of China (R. O. C.) to investigate the relationship between imported and indigenous dengue, and all concurrent meteorological characteristics with potential for facilitating disease transmission. Dengue, including dengue fever (DF) and dengue hemorrhagic fever (DHF), are notifiable infectious diseases to be reported within 24 hours in Taiwan. Information on these confirmed cases of dengue fever (DF) and dengue hemorrhagic fever (DHF) were obtained from Taiwan-CDC from 1998 to 2007 through dengue surveillance in Taiwan. This surveillance system is made up of three parts: passive, active and semi-active surveillance. In passive surveillance, dengue-like illness reports by health care workers to local health authorities account for most confirmed dengue cases. Active surveillance, including volunteer reporting and fever screenings at international airports (identifying fever cases by infrared thermal scanner, which has been routinely operated by the government since 2003) [5], [6]. In semi-active surveillance, fever cases are investigated in residential areas, schools, and work places with epidemiological linkage, and specimens are taken once confirmed dengue cases are identified. These active and semi-active components, serve to complement and reinforce in support of comprehensive virus detection. Among active strategies, fever screening detects imported dengue cases efficiently [6]. All febrile patients identified through fever screening are required to submit blood samples for testing. In addition, public health professionals at local health authorities monitor suspected cases for the development of dengue-like symptoms/signs until dengue virus infection is excluded [10]. These strategies identify and manage potential dengue cases before they enter into the community. The current definitions for dengue, including DF, DHF and dengue shock syndrome (DSS) in Taiwan have been applied since the 1980s. Cases of “probable DF” are patients with body temperatures ≥38°C and two or more of the following clinical manifestations: headache, retro-orbital pain, myalgia, arthralgia, rash, hemorrhagic manifestations and leucopenia. Cases of “probable DHF” and DSS are further identified based on criteria established by the World Health Organization [12]. Identified probable dengue cases must provide blood specimens for laboratory confirmation tests. These laboratory tests include molecular identification of dengue virus by reverse-transcriptase polymerase chain reaction (RT-PCR) [13], single or paired serum samples testing for dengue-specific IgM seropositives, 4-fold dengue-specific IgG serotiter rises (with the exclusion of Japanese encephalitis virus infection) [12], or virus isolation [14], [15]. Date of onset of dengue illness, age, gender, clinical manifestations, reporting hospital, and laboratory results were all thoroughly documented for each dengue case. Epidemiological questions such as travel history, incubation period, and first day of illness were evaluated to identify the possible origin of dengue infection. “Imported dengue cases into Taiwan” were defined as laboratory-confirmed dengue cases with travel history to endemic countries within 14 days before the date of onset of dengue (based on Taiwan-CDC' s definition) [10]. Confirmed indigenous dengue cases in three epidemic areas in Southern Taiwan [Tainan (TN), Kaohsiung (KH), and Pingtung (PT) ] were investigated. All three areas had identified both Aedes aegypti and Ae. albopictus mosquitoes as vectors for transmitting dengue virus. KH, including both metropolitan Kaohsiung and Kaohsiung County, had served as the location for the majority of Taiwan' s dengue epidemics involving all four serotypes of dengue viruses. Smaller scale epidemics of dengue also occurred in both TN and PT, located adjacent to Kaohsiung. For this study, TN included Tainan City and County, while PT referred to Pingtung City and County. The subtropical climate of southern Taiwan presents an annual hot and rainy summer season lasting from June to August and daily mean temperatures ranging from 18° to 32°C year round. Information on the predominant serotype of isolated dengue viruses in TN, KH and PT (Figure 1C) was obtained from Taiwan-CDC [10]. Taiwan' s dominant serotypes/genotypes of epidemic DENV varied by year and area [6]. However, in 2002, a DENV-2 epidemic attacked all three areas of our study. During our study period, KH had the most frequent occurrence of dengue epidemics, with epidemics of DENV-2 in 1998 and 2001–2003; DENV-1 in 2004; DENV-3 in 2006, and DENV-1 in 2007. TN had four major epidemics, including DENV-3 in 1998 [16], DENV-4 in 2000, DENV-2 in 2002, and DENV-1 in 2007. PT had two major epidemics, including DENV-2 in 2001–2003 and DENV-1/DENV-4 in 2004. We found that local dengue epidemics, with geographical variations in these three areas, only had higher numbers of indigenous cases during certain years. We systematically collected daily weather data for Taiwan that was publicly available through the 26 branch stations of the Central Weather Bureau (http: //www. cwb. gov. tw/). The meteorological variables analyzed in this study were selected after comprehensive evaluation of all available data with biological relevance to vectors or cases of dengue, including daily mean temperature, daily maximum temperature, daily minimum temperature, daily mean relative humidity, daily mean wind speed, daily accumulative rainfall, daily accumulative rainy hours, daily sunshine accumulation hours, daily mean sunshine rate (from sunrise to sunset), and daily sunshine total flux. Unlike weather stations in Tainan and Kaohsiung, Pingtung County' s station is located a far distance from Pingtung City, where the majority of Pingtung' s dengue cases occurred. We therefore used weather data collected by the Environment Protecting Agency (EPA) at their station in Pingtung City. This EPA weather station was only able to provide data regarding daily mean temperature, daily maximum temperature, daily minimum temperature, daily mean wind speed, and daily accumulative rainfall. We then substituted Kaohsiung' s data for Pingtung' s meteorological variables not provided by the EPA because of Pingtung City' s close proximity to Kaohsiung City. All laboratory-confirmed daily dengue cases, according to the date of onset of dengue illness, were summed into total case numbers in bi-weekly intervals for data analysis. The mean value of each meteorological variable was also calculated for each biweekly interval. Abbreviations of all variables analyzed are listed in the Table 1. As the effects of imported dengue and meteorological factors on indigenous dengue logically had a time lag, we thus tested different time lags for each variable from lag 1 up to lag 12 (lag 1 representing two weeks, lag 2 representing four weeks, and so on). Logistic regression was used to analyze the correlation between the occurrence/increase of indigenous dengue and the number of imported cases, as well as the correlation between the occurrence/increase of indigenous dengue and each meteorological variable across various time lags (from 2 weeks to 24 weeks). Poisson regression was used to analyze the correlation between the number of indigenous dengue cases and the number of imported cases, as well as the correlation between the number of indigenous dengue cases and quantitative data of each meteorological variable across time lags from 2 weeks to 24 weeks. Regression with the negative binomial model [17] was used for over-dispersed data. All models were adjusted by area (two dummy variables, area_KH and area_TN), popd (area-specific population density), and sine24 plus cosine24 (the oscillatory sine and cosine functions were used to model seasonal variations of dengue cases [18]). Because the quantitative relationship between indigenous and imported dengue cases may exist only at the onset of local dengue epidemics, we further divided all bi-week intervals into three categories for further analysis: 1) Period of “low intensity transmission”: From March to May during our study period, 94. 44% (170/180) of bi-week intervals during these three months had no indigenous dengue cases in these studied areas. 2) Period of “early phase of outbreaks”: Those bi-week intervals presenting <10 indigenous dengue cases for months excluding March to May. 3) Period of “late phase of outbreaks”: Those bi-week intervals presenting ≧10 indigenous dengue cases. Further information on these regression models are listed in the Text S1. Two-tailed p<0. 05 was regarded as statistically significant. The statistical analysis was conducted using S-PLUS Enterprise Developer Version 8. 0. 4 (TIBCO Software Inc., Palo Alto, CA, USA) and SAS 9. 1. 3 Service Pack 4 (SAS Institute Inc., Cary, NC, USA). Among the 9,910 laboratory-confirmed indigenous dengue cases (mean age ± standard deviation = 45. 63±18. 67 years) from 1998 to 2007,9, 195 (92. 79%) were adults (>15 years old). Cases in study areas accounted for 98. 45% (9,756/9,910) of total confirmed indigenous cases in Taiwan during this period (Figure 1A). Figure 1B indicates that the number of biweekly imported dengue cases in Taiwan significantly increased over time (β = 0. 026±0. 002, p<0. 0001). Comparing local dengue case numbers of the three study areas (TN, KH and PT) in Figure 1D with all of Taiwan' s dengue cases in Figure 1B, Figure 1D serves to illustrate that imported dengue cases entered southern Taiwan almost every month (within one year) without a clear pattern. Indigenous dengue cases, in contrast, exhibited a strong seasonal regularity (Figure 1C). Figure 2 displays estimates of regression coefficients of independent variables (Xs) in the logistical regression model for the “occurrence” of indigenous dengue cases. We found that the variables of the number of imported cases (imported, p = 0. 0023∼0. 0315) and daily maximum/mean/minimum temperatures (tmax/tmean/tmin, p = 0. 0002∼0. 0495) were positively correlated. On the contrary, relative humidity (rh) was negatively correlated with indigenous case occurrences (p<0. 0001∼p = 0. 0433). These findings indicate that an increase in imported cases, in conjunction with warmer and drier weather, is favorable for the occurrence of indigenous dengue. Among other meteorological variables, one sunshine related variable and wind speed did not exhibit consistently significant relationships with indigenous dengue (data not shown). However, Figure 3 reveals that, the influence of both imported cases and weather conditions on the “increase” of indigenous dengue was less significant. In addition, when binary outcomes were replaced with indigenous case counts (Figure 4), the quantitative relationships between imported and indigenous dengue cases became insignificant. In Figure 5, we observed variation in the impact of imported dengue at different epidemic phases (please see definitions in Methods). Using Poisson models, we found that the imported dengue cases were significantly correlated with indigenous dengue with lag 4 (i. e. 8 weeks) only in periods of “low intensity transmission” (Figure 5A). However, this relationship was more statistically significant in the “early phase of outbreaks” (Figure 5B). Imported dengue had their greatest impact on epidemics during this phase. When local epidemics entered a period of “late phase of outbreaks”, these correlations disappeared (Figure 5C), suggesting that imported cases were unlikely to have influence on indigenous cases during this period. These findings may indicate that imported dengue cases initiate local dengue cases almost exclusively during the onset of an epidemic. This study examined all laboratory-confirmed dengue cases detected through a combination of active, semi-active, and passive surveillance, and found that imported dengue are able to serve as an initial facilitator, or spark, for domestic epidemics. Nevertheless, imported dengue cases do not have a noteworthy effect from March to May, during the low transmission period of dengue in Taiwan. When these sparks meet suitable weather conditions, the tinder, local dengue epidemics result. Eventually, this relationship disappears once biweekly indigenous case numbers rise over ten, indicating that a local epidemic has occurred. Our findings thus provide evidence that a significant quantitative relationship between Taiwan' s imported and indigenous dengue case numbers exists solely at the onset of an epidemic and in the context of appropriate meteorological conditions. Because the numbers of imported dengue cases that initiate indigenous cases have been increasing in non-endemic areas such as Taiwan [4], [5], [6], [8] (further supported by the high nucleotide identities of dengue viruses isolated from travelers with travel history to endemic countries [5], [6], [13], [16], [19]), this study ventures to provide epidemiological evidence of the combined impact of both imported dengue and weather conditions on local outbreaks. Climate factors have provided helpful clues for monitoring dengue' s transmission in affected areas [20], [21], [22], [23]. Higher temperature has the effect of shortening the time intervals of extrinsic incubation in the mosquito life cycle [23], [24] and is positively correlated with more occurrences of indigenous dengue in our study. This is consistent with previous findings that demonstrate the suitability of warm or hot weather for the survivorship of adult mosquitoes and, thus, dengue transmission [22], [25]. In addition, although increased rainfall has been shown to increase the number and quality of mosquito breeding sites (as well as the density of resting sites) [21], lower rainfall and relative humidity (RH) were significantly related to indigenous dengue in this study. The correlation between lower RH and indigenous dengue with time lags was also observed in previous studies in Thailand [26], [27]. We explain this phenomenon as follows. Drier conditions may facilitate dengue transmission through the increase of water storage behavior, which result in an increase of breeding sites for Aedes mosquitoes, particularly in areas without reliable water supplies [28], [29], [30]. Although piped water supply is available in 90% of Taiwan (http: //www. water. gov. tw/eng/08statistics/sta_a_main. asp? bull_id=4341), water storage for gardening or agricultural use is popular during water restriction period in the dry season, October to April, in southern Taiwan. In addition, a previous field survey identified water buckets as the most common breeding sites of Ae. aegypti in southern Taiwan [31]. Entomologically, lower RH (50% vs. 90%) aids higher flight speed of female adult Ae. aegypti at temperatures higher than 21 degrees of Celsius [32] thus facilitating dengue transmission. This may explain why both RH and rainfall showed a negative correlation with the number of indigenous dengue (Figure 4) and, that while higher temperatures occurred during July to September in the summer of Taiwan, the number of indigenous dengue cases usually peak in October–November. On the other hand, although the correlation between drier conditions and increased transmission is unlikely to be caused by higher temperatures, we acknowledge that the effects of meteorological factors have a complex relationship. Unlike the consistent negative correlation across lags 3–8 (rain) and lags 4–10 (rainhr) in Figure 4, the positive correlation of “rain” and “rainhr” in Figure 3 occurred only in lag 9, and was therefore most likely a random statistical anomaly rather than a conclusive finding. We believe that weather-based mechanisms that support the proliferation of indigenous dengue therefore need further region-specific investigation and more international collaboration. To the best of our knowledge, this is the first study to simultaneously identify the relationship between indigenous and imported dengue cases in the context of meteorological factors. Our findings provide a highly accurate epidemiological portrait of dengue in Taiwan because of the following components of the research: First, a better surveillance system was instituted to actively rather than passively detect dengue cases. This system was also laboratory-based to minimize confounding infection and manifestations [5], [13], [33], [34]. Second, we avoided a potential bias as a result of delays in dengue notification by analyzing all confirmed dengue cases in accordance to their onset dates of illness rather than their reporting dates. We consider that vector control efforts on dengue cases do not affect outbreak initiation, but rather the size and magnitude of an outbreak. A dengue notification delay of over one month allows for two transmission cycles, and increases the potential for a large outbreak [35]. Vector control operations in Taiwan are unlikely to influence imported cases to initiate local dengue epidemics because they are implemented after case notification [10]. By the time indigenous dengue cases increase, the relationship with imported cases disappear (Figure 5C). Hence, the focus of this study was to verify the correlation between imported dengue and the onset of local dengue epidemics under appropriate weather conditions. In order to construct the best possible regression models to reflect meteorological conditions, we built alternative statistical models to demonstrate the role of imported cases in the onset of dengue epidemics. Previous modeling studies using ARIMA (Autoregressive Integrated Moving Average) found that the number of imported dengue cases was not associated with the incidence of local dengue [9], [36]. ARIMA examined a linear relationship between case numbers of imported dengue cases and incidence of indigenous dengue cases over several time lags. However, the quantitative relationship between imported and indigenous dengue was likely limited to the onset (i. e. early phase) of outbreaks, and was therefore not subject to linear modeling. We believe these conclusions by logistic and Poisson regression models are not only demonstrable in countries with distinct seasonality, but also applicable in non-endemic areas of dengue. However, meteorological conditions may need to be modified for countries in higher altitudes. Under suitable weather conditions, dengue viruses introduced via travelers are likely to result in further domestic spread and subsequent occurrence of epidemics. In addition, the introduction of more virulent genotypes of dengue viruses has been documented as a potential factor for driving new epidemics [37], [38], [39]. For example, Thai strains belonging to the 1980–1994 clade within the genotype I of dengue virus serotype 1 (DENV-1) were replaced by a 1990–2002 clade [6]. Additionally, an old clade in genotype I of DENV-3 during 1976–1978 was also replaced by a new 1991–2002 clade in genotype II [5], [6]. Furthermore, cosmopolitan genotypes of DENV-2, the causing agent of Taiwan' s largest-scale epidemic of dengue/DHF in last thirty years, had been gradually and effectively replacing Asian genotype 2 in the Philippines since 1998 and entered Taiwan in 2001 [40]. This cosmopolitan genotype of DENV-2 is different from the Asian 1 and Asian 2 genotypes of Taiwan' s DENV-2 isolates from 1981 to 1998 and the American/Asian genotype of Taiwan' s isolates in 2005, when the majority of dengue cases were dengue fever [41]. In other words, the more virulent genotypes/strains of the same serotype that have emerged during later years have resulted in more severe and/or larger-scale epidemics of dengue/DHF in many Asian countries [37], [39]. Based on phylogenetic analyses of dengue viruses isolated from imported cases [6] at the micro-level, we find that local dengue epidemics in Taiwan typically originate in South East Asia. It is therefore imperative to establish a stable surveillance system to detect the spread of different genotypes of DENV. Currently, Taiwan' s comprehensive dengue surveillance system is evolving and, hopefully, it may continuously monitor the possible evolution of DENV in SE Asian countries through international collaboration. We believe that global warming may have further impact on the incidence of imported dengue cases and future dengue/DHF epidemics [42]. Advanced research integrating virus displacement and meteorology will be necessary to provide a fuller understanding of both the macro and micro changes contributing to the increasing severity of dengue/DHF epidemics. This study had notable limitations. First of all, meteorology alone does not initiate an epidemic. Herd immunity also plays a decisive role in the spread of disease. Once a new or more virulent genotype/strain of dengue virus is introduced, public health officials should alert the public and implement prevention efforts regardless of meteorological conditions. Second, local entomological data from Taiwan' s entomology surveillance was not included. Non-government scholars do not have access to such data prior to 2002. Furthermore, the data was divided by village or “Li” – the basic administration unit in Taiwan, and was not systematically collected with a standardized process. Therefore, we did not use entomological data because of its lack of consistency and inability to adequately represent the locations covered in our study. Lastly, although socioeconomic status may influence vector habitat [43], it was assumed to be relatively stable during the studied ten years. As an increase in viremic international travelers has caused global DHF case numbers to surge in the past several decades [44], efficient measures have to be instituted to prevent imported dengue cases from igniting local dengue/DHF epidemics. Additionally, it has been previously found that DHF cases with higher viral load [45] appeared when the number of dengue fever cases increased rapidly, particularly in areas with higher dengue clusters [46]. All these findings suggest that the entrance of imported cases, in conjunction with suitable meteorological conditions, may have the potential to precipitate severe epidemics involving more DHF cases. Careful tracking and clinical management of imported dengue cases, along with relevant meteorological information, are able to provide earlier warning signals for emerging indigenous dengue epidemics than current surveillance systems [11], [20]. These early alerts allow for the proper implementation of targeted public health interventions and valuable buffer time for preventing subsequent large-scale epidemics of dengue/DHF locally and in affected countries. Advanced investigation and integration of immunological, virological, meteorological, and entomological findings with prevention/control strategies will support a more comprehensive understanding of the mechanisms that initiate dengue epidemics, and will help guide realistic public health interventions in the era of rapid globalization and climate change [47]. SUMMARY: [/INST] Dengue/dengue hemorrhagic fever is the world' s most widely spread mosquito-borne arboviral disease and threatens more than two-thirds of the world' s population. Cases are mainly distributed in tropical and subtropical areas in accordance with vector habitats for Aedes aegypti and Ae. albopictus. However, the role of imported cases and favorable meteorological conditions has not yet been quantitatively assessed. This study verified the correlation between the occurrence of indigenous dengue and imported cases in the context of weather variables (temperature, rainfall, relative humidity, etc.) for different time lags in southern Taiwan. Our findings imply that imported cases have a role in igniting indigenous outbreaks, in non-endemics areas, when favorable weather conditions are present. This relationship becomes insignificant in the late phase of local dengue epidemics. Therefore, early detection and case management of imported cases through timely surveillance and rapid laboratory-diagnosis may avert large scale epidemics of dengue/dengue hemorrhagic fever. An early-warning surveillance system integrating meteorological data will be an invaluable tool for successful prevention and control of dengue, particularly in non-endemic countries. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Background The President’s national strategy for homeland security and the Homeland Security Act of 2002 provide for securing our national borders against terrorists. Terrorist and criminal watch lists are important tools for accomplishing this end. Simply stated, watch lists can be viewed as automated databases that are supported by certain analytical capabilities. To understand the current state of watch lists, and the possibilities for improving them, it is useful to view them within the context of such information technology management disciplines as database management and enterprise architecture management. Overview of the President’s Homeland Security Strategy and the Homeland Security Act Since the September 11th terrorist attacks, homeland security—including securing our nation’s borders—has become a critical issue. To mobilize and organize our nation to secure the homeland from attack, the administration issued, in July 2002, a federal strategy for homeland security. Subsequently, the Congress passed and the President signed the Homeland Security Act, which established DHS in January 2003. Among other things, the strategy provides for performance of six mission areas, each aligned with a strategic objective, and identifies major initiatives associated with these mission areas. One of the mission areas is border and transportation security. For the border and transportation security mission area, the strategy and the act specify several objectives, including ensuring the integrity of our borders and preventing the entry of unwanted persons into our country. To accomplish this, the strategy provides for, among other things, reform of immigration services, large-scale modernization of border crossings, and consolidation of federal watch lists. It also acknowledges that accomplishing these goals will require overhauling the border security process. This will be no small task, given that the United States shares a 5,525 mile border with Canada and a 1,989 mile border with Mexico and has 95,000 miles of shoreline. Moreover, each year, more than 500 million people legally enter our country, 330 million of them noncitizens. More than 85 percent enter via land borders, often as daily commuters. Overview of the Border Security Process Our nation’s current border security process for controlling the entry and exit of individuals consists of four primary functions: (1) issuing visas, (2) controlling entries, (3) managing stays, and (4) controlling exits. The federal agencies involved in these functions include the Department of State’s Bureau of Consular Affairs and its Bureau of Intelligence and Research, as well as the Justice Department’s Immigration and Naturalization Service (INS), the Treasury Department’s U.S. Customs Service (Customs), and the Transportation Department’s Transportation Security Administration (TSA). The process begins at the State Department’s overseas consular posts, where consular officers are to adjudicate visa applications for foreign nationals who wish to enter the United States. In doing so, consular officials review visa applications, and sometimes interview applicants, prior to issuing a visa. One objective of this adjudication process is to bar from entry any foreign national who is known or suspected to have engaged in terrorist activity, is likely to engage in such activity, or is a member or supporter of a known terrorist organization. Foreign nationals (and any other persons attempting to enter the United States, such as U.S. citizens) are to be screened for admission into the United States by INS or Customs inspectors. Generally, this consists of questioning the person and reviewing entry documents. Since October 2002, males aged 16 or over from certain countries (for example, Iran, Iraq, Syria, and the Sudan) are also required to provide their name and U.S. address and to be photographed and fingerprinted. In addition, airline officials use information provided by TSA to screen individuals attempting to travel by air. As discussed in the next section, requirements for checking a person against a watch list differ somewhat, depending upon whether the person arrives at a land-, air-, or seaport. After foreign nationals are successfully screened and admitted, they are not actively monitored unless they are suspected of illegal activity and come under the scrutiny of a law enforcement agency, such as the Department of Justice’s Federal Bureau of Investigation (FBI). Also, when foreign nationals depart the country, they are not screened unless they are males aged 16 years or over from certain countries referenced above, or are leaving by air. According to TSA, all passengers on departing flights are screened prior to boarding the plane. Figure 1 is a simplified overview of the border entry/exit process. The Role of Watch Lists in the Border Security Process Watch lists are important tools that are used by federal agencies to help secure our nation’s borders. These lists share a common purpose—to provide decisionmakers with information about individuals who are known or suspected terrorists and criminals, so that these individuals can either be prevented from entering the country, apprehended while in the country, or apprehended as they attempt to exit the country. As shown in figure 2, which builds on figure 1 by adding watch list icons and associating them with the agencies that maintain the respective lists, watch lists collectively support nine federal agencies in performing the four primary functions in the border security process. Specifically: When a person applies for a visa to enter the United States, State Department consular officials are to check that person against one or more watch lists before granting a visa. When a person attempts to enter the United States by air or sea, INS or Customs officials are required to check that person against watch lists before the person is allowed to enter the country. In addition, when a person attempts to enter the United States by air, INS or Custom officials check him or her against watch lists provided by TSA prior to allowing him or her to board the plane. Persons arriving at land borders may be checked, but there is no requirement to do so. The exception, as previously discussed, is for males aged 16 or over from certain countries, who are required to be checked. Once a watch list identifies a person as a known or suspected terrorist, INS, Customs, or airline officials are to contact the appropriate law enforcement or intelligence organization (for example, the FBI), and a decision will be made regarding the person’s entry and the agency’s monitoring of the person while he or she is in the country. When a person exits the country by plane, airline officials are to check that person against watch lists. In performing these roles, the agencies use information from multiple watch lists. For example, U.S. National Central Bureau for Interpol officials told us that they provide information to the agencies involved in entry control, exit control, and stay management. President’s Strategy Recognizes Problems with Watch Lists and Proposes Improvements In addition to highlighting the importance of watch lists for border security, the President’s national strategy cites problems with these lists, including limited sharing. According to the July 2002 strategy, in the aftermath of the September 11th attacks it became clear that vital watch list information stored in numerous and disparate federal databases as not available to the right people at the right time. In particular, federal agencies that maintained information about terrorists and other criminals had not consistently shared it. The strategy attributed these sharing limitations to legal, cultural, and technical barriers that resulted in the watch lists being developed in different ways, for different purposes, and in isolation from one another. To address these limitations, the strategy calls for integrating and reducing variations in watch lists and overcoming barriers to sharing the lists. It also calls for developing an enterprise architecture for border security and transportation (see next section for a description of an enterprise architecture). More specifically, the strategy provides for developing a consolidated watch list that would bring together the information on known or suspected terrorists contained in federal agencies’ respective lists. Enterprise Architecture: A Brief Description If properly developed, enterprise architectures provide clear and comprehensive pictures of an entity, whether it is an organization (for example, a federal department, agency, or bureau) or a functional or mission area that cuts across more than one organization (for example, grant management, homeland security, or border and transportation security). These architectures are recognized as essential tools for effectively and efficiently engineering business operations and the systems and databases needed to support these operations. More specifically, enterprise architectures are systematically derived and captured blueprints or descriptions—in useful models, diagrams, and narrative—of the mode of operation for a given enterprise. This mode of operation is described in both (1) logical terms, such as interrelated business processes and business rules, information needs and flows, data models, work locations, and users, and (2) technical terms, such as hardware, software, data, communications, and security attributes and performance standards. They provide these perspectives both for the enterprise’s current, or “as is,” environment and for its target, or “to be,” environment, as well as a transition plan for moving from the “as is” to the “to be” environment. Using enterprise architectures is a basic tenet of effective IT management, embodied in federal guidance and commercial best practices. When developed and used properly, these architectures define both business operations and the technology that supports these operations in a way that optimizes interdependencies and interrelationships. They provide a common frame of reference to guide and constrain decisions about the content of information asset investments in a way that can ensure that the right information is available to those who need it, when they need it. Options for Enterprise Database Structures As discussed in the previous section, enterprise architectures facilitate delivery of the right information to the right people at the right time. To this end, these architectures include data models, or logical representations of data types and their relationships, which are used to engineer physical data “stores,” or repositories. When engineered properly, these data stores are structured in a way that effectively and efficiently supports both shared and unique enterprise applications, functions, and operations. The structure of these data stores, whether they are paper records or automated databases, can take many forms, employing varying degrees of centralization and standardization. Associated with the structures being employed are opportunities and limitations to effective and efficient information exchange and use. Generally, these structures can be viewed along a continuum. At one extreme, databases can be nonstandard, both in terms of metadata and the technologies that manage the data, and they can be decentralized, meaning that they were built in isolation from one another to support isolated or separate, “stovepiped” applications, functions, and operations. In this case, integrating the databases to permit information exchange requires the development of unique, and potentially complex and costly, point-to-point interfaces (hardware and software) that translate the data or bridge incompatibilities in the technology. Further, the sheer number of databases involved can exponentially increase the number of relationships, and thus interfaces, that have to be built and maintained. Structuring databases in this way can quickly evolve into an overly complex, unnecessarily inefficient, and potentially ineffective way to support mission operations. (See fig. 3 for a simplified diagram conceptually depicting this approach to structuring databases.) At the other extreme, databases can be structured to recognize that various enterprise applications, functions, and operations have a need for the same data or sets of data, even though they may need to use them in different ways to support different mission applications, functions, and operations. If engineered properly, these database structures allow for greater use of standards, in terms of both data definitions and technology, and are more centralized, although the option exists to create subsidiary databases— known as data warehouses and data marts—to permit more uniquely configured and decentralized data sources to support specific and unique mission needs. Further, since the core data in these subsidiary databases are received from a corporate database(s), the need for interfaces to translate data or connect incompatible technologies is greatly reduced. Structuring databases in this way can minimize complexity and maximize efficiency and mission effectiveness. (See fig. 4 for a simplified diagram conceptually depicting this approach to structuring databases.) Federal Agencies Maintain Numerous Watch Lists, Containing Varying Types of Data, Used by Many Organizations Terrorist watch lists are developed, maintained, or used by federal, state, and local government entities, as well as by private-sector entities, to secure our nation’s borders. Twelve such lists are currently maintained by federal agencies. These lists contain various types of data, from biographical data—such as a person’s name and date of birth—to biometric data—such as fingerprints. Twelve Federal Watch Lists Are Maintained by Nine Agencies Nine federal agencies, which prior to the establishment of DHS spanned five different cabinet-level departments, currently maintain 12 terrorist and criminal watch lists. These lists are also used by at least 50 federal, state, and local agencies. The above-mentioned departments are the Departments of State, Treasury, Transportation, Justice, and Defense. Table 1 shows the departments, the associated nine agencies that maintain watch lists, and the 12 watch lists. The 12 watch lists support the federal agencies involved in the border security process. Figure 5, which builds on figure 2, provides a graphical representation identifying the name of each of the lists and relating them to the agencies that maintain the lists and are involved in performing the four border security functions: issuing visas, controlling entries, managing stays, and controlling exits. Watch Lists Contain Different Types of Data The 12 watch lists do not all contain the same types of data, although some types are included in all of the lists. At the same time, some types of data are included in only a few of the lists. More specifically, all of the lists include the name and date of birth; 11 include other biographical information (for example, passport number and any known aliases); 9 include criminal history (for example, warrants and arrests); 8 include biometric data (for example, fingerprints); 3 include immigration data (for example, visa type, travel dates, departure country, destination country, country visited, arrival dates, departure dates, and purpose of travel); and 2 include financial data (for example, large currency transactions). Figure 6 shows the data types that are included in each watch list. Watch List Sharing Is Governed by Varying Policies and Procedures Effective sharing of information from watch lists and of other types of data among multiple agencies can be facilitated by agencies’ development and use of well-coordinated and aligned policies and procedures that define the rules governing this sharing. One effective way to implement such policies and procedures is to prepare and execute written watch list exchange agreements or memorandums of understanding. These agreements would specify answers to such questions as what data are to be shared with whom, and how and when they are to be shared. Not all of the nine agencies have policies and procedures governing the sharing of watch lists. In particular, two of the agencies reported that they did not have any policies and procedures on watch list sharing. In addition, of the seven that reported having such policies and procedures, one did not require any written agreements. Further, the policies and procedures of the seven have varied. For example, one agency’s policies included guidance on sharing with other federal agencies as well as with state and local governments, but another’s addressed sharing only with other federal agencies. In addition, each agency had different policies and procedures on memorandums of understanding, ranging from one agency’s not specifying any requirements to others’ specifying in detail that such agreements should include how, when, and where data would be shared with other parties. The variation in policies and procedures governing the sharing of information from watch lists can be attributed to the fact that each agency has developed its own policies and procedures in response to its own specific needs. In addition, the agencies reported that they received no direction from the Office of Homeland Security identifying the needs of the government as a whole in this area. As a result, federal agencies do not have a consistent and uniform approach to sharing watch list information. Federal Agency Watch List Data Sharing and Supporting System Architectures Vary The President’s homeland security strategy and recent legislation call for increased sharing of watch lists, not only among federal agencies, but also among federal, state, and local government entities and between government and private-sector organizations. Currently, sharing of watch list data is occurring, but the extent to which it occurs varies, depending on the entities involved. Further, these sharing activities are not supported by systems with common architectures. This is because agencies have developed their respective watch lists, and have managed their use, in isolation from each other, and in recognition of each agency’s unique legal, cultural, and technological environments. The result is inconsistent and limited sharing. Watch List Sharing Varies According to the President’s homeland security strategy, watch list data sharing has to occur horizontally among federal agencies as well as vertically among federal, state, and local governments in order for the country to effectively combat terrorism. In addition, recent federal homeland security legislation, including the Homeland Security Act, USA PATRIOT ACT of 2001, and the Enhanced Border Security and Visa Entry Reform Act of 2002 require, among other things, increased sharing of homeland security information both among federal agencies and across all levels of government. The degree to which watch list data are being shared is not consistent with the President’s strategy and recent legislative direction on increased data sharing. Specifically, while federal agencies report that they are generally sharing watch list data with each other, they also report that sharing with organizations outside of the federal government is limited. That is, five of the nine agencies reported that they shared data from their lists with state and local agencies, and three reported that they shared data with private industry. Figure 7 visually summarizes the extent to which federal agencies share watch list data with each level of government (federal, state, and local) and with the private sector. As noted above, federal agencies are sharing either all or some of their watch list data with each other. However, this sharing is the result of each agency’s having developed and implemented its own interfaces with other federal agencies’ watch lists. The consequence is the kind of overly complex, unnecessarily inefficient, and potentially ineffective network that is associated with unstructured and nonstandard database environments. In particular, this environment consists of nine agencies—with 12 watch lists—that collectively maintain at least 17 interfaces; one agency’s watch list alone has at least 4 interfaces. A simplified representation of the number of watch list interfaces and the complexity of the watch list environment is provided in figure 8. A key reason for the varying extent of watch list sharing is the cultural differences among the government agencies and private-sector organizations involved in securing U.S. borders. According to the President’s strategy, cultural differences often prevent agencies from exchanging or integrating information. We also recently reported that differences in agencies’ cultures has been and remains one of the principal impediments to integrating and sharing information from watch lists and other information. Historically, legal requirements have also been impediments to sharing, but recent legislation has begun addressing this barrier. Specifically, the President’s strategy and our past work have reported on legal requirements, such as security, privacy, and other civil liberty protections, that restrict effective information sharing. To address this problem, Congress has recently passed legislation that has significantly changed the legal framework for information sharing, which, when fully implemented, should diminish the effect of existing legal barriers. In particular, Congress has enacted legislation providing for agencies to have increased access to other agencies’ information and directing more data sharing among agencies. For example, section 701 of the USA PATRIOT ACT broadened the goals of regional law enforcement’s information sharing to cover terrorist activities. The Enhanced Border Security and Visa Entry Reform Act expanded law enforcement and intelligence information sharing about aliens seeking to enter or stay in the United States. Most recently, the Homeland Security Act provides the newly created DHS with wide access to information held by federal agencies relating to “threats of terrorism” against the United States. Section 891 expresses the “sense of Congress” that “Federal, state, and local entities should share homeland security information to the maximum extent practicable.” Further, section 892 of the Act requires the President to prescribe and implement procedures for the sharing of “homeland security information” among federal agencies and with state and local agencies, and section 895 requires the sharing of grand jury information. Watch List Sharing Is Not Supported by a Common Architecture The President’s homeland security strategy stresses the importance of information sharing and identifies, among other things, the lack of a common systems architecture—and the resultant incompatible watch list systems and data—as an impediment to systems’ interoperating effectively and efficiently. To address this impediment, the strategy proposes developing a “system of systems” that would allow greater information sharing across federal agencies as well as among federal agencies, state and local governments, private industry, and citizens. In order for systems to work more effectively and efficiently, each system’s key components have to meet certain criteria. In particular, their operating systems and applications have to conform to certain standards that are in the public domain, their databases have to be built according to explicitly defined and documented data schemas and data models, and their networks have to be connected. More specifically, critical system components would have to adhere to common standards, such as open systems standards, to ensure that different systems interoperate. One source for open system standards is the International Organization for Standardization. Also, these systems’ data would have to have common— or at least mutually understood—data definitions so that data could, at a minimum, be received and processed, and potentially aggregated and analyzed. Such data definitions are usually captured in a data dictionary. Further, these systems would have to be connected to each other via a telecommunications network or networks. When system components and data do not meet such standards, additional measures have to be employed, such as acquiring or building and maintaining unique system interfaces (hardware and software) or using manual workarounds. These measures introduce additional costs and reduce efficiency and effectiveness. The 12 automated watch list systems do not meet all of these criteria (see table 2). For example, they use three different types of operating systems, each of which stores data and files differently. Overcoming these differences requires the use of software utilities to bridge the differences between systems. Without such utilities, for example, a Windows-based system cannot read data from a diskette formatted by a UNIX-based system. Also, nine of the systems do not have software applications that comply with open system standards. In these cases, agencies may have had to invest time and resources in designing, developing, and maintaining unique interfaces so that the systems can exchange data. Further, five of the systems’ databases do not have a data dictionary, and of the remaining seven systems that do have data dictionaries, at least one is not sharing its dictionary with other agencies. Without both the existence and sharing of these data dictionaries, meaningful understanding of data received from another agency could require an added investment of time and resources to interpret and understand what the received data mean. Moreover, aggregation and analysis of the data received with the data from other watch lists may require still further investment of time and resources to restructure and reformat the data in a common way. Last, seven of the systems are not connected to a network outside of their agencies or departments. Our experience has shown that without network connectivity, watch list data sharing among agencies can occur only through manual intervention. According to several of these agencies, the manual workarounds are labor-intensive and time-consuming, and they limit the timeliness of the data provided. For example, data from the TIPOFF system are shared directly with the National Automated Immigration Lookout System through a regular update on diskette. Those data are then transferred from the National Automated Immigration Lookout System to the Interagency Border Inspection System. The President’ s strategy attributes these differences to the agencies’ building their own systems to meet agency-specific mission needs, goals, and policies, without knowledge of the information needs and policies of the government as a whole. As noted and depicted in figure 6, this approach has resulted in an overly complex, unnecessarily inefficient, and potentially ineffective federal watch list sharing environment. Opportunities Exist for Consolidating Watch Lists and Improving Information Sharing As addressed in the preceding sections of this report, federal watch lists share a common purpose and support the border security mission. Nevertheless, the federal government has developed, maintains, and— along with state and local governments and private entities—uses 12 separate watch lists, some of which contain the same types of data. However, this proliferation of systems, combined with the varying policies and procedures that govern the sharing of each, as well as the architectural differences among the automated lists, create strong arguments for list consolidation. The advantages of doing so include faster access, reduced duplication, and increased consistency, which can reduce costs and improve data reliability. Most of the agencies that have developed and maintain watch lists did not identify consolidation opportunities. Of the nine federal agencies that operate and maintain watch lists, seven reported that the current state and configuration of federal watch lists meet their mission needs, and that they are satisfied with the level of watch list sharing. However, two agencies supported efforts to consolidate these lists. The State Department’s Bureau of Consular Affairs and the Justice Department’s U.S. Marshals Service agreed that some degree of watch list consolidation would be beneficial and would improve information sharing. Both cited as advantages of consolidation the saving of staff time and financial resources by limiting the number of labor-intensive and time-consuming data transfers, and one also cited the reduction in duplication of data that could be realized by decreasing the number of agencies that maintain lists. The President’s strategy also recognizes that watch list consolidation opportunities exist and need to be exploited. More specifically, the strategy states that the events of September 11th raised concerns regarding the effectiveness of having multiple watch lists and the lack of integration and sharing among them. To address these problems, the strategy calls for integrating the numerous and disparate systems that support watch lists as a way to reduce the variations in watch lists and remove barriers to sharing them. To implement the strategy, Office of Homeland Security officials have stated in public settings that they were developing an enterprise architecture for border and transportation security, which is one of the six key mission areas of the newly created DHS. They also reported the following initial projects under this architecture effort: (1) developing a consolidated watch list that brings together information on known or suspected terrorists in the federal agencies’ watch lists, and (2) establishing common metadata or data definitions for electronic watch lists and other information that is relevant to homeland security. However, the Office of Homeland Security did not respond to our inquiries about this effort, and thus we could not determine the substance, status, and schedule of any watch list consolidation activities. Since then, the DHS Chief Information Officer told us that DHS has assumed responsibility for these efforts. Conclusions Our nation’s success in achieving its homeland security mission depends in large part on its ability to get the right information to the right people at the right time. Terrorist and criminal watch lists make up one category of such information. To date, the federal watch list environment has been characterized by a proliferation of systems, among which information sharing is occurring in some cases but not in others. This is inconsistent with the most recent congressional and presidential direction. Our experience has shown that even when sharing is occurring, costly and overly complex measures have had to be taken to facilitate it. Cultural and technological barriers stand in the way of a more integrated, normalized set of watch lists, and agencies’ legal authorities and individuals’ civil liberties are also relevant considerations. To improve on the current situation, central leadership—spanning not only the many federal agencies engaged in maintaining and using watch lists, but also the state and local government and the private-sector list users—is crucial to introducing an appropriate level of watch list standardization and consolidation while still enforcing relevant laws and allowing agencies to (1) operate appropriately within their unique mission environments and (2) fulfill their unique mission needs. Currently, the degree to which such leadership is occurring, and the substance and status of consolidation and standardization efforts under way, are unclear. In our view, it is imperative that Congress be kept fully informed of the nature and progress of such efforts. Recommendations for Executive Action To promote better integration and sharing of watch lists, we recommend that DHS’s Secretary, in collaboration with the heads of the departments and agencies that have and use watch lists, lead an effort to consolidate and standardize the federal government’s watch list structures and policies. To determine and implement the appropriate level of watch list consolidation and standardization, we further recommend that this collaborative effort include 1. updating the watch list information provided in this report, as needed, and using this information to develop an architectural understanding of our nation’s current or “as is” watch list environment; 2. defining the requirements of our nation’s target or “to be” watch list architectural environment, including requirements that address any agency-unique needs that can be justified, such as national security issues and civil liberty protections; 3. basing the target architecture on achievement of the mission goals and objectives contained in the President’s homeland security strategy and on congressional direction, as well as on opportunities to leverage state and local government and private-sector information sources; 4. developing a near-term strategy for implementing the target architecture that provides for the integration of existing watch lists, as well as a longer-term strategy that provides for migrating to a more consolidated and standardized set of watch lists; 5. ensuring that these strategies provide for defining and adopting more standard policies and procedures for watch list sharing and addressing any legal issues affecting, and cultural barriers to, greater watch list sharing; and 6. developing and implementing the strategies within the context of the ongoing enterprise architecture efforts of each of the collaborating departments and agencies. In addition, we recommend that the Secretary report to Congress by September 30, 2003, and every 6 months thereafter, on the status and progress of these efforts, as well as on any legislative action needed to accomplish them. Agency Comments And Our Evaluation In commenting on a draft this report, three of the six departments provided either written (Justice and State) or oral (DHS) comments. The remaining three departments (Defense, Transportation, and Treasury) said that they had reviewed the draft but had no comments. The Office of Homeland Security was also provided with a draft but said that it would not comment. The departments that provided comments generally agreed with our findings and recommendations. They also (1) provided technical comments, which we have incorporated as appropriate in the report, and (2) offered department-unique comments, which are summarized and evaluated below. In his oral comments, DHS’s Chief Information Officer stated that the department now has responsibility for watch list consolidation. Additionally, the Chief Information Officer generally described DHS’s plans for watch list consolidation and agreed that our recommendations were consistent with the steps he described. In light of DHS’s assumption of responsibility for watch list consolidation, we have modified our recommendations to direct them to the DHS Secretary. In its written comments, Justice stated that, in addition to cultural differences, there are other reasons why agencies do not share watch list information, such as national security and civil liberty requirements, and that these requirements complicate the consolidation of watch list information. Justice also stated that, while it agrees that there is a need to establish a common watch list architecture to facilitate sharing, this need should not impede short-term efforts to improve sharing. We agree with Justice’s first point, which is why our recommendations provide for ensuring that all relevant requirements, which would include pertinent national security and civil liberty protections, are taken into consideration in developing our nation’s watch list architectural environment. To make this more explicit, we have modified our recommendations to specifically recognize national security and civil liberty requirements. We also agree with Justice’s second point, and thus our recommendations also provide for pursuing short-term, cost-effective initiatives to improve watch list sharing while the architecture is being developed. (Justice’s comments are reprinted in app. II.) In its written comments, State said that our report makes a number of valuable points concerning the benefits of watch list consolidation, enterprise architecture, and information sharing. However, State also said that our report (1) attributed watch list differences solely to varying agency cultures, (2) seemed to advocate a “one size fits all approach,” and (3) often makes the assumption that software and systems architecture differences necessarily obstruct information sharing. With respect to State’s first point, our report states clearly that watch list differences are attributable not only to varying cultural environments, but also to each agency’s unique mission needs and its legal and technical environments as well. Concerning State’s second point, our report does not advocate a “one size fits all” solution. Rather, our recommendation explicitly calls for DHS to lead a governmentwide effort to, among other things, determine the appropriate degree of watch list consolidation and standardization needed and to consider in this effort the differences in agencies’ missions and needs. Regarding State’s last point, our report does not state or assume that differences in software and system architecture categorically obstruct or preclude information sharing. Instead, we state that those differences requiring additional measures—such as building and maintaining unique system interfaces or using manual workarounds—introduce additional costs and reduce efficiency and effectiveness. (State’s comments are reprinted in app. III.) As agreed with your office, unless you publicly announce its contents earlier, we plan no further distribution of this report until 15 days from the date on the report. At that time, we will send copies of the report to other congressional committees. We will also send copies to the Directors of the Offices of Homeland Security and Management and Budget, and the Secretaries of the Departments of Defense, Homeland Security, Justice, State, Transportation, and the Treasury. Copies will also be made available at our Web site at www.gao.gov. Should you or your offices have questions on matters discussed in this report, please contact me at (202) 512-3439. I can also be reached by E-mail at hiter@gao.gov. An additional GAO contact and staff acknowledgments are listed in appendix V. Objectives, Scope, and Methodology Our objectives were to identify (1) federal databases and systems that contain watch lists, the agencies that maintain and use these watch lists in protecting our nation’s borders, and the kinds of data these watch lists contain; (2) whether federal agencies’ sharing of watch list data is governed by policies and procedures; (3) whether watch lists are (a) being exchanged among federal agencies and between federal agencies and state, local, and private organizations and (b) supported by common system architectures (system hardware, software, and data characteristics); and (4) whether opportunities exist for consolidating watch lists. The scope of our work was based on the federal government’s agency structure before the formation of the Department of Homeland Security. We focused on the agencies that use or maintain watch lists in performing border security functions. We identified these departments and agencies through discussions with federal government officials knowledgeable about the U.S. border security mission area. The specific departments and agencies included in our scope were: U.S. National Central Bureau for Interpol Bureau of Intelligence and Research Air Force Office of Special Investigations Transportation Security Administration. To address our objectives, we surveyed each of the agencies cited above, using a data collection instrument. To develop this instrument, we reviewed, among other things, past GAO and other reports on watch lists and on the border security process, along with relevant guidance on such topics as systems interoperability, enterprise architecture management, database management, and information sharing. We used this research to develop a series of questions designed to obtain and aggregate information necessary to answer our objectives. We then incorporated these questions into the questionnaire (see app. IV for a copy of the questionnaire). We pretested the questionnaire at two federal agencies, made adjustments based on the pretest, and then transmitted it to the agencies cited above on July 29, 2002. Responses from agencies were received from August 2002 through October 2002. We did not independently verify agency responses. However, we did contact agency officials when necessary to clarify their responses. Next, we compiled the agencies’ responses to determine the number of watch lists being used, confirm the universe of agencies that have lists, and determine the number of organizations that use the lists and the kinds of data the lists contain. We also analyzed the agencies’ policies and procedures governing watch list sharing. In addition, we reviewed the survey responses to determine the degree of sharing among federal, state, local, and private-sector entities, and we compared the extent of sharing with the sharing goals contained in the President’s homeland security strategy and the Homeland Security Act of 2002. Moreover, we aggregated the agencies’ descriptions of their watch list systems architectures and analyzed them to identify similarities and differences. We also analyzed the architectural components of the watch list systems and compared them with the standards required for systems to interoperate and share data efficiently and effectively. Finally, we analyzed the agencies’ responses on watch list consolidation, to identify whether there were opportunities for consolidating watch lists and, if so, what the benefits were of doing so. Additionally, we reviewed the President’s homeland security strategy, homeland security legislation and agency budget requests, and other public documents to identify federal government efforts related to maintaining and sharing watch lists. We also attended conferences and other public events at which Office of Homeland Security officials spoke on homeland security enterprise architecture and watch list standardization and consolidation efforts. We attempted to meet with Office of Homeland Security officials, but they declined to meet with us. As a result, we submitted written questions to the Office of Homeland Security, but received no response. We conducted our work at the headquarters of the nine federal agencies identified above, in and around the Washington, D.C., metropolitan area, from July 2002 through March 2003, in accordance with generally accepted government auditing standards. Comments from the Department of Justice Comments from the Department of State GAO’s Survey Instrument The U.S. General Accounting Office (GAO), an we may have about your survey responses. Please note investigative agency of Congress, is studying federal that parts II, IV, and V should be answered for each agency “watch lists.” Our objectives are to identify: watch list developed, maintained, or used by your (1) databases and systems that contain watch lists of agency. Additional survey pages are provided at the domestic and international terrorists and criminals; end of the survey if you have more than one watch list. (2) agencies that maintain and use these databases and systems; (3) policies and procedures that govern the sharing of watch list data; (4) the kinds of data that are currently being exchanged among federal, state, and local governments and private sector firms and associations; (5) the architectural characteristics of watch list databases and systems; and (6) opportunities for consolidating these databases and systems. Fax: (202) 512-6450 to U.S. national security and welfare. Security Officer, at the GAO address given at the end and/or the databases and systems in which they reside of the survey. Ms. McGhee can be contacted at (202) could be productively consolidated. Please provide the 512-8116 if you have any questions or concerns. What is your agency’s definition of a “known or suspected domestic and/or international terrorist or criminal.” 4. Other (please specify): _________ 2. Is this list maintained electronically, manually (on paper), or by a combination of these methods? 2. Manually (on paper) only 3. Both electronically and manually 3. How many names are on this list as of August 1, 2002? __________ (number) II. Watch List Development and/or Please provide the requested information for each watch list developed and/or maintained 5. Describe how your agency determines the names by your agency. Name of Watch List: ______________________ determinations. If additional space is needed, add pages as necessary. Purpose of Watch List _____________________ 1. Is your watch list limited to terrorists, or does it include information on others? 2. Terrorists and others, such as criminals 4. Other (please specify): 6. What controls are in place to help ensure that the procedures for adding names to the watch list are consistently applied? 2. Is this list maintained electronically, manually (on paper), or by a combination of these methods? 2. Manually (on paper) only 3. Both electronically and manually 3. How many names are on this list as of August 1, 2002? __________ (number) A watch list—also referred to as lookout, target, or tip-off list—contains information on known and suspected domestic and international terrorists and criminals and is used by federal, state, and local agencies to identify, monitor, and apprehend these terrorists and criminals. 7. Describe how your agency determines the names that are removed from this watch list, including a 9. How often is this watch list updated? description of the criteria used to make such determinations. If additional space is needed, add pages as necessary. 8. Other (please specify): ________________ 10. For this list, what is the level of classification of data as specified by Executive Order 12958? 8. What controls are in place to help ensure that the procedures for deleting names from the watch list are consistently applied? 5. Other (please specify): 11. Does this watch list information allow individuals with false identities to be detected? 1. 2. 12. Does this watch list information allow individuals with false documents to be detected? 1. 2. Executive Order 12958 specifies how information related to national defense and foreign relations is to be maintained and protected against unauthorized disclosure. It provides a hierarchy of three levels, with different levels of protection depending on the sensitivity of the information. 13. Please tell us whether the list includes any of the 14. Do you share all or some of the information in this following items by placing a check () in the appropriate column. list with other federal, state, or local government agencies and/or others (e.g., private sector firms, associations, etc.)? Please check () yes or no for each type of organization. If you answered no to all of the categories above, please explain why you do not share this information with others, and then proceed to Part III. If additional space is needed, add pages as necessary. Other (please specify): Other (please specify): (e.g., student, Tourist, etc.) Other (please specify): Other (please specify): Other (please specify): Other Data Groups (please specify): _____________________________ 15. For each of the categories in question 14 that you answered yes to, please check all of the types of organizations you share data with: a. Federal Agencies: 3. Other (please specify): _____________ Please list the federal agencies you share data with. If additional space is needed, add pages as necessary. b. State Agencies: 3. Other (please specify): _____________ 3. Other (please specify): _____________ d. Private sector firms and associations: 3. Other (please specify): _____________ _______________________________ 16. Of the data items in your watch list, which ones do you share and with which organizations? For each item, please circle whether or not you share the item with the type of organization specified in the categories in the table below. Name of Country Issuing Passport/Visa Other (please specify): Other (please specify): Type of Visa Granted (e.g., student) data, please place a check () in the appropriate column(s) below. and Use Other Agencies’ Watch Lists Please provide the requested information for each watch list provided by another agency. If you do not receive others’ watch lists, please go directly to part V. telecommunications links (e.g., e-mail) Web Access (Hypertext Transfer Protocol (HTTP) or HTTP over Secure Socket Layer (HTTPS)) How does your agency use this watch list? Secure Community of Interest (such as Intel-Link) Other (please specify): 1. Does your agency receive and use watch list information on? 1. 2. Terrorists and others, such as 4. Does your agency have data sharing agreement(s) with the agencies you receive this list from? 3. 4. 1. 2. 2. By what mechanism(s) does your agency receive watch list information? 5. Check () the box showing how frequently you receive updated watch list information: 2. Manually (on paper) only (go to question 4) 3. Both electronically and manually 8. Other (please specify):____________ 6. Would receiving watch list information more 10. For this watch list, please check () the items frequently improve your agency’s ability to not provided and list the reason(s) the agency identify, monitor, and/or apprehend known and gave for not providing them. suspected terrorists and criminals? 1. 2. 7. Does this watch list information allow individuals with false identities to be detected? Other (please specify): 1. 2. 8. Does this watch list information allow individuals with false documents to be detected? 1. 2. 9. Does your agency receive all the data it requests from the agency providing this watch list? Other (please specify): 1. 2. Type of Visa Granted (e.g., student, tourist) If your answer is yes, please go directly to section V. If your answer is no, please proceed to question 10. Please provide the requested information for each watch list identified in parts II and IV. list resides on. In addition, where applicable, check () the standard your product is compliant with. Additional pages are provided in appendix III if you have more than one watch list. If your watch list does not reside in a computerized database or system, skip to part VI. give the agency name) Other (specify): protocols) Memory (bytes) protocols) Other (please specify): client-server) _____________________________________________ 3. For this watch list, please check () below any of 6. Is the database or system your list resides on the software infrastructure standards your system stand-alone or networked? or database is compliant with. If your system or database is compliant with a standard not listed, 1. Stand-alone only (go to question 8) please list it in the other category. (Check all that apply.) Yes () No () If Yes, List System(s) 5. Is the system on which your list resides built in compliance with open system standards? 1. 2. 8. What fields can you use to search for individuals? (Check all that apply.) If yes, please specify which standard(s) you used to develop and/or implement your system. 2. Biometric fields (e.g., fingerprints) 3. Date of birth fields. Other (please specify): ______________ A stand-alone database/system is one that is not directly connected to other systems or networks. 9. Does your system include a “fuzzy” searchcapability? 12. Is your agency using document type definitions (DTDs) or schemas for requesting watch list information from another agency? If you answered yes, please provide a copy structure of your data. of the DTD/schema for requesting watch list information. 10. For this watch list, please describe below what type of standards, schema, or specifications 13. Is your agency using DTD/schemas for your agency uses to define the format and responding to a watch list information request content of your watch list data elements or records. from another agency? If you answered yes, please provide a copy of the DTD/schema for requesting watch list information. 14. Is your agency using DTDs/schema for automatically updating watch list information? 11. Has your agency created a metadata template for describing a terrorist? If you answered yes, please provide a copy of the DTD/schema. 15. Has your agency developed and institutionalized a watch list data dictionary that describes the elements used in the DTDs/schemas? If you answered yes, please provide documents identifying the number of elements, name of each element, data type of each element, and meaning of each element. If you answered yes, please provide a copy of the data dictionary. A search for data that finds answers that come close to the data being searched for. It can get results when the exact spelling is not known or help users obtain information that is loosely related to a topic. Metadata is definitional data that provides information about or documentation of data managed within an application or environment. For example, metadata would document data about data elements or attributes, such as the element name, size, and type. For example, state motor vehicle administrators use the American Association of Motor Vehicle Administrators’ XML Driver History Query System Specifications. A DTD or schema is a file that describes the structure of a document and defines how markup tabs should be interpreted. 16. Is your agency sharing its data dictionary with 20. Does your watch list database contain any of other agencies? the following security controls? (Check all that apply.) 1. 2. If you answered yes, please provide the 3. Vulnerability Assessments or Reviews names of the agencies you share with below. 5. Intrusion (Actual or attempted) Detection 6. Maintaining audit trails of all access to and 7. Investigation of suspicious access or Revision of access control policies and 4. Other (please specify): _______________________________________ 24. What controls are in place to help ensure data reliability? _______________________________________ 2. Additional fill-in boxes for question 6. 1. Additional fill-in boxes for question 5. 3. Additional fill-in boxes for question 7. 4. Additional fill-in boxes for question 8. GAO Contact and Staff Acknowledgments GAO Contact Gary Mountjoy, (202) 512-6367. Staff Acknowledgments In addition to the individual named above, Elizabeth Bernard, Neil Doherty, Joanne Fiorino, Will Holloway, Tonia Johnson, Anh Le, Kevin Tarmann, and Angela Watson made key contributions to this report. GAO’s Mission The General Accounting Office, the audit, evaluation and investigative arm of Congress, exists to support Congress in meeting its constitutional responsibilities and to help improve the performance and accountability of the federal government for the American people. GAO examines the use of public funds; evaluates federal programs and policies; and provides analyses, recommendations, and other assistance to help Congress make informed oversight, policy, and funding decisions. GAO’s commitment to good government is reflected in its core values of accountability, integrity, and reliability. Obtaining Copies of GAO Reports and Testimony The fastest and easiest way to obtain copies of GAO documents at no cost is through the Internet. GAO’s Web site (www.gao.gov) contains abstracts and full- text files of current reports and testimony and an expanding archive of older products. The Web site features a search engine to help you locate documents using key words and phrases. You can print these documents in their entirety, including charts and other graphics. Each day, GAO issues a list of newly released reports, testimony, and correspondence. GAO posts this list, known as “Today’s Reports,” on its Web site daily. The list contains links to the full-text document files. To have GAO e-mail this list to you every afternoon, go to www.gao.gov and select “Subscribe to GAO Mailing Lists” under “Order GAO Products” heading. Order by Mail or Phone To Report Fraud, Waste, and Abuse in Federal Programs Public Affairs SUMMARY: [/INST] Terrorist and criminal watch list systems--sometimes referred to as watchout, lookout, target, or tip-off systems--are important tools in controlling and protecting our nation's borders. The events of September 11, 2001, and other incidents since then, have highlighted the need to share these watch lists. In light of the importance of border security, GAO was asked to identify federal databases and systems that contain watch lists, the agencies that maintain and use them in protecting our nation's borders, the kind of data they contain, whether federal agencies are sharing information from these lists with each other and with state and local governments and private organizations, the structural characteristics of those lists that are automated, and whether opportunities exist to consolidate these watch lists. Generally, the federal government's approach to using watch lists in performing its border security mission is decentralized and nonstandard, largely because these lists were developed in response to individual agencies' unique missions, including their respective legal, cultural, and systems environments. Specifically, nine federal agencies--which prior to the creation of the Department of Homeland Security (DHS) spanned the Departments of Defense, Justice, State, Transportation, and the Treasury--develop and maintain 12 watch lists. These lists include overlapping but not identical sets of data, and different policies and procedures govern whether and how these data are shared with others. As a general rule, this sharing is more likely to occur among federal agencies than between federal agencies and either state and local government agencies or private entities. Further, the extent to which such sharing is accomplished electronically is constrained by fundamental differences in the watch lists' systems architecture (that is, the hardware, software, network, and data characteristics of the systems). Two agencies identified opportunities to standardize and consolidate these lists, which GAO believes would improve information sharing. The President's homeland security strategy further recognizes the need to address the proliferation of these lists. While the Office of Homeland Security was reportedly pursuing consolidation as part of an effort to develop a border and transportation security blueprint, referred to as an enterprise architecture, the DHS Chief Information Officer told us that the department had recently taken responsibility for the blueprint. However, we were not provided enough information to evaluate these efforts. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``American Red Cross Transparency Act of 2016''. SEC. 2. GOVERNMENT ACCOUNTABILITY OFFICE OVERSIGHT. Section 300111 of title 36, United States Code, is amended to read as follows: ``Sec. 300111. Authority of the Comptroller General of the United States ``(a) Audit Authority.--The Comptroller General of the United States is authorized to review-- ``(1) the internal governance of the corporation; and ``(2) any program or activity connected to national preparedness, including any program or activity carried out by the corporation in connection with events for which the Federal Government provides leadership or support under the national preparedness system established under section 644 of the Department of Homeland Security Appropriations Act, 2007 (6 U.S.C. 744), or any successor system. ``(b) Access Authority.-- ``(1) In general.--For purposes of carrying out this section, the Comptroller General of the United States shall have access to and the right to examine and copy all records and other recorded information, electronic or otherwise, within the possession or control of the corporation that the Comptroller General determines relevant to a review authorized under subsection (a), including such records and other recorded information relating to the financial transactions and internal governance of the corporation. ``(2) Individuals.--The Comptroller General shall be provided access to, and be permitted to interview, any member of the board of governors, employee, volunteer, or agent of the corporation whom the Comptroller General believes to have knowledge relevant to a review authorized under subsection (a). ``(c) Enforcement.-- ``(1) Subpoena authority.-- ``(A) In general.--If the corporation does not make available a record, other recorded information, or a member of the board of governors, employee, volunteer, or agent of the corporation upon a request under subsection (b), the Comptroller General of the United States may issue a subpoena for the record or other recorded information or to obtain the testimony of the member of the board of governors, employee, volunteer, or agent. ``(B) Issuance.--A subpoena issued under this paragraph-- ``(i) shall identify the record, other recorded information, or member of the board of governors, employee, volunteer, or agent of the corporation sought; and ``(ii) may be issued by the Comptroller General. ``(C) Service.--The Comptroller General shall have an individual serve a subpoena issued under this paragraph by delivering a copy to the chief executive officer of the corporation or by mailing a copy of the subpoena by certified or registered mail, return receipt requested, to the principal place of business of the corporation. Proof of service is shown by a verified return by the individual serving the subpoena that states how the subpoena was served or by the return receipt signed by the person served. ``(2) Action.--If the corporation does not comply with a subpoena issued under paragraph (1), the Comptroller General of the United States, acting through an attorney the Comptroller General designates in writing, may bring a civil action in the United States District Court for the District of Columbia to require the corporation to produce the record, other recorded information, or member of the board of governors, employee, volunteer, or agent that is the subject of the subpoena. The court shall have jurisdiction of such action and may punish a failure to obey an order of the court under this subsection as a contempt of court.''. SEC. 3. INVESTIGATIONS, COMPLIANCE, AND ETHICS UNIT. (a) In General.--Chapter 3001 of title 36, United States Code, is amended-- (1) by redesignating section 300113 as section 300114; and (2) by inserting after section 300112 the following: ``Sec. 300113. Reporting and other authorities of the Office of Investigations, Compliance, and Ethics ``(a) In General.--There shall be in the corporation an Office of Investigations, Compliance, and Ethics, which-- ``(1) shall be a subcommittee of the Audit and Risk Management Committee of the corporation; and ``(2) shall report directly to the board of governors and the Audit and Risk Management Committee. ``(b) Membership.--An individual who is not a member of the board of governors of the corporation may be a member of the Office of Investigations, Compliance, and Ethics. ``(c) Employees.--The Audit and Risk Management Committee of the corporation shall determine, in consultation with the Chief Executive Officer and the President of the corporation, the number of employees that shall be employed by the Office of Investigations, Compliance, and Ethics. ``(d) Effect of Termination of Audit and Risk Management Committee.--If the Audit and Risk Management Committee of the corporation ceases to exist-- ``(1) the Office of Investigations, Compliance, and Ethics shall become a standing committee of the board of governors; and ``(2) the board of governors, in consultation with the Chief Executive Officer and President of the corporation, shall determine the number of employees to be employed by the Office of Investigations, Compliance, and Ethics. ``(e) Investigations.-- ``(1) In general.--The Office of Investigations, Compliance, and Ethics shall conduct formal investigations relating to fraud, waste, abuse, corporation policy violations, illegal or unethical conduct, or other wrongdoing relating to the corporation. ``(2) Access.--During the course of an investigation under paragraph (1), the Office shall-- ``(A) have access to and the right to interview any employee, volunteer, or agent of the corporation; and ``(B) have access to records and be permitted to copy all records and other recorded information, electronic or otherwise, within the possession or control of the corporation, including such records and other recorded information relating to the financial transactions and internal governance of the corporation, that the Office of Investigations, Compliance, and Ethics determines relevant to the investigation. ``(f) Reporting.-- ``(1) Definition.--In this subsection, the term `appropriate congressional committees' means-- ``(A) the Committee on Finance, the Committee on Foreign Relations, the Committee on Health, Education, Labor, and Pensions, the Committee on Homeland Security and Governmental Affairs, and the Committee on the Judiciary of the Senate; and ``(B) the Committee on Energy and Commerce, the Committee on Foreign Affairs, the Committee on Homeland Security, the Committee on the Judiciary, and the Committee on Ways and Means of the House of Representatives. ``(2) Reports.--The Office of Investigations, Compliance, and Ethics shall annually submit to the appropriate congressional committees, the board of governors, the Audit and Risk Management Committee, the Chief Executive Officer of the corporation, the President, the Comptroller General, and to any Member of Congress (upon request)-- ``(A) a report-- ``(i) discussing any trends and systemic matters that the Office of Investigations, Compliance, and Ethics has identified confronting the corporation; and ``(ii) providing the number of pending investigations by the Office of Investigations, Compliance, and Ethics and the general substance of the investigations; and ``(B) the final report regarding each investigation completed by the Office of Investigations, Compliance, and Ethics during the year covered by the report under subparagraph (A).''. (b) Technical and Conforming Amendment.--The table of sections for chapter 3001 of title 36, United States Code, is amended by striking the item relating to section 300113 and inserting the following: ``300113. Reporting and other authorities of the Office of Investigations, Compliance, and Ethics. ``300114. Reservation of right to amend or repeal.''. SUMMARY: [/INST] American Red Cross Transparency Act of 2016 This bill authorizes the Government Accountability Office (GAO) to review: (1) the internal governance of the American National Red Cross (the corporation), and (2) any program or activity carried out by the corporation that is connected to national preparedness. The bill grants the GAO: (1) access to, and the right to examine and copy, all records of the corporation that the GAO determines are relevant to such review; and (2) access to, and the right to interview, any employee, volunteer, agent, or member of the board of governors of the corporation whom the GAO believes has knowledge relevant to such review. The GAO may issue a subpoena and bring a civil action in U.S. District Court for the District of Columbia to enforce such access. The bill establishes an Office of Investigations, Compliance, and Ethics as a subcommittee of the corporation's Audit and Risk Management Committee. The office shall: (1) conduct formal investigations regarding fraud, waste, abuse, corporation policy violations, illegal or unethical conduct, or other wrongdoing relating to the corporation; and (2) report annually on trends and systemic matters confronting the corporation and on pending and completed investigations. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Last Friday, September 9, a leak was found on the Colonial Pipeline’s gas line near Helena, AL, halting the flow of gasoline from the Gulf Coast to the Southeast. Colonial Pipeline’s main gasoline line continues to be down, impacting supply from Mississippi to Maryland). Colonial began shipping gas along the diesel line today, which only provided minimum relief. The main gas line is not expected to begin pumping until this weekend at the earliest. Currently, unbranded gas supply is very limited along the pipeline. Supply also anticipates diesel to become challenging beginning this weekend/early next week. Mansfield’s Supply and Logistics Teams are meeting daily and treating this situation with the same importance and urgency as a natural disaster and moving to Red Alert. We are currently long hauling from coastal terminals and other supply regions to mitigate the effects of the shortage. As a result, carrier capacity is also impacted due to the additional long hauls required to service customers. We would caution all customers to take fuel savings measures over the next week, or to place orders well in advance of need to allow time to procure supply. Below is a picture of Colonial Pipeline for reference. A leak has caused the closure of a crucial pipeline that carries gasoline to the eastern United States, a disruption that threatens to drive up prices and leave service stations without fuel to sell. A section of the Colonial Pipeline, which runs from Houston to New York, has been closed since Sept. 9 after a spill of roughly 250,000 gallons was discovered in rural Shelby County, Ala. The major pipeline, one pipe of which has been severed, provides gasoline for an estimated 50 million people on the East Coast each day, according to company estimates. The cause of the leak has yet to be determined, according to the company's most recent statement. The pipeline's operator has said full service will not be restored until at least next week. The closure has set off an industry-wide scramble as suppliers seek alternative ways to transport gasoline to the East Coast. Prices have yet to move much. They're only up a penny or two in the last week in states such as Georgia, South Carolina and Tennessee, according to AAA. But gas prices could spike by as much as 15 cents per gallon or more in those three states, as well as North Carolina and Virginia, in the next week according to GasBuddy.com analyst Patrick DeHaan. #GasPrices may rise 5-15c in GA, NC, TN, VA and 10-20c in SC over the next week due to supply/pipeline outage. Some stations may run out. — Patrick DeHaan (@GasBuddyGuy) September 15, 2016 Ships have already been dispatched to carry fuel from Texas to New York as part of the effort. There are also likely to be far more tanker trucks on the road carrying gasoline than normal said Tom Kloza, chief oil analyst with the Oil Price Information Service. But pipelines are by far the cheapest way to move gasoline or oil, so any alternative will raise costs. And not every station will be able to get the gasoline it needs, he said. "You're going to see some places without gasoline," he said. "It's like a mini-hurricane." The pipeline operator said that based on its current projections, parts of Georgia, Alabama, Tennessee, North Carolina and South Carolina will be the first markets to suffer potential supply disruptions. The governors of Alabama and Georgia have already declared states of emergency. The Northeast markets such as New Jersey at the end of the pipeline are less likely to see an impact because they can get gas from other locations, said Kloza. Gas prices typically fall at this time of year. Thursday was the day that stations in most of the country could start using the cheaper winter blend of gasoline rather than the summer blend, which is formulated to combat smog. "People are going to be seeing a 5 to 10 cent a gallon increase at a time they're normally seeing a 5 to 10 cent a gallon price drop," said Kloza. Related: Global glut forecast puts pressure on oil prices Mansfield Oil, a fuel distributor, has warned its customers to take fuel savings measures and to place their orders early. The company said the supply of gasoline is currently very thin along the closed pipeline, and that it was trucking in supplies from the coast to meet demand. The company said it was treating the situation "with the same importance and urgency as a natural disaster." * Largest spill on Colonial line in 20 years * Restart expected by next week * Gasoline futures rise, cash prices in NY higher (Adds states of emergency in Georgia and Alabama) By Devika Krishna Kumar and Jessica Resnick-Ault NEW YORK, Sept 15 (Reuters) - Colonial Pipeline Co, operator of the largest refined products pipeline system in the United States, said on Thursday it would delay until next week the full restart of its main gasoline line bringing fuel to the East Coast after a 6,000-barrel leak in Alabama. The company on Friday shut its main gasoline and distillate lines, which are critical to East Coast product supply, after the leak in Shelby County, Alabama, which appears to be the largest spill for this line in 20 years. Colonial had originally estimated a full restart of Line 1, which runs to Greensboro, North Carolina from Houston, by this weekend, but work was delayed on Wednesday evening and into Thursday morning because of gasoline vapors at the site, the company said. Traders are bracing for tighter supply in the U.S. East Coast and Southeast markets such as Georgia and Virginia if a full restart of the gasoline line is delayed further, particularly as the outage comes around refinery maintenance season when refiners are producing less fuel. Gasoline prices soared on the news of the delay, with U.S. gasoline futures rising as much as 6 percent to a session high of $1.4433 a gallon. Gasoline margins 1RBc1-CLc1 also soared to the highest since June, and New York Harbor cash prices rose as Gulf prices weakened, traders said. “If it were to go on a lot longer, it would be a hairy situation,” said Robert Campbell, head of oil products markets at consultancy Energy Aspects in New York. The cause of the leak has not yet been determined, Colonial spokesman Steve Baker said in an email. The company noted that it was “disappointed” that further progress had not been made in the repairs. The distillate line has since been fully restored, and Colonial is pumping batches of gasoline on that line as a workaround. Separately, shippers have begun moving fuel from the refinery-rich Gulf Coast to the demand-heavy East Coast via tanker, according to a Colonial shipper. Those vessels, because they are required to be U.S.-flagged under the Jones Act, are typically more expensive than transport via pipeline. Docks on the Gulf Coast are “already getting busy” after the outage, a source at a U.S. refiner said. Inventories on the East Coast are still above the 5-year average, but traders say that could change if the 1.2 million-barrel-per-day gasoline line continued to operate at reduced rates for a prolonged period. “We do have the inventory to manage it for the time being, but we’re going to be under a fair bit of pressure, and the uncertainty isn’t helpful,” said Campbell. This is the largest spill on the Colonial line since 1996, when about 22,800 barrels of fuel oil leaked in South Carolina, according to National Transportation Safety Board data. The governors of both Georgia and Alabama issued states of emergency on Thursday as a result of the spill, allowing waivers of regulations on vehicle transport of fuel. The waivers allow trucks hauling transportation fuel to spend more hours on the road to deliver the fuel. The U.S. Environmental Protection Agency waived certain requirements for summer-grade gasoline in the Atlanta and Nashville areas on Wednesday to allow Colonial to maximize its ability to ship gasoline. Colonial said gasoline hauled on Line 2 would be arriving into the southeast on Saturday, and said it expects additional downtime in delivering gasoline ahead of the full restart of Line 1. (Reporting by Devika Krishna Kumar and Jessica Resnick-Ault in New York; Editing by Chris Reese and Richard Chang) The partial closing of a major pipeline running from the Gulf Coast to the East Coast could reduce gas supply and raise prices at the pump in several U.S. states during the next few days. Parts of Colonial Pipeline Co.’s Line 1, a major artery that delivers gasoline from refineries at the Gulf Coast to the East Coast, have been closed this week because of a 6,000 barrel leak that was discovered Friday. The company initially expected to have the pipeline running again by this weekend, according to a company bulletin released Tuesday and viewed by The Wall Street Journal. But repair work has been interrupted by bad weather that has caused gasoline fumes to settle over the site. Colonial said it now anticipates fully restarting the pipeline next week. The pipeline is especially important to markets in southeastern states. With supplies tightening, retail gasoline prices could spike by 5 to 20 cents a gallon, on average, in Alabama, Georgia, North Carolina, South Carolina, Tennessee and Virginia, said Patrick DeHaan, senior petroleum analyst at GasBuddy. “We’re starting to see the dominoes fall where this will become an issue that will affect motorists’ wallets for sure,” Mr. DeHaan said. “It could become not only a wallet issue but a fuel availability issue.” Overall, 13 states are served by the pipeline, and it delivers about 40% of the gasoline consumed on the East Coast. The outage has driven gasoline futures higher this week. Gasoline futures gained 5% to settle at $1.4302 Thursday—only the third time since mid-May that gasoline future gained more than 5% in one day. East Coast inventories of gasoline are relatively high, but some states in the southeast are taking steps to try to head off shortages. Georgia, North Carolina, and Alabama have waived rules that limit how many hours truck drivers can travel, aiming help speed the arrival of trucks carrying fuel. The Environmental Protection Agency on Wednesday waived Clean Air Act requirements for 13 counties in Georgia and five counties in Tennessee “to minimize or prevent disruption of an adequate supply of fuel to consumers.” The waiver lasts through midnight tonight. Colonial is still transporting gasoline from Houston to western Alabama. And the company has started shipping gasoline on its Line 2, which normally carries jet fuel, diesel and home heating oil, to help mitigate the supply impact. Write to Alison Sider at alison.sider@wsj.com and Nicole Friedman at nicole.friedman@wsj.com SUMMARY: [/INST] In what's being called a supply "red alert," a part of the Colonial Pipeline that transports gas from Houston to New York-serving about 50 million people in 13 states daily, per CNN and the Wall Street Journal-has been shut down since Sept. 9, when a 250,000-gallon spill was discovered in a rural part of Alabama. The pipeline's operator isn't sure what caused the leak, which Reuters says is the biggest spill along the pipeline since 1996. The pipeline should resume full operation next week. Despite alternate methods of getting gas to the Southeast and East Coast, there will still be a shortage. "You're going to see some places without gasoline," says Tom Kloza, an oil analyst with Oil Price Information Service. There are already gas-carrying ships lugging barrels from the Gulf Coast to New York, and Kloza says more tanker trucks will probably be sent out as well. But any method other than a pipeline is usually more costly, so even if gas does make it to a particular East Coast station, consumers will likely have to pay more at the pump, with those in Georgia, Alabama, Tennessee, North Carolina, and South Carolina expected to be among the first to reach deeper into their wallets. Gas prices usually drop in the early fall as stations switch to winter-blend gas, but consumers in hard-hit states may now instead see an average hike of anywhere from 5 cents a gallon to 20 cents a gallon, fuel analysts estimate. Meanwhile, markets further north, at the end of the pipeline, may not be hit as hard because they can get their gas elsewhere, says Kloza. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Paul Bentley. A murderer has been told in prison that he is to become Britain’s youngest grandfather at the age of 27. The man stabbed a Good Samaritan to death shortly after fathering his daughter when he was just 14. Now the girl – who is 13 – has announced to friends on Facebook that she is pregnant by a boy of her own age. Young mother: A 13-year-old girl has become pregnant, which will make her 27-year-old father, in jail for murder, Britain's youngest grandfather (file picture) Last night, the family told of their. despair at the situation. ‘She has only ever seen her dad in prison,’ one aunt told the Mail. ‘She. had no chance. Her dad was furious when he heard she is pregnant but he. did the same so what could he say?’ The murderer’s mother, who will. become a great-grandmother at 47, is being consoled by friends at her. home in the South West. The. girl’s 28-year-old mother has promised to take responsibility for the. baby. The jailed murderer cannot be named because to do so would. identify his daughter, who is a minor. He. was imprisoned for 11 years for murdering a man who tried to intervene. in a robbery. He was due for release last year but his sentence has been. extended until next year because he tried to escape from jail. He. apparently begged his daughter not to go through with the pregnancy,. but she has since posted messages online about the baby. She uploaded a. hospital scan to Facebook, saying she was five months’ pregnant. Social media message: The 13-year-old girl posted pictures of her scans on Facebook when she was five months' pregnant, it was reported. Friends. said they were ‘proud’ of her for keeping the child, with one adding:. ‘Hurry up and push that baby out. You and ******* are going to be the. best mum and dad.’ The girl. has been taken out of school and is now being taught at a special unit. for pregnant teens. She still lives with her mother, who has a new. partner and two young boys. Last night, the girl’s mother and maternal grandmother declined to comment. However,. another family member said of the murderer and his daughter: ‘His. cousins would take her to prison to see him. He would ask if she was. doing her homework. ‘He’d say: “You better had been.” But he’s a kid himself, he does not know what parenting is about.’ The. title of Britain’s youngest grandfather is currently held by Shem. Davies, of Bridgend, South Wales, whose 14-year-old daughter gave birth. to a girl when he was 29. Mr. Davies said at the time: ‘She’ll be a brilliant mum. At first I wasn’t. overly pleased that she was pregnant but I soon got over that. Now it’s. all about being positive.’ The number of teenage mothers in the UK is five times higher than in the Netherlands and twice that of France and Spain SUMMARY: [/INST] Girl, 13, posted scans on Facebook when five months' pregnant. Her 27-year-old father, jailed for fatal knife attack, told her to have abortion. It's understood she's attending a special education unit for young mothers. One of the girl's friends has labelled the situation 'disgusting', reportedly. She lives with her 28-year-old mother on a council estate. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS-REFERENCE TO RELATED APPLICATION [0001] This application is a continuation of Ser. No. 11/409,816 filed Apr. 24, 2006. BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention has to do with apparatus and methods for performing osteotomies and drilling holes in bones. More specifically, the invention relates to apparatus and methods for harvesting bone from the operating site during the osteotomy or bone drilling procedure so that it can be used to augment the bone fusion process. [0004] 2. The Related Art [0005] Osteotomies are routinely performed for surgical access or to divide (and reposition) a bone for the correction of a skeletal deformity. Holes may be drilled in bones for various reasons to accommodate screws, pins and various other implantable devices and materials or to take a bone sample for analysis. [0006] One of the more common examples of an osteotomy for surgical access is a craniotomy. In this procedure, the surgeon removes a significant portion of the patient's skull (termed a craniotomy flap, a cranial flap, a skull flap or bone flap) for access to the brain. The removed section of the skull is set aside in a sterile field and at the end of surgery, it is returned to its original position and affixed to the native skull, typically with plates and screws. The intent of the surgeon is to restore the patient's skull to its original contour and to provide physical protection for the brain. The ideal outcome would be complete fusion of the craniotomy flap to the native skull, leaving no long term bony deficit or weakness. In addition, many surgeons would prefer there to be minimal foreign bodies remaining and no imaging artifacts postoperatively. Unfortunately this is difficult to accomplish with the current surgical techniques. [0007] The surgical instrument used to cut the craniotomy (a craniotome) utilizes a rotating cutter approximately 2 mm in diameter. The bone that is removed by this instrument is lost during surgery and as a result, when the cranial flap is returned to its original position, there is a gap around the entire periphery which corresponds to the diameter of the cutter. This gap creates a number of problems. The most obvious deficiency is that bone-to-bone contact, essential for achieving bony fusion, is impossible around the periphery of the cranial flap. This continuous gap (or kerf) creates a surgical “dead space” which is never desirable, it also allows soft tissue (the scalp and dura) to intrude into this space and inhibit bony healing. The step-off between the skull and cranial flap also may result in a cosmetic deformity for the patient. To combat these problems, surgeons use one or more strategies which have their own shortcomings. For example, the surgeon may choose to bias the cranial flap toward one side of the craniotomy. This produces bone-to-bone contact in a local area but increases the gap elsewhere around the periphery. [0008] The surgeon may also elect to fill the gap between the skull and skull flap with a material which will encourage bony fusion. These fill materials can be autologous, allograft, or artificial. Autologous bone grafts are harvested directly from the patient and are the “gold standard,” since they are inherently biocompatible, osteoconductive, osteoinductive, and osteogenic. Harvesting autologous bone is currently carried out by taking bone from a part of the patient's body other than the surgical site. This results in additional surgical time and the additional (surgical) harvest has its own attendant risk of complications such as donor site pain and morbidity. Allografts, derived from donor (cadaver) tissues, are only osteoconductive, and they involve considerable cost, pose the risk of disease transmission and are objectionable to certain religious groups. Artificial materials such as alloplastic bone cement are another alternative. These bone cements are almost always used in conjunction with plates and screws. The drawbacks to this approach include substantial additional cost, risk of infection and no certainty that the bone cement will ever remodel into actual bone. [0009] While this problem is illustrated with a craniotomy example, it occurs whenever an osteotomy is created strictly for surgical access and the bones must be returned to their original positions in order to prevent a postoperative deformity or a functional problem. In the skull alone, this problem exists in skull base surgery, craniofacial tumor surgery and mandibular osteotomies for oncologic resection. At the conclusion of all these procedures, the surgical goal is to restore the original bony anatomy. This precludes achieving bone-to-bone contact of the severed ends since they must remain separated by the width of the blade (or cutter) used for the osteotomy. [0010] Perforations (or holes) are routinely created in bones for surgical access and other reasons. These perforations may be performed for biopsy purposes, to create access for minimally invasive surgery or as the prelude to an osteotomy. An example of the latter is the burr hole that is initially created in the skull which allows the craniotome to be inserted for completion of the craniotomy. In these cases, it is desirable to close the perforation, preferably in a manner which restores the bone to its original condition. Additionally, holes are routinely drilled into bone as a step in preparation for orthopedic screw or pin insertion. Most of these cases would also benefit from the availability of autologous bone graft. [0011] When osteotomies are used to divide a bone so that it may be repositioned to correct a surgical deformity, a different problem exists. In many cases, bone graft material is needed to fill the gaps created as the bones are repositioned and severed bony ends move relative to each other. This is obviously the case where a gap is intentionally created, such as an osteotomy to elevate a collapsed tibial plateau. It also may occur when the intent of the osteotomy is to decrease the bone volume. In these surgeries it is not uncommon for the contours of the bony ends to be slightly mismatched and in these cases the surgeon may elect to augment the fusion with additional bone graft material. As previously discussed, allograft bone, autogenous bone or alloplastic materials may all be used in such situations, each with their related problems. [0012] In all these procedures where an osteotomy (or perforation) is necessary, a common problem exists: bone is removed by the osteotomy or drilling instrument and at the conclusion of surgery, additional bone is required to complete the reconstruction. [0013] The current surgical practice is to manually irrigate the bone as it is cut and also to manually suction off the resulting solids and liquids into the operating room's non-sterile vacuum system. These activities are performed concurrently by other operating room personnel while the surgeon operates the osteotomy instrument. Some of the shortcomings of these practices are detailed in the following text which is excerpted from the USC Neurosurgery website. (http://uscneurosurgery.com/infonet/ecrani/instruments.htm). [0014] Irrigation [0015] With even optimal illumination and magnification and organization of his field, the surgeon is still incapacitated by obscuring blood, cloudy irrigation fluid, or other debris. Efficient intracranial surgery requires keeping the operative field clear of physical and visual obstacles by diligent irrigation, attentive aspiration, and meticulous hemostasis. [0016] Irrigation and aspiration are complimentary aspects of surgical field maintenance. The irrigating-aspirating assistant must concentrate on following the movements of the surgeon's hands visually and with irrigant and suction. Areas of surgical interest are most safely addressed at the time of maximal cleanliness; immediately after they have been washed clean and aspirated dry. [0017] Irrigant should be squirted onto the field under enough pressure to displace blood, but if the bulb is squeezed too hard and fluid issues under too much pressure, fluid from the bulb will be reflected back against the stream because it cannot dissipate fast enough, with the consequence that a splashing of mixed blood-irrigant fluid ends up in the surgeon's face and widely scattered across the field. Better control of the stream from the irrigation fluid bulb is achieved by manipulating it with the dominant hand. [0018] The primarily aqueous solution used for surgical irrigation not only dilutes the blood but pushes it ahead of the irrigant stream. This washing force is greatest at the tip of a irrigation bulb where the irrigant fluid pressure is maximal. [0019] Suction [0020] Blood accumulates with irrigation fluid in dependent portions of the field as it escapes and is washed from lacerated vessels. The bloody fluid then interferes with the working of the electrocautery devices used to stop further bleeding from the openings in the vessels. To this is added the problem of blood's opacity, so that even in small quantities as even a thin layer, it obscures the surgical field. [0021] Suction is a maintenance activity, keeping the operative field clear of debris, blood, or smoke that can obstruct visualization. Whenever possible the suction attachment should be held in the non-dominant hand. [0022] Surgical field suction instrumentation attaches to the same suction canisters which provide suction for anesthesia. Distally non-sterile, proximally sterile tubing connects the suction device to the distal end of the metal suction handle and tip. The proximal end of the metal sucker connects to the suction tubing. [0023] The importance and difficulty of performing simultaneous irrigation and suction in concert with the surgeon's movements are detailed above. Later in the text they discuss the importance of irrigation when cutting the bone: Bone is perforated and/or cut in the course of any intracranial trauma surgery. Irrigation accomplishes two purposes in the setting of drilling bone. First, it cools down the bone. This is important in terms of the mechanics of bone cutting. The bits cut more effectively through cooler bone and in the absence of bone dust that can clog its rotations. [0025] These comments are directed toward neurosurgical craniotomies but the same principles apply to all osteotomies and perforations. Proper irrigation not only improves the efficiency of the cutting instrument, it also prevents thermal necrosis of the bone which can later retard the healing process. This principle takes on even greater importance when one intends to collect the bone particles generated during the cutting process and reuse them in surgery. Irrigation has traditionally been conducted using a liquid. But according to the present invention we can irrigate with a liquid or compressed gas source or a combination of liquid and a compressed gas source. The compressed gas can be chilled if required and also can be intermixed with a fluid (e.g., saline). [0026] Up until now, a reliable and essentially free source of autogenous bone has been overlooked by the surgical community. Manufacturers of surgical cutting instruments have incorporated irrigation on some instruments but none have ever proposed taking the concept one step further—collecting the bone particulate in a sterile fashion for later use in the bony reconstructive phase of the surgery. [0027] We have now developed apparatus and methods for sterilely collecting and containing the particulate bone created during osteotomy and bone drilling procedures. The apparatus and methods also enable more controlled irrigation of the bone as it is cut or drilled and a reduction in the amount of patient bone that is scattered or aerosolized during surgery. [0028] The terms particulate bone, bone particulate and bone particles are used interchangeably in this patent and all are intended to have the same meaning. SUMMARY OF THE INVENTION [0029] A collection module is provided on the cutting end, also referred to herein as the distal end, of a bone cutting tool to prevent the scatter and loss of particulate bone created at the operating site during an osteotomy or bone drilling procedure. The collection module suctions off the bone particulate as well as irrigant, blood and other body fluids and reduces contamination of the surgical field from the cutting operation. The module can be partially or completely disposable. [0030] The collection module contains a suction port which evacuates the particulate bone from the cutting operation. A sterile containment module is provided downstream for collecting the particulate bone and separating it from irrigant and body fluids suctioned off from the surgical field. [0031] An irrigation system is incorporated in some cutting tools and when it is not, it can be incorporated in the collection module to provide a reliable and effective source of irrigation to the cutting area. The irrigant prevents thermal necrosis, prevents the formation of bone dust, improves cutting efficiency and improves visibility within the surgical field. As previously disclosed, the irrigation system in our invention can disperse fluids, gasses or a combination of the two. [0032] The sterile bone particles which are harvested according to the invention are used to augment the reconstructive portion of the surgery. The particulate bone can be used “as is” or mixed with any number of readily available additives such as, but not limited to: [0033] a. Patient's blood; [0034] b. Patient's platelet rich plasma (PRP); [0035] c. Bone morphogenic proteins; [0036] d. Other bone growth factors; and [0037] e. Antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS [0038] The drawing figures are provided for purposes of illustrating the elements of the invention and are not intended to be drawn to scale. [0039] FIG. 1 is an expanded perspective view of a bone cutting tool (a craniotome) of the invention which has been provided with integral irrigation and suction systems. A collection module of the invention is illustrated to the left before attachment to the tool. The craniotome is attached to a handpiece which in turn is attached to a pneumatic line or an electric power source. [0040] FIG. 2 is a perspective view of the craniotome of FIG. 1 with the collection module and the pneumatic line attached. [0041] FIG. 3 is an elevation view of the craniotome of FIG. 2. [0042] FIG. 3A is a view of the left end of FIG. 3. [0043] FIG. 4 is a section view of FIG. 3A taken at section line 4 - 4 of FIG. 3A and illustrating a portion of the suction system. [0044] FIG. 4A is a section of FIG. 3A taken at section line 3 - 3 of FIG. 3A and illustrating a portion of the irrigation system. [0045] FIG. 5 is an elevation view of a collection module of the invention. [0046] FIG. 6 is a distal end view of the collection module of FIG. 5. [0047] FIG. 7 is a section view of the collection module of FIGS. 5 and 6. [0048] FIG. 8 is an expanded elevation view of a standard prior art craniotome and a collection module of the invention. This embodiment of a collection module is for use with standard craniotomes and is illustrated to the left before attachment to the tool. [0049] FIG. 9 is an elevation view of the craniotome of FIG. 8 with the collection module and the pneumatic line attached. [0050] FIG. 9A is a view of the left end of FIG. 9. [0051] FIG. 10 is a section view of FIG. 9A taken at section line 10 - 10 of FIG. 9. [0052] FIG. 11 is an elevation view of the collection module of FIGS. 8-10. [0053] FIG. 12 is a distal end view of FIG. 11. [0054] FIG. 13 is a section view of the collection module of FIGS. 11 and 12 taken at section line 13 - 13 of FIG. 12. [0055] FIG. 14 is an illustration of an apparatus of the invention in operation during a cranial osteotomy. [0056] FIG. 15 is a perspective view of a drill guide of the invention which can suction and collect bone particulate during a bone drilling procedure. [0057] FIG. 16 is a bottom view of FIG. 15. [0058] FIGS. 17 and 18 are partial section views of FIG. 16. FIG. 17 is taken at section line 17 - 17 of FIG. 16 and FIG. 18 is taken at section line 18 - 18 of FIG. 16. [0059] FIG. 19 is a perspective view of the guide of FIG. 15 illustrating the relationship of the guide to a drill and a bone plate. [0060] FIG. 20 is a partial section of FIG. 19 taken at section line 20 - 20 of FIG. 19. [0061] FIG. 21 is a perspective view of another embodiment of a bone particulate collection system for use with a drill. [0062] FIG. 22 is a distal end view of FIG. 21. [0063] FIG. 23 is a section view of FIG. 22 taken at section line 23 - 23 of FIG. 22. [0064] FIG. 24 is an elevation view of a transparent embodiment of the FIG. 21 collection module affixed to a drill. [0065] FIG. 25 is an enlarged section view of a portion of FIG. 24. [0066] FIG. 26 illustrates a sterile containment module of the invention. DESCRIPTION OF THE PREFERRED EMBODIMENT [0067] FIG. 1 is an expanded perspective view of a bone cutting tool of the invention having integral irrigation and suction systems. The tool is a craniotome which is used to cut an opening in the skull for brain surgery. The craniotome 1 is attached to a handpiece 2 which in turn is attached to a pneumatic line 3 (see FIGS. 2-4 ) or an electric power source. Cutting burr 5 has a diameter and an axis and is actuated by a foot switch (not shown). And the foot plate 6 is used to guide the tool along the inside of the skull in order to prevent penetration of the dura. A suction tube 11 is provided with a barbed fitting 12 and an irrigation tube 13 has a barbed fitting 14. Collection module 10 is illustrated before it is attached to craniotome 1. [0068] FIG. 2 is a perspective view of FIG. 1 with the collection module 10 of the invention attached to the craniotome. A flexible bellows 15 is shown in this embodiment with a cylindrical duct in the form of shield 16 and a cap in the form of elastomeric seal 17 affixed at the distal end of the shield, the proximal end of the shield being affixed to the distal end of the bellows. The shield 16 has a diameter and is approximately coaxial with the axis of the cutting burr 5. The shield normally will be comprised of a relatively stiff, clear plastic tube. [0069] FIG. 3 is an elevation view of FIG. 2 and FIG. 4 is a section view of FIG. 3. [0070] FIG. 4 illustrates suction tube 11 which has an open mouth 23 at its distal end around cutting burr 5. FIG. 4A is a different section view of FIG. 3 which illustrates irrigation tube 13 of the irrigation system. [0071] FIG. 5 illustrates the collection module 10 in an elevation view and FIG. 6 illustrates the distal end of the collection module 10. FIG. 7 is a section view of the collection module 10. [0072] FIG. 8 illustrates in expanded elevation another embodiment of the invention. Collection module 110 is made for use with a standard prior art craniotome 101, the craniotome having a distal end 102. FIG. 9 is an elevation view of craniotome 101 with collection module 110 affixed thereto. The collection module 110 comprises a housing 103 (see also FIG. 13 ) having an inner wall 104, an outer wall 107 coaxially disposed around the inner wall and spaced therefrom, and an end wall 108 capping the distal end of the outer wall. The collection module 110 further comprises a suction tube 111 having a barbed fitting 112, an irrigation tube 113 having a barbed fitting 114, a flexible bellows 115 and a clear cylindrical tubular shield 116, the flexible bellows 115 and tubular shield 116 disposed around the housing 103 and extending distally beyond the distal end thereof. An optional indicator tab 119 is also illustrated. The craniotome has a foot plate 106 and a cutting burr 105. [0073] FIG. 10 is a section view of FIG. 9 illustrating the relationship of the elements of collection module 110 to the craniotome 101. In particular, the suction tube 111 connects to a suction channel 121 and the irrigation tube 113 connects to an irrigation channel 123, the suction channel 121 and the irrigation channel 123 being disposed between the inner wall 104 and the outer wall 107. [0074] FIG. 11 is an elevation view of the collection module 110 by itself. The collection module 110 provides the irrigation and suction capability needed to carry out the objectives of the invention when a standard craniotome having no irrigation or suction capability is employed. (Some commercially available craniotomes have irrigation capability in which case the embodiment of FIG. 11 described herein can be made with suction capability but without irrigation capability as will be apparent to those skilled in the art.) This embodiment does not employ a seal of the type illustrated as element 17 in FIGS. 1-7. In FIG. 12, the distal end of the module is illustrated with a slot or opening 118 for a cutting burr and foot plate. An irrigation port 133 is also provided in end wall 108. Referring to the section view FIG. 13, the irrigation port 133 and the irrigation channel 123 are illustrated as well as the suction channel 121 and a suction port 131. [0075] FIG. 8 illustrates in expanded elevation another embodiment of the invention. Collection module 110 is made for use with a standard prior art craniotome 101. FIG. 9 is an elevation view of craniotome 101 with collection module 110 affixed thereto. The collection module 110 comprises a suction tube 111 having a barbed fitting 112, an irrigation tube 113 having a barbed fitting 114, a flexible bellows 115 and a clear tubular shield 116. An optional indicator tab 119 is also illustrated. The craniotome has a foot plate 106 and a cutting burr 105. [0076] The collection module 10 is adapted to the distal end of the craniotome 1 (as shown in FIGS. 2-4 ). Module 10 mates with the outer diameter of the craniotome 1 and is sealingly engaged therewith. The two are aligned in the correct orientation to set the slot 18 in the seal 17 in-line with the footplate 6. The burr 5 extends through slot 18 as illustrated in FIGS. 2 and 3. Slot 18 must be larger than burr 5, as illustrated, and the diameter of shield 16 must be larger than slot 18 as illustrated in FIGS. 3, 4, 4 A, 6 and 7. Optional indicator tabs 19 (in the direction that the instrument will cut, arrow 20 ) can be used to facilitate correct orientation. The bellows 15 is constructed from an elastomer, allowing it to flex so that the distal portion of the collection module 10 can follow the irregularities of the skull 30 without excessive resistance. On the other end of the bellows is an internal lip seal 22 which prevents debris from being forced into the radial space between the craniotome 1 and the bellows 15. It should be noted that the cutting burr, or the drill bit or saw blade in other tools, may or may not extend beyond the distal end of the module when the tool is not in use. This is because the collection module is sufficiently flexible to allow such burr, bit or blade to extend beyond the distal end of the module when the tool is in use. [0077] FIG. 10 is a section view of FIG. 9 illustrating the relationship of the elements of collection module 110 to the craniotome 101. In particular, the suction tube 111 connects to a suction channel 121 and the irrigation tube 113 connects to an irrigation channel 123. [0078] FIG. 15 is a perspective view of a drill guide of the invention which can suction and collect bone particulate in a sterile environment during a bone drilling procedure. The guide 201 comprises a handle 202 and a collection module 210. Sterile vacuum tube 241 connects to suction tube 211 and irrigant supply tube 243 connects to irrigation tube 213 during operation of the guide. Slot or opening 218 accommodates a drill bit 205 (see FIGS. 19 and 20 ) and irrigation and suctioning take place generally through the same opening. A bottom view of guide 201 is illustrated in FIG. 16. [0079] FIG. 11 is an elevation view of the collection module 110 by itself. The collection module 110 provides the irrigation and suction capability needed to carry out the objectives of the invention when a standard craniotome having no irrigation or suction capability is employed. (Some commercially available craniotomes have irrigation capability in which case the embodiment of FIG. 11 described herein can be made with suction capability but without irrigation capability as will be apparent to those skilled in the art.) This embodiment does not employ a seal of the type illustrated as element 17 in FIGS. 1-7. In FIG. 12, the distal end of the module is illustrated with an opening 118 for a cutting burr and foot plate. An irrigation port 133 is also provided. Referring to the section view FIG. 13, the irrigation port 133 and the irrigation channel 123 are illustrated as well as the suction channel 121 and a suction port 131. [0080] FIG. 14 illustrates the operation of the distal (cutting) end of the embodiment of the invention illustrated in FIGS. 1-7. The craniotome 1 has a cutting burr 5 (and burr shaft 5 a ) and an integral foot plate 6. Unlike current instruments, however, the improved craniotome of the invention has many advantageous features. In this embodiment, the craniotome also incorporates internal passages for suction and irrigation. Each of these terminates proximally in a barbed fitting. The collection module 10 comprises an elastomeric bellows 15, a clear tubular shield 16 and an elastomeric seal 17. The collection module can constitute a preassembled, sterile, disposable item, although other configurations are certainly possible. [0081] The collection module 10 is adapted to the distal end of the craniotome 1 (as shown in FIGS. 2-4 ). Module 10 mates with the outer diameter of the craniotome 1 and is sealingly engaged therewith. The two are aligned in the correct orientation to set the slot 18 in the seal 17 in-line with the footplate 6. Optional indicator tabs 19 (in the direction that the instrument will cut, arrow 20 ) can be used to facilitate correct orientation. The bellows 15 is constructed from an elastomer, allowing it to flex so that the distal portion of the collection module 10 can follow the irregularities of the skull 30 without excessive resistance. On the other end of the bellows is an internal lip seal 22 which prevents debris from being forced into the radial space between the craniotome 1 and the bellows 15. It should be noted that the cutting burr, or the drill bit or saw blade in other tools, may or may not extend beyond the distal end of the module when the tool is not in use. This is because the collection module is sufficiently flexible to allow such burr, bit or blade to extend beyond the distal end of the module when the tool is in use. [0082] The shield 16 is a relatively stiff, clear tubular section that forms the radial wall of the collection module 10. Attached to the distal end of the shield 16 is the elastomeric seal 17. Ideally this would be a relatively clear material as well to aid in visualizing the cut. The seal 17 has an optionally, outwardly domed flexible end with a slot 18 to better contain and suction the bone particulate. The domed shape limits the contact area with the bone to reduce resistance. As the surgeon operates the craniotome, he applies both sideways force to cut as well as upward force to keep the tip of the footplate 6 in contact with the underside of the skull. This allows the footplate to ride between the dura 4 (the outer covering of the brain 104 ) and the inner table of the skull 30. Ahead of the cutting burr 5 is solid skull 30 and trailing the cutting burr is the kerf 31. The rotation of the cutting burr 5 and its helical flutes help to draw much of the bone particulate 32 upwards into a collection chamber 24 of the collection module. A funnel shaped depression or mouth 23 at the junction of the suction tube 11 and the distal face of the craniotome guides these bone fragments into the suction tube 11 and draws in by vacuum additional bone particles, irrigant and bodily fluids. The suction tube 11 is connected to a sterile vacuum tube 40. A barbed fitting 12 is provided for this connection. The sterile vacuum tube 40 is connected downstream to a containment module 60 as will be discussed later. (See FIG. 26.) Suction is applied to tube 40 and the result is that all material aspirated into the collection module 10 (bone fragments, irrigant, blood, tissue, etc.) is evacuated in the direction of arrow 41. The irrigation system is not illustrated because it is behind the suction system in this drawing. But the irrigation system is illustrated and discussed above in connection with FIGS. 1, 2 and 4 A. Irrigant supply can be most easily provided from a pressurized IV bag of saline or from a hand syringe, peristaltic pump, sterile compressed gas source, or other common means. When the irrigant is a combination of gas and liquid an additional channel can be provided in either the craniotome of the invention (see FIGS. 1-4 and 14 ) or the collection module, for the purpose of introducing a second irrigation means. This additional channel could communicate with the liquid channel to serve as a mixing device as will be apparent to those having skill in the art based on the disclosures herein. [0083] FIG. 23 is a section view of collection module 310 illustrating a collection chamber 321 and irrigation duct 323 in relation to slot or opening 318. [0084] FIG. 15 is a perspective view of a drill guide of the invention which can suction and collect bone particulate in a sterile environment during a bone drilling procedure. The guide 201 comprises a handle 202 and a collection module 210. Sterile vacuum tube 241 connects to suction tube 211 and irrigant supply tube 243 connects to irrigation tube 213 during operation of the guide. Opening 218 accommodates a drill bit 205 (see FIGS. 19 and 20 ) and irrigation and suctioning take place generally through the same opening. A bottom view of guide 201 is illustrated in FIG. 16. [0085] FIGS. 17 and 18 are section views of collection module 210 taken through line A-A and line B-B, respectively, of FIG. 16. The FIG. 17 section illustrates a barbed fitting 212 at the end of suction tube 211 and the connection of tube 211 with suction chamber 221. Irrigation channel 223 and irrigation ports 233 are illustrated. The FIG. 18 section illustrates another part of suction chamber 221. The FIG. 18 section also illustrates the barbed fitting 214 at the end of irrigation tube 213 and the connection of tube 213 with irrigation channel 223. [0086] A perspective view illustrating the relationship of the guide with a drill 203, drill bit 205 and a bone plate 206 is illustrated in FIG. 19. FIG. 20 is a partial section of FIG. 19 illustrating the relationship of drill bit 205 to the suction chamber 221, irrigation channel 223 and irrigation ports 233. During drilling, bone particulate is carried upward by the drill bit 205 and by suction. Suction vacuum tube 241 is connected to suction tube 211 and the particulate bone is carried by vacuum to a sterile containment module 60 (see FIG. 26 ). The operating area is irrigated by irrigant exiting irrigation ports 233. [0087] FIG. 21 is a perspective view of another embodiment of a bone particulate collection system for use with a drill. Collection module 310 is comprised of an outer telescoping section 301 and an inner telescoping section 302. A spring 304 is biased between section 301 and distal end section 303. When drilling, inner telescoping section 302 telescopes into outer telescoping section 301 and when the drilling is complete spring 304 returns section 302 to its original position (as illustrated). Sterile vacuum tube 341 and irrigant supply tube 343 are also illustrated. [0088] FIG. 22 is a distal end view of the collection module 310 also illustrating opening 318 which accommodates a drill bit 305 (see FIGS. 24 and 25 ) and irrigation and suctioning take place through the same opening. [0089] FIG. 23 is a section view of collection module 310 illustrating a collection chamber 321 and irrigation duct 323 in relation to opening 318. [0090] FIG. 24 is an elevation view of a transparent embodiment of collection module 310 affixed to drill 303 having a drill bit 305. An enlarged section view of a portion of FIG. 24 is provided in FIG. 25. Arrow 320 illustrates the direction of the telescoping movement of section 302 into section 301 when the drill bit is drilled into a bone. Spring 304 causes section 302 to return to the position illustrated when drilling is completed. Sterile vacuum tube 341 is in suctioning communication with suction chamber 321 and irrigant supply tube 343 is in irrigating communication with irrigation duct 323. The suctioning and irrigating operations function in the same manner as the other embodiments of the invention discussed above. [0091] FIGS. 1-25 depict just a few possible configurations of a cutting or drilling and collection apparatus of the invention which would be consistent with the method of the invention. The principles of the invention can easily be adapted to other osteotomy instruments (e.g. an oscillating saw, a rotary saw or a reciprocating saw) to achieve the same results. [0092] According to the method of the invention, a surgeon can simultaneously cut or drill bone and irrigate and suction with essentially no additional effort. Eliminated is the splatter of the irrigant and cutting debris and also the need for an assistant to precisely coordinate with the movements of the surgeon as he or she irrigates and suctions. These benefits however, are secondary to the main purpose of the apparatus and method of the invention, namely, the ability to collect the sterile bone particulate generated by the osteotomy or drilling process for use in the reconstructive portion of the procedure. [0093] FIG. 26 illustrates an embodiment of a sterile containment module 60 for the separation of the bone particles 32 from liquids 33, the liquids comprising irrigant and body fluids. Unlike traditional hospital suction systems, this is a sterile system so that the bone particles collected can be reused in the reconstructive portion of surgery. [0094] The aspirate from the containment chamber is conveyed though the sterile vacuum tube 40 to the containment module 60. The aspirate consists of bone particles, irrigant, small amounts of tissue, blood and other body fluids. The containment module comprises three sterile parts: the canister 61, the collection cup 62 and the cover 63. Of course, other embodiments are certainly possible and would be apparent to those skilled in the art based upon the disclosures herein. It is envisioned that all three items would be provided as a sterile unit for single use. All could be produced (molded) from a clear polymer for visualizing the contents. The suction tube 40 connects to a fitting 64 molded into the cover. A second fitting 65 is then connected to the hospital suction system in a sterile fashion through tube 66. The suction travels in the direction of the arrows 67. When the aspirate enters the canister 61, a deflector 68 forces the flow downward and gravity then separates the contents (solid and liquid) from the air flow. The solids and liquids fall into the cup 62 and settle to the bottom where perforations 69 allow the liquid to drain into the bottom of the canister 61. Optionally the cup may be fitted with a filter to better trap the smaller bone particles. At the conclusion of the osteotomy or drilling procedure, the bone particles in the cup can be left to drain until needed, at which point the cover 63 is removed and the cup 62 is extracted with its sterile contents. As mentioned previously, the bone particles can then be used “as is” or mixed with other biological additives for use in the reconstructive portion of the procedure. [0095] In today's operating room environment, the contents of the canister 61 described above are simply suctioned into the non-sterile hospital system and discarded. A valuable and much-needed commodity, (autologous) bone graft, is simply wasted and later replaced with autograft harvested from a second site, allograft or with alloplastic materials. SUMMARY: [/INST] An apparatus and method for collecting particulate bone from the operating site during an osteotomy or bone drilling procedure so that it can be used subsequently to augment the bone fusion process. A bone cutting or drilling tool is provided with a module for collecting particulate bone simultaneously with cutting or drilling the bone. The collected particulate bone is transferred continuously to a sterile containment module and maintained under sterile conditions until it is prepared for re-use in the patient. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: MEXICO CITY (AP) — Police arrested more than 200 people in the Mexican border state of Baja California in a bid to quash protests and road blockages by farmworkers demanding higher wages, officials said Wednesday. Farmworkers around the town of San Quintin often make less than $8 a day picking fruit and vegetables. They want wages raised to about $20 a day, according to some protesters. In a statement posted on the website of one of the organizers, the workers said they want overtime pay, benefits, medical care and an end to sexual harassment by bosses. The stoppages have affected the rich agricultural area south of the coastal city of Ensenada. Many of the large farms export much of their produce to the United States, while many of the farm workers come from poor southern states like Oaxaca and Chiapas. The Baja California state government said the 200 were arrested on suspicion of vandalism and blocking roads. Photos from the protests showed some demonstrators starting trash fires on roads. Authorities offered increased inspections to guarantee working conditions for about 1,200 day laborers who have no union representation. The state government vowed to keep the roads open and said authorities "warned that there will be no tolerance for those who use demonstrations to act outside the law." The U.S. consulate in Tijuana said the stoppages began Tuesday and advised travelers to exercise caution. The highway is the main route along the Baja peninsula. A Times reporter and photographer find that thousands of laborers at Mexico's mega-farms endure harsh conditions and exploitation while supplying produce for American consumers. At the end of the day, Roma tomatoes are ready for transport in Cristo Rey in the state of Sinaloa. Half the tomatoes consumed in the U.S. come from Mexico. The tomatoes, peppers and cucumbers arrive year-round by the ton, with peel-off stickers proclaiming "Product of Mexico." ADVERTISEMENT Farm exports to the U.S. from Mexico have tripled to $7.6 billion in the last decade, enriching agribusinesses, distributors and retailers. American consumers get all the salsa, squash and melons they can eat at affordable prices. And top U.S. brands — Wal-Mart, Whole Foods, Subway and Safeway, among many others — profit from produce they have come to depend on. These corporations say their Mexican suppliers have committed to decent treatment and living conditions for workers. But a Los Angeles Times investigation found that for thousands of farm laborers south of the border, the export boom is a story of exploitation and extreme hardship. The Times found: Many farm laborers are essentially trapped for months at a time in rat-infested camps, often without beds and sometimes without functioning toilets or a reliable water supply. Some camp bosses illegally withhold wages to prevent workers from leaving during peak harvest periods. Laborers often go deep in debt paying inflated prices for necessities at company stores. Some are reduced to scavenging for food when their credit is cut off. It's common for laborers to head home penniless at the end of a harvest. Those who seek to escape their debts and miserable living conditions have to contend with guards, barbed-wire fences and sometimes threats of violence from camp supervisors. Major U.S. companies have done little to enforce social responsibility guidelines that call for basic worker protections such as clean housing and fair pay practices. The farm laborers are mostly indigenous people from Mexico's poorest regions. Bused hundreds of miles to vast agricultural complexes, they work six days a week for the equivalent of $8 to $12 a day. The squalid camps where they live, sometimes sleeping on scraps of cardboard on concrete floors, are operated by the same agribusinesses that employ advanced growing techniques and sanitary measures in their fields and greenhouses. The contrast between the treatment of produce and of people is stark. Clockwise from top: At Campo Sacramento in Guasave, Sinaloa, barbed wire runs along the perimeter, and arrivals and departures are controlled around the clock. After a long day of work, laborers crowd in the bed of an open truck. At Campo San Jose, Lucio Marquez Garcia, right, dines with his family on food that they picked. Son Luis, 17, says, "It's hard to sleep because of all the TVs and drunks making noise. You wake up so tired you don't feel like working." In immaculate greenhouses, laborers are ordered to use hand sanitizers and schooled in how to pamper the produce. They're required to keep their fingernails carefully trimmed so the fruit will arrive unblemished in U.S. supermarkets. "They want us to take such great care of the tomatoes, but they don't take care of us," said Japolina Jaimez, a field hand at Rene Produce, a grower of tomatoes, peppers and cucumbers in the northwestern state of Sinaloa. "Look at how we live." He pointed to co-workers and their children, bathing in an irrigation canal because the camp's showers had no water that day. At the mega-farms that supply major American retailers, child labor has been largely eradicated. But on many small and mid-sized farms, children still work the fields, picking chiles, tomatillos and other produce, some of which makes its way to the U.S. through middlemen. About 100,000 children younger than 14 pick crops for pay, according to the Mexican government's most recent estimate. Pedro Vasquez, working the chile pepper fields near Leon, Guanajuato, is one of the estimated 100,000 Mexican children younger than 14 who pick crops for pay, according to the government’s most recent estimate. He is 9 years old. During The Times' 18-month investigation, a reporter and a photographer traveled across nine Mexican states, observing conditions at farm labor camps and interviewing hundreds of workers. At half the 30 camps they visited, laborers were in effect prevented from leaving because their wages were being withheld or they owed money to the company store, or both. Some of the worst camps were linked to companies that have been lauded by government and industry groups. Mexico's President Enrique Peña Nieto presented at least two of them with "exporter of the year" honors. The Times traced produce from fields to U.S. supermarket shelves using Mexican government export data, food safety reports from independent auditors, California pesticide surveys that identify the origin of imported produce, and numerous interviews with company officials and industry experts. The practice of withholding wages, although barred by Mexican law, persists, especially for workers recruited from indigenous areas, according to government officials and a 2010 report by the federal Secretariat of Social Development. These laborers typically work under three-month contracts and are not paid until the end. The law says they must be paid weekly. The Times visited five big export farms where wages were being withheld. Each employed hundreds of workers. Wal-Mart, the world's largest retailer, bought produce directly or through middlemen from at least three of those farms, The Times found. Bosses at one of Mexico's biggest growers, Bioparques de Occidente in the state of Jalisco, not only withheld wages but kept hundreds of workers in a labor camp against their will and beat some who tried to escape, according to laborers and Mexican authorities. Asked about its ties to Bioparques and other farms where workers were exploited, Wal-Mart released this statement: "We care about the men and women in our supply chain, and recognize that challenges remain in this industry. We know the world is a big place. While our standards and audits make things better around the world, we won't catch every instance when people do things that are wrong." “ The real truth is that we're work animals for the fields. — Pasqual Garcia, farmworker Watch more At Rene Produce in Sinaloa, The Times saw hungry laborers hunting for scraps because they could not afford to buy food at the company store. The grower, which exported $55 million in tomatoes in 2014, supplies supermarkets across the U.S., including Whole Foods, which recently took out full-page newspaper ads promoting its commitment to social responsibility. Asked for comment, Whole Foods said it did not expect to buy any more produce "directly" from Rene, which it described as a minor supplier. The produce pipeline: A case study » Agricola San Emilio is a Mexican agribusiness where workers endured abusive conditions. Using public records, private market data and interviews, The Times traced produce from San Emilio to the United States. "We take the findings you shared VERY seriously, especially since Rene has signed our social accountability agreement," Edmund LaMacchia, a global vice president of procurement for Whole Foods, said in a statement. Rene Produce was named one of Mexico's exporters of the year in September. Jose Humberto Garcia, the company's chief operating officer, said Rene had consulted with outside experts about ways to enhance worker welfare. "We have tried in recent years to improve the lives of our workers," he said. "There's still room for improvement. There's always room for improvement." Executives at Triple H in Sinaloa, another exporter of the year and a distributor for major supermarkets across the U.S., said they were surprised to hear about abusive labor practices at farms including one of their suppliers, Agricola San Emilio. "It completely violates our principles," said Heriberto Vlaminck, Triple H's general director. His son Heriberto Vlaminck Jr., the company's commercial director, added: "I find it incredible that people work under these conditions." In northern Mexico, agro-industrial complexes stretch for miles across coastal plains and inland valleys, their white rows of tent-like hothouses so vast they can be seen from space. Half the tomatoes consumed in the U.S. come from Mexico, mostly from the area around Culiacan, the capital of Sinaloa. Many farms use growing techniques from Europe. Walls of tomato vines grow 10 feet tall and are picked by laborers on stilts. Agricola San Emilio raises crops on 370 acres of open fields and greenhouses 20 miles west of Culiacan. In a tin-roofed packinghouse, tomatoes, bell peppers and cucumbers are boxed for the journey north to distributors for Wal-Mart, Olive Garden, Safeway, Subway and other retailers. Sinaloa is home to some of the largest export farms in Mexico. Upper left: Growing houses at International Greenhouse Produce in Villa Benito Juarez employ modern techniques to protect crops against insects and to strictly regulate water, fertilizer and light. A worker, upper right, loads just-picked Roma tomatoes at Agricola El Porvenir. Above: International Greenhouse Produce operates one of the largest contiguous greenhouse complexes in North America. ADVERTISEMENT In 2014, the company exported more than 80 million pounds of tomatoes alone, according to government data. Every winter, 1,000 workers arrive at San Emilio by bus with backpacks and blankets, hoping to make enough money to support family members back home. Some simply want to stay fed. Behind the packing facility lies the company's main labor camp, a cluster of low-slung buildings made of cinder block or corrugated metal where about 500 laborers live. The shed-like structures are crudely partitioned into tiny rooms that house four to six people each. The floors are concrete. There are no beds or other furniture, nor any windows. The workers' day begins at 3 a.m. when a freight train known as "The Beast" rumbles past the dusty camp, rousting the inhabitants. They get coffee, a biscuit and a short stack of tortillas before heading to the fields. When Times journalists visited the camp in March, Juan Ramirez, a 22-year-old with a toddler back home in Veracruz, had been working at San Emilio for six weeks and had yet to be paid. He and other laborers spent their days picking, packing and pruning, or scouring the plants for weevils. They lined up for their daily meals: a bowl of lentil soup for lunch, a bowl of lentil soup for dinner. “ I want to go.... But if I leave, I lose everything. ” — Juan Hernandez, farmworker Share this quote Ramirez, wearing a stained white T-shirt, chatted with two young men who were recent arrivals. They complained of hunger and constant headaches. Ramirez knew the feeling. He had lost 20 pounds since starting work at the farm. "We arrive here fat, and leave skinny," he said. Ramirez and several hundred others recruited by the same labor contractor earned $8 a day and were owed as much as $300 each. They said they wouldn't be paid until the end of their three-month contracts. That would be in six more weeks. Workers said they had been promised $8 in pocket money every two weeks but received it only sporadically. If they left now, they would forfeit the wages they'd earned. The barbed-wire fence that ringed the camp was an added deterrent. Farm owners say the barriers are meant to keep out thieves and drug dealers. They also serve another purpose: to discourage laborers from leaving before the crop has been picked and they've paid their debts to the company store. Even if the workers at San Emilio jumped the fence, as some had, they wouldn't be able to afford a ride to Culiacan, let alone $100 for the bus ticket home. Juan Hernandez, a father of five from Veracruz, was worried about his wife, who had been injured in an accident back home. "I want to go," he said. "But if I leave, I lose everything." Hernandez slept atop packing crates padded with cardboard. A suitcase served as his dinner table. In another building, Jacinto Santiago hung a scrap of cardboard in the open doorway of his room, which he shared with his son, daughter and son-in-law. Laborers at Campo San Emilio, Sinaloa, sleep in their windowless rooms on vegetable crates and scraps of cardboard. Juan Hernandez, far right, wanted to visit his ailing wife in Veracruz. "But if I leave, I lose everything," he says. A family of indigenous migrant farmworkers from Guerrero waits by a tomato field in Teacapan, Sinaloa. Each earning as little as $8 a day, they have little money to buy sturdy shoes. Santiago said that in some ways, he had been better off back home in the central state of San Luis Potosi. There, he had a thatched-roof house with windows and a hen that laid eggs. Santiago, like the other laborers, said he was promised that he would be able to send money home. His family was still waiting, because he hadn't been paid. "My family isn't the only one that suffers. Anyone who has a family at home suffers," he said. Efrain Hernandez, 18, said recruiters told him his earnings would be held back so he wouldn't get robbed: "They said it was for my own good." Outside one of the buildings, a group of men gathered under a dim light. It was nearing the 9 p.m. curfew, when the camp's heavy metal gate rolls shut and workers retreat to their rooms. Their voices echoed across the compound as they swapped stories about conditions in various camps. There are at least 200 across Mexico, 150 in Sinaloa alone. Pedro Hernandez, 51, complained that unlike some other camps, San Emilio didn't offer beds or blankets. Then again, there were fewer rats, he said. The conversation attracted a camp supervisor, who was surprised to see a reporter and photographer. "When the people from Wal-Mart come," she said, "they let us know in advance." She walked the journalists to the exit. The pickers went back to their rooms. The gate rolled shut. The road to labor camps like San Emilio begins deep in the indigenous regions of central and southern Mexico, where advertising jingles play endlessly on the radio, echoing from storefront speakers. "Attention. Attention. We are looking for 400 peasants to pick tomatoes." "You'll earn 100 pesos per day, three free meals per day and overtime." "Vamonos a trabajar!" — Let's go work! On a warm January morning this year, dozens of indigenous people looking for work descended from mud-hut villages in the steep mountains of the Huasteca region. Nahuatl men wore holstered machetes. Women cradled children in their arms. Young men shouldered backpacks stuffed with the clothes they would wear for the next few months. The laborers approached a knot of recruiters gathered outside a gas station in the town of Huejutla de Reyes, about 130 miles north of Mexico City. Long march for meager pay Peasants from Mexico's indigenous regions are bused to export farms in the west and northwest to pick and process fruits and vegetables. The Huasteca region is a prime source of agricultural labor. Among those offering jobs at distant farms was Luis Garcia, 37. Garcia, a stocky Nahuatl Indian with silver-rimmed teeth, had risen from child picker to field boss to labor contractor for Agricola San Emilio. He lived just outside town, in a hilltop house behind tall gates, and was known to locals as "Don Luis." "We all owe our livelihoods to the farmworkers," he said. "We have to treat them well, or the gringos don't get their tomatoes." Labor contractors are key players in the agricultural economy, the link between export farms in the north and peasants in Huasteca and other impoverished regions. An estimated 150,000 make the pilgrimage every harvest season. The contractors, working for agribusinesses, transport laborers to and from the farms. Often, they also oversee the camps and distribute workers' pay. Many contractors abuse their power, according to indigenous leaders and federal inspectors. They lie about wages and living conditions at the camps. Under pressure from growers, they sometimes refuse to bring laborers home, even at the end of their contracts, if there are still vegetables to be picked. Earlier this year, 25 farmworkers walked 20 miles across a Baja California desert after a contractor left them on the roadside, short of their destination. At the gas station in Huejutla de Reyes, villagers listened warily to the recruiters' pitches. One was said to be representing a contractor wanted on human trafficking charges. Another worked for a contractor notorious for wage theft and other abuses. Garcia had his own brush with controversy several years ago, when dozens of pickers accused him of holding them captive and abusing them at an onion farm in Chihuahua. "They said I beat people. Lies, all lies," Garcia said, bristling. "I wouldn't be here today talking to you if it was true, would I?" He depicted himself as a reformer who wanted to establish a trade association to set standards and drive out unscrupulous contractors. “ The gringos are the ones that put up the money and make the rules ” — Luis Garcia, labor contractor Share this quote But he saw no need to do more for workers. "The more protected they are, the less they work," he said. As he spoke, recruiters tried to outbid one another for laborers, boosting their offers of spending money for the two-day bus trip to Sinaloa. Garcia won the day's competition. With his smooth baritone, he persuaded about 40 people to get on his bus. Garcia read their contract aloud to the workers, including the provision that they wouldn't be paid until the end of their three-month term. He later acknowledged that federal law requires weekly payments but said that there were other issues to consider. "Paying them every week is a problem because it causes lots of issues with drinking and drugging and violence," Garcia said. "Huasteca people are fighters when they're drunk." Proud of his success in a cutthroat business, Garcia portrayed himself as the product of a farm labor system in which the real bosses were U.S. companies. "The gringos are the ones that put up the money and make the rules," he said. Jenobeba Diaz Matia bathes her 9-month-old son in a basin where fellow residents wash dishes and clothes at their government-run camp in Isla del Bosque, Sinaloa. The U.S. companies linked to Agricola San Emilio through distributors have plenty of rules, but they serve mainly to protect American consumers, not Mexican field hands. Strict U.S. laws govern the safety and cleanliness of imported fruits and vegetables. To meet those standards, retailers and distributors send inspectors to Mexico to examine fields, greenhouses and packing plants. The companies say they are also committed to workers' well-being and cite their ethical sourcing guidelines. Retailers increasingly promote the idea that the food they sell not only is tasty and healthful but was produced without exploiting workers. But at many big corporations, enforcement of those standards is weak to nonexistent, and often relies on Mexican growers to monitor themselves, The Times found. In some low-wage countries, U.S. retailers rely on independent auditors to verify that suppliers in apparel, footwear and other industries comply with social responsibility guidelines. For the most part, that has not happened with Mexican farm labor. American companies have not made oversight a priority because they haven't been pressured to do so. There is little public awareness of harsh conditions at labor camps. Many farms are in areas torn by drug violence, which has discouraged media coverage and visits by human rights groups and academic researchers. Asked to comment on conditions at Agricola San Emilio, Subway said in a statement: "We will use this opportunity to reinforce our Code of Conduct with our suppliers." The code says suppliers must ensure that workers "are fairly compensated and are not exploited in any way." Industry talking points Growers, distributors and importers of Mexican farm produce got "sample talking points" from an industry trade group that learned The Times was preparing this series. Read the memo » Safeway said: "We take any and all claims regarding worker conditions seriously and are looking into each of the points you raise." In its vendor code of conduct, Safeway says that suppliers must offer a "safe and healthy work environment" and that it "will not tolerate any departure from its standards." Vendors are expected to "self-monitor their compliance," the code says. Wal-Mart sought to distance itself from Agricola San Emilio, saying in a statement: "Our records show that we do not currently take from this facility." Asked if it had received produce from the farm in the past, Wal-Mart repeated its statement. Executives at Agricola San Emilio and two firms that have distributed its produce — Triple H of Culiacan and Andrew & Williamson of San Diego — said Wal-Mart received shipments from the Mexican farm this year. John Farrington, chief operating officer at Andrew & Williamson, said that his company shipped San Emilio tomatoes to the retailer and that inspectors from Wal-Mart had been to the farm. Mari Cabanillas, an assistant camp supervisor at Agricola San Emilio, said Wal-Mart inspectors visited regularly, recommending cleanups and fresh coats of paint. "They try and improve conditions here," she said. "They're very strict." As for Agricola San Emilio's pay practices, Daniel Beltran, the firm's director and legal counsel, said workers from the Huasteca region whose wages were withheld until the end of their three-month contracts had agreed to that arrangement. He said they could opt to be paid weekly, as others were. A dozen workers, however, said in interviews that they had no choice in how they were paid. Withholding workers' pay is illegal even if they agree to it, according to Mexico's federal labor law, a senior federal labor official and two labor lawyers. In regard to living conditions, Beltran said the company stopped providing beds because workers dismantled them for firewood. The laborers are from regions where it's common for people to sleep on the floor, he said. Enforcement of Mexican labor laws in Sinaloa is feeble. One state official insisted, incorrectly, that withholding wages until the end of a contract was legal. He took issue with workers' claims that they were underfed. "Some people, even if you give them chicken or beef every day, they'll still want a different menu," he said, adding that workers could supplement company rations by purchasing food from vendors. SunFed, an Arizona firm that has distributed produce from Agricola San Emilio, said its representatives had inspected the fields and packinghouse at the farm but not the labor camp. "The Mexican government would be the first line of protection for Mexican workers," said Dan Mandel, president of SunFed, a distributor for supermarkets across the U.S. Enforcement of Mexican labor laws in Sinaloa is feeble. One state official insisted, incorrectly, that withholding wages until the end of a contract was legal. Federal labor inspectors are clear on the law but said they were largely powerless to crack down on deep-pocketed growers, who can stymie enforcement with endless appeals. "They just laugh at us," said Armando Guzman, a senior official with Mexico's federal Secretariat of Labor and Social Welfare. "They mock authority and mock the letter of the law." Agricola San Emilio is no outlier. Harsh conditions persist in many camps. At Agricola Rita Rosario, a cucumber exporter near Culiacan in Sinaloa, workers said they hadn't been paid in weeks. Some were pawning their belongings to pay for diapers and food when Times journalists visited a year ago. Laborers said company managers had threatened to dump their possessions in the street if they persisted in demanding their wages. "We have nowhere to go. We're trapped," said a 43-year-old man, looking around nervously. Rita Rosario, under new management, started paying workers their back wages this year before suspending operations, according to a U.S. distributor who did business with the farm. Workers at Agricola Santa Teresa, an export farm nearby, were doing odd jobs outside the camp on Sundays to earn spending money because their wages had been withheld. The tomato grower supplies U.S. distributors whose customers include the Albertsons supermarket chain and the Los Angeles Unified School District. Told that workers hadn't been paid, Enrique Lopez, director of Santa Teresa, said it wasn't the company's fault. Santa Teresa pays them by electronic bank deposit every week, he said. Lopez said he suspected that the laborers handed over their ATM cards to the contractor who recruited them, a practice he said was customary for workers from indigenous regions. "That is the agreement they have," Lopez said. "We can't control that situation." An LAUSD spokeswoman, Ellen Morgan, said the district requires suppliers to inspect farms from which they buy produce, primarily to ensure food safety. She said the district was formulating a new procurement policy that would probably address labor conditions too. Albertsons declined to comment. Luis Perez, 26, washes clothes after bathing in an irrigation canal outside Campo San Jose. He and fellow residents use the canal because water often runs out in the camp facilities. In March, a snake was sighted in the canal, sparking a panic. At Agricola El Porvenir, also near Culiacan, workers were required to disinfect their hands before picking cucumbers. Yet they were given just two pieces of toilet paper to use at the outhouses. At Campo San Jose, where many of them lived, workers said rats and feral cats had the run of the cramped living quarters and feasted on their leftovers. Laborers and their families bathed in an irrigation canal because the water had run out in the showers. In March, a snake was sighted in the canal, sparking a panic. Carmen Garcia stepped out of the fetid waterway after washing her 1-year-old grandson. His skin was covered with boils that she blamed on insect bites. "He itches constantly," Garcia said. "I want to get a blood test, but I can't get to a doctor." Agricola El Porvenir's legal counsel, Eric Gerardo, said the company rents Campo San Jose from another agribusiness to handle the overflow when its own camps fill up. Efforts to reach the owner of the other business were unsuccessful. "We don't invest in it because it's not ours," Gerardo said. Many families used buckets in their room to relieve themselves because, they said, the toilets were filthy and lacked water. Men defecated in a cornfield. Share this quote Twenty miles away, at Campo Isabelitas, operated by the agribusiness Nueva Yamal, families used buckets in their room to relieve themselves because, they said, the toilets were filthy and lacked water. Men defecated in a cornfield. Workers could be seen bathing in an irrigation canal; they said the camp's showers were out of water. Charles Ciruli, a co-owner of Arizona-based Ciruli Bros., which distributes Nueva Yamal tomatoes, visited the camp after being told about conditions there by The Times. Through an attorney, he said that the men's bathrooms "did not meet Ciruli's standards" and that repairs had been made to "reinstate running water." The attorney, Stanley G. Feldman, said in a letter that the women's showers and toilets were "fully functioning," with a paid attendant. Asked why workers were washing in the irrigation canal, Feldman wrote: "Ciruli cannot explain this with certainty, but it was told that it may be a cultural practice among some workers." He added: "Ciruli will consult with the on-farm social worker and doctor to determine if a worker education campaign may be appropriate in this case." In June 2013, Bioparques found itself under rare government scrutiny. Three workers at one of the tomato grower's labor camps escaped and complained to authorities about the wretched conditions. Police, soldiers and labor inspectors raided the camp and found 275 people trapped inside. Dozens were malnourished, including 24 children, authorities said. People were desperate, but at least the camp had showers and stoves, said laborer Gerardo Gonzalez Hernandez. "To tell you the truth, Bioparques was a little better than other labor camps I've been to," Gonzalez, 18, said in an interview at his home in the mountains north of Mexico City. "That's why I didn't complain. I've seen a lot worse." Cecilia Sanchez, a researcher in The Times' Mexico City bureau, contributed to this report. About this series: Los Angeles Times reporter Richard Marosi and photojournalist Don Bartletti traveled across nine Mexican states, observing conditions and interviewing workers at some of the mega-farms that have powered the country's agricultural export boom. Read the series: Part 2: A raid exposes brutal conditions at Bioparques, one of Mexico's biggest tomato exporters, which was a Wal-Mart supplier. But the effort to hold the grower accountable is looking more like a tale of impunity. Part 3: The company store is supposed to be a lifeline for migrant farm laborers. But inflated prices drive people deep into debt. Many go home penniless, obliged to work off their debts at the next harvest. Part 4: About 100,000 children under 14 pick crops for pay at small- and mid-size farms across Mexico, where child labor is illegal. Some of the produce they harvest reaches American consumers, helping to power an export boom. Video: Behind the Series Marosi and Bartletti explain what it took to get access to places that have long escaped outside scrutiny. Video Credits: Creative Director: Liz O. Baylen. Editors: Spencer Bakalar, Liz O. Baylen, Bethany Mollenkof. Music: Colin Baylen, Nathan Doiev. Executive Producer: Mary Cooney. Additional Credits: Digital Producer and Developer: Armand Emamdjomeh. Digital Design Director: Stephanie Ferrell. When Velasco and others stopped a Tijuana-bound bus during the blockade Tuesday night, they took the passengers off and escorted them to a church where they spent the night. "We told them there was no need to be scared," Velasco said. "That we only want a just salary." SUMMARY: [/INST] Cops are scuffling with laborers, protesters have blocked highways, and more than 200 arrests have been made in Mexico this week as farmworkers strike for better wages and working conditions, the Los Angeles Times reports. The strike, which started Tuesday in Baja California, is happening at the peak of harvest season in this agricultural region and is the first such demonstration in decades, the Times notes; some fear the strike could even affect produce meant for US shelves and eateries, KPBS reports. The idea for a strike began germinating after the newspaper published a scathing exposé on export-farm labor abuses in December. Among the farmhands' demands, according to an organizer's statement cited by the AP: overtime pay, benefits, medical care, and an end to sexual harassment, as well as increasing wages that often hover at less than $8 a day. Some of these companies' supporters say wages in this part of the country are higher than in other Mexican regions, and the businesses themselves refute alleged mistreatment. "Our primary focus continues to be toward the well-being of our employees," a statement from the US-based BerryMex says. But tensions are growing, with witnesses telling the Times that rocks, tear gas, and rubber bullets have flown back and forth between protesters and police; one group of demonstrators even stopped a bus and made passengers stay the night in a church. With a declining peso value exacerbating already tough conditions, farmworkers say whatever the agribusinesses are doing doesn't suffice. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Archive-It Partner 1067: The Political TV Ad Archive, a project of the Internet Archive, collects political TV ads and social media sites in key 2016 primary election states, unlocking the metadata underneath and highlighting quality journalism to provide journalists, civic organizations, academics, and the general public with reliable information on who is trying to influence them & how. The seed for this crawl was a list of every host in the Wayback Machine This crawl was run at a level 1 (URLs including their embeds, plus the URLs of all outbound links including their embeds) The WARC files associated with this crawl are not currently available to the general public. These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. Archive-It Partner 1067: The Political TV Ad Archive, a project of the Internet Archive, collects political TV ads and social media sites in key 2016 primary election states, unlocking the metadata underneath and highlighting quality journalism to provide journalists, civic organizations, academics, and the general public with reliable information on who is trying to influence them & how. These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. SUMMARY: [/INST] There are 450 days remaining until Election 2016 and about as many people in the running, so the issue that you need to know about on a lazy Sunday in August is that if you have ever dreamed of owning an unbranded thing called a "Guaca Bowle," Jeb Bush is the candidate of your dreams and he can make it happen for a mere $75. And Bush isn't the only would-be occupant of 1600 Pennsylvania Avenue hawking the wacky: The Entrepreneur rounds up a the kookiest items from the corners of the candidates' campaign stores. Highlights: Hillary Clinton's "Pantsuit Tee-shirt." You read that right. It's unisex and $30. Clinton also has a mystifying barbecue apron that reads "More like Grillary Clinton, amirite?" It urges those who "can't take the heat" to "back away from the grill." The Entrepreneur notes that Bush also has a barbecue apron, and his marketing department remembered to brand that one. Marco Rubio has a "Marco Polo." As in, shirt. It'll set you back an exploratory $45 to $48, but free shipping, people. Donald Trump's "Make America Great Again hat." Did you like Trump's look? It can be yours in a variety of colors for $25. "Rand on a Stick." That's Rand Paul's head, but on a literal stick. The "freedom paddles" are "great for rallies, parades, meetings, operas, church services that lack air conditioning and so much more." Your set of 12 for $35. Paul also has a "Hillary's Hard Drive" for sale for $99.95. That's a "100% genuine erased clean email server." Check out the complete tomfoolery at the Entrepreneur. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The enclosed patent application is a divisional patent application of the patent application with the Ser. No. 09/489,814 of the filing date of Jan. 24, 2000 now U.S. Pat. No. 6,402,727, and hereby claims the benefit of this parent patent application of the Ser. No. 09/489,814 of the filing date of Jan. 24, 2000. BACKGROUND 1. Field of Invention This invention relates to sanitary disposal mechanisms, specifically to an improved disposal method for used sanitary napkins and tampons. 2. Prior Art Proper disposal of used individual sanitary napkins and tampons is important for sanitary and discretionary purposes. Currently, there is little available to facilitate disposal of such items. Attempts have been made through various inventions to remedy this problem of proper disposal. However, these inventions have not covered all of the disposal needs relating to used feminine protection products. Inventions have been created where the disposable wrapper for a sanitary pad is an inherent part of the pad. U.S. Pat. No. 4,692,162 to Binker and Miranda (1987) and U.S. Pat. No. 4,581,027 to Alvarado (1986) both deploy such a method as does U.S. Pat. No. 3,035,578 to Elmore (1962). There are a number of disadvantages in approaching disposal in this way. These inventions can only be used with sanitary napkins, not with tampons. Also, the disposable wrapper, being attached to the underside of the pad while the pad is being worn, has a possibility of becoming covered with menstrual fluid from an overused or improperly placed pad, thus causing an unsanitary disposable wrapper. Also, the wrapper cannot be produced as a separate product. These wrappers add another layer of material to the pad, making the pad bulkier and more uncomfortable. U.S. Pat. No. 5,740,554 to Reed (1998) addresses this disposal problem with a mitten device which is used to remove the tampon, then folds over the used tampon, making it ready for disposal. This device is awkward and time consuming to use. Also, there is a possibility of tearing, while the mitten is being pulled onto the user's hand, thus creating holes in the disposable cover which would lead to leakage of menstrual fluid through the holes. This device can only be used with tampons. Also, this product would be more expensive and more difficult to manufacture due to the various sections. (The device has four different portions an index finger, a thumb, a mid-section, and a cuff portion.) The mitten shape could cause the sides to collapse together, making it difficult and time consuming to open prior to inserting the used tampon. U.S. Pat. No. 5,193,684 to McDonald (1993) discloses an invention for a Tampon Disposal Unit. Here, an opening in a folded bag is placed over a cavity, and as the tampon is withdrawn from the cavity into the bag, the bag unfolds longitudinally, then is sealed at the opening. This device exhibits many problems. Only tampons can be disposed of with this appliance. All of its various parts lend to a more expensive, more difficult manufacturing process. The complicated design and various parts would cause confusion as to the proper use of the device. The various steps needed to use this device, including proper placement of the device over the cavity, threading the tampon string through the hole in the bottom of the bag, pulling the tampon into the bag without misplacement, all contribute to the difficulty of using this device. Also, preventing leakage of menstrual fluid around the outside of the bag while withdrawing the tampon from the cavity would be very difficult. Another attempt to aid the sanitary disposal of used feminine protection products has been through inventions for disposable waste bags. U.S. Pat. No. 4,996,727 to Wyatt (1991) exhibits a bag which is comprised of three layers of material and a handle. Aside from being expensive and difficult to manufacture, this device would be clumsy to use. This device would require the user to fit the used item into the bag, which could also result in messy residue around the opening. U.S. Pat. No. 4,765,477 to Froidh et al. (1988) discloses a wrapper for the clean sanitary article, which, after removed, can be used as a disposal bag for the used sanitary article. U.S. Pat. No. 5,484,636 to Berg, Jr., et al. (1996) has a similar system with a pouch on the sanitary napkin wrapper which can be used for disposal of the used sanitary napkin after the clean pad is removed from the wrapper. Users typically remove and discard the soiled article prior to opening and inserting a clean article. The user would have to remove the clean article to render the wrapper usable as a disposal device. The clean sanitary article would have to be laid on a contaminated surface (sink, top of toilet, etc.) while disposing of the used article. Preparing the bag for disposal, removing the soiled article, wrapping it for disposal, and inserting the clean article, would be impossible without laying either the clean or soiled article down on a surface. Laying a soiled article down would contaminate the surface with bloody menstrual fluid. This creates a very awkward situation for the user and decreases the probability that the disposal bag would be used. The plumbing system has also been a means for disposal of used tampons. Some users will flush their tampons down the toilet. However, this can not be done with other solid waste in the toilet. And, the low water toilets, which are the new standard, do clog with just a used tampon being flushed through the system. Sanitary pads cannot be disposed of in this way. SUMMARY OF THE INVENTION The present invention of a disposal cover for used feminine protection items, comprised of a flat piece of fluid-impervious, flexible material with a tape fastening system for securing perimeters of the material together, exhibits the following objects and advantages. This invention provides a disposal cover for used feminine protection products which is fluid-impervious, with an optional scent to mask odors, which will allow the used tampon or sanitary pad to be disposed of in a discreet and sanitary manner. This cover furnishes a means of disposal which is easy and convenient to use, and takes little time to manipulate. This invention provides a disposal cover which is easy to prepare for use, and would afford the user a minimal number of steps to dispose of the used sanitary item. This disposal device can be temporarily attached to the outside of the sanitary device wrapper or as a completely separate product apart from the sanitary device. This device provides a disposal mechanism which can be used for both pads and tampons. It would be simple and inexpensive to manufacture, thus creating an inexpensive disposal item. This disposal cover will not become soiled on the outer (or second) surface of the cover since the used sanitary item only comes into contact with the inner (or first) surface. Since sanitary napkins become bulky after they absorb moisture, making the sanitary napkin compact by use of this cover would facilitate convenient, discreet, and efficient disposal of the sanitary napkin. Further objects and advantages are to provide a discreet, efficient means of disposal for the used feminine protection item, so it will be more readily disposed of through the solid waste system as opposed to the plumbing system (which can become clogged). Also, during times of electrical power outage or water shortage, whether from emergency or other causes, the flushing of toilets would be limited. The invention presented here would provide a hygienic means of disposal, obviating the need for flushing the used sanitary item down the toilet. Still further objects and advantages will become apparent from a consideration of the ensuing description and drawings. DRAWING FIGURES FIG. 1 is a plan view of the first surface of a disposal cover with the second portions of the adhesive tapes positioned on release-treated landing surfaces on the top and side of the cover. FIG. 2 is a plan view of the second surface of a disposal cover with the first portions of the adhesive tapes positioned on the top and side of the cover. FIG. 3 is a plan view of a disposal cover with a first curved side folded over a used napkin. FIG. 4 is a plan view of the disposal cover of FIG. 3 with a second curved side opposite the first curved side folded over against and overlapping the first side, the second side secured to the first side with an opened adhesive tape. FIG. 5 is a plan view of the disposal cover of FIG. 4 with the bottom tapered end of the cover folded up and over the end of the used feminine napkin. FIG. 6 is a plan view of the disposal cover of FIG. 5 with the top tapered end folded down and secured to the bottom tapered end with an opened adhesive tape so that the feminine napkin is completely concealed. DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring to FIGS. 1 and 2, the disposal cover 10 includes a single, flexible, fluid-impervious, plastic sheet 12 having a first surface 14 and a second surface 16. The sheet can be of any fluid-impervious, flexible material such as rubber, polyethylene, or the like. The sheet 12 having a width and a length respectively greater than the width and the length of the used sanitary item which is being disposed. On the first surface 14 of the sheet (FIG. 1) at the top is the second portion of a rectangular shaped tape 22 which can be of any flexible paper or plastic material. The underside of the tape, which faces the first surface of the sheet when folded downward, is coated with a sticky adhesive. The tape is folded down onto a complementary release-treated landing member 24. The landing member 24, which may be comprised of wax or silicone coated paper or the like, has the underside permanently affixed to the first surface 14 of the sheet with hot melt glue or some other similar substance. The wax or silicone or other similar means of coating on the landing member allows the adhesive tape to be easily separated from the landing member's surface. The complementary landing member 24 is slightly larger than the adhesive tape 22 so as to form a border of release treated material around the adhesive tape 22 when the adhesive tape is folded down onto the landing member. This facilitates the release of the adhesive tape 22 from the landing member 24. The adhesive on the underside of the tape 22 temporarily attaches the tape to the landing member. On the curved side of the sheet on the first surface 14 (FIG. 1) is the second portion of a rectangular shaped tape 28, which may be comprised of a flexible paper or plastic material with a coating of adhesive material on the underside of the tape. The underside of the tape faces the first surface of the sheet when folded downward. The adhesive tape 28 is folded down onto a complementary release-treated landing member 20. The landing member 20, which may be comprised of a wax or silicone treated paper or the like, has the underside permanently affixed to the first surface of the sheet with hot melt glue or some other similar substance. The wax or silicone or other similar means of coating on the landing member allows the adhesive tape to be easily separated from the landing member's surface. The adhesive on the underside of the tape 28 temporarily attaches the tape to the landing member. The landing member 20 is slightly larger than the adhesive tape 28 which creates a border of release treated material around the adhesive tape 28 when the adhesive tape is folded down and positioned onto the landing member 20. This enables a user to pull the adhesive tape away from the landing member more easily. On the second surface 16 of the sheet 12 (FIG. 2) at the top tapered end is the first portion of a rectangular shaped tape 26 which rests on the second surface of the sheet. The paper or plastic material comprising the first portion of the adhesive tape 26 is an elongated rectangle which extends above the top tapered end of the second surface of the sheet to become the second portion of the adhesive tape 22. The second portion of the adhesive tape 22 is folded over the top tapered end and folded downward, with the underside of the tape resting against the contemporary landing member 24. The underside of the first portion of the tape 26 is permanently affixed with hot melt glue to the second surface 16 of the sheet of the cover. This first portion of the tape 26 anchors the second portion of the adhesive tape 22 onto the disposal cover so that when the second portion of the adhesive tape 22 is pulled away from the landing member 24, the adhesive tape cannot be pulled off the sheet of the cover. On the curved side of the sheet on the second surface 16 is the first portion of a rectangular shaped tape 30 with the underside permanently affixed with hot melt glue or the like to the second surface 16 of the sheet of the cover. The paper or plastic material comprising the first portion of the adhesive tape 30 is an elongated rectangle which extends beyond the edge of the curved side of the second surface of the sheet and becomes the second portion of the adhesive tape 28. The second portion of the adhesive tape is folded over the curved side and folded downward, with the underside of the tape resting against the contemporary landing member 20. This first portion of the adhesive tape 30 anchors the second portion of the adhesive tape 28 onto the disposal cover so that when the second portion of the adhesive tape 28 is pulled away from the landing member 20, the adhesive tape cannot be pulled off the sheet of the cover. A number of advantages of my disposal cover become apparent from the above description: (a) Used feminine protection products can be completely concealed in a cover which will not leak menses fluid, thus allowing the used feminine protection item to be disposed of in a discreet and sanitary manner. (b) A minimal number of steps are required to conceal the used tampon or napkin, which contributes to the ease and efficiency of use. (c) Due to the nature of this disposal cover, it can be temporarily attached to the outside of the wrapper of an unused feminine protection product or function as a separate product apart from the feminine protection product. (d) Exemplary sanitary items for disposing in this cover include tampons and sanitary napkins. (e) The second surface comprising the outer side of this cover will not become soiled with menses because it is not attached to a pad in use and because the second surface of the disposal cover does not come into contact with the used item. (f) The user will be less likely to use the plumbing system for disposal (which can be detrimental to the plumbing system) when provided with a quick, easy, and discreet means of disposing pads and tampons through the solid waste system. Referring to FIGS. 3-6, using this cover to conceal used feminine protection items is accomplished in, but not limited to, a series of sequential steps. To conceal a used feminine napkin, one begins the process as shown in FIG. 3 by doing the following: one lays the napkin 18 in the center of the first surface 14 of the sheet 12 along the longitudinal axis of the cover with each end of the feminine napkin adjacent to the tapered ends of the cover. Then the user folds the first curved side (the side without the adhesive tape) of the sheet over the napkin so the edge of this first curved side of the cover lies in a parallel fashion above the longitudinal axis of the center of the napkin. The adhesive tape 28 on the complementary landing member 20, which is affixed to the first surface of the sheet on the second curved side, is pulled up, away from the landing member so as to expose the sticky underside of the adhesive tape. The second step of the process of using this disposal cover is illustrated in FIG. 4. The mechanism of operation is described as follows. The second curved side of the sheet opposite the first curved side is folded over the exposed side of the feminine napkin and against and overlapping the first curved side so as to cover the exposed surface of the used napkin along its longitudinal axis. After the second curved side of the sheet overlaps the first curved side, the sticky surface on the underside of the opened adhesive tab 30 is pressed against the second surface of the sheet on the vicinity of the first curved side to secure the tape against the second surface of the sheet. The third step of the process is shown in FIG. 5, and the procedures involved in this third step are described as follows. The bottom tapered end of the cover, opposite to the top tapered end which contains the adhesive tape 22, is folded upward so that the bottom tapered end lands in the approximate center of the sheet of the cover, and the adhesive tape 22 is pulled upward, away from the landing member 24, so as to expose the sticky surface on the underside of the adhesive tape. The final step in using this disposal cover, as shown in FIG. 6, involves the following procedures. The top tapered end containing the opened adhesive tape is folded downward toward the approximate center of the sheet of the cover until the top tapered end overlaps the bottom tapered end (which is in a folded-up position), upon which the sticky underside of the opened adhesive tape 26 is pressed against the second surface of the sheet at the bottom tapered end of the cover. Pressing this sticky surface which is on the underside of the opened adhesive tape against the second surface 16 of the sheet secures the adhesive tape against the second surface of the sheet. The used feminine napkin is now completely concealed in a fluid-impervious cover, which is neat and compact. This discreet, sanitary package can be tossed into a garbage can or other solid waste disposal receptacle. The above sequence of steps, as described for FIGS. 3 through 6 in which a used napkin was concealed, are identical for concealing a used tampon. Conclusion, Ramifications, and Scope Accordingly, the reader can see that this invention of a sanitary cover can be used quickly and efficiently to enclose a used feminine protection device inside a fluid-impervious barrier which will allow for discreet, hygienic disposal of the item in the solid waste system. Although the description of the invention in this application contains many specificities, these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention. A plurality of modifications are conceivable within the use of the patent claims. For example, the disposal cover can be sealed in a number of ways. The disposal cover can have a variety of shapes, such as circular, oval, rectangular, etc. The disposal cover can be made of various liquid-impervious materials such as plastic, rubber, or the like. The disposal cover can have a range of sizes and thicknesses, which can be customized to what is required to properly accommodate the used sanitary item, whether it be a pad or a tampon. Thus the scope of the invention should be determined by the appended claims and their legal equivalents, rather then by the examples given. SUMMARY: [/INST] A disposal cover comprising a single sheet of flexible, fluid-impervious material with a tape fastening system applied to the sheets perimeters is disclosed. In the preferred embodiment, the sheet has two outwardly curved sides which taper toward two opposing ends. In use, a used sanitary item, either a pad or a tampon, is placed longitudinally in the center of the cover, and the curved sides and tapered ends are folded until they overlap, and then are fastened together with a tape fastening system. This results in the used sanitary item being completely concealed in a compact, sanitary package that can be easily and discreetly disposed of through the solid waste system. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Sally Lee. The 'ghost' of one of Australia's most notorious criminals is still lurking within the walls of his old jail cell in Melbourne - or so a group of frightened lawyers have been led to believe. A recent group of visitors were recently tormented by what they believe to be the voice of Mark 'Chopper' Read, who died last year at the age of 53, during a ghost tour of the now desolate Pentridge Prison. It was in this prison that the notorious Read had both his ears chopped off by a fellow inmate back in the late 1970s. Scroll down for video. A ghost which resembles Mark 'Chopper' Read is believed to be haunting is old jail cell at Pentridge Prison in Melbourne. Lantern Ghost tour guide Jeremy Kewley (pictured) said he was leading a group of lawyers around the historic prison when they heard a loud man bellow out near Read's cell 16 in D-Division of the prison. Lantern Ghost tour guide Jeremy Kewley said he was leading the group of lawyers around the historic prison when they heard a loud man bellow out near Read's cell 16 in D-Division of the prison. This startled not only the lawyers but Mr Kewley himself as he initially thought it was a prank by one of the visitors. 'Suddenly came this incredibly loud and aggressive male voice basically screaming out "GET OUT",' Mr Kewley told the Today Show. 'We just sort of froze.' Shortly after, the same voice yelled out and repeated again 'GET OUT!'. 'It scared the holy crap out of me,' Mr Kewley said. 'I had to assure the group that this was not part of the tour.' He said police searched the entire building but could not ascertain where the voice came from. He is adamant that this has never happened before. Mr Kewley also alleges that other group tours sighted an apparition that resembles Read in this very cell. Prison Pentridge was an Australian prison built in 1850 and closed in May, 1997. Other notable prisoners include bush ranger Ned Kelly and Ronald Ryan who was the last man to be executed in Australia. Mr Kewley also alleges that people from other tour groups claim to have seen an apparition that resembles Read, who was behind bars from 20 to 38 years of age. Read, who's been convicted of a long list of crimes including assault, arson, armed robbery, kidnapping, firearm offences and impersonating a police officer, died of liver cancer in October last year. Pentridge was an Australian prison built in 1850 and closed in May, 1997. Other notable prisoners includes bushranger Ned Kelly and Ronald Ryan, who was the last man to be executed in Australia. Mark Read was brought to life on screen by Eric Bana in the 2000 film Chopper SUMMARY: [/INST] A group of lawyers were on a ghost tour at the historic prison in Williamstown, 9km south-west of Melbourne CBD. Mark 'Chopper' Read, who died last year at the age of 53, was behind bars from 20 to 38 years of age. Tour guide Jeremy Kewley said police searched the entire building but weren't able to explain the source of the voice. He said other groups have even witnessed a ghost-like figure which resembles the notorious criminal. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: A man has lost both of his hands and feet after he was mauled by a pack of dogs while wearing no clothes in eastern Detroit. The unnamed victim, believed to be in his 40s, was attacked after 12 pit bulls escaped from a house in Pennsylvania Street last night. Paramedics found him lying naked in a yard in a 'critical' condition, but were unable to get out and help him until police came. Scene: A man has lost both of his hands and feet after he was mauled by a pack of dogs while wearing no clothes in Detroit. Above, the incident happened outside this yellow house (far right) in Pennsylvania Street. After arriving at the scene, Detroit Police officers fired at the dogs, killing one of them, Sargent Michael Woody told WWJ Newsradio 950. They were then able to lure the remaining 11 animals inside the house between East Warren and Mach avenues, before locking them inside. The dogs are now in the custody of Animal Control. 'When we found the victim he was lying in a yard, completely naked, being attacked by several pit bulls... and our officers had to try to corral the pit bulls.' said Sgt Woody. Following the attack at around 9.30pm, the man was taken to Detroit Receiving Hospital, where he remained in a critical condition this afternoon, CBS Detroit reported. Attack: After arriving at the scene, Detroit Police officers fired at the pit bulls, killing one of them. They were then able to lure the remaining 11 animals inside the house, before locking them in (file picture) Street: Following the attack, the man was taken to Detroit Receiving Hospital, where he remains in a critical condition. Above, the house (yellow, second right) was situated between East Warren and Mach avenues. Sgt Woody said it was unclear what the man was doing on the property or why he was naked. He added that the pit bills' owner has come forward and is not thought to be involved in dog fighting. An investigation is ongoing SUMMARY: [/INST] Man, believed to be in his 40s, attacked by 12 pit bulls in eastern Detroit. Paramedics found him lying naked in a yard surrounded by the animals. Police fired at dogs, killing one of them; rest were lured back into house. Victim, who lost both hands and feet, is in 'critical condition' in hospital. It remains unclear what man was doing on property or why he was nude. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a continuation of International Application No. PCT/EP2015/061767, filed May 27, 2015, which claims priority to German Application No. 10 2014 107 834.9, filed Jun. 4, 2014. The disclosures of the above applications are incorporating herein by reference. FIELD [0002] The disclosure relates to a connecting arrangement that connects a mower knife drive to a mower knife. The drive movably reciprocates along a knife axis. The drive is especially for agricultural machines, for example, combine harvesters and field choppers. The connecting arrangement has a driving element that couples the connecting arrangement to the mower knife drive. Furthermore, the connecting arrangement has an output element that couples the connecting arrangement to a mower knife. Thus, the mower knife drive is drive-wise connected, via the connecting arrangement, to the mower knife. BACKGROUND [0003] DE 40 35 528 C2 describes a connecting arrangement between a mower knife drive and a mower knife. The drive movingly linearly reciprocates a double knife cutter unit of front mowers. [0004] The introduction of a lifting movement takes place by means of a pivotably moved driving lever and a drive pin connected to it. The drive pin represents a connecting element. A further connecting element, comprising a joint bearing, is connected to the mower knife. The joint arrangement is necessary since the drive pin is moved, due to its connection to the driving lever, following its pivot movement on a circular section path. The mower knife is only guided linearly in a reciprocating manner. The arrangement, during operation, enables constant pivotal movement of the drive pin relative to the connecting element connected to the mower knife as well as an axial displacement of the drive pin. The first connecting element, connecting to the mower knife, has a ring-shaped portion and a circular cylindrical bore. The intermediate ring, closed in a circumferential direction, is accommodated by its circular cylindrical outer face in the bore. The intermediate ring is adapted to the bore and retained in it. The intermediate ring has a hollow sphere-like inner face. On this hollow-spherical inner face, a bearing ring, closed in circumferential direction, is accommodated with a spherical outer face in a pivotable manner. The bearing ring has a circular cylindrical through bore. The drive pin slidable rests along the axis of the through bore, in the through bore, to be able to compensate positional change. This results from the movement of the drive pin with the driving lever on a circular path relative to the moving axis of the mower knife. [0005] Mower knife drives are known where the mower knife is driven directly linearly in a reciprocating manner by a gearbox. One example is described in DE 39 31 736 C2 or DE 10 2005 048 766 A1. A driving journal of the gearbox reciprocatingly moves and is connected to a driving element of a connecting arrangement. Thus, during the movement at an optimal alignment of the gearbox and of the mower knife relative to each other, no constant relative movements need to be compensated for during the driving of the mower knife. However, EP 1 832 154 A1 shows an adjustment possibility. It enables an adaptation of the relative position of the components relative to each other during assembly. This adjustment is retained by tightening the parts. Also, an easy loosening remains possible for exchange purposes, for example of the mower knife. [0006] However, it has been shown that increased wear occurs due to positional or manufacturing tolerances or deformations during operation when using a mower knife drive according to DE 39 31 736 C2 or DE 10 2005 048 766 A1, even with the direct linear driving of the mower knife. The increased wear is caused by one or more malpositions or inclined positions of the movement axis of the drive journal of the mower knife drive relative to the mower knife axis. SUMMARY [0007] It is an object of the present disclosure to provide a connection arrangement that compensates for positional and manufacturing tolerances between a mower knife drive and a mower knife. [0008] The object is achieved by a connecting arrangement, for connecting a mower knife drive to a mower knife, that movably reciprocates along a knife axis. The connection arrangement includes a driving element to connect the connecting arrangement to a mower knife drive. An output element connects the connecting arrangement to the mower knife. The driving element and the output element are, via a compensation arrangement, rotatable around three axes of rotation arranged preferably at a right angle to each other. Also, the driving element and output element are displaceable along at least two of the named axes of rotation relative to each other. [0009] An advantage of the connecting arrangement according to the disclosure is that compensation movements are possible during operation between the movements of the mower knife drive and the mower knife. All degrees of freedom are possible except the linear reciprocating movement in direction of the knife axis. Therefore, rotational movements of the driving element and of the output element are possible around all axes of rotation in the Cartesian coordinate system. Furthermore, linear movements are possible along two of the axes of rotation. However, linear movement is not possible in the direction of the knife axis. Thus, two named axes of rotation, along which the driving element and the output element are displaceable relative to each other, are arranged at a right angle to the knife axis. [0010] A separate bearing is provided for each axis of rotation of the compensation arrangement. Thus, the rotational movements can take place independently of each other in the individual degrees of freedom. Further, the driving element and the output element are rotatable relative to each other. [0011] The driving element and the output element are displaceable relative to each other by means of two of the named bearings. Thus, the longitudinal movements, concerning the two degrees of freedom in the longitudinal direction, can be arranged independently relative to each other. [0012] The compensation arrangement has a first joint element and a second joint element. The output element is rotatably connected, via a first bearing, around a first axis of rotation of the named axes of rotation to the first joint element. The first joint element is rotatably connected, via a second bearing, around a second axis of rotation of the named axes of rotation to the second joint element. The second joint element is rotatably connected, via a third bearing, around a third axis of rotation of the named axes of rotation to the driving element. [0013] The first joint element and the second joint element are rotatably displaceable, via the second bearing, along the second axis of rotation relative to each other. The driving element and the second joint element are displaceable relative to each other, via the third bearing, along the third axis of rotation. [0014] A rotational movement and a linear movement are enabled at the second bearing and at the third bearing by a bearing journal and a bearing bore, respectively. The bearing journal is rotatably accommodated and axially displaceable in the bearing bore. This can also be represented by a sliding bearing or also by a rolling member bearing. [0015] For simplification, the lubrication of all bearings can have a common lubricant supply. In this case, for example, a lubrication nipple can be provided. The nipple is connected, via lubrication channels, to all bearings. Thus, by transporting the lubricant through the lubrication nipple all three bearings can be lubricated. [0016] Further areas of applicability will become apparent from the description provided herein. The description and specific examples in this summary are intended for purposes of illustration only and are not intended to limit the scope of the present disclosure. DRAWINGS [0017] The drawings described herein are for illustrative purposes only of selected embodiments and not all possible implementations, and are not intended to limit the scope of the present disclosure. [0018] FIG. 1 is a perspective view of the connecting arrangement with a mower knife. [0019] FIG. 2 is a longitudinal sectional view at a right angle to the longitudinal axis of the connecting arrangement of FIG. 1. [0020] FIG. 3 is a longitudinal sectional view at a right angle to the vertical axis of the connecting arrangement of FIG. 1. [0021] FIG. 4 is a longitudinal sectional view at a right angle to the knife axis of the connecting arrangement of FIG. 1. DETAILED DESCRIPTION [0022] Example embodiments will now be described more fully with reference to the accompanying drawings. [0023] FIG. 1 is a perspective representation of a connecting arrangement 1 with a driving element 2 and an output element 3 that are connected to each other, via a compensation arrangement 4. The driving element 2 is formed as a driving adapter that can be connected to a driving journal of a gearbox. An example is described in DE 39 31 736 C2 and DE 10 2005 048 766 A1. The output element 3 is, as shown in FIG. 1, connected to a mower knife 7. The mower knife 7 includes a knife back 8 on which several knife blades 9 are mounted. [0024] The driving element 2 is driven along the X-axis, which is also designated as knife axis. It is driven by the above named gearbox. The driving element 2 is reciprocatingly moved. [0025] Due to manufacturing and assembly tolerances, as well as deformation of the individual components during operation, angular deviations can occur between the moving direction of the driving journal of the gearbox and the knife or X-axis. This means that the knife axis and the moving direction of the driving element 2 do not extend parallel to each other. In this case, during operation, tension of the drive and especially of the mower knife 7 occurs. Thus, increased frictional forces and/or bending forces are produced that lead to an increased wear. If the moving direction of the driving element 2 does not extend parallel to the knife axis, relative movements constantly produced during operation have to be compensated for between the driving element 2 and the output element 3. Accordingly, the compensation arrangement 4 serves this purpose. [0026] The compensation arrangement 4 includes a first joint element 5 and a second joint element 6. The output element 3 is connected, via a first bearing 10, to the first joint element 5. The first joint element 5 is again connected, via a second bearing 11, to the second joint element 6. The driving element 2 is connected, via a third bearing 12, to the second joint element 6. [0027] The first bearing 10 enables rotation of the output element 3 relative to the first joint element 5 around the knife X-axis. The first bearing 10 axially holds the output element 3 in an undisplaceable manner relative to the first joint element 5. The first bearing 10 thus has one degree of freedom. [0028] The second bearing 11 enables rotational movement of the first joint element 5 and the second joint element 6 relative to each other around a longitudinal Y-axis. The longitudinal Y axis is arranged vertically to the knife axis and is aligned in the mowing direction. The second bearing 11 further enables an axial displacement of the first joint element 5 and the second joint element 6 relative to each other along the longitudinal Y-axis. The second bearing 11 thus has two degrees of freedom. [0029] The third bearing 12 enables rotational movement of the driving element 2 relative to the second joint element 6 around the vertical Z-axi. The vertical Z-axis is arranged at a right angle to the knife axis and to the longitudinal Y-axix. The third bearing 12 enables an axial displacement of the driving element 2 relative to the second joint element 6 along the vertical Z-axis. The third bearing 12 thus has two degrees of freedom. [0030] The compensation arrangement 4 thus has five degrees of freedom. Three degrees of freedom enable rotation around all three named axis X, Y and Z. These axes could also be designated together as axes of rotation. Two degrees of freedom is provided for a displacement along both axes (Y, Z). [0031] For each rotation around one of the axes X, Y and Z, a separate bearing 10, 11, 12 is provided. Thus, each rotational movement is compensated for by one of the bearings 10, 11, 12 around one of the axes X, Y, Z. Two of the bearings ( 11, 12 ) also provide linear movement. Thus, these bearings are also separated from each other. The bearings for the linear movement do, however, not have to compellingly enable at the same time a rotational movement. It is also possible to provide separate bearings for the rotational movements and for the linear movements. [0032] FIG. 2 shows a longitudinal sectional view of the connection arrangement 1 in a section plane that contains the knife X-axis and the vertical Z-axis. Visible are the first bearing 10 and the third bearing 12. The knife axis, which represents at the same time the axis of rotation of the first bearing 10, intersects the vertical Z-axis. The Z-axis is the axis of rotation of the third bearing 12. Furthermore, the longitudinal Y-axis, the axis of rotation of the second bearing 11, extends through the intersecting point of the knife axis and of the vertical Z-axis. Thus, the entire compensation arrangement 4 forms, at this intersecting point, a joint centre point. [0033] The first bearing 10 includes a bearing journal 13 on the output element 3. The bearing journal 13 is rotatably supported in a bearing bore 14 of the first joint element 5. The bearing journal 13 projects axially from a knife connecting portion 20 of the output element 3 and is passed through the bearing bore 14. At the end facing away from the knife connecting portion 20, the bearing journal 13 has a thread 16. A nut 15 is screwed onto the thread 16. The nut 15 is axially supported in direction to the knife connecting portion 20 on the first joint element 5. In the opposite direction, the output element 3 is supported, via a shoulder 17, axially on the first joint element 5. The bearing journal 13 is supported, in this case, in a sliding manner within the bearing bore 14. [0034] Two sealing rings 18, 19 are provided. One of the sealing rings 18 is arranged between the first joint element 5 and the output element 3. The other of the two sealing rings 19 is arranged between the first joint element 5 and the nut 15. [0035] Generally, it is also possible, that the first joint element 5 has the bearing journal and the bearing bore is provided in the output element 3. Alternatively to sliding bearings, other bearings can also be provided, for example rolling member bearings. [0036] The third bearing 12, also visible in FIG. 4, includes a bearing journal 21 on the driving element 2. A bearing bore 22 is in the second joint element 6. The bearing journal 21 is rotatably supported in the bearing bore 22. A needle roller bearing 23 is shown. Generally, also at this position, a different bearing, like for example a sliding bearing or a different roller member bearing, would be possible. Thus, the bearing journal 21 is rotatable within the bearing bore 22 around the vertical Z-axis. The needle member bearing 23 further enables an axial displacement of the bearing journal 21 within the bearing bore 22 along the vertical Z-axis. [0037] The bearing bore 22 is formed as a blind hole bore. The blind hole bore 22 is sealed to the outside by a sealing ring 24 between the second joint element 6 and the driving element 2. [0038] It is, generally, also possible, that the second joint element 6 has the bearing journal and the bearing bore is provided in the driving element 2. [0039] The second bearing 11 is shown in FIGS. 3 and 4. The second bearing 11 includes a bearing journal 25 of the second joint element 6. A bearing bore 26 is in the first joint element 5. The bearing journal 25 is rotatably accommodated in the bearing bore 26 around the longitudinal Y-axis. It is also axially displaceable along the same. Thus, the bearing journal 25 is supported in a sliding manner in the bearing bore 26. Generally, another bearing arrangement, like for example a roller member bearing, may be considered here. The bearing bore 26 is formed as a blind hole bore. The bearing bore 26 is sealed to the outside by a sealing ring 27. The sealing ring 27 is arranged between the first joint element 5 and the second joint element 6. [0040] Generally, it can be considered here that the first joint element 5 has the bearing journal and the bearing bore is provided in the second joint element 6. [0041] The third bearing 12 has a needle roller bearing 23. The driving element 2 does not only perform, by the above named gearbox, a reciprocating movement along the knife axis, but also a continuous movement rotating around the vertical Z-axis. Thus, the third bearing 12 has to completely compensate the rotation of the driving element 2 relative to the second joint element 6. Thus, especially, rolling member bearings are suitable. All other bearings, the first bearing 10 and the second bearing 11, do not have to compensate for either rotational movements or longitudinal movements when the other bearings are aligned and adjusted properly. Only for the cases where manufacturing and assembly tolerances or deformations occur, compensational movements are produced in the bearings. Here, movements are rotating reciprocating movements or linear reciprocating movements, so that sliding bearings can be used. The bearings are separated from each other and for example not represented by a ball head. When using a ball head, it would not be design-wise defined, whether the rotation of the driving element 2 is compensated around the vertical Z-axis by the third bearing 12 or the needle member bearing 23 or by the ball head. Because of the drag moments within the third bearing 12, rotational movements could also be produced in the ball head, which could lead to fretting corrosion. [0042] All bearings 10, 11, 12 have a common lubricant supply. A lubrication nipple 28 is provided in the driving element 2. The lubrication nipple 28 leads to a radially extending lubrication channel 29. This lubrication channel 29 ends in an axially extending lubrication channel 30. The channel 30 ends at an end face 31 of the bearing journal 21 and, thus, leads to the bearing bore 22. These channels enable lubricant flow to the needle bearing 23 to lubricate it. A radially extending lubrication channel 32 branches off from the axially extending lubrication channel 30. The lubrication channel 32 leads to a circumferential outer face 33 of the bearing journal 21. This radially extending lubrication channel 32 ends between two rows of needles 34, 35 of the needle bearing 23. The two rows of needles 34, 35 are arranged behind one another along the vertical Z-axis. The radially extending lubrication channel 32 is positioned such that, depending on the axial position of the bearing journal 21 within the bearing bore 22, it at least extends across an axially extending lubrication channel 36 during the rotation of the driving element 2. The axially extending lubrication channel 36 is arranged in the bearing journal 25 of the second bearing 11. This axially extending lubrication channel 36 leads to an end face 37 of the bearing journal 25 of the second bearing 11. Thus, the channel 36 provides lubricant to the bearing bore 26 of the second bearing 11 to lubricate the sliding bearing between the bearing journal 25 and the bearing bore 26. The lubricant gets through the bearing gap between the bearing journal 25 and the circumferential inner face 39 of the bearing bore 26 of the second bearing 11 and into an annular chamber 40. The chamber 40 is formed by a circumferential groove 41 in the bearing journal 25 and the circumferential inner face 39 of the bearing bore 26. As shown in FIG. 3, a helical groove 38 can be provided in the circumferential inner face 39. The groove 38 transports lubricant from the area of the end face 37 of the bearing journal 25 into the annular chamber 40. [0043] The circumferential groove 41 is elongated formed in the axial direction. Thus, independent of the axial position of the bearing journal 25 in the bearing bore 26, the annular chamber 40 is also in fluid communication with a lubrication channel 42 of the first joint element 5. This lubrication channel 42 leads to the first bearing 10. The channel 42 provides lubricant to lubricate the sliding bearing in the first joint element. [0044] Thus, as the lubricant enters through only one lubrication nipple 28, the lubrication of all three bearings 10, 11 and 12 is achievable. [0045] The foregoing description of the embodiments has been provided for purposes of illustration and description. It is not intended to be exhaustive or to limit the disclosure. Individual elements or features of a particular embodiment are generally not limited to that particular embodiment, but, where applicable, are interchangeable and can be used in a selected embodiment, even if not specifically shown or described. The same may also be varied in many ways. Such variations are not to be regarded as a departure from the disclosure, and all such modifications are intended to be included within the scope of the disclosure. SUMMARY: [/INST] A connecting arrangement ( 1 ) for connecting a mower knife drive to a mower knife ( 7 ), that moves back and forth along a knife or X-axis, has a driving element ( 2 ) and an output element ( 3 ). The driving element ( 2 ) connects the connecting arrangement ( 1 ) to the mower knife drive. The output element ( 3 ) connects the connecting arrangement ( 1 ) to the mower knife ( 7 ). The driving element ( 2 ) and the output element ( 3 ) rotate relative to one another about three mutually perpendicular axes of rotation (X, Y, Z). Also, the driving element ( 2 ) and output element ( 3 ) can be moved relative to one another along at least two of the axes of rotation (Y, Z). </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Spontaneous waves in the developing retina are essential in the formation of the retinotopic mapping in the visual system. From experiments in rabbits, it is known that the earliest type of retinal waves (stage I) is nucleated spontaneously, propagates at a speed of 451±91 μm/sec and relies on gap junction coupling between ganglion cells. Because gap junctions (electrical synapses) have short integration times, it has been argued that they cannot set the low speed of stage I retinal waves. Here, we present a theoretical study of a two-dimensional neural network of the ganglion cell layer with gap junction coupling and intrinsic noise. We demonstrate that this model can explain observed nucleation rates as well as the comparatively slow propagation speed of the waves. From the interaction between two coupled neurons, we estimate the wave speed in the model network. Furthermore, using simulations of small networks of neurons (N≤260), we estimate the nucleation rate in the form of an Arrhenius escape rate. These results allow for informed simulations of a realistically sized network, yielding values of the gap junction coupling and the intrinsic noise level that are in a physiologically plausible range. Spontaneous activity spreads through neuronal systems of many different mammal species during development. Crucial roles are attributed to this spontaneous activity [1]. Among the most prominent roles is the synaptic refinement in the retina, where spatio-temporally correlated bursts of activity are observed, and it was found that blocking these waves disrupts eye-specific segregation into the visual thalamus [2,3]. Therefore, much effort has been devoted in recent years (e. g. [4–7]) to understand the mechanisms responsible of retinal waves. The observed patterns of spontaneous activity in the developing retina are remarkably similar across many species [1]. These patterns have been characterized as spatially correlated bursts of activity in the ganglion cell (GC) layer, which are followed by periods of silence [8–10]. So far, three different stages of retinal waves have been described in rodents, (for review see e. g. [1]). These different stages are characterized by their underlying circuits, which mature subsequently in development. In stage I, bursts of activity spread between retinal ganglion cells. In this stage, few synapses are identifiable and waves are mediated by gap junctions (GJs) and adenosine [11]. Stage II begins with the onset of synaptogenesis and ends with the maturation of glutamatergic circuits while stage III waves end with eyeopening and the onset of vision [12,13]. Here, we exclusively focus on the earliest developmental stage (stage I). This stage is prior to the emergence of functional chemical synapses in the retina. Waves show random initiation sites, no directional bias, and a propagation speed of about 450 μm/s. Via patch-clamp recordings, stage I retinal waves were found to be initiated and propagated in the GC layer [11]. In this work we develop a theoretical model of the retina and limit ourselves to a GC layer of bursting neurons which are coupled by GJs. These electrical synapses are formed between each of the major neuron types in the vertebrate retina [14–18] and play a major role in signal processing and transmission of visual information (for a review, see [18]). GJs are formed by two apposed hemichannels, each one formed by an hexameric array of proteins know as connexins. In mammals, connexin-36 and connexin-45 were clearly identified in neurons located in the inner retina [15,19]. Both types of connexins follow a distinct expression pattern during retinal development [20]. GJ coupling between neurons has been addressed in various theoretical studies (see e. g. [21,22]) and has received particular attention in the context of large-scale brain rhythms (e. g. [23,24]) and traveling wave dynamics (see e. g. [25,26]). However, their involvement in the maturation process of the retina is not yet fully understood [27]. GJs have been proposed as the responsible mediator of stage I retinal waves but not yet been used in a model of such waves [5], which is the problem that we intend to solve with this study. From a physical perspective, GJs act with integration times of the order of milliseconds and were thus argued not to be the mediator of stage I waves [5,9], which are much slower compared to this time-scale. In this work, we present a model of stage I retinal waves, formed by a network of bursting cells. The cells are coupled by the Ohmic currents through GJs which corresponds to the discretized version of a diffusive coupling (see e. g. [28] for a recent example of complex pattern generation with such a coupling); for recent studies of wave propagation using the alternative spatially extended coupling by an integral kernel, see e. g. [29,30]. For our model, we show that under certain conditions, the wave propagation can be sufficiently slow to be the responsible mediator for stage I retinal waves. We discuss analytical estimations of the propagation velocities and compare them to extensive numerical simulations of networks of up to 12,000 neurons. Our analytical work, based on diffusively coupled bursting neurons, applies methods from nonlinear dynamics and pattern formation to differential equations with discontinuous resettings. Furthermore, we study the repetitive nucleation of waves caused by noisy input currents and discuss the dependence of the nucleation rates on the noise intensities. We use the phenomenological Izhikevich neuron model [31,32], known for displaying biologically plausible dynamics. Due to its discontinuous fire and reset mechanism, it is a computationally efficient model of a bursting neuron. Comparable dynamics can be obtained from two-dimensional excitable models such at the Morris-Lecar model, under incorporation of an additional third dimension, e. g. a calcium-dependent potassium current, cf. Sec. 5. 2 in [33] The model can be regarded as a quadratic integrate-and-fire neuron for the membrane voltage Vi (t) of the ith neuron with an additional slow recovery variable ui (t), also referred to as gating variable (cf. Fig 1 (a) for the nullclines of the system): τ V d V i d t= a (V i - V rest) (V i - V crit) - u i + R I i, (1) τ u d u i d t= b V i - u i, (2) if: V i ≥ V peak → { V i = V reset, u i = u i + d. (3) The membrane recovery variable provides negative feedback to the voltage (cf. Fig 1 (b) and 1 (c) top). The parameters a, b, d as well as Vrest, Vcrit, Vreset, and Vpeak determine the spiking regime of the neuron, with Vrest < Vcrit < Vpeak. The time-scales of the voltage and gating variable are defined by τV and τu, respectively. For u (t) ≡ 0 and I (t) ≡ 0, Vrest and Vcrit are the stable and the unstable fixed points of the dynamics, respectively. If Vi ≥ Vpeak, the membrane potential is reset to Vreset, the kth spike time, ti, k, is registered, and the recovery variable is increased by the constant value d. We choose parameters such that the burst characteristics of our model neuron illustrated in Fig 1 roughly agree with experimental measurements from Syed et al. [11]. Specifically, we aim at a burst duration of about 1 − 2 seconds (cf. Fig 1 (c) bottom) and a spike frequency during bursts of about 5 − 15 Hz. We find those characteristics reasonably met for: a = 0. 1, b = 0. 3, d = 1. 2, τV = 100 msec, τu = 0. 0003−1 msec, Vrest = −76 mV, Vcrit = −48 mV, Vpeak = 30 mV, Vreset = −50 mV. The bursting mechanism is illustrated in Fig 1. The chosen time-scale of the gating variable u is comparatively large, but not uncommon for cortical neurons [34]. The total current RIi = R[Igap, i + Inoise, i] is a superposition of the intrinsic noise current and GJ currents from neighboring cells (see below). The intrinsic noise originates from fluctuations of the various channel populations (sodium, calcium, and different potassium channels, see e. g. [35]) and is approximated by white Gaussian noise: R I noise, i = τ V 2 D ξ i (t), (4) with 〈ξi (t) 〉 = 0 and 〈ξi (t) ξj (t′) 〉 = δij δ (t − t′) and D is the noise intensity. We perform simulations at discrete times with a time step of Δt = 0. 1 msec according to an Euler-Maruyama integration scheme, see supporting information S1 Text. Ganglion cells are distributed within the ganglion cell layer with a decreasing density towards the outer regions of the retina. For instance, the density in rabbits covers a range from 5000 cells/mm2 down to 200 cells/mm2 (the mean value is 800) [36]. In a previous study of retinal waves observed in rats, Butts et al. [4] used a ganglion cell density of ∼ 4000 cells/mm2. In their simulations they placed neurons in a regular triangular lattice for which the given density translates to a lattice spacing of 17 μm. Because we focus on the rabbit retina, we assume a triangular lattice with a different lattice spacing of 38 μm, reflecting the lower cell density (800 cells/mm2) for this system. The reported experimental observations on characteristics of stage I retinal wave were obtained from retina patches of roughly 3 × 5 mm. A mean cell density of 800 cells/mm2 translates to a total cell number estimate of 12,000 cells in the studied system. For comparability, we use a similar number of cells for simulations (i. e. 12,100 = 110 × 110). The triangular lattice structure can be seen in Fig 2 (a). Here, we ignore for simplicity the inhomogeneous and irregular structure of the ganglion cell layer. We place N = n × n single ganglion cells in a rectangular domain on a triangular lattice such that every cell is connected with GJs to six nearest neighbors, (the lattice structure is illustrated in Fig 2 (a) ). For illustrative purposes, we will also consider a one-dimensional chain, in which each neuron has only two neighbors. Because we are interested only in stage I waves, prior to synaptogenesis, these cells are not connected to any other cells, i. e. bipolar and amacrine cells are not part of our model. We choose a common approach (e. g. [21]) to model the GJ current as diffusive and instantaneous coupling by R I gap, i = G ∑ n = neighbor (V n - V i), (5) where G is the rescaled dimensionless GJ coupling, i. e. G = R/Rgap. The membrane resistance R of retinal ganglion cells can experimentally be measured and is in the range of 100-500 MΩ, e. g. [37]. Rgap is the GJ resistance between neighboring ganglion cells in the retina, which depends on the connexin type and the transjunctional voltage difference and is roughly Rgap ≈ 1GΩ [38,39]. The values of R and Rgap imply a physiological range for our parameter of G ∈ [0. 1,0. 5]. Because the time course of the action potential produced by our neuron model is only a coarse approximation of the electrophysiological shape of a spike, the GJ coupling may be stronger or weaker than assumed here. This gives additional justification for choosing a wider range of G. For the two-dimensional setup, we apply two different boundary conditions. For estimating the noise dependence of propagation velocities and nucleation rates, we perform small system simulations (N∼50-260) with periodic boundary conditions in both directions (system on a torus) in order to avoid strong finite-size effects. Simulations of the full system with N∼12,000 are carried out with two additional layers of neurons on the boundary, that are not exposed to intrinsic noise (cells on the system boundary have fewer neighbors, between 2 and 5 instead of 6). Neurons in the two outer layers of the large simulations are discarded from all statistical evaluations. Single propagating waves running through the network can be captured by the population activity [40] A (t) = 1 N Δ t A ∑ i = 1 N ∑ k ∫ t t + Δ t A d t δ (t - t i, k), (6) where the index k runs over the spike times of the ith neuron. Hence, A (t) is the firing rate, averaged over the network and the time bin ΔtA. We use ΔtA = 0. 5 seconds, which is comparatively large and covers multiple spikes when the cells are bursting. If we couple cells in a chain (as indicated in Fig 2 (a) —1D) and initiate a burst in one of them, we see a propagation of the burst along the chain (cf. Fig 2 (b) ); similar voltage traces have also been seen in simulation of computational models of cortex slices, e. g. [41]. A higher propagation speed can be achieved by increasing the GJ conductance parameter G Fig 2 (c). The picture is similar in our two-dimensional setup, for which snapshots are shown in Fig 2 (d). In this case, the wave has been evoked by enforcing a burst in the lower left corner. It propagates as a circularly shaped wave front, which is a consequence of the regularity and rotational symmetry of the system. The gating variable u (lower row in Fig 2 (d) ) can be associated with the experimentally accessible calcium dynamics and resembles calcium fluorescences images [11]. Compared to the membrane potential (top row), the wavefront of the gating variable lags behind, as it slowly builds up during the burst. In both, one-dimensional and two-dimensional simulations in Fig 2, we have set the intrinsic noise intensity to zero in order to illustrate that wave propagation does not hinge on the presence of fluctuations. We note already here, that the propagation speed in the two-dimensional system matches the order of magnitude of biologically observed values. To determine the speed of the waves from simulation such as shown in Fig 2 (c), we approximate the wave’s shape as circular with a fixed center. We define a wavefront as the group of neurons that spike within the same time bin of Δt = 0. 1 seconds (see left illustration in Fig 3 (a) ) and measure the front’s mean distance from the center and its mean time instance of occurrence. From the differences of these distances and times, we determine the mean velocity, which we find to be weakly distance dependent, but saturating at about 350 μm from the origin of the wave, cf. Fig 3 (b). In the following, all velocity values are averaged over measurements for the range of distances 350 − 650 μm (shaded area in Fig 3 (b) ) from the point of initiation and we refer to this measuring method as concentric method. The velocities are shown in Fig 3 (c) as a function of the GJ parameter for the physiologically relevant range of G (see Methods). We obtain velocities that are in the range of values observed in the rabbit retina [11], cf. the shaded area in Fig 3 (b). The experimental mean value of about 450 μm/sec is attained for G ≈ 0. 4. The propagation and its speed can be theoretically understood as follows. Assuming a steep wave profile, the speed of the wave is given by the inverse of the time it takes a bursting neuron to excite its neighbors, times the displacement of the corresponding wave fronts. We refer to this time as burst onset time difference (BOTD). For simplicity, we neglect noise and consider in the following a one-dimensional setup consisting of three neurons: one initially quiescent neuron (i) is connected to a bursting neuron (i − 1) on one side and to a quiescent neuron (i + 1) on the other side. They are separated by the lattice spacing ℓ = 38 μm, hence the velocity is defined as v1D = ℓ/TB. Therein, TB denotes the analytical approximation of the BOTD for this one-dimensional case. The approximation TB for the BOTD between neighboring neurons can be derived using three assumptions (details in S1 Text). First, we assume a constant gating variable (u (t) ≈ ur = const), which is reasonable on a short time-scale, because τu ≫ τV. Second, we replace the voltage variable of the bursting neuron Vi−1 (t) by its temporal average V ¯ b = const, that can be analytically calculated (see S1 Text) and for our standard parameters is V ¯ b = - 34 mV. Third, we replace the voltage of the quiescent neuron that is not directly connected to the bursting neuron by the resting potential, Vi+1 = Vr. Consequently, the GJ current seen by the driven neuron reads R I gap, i = G (V i - 1 + V i + 1 - 2 V i) ≈ G (V ¯ b + V r - 2 V i (t) ), and the resulting dynamics until the voltage Vi reaches the peak potential for the first time is effectively one-dimensional and can be recast to the form (cf. details in S1 Text): τ V d V i d t ≈ a (V i - V rest) (V i - V crit) - u r + G (V ¯ b + V r - 2 V i). (7) This first order ordinary differential equation can be solved via separation of variables to find t (V). We obtain it by first calculating the difference of the times from the voltage being at its peak potential and its resting potential. However, the driven neuron is already exposed to the driving GJ current while the voltage of the bursting neuron travels to its first spike time (cf. Fig. A of S1 Text). Therefore, for simplicity we subtract the first inter-spike interval TISI from the beforehand calculated time difference: T B (G) =t (V peak) - t (V r) - T ISI. (8) The explicit expression is lengthy and derived in S1 Text, resulting in Eq. O of S1 Text. Comparing TB to simulations of a one-dimensional chain shows a reasonable agreement (cf. Fig. A of S1 Text), although the theory overestimates the simulated values, in particular, for larger values of G. For comparison we also discuss a corresponding result for the wave velocity in the continuum limit in S1 Text. In the two-dimensional setup at larger times, the wave attains a planar shape as indicated in Fig 3 (a), where red circles represent bursting neurons and blue and yellow circles represent driven and quiescent neurons. Now, we assume that the wave front is perfectly flat and all neurons shown in the same color share an identical voltage. In that case, the propagation mechanism simplifies to two bursting neurons exciting one quiescent neuron, whose membrane potential is further affected by two quiescent neurons. Hence, we can mimic the quasi one-dimensional situation by doubling the value of G and additionally taking into account the modification of the effective length, i. e. ℓeff = (3/4) 1/2 ℓ, see Fig 3 (a). Consequently, we can approximate the velocity in the two-dimensional system as v 2 D (G) =3 / 4 · ℓ T B (2 G). (9) Calculated velocities v2D (G) are shown in Fig 3 (c) by the blue line, underestimating the true velocity (circles) but providing a correct order-of-magnitude estimate. Note that so far we restricted the considerations to a purely deterministic setup. Our simulations with noise indicate that moderate fluctuations have only little impact on the mean velocities. In the stochastic version of our system, we observe spontaneous waves that resemble those found in experiments [11]. Experimentally, it was observed by Syed et al. [11] that the spontaneously nucleated waves appear with a mean inter-wave interval TIWI of 36 seconds. In our model, waves are initiated by noise, since neurons are set in the excitable regime and cannot generate periodic spiking or bursting without external input. We expect that the nucleation rate per neuron depends strongly on the noise intensity D. To characterize this dependence, we simulate small systems (N∼50-260, see Methods) with periodic boundary conditions for two different values of GJ coupling and different noise intensities, cf. Fig 4. With the understanding that every neuron has the same chance to trigger a wave, the global nucleation rate should be linear with N to a first approximation. Thus we measure the nucleation rate per neuron as r = 1/ (TIWI N). As demonstrated in Fig 4 by the linear dependence of the rate’s logarithm on the inverse noise intensity, we obtain an Arrhenius rate r=r 0 exp (- Δ U / D). (10) The effective potential barrier ΔU depends on G and the system size N and saturates for sufficiently large systems (inset) for both values of G. The increase of the potential barrier with G can be understood to first approximation by the effective change of the current-voltage relation in the single neuron. The GJ coupling term Eq (5) leads to an effective increase in the leak current that stabilizes the resting potential and makes it harder to initiate a burst. This mechanism is dominant in comparison to the influence of other coupling effects and the stochasticity of the neighbors on the nucleation rate (supported by additional simulations, see Fig. B of S1 Text). The more subtle dependence of ΔU on the system size can be explained as follows: Coupling stochastic neurons in small systems with periodic boundary conditions leads to spatial correlations and thus effectively to stronger noise. This effect can be neglected for large system sizes or weak coupling, but has a measurable effect otherwise (cf. Fig 4 and Fig 4 inset). Our results so far can be used to predict the mean inter-wave interval and the propagation speed of retinal waves for a system size N = 12,100 that roughly corresponds to the experimentally studied patch size in Ref. [11]. Vice versa, we can infer an approximate value of the noise intensity D that leads to the experimentally observed value of TIWI = 36 seconds and test this in numerical simulations of the full system. For our estimation of the rough value of the noise intensity in a large system, we have to take into account that the single neuron undergoes a substantial refractory period of Tref ≈ 14 seconds after bursting (estimated from small-system simulations investigating the minimal mean inter-wave interval for various noise intensities). The mean inter-wave interval is then given by TIWI = Tref + 1/[N ⋅ r (D) ] and the estimated value of the noise intensity follows from the Arrhenius law, Eq (10), as D =Δ U / ln [ N (T IWI - T ref) r 0 ] ≈ 0. 050 (11) (for G = 0. 4, and r0 = 6 and ΔU = 0. 71, fit parameters from Fig 4, solid line with N = 256). The estimated parameters, G = 0. 4 and D = 0. 050, can now be used in a large-scale simulation. In Fig 5 (a), we show snapshots of the full system’s gating variable (a proxy for the experimentally accessible calcium concentration). The wave front seen in the experimentally observable area (box in Fig 5 (a) ) looks similar to experimental measurements, cf. Ref. [11]. From Fig 5 (b), it becomes evident that the mean inter-wave interval becomes much shorter for a slight increase in D. The mean inter-wave interval at these parameter values is not exactly 36 seconds, but somewhat larger: these statistics depend very sensitively on the value of the noise intensity (i. e. on the second leading digit, cf. Fig 5 (c) middle). This is seen in the global population activity, that reveals a wave going through the system as a single peak vs. time. The dependence of crucial neural statistics on the noise intensity is illustrated in Fig 5 (c). In contrast to the mean inter-wave interval, the mean velocity of the wave does not depend strongly on the noise (Fig 5 (c), top) but stays close to the experimentally observed mean value (dashed line). This is due to the fact, that the wave, once it is initiated, is largely determined by the deterministic propagation mechanism explained above. The fine tuning of the noise intensity shows that the experimental value of 〈TIWI, exp〉 = 36 seconds is attained for a noise level of D = 0. 052, slightly larger than D (estimated above). How realistic is this noise level? To address this question, we show at the bottom of Fig 5 (c) the standard deviation of the subthreshold voltage fluctuations, σV, as a function of the noise intensity D. σV increases only slightly with D and attains values around 1. 6 mV. To our knowledge, there are no detailed investigations of intrinsic noise sources in retinal ganglion cells at embryonic age. Because in this developmental stage there are no chemical synapses present [42], the synaptic background fluctuations can be excluded for our system: in the recurrent networks of the cortex, fluctuations stem mainly from the many synaptic interactions among the neurons, resulting in the famous asynchronous irregular state [43] that can be highly variable [44–46]. In our system, one likely source of variability is channel noise that typically leads to small membrane potential fluctuations with a standard deviation σV below 0. 6 mV [47,48]. The noise intensity that is required for the experimentally observed inter-wave interval results in sub-threshold voltage fluctuations that are three times bigger, cf. Fig 5 (c) bottom, suggesting that besides ion channel noise there are additional sources of fluctuations present. These could result from stochasticity of GJs itself but also indirectly from GJs via differences in individual resting potentials (for the heterogeneity of the resting potential in similarly sized cells, pyramidal cells in the cortex, see [49]). In any case, the apparent voltage fluctuations of about 1. 6 mV are well within the range of experimentally observed voltage noise in embryonic ganglion cells (cf. Fig. 1 in Ref. [11]). The investigations presented in this paper propose a GJ-based model of stage I waves in the developing retina. Starting with a neuron model that roughly reproduces the spiking properties of a burst of one single retinal ganglion cell, we incorporated GJ coupling of physiologically plausible strength and temporally uncorrelated fluctuations. This allowed us to reproduce the characteristics of wave nucleation and slow wave propagation in the early retina. Earlier it was believed that GJs can play a role in fast neural transmissions only [5,9], since the current in electrical synapses responds much quicker than neurotransmitters in chemical synapses. As shown in our paper, however, it is possible to obtain a limited transmission speed in a simple Ohmic model of the GJ coupling. Furthermore, although stochastic fluctuations are strong enough to ignite bursts with the correct nucleation rate, they do not distort the propagating fronts very much, i. e. the wave propagation is still a reliable process. The reason for the slow transmission we observe can be found in the nonlinear dynamics of the single neuron. The Izhikevich model that we use for the ganglion cell is essentially a quadratic integrate-and-fire neuron model with a slow adaptation variable. This model is the normal form of a saddle-node bifurcation and has a pronounced latency if close to this bifurcation, i. e. the spike response to a current step (in our case provided by a neighboring bursting cell) is considerably delayed because the system experiences the “ghost of the former fixed point”, see Ref. [50]. The presence of weak noise modifies this picture only slightly [51]. Although our model accounts for the most important features of wave nucleation and propagation for stage I retinal waves, it cannot explain the strong variability of the experimentally measured statistics (error of velocity ±91 μm/sec [11]). This is due to a number of model simplifications, which we now concludingly discuss. Firstly, the real system is much more heterogeneous than in our model, both with respect to the lattice structure as well as with respect to the local coupling between cells; secondly, GJs may couple more than next neighbors and their conductivity may be noisy and voltage gated; thirdly, the detailed dynamics of ganglion cells is certainly more complex than can be captured by the Izhikevich model; last but not least, the white Gaussian noise in our model is a rather coarse approximation of the channel noise and other fluctuations in the system. In our model, we arranged the neurons on a highly regular lattice with a cellular spacing according to an experimentally determined mean value of cell density, neglecting the strong heterogeneities in the distribution [36]. On this lattice, each cell is connected to exactly six nearest neighbors. Given the aforementioned heterogeneity, the numbers and distances between neighbors will be more broadly distributed than in our model. Incorporating these heterogeneous features in the simulations would likely broaden the range of observed velocities and thus better reflect the considerable variability found in experimentally measured values. The soma size of (rabbit) retinal ganglion cells (< 30μm, e. g. Ref [36]) is smaller than our employed lattice spacing, implying GJ coupling between dendrites rather than soma-soma coupling only. The size of the dendritic arbor of retinal ganglion cells is ∼ 100 − 130μm, thus suggesting direct communication between cells that are up to the threefold of the lattice spacing apart. In our simulations with only next-neighbor coupling, we could reproduce the experimentally observed velocity with a comparatively large coupling constant of G = 0. 4 (physiological range was G ∈ [0. 1,0. 5], see Methods). It is conceivable, that this large G value is an effective description of a system with larger effective GJ neighborhood but with a smaller (and possibly distance-dependent) coupling value G. Put differently, we expect similar results for the wave speed in a system with extended coupling neighborhood but reduced coupling strength per connection (with the latter still being within the physiological range). Regarding the neuron model and the incorporation of noise, we note that for developed retinal ganglion cells detailed multi-compartment conductance-based models with stochastic ion channels exist [35]. With more electrophysiological data available, it will certainly be possible to develop biophysically more realistic models of the bursting ganglion cell at the early stage. Furthermore important for our problem will be the incorporation of stochastic models of GJs [52] with voltage-dependent kinetics [53,54] and the heterogeneity of physiological parameters such as the resting potential. Such detailed models are certainly difficult to simulate for large networks but could be employed to estimate the total noise intensity in the system and to identify the dominant noise source, cf. similar approaches in Refs. [35,55,56]. SUMMARY: [/INST] Retinal waves are a prominent example of spontaneous activity that is observed in neuronal systems of many different species during development. Spatio-temporally correlated bursts travel across the retina at a few hundred μm/sec to facilitate the maturation of the underlying neuronal circuits. Even at the earliest stage, in which the network merely consists of ganglion cells coupled by electric synapses (gap junctions), it is unclear which mechanisms are responsible for wave nucleation and transmission speed. We propose a model of gap junction coupled noisy neurons, in which waves emerge from rare stochastic fluctuations in single cells and the wave's transmission speed is set by the latency of the burst onset in response to gap junction currents between neighboring cells. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Longtime Obama administration political insider David Axelrod claimed on Monday that the Obama administration hasn't been tainted by a smidgen of scandal. The surprising boast came during a Q&A at the University of Chicago Institute of Politics, an organization he founded and leads. 'I'm proud of the fact that basically you have had an administration in place for six years in which there hasn’t been a major scandal,' Axelrod said. 'And I think that says a lot about the ethical strictures of this administration.' Audio and video of Axelrod's remarks indicate the audience's first reaction to his insistence that Obama has presided over a scandal-free government was a chorus of laughs – before friendly attendees quickly drowned them out with applause. Conservatives have made a parlor game out of cataloging the Obama White House's scandals, with tallies running into the dozens and some organized alphabetically. SCROLL DOWN FOR VIDEOS. GREEN CARDS: Millions of illegal immigrants will have IDs and become mainstreamed into the US population under a policy Obama put into place without input from Congress, sparking a Constitutional-crisis scandal. A leaked slideshow about the National Security Agency snooping on domestic Internet traffic grew into a major international scandal in 2013. Among the administration's earliest media firestorms was its green-energy loan guarantees to Solyndra and other alternative-energy companies. Solyndra ultimately defaulted on $527 million in loans that the federal government guaranteed, leaving taxpayers on the hook for the money. In April 2009 a White House official green-lighted a photo-op that featured Air Force One, Obama's private plan, doing a flyby in New York City past the Statue of Liberty. Panicked New Yorkers flooded the streets thinking another 9/11-style aircraft attack was underway. Also early in his presidency – on Day One – was a pledge to shut down the military detention camp at Guantanamo Bay, Cuba. That effort has led to 115 prisoner releases, including several later confirmed to have re-entered hostilities against the West. Last year the president traded five high-value Taliban detainees for the safe return of Army Sgt. Bowe Bergdahl, who is now expected to be charged with desertion for walking away from his Afghanistan post in 2009. Military veterans who return home under more typical circumstances were shocked to learn in 2014 that dozens were dying for lack of medical care through the Veterans Administration health system. REMEMBER SOLYNDRA? $527 million later, the company is bankrupt and US taxpayers had to cover itsload defaults. The Internal Revenue Service, Americans' most feared and loathed government agency, has had a bumper crop of scandals since Obama took office. In May 2013 an inspector general report found that the agency spent more than $4.1 million on a single conference in California that included six-figure fees for speakers and expensive video production for a corny Star-Trek themed humor video. The General Services Administration was caught in a similar conference scandal later that year over an $823,000 in Las Vegas training conference held in 2010. It featured mind-readers, a clown and lavish hotel suites with jacuzzis. The GSA administration resigned over the flap. Also in May 2013, the IRS was plunged into scandal over news that its Tax-Exempt Organizations section was subjecting Tea Party groups and conservative-oriented charities to intrusive screening and years-long delays before granting them tax-exempt status – while liberal groups were often given a pass. The IRS later claimed to Congress that years worth of emails belonging to retired official Lois Lerner, who is thought to be responsible, were destroyed in a hard drive crash. Americans had a civil-liberties awakening in June 2013 that grew into an international scandal, when former government contractor Edward Snowden fled the country with untold amounts of stolen data and gave journalists evidence of a massive global eavesdropping program run by the National Security Agency. Called Project PRISM, its tentacles reached into industry, private citizens' emails and even the cellphone of German Chancellor Angela Merkel. Outrage over the program put the NSA on a tighter congressional leash. 'WHAT DIFFERENCE... DOES IT MAKE?' Hillary Clinton's State Department still has questions pending about Benghazi, and the former secretary of state was never interviewed by investigators. The White House's own black eyes continued with other revelations related to domestic spying on American citizens, including members of the press. The Justice Department under Attorney General Eric Holder, it was revealed, had tapped the phones of Associated Press reporters and scoured emails belonging to a Fox News Channel correspondent, all without notifying the affected news organizations. The ensuing scandal forced Holder to convene apologetic meetings with journalists and news executives in which he and his deputies pledged to follow a more transparent route in the future when dealing with the Fourth Estate. The attorney general was already reeling from a series of revelations about Operation Fast and Furious, a failed effort to track illegal U.S. gun sales to Mexican drug lords that resulted in hundreds of deaths south of the border and the killing of at least one U.S. Border Patrol agent, Brian Terry. Holder's Bureau of Alcohol, Tobacco, Firearms and Explosives instructed legitimate gun dealers to sell illegal quantities of rifles, shotguns and handguns to'straw buyers,' whom they knew would take the guns into Mexico for use by narcotics cartels. Of the 2,100 guns trafficked into Mexico in this fashion, just over 700 were recovered. Holder was held in Contempt of Congress for refusing to turn over documents subpoenaed by lawmakers. He was also accused of committing perjury when he claimed in a congressional hearing that he had only learned about Fast and Furious weeks earlier. Documents later proved otherwise. President Obama's Affordable Care Act was a signature legislative accomplishment but remains shrouded in controversy and scandal. The Benghazi siege killed a US ambassador; the Obama White House initially spun the terror attack as an out-of-control protest over a YouTube video. After the president pledged dozens of times that Americans who liked their existing health insurance plans could keep them under his new system, millions found themselves with cancellation letters because their older policies fell short of the government's minimum requirements. Those included birth-control and breast cancer coverage for men and prostate exams for women on single-person policies. Obamacare also became a punchline when billions of dollars failed to produce a working website in the fall of 2013 when open-enrollment for government-brokered medical insurance policies opened up. By then, the administration had already angered members of Congress by unilaterally pushing back implementation dates that were written into the law he signed. Some of those impromptu delays pushed back key outcomes – including the massive wave of insurance policy cancellations – until after the 2012 election. In late 2014 the GOP got another chance to raise a ruckus about the Obamacare law when its self-proclaimed 'architect' Jonathan Gruber was caught on video saying that it only passed Congress because of 'the stupidity of the American voter.' Overseas, the administration's role in failures related to the September 11, 2012 terror attack in Benghazi is still the subject of scandal, with former Secretary of State Hillary Clinton eyeing a presidential run of her own. Under Clinton, the State Department refused to provide added security for the diplomatic compound that would later be firebombed and attacked in a coordinated paramilitary assault, killing three Americans including U.S. Ambassador to Libya Chris Stevens. Afterward, with a presidential election just weeks away, Obama and Clinton both claimed the attack was the product of a spontaneous escalation of protests related to a crude YouTube video that mocked the Muslim prophet Muhammad. Protests in other countries throughout the Arab world did take place after the film was publicized online. FIVE-FOR-ONE: Obama consoled Sgt. Bowe Bergdahl's parents at the White House after giving away five Taliban prisoners from Guantanamo to get him home, but the soldier's comrades later said he was a deserter. But the Benghazi attack, it emerged after the election, was planned and executed by Ansar al-Shariah, an affiliate of al-Qaeda. A scandal-within-a-scandal erupted when ti was proven that the CIA and White House insiders both edited a set of 'talking points' used by the administration to brief Congress and talk to reporters. Those changes removed all references to the Islamist and jihadi groups that intelligence officials knew were responsible. Some analysts believe Obama's re-election was cinched when an ABC News anchor incorrectly said during a debate with Republican nominee Mitt Romney that the president had called the event a 'terrorist attack' the day after it occurred. RIP: US Border Patrol Agent Brian Terry was gunned down by a Mexican drug cartel member who was armed with an Operation Fast and Furious rifle that US government supplied. Clinton later raised senators' hackles when she asked 'What difference does it make?' whether or not the deadly attack was the careful work of terrorists. More recently the president's executive actions on immigration have become the stuff of scandal intense enough to spur federal lawsuits filed by 26 sitting governors and the Republican-led House of Representatives. Obama has begun already to offer green cards and work permits to millions of people who were brought to the United States illegally as children. He has proposed to expand that program dramatically, guaranteeing millions more that they won't be deported during his term in office. A federal judge on Monday night blocked that plan – which Obama himself said more than 20 times he lacked to legal authority to carry out – but the final say will rest with the Fifth Circuit or the Supreme Court. Other more minor blips on America's scandal radar since 2009 included former Environmental Protection Agency administrator Lisa Jackson using a private email address – complete with an alias – to conduct agency business. Those emails, unlike messages archived from official government accounts, weren't subject to retention policies and could not be subpoenaed. Obama was also hammered for appointing Timothy Geithner as his first Treasury Secretary, since Geithner had failed to pay his own taxes years earlier. And in January 2012 he created a scandal by making presidential'recess appointments' of key personnel who required congressional approval while Congress was still in session. The move allowed his appointees to serve for a year without being confirmed on Capitol Hill. Four federal courts later ruled that the actions were unconstitutional, including a unanimous 9–0 Supreme Court ruling SUMMARY: [/INST] Senior political operative was speaking at the University of Chicago Institute of Politics, which he founded and leads. Laundry list of scandals during Obama's six years includes Operation Fast and Furious, IRS targeting conservative nonprofit groups, Justice Department snooping on reporters. State Department was slammed for bungling that led to the 2012 Benghazi terror attack, and alleged cover-ups afterward. Healthcare.gov website's follies made for late-night TV jokes during its botched rollout and immigration executive actions have brought lawsuits. National Security Agency was pilloried for a global eavesdropping program that included Americans' computers and foreign leaders' cellphones. Bowe Bergdahl 5-for-1 Taliban trade drew catcalls from both sides of the political aisle. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Military Personnel Financial Services Education Act of 2005''. SEC. 2. CONSUMER EDUCATION FOR MEMBERS OF THE ARMED FORCES AND THEIR SPOUSES ON INSURANCE AND OTHER FINANCIAL SERVICES. (a) Education and Counseling Requirements.-- (1) In general.--Chapter 50 of title 10, United States Code, is amended by adding at the end the following new section: ``Sec. 992. Consumer education: financial services ``(a) Requirement for Consumer Education Program for Members.--(1) The Secretary concerned shall carry out a program to provide comprehensive education to members of the armed forces under the jurisdiction of the Secretary on-- ``(A) financial services that are available under law to members; ``(B) financial services that are routinely offered by private sector sources to members; ``(C) practices relating to the marketing of private sector financial services to members; ``(D) such other matters relating to financial services available to members, and the marketing of financial services to members, as the Secretary considers appropriate; and ``(E) such other financial practices as the Secretary considers appropriate. ``(2) Training under this subsection shall be provided to members as-- ``(A) a component of the members' initial entry training; ``(B) a component of each level of the members' professional development training that is required for promotion; and ``(C) a component of periodically recurring required training that is provided for the members at military installations. ``(3) The training provided at a military installation under paragraph (2)(C) shall include information on any financial services marketing practices that are particularly prevalent at that military installation and in the vicinity. ``(b) Counseling for Members and Spouses.--(1) The Secretary concerned shall provide counseling on financial services to each member of the armed forces under the jurisdiction of the Secretary. ``(2) The Secretary concerned shall, upon request, provide counseling on financial services to the spouse of any member of the armed forces under the jurisdiction of the Secretary. ``(2) The Secretary concerned shall provide counseling on financial services under this subsection as follows: ``(A) In the case of members, and the spouses of members, assigned to a military installation to which at least 750 members of the armed forces are assigned, through a full-time financial services counselor at such installation. ``(B) In the case of members, and the spouses of members, assigned to a military installation other than an installation described in subparagraph (A), through such mechanisms as the Secretary considers appropriate, including through the provision of counseling by a member of the armed forces in grade E-7 or above, or a civilian, at such installation who provides such counseling as a part of the other duties performed by such member or civilian, as the case may be, at such installation. ``(3) Each financial services counselor under paragraph (2)(A), and each individual providing counseling on financial services under paragraph (2)(B), shall be an individual who, by reason of education, training, or experience, is qualified to provide helpful counseling to members of the armed forces and their spouses on financial services and marketing practices described in subsection (a)(1). Such individual may be a member of the armed forces or an employee of the Federal Government. ``(4) The Secretary concerned shall take such action as is necessary to ensure that each financial services counselor under paragraph (2)(A), and each individual providing counseling on financial services under paragraph (2)(B), is free from conflicts of interest relevant to the performance of duty under this section and, in the performance of that duty, is dedicated to furnishing members of the armed forces and their spouses with helpful information and counseling on financial services and related marketing practices. ``(5) The Secretary concerned may authorize financial services counseling to be provided to members of a unit of the armed forces by unit personnel under the guidance and with the assistance of a financial services counselor under paragraph (2)(A) or an individual providing counseling on financial services under paragraph (2)(B), as applicable. ``(c) Life Insurance.--(1) In counseling a member of the armed forces, or spouse of a member of the armed forces, under this section regarding life insurance offered by a private sector source, a financial services counselor under subsection (b)(2)(A), or an individual providing counseling on financial services under subsection (b)(2)(B), shall furnish the member or spouse, as the case may be, with information on the availability of Servicemembers' Group Life Insurance under subchapter III of chapter 19 of title 38, including information on the amounts of coverage available and the procedures for electing coverage and the amount of coverage. ``(2)(A) A covered member of the armed forces may not authorize payment to be made for private sector life insurance by means of an allotment of pay to which the member is entitled under chapter 3 of title 37 unless the authorization of allotment is accompanied by a written certification by a commander of the member, or by a financial services counselor referred to in subsection (b)(2)(A) or an individual providing counseling on financial services under subsection (b)(2)(B), as applicable, that the member has received counseling under paragraph (1) regarding the purchase of coverage under that private sector life insurance. ``(B) Subject to subparagraph (C), a written certification described in subparagraph (A) may not be made with respect to a member's authorization of allotment as described in subparagraph (A) until 7 days after the date of the member's authorization of allotment in order to facilitate the provision of counseling to the member under paragraph (1). ``(C) The commander of a member may waive the applicability of subparagraph (B) to a member for good cause, including the member's imminent change of station. ``(D) In this paragraph, the term `covered member of the armed forces' means a member of the armed forces in grades E-1 through E-4. ``(d) Financial Services Defined.--In this section, the term `financial services' includes the following: ``(1) Life insurance, casualty insurance, and other insurance. ``(2) Investments in securities or financial instruments.''. (2) Clerical amendment.--The table of sections at the beginning of such chapter is amended by adding at the end the following new item: ``992. Consumer education: financial services.''. (b) Continuing Effect of Existing Allotments for Life Insurance.-- Subsection (c)(2) of section 992 of title 10, United States Code (as added by subsection (a)), shall not affect any allotment of pay authorized by a member of the Armed Forces before the effective date of such section. (c) Effective Date.--The amendments made by this section shall take effect on the first day of the first month that begins more than 120 days after the date of the enactment of this Act. SUMMARY: [/INST] Military Personnel Financial Services Education Act of 2005 - Provides financial services and life insurance consumer education for members of the Armed Forces and their spouses, which shall be provided as a component of initial entry and recurring training. (Such training shall include information on financial services marketing practices that are particularly prevalent at a military installation and vicinity.) Provides financial services counseling for members of the Armed Forces, and upon request, for their spouses. Requires a full-time trained counselor at installations with at least 750 assigned personnel, and other counseling at smaller installations. Requires counselors to provide members or spouses with information on Servicemembers' Group Life Insurance when providing information on private sector life insurance. Prohibits E-1 through E-4 members to pay for private sector insurance through pay allotments without a written certification of counseling. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Improving Diagnostic Innovations Act of 2012''. SEC. 2. CREATING INCENTIVES FOR INNOVATIVE DIAGNOSTICS. (a) Improvements to Process for Determining Fee Schedule Amounts for New Tests.-- (1) Clarifying factors for rate-setting.-- (A) In general.--In determining the payment amount under gapfilling procedures (as described in section 414.508(b) of title 42, Code of Federal Regulations, or any successor regulation to such section) for new clinical diagnostic laboratory tests under section 1833(h)(8) of the Social Security Act (42 U.S.C. 1395l(h)(8)), the Secretary of Health and Human Services (in this section referred to as the ``Secretary'') shall take into account, as applicable and available, the following factors with respect to such a new test: (i) Impact on patient care.--The impact of the new test on patient care, patient management, or patient treatment. (ii) Technical characteristics.--The technical characteristics of the new test, and the resources required to develop, validate, and perform the new test. (iii) Claims data.--Data from claims for which payment is made under part B of title XVIII of the Social Security Act. (iv) Laboratory charges.--Amounts charged by laboratories to self-pay patients for the new test. (v) Private insurance rates.--Amounts paid to laboratories for such new test under private health insurance coverage offered in the group market and the individual market. (vi) Advisory panel recommendations.--The findings and recommendations of the independent advisory panel convened under paragraph (2) with respect to that new test and any comments received during the open meeting of the advisory panel. (vii) Additional factors.--Such other factors as the Secretary may specify. (2) Input from patients, clinicians, and technical experts.-- (A) Requirement for independent advisory panel.-- The Secretary shall convene an independent advisory panel from which the Secretary shall request information and recommendations regarding any new test (as referred to under subparagraph (A) of section 1833(h)(8) of the Social Security Act (42 U.S.C. 1395l(h)(8))) for which payment is made under such section, including technical, clinical, and quality information. (B) Composition of independent advisory panel.--The independent advisory panel shall be comprised of 19 members, including-- (i) 4 individuals with expertise and experience with advanced clinical diagnostic laboratory tests, including expertise in the technical characteristics of the new test; (ii) 3 representatives of patients, including a patient representative for rare disorders; (iii) 3 clinicians who use results of the new test in patient care; (iv) 3 individuals with expertise in the requirements to develop, validate, and perform the new test; (v) 2 laboratorians; (vi) 2 experts in the area of pharmacoeconomics or health technology assessment; and (vii) 2 individuals with expertise on the impact of new tests on quality of patient care, including genetic counselors. (C) Terms.--A member of the panel shall be appointed to serve a term of 6 years, except with respect to the members first appointed, whose terms of appointment shall be staggered evenly over 2-year increments. (D) Expert consultants.--The Secretary may include to serve temporarily on the panel individuals who have expertise pertaining to the new test involved. (E) Open meetings.--The Secretary shall receive or review the findings and recommendations of the independent advisory panel with respect to the new tests described in subparagraph (A) involved during a meeting open to the public and provide opportunity for public comment. (F) Clarification of authority of secretary to consult carriers.--Nothing in this section shall be construed as affecting the authority of the Secretary to consult with appropriate Medicare administrative contractors. (b) Process for Assignment of Temporary Codes for Diagnostic Tests.--The Secretary shall establish a process for application for the assignment of a temporary national HCPCS code to uniquely identify a diagnostic test until a permanent national HCPCS code is available for assignment to that test. Assignments of a temporary national HCPCS code shall occur on a quarterly basis. The Secretary shall provide public notice through the Centers for Medicare & Medicaid Services Web site of applications made for such temporary national HCPCS codes. Upon assignment of a temporary code under this process, the Secretary shall treat such test as a new test for purposes of section 1833(h)(8) of the Social Security Act. (c) Development of Further Improvements in Rate-Setting Processes.--The Secretary shall analyze the process used for the gapfilling procedure used in determining payment amounts for new clinical diagnostic laboratory tests under section 1833(h)(8) of the Social Security Act. Taking into account the changes made by this section, the Secretary shall identify further changes to improve the accuracy and appropriateness of resulting rates and the openness, transparency, and predictability of the process. The Secretary shall examine what and how many entities should perform gapfilling, under contract or otherwise, and how to ensure that the process is informed by appropriate expertise and proceeds in a transparent and accountable manner. The Secretary shall implement improvements in the process, insofar as these are possible under the law through regulations, after public notice and opportunity for comment. For changes the Secretary determines would require a change in law, the Secretary shall transmit recommendations to the Speaker of the House and the President of the Senate not later than July 1, 2013. (d) Definitions.--For purposes of this section: (1) New clinical diagnostic laboratory tests.--The term ``new clinical diagnostic laboratory test'' means a clinical diagnostic laboratory test-- (A) that is assigned a new or substantially revised code on or after January 1, 2013; or (B) for which an application for a temporary national HCPCS code is made under subsection (b) on or after January 1, 2013. (2) Self-pay patient.--The term ``self-pay patient'' means, with respect to a health care item or service, an individual who pays out of pocket for such item or service and who does not have health insurance coverage for such item or service. (e) Effective Date.--This section shall take effect on the date of enactment of this Act, and shall apply with respect to new clinical diagnostic laboratory tests. SUMMARY: [/INST] Improving Diagnostic Innovations Act of 2012 - Sets forth additional factors for the Secretary of Health and Human Services (HHS) to consider in determining the payment amount for new clinical diagnostic laboratory tests under gap filling procedures which are used when no comparable existing test is available. Directs the Secretary to convene an independent advisory panel to inform and make recommendations to the Secretary regarding any new test. Directs the Secretary to: (1) establish a process for application for the assignment of a temporary national HCPCS (Healthcare Common Procedure Coding System) code to uniquely identify a diagnostic test until a permanent national HCPCS code is available for assignment to that test, (2) analyze the process used for the gapfilling procedures used in determining payment amounts for new clinical diagnostic laboratory tests, and (3) implement improvements in the process after public notice and opportunity for comment. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Down-regulation of GABAergic inhibition may result in the generation of epileptiform activities. Besides spike-triggered synchronous GABA release, changes in asynchronous release (AR) following high-frequency discharges may further regulate epileptiform activities. In brain slices obtained from surgically removed human neocortical tissues of patients with intractable epilepsy and brain tumor, we found that AR occurred at GABAergic output synapses of fast-spiking (FS) neurons and its strength depended on the type of connections, with FS autapses showing the strongest AR. In addition, we found that AR depended on residual Ca2+ at presynaptic terminals but was independent of postsynaptic firing. Furthermore, AR at FS autapses was markedly elevated in human epileptic tissue as compared to non-epileptic tissue. In a rat model of epilepsy, we found similar elevation of AR at both FS autapses and synapses onto excitatory neurons. Further experiments and analysis showed that AR elevation in epileptic tissue may result from an increase in action potential amplitude in the FS neurons and elevation of residual Ca2+ concentration. Together, these results revealed that GABAergic AR occurred at both human and rat neocortex, and its elevation in epileptic tissue may contribute to the regulation of epileptiform activities. During active states in the cerebral cortex, cortical neurons receive both excitatory and inhibitory synaptic inputs. Proper balance of these inputs [1], [2] is important for neuronal responsiveness to incoming inputs [3], [4] and for sensory processing [5], [6]. Disruption of this balance may cause malfunctioning of the network, leading to various brain disorders such as epileptic seizures [7], [8]. The main inhibitory neurotransmitter in the cortex is GABA, which is normally released from axonal terminals of inhibitory interneurons and mainly activates GABAA and GABAB receptors, leading to cortical inhibition [9]. The balance between excitation and inhibition largely depends on proper regulation of the activities of these interneurons and the excitatory pyramidal cells (PCs) [10]–[13]. Molecular and functional changes in GABA receptors [14], [15] or selective loss [16]–[20] or dormancy [21]–[23] of inhibitory interneurons may result in hyperexcitability of neuronal networks and contribute to epileptogenesis. However, there are also several lines of evidence showing no substantial change in the basal GABAergic transmission in epileptic tissues [24]–[27]. It is possible that other changes in the properties of inhibitory synapses associated with high-frequency discharges may be involved in generating and regulating the network activities, including the epileptiform activity. Under most circumstances, action potential (AP) is initiated at the axon initial segment and propagates to the presynaptic terminals, triggering neurotransmitter release within milliseconds [28]. This tightly coupled or synchronized transmitter release with presynaptic AP generation ensures precise signaling in the complex neural network. However, prolonged asynchronous release (AR) for hundreds of milliseconds following presynaptic AP burst has been observed at some excitatory and inhibitory synapses, particularly after high-frequency firing of presynaptic neurons [29]–[32]. At GABAergic synapses, AR may provide long-lasting inhibition and reduce the discharge probability and precision in postsynaptic neurons, leading to desynchronization of network activities. A recent study demonstrated that, after a burst of APs, fast-spiking (FS) interneurons in the rat neocortex show AR at their output synapses, including FS autapses and FS-PC synapses [33]. AR at FS autapses results in self-inhibition and consequently excitation of its target cells, while that at FS-PC synapses causes inhibition of target PCs. Therefore, regulation of the AR-induced self-inhibition in FS neurons and inhibition in PCs may contribute to the proper excitation-inhibition balance in the cerebral cortex. In this study, we examine whether AR occurs in human epileptic neocortical tissue and whether AR is subjected to change after the induction of epileptic seizures. We obtained human cortical tissues from small brain blocks that were surgically removed to cure intractable epileptic patients and brain tumor patients. Since the surgery is considered a therapy of the last resort for patients that had frequently suffered severe epileptic seizures, the cortical tissue should have experienced chronic epileptiform activities. We found that although AP burst-evoked AR occurred in all GABAergic synapses of FS interneurons (including FS autapses, FS-FS and FS-PC synapses) in these human epileptic tissues, FS autapses exhibited the strongest AR among these synapses. Further experiments in rats revealed similar differences in AR at different synapses. Importantly, as compared with control tissues, AR is significantly stronger in epileptic tissues, indicating that AR at GABAergic synapses might be subjected to modulation by epileptic seizures and involved in regulating epileptiform activities. Human neocortical tissues from 52 patients (aged 5–42 y) with frontal or temporal lobe epilepsy were sliced and examined by electrophysiology within 2–10 h after surgical removal. Whole-cell recording was performed on single FS neurons or synaptically connected FS-FS and FS-PC pairs in layer 5. We first examined the properties of asynchronous release (AR) of GABA at autapses made by single FS neurons on themselves. In about 22% of FS neurons tested (n = 85/392), we consistently observed elevated spontaneous synaptic events immediately after high-frequency firing evoked by DC current injection through the recording pipette in current-clamp mode (Figure 1A). By using a high-Cl− pipette solution (75 mM Cl−), inhibitory postsynaptic potentials (IPSPs) were depolarizing events at the resting membrane potential (∼−70 mV). Consistent with previous findings in rodents [34], we found that in voltage-clamp mode (Vhold = −70 mV) single AP could trigger an inward current in the same recorded cell that peaked within 2 ms and could be completely blocked by the bath application of picrotoxin (PTX, 50 µM; n = 15), a GABAA receptor antagonist (Figure 1B). This indicates the existence of monosynaptic autaptic connections in these human FS interneurons. These unitary inhibitory postsynaptic currents (IPSCs) had a failure rate of 0. 3±0. 3% and an onset latency of 0. 84±0. 07 ms; the rise time and decay time constant were 0. 59±0. 08 and 3. 9±0. 5 ms, respectively (n = 12 FS neurons). The amplitudes of these IPSCs were relatively large (255. 8±53. 6 pA) because we selectively examined the effects of PTX on FS neurons with obvious autaptic unitary IPSCs, ensuring accurate measurements of the IPSC kinetics after subtraction (control – PTX, Figure 1B). In another set of recordings, we applied PTX for every FS neuron recorded to examine the probability of autaptic connections; we found that 9/14 cells (64. 3%) had autaptic synapses, slightly less than that found in rodents [34]. Similarly, in voltage-clamp mode, the spontaneous events following trains of high-frequency stimulation (>50 Hz) in FS neurons were also completely abolished by PTX, indicating that these events were also GABAA receptor-mediated spontaneous IPSCs (sIPSCs) (Figure 1B). In physiological conditions, GABAergic responses normally hyperpolarize postsynaptic neurons, and therefore it is unlikely that FS neuron firing could drive other neurons to fire APs [13], [35], [36]. Thus, these sIPSPs or sIPSCs are unlikely to be caused by recurrent polysynaptic events but rather are attributable to AR at autapses. In response to a train of stimulation (20 APs at 200 Hz), post-train AR (PT-AR) lasted for 187±11 ms and had a total number of 17. 7±1. 6 spontaneous events (n = 74, Figure 1C; see Materials and Methods). We then varied the stimulation frequency and the number of APs and found that the duration and event number of PT-AR progressively increased with increasing stimulus intensity (two-way ANOVA analysis, p<0. 001 for both AP frequency and number, n = 49; Figure 1C–D). Due to the difficulties of identifying individual AR events among action currents (FS autapses) or synchronous IPSCs (FS-FS and FS-PC synaptic connections, shown below) that occurred during the high-frequency train stimulation, we only analyzed the properties of PT-AR in this study. Together, these results revealed the existence of robust AR at FS autapses in human epileptic neocortical tissue, indicating a long-lasting self-inhibition of FS neurons during high-frequency firing. In addition to their autaptic connections, FS neurons also form inhibitory synaptic connections onto other FS neurons (Figure 2A–B). We found chemical synapses in 12/39 (30. 8%) FS-FS pairs (intersomatic distance<50 µm), including 11 uni-directional connections and one bi-directional connection. Among these 39 pairs, nine pairs (23. 1%) showed electrical coupling and three pairs (7. 7%) were both chemically and electrically connected. The unitary IPSCs had a failure rate of 1. 3±0. 5%, an average peak amplitude of 58. 1±13. 5 pA and an onset latency of 0. 95±0. 11 ms; the rise time and decay time constant were 0. 78±0. 03 and 4. 5±0. 6 ms, respectively (n = 11). We found that high-frequency firing in presynaptic FS neurons also evoked long-lasting AR, detected as sIPSCs in the postsynaptic FS neuron (n = 10/10 pairs, Figure 2C). Similarly, AR at FS-FS synapses depended on the intensity of presynaptic stimulation. Increasing the frequency or the number of presynaptic APs increased the duration and total number of PT-AR (Figure 2C–D). The average duration and number of events were 64. 8±8. 6 ms and 3. 2±0. 6, respectively, in response to 20 APs at 200 Hz in presynaptic FS neurons and increased to 117±23 ms (paired t test, p<0. 01) and 7. 0±1. 4 (p<0. 01) when the number of APs were increased to 40 (n = 10 FS-FS pairs; Figure 2D). The PT-AR frequency was also significantly increased (Student' s t test; Figure 2E). Interestingly, in comparison with FS autapses, both the duration and the number of PT-AR were significantly smaller in FS-FS synapses (K-S test, p<0. 001). Together, these results indicate that although weaker than in FS autapses, asynchronous GABA release also occurs in synaptically connected FS neurons, providing long-lasting inhibition within this population of cortical inhibitory neurons. Next, we investigated the occurrence of AR in FS synapses onto excitatory PCs (Figure 3). Again, after bursts of APs in the presynaptic FS neuron, we frequently observed AR during and following the AP burst-triggered synchronous release (n = 61/66 pairs). In current-clamp mode, a train of APs evoked by step current injection in FS neuron evoked both autaptic (through FS autapses) and synaptic (through synapses from FS neuron to PC) AR in a stimulus intensity-dependent manner (Figure 3A). Close examination of these PT-AR events revealed that the FS-PC synaptic AR was much weaker than autaptic AR, by showing shorter duration and less AR events after FS neuron firing (Figure 3B–C). To further elucidate the differences between FS autaptic and FS-PC synaptic AR, we performed dual recordings in voltage-clamp mode. Single stimulation (0. 3∼0. 5-ms step command from −70 to 40 mV) evoked monosynaptic IPSCs in both FS neuron (Figure 1) and PC (Figure 4A). Among 343 FS-PC pairs tested, we found 79 FS-to-PC (23. 0%) and 32 PC-to-FS (9. 3%) connected pairs, and five (1. 5%) bi-directionally connected pairs. FS-PC IPSCs had a failure rate of 0. 03±0. 03%, an average peak amplitude of 90. 9±10. 2 pA, an onset latency of 1. 00±0. 04 ms, rise time of 0. 79±0. 04 ms, and decay time constant of 8. 5±0. 7 ms (n = 51 pairs). As shown in Figure 4B–C, both autaptic and FS-PC synaptic AR show dependence on the number and frequency of FS neuron discharges (ANOVA, p<0. 001). In sharp contrast to autapses, PT-AR at FS-PC synapses had shorter duration (98. 8±9. 6 versus 187±11 ms) and less IPSC events (6. 1±0. 8 versus 17. 7±1. 6, n = 51 FS-PC pairs and 74 FS neurons with autaptic connections) in response to presynaptic firing of 20 APs at 200 Hz. Cumulative frequency distribution of all these recordings revealed significant differences in the duration and total number of events of PT-AR between FS autapses and FS-PC synapses (K-S test, p<0. 001 for both duration and events; Figure 4D). Consistently, in 22 FS-PC pairs that showed both autaptic and synaptic connections, the duration and total events of PT-AR at autapses were significantly larger than those of FS-PC synapses (n = 22, p<0. 001, paired t test; Figure 4E). Examination of the PT-AR frequency revealed that FS autapses exhibited significantly higher frequency than FS-PC synapses (Figure 4F). To examine whether the strength of PT-AR depends on the size of AP-triggered synaptic responses, we normalized the PT-AR duration by the average peak amplitude of unitary IPSCs (synaptic strength). We found that although PT-AR duration in autaptic connections was longer than that in FS-PC connections, the normalized PT-AR duration showed no significant difference between the two types of connections (Figure 4G), indicating a dependence of AR duration on synaptic strength. Consistently, PT-AR duration showed a positive linear correlation with the average IPSC amplitude, and the slopes were 0. 53 and 0. 54 ms/pA for FS autapses and FS-PC synapses, respectively (Figure 4H). Similar results were observed in the total number of PT-AR events. This analysis revealed the dependence of AR strength on the size of synchronous synaptic responses that may be attributed to the differential AR strength at different types of synapses. We next analyzed the dependence of AR differences between FS autapses and FS-PC synapses on the clinical parameters of patients (sex, age, time since seizure onset, cause of disease, occurrence frequency, and seizure duration). We found no obvious dependence of PT-AR duration differences in the two types of connections on these parameters (Figure S1); that is, the duration at FS autapses was always significantly longer than that at FS-PC synapses if we categorized the patients by these parameters. Interestingly, we detected a small but significant difference in PT-AR duration at autaptic connections between patients with seizure duration of 1–3 min and those ≥3 min (Figure S1), suggesting a role of AR in regulating epileptic activities. Together, these results demonstrated that, in human epileptic tissue, AR also occurred at FS-PC synaptic connections but was substantially weaker than that in FS autaptic connections. Accumulation of Ca2+ in presynaptic terminals during trains of stimulation could be responsible for the occurrence of AR in hippocampus [32] and somatosensory cortex [33]; we therefore investigated the role of background or residual Ca2+ in the occurrence of AR in human neocortex. In the presence of EGTA-AM (100 µM), a membrane permeable Ca2+ chelator, FS autaptic, and FS-FS/FS-PC synaptic AR in human cortical tissues were completely blocked after 15-min drug application (Figure 5). The PT-AR in FS autapses was decreased to −5. 6±10. 2% of control (t test, p<0. 001, n = 12, Figure 5A). In FS-FS synapses, EGTA-AM blocked the release after the train (PT-AR) and reduced the release during the train (Train) as well as the peak amplitude of the first IPSC (IPSC1) in the train (PT-AR: 13. 8±6. 8%, p = 0. 003; Train: 36. 1±10. 7%, p = 0. 005; IPSC1: 50. 2±27. 4%, p = 0. 08, n = 4; Figure 5B). We observed similar results in FS-PC synapses; PT-AR, Train, and IPSC1 were decreased to 4. 4±4. 1%, 31. 0±1. 3%, and 37. 1±5. 6% of control, respectively (p<0. 001 for all comparisons, n = 5, Figure 5C). As shown in Figure 5C–D, PT-AR events in FS-PC pairs were completely abolished by the application of EGTA-AM. The blockade of PT-AR events was accompanied by an increase in short-term depression of the synchronous IPSCs in response to 40 APs at 200 Hz (Figure 5D), consistent with the finding that EGTA sharpens the initial decay phase of calcium transient [37]. Further recordings showed that the replacement of normal ACSF with Ca2+-free ACSF completely blocked the occurrence of IPSCs, including the PT-AR in FS-PC synapses (unpublished data), suggesting that AR requires Ca2+ entry through Ca2+ channels. Together, these results indicate that AR was dependent on the buildup of intracellular Ca2+ during the train of stimulation. Previous studies demonstrated that alteration of GABAergic inhibition could contribute to epileptogenesis. We speculated that the asynchronous GABA release from FS output synapses may undergo changes in the epileptic brain tissue. Furthermore, the findings in epileptic cortical tissues described above may be due to lengthy treatments of patients with anti-epileptic drugs. We thus performed recordings from FS neurons of surgically removed non-epileptic peri-tumor tissues and compared the AR properties with those of epileptic tissues. Similar to the epileptic tissue, the autaptic AR occurred after a train of APs evoked by current injections (Figure 6A) or voltage steps (Figure 6B) in FS neurons, and the strength of AR depended on the stimulation intensity (Figure 6B). However, the average PT-AR duration (103±11 ms) and total events (8. 1±1. 0) of autaptic AR (20 APs at 200 Hz, n = 20) were significantly lower than the values found in the epileptic tissue (187±11 ms and 17. 7±1. 6 events, n = 74; K-S test, p<0. 001 for both parameters; Figure 6C). Significant differences in AR properties were also observed when FS neurons fired 40 APs at 200 Hz (K-S test, p<0. 05, Figure 6D). In addition, the non-epileptic tissue had lower PT-AR frequencies than the epileptic tissue (Figure 6E). Thus, asynchronous GABA release at FS autaptic connections is elevated in human epileptic patients. Next, we sought to examine whether or not there are differences in AR between FS autapses and FS-PC synapses in cortical slices obtained from adult rats and whether AR is subjected to change after the induction of epileptic seizures (Figure 7). In these experiments, we employed the pilocarpine model of status epilepsy (see Materials and Methods) that mimics human temporal-lobe epilepsy [38], [39]. Recordings from FS neurons or FS-PC pairs in control and pilocarpine-treated rats showed that the connectivity probabilities from FS to neighboring PCs (<50 µm apart) were 33. 7% (n = 29/86) and 37. 3% (n = 38/102) for control and pilocarpine-treated rats, respectively, much higher than those in the opposite directions (PC-to-FS, 3. 5% for control, n = 3/86; 1. 0% for model animals, n = 1/102). Consistent with previous reports [32], [33], we found that, in prefrontal cortical slices from control rats, the strength of AR in FS autapses was dependent on the intensity of stimulation. In response to 20 APs at 200 Hz, PT-AR had an average duration of 53. 9±4. 2 ms and an average number of 3. 3±0. 4 events (n = 47). These values increased to 110±9 ms and 9. 7±1. 1 events, respectively, when the number of APs was increased to 40 (Figure 7A). Similar results were observed in FS-PC synaptic connections (20 APs: 36. 8±4. 4 ms and 1. 8±0. 3 events; 40 APs: 79. 5±8. 5 ms and 5. 9±0. 9 events; n = 25 pairs; Figure 7A). Again, cumulative frequency distribution of the recordings by the PT-AR duration and events showed that FS autapses exhibited significantly stronger PT-AR than FS-PC synapses (K-S test, p<0. 001 and p<0. 05 for duration and events, respectively; n = 47 FS neurons with autapses and 25 FS-PC pairs; Figure 7A–B). Together with the findings obtained from human tissue, these results indicate that the dependence of AR strength on the type of synaptic connections is a fundamental property of FS neuron output synapses. Because postsynaptic spiking may cause an elevation of intracellular Ca2+ and send retrograde signals to presynaptic terminals to regulate synaptic transmission [40], we then investigated whether the AR strength was dependent on postsynaptic spiking. In FS-PC pairs, the PT-AR duration and number of events showed no substantial changes after paired stimulations in the presynaptic FS neuron and the postsynaptic PC (40 APs at 200 Hz in both cells simultaneously; Figure S2). The PT-AR duration was 76. 4±13. 4 and 76. 2±13. 5 ms (paired t test, p = 0. 98), and the total number of PT-AR events was 5. 6±1. 4 and 5. 0±1. 2 for control (firing in FS neuron only) and paired firing (p = 0. 36, n = 6 FS-PC pairs), respectively. This result indicates that postsynaptic spiking is not required for the occurrence of AR from presynaptic FS neurons. Next, we analyzed the strength of AR and synchronous release in pilocarpine-treated rats. Similar to control rats, we also observed that the strength of PT-AR was different between FS autapses and FS-PC synapses, with stronger PT-AR detected at FS autapses (Figure 7A–B). No significant difference in the peak amplitude of single AP-evoked unitary IPSCs was observed (78. 9±16. 3 pA in control versus 62. 0±12. 9 pA in model rats, n = 25 and 32, respectively; t test, p = 0. 07) in FS-PC pairs, indicating that the basic neurotransmission was unchanged in this model of epilepsy. Importantly, we found that AR at both FS autaptic and FS-PC synaptic connections were significantly increased in pilocarpine-treated rats (Figure 7B). In response to 40 APs at 200 Hz, the average duration and number of events were increased to 180±21 ms and 15. 4±1. 9 events in FS autaptic connections (K-S test, p = 0. 002 and p = 0. 005, n = 35) and to 126±16 ms and 9. 6±1. 7 events in FS-PC synapses (p = 0. 015 and p = 0. 066, n = 32). Cumulative frequency distributions of recordings obtained from epileptic animals by PT-AR duration and events showed a rightward shift in comparison with those from control rats (Figure 7B). We next normalized the duration and number of events to the peak amplitude of unitary IPSCs (synaptic strength); this normalization also showed a significant PT-AR increase in pilocarpine-treated rats (t test, p = 0. 02 and p = 0. 005, respectively; Figure 7C). The mean frequencies of PT-AR events in both FS autaptic and FS-PC synaptic connections were also significantly larger in epileptic animals (Figure 7D). Further analysis on the ratio of PT-AR to total release (PT-AR/Total, Figure S3) revealed a significant increase from 3. 8±0. 5% (control rats, n = 24 FS-PC pairs) to 7. 6±0. 9% (pilocarpine rats, n = 32 pairs; p<0. 001) for FS neurons firing 20 APs at 200 Hz. Similar results were obtained when FS neurons fired 40 APs (Figure S3). A recent study demonstrated that AR occurred in response to high-frequency second-long stimulation of the presynaptic FS interneuron [33]; we therefore examined whether there is a difference between the FS autaptic and FS-PC synaptic AR after these strong stimulations. In human neocortical slices (Figure S4), firing of 300 APs at 150 Hz in FS neuron caused long-lasting AR in both FS autapses (n = 18 FS neurons) and FS-PC synapses (n = 10 pairs). Consistent with the results described above (Figure 4F), we also observed differences of AR frequency in the two types of connections. Again, comparison between control and pilocarpine-treated rats showed that AR frequency in both FS autapses and FS-PC synapses was significantly increased in epileptic animals (Figure S4). Although the basal transmission exhibited no significant change in model animals, the short-term depression of synchronous release at FS-PC synapses in response to stimulation of 40 APs at 200 Hz (Figure 7E) were significantly reduced in model animals. Further analysis revealed a close correlation between PT-AR strength and the time course τ of IPSC depression; the PT-AR duration and events showed an increase with increasing time course (Figure 7F). Short-term plasticity is tightly coupled to the concentration of presynaptic Ca2+ [41]; reducing residual Ca2+ levels could significantly accelerate short-term depression (Figure 5D, also see [42]). The reduction of short-term depression may therefore reflect an elevation of residual Ca2+ concentration at the presynaptic axon terminals, in line with the enhancement of AR in model animals. Together, these results obtained from rats indicate that the strength of AR at FS neuron axon terminals was elevated in epileptic neocortical tissue, possibly resulting from an increase in residual Ca2+ levels. Changes in AP waveforms can regulate Ca2+ entry during APs [43], so we next investigated whether AP waveforms of FS neurons were altered in model animals (Figure 8). We analyzed APs (fired at ∼200 Hz) evoked by 500-ms current steps and found that although the AP threshold (1st AP: −46. 0±0. 7 mV in control versus −45. 3±1. 3 mV in pilocarpine rats, p = 0. 7) and the half width showed no significant difference, all APs during the train in pilocarpine rats exhibited larger peak amplitude and integrated area than those in control rats (Figure 8A–C). The average peak amplitudes of the first and the 40th AP were 68. 6±2. 1 and 60. 2±2. 0 mV, respectively, in model animals, significantly higher than those in control animals (63. 7±1. 4 and 52. 7±1. 4 mV, t test, p<0. 05 for the first AP, p<0. 01 for the 40th AP and other APs). Further analysis revealed that AP waveform changes correlated well with the AR strength; PT-AR duration and events increases with increasing AP amplitude and area (Figure 8D). To investigate the role of the AP amplitude increase in mediating the enhanced AR, we reduced the AP amplitude by an amount similar to that of AP increase in epileptic animals, with the treatment of a low concentration of TTX (Figure 9, also see Figure S5). During the period from 120 to 180 s following the onset of TTX treatment (100 nM), we found a slight change in the threshold and half width (Figure S5) but a significant reduction in the average peak amplitude of APs in FS neurons (from 75. 4±1. 9 to 67. 4±2. 9 mV, p = 0. 001, n = 9). Although we observed no significant TTX effect on the synaptic strength (average amplitude of the first IPSCs), the success rate, and the total integrated charge of IPSCs during the train stimulation (40 or 60 APs at 200 Hz) in FS-PC pairs (Figure 9A, B, and D), the PT-AR duration and total number of events significantly decreased to 76. 9±6. 7% and 71. 4±8. 2% of control in FS autaptic connections (p<0. 01 for both parameters, n = 8; Figure 9C) and to 80. 7±5. 1% and 85. 1±6. 7% of control in FS-PC synaptic connections (p<0. 01 and 0. 05, n = 8; Figure 9D), respectively. Together, our results demonstrate that AR occurs in all GABAergic synapses of FS neurons, with autapses having the strongest AR, and the generation of epileptic seizures correlates with an increase in AR at both FS autapses and FS-PC synapses, suggesting that AR is subjected to modification during elevated network activities and is involved in regulating epileptic activities. Asynchronous GABA release was originally reported at output synapses of hippocampal cholecystokinin-containing interneurons onto granule cells in the dentate gyrus [32]. Unlike these cholecystokinin neurons, parvalbumin-containing FS interneurons release GABA in a tightly synchronized manner in response to single or a burst of APs. However, a recent study reported the occurrence of AR at output synapses of FS neurons onto themselves (autapses) and PCs in the rat somatosensory cortex [33]. Using human neocortical tissue, we demonstrate that AR occurs at all synapses of FS neurons in human neocortex, including synaptic contacts onto other FS neurons. In addition, the results show a dependence of AR strength on the type of connections, and FS autapses exhibit much stronger AR than FS-FS and FS-PC synapses. These findings were obtained from human epileptic tissue and thus may reflect synaptic modifications after epileptic seizures. However, similar results were observed in normal adult rats, indicating that AR is a fundamental property of neocortical FS neurons across different species and that the differences in AR strength between different types of connections are not associated with epilepsy. Why do FS autapses have the strongest AR than other synapses? One possibility is that the AR strength depends on the size of synaptic responses. Indeed, our results showed a correlation between the amplitude of unitary IPSCs and the duration of PT-AR; no significant difference was observed if the duration was normalized to the average peak amplitude of unitary IPSCs (Figure 4G–H). Another potential mechanism may lie on retrograde signals. At the autaptic connection, firing of the FS neuron may cause an increase in intracellular Ca2+ and consequently send retrograde signals to presynaptic terminals, such as nitric oxide, BDNF, and GABA [40], [44]. AP burst-induced GABA release from the dendrites unlikely contributes to the elevated spontaneous release because 307/392 FS neurons tested in this study showed no AR following high-frequency discharges. Our experiments in FS-PC pairs showed no changes in PT-AR duration and number of sIPSC events after pairing postsynaptic and presynaptic firing (Figure S2), indicating that postsynaptic spiking has no effect on presynaptic asynchronous GABA release. Previous findings [32] together with our results (Figure 5) demonstrate that the slow Ca2+ buffer EGTA can efficiently block the AR, indicating the dependence of the residual Ca2+. One distinct characteristic of FS interneurons is their expression of parvalbumin [12]; this Ca2+-binding protein functions as a slow Ca2+ buffer in presynaptic terminals and participates in short-term plasticity of synaptic transmission [45]–[48]. The presence of parvalbumin may prevent the occurrence of AR in FS neuron terminals. In hippocampal dentate gyrus, Hefft and Jonas [32] reported that AR at output synapses of parvalbumin-containing interneurons is almost absent (also see [49], [50]). In the neocortex, Manseau et al. [33] reported recently that parvalbumin-expressing interneurons also have strong AR but are weaker than those that lack of parvalbumin, indicating an important role of parvalbumin in controlling the strength of AR. Regulation of parvalbumin expression by neuronal activity may contribute to changes in AR strength in epileptic brain tissue. Comparison of short-term depression of synchronous IPSCs (Figure 7E–F) suggests that the kinetics of presynaptic Ca2+ may be altered in pilocarpine model animals, and this alteration could lead to the enhancement of AR. Interestingly, our results demonstrate that the peak amplitude of APs in FS neurons was substantially increased in the epileptic tissue, possibly resulting from homeostatic regulation of neuronal intrinsic properties (e. g., Na+ channel properties) [51], [52]. This AP-waveform change may cause more Ca2+ entry during APs [43] and consequently increase the total residual Ca2+ after a train of stimulation. Indeed, when we perfused the slice with TTX at a low concentration that showed no effect on the synchronous synaptic transmission but slightly decreased the amplitude of APs, PT-AR duration and number of events were significantly reduced (Figure 9). These findings suggest that changes in AP waveforms may play an important role in regulating AR strengths. The distance between the Ca2+ source (voltage-gated Ca2+ channels) and the sensor of exocytosis may differ at different types of synaptic connections and thus determine the occurrence and the strength of AR. At the hippocampal cholecystokinin interneuron terminals, this distance is large, leading to long-lasting intracellular Ca2+ transient and thus asynchronous vesicle release; whereas at parvalbumin interneuron terminals, the Ca2+ channels locate closely with sensors, allowing fast and precise synchronous release of vesicles [32], [53]. Our results demonstrate that, in human neocortical slices, bath application of EGTA-AM not only completely blocked the AR but also substantially reduced the synchronous release during the train stimulation, suggesting a large diffusional distance between the Ca2+ source and the sensor of exocytosis in FS neuron terminals [32]. Whether this distance is subjected to modulation by cortical activities and whether different Ca2+ sensors [54], [55] are involved in regulating AR at FS neuron terminals remain to be further examined. Changes in AR could also be explained by the homeostatic regulation of synaptic strength and intrinsic neuronal property in response to the epileptic activity. Previous studies have shown that changes in network activities can lead to alterations of synaptic strength in both excitatory and inhibitory synapses, leading to adjustment of the firing rate of individual neurons within a physiological range [56]. For example, a chronic elevation of network activity in cultured neurons decreased excitatory but increased inhibitory synaptic strengths of input synapses in PCs [57], [58], suggesting that the homeostatic synaptic scaling could help to maintain a balance between cortical excitation and inhibition. The enhanced asynchronous GABA release in both human and rat epileptic tissues may thus reflect a homeostatic change in GABAergic inhibition that can counterbalance the excessive excitation following prolonged epileptic activities. Considering the inhibitory nature of GABA and the desynchronizing effect of AR [59], we speculated that the enhanced AR in epileptic tissue might be anti-epileptic. In addition to homeostatic changes in synaptic strength, alteration in intrinsic neuronal properties could also occur when the level of network activity changes [59]. The density or the composition of ion channels is finely regulated by neuronal activities. In animals that developed status epilepsy, previous studies [60], [61] revealed a down-regulation of ion channels that mediate the dendritic A- and h-currents, resulting in changes in firing patterns and synaptic integration in hippocampal and cortical PCs. In this study, we found an increase in the peak amplitude of APs in FS neurons in pilocarpine-treated rats (Figure 8), suggesting an upregulation of Na+ channel density in these neurons, consistent with homeostatic regulation in response to epileptic activities. Because it is not possible to obtain normal brain tissue from healthy humans, we used the discarded peri-tumor tissues from patients with brain tumors who exhibited no clinical symptoms of epileptic seizures. Recordings from these non-epileptic tissues were considered as control for the effects of epileptic activities or lengthy treatment of anti-epileptic drugs. Our observation of AR occurrence in both control and epileptic human tissues indicated that AR is a fundamental property of human neocortical FS neurons and not due to drug treatment. Furthermore, our results clearly show that AR at FS autaptic connections in the epileptic tissue was substantially stronger than that in the non-epileptic tissue (Figure 6). Similar results were obtained from experiments using the pilocarpine rat model of epilepsy. In addition to FS autapses, enhanced AR was also observed in FS-PC synaptic connections in epileptic rats. These findings also indicated that the pilocarpine model of epilepsy is an appropriate model for temporal lobe epilepsy. Similar AR enhancement in pilocarpine-treated rats also supports the notion that the enhanced AR in human epileptic patients was not due to the treatment of anti-epileptic drugs. Further analysis on clinical parameters (Figure S1) revealed no dependency of the differences in AR duration between FS autaptic and FS-PC synaptic connections on patients' sex, age, time since the seizure onset, causes of seizure, occurrence frequency, and duration of seizure. Only those patients with relatively long-lasting seizures (i. e., seizure duration longer than 3 min) had significantly longer AR duration at autaptic connections (Figure S1), indicating a role of the enhanced autaptic AR in regulating epileptic seizures. Together, our results revealed an alteration of AR-induced long-lasting self-inhibition in FS neurons and inhibition in PCs, which may contribute to the generation and maintenance of the epileptiform activity. Our results demonstrate that AR in FS neuronal terminals occurs not only in rat but also in human neocortex, indicating that AR is a fundamental property of the cerebral cortex and participates in cortical functions. In a normal brain, asynchronous GABA release after high-frequency firing provides long-lasting inhibition and enables gain control of the postsynaptic neurons [32], [62]. Moreover, a recent study [33] revealed that asynchronous GABA release from FS neurons causes reduction of the discharge reliability and precision in postsynaptic neurons, particularly in PCs, a mechanism that may cause desynchronization of cortical activities. Therefore, on the one hand, FS neurons synchronize large populations of neurons during various cortical oscillations through their synchronous release at relatively low firing rates; on the other hand, they desynchronize neuronal networks through their AR when excessive excitation arises. The later process may play an important role in preventing runaway excitation and diminishing the generation and propagation of epileptiform activities. Consistently, our experiments in human and rat epileptic tissue revealed an increase in asynchronous GABA release at both autaptic and FS-PC synaptic connections, leading to desynchronization of FS/PC activities and the regulation of the generation and maintenance of epileptiform activities. These results are also in line with a recent report showing that neuronal firing during seizure initiation and propagation in epileptic human patients was highly heterogeneous rather than hypersynchronous [63]. Previous studies mainly focused on the alteration of basic neurotransmitter release at GABAergic synapses in epileptic brain tissue. Given that cortical neurons encounter large depolarizations and high-frequency discharges during epileptiform activities, it is important to investigate the changes in AR evoked by high-frequency discharges. Interestingly, we found no significant difference in the amplitude of unitary IPSCs between control and epileptic animals. With high-frequency stimulation of FS neurons, we did observe an increase in asynchronous GABA release in the rat model as well as in human epileptic tissues. Therefore, our results suggest that asynchronous GABA release in FS interneurons could be a target for the development of novel anti-epilepsy drugs. The protocols for handling and using the human brain tissue had been approved by the Biomedical Research Ethics Committee of Shanghai Institutes for Biological Sciences (License No. ER-SIBS-221004). The use and care of animals complied with the guidelines of the Animal Advisory Committee at the Shanghai Institutes for Biological Sciences. Human neocortical slices were prepared from brain tissues that had to be removed surgically to cure intractable epileptic seizure and brain tumor. Prior to the surgery, all patients and relatives or their legal representatives had provided written informed consent. Brain tissues from 52 human patients with frontal or temporal lobe epilepsy (aged from 5 to 42 y) and two patients with brain tumors (57 and 69 y), who showed no clinical symptoms of epileptic seizures, were used in this study. A small block of the discarded tissue was immediately immersed into an ice-cold oxygenated (0°C, 95% O2 and 5% CO2) sucrose solution (modified artificial cerebrospinal fluid, ACSF) in which the NaCl was substituted with equiosmolar sucrose and dextrose was reduced to 10 mM. We then sliced the brain tissue in this sucrose solution. In the case of brain tumor, we only used the peri-tumor tissue that had clear cortical layers (from layer 1 to 6) and white matter. Rat neocortical slices were obtained from adult Sprague-Dawley (SD) rats and pilocarpine-treated epileptic rats. A classic protocol was utilized to produce a pilocarpine model of epilepsy [38], [39]. Thirty minutes prior to pilocarpine injection, cholinergic antagonist methyl scopolamine nitrate (2 mg/kg, Sigma) was administered to minimize the peripheral effects of pilocarpine. The animals (220–250 g in weight) were then randomly divided into two groups: the pilocarpine group, which received a single injection of pilocarpine hydrochloride (345 mg/kg, Sigma), and the control group, with an injection of normal saline. All rats in the pilocarpine groups showed severe epileptic behavior ∼15 min after the injection, and this convulsive behavior was characterized by tonic-clonic generalized seizures (stage 5). The seizure intensity was evaluated according to Racine' s criteria [64]. For every pilocarpine-treated rat, seizures were allowed to continue for 1. 5 h and then terminated by the administration of diazepam (10 mg/kg, Sigma). Control rats also received the same dose of diazepam. Rats were then marked and sent back to their home cage. All drugs were applied through intraperitoneal injection. Seven days after the drug treatments, the occurrence of spontaneous epileptic seizures in these rats were monitored with a video-monitoring system. Rats with severe sustained seizures (showing clonic convulsions lasting for ∼20 s at least twice within 48 h) were selected for electrophysiological recordings, which were carried out 13–16 d after the pilocarpine injection. In our experimental condition, about half of the pilocarpine-treated rats showed spontaneous epileptic seizures within the monitoring time window. Animals were sent back to their home cages without video-monitoring until use. It is possible that spontaneous seizures might have occurred shortly before the preparation of slices. Neocortical tissues from human patients, control rats, and pilocarpine-treated rats were utilized for patch clamp recordings. Slices with a thickness of 350 µm were cut in the ice-cold sucrose ACSF from a block of brain tissue with a vibratome (VT–1000S, Leica). After slicing, the slices were immediately transferred to an incubation beaker and incubated at 35. 5°C for about 1 h and then room temperature until use. Recordings were performed in a submerged-style chamber at 36°C mounted under an infrared-differential interference contrast (IR-DIC) microscope (BX–51 WI, Olympus). The ACSF contained in mM: 126 NaCl, 2. 5 KCl, 2 MgSO4,2 CaCl2,26 NaHCO3,1. 25 NaH2PO4, and 25 dextrose (315 mOsm, pH 7. 4). Whole-cell recordings were achieved using a Multiclamp 700B amplifier (Molecular Devices). Signals were filtered at 10 kHz and then sampled by Micro 1401 mkII (Cambridge Electronic Design, Cambridge, UK) at 20 kHz using Spike 2 acquisition software. The impedance of patch pipettes was 5–7 MΩ with an internal solution containing in mM: 71 KCl, 72 Kgluconate, 2 MgCl2,10 HEPES, 0. 025 BAPTA, and 2 Na2ATP (288 mOsm, pH 7. 2 with KOH). The reversal potential of Cl− was −15 mV. Alexa Fluor 488 (50 µM) and biocytin (0. 2%) were added to the internal solution for visualizing the morphology of recorded neurons. AP trains with varying AP number and frequency were evoked by step current injection (in current-clamp mode) or trains of voltage commands (voltage-clamp mode). Liquid junction potential (9 mV) has not been corrected for the membrane potential shown in the text and figures. PCs and FS neurons were identified by their morphology and firing properties. PCs had pyramid-shaped soma and a single thick apical dendrite, exhibiting a regular firing pattern with adapting APs in response to a steady depolarization, whereas FS interneurons had a non-pyramidal soma and multiple primary dendrites and fired APs at very high frequencies (up to 500 Hz) without adaptation. After recording, the neurons were further identified using DAB-staining. Picrotoxin (PTX, GABAA receptor antagonist, Tocris), DL-2-Amino-5-phosphonopentanoic acid (APV, NMDA receptor antagonist, Tocris) and 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX, AMPA, and kainate receptor antagonist, Sigma), and EGTA-AM (membrane permeable calcium chelator, Invitrogen) were applied through bath perfusion. We performed data analysis using Spike 2 and MATLAB (MathWorks, Bethesda, MD). The current trace of the postsynaptic neuron was transformed to slope for event detection. Individual AR events were detected by setting a slope threshold. The frequencies of spontaneous IPSCs during the 4-s period before the train stimuli were defined as the baseline frequency. PT-AR frequency was calculated with a bin size of 50 ms. The end of AR was defined as the time point of the last IPSC before AR frequencies reached the baseline frequency. The PT-AR duration was the time between the cessation of the train stimulation and the end of AR. To investigate the strength of asynchronous GABA release from FS neurons, we only measured the duration and number of spontaneous IPSC events after the train stimulation because it was difficult to detect the asynchronous events that occurred during the train, due to the mixture of synchronous and asynchronous release in response to presynaptic high-frequency discharges. For single AP-evoked unitary IPSCs, we obtained the peak amplitude by taking the differences between the peak and the baseline current. The rise time of unitary IPSCs was measured as the time from 10% to 90% of the peak amplitude; the decay time constant was obtained by fitting the decay phase with a single exponential function. The threshold of an action potential (AP) was defined as the membrane potential when dV/dt reached 20 V/s. The peak amplitude of an AP was measured as the voltage difference between the peak and the threshold. AP area was the integrated area above the level of AP threshold (Figure 8). In order to calculate the quanta number during and after the train stimulation, we performed deconvolution analysis as described in previous studies [32], [49]. We first chose an isolated sIPSC from the barrages of sIPSCs that occurred after the train stimulation as a template. Then we used a template fit algorithm to detect the putative quantal IPSCs, within which we considered the peak amplitude of the smallest IPSC as the quantal size (5–10 pA). We fitted the rising phase of the previous IPSC template with a linear function and the decay phase with single exponential function and then scaled the amplitude to the quantal size to create an artificial quantal IPSC (IPSCquantal), which was used for deconvolution of the postsynaptic currents. We then performed the deconvolution with the following equation: Release rate = F−1[F (IPSC) /F (IPSCquantal) ], where F is the discrete Fourier transform [32], [49]. The resultant trace was filtered by 5–10 repetitions of Gaussian-window FIR filter depending on the signal-to-noise ratio. For FS autapses, only the post-train spontaneous IPSCs were used for deconvolution, as action currents occurred during the train stimulation may cause errors in the following analysis. The quanta released after the train (PT-AR) was calculated as the integrated area of the post-train release rate. For FS-FS and FS-PC synapses, the amount of release during (Train) and after the train (PT-AR) were measured as the corresponding area of the release rate. The baseline release was the average during the 4-s period preceding the onset of the train stimulation. This baseline release was subtracted from the Train release and PT-AR. PT-AR ratio was the ratio of PT-AR to the total release (the sum of Train release and PT-AR; Figure S3). Values were given as mean ± s. e. m., and error bars in figures also indicate the s. e. m. Significance of differences was assessed by two sample Student' s t test. Two-sample Kolmogorov-Smirnov (K-S) test was performed if the data were not normally distributed. In order to study the intensity-dependent properties of synchronous release and PT-AR, two-way ANOVA analysis was utilized to test whether the number or frequency of APs in FS neurons had an effect on PT-AR. SUMMARY: [/INST] The balance between excitation and inhibition in the cerebral cortex is important for multiple brain functions. Down-regulation of GABA-induced inhibition disrupts this balance and may lead to epileptic seizures. Asynchronous release of GABA is known to occur at certain GABAergic synapses and represents release of inhibitory neurotransmitter that is not precisely timed to presynaptic action potentials. Whether asynchronous release is subject to change after the induction of epilepsy remains unclear. In this study, using simultaneous recordings from inhibitory fast-spiking neurons and excitatory pyramidal cells, we found that asynchronous release occurred at the output synapses of fast-spiking neurons in both human and rat neocortex. The occurrence of asynchronous release depended on the level of residual calcium at the presynaptic terminals but not on postsynaptic spiking. Further experiments using cortical tissue derived from human patients with intractable epilepsy and from a rat model of the disorder revealed an elevation of asynchronous release in epileptic cortex, possibly resulting from an increase in action potential amplitude of fast-spiking neurons and changes in calcium dynamics in their axon terminals. Taken together, these results demonstrate that asynchronous release is a fundamental property shared by neocortical fast-spiking neurons regardless of species, and the enhancement of asynchronous release in epileptic tissue suggests a role for it in regulating epileptic activities. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: BACKGROUND OF INVENTION 1. Related Applications There are no applications related hereto heretofore filed in this or any foreign country. 2. Field of the Invention This invention relates generally to athletic boots, and more particularly to boots for snowboarding that have flexible uppers that are adjustably stiffenable by selectively positionable stays. BACKGROUND AND DESCRIPTION OF PRIOR ART Snowboarding is a winter sport of historically recent origin that has experienced rapid growth, both in popularity and number of participants. A participant in the sport, positions himself in a lateral orientation on a single snowboard that is somewhat shorter and substantially wider than a traditional snow ski. The snowboard is steered and controlled by the user's shifting of weight to cause varying forces on different parts of the board during its motion over a snow covered surface. Traditionally a snowboarder wears boots for comfort, support and protection of the feet and lower legs and those boots are normally positionally maintained, to at least some degree, on the snowboard by means of various boot harnesses. It has been found in some snowboard activities which require little fine or rapid maneuvering, such as downhill racing and the like, that rigid boots which allow little or no motion of the upper portions of the boot in a lateral direction with reference to a snowboarder's ankle are of most comfort and utility. In the case of snowboard activities that do require fine and rapid maneuvering, such as in slalom snowboarding, the opposite is true, owever, and it has been found that boots having flexible uppers above the boot foot that allow lateral motion of the lower leg above the ankle are much more comfortable and utilitarian for this purpose. Responsively both rigid and flexible boots have become known individually for use by snowboarders for the particular activities which they best suit. The instant invention seeks to provide a new and novel snowboarding boot that may be selectively changed from an upper portion having the complete flexibility of the boot upper through various intermediate states having varying rigidity to an upper having the substantial rigidity of any of the present day rigid boots. To accomplish this end, I provide a boot with one or more elongate vertically or vertically angulated oriented pockets on its upper portion to carry stiffening stays which may be inserted to selective lengths in the pockets to create adjustable rigidity in the upper portion of the boot. It has heretofore become known to use devices of various sorts with both hand and foot wear that coincidentally stiffen that wear, but the purpose of such devices has been other than that of adjustable stiffening and by reason of this difference in purpose those prior devices are distinguished because of the particular structures they disclose that are specifically related to the purposes for which they were created. These prior devices also have in common the lack of any adjustable stiffening function per se. Various rigid or semi-rigid elements have become known as additives to handwear, footwear and other clothing to provide protection to the wearer during hazardous activities such as to prevent cutting by saw blades, impact damage by moving or falling objects, injury from entanglement in machinery and the like. The nature of the materials which are used for this purpose normally tends to provide some additional rigidity for the article of clothing supporting the protective elements, but in general this art provides protectors of small size and compound articulating or flexible nature, such as coiled springs, to provide as much flexibility as possible. This art does not seek to provide stiffening at all and in fact, teaches away from it in attempting to provide flexibility. This art also, since it is not concerned with stiffening, does not show methods or means for adjustably regulating stiffening associated with some type of clothing in distinguishment from the instant stiffeners which are specifically created to provide adjustability. The stiffening of various portions of footwear, and especially boots and higher top shoes, has also become known for purposes other than safety of the wearer. Most commonly, such stiffening has been for the purpose of preserving the original footwear shape and configuration to maintain the aesthetics of the footwear, to preserve its utility or to provide for proper foot support and comfort of a user. Various such supports have been associated with the upper portions of higher top boots to prevent those upper portions from moving downwardly during storage or while being worn. Such devices have usually provided elongate, vertically oriented stays that may be supported variously by the boot sole, by a heel vamp or by the boot uppers themselves by some type of mechanical fastening. Other such devices have commonly been associated with either the toe or the heel of a shoe or boot to maintain the configuration of these shoe elements, especially against forces caused by normal use of the shoe which tend to change or modify the original configuration of these elements. These various devices, however, all teach of providing sufficient rigidity to perform their function of maintaining particular footwear configuration and because of this, they necessarily provide some substantial rigidity to accomplish their purposes. Since such devices are not concerned with and teach away from providing flexibility, they also do not provide means for adjustment of their rigidity in distinguishment from the instant stiffeners which purposefully and directly teach of providing adjustable rigidity in the upper part of higher top footwear above the ankle area. Ski and snowboarding boots in their inception generally were of a flexible nature, but as either sport increased in sophistication, various rigid or semi-rigid boots have become known. Various of this type of more rigid boot have been of a compound nature formed of a plurality of articulatingly joined elements that allow motion of various parts of the boot relative to the other parts. This structure has to some degree provided a boot that may have some of the functions of both a rigid and a flexible type of boot. It has also become known to provide connectors in the articulated portions of such boots that allow adjustment of the stiffness of the motion of particular joints to provide some degree of adjustability of the flexibility of such a boot. Such boots, however, have generally had relatively few articulated parts, and often only one articulated joint between the body and upper portion of the boot, so that in essence they tend to allow only a generally forward-rearward bending action of an ankle. The instant boot is distinguished from such boots having rigid compound articulatingly interconnected elements by reason of its greater range of flexibility and the location of areas of restraint. The instant boot allows motion of the boot upper that is substantially as flexible as the boot material itself when the stiffening stays are completely removed from the boot. It also provides increasing rigidity starting at the upper part of the upper portion of the boot and extending progressively downwardly to the level of the ankle, but does not cause rigidity in the area at the ankle itself, to allow normal ankle motion that may not be accomplished with a boot having a rigid element extending about the ankle. This stiffening structure allows substantially greater control of a snowboard by a user than is had with the compound boot having articulatingly interconnected rigid elements. The instant boot at the same time, however, allows use of a rigid sole and body structure to provide the benefits of those elements while yet allowing the adjustably variable stiffness of the upper boot portion. Our invention resides not in any one of these features individually, but rather in the synergistic combination of all of its structures that necessarily give rise to the functions flowing therefrom. SUMMARY OF INVENTION Our invention provides a snowboarding boot having a sole and body of ordinary construction, with an interconnected, flexible upper portion that may be adjustably stiffened from its top to the ankle level of a wearer. The flexible upper portion of the boot provides plural elongate pockets carried on the inner or outer surfaces of the lateral portions of a boot upper portion. The pockets are elongate and extend from the top of the upper portion of the boot downwardly to the ankle level to define an internal channel in which stiffening stays are slidably carried. One or more of such pockets are defined on one or both of the outer lateral sides of a boot upper. A stiffening stay formed of rigid or semi-rigid, resiliently deformable material is provided for each pocket and is of a configuration to be frictionally carried within the channel defined by each pocket and extend through the vertical length of the pocket. The stiffening stays optionally may have an insertion, and fasteners to releasably positionally maintain the stay within a pocket. In providing such an article, it is: A principal object to create a snowboarding boot with sole and body of traditional design and function, but with a flexible upper portion that may be adjustably stiffened by selectively positionable stiffening stays. A further object is to provide such a boot that has an upper portion supporting at least one somewhat vertically oriented, open top pocket on at least one of its lateral sides to carry a stiffening stay somewhat limit lateral motion of a wearer's lower leg above the ankle but allow motion of the ankle joint especially in a medial plane. A still further object is to provide stiffening stays, having more rigid nature than the material of the boot upper portion, that may be inserted within the pockets defined on the boot upper portion and maintained in selective, vertical positions within those pockets by reason of frictional engagement therewith to allow adjustable stiffening of the boot upper portion. A still further object is to provide such stiffening structure that may be installed during boot manufacture or added to existing boots after their manufacture. A still further object is to provide such an article and stiffening structure that is of new and novel design, of rugged and durable nature, of simple and economic manufacture and otherwise well adapted to the uses and purposes for which it is intended. Other and further objects of our invention will appear from the following specification and accompanying drawings which form a part hereof. In carrying out the objects of our invention, however, it is to be remembered that its accidental features are susceptible of change in design and structural arrangement, with only preferred and practical embodiment of the best known mode being specified and illustrated in the accompanying drawings, as is required. BRIEF DESCRIPTION OF DRAWINGS In the accompanying drawings which form a part hereof and wherein like numbers of reference refer to similar parts throughout: FIG. 1 is a somewhat expanded, isometric surface view of a snowboarding boot having our stiffening structure thereon to show its various parts, their configuration and relationship. FIG. 2 is an orthographic side elevational view of the boot of FIG. 1, taken from the right side of FIG. 1. FIG. 3 is an orthographic front elevational view of the boot of FIG. 1. FIG. 4 is a somewhat enlarged, horizontal cross-sectional view through the upper portion of the boot of FIG. 3, taken on the line 4--4 thereon in the direction indicated by the arrows. FIG. 5 is an orthographic side view of a boot having somewhat vertically orientated single pockets on each side of the carrying stays, having snap fasteners. FIG. 6 is an elongate cross-sectional view through the pocket and stiffener of FIG. 5, taken on the line 6--6 thereon in the direction indicated by the arrows. DESCRIPTION OF THE PREFERRED EMBODIMENT Our invention generally provides pockets 10, supported on the upper portion of snowboard boot 12, to carry stiffening stays 11 in selectively adjustable positions therein. Snowboard boot 12 on which our invention is used is a boot of ordinary traditional configuration and nature presently used in the snowboarding arts and may comprise a pre-manufactured boot or one created especially for use with our invention. The boot provides foot 13 with welt 14 interconnecting the sole structure with boot upper portion 15 having traditional front opening 16 covered by tongue 17 and closable by fastener structure 18 in the instance illustrated comprising eyelets interconnected by a lace. The boot may be formed by most of the known manufacturing methods to a traditional snowboard boot configuration that is adaptable to fastening in the common and somewhat standardized boot bindings carried by snowboards. Commonly in the present day, the outer surfaces of sole 13 and welt 14 will be formed of rubber, TEFLON or some polymeric rubber-like material that may be fastened to adjacent elements by traditional mechanical fastening of sewing, adhesion, thermal welding or the like and may also be vulcanized or otherwise joined to the adjacent material to aid in providing a water-proof structure for the boot foot structure, including the sole and welt. The boot upper portion 15 is formed of some flexible material, commonly a more pliable leather, a woven fabric material such as polymeric canvas, polymeric sheet material or some layered combination of such materials. The pliability of this material varies somewhat, but all such material generally is of a reasonably flexible nature to allow somewhat of a conformable fit about the lower leg of a boot wearer and to allow the leg to have a limited range of motion at the ankle joint relative to the foot of a user. Our invention is adapted for use with such a boot. Pockets 10 provide body 19 that, when positioned on boot upper 15, defines elongate channel 20 between the body and adjacent boot surface to hold a stiffening stay. Pocket body 19 is an elongate element that is fastened about its similar longer sides 21 and bottom 22 to a surface of boot upper 15 by some mechanical means, in the instance illustrated comprising sewing 23. This fastening also may be accomplished by adhesion, welding or other known methods, depending upon the nature of the materials being joined, and such methods are within the ambit and scope of our invention. The pockets may even be defined within and as a part of the structure of the boot upper itself (not shown), and this also is within the ambit of our invention. The pockets 10 may be defined on the exterior or interior surface of the boot uppers. The top edge of pocket body 19 is not fastened to the supporting boot so as to leave a top opening for channel 20 through which stiffening stays may be inserted. The pockets are arrayed in a somewhat vertical orientation extending from the top of upper portion 15 of a snowboard boot downwardly to a position at approximately the ankle of a user. The pockets may be vertical as in FIGS. 1-4 or may be vertically angulated as in FIG. 5, which may allow the use of less stays than the vertical orientation. Preferably pockets are defined on each lateral outside surface of boot upper 15, in a spaced relationship as illustrated in FIG. 1 if there be more than one pocket on a side. Commonly one or two pockets on each side of the boot upper are sufficient to accomplish the purposes of our invention, especially if the stays have appropriate width, and additional pockets are not necessary, though they may be used if desired, especially with narrower stays. Pockets may be placed at the rearward and forward surfaces of the boot, if desired, to make these areas stiffer, though commonly this is not desirable to aid ordinary snowboarding functions. The forward-rearward or width dimensions of each channel 20 preferably are substantially the same and such that when taken into account with the area of the channel, a stiffening stay that is to be used therein will be easily insertable but maintained in position by some frictional force to allow selective positioning and positional maintenance of the stiffening stay once positioned. In the species of pocket shown in FIG. 5, for a stay not having a manipulation loop, a finger notch 29 is defined in the upper medial portion of the pocket body, and one portion of a releasable snap fastener 30a is carried by the boot upper in a position to cooperate with the other snap fastener portion carried by a stiffening stay. The material from which pocket body 19 is formed preferably has a flexibility similar to or less than that of the material from which boot upper 15 is formed and commonly may be of the same type of material, such as a softer pliable leather, woven fabric canvas, polymeric sheet material or a combination of these materials. A stiffer material may be used for our pockets to enhance the stiffening effect of our invention but, if such material is used, it is to be remembered that the stiffness created by it may not be changed or modified and this detracts from the amount of variation obtainable by use of our stays if the pocket material is of the same or greater flexibility than the material of the boot upper. The same situation may exist in the method of fastening the pocket bodies to the boot uppers, and again normally as great a flexibility as is possible is desirable to create the widest range of potential adjustable stiffening. Stiffening stay 11 provides stay body 25, in the species of FIGS. 1-4 supporting manipulation loop 26 at its upper end. The stay body 25 is a relatively thin, elongate element of a size and cross-sectional shape to fit and be insertable with position maintaining friction within channel 20 defined by a pocket 10. The lower portion 27 of the stay body is somewhat rounded at its corners to aid placement and insertion within a pocket channel. In this species the manipulation loop 26 is an elongate strip of somewhat resilient material folded upon itself so that each of its ends lie adjacent to the opposite sides of the upper portion of stay body 25, and the loop material is fastened in this position by rivet 28, though other equivalent manipulation aiding devices and fastening means are within the scope of our invention. The length of the stay body from its lower end to the lower edge of manipulation loop 26 is preferably substantially equal to the vertical length of channel 20 defined by pockets 10. In the species of stiffening stay of FIGS. 5-6 there is no manipulation loop, as its use is optional and the device is fully operative without it. This species also provides one-half 30b of snap fastener 30 appropriately positioned to cooperate with the other half 30a carried by the boot upper to releasably fasten the stiffening stay within channel 20 of pocket 19. This snap fastener also is optional and our apparatus is operative without the fastener. The material from which the stiffening stays are formed should be stiffer than the material from which the upper portion 15 of boot 12 is formed and may vary through a wide range of stiffness to the point of substantial rigidity, depending upon the particular results desired from the element. The material also must provide sufficient strength and durability to avoid breakage during use and in the normal adverse environments of that use, and must have sufficient elastic resilience or plastic memory to substantially maintain its original configuration after deformation. The material of preference for stays of greater stiffness is elastically resilient spring steel and for various lesser degrees of stiffness varying through a fairly wide range, the preferred material is one of the higher density polymeric or resinous plastics which may be chosen and styled for a wide range of variance in flexibility especially by varying cross-sectional area and dimension. It is possible that various stiffening stays having different flexibility and elasticity may be used simultaneously in a single boot or in boots for both feet and if the stay bodies are appropriately configured, it is possible that more than one stiffening stay may be used in a single pocket to accomplish a particular desired result. Having described our invention, its use may be understood. Firstly, a pair of snowboard boots, or a single boot if desired, are created according to the foregoing specification to embody our adjustable stiffening structure. The boots preferably have pockets 10 extending downwardly on the outer surface of each lateral side of the upper portion 15 of each boot. These boots are placed upon the feet of a user and fastened in normal fashion. The boots may be used in this form, like any other flexible snowboarding boot, for walking and the like and may be used for snowboarding if a boot with a flexible upper is desired for the particular snowboarding use. If it be desired to stiffen the upper portions of the boots for a particular snowboarding purpose, such as general downhill transport or racing, one or more stiffening stays are placed in the pockets carried on the boot upper. These stays may be placed before a boot is fastened in a snowboard boot harness or after such fastening as desired. For placement the stay is manually moved to a position immediately above the upper orifice of channel 20 and the lower portion of the stiffening stay is inserted within that orifice. The stay during this procedure commonly will be grasped and supported by its upper portion or manipulation loop 26 if present. After establishment of the stiffening stay within channel 20, the stay is moved downwardly by sliding within that channel to a depth that gives the degree and areal positioning of stiffness desired by the user for a particular use. This stiffness may be estimated for stay positioning by the user's motion of his foot to test the stiffness during stay insertion and by experience from prior use. The stays after initial placement may also be adjusted as desired, even during use while snowboarding, so long as they may be accessed. For normal use the stays selected preferably are such that when they are fully included within the pockets, they create substantially the desired degree of stiffness for downhill snowboarding. When it is desired to change the stiffness of the boot for different snowboarding purposes or to allow walking, the stays may be removed partially or completely merely by pulling them upwardly in the pocket channels or completely out of those channels as the case may be. It is to be noted that to create various specialized conditions only part of the stays that may be insertable in a particular boot may be used, and stays of varying degrees of stiffness may be used, either individually or in combination. It is also to be noted that multiple stays may be used in a single pocket if either the stays, pocket or both are designed for such purpose to allow insertion and positional maintenance. Various numbers and positioning of pockets on a boot will also create variable parameters to determine the total stiffening effect and its area of application. The foregoing description of our invention is necessarily of a detailed nature so that a specific embodiment of it might be set forth as required, but it is to be understood that various modifications of detail, rearrangement and multiplication of parts might be resorted to without departing from its spirit, essence or scope. Having thusly described our invention, what we desire to protect by Letters Patent, and SUMMARY: [/INST] A snowboarding boot having a flexible upper portion has one or more somewhat vertical elongate pockets on the surface of the upper portion to receive therein elongate, semi-rigid stiffening stays. Each pocket is formed of flexible material to define a medial channel having an open top and cross-sectional area similar to that of the stiffening stay to be carried therein to allow variable vertical positioning and positional maintenance of the stiffening stays by reason of frictional engagement with the pocket. Stiffening stays are formed of elongate strips of semi-rigid material, normally having some resiliency but being more rigid than the flexible upper portion of a boot, and the stiffening stays optionally carry a loop of flexible material in their upper end portions to aid insertion and removal and releasable fasteners for positional maintenance within a carrying pocket. The pockets extend downwardly from the top of a boot or to the ankle area in vertical or angulated orientation. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: SECTION 1. SHORT TITLE. This Act may be cited as the ``Federal Integrated Spent Fuel and High-Level Waste Management Act of 1994''. SEC. 2. FINDINGS AND PURPOSES. (a) Congressional Findings.--The Congress finds the following: (1) The transportation, storage, and disposal of high-level radioactive waste and spent nuclear fuel is a matter of national urgency that is the responsibility of this generation. (2) The utility generators and owners of high-level radioactive waste and spent nuclear fuel, together with their customers, have met, and will continue to meet, their obligations under the Nuclear Waste Policy Act of 1982 to provide for the cost of siting, licensing, construction, and operation of a Federal waste management system. (3) Some utilities have now exhausted their spent nuclear fuel pool storage capacity, a total of 26 nuclear power reactors will reach their spent nuclear fuel pool storage capacity by the end of 1998, and approximately 80 nuclear power reactors will be without spent nuclear fuel pool storage capacity by 2010. As a result, utility rate payers face significant costs associated with expanding storage capacity at reactor sites, and continued delay is unacceptable. (4) Federal efforts to site, license, construct, and operate disposal facilities in accordance with the provisions of the Nuclear Waste Policy Act of 1982 have not met the timetables contemplated by such Act. (5) The Secretary of Energy has a clear and unconditional obligation to take possession of and title to high-level radioactive waste and spent nuclear fuel beginning not later than January 31, 1998. (6) Notwithstanding the passage of 12 years since enactment of the Nuclear Waste Policy Act of 1982, the payment of more than $8,400,000,000 into the Nuclear Waste Fund during such period, and the additional programmatic direction provided by the Congress in the 1987 amendments to such Act, the projected date of commencement of operations at a repository is, under the most optimistic of assumptions, 2010. (7) Until a repository is operational, interim storage will continue to be required for high-level radioactive waste and spent nuclear fuel. (8) In light of the obligation of the Secretary of Energy to accept high-level radioactive waste and spent nuclear fuel beginning not later than January 31, 1998, the Secretary must establish an interim storage facility for such waste and spent fuel by such date. (b) Statement of Purposes.--The purposes of this Act are the following: (1) To specify with certainty the obligation of the Federal Government to take possession of and title to high-level radioactive waste and spent nuclear fuel and provide for its timely and safe transportation, storage, and disposal. (2) To provide the Secretary of Energy with additional incentives and means for succeeding in the siting, licensing, construction, and operation of Federal facilities for the storage and disposal of high-level radioactive waste and spent nuclear fuel. (3) To require the Secretary of Energy to establish an interim storage facility for high-level radioactive waste and spent nuclear fuel of domestic origin by January 31, 1998, for the purpose of fulfilling the obligation of the Federal Government under the Nuclear Waste Policy Act of 1982. SEC. 3. FEDERAL OBLIGATION TO TAKE POSSESSION OF AND TITLE TO HIGH- LEVEL RADIOACTIVE WASTE AND SPENT NUCLEAR FUEL. Section 302(a) of the Nuclear Waste Policy Act of 1982 (42 U.S.C. 10222(a)) is amended by adding at the end the following new paragraph: ``(7)(A)(i) Notwithstanding any other provision of this Act or other law, the terms of the contracts entered into pursuant to this section, or the commencement of operations of a repository, the Secretary shall, by not later than January 31, 1998, begin taking possession and providing for the removal from existing storage facilities of the high-level radioactive waste and spent nuclear fuel covered by such contracts. ``(ii) A means of fulfilling the obligation set forth in clause (i) shall be the Federal Integrated Spent Fuel and High-Level Waste Management Program established in section 162. ``(B) The Secretary shall take possession and provide for the removal of the high-level radioactive waste and spent nuclear fuel referred to in subparagraph (A) in accordance with the acceptance priority ranking as required by the contracts entered into pursuant to this section. ``(C) As any high-level radioactive waste or spent nuclear fuel referred to in subparagraphs (A) and (B) comes into the possession of, and is removed by, the Secretary, title to such waste or spent fuel shall transfer to the Secretary.''. SEC. 4. FEDERAL INTEGRATED SPENT FUEL AND HIGH-LEVEL WASTE MANAGEMENT PROGRAM. (a) In General.--Subtitle E of title I of the Nuclear Waste Policy Act of 1982 (42 U.S.C. 10172 et seq.) is amended by adding at the end the following new section: ``federal integrated spent fuel and high-level waste management program ``Sec. 162. (a) Establishment.--The Secretary shall establish and administer in accordance with this section a Federal Integrated Spent Fuel and High-Level Waste Management Program as a means of fulfilling, in a safe, efficient, and cost-effective manner, the responsibility of the Federal Government to take possession and provide for the removal from existing storage facilities of, and take title to, high-level radioactive waste and spent nuclear fuel as provided in section 302(a)(7), and to provide for the management of high-level radioactive waste and spent nuclear fuel in accordance with subsection (b). ``(b) Components of Program.--The Federal Integrated Spent Fuel and High-Level Waste Management Program shall include the following components: ``(1) Development and use of a multipurpose canister system or systems for the transportation, storage, and disposal of spent nuclear fuel. ``(2) Development of the transportation infrastructure required to carry out the storage and disposal of high-level radioactive waste and spent nuclear fuel in accordance with the Program. ``(3) Establishment of an interim storage facility for high-level radioactive waste and spent nuclear fuel, consistent with applicable licensing and environmental protection requirements, by not later than January 31, 1998. ``(4) Disposal of high-level radioactive waste and spent nuclear fuel in a repository developed under this Act. ``(c) Progress Reports.--The Secretary shall submit to the Congress, not later than 120 days after the date of the enactment of this section and annually thereafter, a comprehensive progress report with specific details of how the Secretary is implementing the Federal Integrated Spent Fuel and High-Level Waste Management Program. Each report shall also include a list of recommendations for the continued successful implementation of the Program and any proposed implementing legislation. Prior to submission of any such report, the Secretary shall publish in the Federal Register a notice of the availability of a draft of the report, and shall solicit comments from interested parties.''. SUMMARY: [/INST] Federal Integrated Spent Fuel and High-Level Waste Management Act of 1994 - Amends the Nuclear Waste Policy Act of 1982 to instruct the Secretary of Energy to begin taking possession and providing for the removal from existing storage facilities of high-level radioactive waste and spent nuclear fuel by a specified deadline. Transfers title to such waste or spent fuel to the Secretary at the time of its Federal removal or possession. Directs the Secretary to: (1) establish a Federal Integrated Spent Fuel and High-Level Waste Management Program to implement such directive; and (2) submit annual status reports to the Congress. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: .................................................................................................................................................................................... ALBUQUERQUE, N.M. — A rowdy passenger forced a Delta flight traveling from Atlanta to Los Angeles to land at the Albuquerque International Sunport between 6 and 7 p.m. Thursday, according to an airport spokesman. Sunport police arrested the disruptive passenger, who was traveling on Delta flight 81, once the plane landed, said spokesman Daniel Jiron. “I don’t know exactly what the incident was” that made the pilot feel he had to land the plane, Jiron said. The FBI was called in, which is standard procedure in situations like this, Jiron said. The man was not charged but did not get back on the the plane, which took off for Los Angeles shortly before 8 p.m., according to KOAT-TV. He is reportedly supposed to leave on a flight scheduled for tomorrow, according to KOAT-TV. A Delta Airlines flight from Atlanta to Los Angeles was diverted to an Albuquerque airport Thursday because of a disruptive passenger, an airport spokesman said. The nature of the disturbance was not immediately available, but an Albuquerque International Sunport spokesman said in an email that the man was booted off of Delta flight 81 after it landed just after 6 p.m. local time (8 p.m. ET) but was not charged. A passenger on the plane, Lauri Springer, told NBC station KOB that the incident happened far in the front of the plane, where first-class passengers sit. "We didn't really know what was going on. There was no commotion, no yelling," said the college student, who planned to do some sightseeing in Los Angeles when her flight hit the unexpected snag. "We got about 20 minutes outside of Albuquerque and the pilot came on and said that we were going to be making an emergency landing in Albuquerque because of a security issue he was concerned with." Police met the plane and escorted the passenger off. Airport spokesman Daniel Jiron said the man wouldn't be charged but was not allowed back on the flight. The flight took off about 90 minutes after the unscheduled stop, Jiron said. SOCIAL Update: there was a disruptive passenger who was making threats.. So police officers escorted him off. 'Tis the season! — Lauri (@lkspringer) December 26, 2014 And then everyone applauded the police officers and pilot and flight attendants for handling it so well. — Lauri (@lkspringer) December 26, 2014 — Phil Helsel SUMMARY: [/INST] Authorities say a disruptive passenger forced a Delta Air Lines flight from Atlanta to Los Angeles to land at the Albuquerque International Sunport in New Mexico between 6pm and 7pm on Christmas night. Airport spokesman Daniel Jiron tells the Albuquerque Journal that Sunport police arrested the passenger, who was traveling on Delta Flight 81, once the plane landed. Jiron adds that he doesn't know the nature of the incident that made the pilot feel he had to land the plane. He also notes that the FBI was called, which is standard in cases like this. Lauri Springer, a college student on the flight, tells NBC station KOB that the incident happened in the front first-class area. "We didn't really know what was going on. There was no commotion, no yelling," she says, per NBC News. "We got about 20 minutes outside of Albuquerque and the pilot came on and said that we were going to be making an emergency landing in Albuquerque because of a security issue he was concerned with." The man was not charged and didn't get back on the plane; the plane left for Los Angeles around 8pm. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: Nathan Eames was left an offensive voicemail message by a Natwest employee after he was turned down for a loan. NatWest has apologised after a business manager accidentally left a three-minute message on a customer's answerphone, mocking his financial situation and calling him a 'kb'. Nathan Eames, 39, received a call from a business team manager at the bank to discuss his 'feedback' after he was turned down for a loan. The call went straight to answerphone and the business manager left a polite message requesting he call her back. But the business bank manager then failed to hang up properly and, unaware the voicemail was still recording, immediately began joking with colleagues and mocking Mr Eames. She joked: 'God, I'm glad he wasn't there, 'cause he's a kb.' Mr Eames, who declared himself bankrupt in 2009 due to the financial downturn, said he was'shocked' at the message. The freelance photographer said: 'I was appalled when I listened to the message. I couldn't believe what I heard. 'Being. rejected for a loan is one thing - but being subjected to a torrent of. abuse by ignorant people, completely lacking in empathy and compassion. for my situation, is quite another.' Mr Eames, from Poole, Dorset, declared himself bankrupt in January 2009 after falling into financial difficulties during the economic slump. After getting himself back on his feet, he contacted his local NatWest branch in January to enquire about a £10,000 short-term business loan to enable him to buy a photography studio. His application was turned down and he was told that he had not been discharged long enough from bankruptcy. He didn't let the setback get to him and instead he began putting money aside each month in the hope that he could then fund his dream. Two weeks ago, NatWest got back in touch with him and asked him to fill out a customer satisfaction survey. Mr Eames said he told the bank he felt they should consider giving loans to applicants whose bankruptcy had been fully discharged after five years. One week later, on June 22, he was called back by the bank to discuss his feedback. It is believed the call was made by a worker at the Salisbury branch of the bank in Wiltshire. He didn't take the call but got a message on his voicemail from 'Sarah', a Natwest 'business specialist'. She said: 'Yeah hi, a message for Nathan, it's Sarah, the Business Specialist at the Natwest in Salisbury. 'It's just a quick courtesy call following your feedback on the 2nd of June with the monthly business banking survey. 'If you could give us a call back and ask to speak to the North Dorset business team, thanks then, bye.' The caller then thought she had hung up and said to her colleagues: 'God, I'm glad he wasn't there, 'cause he's a knob. 'He's complaining but it's so clear. It says.. No, no, he's put on here 'as ex-bankrupt I do not get anything from you' Her colleagues are heard laughing in the background as she adds: 'Start considering lending to ex-bankrupts are his comments.' Natwest has apologised to Mr Eames and says it is investigating the incident and the members of staff involved. After listening to the abuse, furious Mr Eames said: 'Going bankrupt was an extremely difficult decision for me but, at the time, I didn't feel I had any other choice. 'But the bankruptcy was completely discharged and, for the past five years, I have been trying to get back on my feet. 'So to hear someone, who doesn't know me, insulting and mocking me to colleagues was completely unjustified and demoralising. 'Natwest. should train all their staff to understand the complexities of going. bankrupt. It was the hardest thing I have ever done.' 'I'm. now considering closing my business bank account with Natwest. I'm not. prepared to give them my business when they obviously hold me in such. low esteem.' A Natwest spokesperson said: 'We apologise unreservedly to Mr Eames. 'This is not the behaviour we expect from our people and we are currently investigating this incident, dealing directly with the members of staff involved.' SUMMARY: [/INST] Nathan Eames filled in customer survey after he was denied loan. He was phoned by a business manager to talk to him about his feedback. Bank boss left polite message on his answer phone after he did not pick up. Then, thinking she had hung up, she made offensive comments to colleague. She called Mr Eames a 'k**b' as colleagues laughed in the background. Shocked Mr Eames has accused staff of being insensitive and ignorant. Natwest has now apologised to him and says it is investigating the incident. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: An object in the peripheral visual field is more difficult to recognize when surrounded by other objects. This phenomenon is called “crowding”. Crowding places a fundamental constraint on human vision that limits performance on numerous tasks. It has been suggested that crowding results from spatial feature integration necessary for object recognition. However, in the absence of convincing models, this theory has remained controversial. Here, we present a quantitative and physiologically plausible model for spatial integration of orientation signals, based on the principles of population coding. Using simulations, we demonstrate that this model coherently accounts for fundamental properties of crowding, including critical spacing, “compulsory averaging”, and a foveal-peripheral anisotropy. Moreover, we show that the model predicts increased responses to correlated visual stimuli. Altogether, these results suggest that crowding has little immediate bearing on object recognition but is a by-product of a general, elementary integration mechanism in early vision aimed at improving signal quality. Since Korte [1] originally described perceptual phenomena of reading in peripheral vision, a substantial number of studies have shown the important role of spacing for object recognition. The phenomenon that an object becomes more difficult to recognize when surrounded by other objects is now popularly known as ‘crowding’ [2] (see [3], [4] for two recent reviews). The strength of the crowding effect depends on the spacing between objects (Figure 1). The largest spacing at which there is a measurable effect is commonly referred to as the ‘critical spacing’. An important and often replicated finding is that the critical spacing for object recognition is proportional to the viewing eccentricity [5]. Moreover, critical spacing is found to be highly invariant to a great variety of stimulus manipulations, such as contrast and size [6]–[8]. Critical spacing is the most extensively studied crowding property and, because of its robustness, now sometimes considered the defining property of crowding [3]. Crowding is a general phenomenon in vision. It is not confined to letter and shape recognition, but affects a broad range of stimuli and tasks, including the identification of orientation [9]–[11], object size, hue and saturation of colors [12], recognition of faces [13], [14], reading [15], and visual search [16]–[18]. Altogether, crowding emerges as a fundamental limiting factor in vision, making the question about its neural basis and functional origin rather pressing. Several theories have been proposed to explain the crowding effect [4], [19]. Currently, there is a growing consensus that crowding results from feature integration over an area that is larger than the target object [4]. However, there is a marked controversy about both the underlying mechanism and the functional origin of the effect. Some authors assert the existence of bottom-up hardwired integration fields (e. g., [3]), while others claim that feature integration arises from limitations related to the spatial resolution of attention (e. g. [20], [21]). Postulated functions of feature integration include texture perception [10], contour integration [22], and object recognition [3], [23]. In the absence of quantitative, biologically motivated models, however, it is not clear whether these theories can also quantitatively account for the ‘mysteries of crowding’ [4], and how plausible they are from a biological perspective. Here, we present a quantitative model for spatial integration of orientation signals. Our model is based on the principles of population coding [24], which is an approach that mathematically formalizes the idea that information is encoded in the brain by populations of cells, rather than by single cells. Motivated by findings from physiological [25], [26] and theoretical [27] studies, we model feature integration as a (weighted) summation of population codes. Using simulations, we demonstrate that this approach allows to explain several fundamental crowding properties in a single, unified model, including aspects of critical spacing [6], [15], compulsory averaging of crowded orientation signals [10], and an asymmetry between the effects of foveally and peripherally placed flankers [28], [29]. Moreover, we show that the model predicts enhancement of signals that encode visual contours, which could facilitate subsequent contour detection and segmentation and adds support to earlier findings about a link between crowding and contour integration. Altogether, our main finding is that feature integration, implemented in a neurophysiologically plausible way, produces crowding as a by-product. Furthermore, our results add support to an earlier suggested link between crowding and contour integration, and they point at V4 as a likely locus for feature integration cells (at least for the orientation domain). Several different population coding schemes have been proposed in the literature [30]. Although they differ in their details, the general idea behind all of them is that variables are encoded in the brain by entire populations of cells. Our model is based on the ‘distributional population coding’ (DPC) scheme that was proposed by Zemel et al. [31]. In this scheme, a population code explicitly encodes a probability distribution over the stimulus domain. In this section we will only provide a general overview of our model. Mathematical details can be found in the Methods section. The input to the model consists of a set of stimuli, each one defined by a location, orientation, contrast, and size (Figure 2a). The first layer of the model represents full probability distributions over the input stimuli. These distributions are assumed to be Gaussian, with a width that depends on the eccentricity, contrast, and size of the stimuli (Figure 2b). Subsequently, these probability distributions are used as inputs to the DPC encoder that computes a population code representation for each of the stimuli (Figure 2c). The properties of the cells (e. g., tuning width) in the first layer are chosen such that they closely resemble V1 simple cells (see Methods for parameter values). In the second layer, stimulus representations from the first layer are spatially integrated, in the form of weighted summations of cell responses (Figure 2d). The integration weights depend on the cortical distance in primary visual cortex between the locations of the ‘integration cell’ and the cells encoding the input stimuli (for details about the weight function and mapping of visual field to cortical locations, see Methods). This function can be interpreted as defining a cortical ‘integration field’. The size and shape of these integration fields can be thought of as representing the arborization of the dendritic tree, i. e., the distribution of lateral connections of a physiological integration cell. The weight function is a 2D Gaussian, thus reflecting that there are many short-range connections and fewer long-range connections. Unlike the first layer, which is a simulation of V1 simple cells, it is currently difficult to link the cells from the second layer to a very specific cortical area. Nonetheless, if we compare the predictions that follow from optimization of our model parameters to the current physiological literature, then we find V4 to be a likely candidate. We come back to this in the discussion section. Several of the simulation experiments that we conducted required that a response be generated (e. g., when simulating psychophysical experiments involving target tilt estimation). In those simulations, a maximum-likelihood decoder was used to decode the post-integration population code associated with the target position back to a stimulus distribution (Figure 2e). The number of components of the returned mixture model was interpreted as the number of distinct orientations perceived at the location associated with the decoded population code, the mixing proportions as the amounts of evidence for the presence of an orientation, the means as estimates of these orientations, and the standard deviations as the amounts of uncertainty about these estimates. A well-established behavioral finding in human observers is that identification thresholds for a crowded target decrease as a function of target-flanker spacing until a certain critical spacing is reached. Beyond this critical spacing flankers no longer have an effect (see, for example, the results shown in Figure 1). In our model, the integration fields are implemented as weight functions of stimulus spacing in cortex. Consequently, flanker stimuli affect the identification of a target only when positioned within a certain distance from the target, yielding a critical region for target identification. To examine whether our model can quantitatively account for critical regions found for human subjects, we performed a simulation that mimicked the psychophysical experiment by Pelli et al. [15], who estimated critical regions for letter identification at several positions in the visual field. Critical regions predicted by our model were estimated as follows. For each target position, identification thresholds were determined for a range of target-flanker spacings (see Figures 3a and 3b; we refer to Methods for details about the procedure that was used to estimate identification thresholds). A ‘clipped line’ was fit to the resulting data, providing an estimate of the critical spacing (Figure 3c). By varying the positions of the flankers, we estimated critical spacing in several directions around the target. Combining these spacings gives an estimate of the critical region around a given target location (Figure 3d). We estimated model parameter values that result in a good model fit to one of the critical regions measured by Pelli et al. Subsequently, we repeated the experiment for the other target locations using the same parameter values, and found that the model accurately predicts all reported human critical regions (Figure 3d). These results thus provide quantitative evidence for the suggestion that the behavioral crowding regions found in humans can be explained as the result of fixed-sized, hard-wired integration fields in visual cortex. The critical spacing for crowding is known to scale with eccentricity and is consistently found to be in the range 0. 3–0. 6 times the target eccentricity [6]. Moreover, it is found to be largely invariant under changes to the physical properties of the stimulus, such as the size, contrast, and number of flankers [6] and the ‘scaling’ of stimuli (i. e., changing the size of both the target and flankers) [6]–[8]. To further verify our model, we conducted another series of simulation experiments, in which we manipulated several stimulus properties. We found that the results are compatible with findings in human subjects: critical spacing predicted by our model scales linearly with target eccentricity and is hardly affected by stimulus manipulations (Figure 4). Human observers are able to report the mean orientation of a set of crowded stimuli, but not the orientations of the individual stimuli [10]. This peculiar crowding property is generally referred to as ‘compulsory averaging’. In the experiment of Parkes et al., observers reported the tilt direction of a variable number of equally tilted targets positioned among horizontal flankers. Parkes et al. found that a relatively simple pooling model could account for human data when the total number of stimuli is kept constant. However, when targets are presented without flankers, identification thresholds dropped significantly slower as a function of the number of targets than predicted by their model (Figure 5b). They postulated a ‘late noise’ factor to explain the discrepancy between data and model. Our model suggests the following explanation for the compulsory averaging phenomenon. When two features are highly similar, their population code representations have a high degree of overlap and will merge when summed. Consequently, the resulting post-integration code will be interpreted as representing a single feature with a value somewhere in between the values of the input stimuli (Figure 5a). To examine whether our model can also quantitatively account for compulsory averaging, we conducted a simulation experiment with conditions and stimuli similar to those used in the psychophysical experiment performed by Parkes et al. [10]. The results show that our model produces accurate fits to the psychophysical data for both the condition with and without flankers (Figure 5b). An important difference between our model and the pooling model proposed by Parkes et al. is that the latter integrates all stimuli with equal weight, while integration in our model is weighted by object spacing. To verify the relevance of this aspect in explaining why the models make different predictions, we reran the simulations with varying stimulus spacing (see Text S1 and Figure S3 for results). We found that when we set all integration weights in our model to one (implying an object spacing of zero), the identification thresholds predicted by our model are similar to those predicted by the pooling model of Parkes et al. Additionally, the predictions of the models increasingly diverge when object spacing is increased. These results confirm that object-spacing related weighting of integration is an essential difference between the models. Moreover, they challenge the need for the ‘late noise’ factor proposed by Parkes et al. to explain their results. Several studies [5], [29] have found that, with equal target-flanker spacing, flankers positioned at the peripheral side of a target cause stronger crowding effects than flankers positioned at the foveal side. As has been noted previously [16], this asymmetry follows directly from the way that the visual field is mapped onto the cortex. With increasing eccentricity, the representation of visual space becomes more and more compressed. Consequently, for equal target-flanker spacing in visual space, the cortical distance between the representation of a target and a foveal flanker is larger than that between a target and a peripheral flanker. Assuming that cortical integration fields are isotropic, peripheral flankers will, therefore, contribute more to the integrated target signal than foveal flankers. We conducted a simulation experiment to verify whether our model replicates the foveal-peripheral anisotropy and to investigate how its predictions depend on target-flanker spacing. For several target-flanker spacings, we estimated 75%-correct target contrast thresholds for identifying the tilt of a target without a flanker, a target with a foveal flanker, and a target with a peripheral flanker (Figure 6a). The results show that while both the foveal and peripheral flanker produce crowding (Figure 6b), the effect caused by a peripheral flanker is substantially larger than that caused by a foveal flanker (Figure 6c). Hence, our model exhibits a foveal-peripheral flanker anisotropy. Furthermore, the model predicts the anisotropy to be strongest at intermediate spacings while it predicts no anisotropy when target-flanker spacing is very small or approaches the critical spacing (Figure 6d). In these simulation data, the strongest anisotropy is found when target-flanker spacing is about 2 degrees (i. e., about 0. 3 times the target eccentricity). At this spacing, threshold elevation caused by the peripheral flanker is predicted to be approximately 2. 5 times that caused by the foveal flanker. This is comparable to the effect size measured for human observers [29]. The results so far suggest that crowding is what happens when signals from closely-spaced, unrelated stimuli are integrated with each other. However, in normal viewing conditions, signals from closely-spaced stimuli are often correlated (e. g., neighboring line segments of an edge or smooth contour). It has been suggested that integration of such correlated (orientation) signals may underlie phenomena such as contour integration [25], [32], [33]. To see how our model responds to signals from correlated stimuli, we ran a simulation with an input stimulus consisting of a set of line segments comprising various contours within a noisy background (see Methods for details). The results are shown in Figure 7. Line segments that are part of a contour clearly stand out in the post-integration representation. This is because both stimulus density and orientation correlation are higher for contours than for the random background. This result supports an earlier suggested link between contour integration and crowding [22], but firm conclusions would require further extensive evaluation. Note that in areas away from fixation, in the periphery of the visual field, the decoder often returned stimulus distributions that represent more than one orientation value. This indicates that the post-integration codes at those locations are ambiguous in terms of the encoded orientation. In other words, when stimulus spacing is small relative to eccentricity, stimuli become jumbled with their neighbors, just as observed in crowding. The cells in the first layer are modeled after V1 simple cells (see Methods for accompanying parameter values). However, there is currently no agreement about the cortical locus of the ‘integration cells’ that are supposed to underlie crowding. Therefore, we decided to make minimum assumptions about their physiological origin. Consequently, the size and shape of their receptive fields, determined by σrad and σtan (see Methods), were taken to be free parameters, such that the parameter values that provide a good fit to experimental data can be considered a prediction for the receptive field properties of the integration cells underlying crowding. We found that the best model fit to the data is obtained with integration cells that are strikingly similar to a type of cell that has recently been identified in V4 (of cat and monkey) [34], [35]. The function of these cells is currently unknown [36]. Hence, we speculate that these V4 cells spatially integrate information from V1 (either directly or mediated by V2). Their possible function may be contour integration (e. g., as a precursor for shape coding), with crowding as a by-product. Interestingly, other, independent, lines of evidence also have suggested that crowding occurs beyond V1 [21], [37] with V4 as a likely candidate area [38]. The parameter settings (see Methods) in our model were fixed over the entire range of simulations that we performed, with one minor exception (see Figure 3). We reran a number of simulations with different parameter values and found that this hardly affected our results (see Text S1 and Figure S4 for details). This suggests that crowding is an inherent property of a mechanism that integrates signals by summing population codes. These results shed new light on earlier proposed crowding theories. Some authors have proposed that crowding is, at least in part, the result of ‘source confusion’ due to positional uncertainty [39], [40]. We would like to note, however, that integrating signals over space necessarily increases positional uncertainty. Hence, we consider location uncertainty and, consequently, ‘source confusion’ a result of feature integration, rather than an additional factor in the explanation of crowding. Indeed, our results show clear evidence for ‘source confusion’, even though we did not explicitly incorporate positional uncertainty into our model (for an example, see Figure 5a). When spatially averaging signals in a retinotopically arranged ‘feature map’ (such as V1), activation patterns that are caused by closely spaced stimuli may slightly shift towards each other (or even completely merge together, if spacing is very small). As a result, an averaging of stimulus positions may be perceived in such situations. In a recent paper it was shown that judgments of the position of a crowded target object are systematically biased towards the positions of flanking objects [41]. The authors of that paper explained their results by a model that averages stimulus positions. Based on the foregoing argument, their results can presumably just as well be explained as a result of averaging feature signals over space. A recent theory suggests that crowding is the ‘breakdown of object recognition’ [3]. The reasoning is that spatial integration of object features (in the notion of ‘binding’) is required for object recognition, whereas crowding occurs when multiple objects fall within the same integration field. Our results indicate that the spatial signal integration underlying crowding may enhance responses for correlated signals, such as contours. This corroborates an earlier suggestion that the ‘association fields’ that have been proposed to underlie contour integration [42] may also cause crowding [22]. While such enhancement of responses to correlated signals will no doubt facilitate higher-order functions such as object recognition, integration appears to have a more elementary and general function. Other authors argue that crowding is the result of attentional limitations [20], [21], although evidence for these theories is considered very slim [4]. While we deem it possible that attentional factors have modulatory effects on crowding, our present results show that the general properties of crowding can very well be accounted for without invoking attentional mechanisms. It has also been suggested that crowding is ‘texture perception when we do not wish it to occur’ [10]. The motivation behind this proposal is the finding that observers cannot identify individual stimulus properties in a crowded display, but still have access to its average statistics (i. e., its texture properties). Our model is able to explain this finding (see Figure 5), and we agree that what occurs after pooling can be described as ‘texture perception’. However, in view of the plausible connection between spatial integration and contour integration, we hesitate to conclude that texture perception is the primary function of spatial integration. Moreover, if a functional link exists between spatial integration and texture perception, then we deem it just as likely that integration serves to compress visual information, in order to reduce energy requirements at higher levels of processing. Two crowding properties that our current model does not account for are the effects of ‘target-flanker similarity’ and ‘flanker configuration’. The former refers to the finding that crowding is stronger for target-like flankers compared to dissimilar flankers [9], [43], [44]. The ‘flanker configuration’ effect refers to the finding that crowding is partially ‘released’ when surrounding flankers form a contour [45], [46]. A rather natural extension to our model may allow it to account for these two effects as well. At present, the integration fields in our model represent exclusively excitatory horizontal connections between cells. Alongside these excitatory connections, however, many of the cells in primary visual cortex are known to have inhibitory connections as well as feedback connections from higher-order brain areas [47]. Inhibition could reduce the integration of dissimilar pieces of information and thus be responsible for target-flanker similarity effects in crowding. Likewise, the feedback connections might inhibit the integration of signals that are likely to represent different objects or ‘perceptual groups’ and, therefore, be responsible for configuration influences on crowding. The model and simulations that were presented in this paper are limited to the orientation domain. However, crowding is a rather general phenomenon that affects a large number of tasks, including discrimination of letters and objects sizes, colors, and shapes. Since population coding is considered the general way by which variables are encoded in the brain [24], crowding of other basic features such as size and color [12] can presumably be explained by a model that is largely analogous to the one presented here. Moreover, if population coding is also used to encode more complex information, and spatial integration takes place at many different levels of processing, then our model predicts that crowding should also be found at many different levels. Hence, crowding of more complex structures (such as letters, object shapes, bodies, and faces) could follow both from crowding in their constituent features and from crowding within higher-order population codes that represent the structures themselves [48]. Our model licenses a number of predictions that can be tested experimentally. For example, the simulations related to the ‘compulsory averaging’ effect predicts the effects of stimulus spacing and contrast on identification thresholds. Additionally, the model makes quantitative predictions regarding the effect of spacing on the foveal-peripheral flanker anisotropy of crowding. Finally, the model makes predictions about the receptive field properties of the integration cells responsible for crowding, The results that we presented here lend strong quantitative support to the theory that the mechanism behind crowding is spatial feature integration, and our model provides a computationally motivated physiological basis to this theory. Input stimuli are specified as 4-tuples, where is the orientation, the size, the location, and the (relative) contrast of the stimulus. For each of these inputs we first define a corresponding probability distribution, which is subsequently used as input to the distributional population coding scheme of Zemel et al. [31]. The width of an input distribution represents the perceptual uncertainty about a stimulus and is related to stimulus eccentricity, size, and contrast c, in the following way (see Text S1 for motivation): (1) In order to account for the circularity of the orientation domain, we define these distributions to be circular normal (von Mises) distributions. More specifically, the distribution over orientation s for a stimulus is defined as: (2) where is the modified Bessel function of order 0, is an inverse measure of statistical dispersion, and is a value drawn from the normal distribution over s. In the simulation experiments we map the stimulus domain [−90,90) deg to [−π, π). The tuning curves fi (s) of the cells are defined as circular normal functions over s: (3) where si is the preferred orientation of cell i, the width of the tuning curves, and an S-shaped function that defines how cell gain relates to the contrast c and size α of a stimulus (see Text S1 and Figure S1). Following the DPC scheme, we compute the average response of cell i to a stimulus as follows: (4) where is the level of spontaneous activity and drawn from a normal distribution with mean and a standard deviation. In order to evaluate this integral numerically, we approximate the input distributions by histograms and the tuning functions by histograms, both with bin centres linearly spaced in the range. Hence, we can rewrite equation (4) to (5) A population code representing a stimulus is constructed by drawing responses rhi from Poisson distributions (6) The second layer of the model spatially integrates the stimulus representations in the first layer. The layer-2 population code that is associated with position is computed as a weighted sum over the population code representations of all N input stimuli: (7) where is a 2D Gaussian weight function that represents the cortical integration fields (see Text S1 and Figure S2 for details). Several of our simulation experiments require that a task response is generated. In those experiments, a Bayesian decoder is used to estimate the stimulus probability distribution that is encoded in the post-integration population code associated with the target position. Subsequently, the orientation with the highest probability is interpreted as representing the most likely orientation of the target, and chosen for response. We use the Bayesian Information Criterion to choose the most likely mixture model among a set of models with 1,2, and 3 mixture components. We refer to the Text S1for all mathematical details of the decoder. The parameter settings of the model were as follows. In all simulations, the width of the tuning curves was set to, the number of neurons J comprising one population code was set to 90, the spontaneous firing rate rbase was set to 5 spikes/s, and the maximum firing rate was set to 90 spikes/s. The only parameters that varied between simulations were σrad and σtan, which determine the integration field width in the ‘radial’ and ‘tangential’ direction, respectively (see Text S1). These were set to 2. 5 and 1. 0 mm, respectively, in all simulations, except the one in which we estimated critical regions (Figure 3), where the values were set to 1. 6 and 1. 1mm, respectively. This difference is motivated by the observation that the human data in Figure 3 are from a subject with an unusually small critical spacing (approximately 0. 3 times the target eccentricity). Several simulation experiments involved estimation of target contrast thresholds for a tilt identification task. In those experiments, the procedure on a single trial was as follows. The target and flanker stimuli were encoded and their representations integrated, as described above. Subsequently, the post-integration population code associated with the target position was decoded to a mixture of normal distributions. The sign of the orientation associated with the peak location in the returned probability distribution was compared with the sign of the input target. Performance was considered ‘correct’ if the signs were the same, and ‘incorrect’ otherwise. Performance estimates were made for several target contrasts, by simulating 50 trials for each contrast. Finally, a sigmoid function with a mean a and a width b: (8) was fit to these data, in order to obtain an estimate of the target contrast that yields 75%-correct performance (see Figure 3b for an example). In the simulation experiments that estimated critical spacing, the above procedure was repeated to obtain 75%-correct thresholds for several target-flanker spacings. A ‘clipped line’ was fit to these thresholds in order to estimate critical spacing (see Figure 3c for an example). Input stimuli consisted of a ±10° tilted target and two 30° tilted flankers, positioned at opposite sides of the target. Flanker contrast and the size of both the target and flankers were set to 1. Using the procedure described above, critical spacing was estimated for the same target and flanker positions as in the psychophysical experiment by Pelli et al. [15]. The input stimuli consisted of a ±10° tilted target, one −30° tilted flanker, and one +30° tilted flanker. Flanker contrast and the size of both the target and flankers were set to 1. Critical spacing was determined for flankers positioned along the radial axis, on opposite sides of the target. In the first simulation (Figure 5a), input stimuli consisted of a 0° tilted target and two flankers with 10° tilt in the first condition and 50° tilt in the second condition. The target was positioned at 2. 5 deg of eccentricity. The flankers were positioned on opposite sides of the target, with a spacing of 0. 5 deg of eccentricity. The contrast and size of all stimuli were set to 1. Stimuli used in the second simulation (Figure 5b) were similar to those used in the psychophysical experiment by Parkes et al. [10]: N tilted targets and 9-N vertical flankers (first condition) or no vertical flankers (second condition), with a central position of 2. 5 deg of eccentricity and a spacing of 0. 5 deg between the central stimulus and surrounding stimuli. The contrast and size of the stimuli were set to 0. 5. On a single trial, the post-integration population code associated with the central stimulus position was decoded to a unimodal stimulus distribution. The sign of the orientation with the highest probability was compared with the sign of the target. If they were the same, performance on that trial was considered correct. We measured performance over 100 trials for varying target tilts. Based on these data, 75%-correct performance thresholds were determined. This procedure was repeated for different values of N. Input stimuli consisted of a ±10° tilted target without a flanker (condition 1), with a 30° tilted foveal flanker (condition 2), or a 30° tilted foveal flanker (condition 3). Flanker contrast and the size of both the target and flankers were set to 1. For all three conditions, 75%-correct target contrasts were estimated for a range of target-flanker spacings. Threshold elevations TEfoveal and TEperipheral were defined as described in the main text. The input stimuli consisted of a set of oriented bars, comprising three contours within a field of randomly oriented bars. The circle contour consisted of 35 equally spaced segments, was centered at (0,10) degrees of eccentricity and had a radius of 4 degrees of visual angle. The other four contours consisted of 23 line segments each, with a spacing of 0. 7 degrees of visual angle between every two neighboring segments. The randomly oriented line segments were placed on a grid with a radius of 18 degrees of eccentricity and a grid spacing of 2. 0 degrees. The contrast and size of all line segments was set to 0. 8. SUMMARY: [/INST] Visual crowding refers to the phenomenon that objects become more difficult to recognize when other objects surround them. Recently there has been an explosion of studies on crowding, driven, in part, by the belief that understanding crowding will help to understand a range of visual behaviours, including object recognition, visual search, reading, and texture recognition. Given the long-standing interest in the topic and its relevance for a wide range of research fields, it is quite surprising that after nearly a century of research the mechanisms underlying crowding are still as poorly understood as they are today. A nearly complete lack of quantitative models seems to be one of the main reasons for this. Here, we present a mathematical, biologically motivated model of feature integration at the level of neuron populations. Using simulations, we demonstrate that several fundamental properties of the crowding effect can be explained as the by-product of an integration mechanism that may have a function in contour integration. Altogether, these results help differentiate between earlier theories about both the neural and functional origin of crowding. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: By. Daily Mail Reporter and Associated Press Reporter. PUBLISHED:. 10:56 EST, 20 November 2013. \|. UPDATED:. 10:56 EST, 20 November 2013. Butterball apparently has a big mystery on its hands: The company says it doesn't know why some of its turkeys wouldn't plump up in time for Thanksgiving this year. CEO Rod Brenneman says it's the first time it has happened and that the company is investigating what went wrong. Butterball announced last week that it will have a limited supply of large, fresh turkeys that are 16 pounds or heavier for the holidays. 'No answer': Butterball, which produces fresh and frozen turkeys, says it has no clue why their turkeys are not gaining weight. The company produces one out of every five turkeys eaten on Thanksgiving. ‘It's a really good question. We. don't have an answer yet,’ Brenneman said when asked about the cause. But he noted that turkeys are ‘biological creatures’ subject to a. variety of factors. ‘For whatever reason, they just didn't gain quite as well this year,’ he said. Like. many other turkey producers, Butterball feeds its birds antibiotics to. prevent and treat illnesses, which can occur from living in cramped. quarters. The. use of antibiotics, which also promote growth in livestock, has been. the subject of concern that it could lead to antibiotic-resistant germs. Butterball, a. privately held company based in Garner, North Carolina, declined to say. whether it made any changes to its feed this year. But the problem seems. to have come up rather recently. For much of the year, Butterball produces turkeys that are frozen and stored until they're ready to be sold for the holidays. 'Mystery': Butterball says it is the first time its turkeys wouldn't plump up in time for Thanksgiving this year. Stocks cut in half: Supermarket chain Big Y said it had been notified by Butterball that orders for fresh Thanksgiving turkeys across the country were cut by 50 per cent. But then in October and November, it shifts into production for fresh turkeys. And that's when the company ran into problems with the turkeys not gaining enough weight, Brenneman said. Butterball declined to say whether the issue has been resolved or provide details on the extent of its shortage. But Big Y, a supermarket chain based in Springfield, Massachusetts, said it had been notified by the company that orders across the country were cut by 50 per cent. Mark Kastel, founder of The Cornucopia Institute, a Wisconsin-based group that advocates for organic farming, noted that major poultry producers tightly control production factors, making Butterball's shortage unusual. ‘I thought that was very mysterious. I could not think of a rational explanation,’ Kastel said, suggesting that a change in the feed formula may have been to blame. Butterball's shortage shouldn't be a problem for most, since fresh turkeys only account for about 15 per cent of sales, with frozen turkeys making up the rest. Butterball produces one out of every five turkeys eaten on Thanksgiving. Over at Cargill, spokesman Michael Martin says in an email that the company has never had a problem where its birds didn't put on enough weight to produce an adequate supply of large turkeys SUMMARY: [/INST] Company says it has limited supply of large, fresh turkeys that are 16 pounds or heavier for the holidays. Butterball produces one out of every five turkeys eaten on Thanksgiving. CEO says turkeys 'just didn't gain quite as well this year' and doesn't know why. Supermarket chain Big Y says fresh turkey orders across country cut by 50 per cent. Butterball declined to say whether it made changes to its feed this year. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: FIELD OF THE INVENTION [0001] The present invention relates to a class of novel compounds extracted from Semen Cassiae, and their use in reducing blood fat and reducing weight. BACKGROUND OF THE INVENTION [0002] Semen Cassiae are dried mature seeds of a leguminous plant, Cassia obtusifolia L., which has the effect of dispelling pathogenic wind and heat, removing heat from the liver and improving eyesight, and loosening the bowel to relieve constipation. Semen Cassiae is used to decrease the level of serum cholesterol in clinical practice. Semen Cassiae contains a variety of anthraquinone and benzopyrone components. It has been reported that among those components, some anthraquinone glycosides and benzopyrone glycosides have the efficacy of preventing the damage of tetrachloromethane and galactosamine to the primary hepatic cell culture of mouse (Qiwei, Zhang, et al., Chinese Traditional and Herbal Medicine, 1996, 27 (2): 79□ Wong, S M, et al., Planta Med. 1989, 55 (3): 276 and 28 (1): 211). [0003] Many medicaments for reducing blood fat and reducing weight, prepared from Semen Cassiae and other traditional Chinese medicine, have been proposed in many patent applications. However, their complicated composition makes it difficult to identify the active ingredients that play the key role. [0004] Takahashi et al. reported their results from studies on the components of the seeds of Cassia tora L. in Yakugaku Zasshi 93 (3) 261-267 (1973), in which the compounds of the following general formula were disclosed: [0005] I: R 1, R 2 =H V: R 3 =H, R 4 =COCH 3 [0006] II: R 1, R 2 =COCH 3 [0007] III: R 1, R 2 =CH 3 [0008] IV: R 1 =H, R 2 =COCH 3 [0009] VI: R 1 =CH 3, R 2 =H [0010] wherein Compound I, named as toralactone, is a yellow dye. However, the pharmaceutical effect of the compound was not reported therein. [0011] The object of the present invention is to provide a class of novel toralactone compounds, which has the efficacy of reducing blood fat and reducing weight. SUMMARY OF THE INVENTION [0012] The present invention provides a class of novel toralactones of general formula [A] and derivatives thereof, which are extracted from Semen Cassiae, or obtained by modifying the structure of the extracted compounds: [0013] wherein R 3 is H or C 2 -C 4 acyl, R 1, R 2 are same or different, and are each H, glycosyl or C 2 -C 4 acyl. [0014] The present invention further provides the use of the above compounds in reducing blood fat and reducing weight, and the pharmaceutical compositions comprising such compounds. DETAILED DESCRIPTION OF THE INVENTION [0015] The present inventor has taken a long-term study on the use of the extracts from Semen Cassiae in reducing blood fat. The extraction of Semen Cassiae comprises the following steps: [0016] 1. Pulverizing Semen Cassiae (produced in Anhui Province, China), extracting with hydrophilic solvent, such as water, methanol, ethanol, acetone, or the like, and heating to reflux, then removing the solvent under reduced pressure to yield Extract (A); [0017] 2. Loading Extract (A) on a porous resin, washing with water, and eluting with hydrophilic solvent, such as methanol, ethanol, acetone or the like, then collecting the eluent and removing the solvent under reduced pressure to yield Extract (B); [0018] 3. Performing column chromatography on Extract (B) using Silica Gel H, Silica Gel G or aluminum hydroxide and eluting with chloroform, ethyl acetate, ethanol or methanol, then combining the fractions that have the same components as detected by TLC, and removing the solvent, recrystallizing with methanol to yield Compound (1), Compound (2), Compound (3), Compound (4) and Compound (5): [A] Compound R 1 R 2 R 3 (1) H H H (2) glucosyl H H (3) H Glucosyl H (4) galactosyl H H (5) CH 3 H H [0019] wherein Compound (5) is the known toralactone, i.e. the above-mentioned compound I. Compounds (1)-(4) are novel compounds, which are named as: [0020] (1) neotoralactone, or nortoralactone; [0021] (2) neotoralactone-6-O-β-D-glucoside [0022] (3) neotoralactone-8-O-β-D-glucoside [0023] (4) neotoralactone-6-O-β-D-galactoside [0024] Further synthetic studies have shown that R 1, R 2, R 3 can be further acylated to obtain compounds wherein R 1, R 2 and R 3 are independently C 1 -C 4 acyl, e.g. Compound (6): Compound R 1 R 2 R 3 (6) COCH 3 COCH 3 COCH 3 [0025] Instrumental analysis has confirmed that the extracted Compounds (1)-(5) have the above-mentioned structures. [0026] Experiments on animals with these compounds have shown that, Compounds (1)-(4) have the effect of modulating serum cholesterol in hyperlipemia guinea pigs, and they contribute to the prevention of obesity. They have the efficacy of reducing blood fat and reducing weight. [0027] The present invention will be further illustrated by the following examples and test examples, which are not intended to limit the scope of the invention. EXAMPLE 1 Extraction and Structure Characterization of Compounds (1)-(5) [0028] Compounds (1)-(5) were extracted by the following steps: [0029] 1. Pulverizing Semen Cassiae (seeds of Cassia obtusifolia and Cassia tora (produced in Anhui Province, China) into coarse powders, extracting with 10 L of ethanol, while heating to reflux, then removing the solvent under reduced pressure to yield 210 g of Extract (A); [0030] 2. Loading 210 g of Extract (A) on 1000 g of a porous resin obtained by mixing Porous Resin D101, D201, D061 (produced by Tianjin Agriculture Pesticide Factory) in a ration of 1:1:1, then washing with 10 L of water and 5 L of ethanol sequentially, collecting the eluent, and removing the solvent to yield 10 g of Extract (B); [0031] 3. Performing column chromatography on 10 g of Extract (B) using 1000 g of Silica Gel H and eluting with chloroform, combining the portions that had the same constituents as detected by TLC, then removing the solvent, recrystallizing with methanol to yield Compound (1) (0.02 g), Compound (2) (2.42 g), Compound (3) (1.05 g), Compound (4) (0.5 g) and Compound (5) (0.32 g). [0032] Compound (1) was in the form of yellow acicular crystal, with m.p. 187-189□ (methanol). Its molecular weight determined by high resolution mass spectrum was 258.052849, and the molecular formula was C 14 H 10 O 5, EI-MS (m/e): 258, 229, 162, 115, 69. The data from 13 C-NMR and 1 H-NMR is shown in Table 1 and Table 2. Compound (1) was identified as neotoralactone (i.e. nortoralactone). [0033] Compound (2) was in the form of yellow acicular crystal, with m.p. 252-254□ (methanol). FAB-MS (m/e): 421 (M+1), 259 (aglucone+1), 235. The data from 13 C-NMR and 1 H-NMR is shown in Table 1 and Table 2. Compound (2) gave Compound (1) and glucose after hydrolyzed in the presence of diluted acid. 13 C-NMR indicated that glycosyl was bonded to the hydroxy at position 6. Compound (2) was identified as neotoralactone-6-O-β-D-glucoside. [0034] Compound (3) was in the form of yellow acicular crystal, with m.p. 263-265□ (methanol). FAB-MS (m/e): 421 (M+1), 259 (aglucone+1), 235. The data from 13 C-NMR and 1 H-NMR is shown in Table 1 and Table 2. Compound (3) gave Compound (1) and glucose after hydrolysis. 13 C-NMR indicated that glycosyl was bonded to the hydroxy at position 8. Compound (3) was identified as neotoralactone-8-O-β-D-glucoside. [0035] Compound (4) was in the form of yellow acicular crystal, with m.p. 258-260□ (methanol). FAB-MS (m/e): 421, 259 (aglucone+1), 235. The data from 13 C-NMR and 1 H-NMR is shown in Table 1 and Table 2. Compound (4) gave Compound (1) and galactose after hydrolysis. 13 C-NMR indicated that glycosyl was bonded to the hydroxy at position 6. Compound (4) was identified as neotoralactone-6-O-β-D-galactoside. [0036] Compound (5) was in the form of yellow acicular crystal, with m.p. 234-236□ (methanol). R f value from TCL was the same as that of toralactone. TABLE 1 13 C-NMR analysis Compound (1) Compound (2) Compound (3) Compound (4) 1 182.8 183.6 183.4 183.5 3 168.2 168.5 168.5 168.4 4 139.6 140.4 140.2 140.3 4a 159.4 159.4 159.5 159.4 5 104.3 102.3 104.3 102.4 6 164.0 168.4 164.0 167.2 7 102.7 101.7 101.6 101.6 8 101.7 101.7 105.8 101.6 8a 1580 158.2 157.0 158.3 9 152.2 151.8 151.0 151.1 9a 159.4 159.4 159.8 159.3 10 106.4 106.4 106.3 106.4 10a 161.5 161.2 161.5 161.3 11 20.1 20.1 20.1 20.1 1′ 100.1 100.2 99.8 2′ 73.4 74.0 76.2 3′ 77.2 77.3 78.3 4′ 69.5 69.6 73.1 5′ 76.2 76.3 71.0 6′ 60.5 60.5 61.0 [0037] [0037] TABLE 2 1 H-NMR analysis Compound (1) Compound (2) Compound (3) Compound (4) 4 6.6(s) 6.6(s) 6.6(s) 6.6(s) 5 7.0(d.s = 3.5) 7.0(d) 7.1(d) 7.1(d) 6 10.2(s) — 10.2(s) — 7 5.9(d.s = 3.5) 6.1(d) 6.0(d) 6.0(d) 8 10.4(s) 10.3(s) — 10.3(s) 9 15.0(s) 14.9(s) 14.9(s) 14.9(s) 10 6.7(s) 6.7(s) 6.7(s) 6.7(s) 11 2.5(s) 2.5(s) 2.5(s) 2.5(s) 1 1 4.9(d.J = 7.6) 5.2(d.J = 7.6) 4.7(d.J = 7.6) 2 1 - 2.9-3.8(m) 2.9-3.8(m) 2.9-3.8(m) 6 1 EXAMPLE 2 Preparation of Compound (6) [0038] 10 mg of Compound (1) was dissolved in pyridine, to which 2 ml of acetic anhydride was added. After standing for 24 hours, the mixture was poured into ice water. After filtration, the acetylated Compound (1), i.e. Compound (6) was yielded. [0039] Compound (6) was in the form of yellow acicular crystal, with m.p. 156-158□. FAB-MS (m/e): 385 (M + +1), 384 (M + ), 342 (M + -COCH 3 ), 299 (M + -2×COCH 3 ), 257 (M + -3×COCH 3 ), 162, 115. Compound (6) was identified as 6,8,10-triacetylneotoralactone. TEST EXAMPLE 1 The Effect of Neoalactone and its Derivatives on the Level of Serum Cholesterol in Hyperlipemia Guinea Pigs [0040] The test was performed as described in Fuhua, Wang, Chinese Journal of Surgery, 1991; 8 (1): 17. 60 healthy guinea pigs of 200-500 g were randomly divided into 6 groups based on body weight and sex. Each group contained 10 animals, including both male and female. The guinea pigs of Group 1 were fed with high-cholesterol feed (basic feed+0.5% cholesterol) at an amount of 20 g per 100 g body weight per day. Groups 2, 3, 4, 5 were test groups, the guinea pigs of which were fed with high-cholesterol feed plus 10 mg/(kg·d) of Compound (1), (2), (3) or (4) for 30 days. The guinea pigs of Group 6 were fed with basic feed only. The feeding for each group continued for 30 days, and 24 hours after the last feeding, the guinea pigs were anaesthetized i.p. with 1 g/kg Urethane. Blood was taken from heart, and serum was separated. The level of serum total cholesterol (TC) and triglyceride (TG) were determined. The results were shown in Table 3. TABLE 3 The effect of the active compounds on the level of serum cholesterol and triglyceride in hyperlipemia guinea pigs Numbers of Dosage Serum Group guinea pigs mg/kg TC (mmol/L) TG (mmol/L) Normal 10 — 3.75 ± 1.5 1.28 ± 0.2 High 10 4.80 ± 1.4 1.87 ± 0.8 cholesterol Compound (1) 10 10 4.21 ± 1.9 1.21 ± 0.3 Compound (2) 10 10 2.68* ± 0.2 0.78** ± 0.2 Compound (3) 10 10 3.81 ± 0.9 1.18 ± 0.2 Compound (4) 10 10 3.71 ± 1.1 1.22 ± 0.2 [0041] It can be seen from Table 3 that, the level of total serum cholesterol increased whereas the level of bile acid decreased when 0.05% of cholesterol was incorporated into the basic feed. The level of serum TC and TG could be reduced when the active compounds were fed at an amount of 10 mg/(kg·d)×30d. And the effect of Compound (2) was most prominent. This indicates that these compounds have the effect of modulating blood fat and promoting the balance of lipid metabolism. They contribute to the prevention of hyperlipemia obesity. And Compound (2) is preferred. [0042] In the above procedure, cholesterol was determinated by enzymatic analysis, using enzymatic agent assay kit from BGH Company (Taiwan). All the operations were carried out according to the manufacturer's instruction, and the determination was accomplished in ENCOREII automatic biochemistry analyser. SUMMARY: [/INST] A class of novel toralactones of general formula [A] extracted from Semen Cassiae, wherein R 3 is H or C 2 -C 4 acyl, R 1, R 2 are same or different, and are each H, glycosyl, or C 2 -C 4 acyl, and the derivatives thereof. Said compounds can decrease the level of total serum cholesterol and increase the level of bile acid, manifesting that these compounds have the efficacy of reducing blood fat and reducing weight. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: siens. La pionnière de l’aviation Amelia Earhart, à New York en 1932. Elle fut la première femme à traverser l’Atlantique en solitaire. 1936 by Keystone/Zuma/REA « Si Amelia Earhart avait réussi son pari fou de tenter le tour du monde en avion, elle aurait rejoint les grands pionniers de l’aviation. Mais sa disparition fit d’elle quelque chose d’encore plus tenace et énigmatique : elle fit d’elle un mystère », estimait le Los Angeles Times dans un article du 19 octobre 1999 retraçant les événements marquants du XXe siècle. La disparition de « Little Lindy », surnommée ainsi en référence à Charles Lindbergh, qui avait effectué la traversée de l’ Atlantique en solitaire à 34 ans, le 20 mai 1932, cinq ans jour pour jour après le célèbre aviateur, s’y trouvait en bonne place. À l’approche de ses 40 ans, cette collectionneuse de records voulut être la première femme à faire le tour du monde en avion. Son navigateur, Fred Noonan, et elle décollèrent le 1er juin 1937 de Miami, après avoir déjà traversé tous les États-Unis depuis la côte Ouest. Ils firent une trentaine d’étapes, en Amérique du Sud, en Afrique, en Asie, en Australie et, enfin, en Papouasie-Nouvelle-Guinée, d’où il ne leur restait « plus que » le Pacifique à traverser pour boucler leur circumnavigation. Hypothèses farfelues Ils décollèrent le 2 juillet, à destination de l’île Howland, une minuscule île corallienne de deux kilomètres de long quasiment posée sur l’équateur, située à mi-chemin entre Hawaï et l’Australie ; autant dire presque invisible et au milieu de nulle part. Les deux aventuriers n’y atterrirent jamais. Dès lors, les théories les plus romanesques surgirent pour expliquer cette disparition : Amelia prisonnière des Japonais qui auraient confisqué son Lockheed 10E Electra et s’en seraient inspirés pour construire le redoutable Zéro, chasseur-bombarbier des kamikazes ; Amelia exfiltrée aux États-Unis, où elle aurait repris une vie normale sous une nouvelle identité ; Amelia agent secret du gouvernement américain, finalement abandonnée aux mains de l’ennemi… Les hypothèses d’un crash dû à un manque de fioul ou à la moindre erreur de navigation n’avaient évidemment pas le même attrait. Du coup quand, trois ans plus tard, en 1940, le jeune officier britannique Gerald Gallagher, 29 ans, administrateur des îles Phoenix (aujourd’hui partie de l’État indépendant des Kiribati), découvrit un squelette et un sextant sur l’île de Nikumaroro, à quelques centaines de kilomètres de l’île Howland, il fut quasiment le seul à dire, et à croire, qu’il s’agissait du corps d’Amelia Earhart. Près de quatre-vingts ans après sa découverte, un article publié ce mois-ci dans la revue de l’université de Floride Forensic Anthropology par l’anthropologue Richard L. Jantz semble confirmer son intuition. À l’époque, Gallagher envoya quelques os, pour analyse, aux Fidji. Un certain docteur D.W. Hoodless, de l’École centrale de médecine, en fit des relevés précis et conclut qu’il s’agissait d’un squelette masculin. En 2015, une nouvelle étude confirma la validité des conclusions du Dr. Hoodless. Nouvelles analyses Mais tout cela vient de voler en éclats avec l’analyse du professeur Jantz, qui a utilisé des techniques beaucoup plus sophistiquées pour évaluer la taille d’un corps à partir de celle des os. Il lui a toutefois fallu se fier aux relevés de 1940, car les ossements se sont hélas perdus à leur tour depuis. Les os trouvés à Nikumaroro correspondent « davantage au squelette d’Amelia Earhart qu’à 99 % d’autres individus quelconques ». L’auteur les a donc confrontés à des dizaines de documents et de photos et, malgré quelques incertitudes (comme la différence de 2,5 cm entre la taille indiquée sur son permis de conduire et celle de sa licence de pilote…), l’étude conclut que les os trouvés à Nikumaroro par Gallagher, en 1940, correspondent « davantage au squelette d’Amelia Earhart qu’à 99 % d’autres individus quelconques ». Reste une part infime d’incertitude qui réjouira les adeptes du mystère… et les lecteurs des centaines d’ouvrages consacrés à la célèbre aviatrice. On y apprend notamment que sa mère l’avait élevée ainsi que sa sœur cadette en leur mettant des culottes courtes dans l’espoir de ne pas en faire de « gentilles petites filles ». Bien qu’elle eût épousé son publiciste et éditeur, George Putnam, en 1931, elle lui fit parvenir, le jour de leur mariage, une note lui indiquant qu’elle n’avait pas l’intention de lui imposer « le code médiéval de la fidélité entre époux » et qu’elle ne s’attendait donc pas non plus à y être tenue. Sa passion pour l’aviation, son engagement pour le vote des femmes et son goût de l’aventure et des défis firent aussi d’elle une icône de l’émancipation féminine. SUMMARY: [/INST] L'Américaine s'est "volatilisée" en 1937, alors qu'elle tentait de faire le tour du monde en avion. Plus de quatre-vingts ans après sa disparition, une nouvelle étude scientifique conclut que les ossements retrouvés en 1940 sur une petite île du Pacifique sont les siens. </s>
<s>[INST] <<SYS>> You are a kind, helpful, empathetic, intelligent AI medical chatbot with exceptional critical thinking. When I write BEGIN you will enter this role, and all further input is a passage of text OR a conversation between USER and BOT. Provide a detailed and concise SUMMARY of CONTEXT. Only summarise using information in CONTEXT. Do not make up facts in SUMMARY. <</SYS>> BEGIN CONTEXT: The announcement of the Al Maghtas site in Jordan – believed by many Christians to be where Jesus was baptized – as a UNESCO World Heritage Site was greeted enthusiastically in that country on Sunday, with Jordanian newspaper Al Rai declaring that the move "put an end to the Israeli claims" that the authentic location is beyond the Jordan River in Israeli territory. Follow Ynetnews on Facebook and Twitter Israeli officials, for their part, insisted that there was no controversy over the site. The Al Maghtas site in Jordan (Photo: Shutterstock) In 2011, Israel officially opened the Qasr el Yahud site on the west bank of the Jordan River after a decades-long closure. According to Jewish tradition, this was where the Israelites crossed the Jordan River as they entered Canaan, and supposedly was where Jesus was baptized. Some in Jordan were then angered by the ceremonial reopening, claiming that Jesus was baptized by John the Baptist at the Jordanian location and noting that the Vatican had recognized this when Pope John Paul II was present at the ceremony marking the site's opening in 2000. These voices accused Israel not only of rewriting history, but also of attempting to attract Christian tourism at Jordan's expense. Al Rai wrote on Sunday that UNESCO's decision settled the matter. "Since the site was discovered, Israel has not stopped trying to deal it and attribute it to the occupied side of the Jordan River," said the paper. "This despite the religious and historical documents that prove that the baptism of Jesus, peace be unto him, is on the Jordanian side of the Jordan River." The director of the EcoPeace Friends of the Earth Middle East, Gidon Bromberg, told Ynet that recognition of the Jordanian spot as a world heritage site points to the Hashemite kingdom's astuteness in advancing the issue and being aware of the potential tens of millions of Christian visitors interested in being baptized in the Jordan River. Bromberg said the heritage site designation could hurt tourism at the Qasr al Yahud site. "As far as we know, around 300,000 Christian pilgrims arrive at the Israeli site every year, while on the Jordanian side the number is around 100,000 pilgrims a year." Israel and Jordan's representatives to UNESCO embrace after the declaration of Beit She'arim as a World Heritage Site However, despite the UNESCO listing, which will certainly boot tourism for the Jordanian site, Bromberg pointed to what he said was the real problem – one shared by Jordan, Israel, and the Palestinians: "Whether it's listed by UNESCO or not, ultimately the quantity and quality of the Jordan River's water is so poor." Meanwhile, Israeli officials said there was no difference of opinion or battle against the Jordanians on the issue, and that "we are talking about pure anti-Israeli propaganda." According to an Israeli official, the original Jordanian proposal to UNESCO stated that there were plans to expand the site in the future in cooperation with "the neighboring country". The Lebanese ambassador demanded changing the phrasing to "Palestine", a request that was accepted. Diplomatic officials said that Israel had no problems with the Jordanian proposal and did not lobby against it – quite the opposite, in fact. The relations between the Israeli and Jordanian delegations to UNESCO are considered strong. The Jordanian ambassador was one of of the first to congratulate the Israeli ambassador after the recognition Beit She'arim in the Galilee as a heritage site. The Palestinians are also recognized as a state in UNESCO, so Israel was not in a position to prevent the textual change to Palestine anyway. UNESCO's World Heritage Committee, which met in Bonn, Germany, declared the national park in Beit She'arim in the lower Galilee as a World Heritage Site on Sunday. Beit She'arim was a thriving village in biblical times, and the site includes 30 burial caves in which the noble class weere buried, including Rabbi Yehudah Hanasi, the writer of the Mishnah. The site in Beit She'arim is one of nine UNESCO World Heritage Sites in Israel. Among the 21 member states, 17 states voted in favor of including Beit She'arim, including India, Turkey, and Senegal. Four states voted against the move -- Lebanon, Qatar, Algeria, and Malaysia. Whatever one’s religious persuasions, it’s hard not to be moved by this minimal pile of ruins with its preposterously long name. This is the site, archaeologists assure us, where John the Baptist preached, where Jesus was baptised, where the first five apostles met and where, thereby, the foundations of the early Christian faith were laid. They chose an auspicious spot as many also believe that this was the place from where prophet Elijah (who was born in Mar Elias in north Jordan) ascended to heaven in a whirlwind. Although John was later beheaded by Herod at Machaerus and Jesus was crucified in Jerusalem, the meeting between the two men at this spot in the fertile Jordan Valley was one of hope and new beginnings. It is little surprise, then, that it became a focus for early pilgrimage, and remains so to this day. The name Bethany comes from the Aramaic Beit Anniya (House of the Crossing). As you stand by the almost-stagnant river at this point, Israel and the Palestinian Territories is almost within arms’ reach. Pilgrim churches, guesthouses and a 6th-century pilgrim road developed around the crossing as pilgrims broke their journey between Jerusalem and Mt Nebo. Today, there’s little visible evidence of the early passage of pilgrims but the sense of crossing is still disturbingly apparent: as one traveller, Nathalie Ollier, remarked, 'It's hard for Christian visitors on either side of the water to pray when watched over by Jewish and Muslim guards intent on making sure you don't cross the border.' The site has only relatively recently been identified. Some ancient ruins were discovered in 1899 but it wasn’t until the clearing of landmines (following the 1994 peace treaty with Israel and the Palestinian Territories) that the remains of churches, caves, extensive wells and several baptism pools were unearthed. After much debate, scholars identified the site of John the Baptist’s mission and Jesus’ baptism from descriptions in the Bible and from 3rd- to 10th-century pilgrim accounts. Pope John Paul II sanctified the claim with an open-air mass at the site in the spring of 2000. Entry to the site includes a one-hour guided tour and shuttle bus service to the main complex, close to the sensitive border with Israel and the Palestinian Territories. Collect a brochure and map at the main gate, where there are toilets, souvenir shops and a restaurant. The flies here are of plague proportions in spring. AL-MAGHTAS, Jordan (AP) — For years, Christian pilgrims have waded into the Jordan River from both its eastern and western banks to connect with a core event of their faith — the baptism of Jesus. The parallel traditions allowed Jordan and Israel to compete for tourism dollars in marketing one of Christianity's most important sites. In this July 6, 2015 photo, Christian visitors soak themselves in the Jordan River at the baptismal area of the Israeli-run site known as Qasr al-Yahud, located in a part of the West Bank, seen from the... (Associated Press) This July 6, 2015 photo shows the baptismal area on the eastern bank of the Jordan River in South Shuna, Jordan, foreground, and the baptismal area of the Israeli-run site known as Qasr al-Yahud, with... (Associated Press) In this July 6, 2015 photo, Jordanian Christians pour water over themselves at the baptismal area on the eastern bank of the Jordan River in South Shuna, Jordan. UNESCO recently designated Jordan's baptismal... (Associated Press) FILE - In this Wednesday, March 31, 2010 file photo, Orthodox Christians immerse themselves in the Jordan River at a baptism ceremony at Qasr al-Yahud near the West Bank town of Jericho. UNESCO recently... (Associated Press) FILE - In this Monday, Jan. 18, 2010 file photo, Orthodox Christian pilgrims take part in a traditional Epiphany baptism ceremony at the baptismal site of Qasr al-Yahud, near the West Bank town of Jericho.... (Associated Press) In this July 6, 2015 photo, Christian visitors immerse themselves in the Jordan River at the baptismal area of the Israeli-run site known as Qasr al-Yahud, located in a part of the West Bank, seen from... (Associated Press) This July 6, 2015 photo shows a construction site of a church near the baptismal area on the eastern bank of the Jordan River in South Shuna, Jordan. UNESCO recently designated Jordan's baptismal area... (Associated Press) FILE - In this Tuesday, April 22, 2008 file photo, a Greek Orthodox Christian priest bathes in the Jordan River after it was blessed during a baptism ceremony at Qasr al-Yahud near Jericho in the West... (Associated Press) FILE - In this Tuesday, Jan. 18, 2011 file photo, an Ethiopian Orthodox Christian pilgrim immerses himself in water taken from the Jordan River after it was blessed during a baptism ceremony at Qasr al-Yahud,... (Associated Press) In this July 6, 2015 photo, a Christian visitor pours water from the Jordan River over the head of another at the baptismal area on the eastern bank of the river in South Shuna, Jordan, as people, background,... (Associated Press) But now UNESCO has weighed in on the rivalry, designating Jordan's baptismal area on the eastern bank a World Heritage site. The U.N. cultural agency declared this month that the site "is believed to be" the location of Jesus' baptism, based on what it said is a view shared by most Christian churches. The decision drew cheers in Jordan, where the number of tourists has dropped sharply since the 2011 Arab Spring and the rise of the Islamic State group. Israel has kept silent while a Palestinian official said the western baptismal site, located in an Israeli-occupied area sought for a Palestinian state, should have been included. The UNESCO decision also raised eyebrows among some scholars. It "has nothing to do with archaeological reality," said Jodi Magness, an archaeologist at the University of North Carolina at Chapel Hill. "We don't have any sites with evidence or archaeological remains that were continuously venerated from the first century on." Experts who reviewed the Jordanian application for UNESCO acknowledged that there is no solid archaeological evidence confirming that "Bethany Beyond the Jordan," also known as al-Maghtas, Arabic for baptism, is the authentic site. However, the Jordanian site is of "immense religious significance to the majority of denominations of Christian faith, who have accepted this site as the location" of Jesus' baptism, the experts wrote in their recommendation. Jesus's baptism is recounted in New Testament passages as the beginning of his ministry. John 1:28 hints at a possible location, the eastern bank: "These things were done in Bethany beyond the Jordan, where John was baptizing." The debate over the baptism site comes at a time of regional turmoil, including the rising threat from Islamic militants who have destroyed ancient artefacts. Jordan's tourism minister, Nayef al-Fayez, told UNESCO that Jordan is sending a message of tolerance. The kingdom's Hashemite rulers "who are the direct descendants of the Prophet Muhammad... are the same ones who are protecting one of the holiest sites of Christianity," he said. The Israeli-Palestinian conflict also looms in the background. The Israeli-run site, known as Qasr al-Yahud, is located in the West Bank, one of three territories captured by Israel in the 1967 Mideast war and sought by the Palestinians for a state. The baptism site is in a part of the West Bank that remains under full Israeli military occupation. Extending the World Heritage designation to Qasr al-Yahud would benefit the Palestinians if they ever win statehood, but calling for this now might upset their ally, Jordan. A Palestinian Tourism Ministry official, speaking on condition of anonymity because he was not authorized to talk with journalists, said both banks of the river should receive the same treatment, but that "it's not easy for us to defend a site we have no control over." The Israeli-run site has attracted larger crowds than its Jordanian counterpart, in part because it is on the classic Holy Land pilgrimage trail. Israeli officials said half a million visitors came to Qasr al-Yahud last year, compared to several tens of thousands on the Jordanian side. On a recent morning, the western site was filled with pilgrims while the eastern one, a few meters (yards) away across the muddy waters, stood largely empty. Ukrainian pilgrims pulled white robes with baptismal motifs — available at a gift shop for $8 — over swimsuits. They walked down steps into the river, some pinching their noses as they submerged themselves. On a slope above them, South African worshippers sang "Glory, Glory Hallelujah" to the sounds of an acoustic guitar. "It doesn't matter to me much whether it's on this side of the river or the other side of the river," said pilgrim Johan Cornelius, 47, from Middelburg, South Africa. "The fact that it is the Jordan River and that Jesus has been here, he's been baptized by John in this area, that's of utmost importance to me." For decades, such scenes were unimaginable. The river once formed a hostile border, and tensions eased only after a 1994 peace treaty. Over the years, Israel granted access to pilgrims on religious holidays, and opened Qasr al-Yahud for daily visits in 2011 after removing nearby mines, though thousands remain buried in the area. Jordan opened al-Maghtas in 2002. Archaeological digs there yielded remains of baptismal pools, chapels and monks' caves — a setting reflected in early pilgrims' accounts. UNESCO's experts said the finds are "associated with the commemoration" of the baptism. An eastern baptism site would make sense, some scholars said. John the Baptist had antagonized Jewish authorities in Jerusalem and would likely have preferred to stay out of their reach, across the river, said New Testament professor Ben Witherington at the Asbury Theological Seminary in Kentucky. Yisca Harani, an Israeli expert on pilgrimage, said that "if there is theological dictum to use one side, I would say the eastern side." However, Harani said both banks should have been designated as a single site to reflect the meaning of baptism as a journey from the "spiritual desert" to the Holy Land. A number of denominations, including Roman Catholics, Greek Orthodox and Lutherans, have written letters of support for the Jordanian side, which three popes have visited since 2000. But some hedge their bets, as the Greek Orthodox Church considers "both sides as holy sites," said Issa Musleh, a spokesman for the church's Jerusalem-based patriarch. During Epiphany celebrations, he said, worshippers come from the east and the west and "meet in the river." ___ Laub reported from Qasr al-Yahud, West Bank. Associated Press writer Mohammed Daraghmeh in Ramallah, West Bank, contributed to this report. ___ This story has been corrected to fix the spelling of the name Yisca Harani. SUMMARY: [/INST] Addressing a long-simmering debate about whether Jesus Christ was baptized on the eastern or western side of the Jordan River, UNESCO has made its final decision, and the winner is... Jordan, not the West Bank in Israel, the AP reports. Despite a lack of strong archaeological evidence, the UN organization deemed "Bethany Beyond the Jordan," also known as al-Maghtas (Arabic for "baptism") a World Heritage site after determining the site has "immense religious significance to the majority of denominations of Christian faith, who have accepted this site as the location," the experts wrote. What this could mean for Jordan is more tourist dollars, especially since the AP notes that the Israeli-run site, known as Qasr al-Yahud, currently receives hundreds of thousands more visitors every year than its Jordanian counterpart. When Israel reopened Qasr al-Yahud in 2011 after a decade-long closure, critics accused Israel of revisionism, Ynet reports-especially since Pope John Paul II sanctified al-Maghtas as the site in 2000. In a bit of gloating, Jordanian paper Al Rai noted yesterday, "Since the site was discovered, Israel has not stopped trying to... attribute it to the occupied side of the Jordan River. This despite the religious and historical documents that prove that the baptism... [was] on the Jordanian side of the Jordan River." Some don't care either way which side of the river it was on. "It doesn't matter to me much," a visitor tells the AP. "The fact that Jesus has been here... [is] of utmost importance to me." Meanwhile, the head of a Mideast environmental group tells Ynet there's a bigger problem affecting everyone in the region: "Whether it's listed by UNESCO or not... the quantity and quality of the Jordan River's water is so poor." </s>

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.