Datasets:

bigbio

/

bionlp_st_2013_ge

like 1

[ { "id": "PMC-1310901-05-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Expression analysis\nTo analyze the IRF-4 transcriptional level, RNA was extracted from cells using the commercial RNAzol-kit (Paesel, Frankfurt, Germany). An aliquot of 1 mug total RNA was used for cDNA synthesis as described previously (27). RNA expression analysis for IRF-4 and the reference gene beta-actin was carried out by semi-quantitative PCR as described previously (3,27). PCR products were verified by automated sequencing. PCR primers and conditions for expression analysis of DNMT or MBP (DNMT1 DNMT3A, DNMT3B, MeCP, MBD1, MBD2 and MBD4) were published elsewhere (28).\nFor analysis of IRF-4 protein expression, a standard immunoblotting assay was performed as described previously (29). Briefly, protein lysates were generated by incubating 1 x 106 cells in 100 microl RIPA buffer (1% NP-40, 0.5% sodiumdesoxycholate, 0.1% SDS, 100 microg/ml phenylmethylsulfonyl fluoride, 10 microl/ml protease-inhibitory-mix, 1 micromol/ml sodiumorthovanadate in phosphate-buffered saline) for 30 min on ice. After centrifugation, protein concentration of the supernatant was determined by BCA-method (Pierce, Rockford, IL) as recommended. Protein lysates (70-100 microg) were electrophoresed on polyacrylamide gels and transferred to a PVDF-membrane (Immobilon P, 0.45 microm; Millipore, Eschborn, Germany). Membranes were blocked with 2.5% blocking reagent (Boehringer Mannheim, Germany) in TBST buffer (4.44 g/l Tris-HCL, 2.65 g/l TrisOH, 8.07 g/l NaCl, 0.2 g/l KCl and 500 microl/l Tween-20 in H2O) and subsequently incubated with primary antibody as indicated and horseradish peroxidase-conjugated secondary antibody, anti-mouse or anti-goat IgG (DAKO, Hamburg, Germany), respectively. The membranes were then developed with an ECL detection kit (Amersham Pharmacia Biotech, Freiburg, Germany). The primary antibodies were goat anti-IRF-4/ICSAT (M-17) (Santa Cruz Biotechnology, Santa Cruz, CA) and mouse anti-beta-actin (AC-74) (Sigma)." ], "offsets": [ [ 0, 1941 ] ] } ]

[ { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 35, 40 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 271, 276 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T3", "type": "Protein", "text": [ "beta-actin" ], "offsets": [ [ 300, 310 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T4", "type": "Protein", "text": [ "(DNMT1" ], "offsets": [ [ 502, 508 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T5", "type": "Protein", "text": [ "DNMT3A" ], "offsets": [ [ 509, 515 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T6", "type": "Protein", "text": [ "DNMT3B" ], "offsets": [ [ 517, 523 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T7", "type": "Protein", "text": [ "MeCP" ], "offsets": [ [ 525, 529 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T8", "type": "Protein", "text": [ "MBD1" ], "offsets": [ [ 531, 535 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T9", "type": "Protein", "text": [ "MBD2" ], "offsets": [ [ 537, 541 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T10", "type": "Protein", "text": [ "MBD4" ], "offsets": [ [ 546, 550 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T11", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 599, 604 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T12", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1837, 1842 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T13", "type": "Protein", "text": [ "ICSAT" ], "offsets": [ [ 1843, 1848 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T14", "type": "Protein", "text": [ "M-17" ], "offsets": [ [ 1850, 1854 ] ], "normalized": [] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_T15", "type": "Protein", "text": [ "beta-actin" ], "offsets": [ [ 1914, 1924 ] ], "normalized": [] } ]

[ { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E1", "type": "Transcription", "trigger": { "text": [ "transcriptional" ], "offsets": [ [ 41, 56 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T1" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E2", "type": "Transcription", "trigger": { "text": [ "RNA expression" ], "offsets": [ [ 243, 257 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T2" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E3", "type": "Transcription", "trigger": { "text": [ "RNA expression" ], "offsets": [ [ 243, 257 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T3" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T4" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T5" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E6", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T6" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T7" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E8", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T8" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E9", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T9" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E10", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 467, 477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T10" } ] }, { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_E11", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 613, 623 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-05-MATERIALS_AND_METHODS_T11" } ] } ]

[ { "id": "PMC-1310901-05-MATERIALS_AND_METHODS_1", "entity_ids": [ "PMC-1310901-05-MATERIALS_AND_METHODS_T12", "PMC-1310901-05-MATERIALS_AND_METHODS_T14", "PMC-1310901-05-MATERIALS_AND_METHODS_T13" ] } ]

[]

[ { "id": "PMC-2791889-15-Experimental_Procedures__text", "type": "abstract", "text": [ "Immunoblotting\nDifferentiated CD4+ T cells were rested for 5 hr in 1% FCS-containing medium and restimulated as described for specific experiments. Cell lysates were prepared, equal amounts of protein were separated by SDS-PAGE, and phosphorylated or total ERK and actin were detected as described before (Beinke et al., 2004)." ], "offsets": [ [ 0, 327 ] ] } ]

[ { "id": "PMC-2791889-15-Experimental_Procedures_T1", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 30, 33 ] ], "normalized": [] }, { "id": "PMC-2791889-15-Experimental_Procedures_T2", "type": "Protein", "text": [ "ERK" ], "offsets": [ [ 257, 260 ] ], "normalized": [] }, { "id": "PMC-2791889-15-Experimental_Procedures_T3", "type": "Protein", "text": [ "actin" ], "offsets": [ [ 265, 270 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2664230-11-RESULTS__text", "type": "abstract", "text": [ "PTX upregulates CREB phosphorylation and activation after LPS stimulation\nPhosphorylation of nuclear CREB was used as a marker for CREB activation. LPS stimulation caused a negligible increase in CREB phosphorylation when compared to control (Figure 4A). PTX alone caused a marked increase in CREB phosphorylation (P < 0.01 vs. HBSS). When LPS and PTX exposure occurred simultaneously, CREB phosphorylation was significantly higher than with LPS stimulation alone (543 +/- 92 vs. 100 +/- 0; P < 0.01). In addition, the amount of CREB phosphorylation seen with concomitant LPS and PTX treatment was less than that seen with PTX alone, although this difference was not statistically significant (P = 0.08).\nTo determine if CREB-DNA binding was affected by PTX in a manner similar to CREB phosphorylation, an EMSA was performed. Exposure of LPS-stimulated cells to PTX similarly increased CREB DNA-binding compared to LPS alone (Figure 4B)." ], "offsets": [ [ 0, 937 ] ] } ]

[ { "id": "PMC-2664230-11-RESULTS_T1", "type": "Protein", "text": [ "CREB" ], "offsets": [ [ 886, 890 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-11-RESULTS_E1", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 876, 885 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-11-RESULTS_E2" } ] }, { "id": "PMC-2664230-11-RESULTS_E2", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 895, 902 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-11-RESULTS_T1" } ] } ]

[]

[]

[ { "id": "PMC-3245220-07-Results__text", "type": "abstract", "text": [ "M-CSF Induces Phosphorylation of NF-kappaB Ser276 in a PKC-dependent Fashion\nSince M-CSF did not regulate NF-kappaB activation by influencing IkappaBalpha, we next sought to determine if M-CSF affected NF-kappaB p65 by post-translational mechanisms. Thus, we examined the phosphorylation of NF-kappaB p65 with specific phospho-NFkappaB p65 (Ser276 and Ser536) antibodies. M-CSF induced the phosphorylation of Ser276 but not Ser536 of NF-kappaB p65 in MDMs. Compared to vehicle, the general PKC inhibitor Ro-31-8220 reduced Ser276 phosphorylation, but not Ser536, phosphorylation in M-CSF-stimulated cells (Figure 5B). Furthermore, M-CSF-stimulated NF-kappaB p65 phosphorylation at residue Ser276 in RAW 264.7 cells was also PKC dependent (Figure 5C). These studies suggested that PKC(s) regulated Ser276 phosphorylation but not Ser536 in both human MDMs and mouse macrophages after M-CSF stimulation.\nWe next performed cellular fractionation to identify the cellular location of phosphorylated NF-kappaB p65 in Raw 264.7 cells. Non-phosphorylated NF-kappaB p65 was located in both cytosolic and nuclear fractions, but phosphorylated Ser276 and Ser536 NF-kappaB p65 was primarily located in nuclear fraction after M-CSF stimulation (Figure 5D). Notably, constitutive phosphorylation of Ser536 NF-kappaB p65 was found in these cells. Importantly, Ro-31-8220 reduced M-CSF-induced Ser276 phosphorylation of NF-kappaB p65 in both the cytosolic and nuclear fractions, while M-CSF-induced NF-kappaB p65 Ser536 phosphorylation was present in the nucleus regardless of PKC inhibition. These observations indicate that M-CSF-induced Ser276 and Ser536 are regulated differently by conventional PKC activation in mononuclear phagocytes. The purity of the cytosol and nuclear cell fractions was confirmed by immunoblotting with GAPDH and Lamin B, respectively (Figure 5D)." ], "offsets": [ [ 0, 1860 ] ] } ]

[ { "id": "PMC-3245220-07-Results_T1", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 142, 154 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 212, 215 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 301, 304 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T4", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 444, 447 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T5", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 658, 661 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T6", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1004, 1007 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T7", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1057, 1060 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T8", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1161, 1164 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T9", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1302, 1305 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T10", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1414, 1417 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T11", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1493, 1496 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T19", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 409, 415 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T20", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 424, 430 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T22", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 523, 529 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T24", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 555, 561 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T28", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 689, 695 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T31", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 797, 803 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T33", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 828, 834 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T39", "type": "Entity", "text": [ "both cytosolic and nuclear fractions" ], "offsets": [ [ 1076, 1112 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T41", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 1133, 1139 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T42", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 1144, 1150 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T44", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 1190, 1197 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T46", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 1285, 1291 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T49", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 1378, 1384 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T52", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 1497, 1503 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T55", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 1624, 1630 ] ], "normalized": [] }, { "id": "PMC-3245220-07-Results_T56", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 1635, 1641 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-07-Results_E1", "type": "Regulation", "trigger": { "text": [ "affected" ], "offsets": [ [ 193, 201 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E2" } ] }, { "id": "PMC-3245220-07-Results_E2", "type": "Protein_modification", "trigger": { "text": [ "post-translational mechanisms" ], "offsets": [ [ 219, 248 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T2" } ] }, { "id": "PMC-3245220-07-Results_E3", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 272, 287 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T3" } ] }, { "id": "PMC-3245220-07-Results_E4", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 378, 385 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E5" } ] }, { "id": "PMC-3245220-07-Results_E5", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 390, 405 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T4" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T19" } ] }, { "id": "PMC-3245220-07-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 378, 385 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E7" } ] }, { "id": "PMC-3245220-07-Results_E7", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 390, 405 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T4" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T20" } ] }, { "id": "PMC-3245220-07-Results_E8", "type": "Negative_regulation", "trigger": { "text": [ "reduced" ], "offsets": [ [ 515, 522 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E9" } ] }, { "id": "PMC-3245220-07-Results_E9", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 530, 545 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T4" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T22" } ] }, { "id": "PMC-3245220-07-Results_E10", "type": "Negative_regulation", "trigger": { "text": [ "reduced" ], "offsets": [ [ 515, 522 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E11" } ] }, { "id": "PMC-3245220-07-Results_E11", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 563, 578 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T4" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T24" } ] }, { "id": "PMC-3245220-07-Results_E12", "type": "Positive_regulation", "trigger": { "text": [ "stimulated" ], "offsets": [ [ 637, 647 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E13" } ] }, { "id": "PMC-3245220-07-Results_E13", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 662, 677 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T5" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T28" } ] }, { "id": "PMC-3245220-07-Results_E14", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 728, 737 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E12" } ] }, { "id": "PMC-3245220-07-Results_E15", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 787, 796 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E16" } ] }, { "id": "PMC-3245220-07-Results_E16", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 804, 819 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T5" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T31" } ] }, { "id": "PMC-3245220-07-Results_E17", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 787, 796 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E18" } ] }, { "id": "PMC-3245220-07-Results_E18", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 804, 819 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T5" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T33" } ] }, { "id": "PMC-3245220-07-Results_E19", "type": "Positive_regulation", "trigger": { "text": [ "stimulation" ], "offsets": [ [ 888, 899 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E15" } ] }, { "id": "PMC-3245220-07-Results_E20", "type": "Positive_regulation", "trigger": { "text": [ "stimulation" ], "offsets": [ [ 888, 899 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E17" } ] }, { "id": "PMC-3245220-07-Results_E21", "type": "Localization", "trigger": { "text": [ "location" ], "offsets": [ [ 967, 975 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T6" } ] }, { "id": "PMC-3245220-07-Results_E22", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 979, 993 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T6" } ] }, { "id": "PMC-3245220-07-Results_E23", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1032, 1046 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T7" } ] }, { "id": "PMC-3245220-07-Results_E24", "type": "Localization", "trigger": { "text": [ "located" ], "offsets": [ [ 1065, 1072 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T7" }, { "role": "ToLoc", "ref_id": "PMC-3245220-07-Results_T39" } ] }, { "id": "PMC-3245220-07-Results_E25", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1118, 1132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T8" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T41" } ] }, { "id": "PMC-3245220-07-Results_E26", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1118, 1132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T8" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T42" } ] }, { "id": "PMC-3245220-07-Results_E27", "type": "Localization", "trigger": { "text": [ "located" ], "offsets": [ [ 1179, 1186 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T8" }, { "role": "ToLoc", "ref_id": "PMC-3245220-07-Results_T44" } ] }, { "id": "PMC-3245220-07-Results_E28", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1266, 1281 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T9" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T46" } ] }, { "id": "PMC-3245220-07-Results_E29", "type": "Negative_regulation", "trigger": { "text": [ "reduced" ], "offsets": [ [ 1356, 1363 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E30" } ] }, { "id": "PMC-3245220-07-Results_E30", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1370, 1377 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E31" } ] }, { "id": "PMC-3245220-07-Results_E31", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1385, 1400 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T10" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T49" } ] }, { "id": "PMC-3245220-07-Results_E32", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1475, 1482 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E33" } ] }, { "id": "PMC-3245220-07-Results_E33", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1504, 1519 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T11" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T52" } ] }, { "id": "PMC-3245220-07-Results_E34", "type": "Regulation", "trigger": { "text": [ "regardless" ], "offsets": [ [ 1547, 1557 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E32" } ] }, { "id": "PMC-3245220-07-Results_E35", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1616, 1623 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T11" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T55" } ] }, { "id": "PMC-3245220-07-Results_E36", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1616, 1623 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_T11" }, { "role": "Site", "ref_id": "PMC-3245220-07-Results_T56" } ] }, { "id": "PMC-3245220-07-Results_E37", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1646, 1655 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E36" } ] }, { "id": "PMC-3245220-07-Results_E38", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1646, 1655 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-07-Results_E35" } ] } ]

[]

[]

[ { "id": "PMC-3148254-09-Materials_and_Methods__text", "type": "abstract", "text": [ "Somatic cell gene targeting\nThe generation of HOIP-deficient cells was accomplished using a homologous recombination approach described previously [7], [8]. Segments of Rnf31 gene sequence used in the targeting construct (Fig. 1A) were amplified by PCR from A20.2J genomic DNA. The oligonucleotide primers used to generate the 5' flank (1224 bp) were 5'-ttttctagagcggtggcttaagtgaccc-3' and 5'-tattctagatgcagcatctgagaaagcaagc-3'. The 3' flank (6032 bp) primers were 5'-aaaaccggtgtatgcttctttacgggagaaaaatattag-3' and 5'-tataccggtatgaagccaaaggaacactgagag-3'. Restriction endonuclease sites in the oligonucleotide primers allowed insertion of the PCR products into the targeting vector. A20.2J cells were transfected (by electroporation [7]) with the targeting construct and subcloned in medium containing 600 microg/ml G418 sulfate. Homologous recombination in G418-resistant clones was detected by PCR of genomic DNA, as described [7]. Oligonucleotide primers used for screening were 5'-cttcctgatctcagctttaccgtcac-3' (homologous to genomic sequence; approximate position noted in Fig. 1) and 5'-caatccatcttgttcagccat-3' (homologous to sequence in NeoR). Clones in which one copy of Rnf31 had been disrupted were transiently transfected with an expression plasmid encoding Cre, in order to remove NeoR. G418-sensitive subclones were subjected to a second round of targeting to disrupt the remaining copy of Rnf31. G418-resistant clones were tested for homologous recombination by PCR and HOIP protein expression by Western blot." ], "offsets": [ [ 0, 1525 ] ] } ]

[ { "id": "PMC-3148254-09-Materials_and_Methods_T1", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 46, 50 ] ], "normalized": [] }, { "id": "PMC-3148254-09-Materials_and_Methods_T2", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 169, 174 ] ], "normalized": [] }, { "id": "PMC-3148254-09-Materials_and_Methods_T3", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1180, 1185 ] ], "normalized": [] }, { "id": "PMC-3148254-09-Materials_and_Methods_T4", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1404, 1409 ] ], "normalized": [] }, { "id": "PMC-3148254-09-Materials_and_Methods_T5", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1485, 1489 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-09-Materials_and_Methods_E1", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 51, 60 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-09-Materials_and_Methods_T1" } ] }, { "id": "PMC-3148254-09-Materials_and_Methods_E2", "type": "Negative_regulation", "trigger": { "text": [ "disrupted" ], "offsets": [ [ 1195, 1204 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-09-Materials_and_Methods_T3" } ] }, { "id": "PMC-3148254-09-Materials_and_Methods_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1498, 1508 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-09-Materials_and_Methods_T5" } ] } ]

[]

[]

[ { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION__text", "type": "abstract", "text": [ "Runx3 controls multiple aspects of the CTL differentiation program, in part through induction of Eomes\nBecause Runx3 is highly expressed in peripheral CD8+ T cells, and because of the T-bet-Runx3 cooperation we observed earlier in CD4+ T cells (15), we examined the role of Runx3 in effector CTL differentiation. We isolated CD8+ T cells from Runx3-/- (KO) mice of the outbred ICR background and their WT Runx3+/+ littermates by positive selection with anti-CD8 magnetic beads (Figs. S1 and S2, available at http://www.jem.org/cgi/content/full/jem.20081242/DC1). Strikingly, Runx3-/- CD8+ T cells were strongly impaired in their ability to differentiate into effector CTLs, as judged by expression of perforin, granzyme B, and IFN-gamma (Fig. 3). Compared with WT T cells, perforin mRNA and protein expression were essentially undetectable in Runx3-/- T cells at day 6 of culture (Fig. 3, A and B). Runx3-/- T cells also had no detectable Eomes expression; in contrast, T-bet expression was unimpaired (Fig. 3 A). Furthermore, Runx3 was required for maximal production of IFN-gamma, but not TNF or IL-2, by CD8+ T cells restimulated at day 6 (Fig. 3 C).\nWe previously reported that Th1 cell differentiation was regulated through a feed-forward loop in which T-bet is up-regulated early and induces Runx3, after which T-bet and Runx3 cooperate to induce IFN-gamma and silence IL-4, thus promoting stable differentiation toward the Th1 lineage (15, 22). Because (a) Runx3 appeared necessary for Eomes induction (Fig. 3 A), (b) the kinetics of Eomes expression paralleled those of perforin expression (Fig. 2), and (c) overexpression of Eo-VP16 in either WT or T-bet-deficient T cells led to an increase in both perforin and IFN-gamma expression (Fig. 2, B and D), we asked whether CTL differentiation was also potentially regulated by a feed-forward loop involving these same two classes of Runx and T-box transcription factors. Specifically, we asked whether Runx3, which was necessary for Eomes induction, then cooperated with Eomes to regulate transcription of the effector CTL markers perforin, IFN-gamma, and granzyme B.\nTo test this hypothesis, we used chromatin immunoprecipitation (ChIP) assays to ask whether Eomes and Runx3 bound regulatory regions of the Prf1, Ifng, and Gzmb genes (Fig. 3 D). Both proteins associated with gene regulatory regions in differentiated CTLs. Runx3 bound to the Prf1 and Gzmb transcription start sites (TSS); to a known IL-2 responsive enhancer located near -1 kb of the Prf1 gene (23); to the distal CTL-specific DNase I hypersensitive site 9 in the Prf1 locus (24); to the Ifng promoter near the TSS, as previously reported for Th1 cells (10); and to several DNase I hypersensitive sites in the Ifng locus (Fig. 3 D and not depicted) (25). Eomes bound primarily to the Prf1 TSS and the -1 kb enhancer; this binding was substantially greater than that observed at the promoter of the Il2rb gene, a known direct target of Eomes (8), and comparable to that observed at the Ifng TSS, a known target of T-box proteins in both Th1 and CD8+ T cells (Fig. 3 D) (17).\nTo determine whether Runx3 controlled the expression of CTL effector genes through its induction of Eomes, we retrovirally expressed Runx3 and Eo-VP16 in CD8+ T cells from Runx3-/- mice. Because of the limited number of CD8+ T cells in these mice, and because we saw no difference between Runx3-/- CD8+CD4- SP and CD8+CD4+ DP cells in our previous experiments, we used total Runx3-/- CD8+ T cells without further fractionation as recipients for retroviral transduction. Reconstitution of Runx3-/- CD8+ T cells with Runx3 restored expression of Eomes as well as perforin, granzyme B, and IFN-gamma (Fig. 4, A and B). In addition, Runx3-/- T cells showed a compensatory up-regulation of Runx1, which was suppressed upon reconstitution with Runx3, indicating that Runx1 is a target of repression by Runx3. Notably, Eo-VP16 did not up-regulate perforin expression when expressed in Runx3-/- cells, even though it restored the capacity to induce IFN-gamma expression upon TCR restimulation (Fig. 4, A and B). This result suggests strongly that perforin expression requires Runx3 and Eomes.\nAs expected from their defect in perforin and granzyme B expression, Runx3-/- CD8+ T cells showed defective cytolytic activity in a mixed lymphocyte reaction (12). However, TCR-stimulated Runx3-/- CD8+ cells were as effective as WT cells in killing tumor cells in a redirected CTL assay (12). Furthermore, CD8+ cells from the peritoneal cavity of Runx3-/- mice immunized with certain tumor cells effectively killed these targets (13). Therefore, although activation of the perforin/granzyme B machinery is defective in Runx3-/- CD8+ cells, these cells are not entirely devoid of cytolytic activity and could still effectively kill targets, possibly by alternative mechanisms such as the Fas-Fas ligand pathway." ], "offsets": [ [ 0, 4894 ] ] } ]

[ { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T1", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T2", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 97, 102 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T3", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 111, 116 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T4", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 151, 154 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T5", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 184, 189 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T6", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 190, 195 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T7", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 231, 234 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T8", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 274, 279 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T9", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 325, 328 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T10", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 343, 348 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T11", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 405, 410 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T12", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 458, 461 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T13", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 575, 580 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T14", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 584, 587 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T15", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 701, 709 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T16", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 711, 721 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T17", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 727, 736 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T18", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 773, 781 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T19", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 843, 848 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T20", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 899, 904 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T21", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 939, 944 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T22", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 970, 975 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T23", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1027, 1032 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T24", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1072, 1081 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T25", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 1091, 1094 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T26", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 1098, 1102 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T27", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1107, 1110 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T28", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 1258, 1263 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T29", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1298, 1303 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T30", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 1317, 1322 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T31", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1327, 1332 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T32", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1353, 1362 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T33", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 1375, 1379 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T34", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1464, 1469 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T35", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 1493, 1498 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T36", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 1541, 1546 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T37", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 1578, 1586 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T38", "type": "Protein", "text": [ "Eo-VP16" ], "offsets": [ [ 1634, 1641 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T39", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 1658, 1663 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T40", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 1709, 1717 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T41", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1722, 1731 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T42", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1958, 1963 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T43", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 1989, 1994 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T44", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2027, 2032 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T45", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 2087, 2095 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T46", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2097, 2106 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T47", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 2112, 2122 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2216, 2221 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2226, 2231 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T50", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2264, 2268 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T51", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 2270, 2274 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T52", "type": "Protein", "text": [ "Gzmb" ], "offsets": [ [ 2280, 2284 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T53", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2381, 2386 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T54", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2400, 2404 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T55", "type": "Protein", "text": [ "Gzmb" ], "offsets": [ [ 2409, 2413 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T56", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2509, 2513 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T57", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2589, 2593 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T58", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 2613, 2617 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T59", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 2735, 2739 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T60", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2780, 2785 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T61", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2809, 2813 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T62", "type": "Protein", "text": [ "Il2rb" ], "offsets": [ [ 2923, 2928 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T63", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2960, 2965 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T64", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 3010, 3014 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T65", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3069, 3072 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T66", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3120, 3125 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T67", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 3199, 3204 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T68", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3232, 3237 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T69", "type": "Protein", "text": [ "Eo-VP16" ], "offsets": [ [ 3242, 3249 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T70", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3253, 3256 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T71", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3271, 3276 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T72", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3319, 3322 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T73", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3388, 3393 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T74", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3397, 3400 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T75", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 3401, 3404 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T76", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3413, 3416 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T77", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 3417, 3420 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T78", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3474, 3479 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T79", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3483, 3486 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T80", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3587, 3592 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T81", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 3596, 3599 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T82", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3614, 3619 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T83", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 3643, 3648 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T84", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 3660, 3668 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T85", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 3670, 3680 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T86", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 3686, 3695 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T87", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3728, 3733 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T88", "type": "Protein", "text": [ "Runx1" ], "offsets": [ [ 3784, 3789 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T89", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3837, 3842 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T90", "type": "Protein", "text": [ "Runx1" ], "offsets": [ [ 3860, 3865 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T91", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3895, 3900 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T92", "type": "Protein", "text": [ "Eo-VP16" ], "offsets": [ [ 3911, 3918 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T93", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 3939, 3947 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T94", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 3977, 3982 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T95", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 4040, 4049 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T96", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 4138, 4146 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T97", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 4167, 4172 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T98", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 4177, 4182 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T99", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 4217, 4225 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T100", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 4230, 4240 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T101", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 4253, 4258 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T102", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 4262, 4265 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T103", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 4372, 4377 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T104", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 4381, 4384 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T105", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 4490, 4493 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T106", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 4531, 4536 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T107", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 4657, 4665 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T108", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 4666, 4676 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T109", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 4703, 4708 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T110", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 4712, 4715 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T111", "type": "Protein", "text": [ "Fas" ], "offsets": [ [ 4871, 4874 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T112", "type": "Protein", "text": [ "Fas ligand" ], "offsets": [ [ 4875, 4885 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145", "type": "Entity", "text": [ "regulatory regions" ], "offsets": [ [ 2238, 2256 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T113", "type": "Anaphora", "text": [ "Both proteins" ], "offsets": [ [ 2303, 2316 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T148", "type": "Entity", "text": [ "transcription start sites" ], "offsets": [ [ 2414, 2439 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T150", "type": "Entity", "text": [ "TSS" ], "offsets": [ [ 2814, 2817 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T151", "type": "Entity", "text": [ "-1 kb enhancer" ], "offsets": [ [ 2826, 2840 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T153", "type": "Entity", "text": [ "promoter" ], "offsets": [ [ 2907, 2915 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T156", "type": "Entity", "text": [ "TSS" ], "offsets": [ [ 3015, 3018 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T114", "type": "Anaphora", "text": [ "which" ], "offsets": [ [ 3791, 3796 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T115", "type": "Anaphora", "text": [ "it" ], "offsets": [ [ 4005, 4007 ] ], "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T116", "type": "Anaphora", "text": [ "their" ], "offsets": [ [ 4201, 4206 ] ], "normalized": [] } ]

[ { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E1", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 84, 93 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T2" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T1" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E2", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 127, 136 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T3" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 687, 697 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T15" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 687, 697 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T16" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 687, 697 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T17" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E6", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 799, 809 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T18" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E7", "type": "Positive_regulation", "trigger": { "text": [ "undetectable" ], "offsets": [ [ 827, 839 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E6" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E8", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 945, 955 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T21" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E9", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 976, 986 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T22" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E10", "type": "Negative_regulation", "trigger": { "text": [ "unimpaired" ], "offsets": [ [ 991, 1001 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E9" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E11", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 1037, 1045 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E12" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T23" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E12", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1058, 1068 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T24" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E13", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 1037, 1045 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E14" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T23" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E14", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1058, 1068 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T25" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E15", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 1037, 1045 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E16" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T23" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E16", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1058, 1068 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T26" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E17", "type": "Positive_regulation", "trigger": { "text": [ "up-regulated" ], "offsets": [ [ 1267, 1279 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T28" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E18", "type": "Positive_regulation", "trigger": { "text": [ "induces" ], "offsets": [ [ 1290, 1297 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T29" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E19", "type": "Positive_regulation", "trigger": { "text": [ "induce" ], "offsets": [ [ 1346, 1352 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T32" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T30" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E20", "type": "Positive_regulation", "trigger": { "text": [ "induce" ], "offsets": [ [ 1346, 1352 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T32" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T31" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E21", "type": "Negative_regulation", "trigger": { "text": [ "silence" ], "offsets": [ [ 1367, 1374 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T33" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T30" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E22", "type": "Negative_regulation", "trigger": { "text": [ "silence" ], "offsets": [ [ 1367, 1374 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T33" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T31" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E23", "type": "Positive_regulation", "trigger": { "text": [ "necessary" ], "offsets": [ [ 1479, 1488 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E24" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T34" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E24", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 1499, 1508 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T35" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E25", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1547, 1557 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T36" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E26", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1587, 1597 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T37" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E27", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 1616, 1630 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T38" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E28", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1664, 1673 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T39" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E29", "type": "Positive_regulation", "trigger": { "text": [ "led" ], "offsets": [ [ 1682, 1685 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E30" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E27" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E30", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 1692, 1700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E33" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E31", "type": "Positive_regulation", "trigger": { "text": [ "led" ], "offsets": [ [ 1682, 1685 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E32" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E27" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E32", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 1692, 1700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E34" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E33", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1732, 1742 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T40" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E34", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1732, 1742 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T41" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E35", "type": "Positive_regulation", "trigger": { "text": [ "necessary" ], "offsets": [ [ 1975, 1984 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E36" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T42" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E36", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 1995, 2004 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T43" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E37", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E38" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T42" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E38", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 2045, 2058 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T45" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E39", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E38" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T44" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E40", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E41" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T42" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E41", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 2045, 2058 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T46" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E42", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E41" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T44" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E43", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E44" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T42" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E44", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 2045, 2058 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T47" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E45", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 2036, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E44" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T44" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E46", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T50" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E47", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T51" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E48", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T52" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E49", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T50" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E50", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T51" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E51", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2232, 2237 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T52" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T145" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E52", "type": "Binding", "trigger": { "text": [ "associated" ], "offsets": [ [ 2317, 2327 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E53", "type": "Binding", "trigger": { "text": [ "associated" ], "offsets": [ [ 2317, 2327 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E54", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2387, 2392 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T53" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T54" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T148" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E55", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2387, 2392 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T53" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T55" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T148" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E56", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2786, 2791 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T60" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T61" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T150" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E57", "type": "Binding", "trigger": { "text": [ "bound" ], "offsets": [ [ 2786, 2791 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T60" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T61" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T151" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E58", "type": "Binding", "trigger": { "text": [ "that" ], "offsets": [ [ 2886, 2890 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T60" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T62" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T153" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E59", "type": "Binding", "trigger": { "text": [ "target" ], "offsets": [ [ 2950, 2956 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T62" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T63" }, { "role": "Site", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T153" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E60", "type": "Binding", "trigger": { "text": [ "that" ], "offsets": [ [ 2989, 2993 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T60" }, { "role": "Theme2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T64" }, { "role": "Site2", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T156" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E61", "type": "Binding", "trigger": { "text": [ "target" ], "offsets": [ [ 3028, 3034 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T64" }, { "role": "Site", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T156" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E62", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 3186, 3195 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T67" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T66" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E63", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 3222, 3231 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T68" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E64", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 3222, 3231 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T69" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E65", "type": "Positive_regulation", "trigger": { "text": [ "restored" ], "offsets": [ [ 3620, 3628 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E66" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T82" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E66", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3629, 3639 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T83" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E67", "type": "Positive_regulation", "trigger": { "text": [ "restored" ], "offsets": [ [ 3620, 3628 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E68" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T82" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E68", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3629, 3639 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T84" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E69", "type": "Positive_regulation", "trigger": { "text": [ "restored" ], "offsets": [ [ 3620, 3628 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E70" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T82" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E70", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3629, 3639 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T85" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E71", "type": "Positive_regulation", "trigger": { "text": [ "restored" ], "offsets": [ [ 3620, 3628 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E72" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T82" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E72", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3629, 3639 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T86" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E73", "type": "Positive_regulation", "trigger": { "text": [ "up-regulation" ], "offsets": [ [ 3767, 3780 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T88" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E74", "type": "Negative_regulation", "trigger": { "text": [ "suppressed" ], "offsets": [ [ 3801, 3811 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T88" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T89" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E75", "type": "Negative_regulation", "trigger": { "text": [ "repression" ], "offsets": [ [ 3881, 3891 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T90" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T91" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E76", "type": "Positive_regulation", "trigger": { "text": [ "up-regulate" ], "offsets": [ [ 3927, 3938 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E77" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T92" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E77", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3948, 3958 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T93" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E78", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 3964, 3973 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T92" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E79", "type": "Positive_regulation", "trigger": { "text": [ "restored" ], "offsets": [ [ 4008, 4016 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E80" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T92" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E80", "type": "Positive_regulation", "trigger": { "text": [ "induce" ], "offsets": [ [ 4033, 4039 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E81" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E81", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4050, 4060 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T95" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E82", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4147, 4157 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T96" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E83", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 4158, 4166 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E82" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T97" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E84", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 4158, 4166 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E82" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T98" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E85", "type": "Positive_regulation", "trigger": { "text": [ "defect" ], "offsets": [ [ 4207, 4213 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E86" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T97" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E86", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4241, 4251 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T99" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E87", "type": "Positive_regulation", "trigger": { "text": [ "defect" ], "offsets": [ [ 4207, 4213 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E86" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T98" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E88", "type": "Positive_regulation", "trigger": { "text": [ "defect" ], "offsets": [ [ 4207, 4213 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E89" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T97" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E89", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4241, 4251 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T100" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E90", "type": "Positive_regulation", "trigger": { "text": [ "defect" ], "offsets": [ [ 4207, 4213 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E89" }, { "role": "Cause", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T98" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E91", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 4639, 4649 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T107" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E92", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 4639, 4649 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T108" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E93", "type": "Negative_regulation", "trigger": { "text": [ "defective" ], "offsets": [ [ 4690, 4699 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E91" } ] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E94", "type": "Negative_regulation", "trigger": { "text": [ "defective" ], "offsets": [ [ 4690, 4699 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_E92" } ] } ]

[]

[ { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R1", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T113", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T48", "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R2", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T113", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T49", "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R3", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T114", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T88", "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R4", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T115", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T92", "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R5", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T116", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T97", "normalized": [] }, { "id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_R6", "type": "Coreference", "arg1_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T116", "arg2_id": "PMC-2626671-06-RESULTS_AND_DISCUSSION_T98", "normalized": [] } ]

[ { "id": "PMC-3279418-11-Materials_and_Methods__text", "type": "abstract", "text": [ "Generation of BMDC\nBMDC were developed as previously reported [54], [55]. Cells were collected after 10-12 days of culture. The cell yield was 2-3x107 cells/mouse with 80-95% BMDC." ], "offsets": [ [ 0, 180 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2889865-15-Materials_and_methods__text", "type": "abstract", "text": [ "Reverse transcription quantitative PCR (RT-qPCR)\nRT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-kappaB, JNK and PKC. The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 degreesC followed by 60 cycles of 95degreesC for 1s and 60degreesC for 30s. Gene expression was analysed using Stratagene (Mx3000p(TM)) (AH diagnostics). The obtained Ct values were normalized against 18S. Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the deltaCt values for each sample. Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S deltaCt." ], "offsets": [ [ 0, 936 ] ] } ]

[ { "id": "PMC-2889865-15-Materials_and_methods_T1", "type": "Protein", "text": [ "il-6" ], "offsets": [ [ 105, 109 ] ], "normalized": [] }, { "id": "PMC-2889865-15-Materials_and_methods_T2", "type": "Protein", "text": [ "cxcl8" ], "offsets": [ [ 114, 119 ] ], "normalized": [] }, { "id": "PMC-2889865-15-Materials_and_methods_T3", "type": "Protein", "text": [ "il-6" ], "offsets": [ [ 229, 233 ] ], "normalized": [] }, { "id": "PMC-2889865-15-Materials_and_methods_T4", "type": "Protein", "text": [ "cxcl8" ], "offsets": [ [ 305, 310 ] ], "normalized": [] }, { "id": "PMC-2889865-15-Materials_and_methods_T5", "type": "Protein", "text": [ "il-6" ], "offsets": [ [ 861, 865 ] ], "normalized": [] }, { "id": "PMC-2889865-15-Materials_and_methods_T6", "type": "Protein", "text": [ "cxcl8" ], "offsets": [ [ 870, 875 ] ], "normalized": [] } ]

[ { "id": "PMC-2889865-15-Materials_and_methods_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 84, 94 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_T1" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 84, 94 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_T2" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E3", "type": "Positive_regulation", "trigger": { "text": [ "in response to" ], "offsets": [ [ 120, 134 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_E1" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E4", "type": "Positive_regulation", "trigger": { "text": [ "in response to" ], "offsets": [ [ 120, 134 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_E2" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E5", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 139, 148 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_E3" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E6", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 139, 148 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_E4" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 837, 847 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_T5" } ] }, { "id": "PMC-2889865-15-Materials_and_methods_E8", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 837, 847 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-15-Materials_and_methods_T6" } ] } ]

[]

[]

[ { "id": "PMC-3148254-00-TIAB__text", "type": "abstract", "text": [ "HOIL-1L Interacting Protein (HOIP) Is Essential for CD40 Signaling\nCD40 is a cell surface receptor important in the activation of antigen-presenting cells during immune responses. In macrophages and dendritic cells, engagement of CD40 by its ligand CD154 provides signals critical for anti-microbial and T cell-mediated immune responses, respectively. In B cells, CD40 signaling has a major role in regulating cell proliferation, antibody production, and memory B cell development. CD40 engagement results in the formation of a receptor-associated complex that mediates activation of NF-kappaB, stress-activated protein kinases, and other signaling molecules. However, the mechanisms that link CD40 to these signaling events have been only partially characterized. Known components of the CD40 signaling complex include members of the TNF receptor-associated factor (TRAF) family of proteins. We previously showed that the TRAF family member TRAF2 mediates recruitment of HOIL-1L-interacting protein (HOIP) to the cytoplasmic domain of CD40, suggesting that HOIP has a role in the CD40 signaling pathway. To determine the role of HOIP in CD40 signaling, we used somatic cell gene targeting to generate mouse B cell lines deficient in HOIP. We found that the CD40-induced upregulation of CD80 and activation of germline immunoglobulin epsilon transcription were defective in HOIP-deficient cells. We also found that the CD40-mediated activation of NF-kappaB and c-Jun kinase was impaired. Recruitment of IkappaB kinase proteins to the CD40 signaling complex was undetectable in HOIP-deficient cells, potentially explaining the defect in NF-kappaB activation. Restoration of HOIP expression reversed the defects in cellular activation and signaling. These results reveal HOIP as a key component of the CD40 signaling pathway." ], "offsets": [ [ 0, 1823 ] ] } ]

[ { "id": "PMC-3148254-00-TIAB_T1", "type": "Protein", "text": [ "HOIL-1L Interacting Protein" ], "offsets": [ [ 0, 27 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T2", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 29, 33 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T3", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 52, 56 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T4", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 67, 71 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T5", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 230, 234 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T6", "type": "Protein", "text": [ "ligand" ], "offsets": [ [ 242, 248 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T7", "type": "Protein", "text": [ "CD154" ], "offsets": [ [ 249, 254 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T8", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 364, 368 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T9", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 482, 486 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T10", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 694, 698 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T11", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 942, 947 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T12", "type": "Protein", "text": [ "HOIL-1L-interacting protein" ], "offsets": [ [ 972, 999 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T13", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1001, 1005 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T14", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1036, 1040 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T15", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1058, 1062 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T16", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1081, 1085 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T17", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1130, 1134 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T18", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1138, 1142 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T19", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1234, 1238 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T20", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1258, 1262 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T21", "type": "Protein", "text": [ "CD80" ], "offsets": [ [ 1287, 1291 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T22", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1374, 1378 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T23", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1419, 1423 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T24", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1577, 1581 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T25", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1673, 1677 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T26", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1769, 1773 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T27", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1800, 1804 ] ], "normalized": [] }, { "id": "PMC-3148254-00-TIAB_T32", "type": "Entity", "text": [ "cytoplasmic domain" ], "offsets": [ [ 1014, 1032 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-00-TIAB_E1", "type": "Binding", "trigger": { "text": [ "engagement" ], "offsets": [ [ 216, 226 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T5" }, { "role": "Theme2", "ref_id": "PMC-3148254-00-TIAB_T7" } ] }, { "id": "PMC-3148254-00-TIAB_E2", "type": "Binding", "trigger": { "text": [ "engagement" ], "offsets": [ [ 487, 497 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T9" } ] }, { "id": "PMC-3148254-00-TIAB_E3", "type": "Positive_regulation", "trigger": { "text": [ "mediates" ], "offsets": [ [ 948, 956 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_E4" }, { "role": "Cause", "ref_id": "PMC-3148254-00-TIAB_T11" } ] }, { "id": "PMC-3148254-00-TIAB_E4", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 957, 968 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T12" }, { "role": "Theme2", "ref_id": "PMC-3148254-00-TIAB_T14" }, { "role": "Site2", "ref_id": "PMC-3148254-00-TIAB_T32" } ] }, { "id": "PMC-3148254-00-TIAB_E5", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1221, 1230 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T19" } ] }, { "id": "PMC-3148254-00-TIAB_E6", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1263, 1270 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_E7" }, { "role": "Cause", "ref_id": "PMC-3148254-00-TIAB_T20" } ] }, { "id": "PMC-3148254-00-TIAB_E7", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 1271, 1283 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T21" } ] }, { "id": "PMC-3148254-00-TIAB_E8", "type": "Negative_regulation", "trigger": { "text": [ "defective" ], "offsets": [ [ 1361, 1370 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_E6" } ] }, { "id": "PMC-3148254-00-TIAB_E9", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1379, 1388 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T22" } ] }, { "id": "PMC-3148254-00-TIAB_E10", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1582, 1591 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T24" } ] }, { "id": "PMC-3148254-00-TIAB_E11", "type": "Positive_regulation", "trigger": { "text": [ "Restoration" ], "offsets": [ [ 1658, 1669 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_E12" } ] }, { "id": "PMC-3148254-00-TIAB_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1678, 1688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-00-TIAB_T25" } ] } ]

[ { "id": "PMC-3148254-00-TIAB_1", "entity_ids": [ "PMC-3148254-00-TIAB_T1", "PMC-3148254-00-TIAB_T2" ] }, { "id": "PMC-3148254-00-TIAB_2", "entity_ids": [ "PMC-3148254-00-TIAB_T12", "PMC-3148254-00-TIAB_T13" ] } ]

[]

[ { "id": "PMC-3245220-32-Caption-Figure_8__text", "type": "abstract", "text": [ "NF-kappaB p65 Ser276 is essential in regulating NF-kappaB activity.\n(A) Raw 264.7 cell line was transiently transfected with pNF-kappaB-SEAP along with empty vector or plasmid encoding either NF-kappaB p65 WT or NF-kappaB p65 276S/A. The cells were transfected for 18-24 hours, serum starved for 4 hours, and then incubated with 10 microM of Ro-31-8220 for 30 minutes prior to treatment with 100 ng/ml of M-CSF for 2 hours and SEAP secretion in the medium was measured. (B) NF-kappaB p65-/- cell line was transiently transfected with pNF-kappaB-SEAP along with empty vector or plasmid encoding either NF-kappaB p65 WT, NF-kappaB p65 276S/A, or NF-kappaB p65 536S/A. The cells were cultured for 24 hours and then serum starved for 4 hours. Cells were then incubated in fresh DMEM medium for 2 hours and SEAP secretion in the medium was measured. The results shown are fold change over empty vector + pTAL-SEAP. (C) NF-kappaB p65-/- cell line was transiently transfected with pNF-kappaB-SEAP with either empty vector or plasmid encoding either NF-kappaB p65 WT or NF-kappaB p65 276S/A. The cells were transfected for 24 hours and serum starved for 4 hours, and then incubated with 10 microM of Ro-31-8220 for 30 minutes prior to treatment with 10 ng/ml of TNFalpha. The supernatant were collected after 2 hours of treatment and SEAP secretion in the medium was measured. The results shown are the fold change over empty vector + pNF-kappaB-SEAP. Data shown are mean +/- S.E.M for at least three independent experiments performed in duplicate." ], "offsets": [ [ 0, 1540 ] ] } ]

[ { "id": "PMC-3245220-32-Caption-Figure_8_T1", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 10, 13 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 202, 205 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 222, 225 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T4", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 484, 487 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T5", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 611, 614 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T6", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 629, 632 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T7", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 654, 657 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T8", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 924, 927 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T9", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1052, 1055 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T10", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1072, 1075 ] ], "normalized": [] }, { "id": "PMC-3245220-32-Caption-Figure_8_T11", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 1254, 1262 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-32-Caption-Figure_8_E1", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 108, 119 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T2" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E2", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 108, 119 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T3" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E3", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 517, 528 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T5" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E4", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 517, 528 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T6" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E5", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 517, 528 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T7" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E6", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 957, 968 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T9" } ] }, { "id": "PMC-3245220-32-Caption-Figure_8_E7", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 957, 968 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-32-Caption-Figure_8_T10" } ] } ]

[]

[]

[ { "id": "PMC-2065877-06-Results__text", "type": "abstract", "text": [ "LMP1 Upregulates IL10 and Constitutively Activates Stat3\nTo identify cytokines that may contribute to the increased survival and growth of lymphomas, the expression levels of a panel of cytokines were screened on CD19+ MACS-purified B cells, using an RPA probe set for IL4, IL5, IL10, IL13, IL15, IL9, IL2, IL6, and IFNgamma. Expression levels were quantified with a phosphorimager and normalized to the ribosomal housekeeping gene L32. None of the tested cytokines were detected in wild-type lymphocytes, therefore cytokine:L32 ratios were set to 1 in the mouse B cell lymphoma line 967. Transcription of IL10, IL15, and IFNgamma were reproducibly detected in LMP1 transgenic lymphocytes and lymphoma cells and was higher than in the B cell lymphoma cell lines 967 and K46mu (Figure 5A). There was no significant difference in the expression of IL15 and IFNgamma between LMP1 transgenic lymphocytes and lymphoma cells, suggesting that upregulation of IL15 and IFNgamma is induced by LMP1 expression in healthy lymphocytes but is not a unique property of malignant lymphocytes. Strikingly, IL10, a B lymphocyte stimulatory cytokine, was increased 1.5- to 5-fold in the wild-type and LMP1 transgenic lymphoma cells compared to LMP1 transgenic lymphocytes (Figure 5A). Production of IL15 and IFNgamma has been associated with induction of cytotoxic effector responses in cells latently infected with EBV [33,34]. However, transformation and growth properties induced by EBV are associated with the upregulation of IL10 [35-38]; hence, the effects of IL10 upregulation on the growth properties of the lymphoma cells were further examined. Immunoblot analysis indicated that LMP1 transgenic lymphocytes and wild-type and LMP1 transgenic lymphoma cells had corresponding increased levels of phosphorylated alpha and beta isoforms of activated Stat3, a target of the IL10 receptor (Figure 5B). However, when comparing the same lymphomas, there was no correlation between the levels of IL10 induction and the levels of Stat3 activation. This suggests that the activation of Stat3 is not solely induced by IL10 or that Stat3 activation may be constitutive. Additionally, there was no correlation between the levels of LMP1 expression and the levels of IL10 induction (Figures 1A and 5A). This indicates that the induction of IL10 is a general property associated with enhanced survival and may only be indirectly affected by LMP1. Neutralizing antibodies to IL10 did not affect the survival of lymphoma cells as determined by the MTS assay (unpublished data), suggesting constitutive activation of Stat3. This was confirmed by immunoblot analysis such that in the presence of anti-IL10 neutralizing antibodies, pStat3 levels remained activated in lymphoma cells isolated from wild-type and LMP1 transgenic lymphomas (Figure 5C). Exogenous addition of IL10 enhanced pStat3 activation above constitutive levels, indicating that lymphoma cells are responsive to IL10 treatment (Figure 5C). This means that although the lymphoma cells have constitutive Stat3 activation, it may be further enhanced by IL10 induction. The neutralizing effect of the anti-IL10 antibody was confirmed by pre-incubation of IL10 with anti-IL10 antibody compared to a rat IgG1 isotype control (Figure 5C).\nNuclear translocation of pStat3 is a consequence of activation, and nuclear pStat3 was not detected by immunohistochemistry staining of spleen sections from control mice. However, nuclear pStat3 was detectable in LMP1 transgenic mice and wild-type lymphomas and was detected more homogeneously in LMP1 transgenic lymphomas (Figure 5D). The constitutive activation of pStat3 and abundant nuclear Stat3 suggests that Stat3 signaling contributes to LMP1-mediated lymphoma development." ], "offsets": [ [ 0, 3752 ] ] } ]

[ { "id": "PMC-2065877-06-Results_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T2", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 17, 21 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T3", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 51, 56 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T4", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 213, 217 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T5", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 269, 272 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T6", "type": "Protein", "text": [ "IL5" ], "offsets": [ [ 274, 277 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T7", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 279, 283 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T8", "type": "Protein", "text": [ "IL13" ], "offsets": [ [ 285, 289 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T9", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 291, 295 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T10", "type": "Protein", "text": [ "IL9" ], "offsets": [ [ 297, 300 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T11", "type": "Protein", "text": [ "IL2" ], "offsets": [ [ 302, 305 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T12", "type": "Protein", "text": [ "IL6" ], "offsets": [ [ 307, 310 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T13", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 316, 324 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T14", "type": "Protein", "text": [ "L32" ], "offsets": [ [ 432, 435 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T15", "type": "Protein", "text": [ "L32" ], "offsets": [ [ 525, 528 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T16", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 606, 610 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T17", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 612, 616 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T18", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 622, 630 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T19", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 661, 665 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T20", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 846, 850 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T21", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 855, 863 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T22", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 872, 876 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T23", "type": "Protein", "text": [ "lymphoma cells" ], "offsets": [ [ 904, 918 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T24", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 952, 956 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T25", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 961, 969 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T26", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 984, 988 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T27", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 1090, 1094 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T28", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1183, 1187 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T29", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1226, 1230 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T30", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 1281, 1285 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T31", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 1290, 1298 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T32", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 1512, 1516 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T33", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 1548, 1552 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T34", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1671, 1675 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T35", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1717, 1721 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T36", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 1838, 1843 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T37", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 1861, 1865 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T38", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 1979, 1983 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T39", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2012, 2017 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T40", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2067, 2072 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T41", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2098, 2102 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T42", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2111, 2116 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T43", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2210, 2214 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T44", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2244, 2248 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T45", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2317, 2321 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T46", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2417, 2421 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T47", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2450, 2454 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T48", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2590, 2595 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T49", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2673, 2677 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T50", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 2703, 2709 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T51", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2782, 2786 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T52", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2843, 2847 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T53", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 2857, 2863 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T54", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 2951, 2955 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T55", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3041, 3046 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T56", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 3089, 3093 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T57", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 3141, 3145 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T58", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 3190, 3194 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T59", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 3205, 3209 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T60", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 3296, 3302 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T61", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 3347, 3353 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T62", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 3459, 3465 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T63", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3484, 3488 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T64", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3568, 3572 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T65", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 3638, 3644 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T66", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3666, 3671 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T67", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3686, 3691 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T68", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3717, 3721 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T69", "type": "Anaphora", "text": [ "the tested cytokines" ], "offsets": [ [ 445, 465 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T70", "type": "Anaphora", "text": [ "it" ], "offsets": [ [ 3059, 3061 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T106", "type": "Entity", "text": [ "Nuclear" ], "offsets": [ [ 3271, 3278 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T110", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 3339, 3346 ] ], "normalized": [] }, { "id": "PMC-2065877-06-Results_T112", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 3451, 3458 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-06-Results_E1", "type": "Positive_regulation", "trigger": { "text": [ "Upregulates" ], "offsets": [ [ 5, 16 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T2" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_T1" } ] }, { "id": "PMC-2065877-06-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "Activates" ], "offsets": [ [ 41, 50 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T3" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_T1" } ] }, { "id": "PMC-2065877-06-Results_E3", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T5" } ] }, { "id": "PMC-2065877-06-Results_E4", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T6" } ] }, { "id": "PMC-2065877-06-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T7" } ] }, { "id": "PMC-2065877-06-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T8" } ] }, { "id": "PMC-2065877-06-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T9" } ] }, { "id": "PMC-2065877-06-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T10" } ] }, { "id": "PMC-2065877-06-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T11" } ] }, { "id": "PMC-2065877-06-Results_E10", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T12" } ] }, { "id": "PMC-2065877-06-Results_E11", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 471, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T13" } ] }, { "id": "PMC-2065877-06-Results_E12", "type": "Transcription", "trigger": { "text": [ "Transcription" ], "offsets": [ [ 589, 602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T16" } ] }, { "id": "PMC-2065877-06-Results_E13", "type": "Transcription", "trigger": { "text": [ "Transcription" ], "offsets": [ [ 589, 602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T17" } ] }, { "id": "PMC-2065877-06-Results_E14", "type": "Transcription", "trigger": { "text": [ "Transcription" ], "offsets": [ [ 589, 602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T18" } ] }, { "id": "PMC-2065877-06-Results_E15", "type": "Positive_regulation", "trigger": { "text": [ "higher" ], "offsets": [ [ 716, 722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E12" } ] }, { "id": "PMC-2065877-06-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "higher" ], "offsets": [ [ 716, 722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E13" } ] }, { "id": "PMC-2065877-06-Results_E17", "type": "Positive_regulation", "trigger": { "text": [ "higher" ], "offsets": [ [ 716, 722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E14" } ] }, { "id": "PMC-2065877-06-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 832, 842 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T20" } ] }, { "id": "PMC-2065877-06-Results_E19", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 832, 842 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T21" } ] }, { "id": "PMC-2065877-06-Results_E20", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 936, 948 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T24" } ] }, { "id": "PMC-2065877-06-Results_E21", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 936, 948 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T25" } ] }, { "id": "PMC-2065877-06-Results_E22", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 973, 980 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E20" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_E23" } ] }, { "id": "PMC-2065877-06-Results_E23", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 989, 999 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T26" } ] }, { "id": "PMC-2065877-06-Results_E24", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 973, 980 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E21" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_E23" } ] }, { "id": "PMC-2065877-06-Results_E25", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1137, 1146 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T27" } ] }, { "id": "PMC-2065877-06-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 1267, 1277 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T30" } ] }, { "id": "PMC-2065877-06-Results_E27", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 1267, 1277 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T31" } ] }, { "id": "PMC-2065877-06-Results_E28", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 1496, 1508 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T32" } ] }, { "id": "PMC-2065877-06-Results_E29", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 1553, 1565 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T33" } ] }, { "id": "PMC-2065877-06-Results_E30", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1766, 1775 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E31" } ] }, { "id": "PMC-2065877-06-Results_E31", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1786, 1800 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T36" } ] }, { "id": "PMC-2065877-06-Results_E32", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 1828, 1837 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T36" } ] }, { "id": "PMC-2065877-06-Results_E33", "type": "Regulation", "trigger": { "text": [ "target" ], "offsets": [ [ 1847, 1853 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T36" } ] }, { "id": "PMC-2065877-06-Results_E34", "type": "Regulation", "trigger": { "text": [ "correlation" ], "offsets": [ [ 1945, 1956 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E35" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_E36" } ] }, { "id": "PMC-2065877-06-Results_E35", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2018, 2028 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T39" } ] }, { "id": "PMC-2065877-06-Results_E36", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 1984, 1993 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T38" } ] }, { "id": "PMC-2065877-06-Results_E37", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2053, 2063 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T40" } ] }, { "id": "PMC-2065877-06-Results_E38", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2087, 2094 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E37" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_T41" } ] }, { "id": "PMC-2065877-06-Results_E39", "type": "Regulation", "trigger": { "text": [ "correlation" ], "offsets": [ [ 2176, 2187 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E40" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_E41" } ] }, { "id": "PMC-2065877-06-Results_E40", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 2249, 2258 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T44" } ] }, { "id": "PMC-2065877-06-Results_E41", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2215, 2225 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T43" } ] }, { "id": "PMC-2065877-06-Results_E42", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 2304, 2313 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T45" } ] }, { "id": "PMC-2065877-06-Results_E43", "type": "Regulation", "trigger": { "text": [ "affected" ], "offsets": [ [ 2405, 2413 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E42" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_T46" } ] }, { "id": "PMC-2065877-06-Results_E44", "type": "Negative_regulation", "trigger": { "text": [ "Neutralizing" ], "offsets": [ [ 2423, 2435 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T47" } ] }, { "id": "PMC-2065877-06-Results_E45", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2576, 2586 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T48" } ] }, { "id": "PMC-2065877-06-Results_E46", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 2726, 2735 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T50" } ] }, { "id": "PMC-2065877-06-Results_E47", "type": "Positive_regulation", "trigger": { "text": [ "enhanced" ], "offsets": [ [ 2848, 2856 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E48" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_T52" } ] }, { "id": "PMC-2065877-06-Results_E48", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2864, 2874 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T53" } ] }, { "id": "PMC-2065877-06-Results_E49", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3047, 3057 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T55" } ] }, { "id": "PMC-2065877-06-Results_E50", "type": "Positive_regulation", "trigger": { "text": [ "enhanced" ], "offsets": [ [ 3077, 3085 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E49" } ] }, { "id": "PMC-2065877-06-Results_E51", "type": "Negative_regulation", "trigger": { "text": [ "neutralizing effect" ], "offsets": [ [ 3109, 3128 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T57" } ] }, { "id": "PMC-2065877-06-Results_E52", "type": "Localization", "trigger": { "text": [ "translocation" ], "offsets": [ [ 3279, 3292 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T60" }, { "role": "ToLoc", "ref_id": "PMC-2065877-06-Results_T106" } ] }, { "id": "PMC-2065877-06-Results_E53", "type": "Positive_regulation", "trigger": { "text": [ "consequence" ], "offsets": [ [ 3308, 3319 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_E52" }, { "role": "Cause", "ref_id": "PMC-2065877-06-Results_E54" } ] }, { "id": "PMC-2065877-06-Results_E54", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3323, 3333 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T60" } ] }, { "id": "PMC-2065877-06-Results_E55", "type": "Localization", "trigger": { "text": [ "detected" ], "offsets": [ [ 3362, 3370 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T61" }, { "role": "ToLoc", "ref_id": "PMC-2065877-06-Results_T110" } ] }, { "id": "PMC-2065877-06-Results_E56", "type": "Localization", "trigger": { "text": [ "detectable" ], "offsets": [ [ 3470, 3480 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T62" }, { "role": "ToLoc", "ref_id": "PMC-2065877-06-Results_T112" } ] }, { "id": "PMC-2065877-06-Results_E57", "type": "Localization", "trigger": { "text": [ "detected" ], "offsets": [ [ 3537, 3545 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T62" }, { "role": "ToLoc", "ref_id": "PMC-2065877-06-Results_T112" } ] }, { "id": "PMC-2065877-06-Results_E58", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3624, 3634 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T65" } ] }, { "id": "PMC-2065877-06-Results_E59", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3624, 3634 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-06-Results_T66" } ] } ]

[]

[ { "id": "PMC-2065877-06-Results_R1", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T5", "normalized": [] }, { "id": "PMC-2065877-06-Results_R2", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T6", "normalized": [] }, { "id": "PMC-2065877-06-Results_R3", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T7", "normalized": [] }, { "id": "PMC-2065877-06-Results_R4", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T8", "normalized": [] }, { "id": "PMC-2065877-06-Results_R5", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T9", "normalized": [] }, { "id": "PMC-2065877-06-Results_R6", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T10", "normalized": [] }, { "id": "PMC-2065877-06-Results_R7", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T11", "normalized": [] }, { "id": "PMC-2065877-06-Results_R8", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T12", "normalized": [] }, { "id": "PMC-2065877-06-Results_R9", "type": "Coreference", "arg1_id": "PMC-2065877-06-Results_T69", "arg2_id": "PMC-2065877-06-Results_T13", "normalized": [] } ]

[ { "id": "PMC-2626671-15-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Northern and Western blot analyses.\nRNA isolation and Northern blot analysis was performed as previously described (29). In brief, 10 mug of total RNA was loaded per lane and transferred to positively charged nylon membranes (Hybond-N+; GE Healthcare), which was confirmed by ethidium bromide staining of ribosomal RNA species on the membrane. Membranes were hybridized with 1 ng/ml alpha-[32P]dCTP-labeled trichloroacetic acid precipitable probe in ExpressHyb hybridization buffer (Clontech Laboratories, Inc.). All cDNA probes were confirmed to have the appropriate single-copy specificity under these conditions using genomic Southern blot analysis. Band intensities were acquired by phosphorimaging analysis.\nFor Western analysis, whole-cell protein lysates were obtained from CD8+ T cells at the time points indicated in the figures during clonal expansion in 100 U/ml IL-2 with lysis buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 10% glycerol, 5 mM EDTA, 1% NP-40) by resuspending samples in 10 mul per 106 cells and incubating on ice for 30 min in the presence of protease inhibitors. Immunoblot analysis was performed with the antibodies indicated in the figures after SDS-PAGE (10-30 mug of total protein was loaded per well). Quantification of detected protein was performed with an Intelligent Dark Box unit (LAS-3000; Fujifilm) and normalized for loading with the amount of RNA Pol-II detected in each lane." ], "offsets": [ [ 0, 1415 ] ] } ]

[ { "id": "PMC-2626671-15-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 781, 784 ] ], "normalized": [] }, { "id": "PMC-2626671-15-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 874, 878 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-1447668-05-Results__text", "type": "abstract", "text": [ "The Transactivation Functions of HTLV-I Tax Are Suppressed by Foxp3\nPrevious studies by Bettelli and colleagues have demonstrated that Foxp3 can repress both the basal levels of NF-kappaB activation as well as tumor necrosis factor-alpha-stimulated NF-kappaB activation [15]. Our next step was to determine whether Foxp3 could also suppress the activation of NF-kappaB caused by a strong viral transactivator protein. HTLV-I encodes a multifunctional transactivator protein, Tax, capable of activating both the NF-kappaB and CREB pathways [24-29]. Since the HTLV-I Tax protein can function at multiple levels in both the cytoplasm and the nucleus to stimulate activation of NF-kappaB [28,29], we hypothesized that overexpression of Foxp3 may interfere with this process. However, since Tax-dependent HTLV-I gene expression is independent of NF-kappaB [18], we also hypothesized that Foxp3 would not affect Tax-dependent activation of the HTLV-I LTR. To test these hypotheses, we overexpressed HTLV-I Tax, full-length Foxp3, and/or deltaFKH in HEK 293T cells cotransfected with an HTLV-I LTR or NF-kappaB reporter vector. As shown in Figure 4A, HTLV-I Tax strongly up-regulated NF-kappaB-dependent transcriptional activation (~60-fold). Interestingly, overexpression of Foxp3, but not deltaFKH, suppressed Tax-mediated activation of NF-kappaB-dependent transcription. These observations further suggest that the carboxyl-terminal FKH domain is required for inhibiting activation of NF-kappaB in the presence of Tax in HEK 293T cells, strikingly similar to the requirements of Foxp3 inhibition of basal NF-kappaB activation shown in Figure 2B. Transactivation of the HTLV-I LTR was stimulated about 55-fold by overexpression of Tax (Figure 4B), while transfection of Foxp3 suppressed Tax-dependent HTLV-I LTR activation, although HTLV-I LTR activation in the presence or absence of Tax is independent of NF-kappaB or NF-AT (another transcriptional activator known to interact with Foxp3). Furthermore, overexpression of deltaFKH also led to suppression of HTLV-I transactivation by Tax to a similar extent as full-length Foxp3 (Figure 4B). The suppressive effects shown in Figure 4A and 4B were not the result of Foxp3 down-regulating the expression of the transfected Tax plasmid as determined by real-time RT-PCR (Figure 4C). These results strongly suggest that Foxp3 interacts with transcriptional regulators in addition to NF-kappaB and NF-AT, and that the carboxyl-terminal FKH domain, and therefore localization to the nucleus, are not required for inhibition of Tax-mediated HTLV-I LTR activation (even in HEK 293T cells).\nTo determine whether Foxp3 inhibited the transactivation functions of Tax by directly associating with this viral protein, we generated an expression vector in which HTLV-I Tax was fused in-frame to the carboxyl terminus of the Gal4 DNA-binding domain (Gal4-BD). This Gal4-BD-Tax fusion protein activated transcription of a synthetic promoter containing five Gal4 binding sites, while Gal4-BD was insufficient to stimulate transcription by itself (Figure 4D). Transactivation of the Gal4-resposive promoter by Gal4-BD-Tax remained relatively unaffected by overexpression of either EGFP (control), Foxp3, or deltaFKH, suggesting that Foxp3 does not repress Tax transactivation by directly interfacing with the HTLV-I Tax protein. To confirm that Foxp3 had a direct effect on HTLV-I replication, we transfected HEK 293T cells with a well-characterized HTLV-I infectious molecular clone (termed ACH) [30] in the presence of full-length Foxp3, deltaFKH, or control vector. ACH has been previously shown to direct the expression of viral antigens, produce infectious virus, and transform CD4+ T cells both in vitro and in vivo [31,32]. After 24 h, the amount of viral antigen expression, in this case Tax mRNA, was detected by a sensitive real-time RT-PCR assay. As illustrated in Figure 5, the level of Tax mRNA synthesized from ACH was down-regulated in the presence of Foxp3 compared to the level produced in the presence of the control vector. deltaFKH did not have a discernable affect on Tax expression. These data indicate that Foxp3 is capable of repressing the expression of Tax from an infectious HTLV-I molecular clone." ], "offsets": [ [ 0, 4253 ] ] } ]

[ { "id": "PMC-1447668-05-Results_T1", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 40, 43 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 62, 67 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 135, 140 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T4", "type": "Protein", "text": [ "tumor necrosis factor-alpha" ], "offsets": [ [ 210, 237 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T5", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 315, 320 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T6", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 475, 478 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T7", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 565, 568 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T8", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 732, 737 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T9", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 786, 789 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T10", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 883, 888 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T11", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 906, 909 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T12", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1000, 1003 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1017, 1022 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T14", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1031, 1039 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T15", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1151, 1154 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T16", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1269, 1274 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T17", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1284, 1292 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T18", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1305, 1308 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T19", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1510, 1513 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T20", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1575, 1580 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T21", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1726, 1729 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T22", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1765, 1770 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T23", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1782, 1785 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T24", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1880, 1883 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T25", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1979, 1984 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T26", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 2018, 2026 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T27", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2080, 2083 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T28", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2119, 2124 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T29", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2211, 2216 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T30", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2267, 2270 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T31", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2362, 2367 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T32", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2567, 2570 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T33", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2649, 2654 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T34", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2698, 2701 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T35", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2801, 2804 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T36", "type": "Protein", "text": [ "Gal4" ], "offsets": [ [ 2856, 2860 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T37", "type": "Protein", "text": [ "Gal4" ], "offsets": [ [ 2881, 2885 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T38", "type": "Protein", "text": [ "Gal4-BD-Tax" ], "offsets": [ [ 2896, 2907 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T39", "type": "Protein", "text": [ "Gal4" ], "offsets": [ [ 3013, 3017 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T40", "type": "Protein", "text": [ "Gal4-BD-Tax" ], "offsets": [ [ 3138, 3149 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T41", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3225, 3230 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T42", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 3235, 3243 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T43", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3261, 3266 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T44", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3284, 3287 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T45", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3344, 3347 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T46", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3373, 3378 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T47", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3561, 3566 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T48", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 3568, 3576 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T49", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 3711, 3714 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T50", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3824, 3827 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T51", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3927, 3930 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T52", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3995, 4000 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T53", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 4071, 4079 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T54", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 4117, 4120 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T55", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4158, 4163 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T56", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 4207, 4210 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T70", "type": "Entity", "text": [ "nucleus" ], "offsets": [ [ 2523, 2530 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T57", "type": "Anaphora", "text": [ "this viral protein" ], "offsets": [ [ 2731, 2749 ] ], "normalized": [] }, { "id": "PMC-1447668-05-Results_T58", "type": "Anaphora", "text": [ "viral antigen" ], "offsets": [ [ 3785, 3798 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-05-Results_E1", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 714, 728 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T8" } ] }, { "id": "PMC-1447668-05-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "overexpressed" ], "offsets": [ [ 979, 992 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T12" } ] }, { "id": "PMC-1447668-05-Results_E3", "type": "Positive_regulation", "trigger": { "text": [ "overexpressed" ], "offsets": [ [ 979, 992 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T13" } ] }, { "id": "PMC-1447668-05-Results_E4", "type": "Positive_regulation", "trigger": { "text": [ "overexpressed" ], "offsets": [ [ 979, 992 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T14" } ] }, { "id": "PMC-1447668-05-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 1251, 1265 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T16" } ] }, { "id": "PMC-1447668-05-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 1251, 1265 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T17" } ] }, { "id": "PMC-1447668-05-Results_E7", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 1708, 1722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T21" } ] }, { "id": "PMC-1447668-05-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "transfection" ], "offsets": [ [ 1749, 1761 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T22" } ] }, { "id": "PMC-1447668-05-Results_E9", "type": "Binding", "trigger": { "text": [ "interact" ], "offsets": [ [ 1965, 1973 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T25" } ] }, { "id": "PMC-1447668-05-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 2000, 2014 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T26" } ] }, { "id": "PMC-1447668-05-Results_E11", "type": "Negative_regulation", "trigger": { "text": [ "down-regulating" ], "offsets": [ [ 2217, 2232 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_E12" }, { "role": "Cause", "ref_id": "PMC-1447668-05-Results_T29" } ] }, { "id": "PMC-1447668-05-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2237, 2247 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T30" } ] }, { "id": "PMC-1447668-05-Results_E13", "type": "Binding", "trigger": { "text": [ "interacts" ], "offsets": [ [ 2368, 2377 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T31" } ] }, { "id": "PMC-1447668-05-Results_E14", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 2503, 2515 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T31" }, { "role": "ToLoc", "ref_id": "PMC-1447668-05-Results_T70" } ] }, { "id": "PMC-1447668-05-Results_E15", "type": "Binding", "trigger": { "text": [ "associating" ], "offsets": [ [ 2714, 2725 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T33" }, { "role": "Theme2", "ref_id": "PMC-1447668-05-Results_T34" } ] }, { "id": "PMC-1447668-05-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3184, 3198 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T41" } ] }, { "id": "PMC-1447668-05-Results_E17", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3184, 3198 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T42" } ] }, { "id": "PMC-1447668-05-Results_E18", "type": "Negative_regulation", "trigger": { "text": [ "interfacing" ], "offsets": [ [ 3316, 3327 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T45" }, { "role": "Cause", "ref_id": "PMC-1447668-05-Results_T43" } ] }, { "id": "PMC-1447668-05-Results_E19", "type": "Transcription", "trigger": { "text": [ "expression" ], "offsets": [ [ 3799, 3809 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T50" } ] }, { "id": "PMC-1447668-05-Results_E20", "type": "Transcription", "trigger": { "text": [ "synthesized" ], "offsets": [ [ 3936, 3947 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T51" } ] }, { "id": "PMC-1447668-05-Results_E21", "type": "Negative_regulation", "trigger": { "text": [ "down-regulated" ], "offsets": [ [ 3961, 3975 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_E20" }, { "role": "Cause", "ref_id": "PMC-1447668-05-Results_T52" } ] }, { "id": "PMC-1447668-05-Results_E22", "type": "Transcription", "trigger": { "text": [ "produced" ], "offsets": [ [ 4023, 4031 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T51" } ] }, { "id": "PMC-1447668-05-Results_E23", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 4107, 4113 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_E24" }, { "role": "Cause", "ref_id": "PMC-1447668-05-Results_T53" } ] }, { "id": "PMC-1447668-05-Results_E24", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4121, 4131 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T54" } ] }, { "id": "PMC-1447668-05-Results_E25", "type": "Negative_regulation", "trigger": { "text": [ "repressing" ], "offsets": [ [ 4178, 4188 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_E26" }, { "role": "Cause", "ref_id": "PMC-1447668-05-Results_T55" } ] }, { "id": "PMC-1447668-05-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4193, 4203 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-05-Results_T56" } ] } ]

[]

[ { "id": "PMC-1447668-05-Results_R1", "type": "Coreference", "arg1_id": "PMC-1447668-05-Results_T57", "arg2_id": "PMC-1447668-05-Results_T34", "normalized": [] }, { "id": "PMC-1447668-05-Results_R2", "type": "Coreference", "arg1_id": "PMC-1447668-05-Results_T58", "arg2_id": "PMC-1447668-05-Results_T50", "normalized": [] } ]

[ { "id": "PMC-3245220-20-Materials_and_Methods__text", "type": "abstract", "text": [ "Western Blot Analysis\nCells were washed with PBS and resuspended in cell lysis buffer. (Cell Signaling Technology) and incubated for 10 minutes on ice then centrifuged to remove the insoluble fraction. The protein concentration was determined by the BCA protein assay (Bio-Rad, Hercules, CA). Cell lysates were separated by SDS-PAGE on 10% polyacrylamide gels and then transferred onto nitrocellulose membranes and subjected to Western blotting. The immunoblotted proteins were detected by ECL reagent (GE Healthcare Bio-Sciences Corp., Piscataway, NJ)." ], "offsets": [ [ 0, 553 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2065877-10-Materials_and_Methods__text", "type": "abstract", "text": [ "Transgenic mice.\nGeneration of LMP1 mice under the Ig heavy chain promoter and enhancer have been described previously and were maintained as heterozygotes on a Balbc background [26]. LMP1 mice were genotyped by Southern blot and PCR analysis of tail DNA as described previously [26]. Spleen and liver sections were fixed in 4% paraformaldehyde and embedded in paraffin, and 5-mum sections were stained with hematoxylin and eosin for histopathological analysis. Lymphomas were passaged by intraperitoneal injection of 1 x 108 splenocytes into SCID mice and sacrificed upon development of an extended abdomen. Animals were housed in the Association for Assessment and Accreditation for Animal Care-approved animal facility at the University of North Carolina at Chapel Hill. All protocols were approved by the Institutional Animal Care and Use Committee." ], "offsets": [ [ 0, 853 ] ] } ]

[ { "id": "PMC-2065877-10-Materials_and_Methods_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 31, 35 ] ], "normalized": [] }, { "id": "PMC-2065877-10-Materials_and_Methods_T2", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 184, 188 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-24-Caption-Figure_6__text", "type": "abstract", "text": [ "LMP1 Activates Akt Signaling and Deregulates the Rb Cell Cycle Pathway\n(A and B) Immunoblot analysis of purified B cells (CD19+) from the spleens of WT and LMP1 transgenic mice for Akt signaling, probing for (A) activated pAkt and downstream targets, including inactivated pGSK3alpha/beta, and (B) activated p-mTOR, and total levels of FoxO1. Arrows indicate the positions of alpha and beta isoforms of GSK3. The white line indicates that intervening lanes have been spliced out.\n(C) Immunoblot analysis for cell cycle proteins regulating the Rb pathway, probing for activated pRb, and total levels of Cdk2 and the Cdk inhibitor p27. Actin was used as a loading control." ], "offsets": [ [ 0, 670 ] ] } ]

[ { "id": "PMC-2065877-24-Caption-Figure_6_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T2", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 15, 18 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T3", "type": "Protein", "text": [ "Rb" ], "offsets": [ [ 49, 51 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T4", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 122, 126 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T5", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 156, 160 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T6", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 181, 184 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T7", "type": "Protein", "text": [ "pAkt" ], "offsets": [ [ 222, 226 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T8", "type": "Protein", "text": [ "pGSK3alpha" ], "offsets": [ [ 273, 283 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T9", "type": "Protein", "text": [ "beta" ], "offsets": [ [ 284, 288 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T10", "type": "Protein", "text": [ "p-mTOR" ], "offsets": [ [ 308, 314 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T11", "type": "Protein", "text": [ "FoxO1" ], "offsets": [ [ 336, 341 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T12", "type": "Protein", "text": [ "GSK3" ], "offsets": [ [ 403, 407 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T13", "type": "Protein", "text": [ "Rb" ], "offsets": [ [ 543, 545 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T14", "type": "Protein", "text": [ "pRb" ], "offsets": [ [ 577, 580 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T15", "type": "Protein", "text": [ "Cdk2" ], "offsets": [ [ 602, 606 ] ], "normalized": [] }, { "id": "PMC-2065877-24-Caption-Figure_6_T16", "type": "Protein", "text": [ "p27" ], "offsets": [ [ 629, 632 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-24-Caption-Figure_6_E1", "type": "Regulation", "trigger": { "text": [ "targets" ], "offsets": [ [ 242, 249 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T8" } ] }, { "id": "PMC-2065877-24-Caption-Figure_6_E2", "type": "Regulation", "trigger": { "text": [ "targets" ], "offsets": [ [ 242, 249 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T9" } ] }, { "id": "PMC-2065877-24-Caption-Figure_6_E3", "type": "Positive_regulation", "trigger": { "text": [ "inactivated" ], "offsets": [ [ 261, 272 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T8" } ] }, { "id": "PMC-2065877-24-Caption-Figure_6_E4", "type": "Positive_regulation", "trigger": { "text": [ "inactivated" ], "offsets": [ [ 261, 272 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T9" } ] }, { "id": "PMC-2065877-24-Caption-Figure_6_E5", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 298, 307 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T10" } ] }, { "id": "PMC-2065877-24-Caption-Figure_6_E6", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 567, 576 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-24-Caption-Figure_6_T14" } ] } ]

[]

[]

[ { "id": "PMC-2065877-00-TIAB__text", "type": "abstract", "text": [ "EBV Latent Membrane Protein 1 Activates Akt, NFkappaB, and Stat3 in B Cell Lymphomas\nLatent membrane protein 1 (LMP1) is the major oncoprotein of Epstein-Barr virus (EBV). In transgenic mice, LMP1 promotes increased lymphoma development by 12 mo of age. This study reveals that lymphoma develops in B-1a lymphocytes, a population that is associated with transformation in older mice. The lymphoma cells have deregulated cell cycle markers, and inhibitors of Akt, NFkappaB, and Stat3 block the enhanced viability of LMP1 transgenic lymphocytes and lymphoma cells in vitro. Lymphoma cells are independent of IL4/Stat6 signaling for survival and proliferation, but have constitutively activated Stat3 signaling. These same targets are also deregulated in wild-type B-1a lymphomas that arise spontaneously through age predisposition. These results suggest that Akt, NFkappaB, and Stat3 pathways may serve as effective targets in the treatment of EBV-associated B cell lymphomas." ], "offsets": [ [ 0, 974 ] ] } ]

[ { "id": "PMC-2065877-00-TIAB_T1", "type": "Protein", "text": [ "Latent Membrane Protein 1" ], "offsets": [ [ 4, 29 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T2", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 40, 43 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T3", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 59, 64 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T4", "type": "Protein", "text": [ "Latent membrane protein 1" ], "offsets": [ [ 85, 110 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T5", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 112, 116 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T6", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 192, 196 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T7", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 458, 461 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T8", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 477, 482 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T9", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 515, 519 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T10", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 606, 609 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T11", "type": "Protein", "text": [ "Stat6" ], "offsets": [ [ 610, 615 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T12", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 692, 697 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T13", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 857, 860 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T14", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 876, 881 ] ], "normalized": [] }, { "id": "PMC-2065877-00-TIAB_T15", "type": "Anaphora", "text": [ "These same targets" ], "offsets": [ [ 709, 727 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-00-TIAB_E1", "type": "Positive_regulation", "trigger": { "text": [ "Activates" ], "offsets": [ [ 30, 39 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T2" }, { "role": "Cause", "ref_id": "PMC-2065877-00-TIAB_T1" } ] }, { "id": "PMC-2065877-00-TIAB_E2", "type": "Positive_regulation", "trigger": { "text": [ "Activates" ], "offsets": [ [ 30, 39 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T3" }, { "role": "Cause", "ref_id": "PMC-2065877-00-TIAB_T1" } ] }, { "id": "PMC-2065877-00-TIAB_E3", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 444, 454 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T7" } ] }, { "id": "PMC-2065877-00-TIAB_E4", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 444, 454 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T8" } ] }, { "id": "PMC-2065877-00-TIAB_E5", "type": "Regulation", "trigger": { "text": [ "deregulated" ], "offsets": [ [ 737, 748 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T10" } ] }, { "id": "PMC-2065877-00-TIAB_E6", "type": "Regulation", "trigger": { "text": [ "deregulated" ], "offsets": [ [ 737, 748 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T11" } ] }, { "id": "PMC-2065877-00-TIAB_E7", "type": "Regulation", "trigger": { "text": [ "deregulated" ], "offsets": [ [ 737, 748 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-00-TIAB_T12" } ] } ]

[]

[ { "id": "PMC-2065877-00-TIAB_R1", "type": "Coreference", "arg1_id": "PMC-2065877-00-TIAB_T15", "arg2_id": "PMC-2065877-00-TIAB_T10", "normalized": [] }, { "id": "PMC-2065877-00-TIAB_R2", "type": "Coreference", "arg1_id": "PMC-2065877-00-TIAB_T15", "arg2_id": "PMC-2065877-00-TIAB_T11", "normalized": [] }, { "id": "PMC-2065877-00-TIAB_R3", "type": "Coreference", "arg1_id": "PMC-2065877-00-TIAB_T15", "arg2_id": "PMC-2065877-00-TIAB_T12", "normalized": [] } ]

[ { "id": "PMC-2791889-05-Results__text", "type": "abstract", "text": [ "IL-10 Production Is Maintained by High TCR Signal Strength and IL-12\nWe next investigated whether repeated strong TCR activation is a compensatory signal for IL-12-induced STAT4 signaling in the induction of IL-10 in Th1 cells. For this, CD4+ T cells were differentiated for 2 consecutive weeks with high antigen doses in the presence or absence of IL-12 throughout (Figures 4A-4D). High antigen dose and IL-12 cooperated to induce maximal IL-10 production (Figures 4A and 4B), given that this combination resulted in the highest numbers of IL-10-producing Th1 cells. Repeated high antigen dose stimulation in the absence of exogenously added IL-12 resulted in the production of IL-10 by Th1 cells, suggesting that repeated strong TCR triggering may overcome the need for IL-12 for IL-10 induction (Figures 4C and 4D). However, IL-10 induction under these conditions was abrogated when IL-12p40-deficient DCs were used as APCs (Figure 4E). Thus, IL-12 is essential during both primary and secondary antigenic stimulation for production of IL-10 by Th1 cells.\nTo determine the requirements for stability of the IL-10-producing Th1 cells, we differentiated CD4+ T cells for 1 week with high antigen doses with or without IL-12 (Figures 4A and 4C), washed them, and then restimulated them for an additional week with a low antigen dose, in the absence or presence of IL-12 (Figure 4F). Th1 cells induced in the first week to produce IL-10 by culture with high antigen doses and IL-12 lost their ability to express IL-10 when recultured with low doses of OVA, which could be compensated for, to some extent, by addition of IL-12 to the secondary cultures (Figure 4F), again suggesting that antigen dose and IL-12 signals cooperate for the induction of IL-10. Finally, DO11.10 CD4+ cells that were exposed to low doses of antigen and IL-12 during the primary differentiation phase produced high amounts of IFN-gamma but little IL-10, but they could be induced to produce IL-10 when both high antigen dose and IL-12 were present during the recall phase (Figure S4). Thus, high antigen dose and IL-12 are required for sustaining the induction of IL-10 production by Th1 cells." ], "offsets": [ [ 0, 2169 ] ] } ]

[ { "id": "PMC-2791889-05-Results_T1", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T2", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 63, 68 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T3", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 158, 163 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T4", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 172, 177 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T5", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 208, 213 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T6", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 238, 241 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T7", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 349, 354 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T8", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 405, 410 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T9", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 440, 445 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T10", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 541, 546 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T11", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 643, 648 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T12", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 679, 684 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T13", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 772, 777 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T14", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 782, 787 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T15", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 828, 833 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T16", "type": "Protein", "text": [ "IL-12p40" ], "offsets": [ [ 886, 894 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T17", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 946, 951 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T18", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1039, 1044 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T19", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1110, 1115 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T20", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1155, 1158 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T21", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1219, 1224 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T22", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1364, 1369 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T23", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1430, 1435 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T24", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1475, 1480 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T25", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1511, 1516 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T26", "type": "Protein", "text": [ "OVA" ], "offsets": [ [ 1551, 1554 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T27", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1619, 1624 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T28", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1703, 1708 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T29", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1748, 1753 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T30", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1772, 1775 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T31", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1829, 1834 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T32", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1901, 1910 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T33", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1922, 1927 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T34", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1966, 1971 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T35", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2004, 2009 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T36", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2088, 2093 ] ], "normalized": [] }, { "id": "PMC-2791889-05-Results_T37", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2139, 2144 ] ], "normalized": [] } ]

[ { "id": "PMC-2791889-05-Results_E1", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 6, 16 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T1" } ] }, { "id": "PMC-2791889-05-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "Maintained" ], "offsets": [ [ 20, 30 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E1" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T2" } ] }, { "id": "PMC-2791889-05-Results_E3", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 195, 204 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T5" } ] }, { "id": "PMC-2791889-05-Results_E4", "type": "Positive_regulation", "trigger": { "text": [ "induce" ], "offsets": [ [ 425, 431 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E5" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T8" } ] }, { "id": "PMC-2791889-05-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 446, 456 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T9" } ] }, { "id": "PMC-2791889-05-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 547, 556 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T10" } ] }, { "id": "PMC-2791889-05-Results_E7", "type": "Positive_regulation", "trigger": { "text": [ "resulted" ], "offsets": [ [ 649, 657 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E8" } ] }, { "id": "PMC-2791889-05-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 665, 675 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T12" } ] }, { "id": "PMC-2791889-05-Results_E9", "type": "Positive_regulation", "trigger": { "text": [ "need" ], "offsets": [ [ 763, 767 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E10" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T13" } ] }, { "id": "PMC-2791889-05-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 788, 797 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T14" } ] }, { "id": "PMC-2791889-05-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 834, 843 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T15" } ] }, { "id": "PMC-2791889-05-Results_E12", "type": "Negative_regulation", "trigger": { "text": [ "abrogated" ], "offsets": [ [ 871, 880 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E11" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_E13" } ] }, { "id": "PMC-2791889-05-Results_E13", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 895, 904 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T16" } ] }, { "id": "PMC-2791889-05-Results_E14", "type": "Positive_regulation", "trigger": { "text": [ "essential" ], "offsets": [ [ 955, 964 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E15" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T17" } ] }, { "id": "PMC-2791889-05-Results_E15", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1025, 1035 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T18" } ] }, { "id": "PMC-2791889-05-Results_E16", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 1116, 1125 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T19" } ] }, { "id": "PMC-2791889-05-Results_E17", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1393, 1400 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E18" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T24" } ] }, { "id": "PMC-2791889-05-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 1422, 1429 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T23" } ] }, { "id": "PMC-2791889-05-Results_E19", "type": "Negative_regulation", "trigger": { "text": [ "lost" ], "offsets": [ [ 1481, 1485 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E20" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T26" } ] }, { "id": "PMC-2791889-05-Results_E20", "type": "Gene_expression", "trigger": { "text": [ "express" ], "offsets": [ [ 1503, 1510 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T25" } ] }, { "id": "PMC-2791889-05-Results_E21", "type": "Negative_regulation", "trigger": { "text": [ "compensated" ], "offsets": [ [ 1571, 1582 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E19" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T27" } ] }, { "id": "PMC-2791889-05-Results_E22", "type": "Positive_regulation", "trigger": { "text": [ "addition" ], "offsets": [ [ 1607, 1615 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T27" } ] }, { "id": "PMC-2791889-05-Results_E23", "type": "Positive_regulation", "trigger": { "text": [ "cooperate" ], "offsets": [ [ 1717, 1726 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E24" } ] }, { "id": "PMC-2791889-05-Results_E24", "type": "Gene_expression", "trigger": { "text": [ "induction" ], "offsets": [ [ 1735, 1744 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T29" } ] }, { "id": "PMC-2791889-05-Results_E25", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1876, 1884 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T32" } ] }, { "id": "PMC-2791889-05-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1876, 1884 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T33" } ] }, { "id": "PMC-2791889-05-Results_E27", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1947, 1954 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E28" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T35" } ] }, { "id": "PMC-2791889-05-Results_E28", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 1958, 1965 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T34" } ] }, { "id": "PMC-2791889-05-Results_E29", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 2126, 2135 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_E30" }, { "role": "Cause", "ref_id": "PMC-2791889-05-Results_T36" } ] }, { "id": "PMC-2791889-05-Results_E30", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 2145, 2155 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-05-Results_T37" } ] } ]

[]

[]

[ { "id": "PMC-2626671-17-Caption-Figure_1__text", "type": "abstract", "text": [ "Kinetics of gene expression during CD8+ T cell differentiation. (A) Kinetics of Prf1, Gzmb, Tbx21 (T-bet), and Eomes mRNA expression in differentiating P14 CD8+ T cells analyzed by Northern blotting. RNA from day 7 Th1 cells was used as a control. Sizes of mRNA transcripts are indicated. (B) Quantification of relative mRNA amounts by phosphorimager analysis. (C) Kinetics of protein expression in differentiating P14 CD8+ T cells analyzed by immunoblotting. Sizes of protein bands are indicated. (D) Relative protein amounts quantified from the Western blots. (E) Intracellular staining for granzyme B, IFN-gamma, and TNF. Granzyme B staining was specific relative to an isotype control (not depicted). Cells were restimulated with PMA and ionomycin for 4 h. (F) FACS-based assay to measure cytolytic activity of P14 CD8+ T cells against EL4 targets loaded with 0 (-) or 1 (+) muM Gp33 peptide (effector-to-target ratio = 5:1). Percentage of Annexin V+ (apoptotic) target cells in the CD8-negative EL4 target population (dot plots) was determined (histograms). Cytolytic activity was blocked by incubation with 2 mM EGTA (not depicted), confirming involvement of the granule exocytosis (perforin-granzyme B) pathway. Data are representative of at least five (A-E) or three (F) independent experiments." ], "offsets": [ [ 0, 1303 ] ] } ]

[ { "id": "PMC-2626671-17-Caption-Figure_1_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 35, 38 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T2", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 80, 84 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T3", "type": "Protein", "text": [ "Gzmb" ], "offsets": [ [ 86, 90 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T4", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 92, 97 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T5", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 99, 104 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T6", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 111, 116 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T7", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 156, 159 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T8", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 419, 422 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T9", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 593, 603 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T10", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 605, 614 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T11", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 620, 623 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T12", "type": "Protein", "text": [ "Granzyme B" ], "offsets": [ [ 625, 635 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T13", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 819, 822 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T14", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 944, 953 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T15", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 987, 990 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T16", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 1189, 1197 ] ], "normalized": [] }, { "id": "PMC-2626671-17-Caption-Figure_1_T17", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 1198, 1208 ] ], "normalized": [] } ]

[ { "id": "PMC-2626671-17-Caption-Figure_1_E1", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 117, 132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T2" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E2", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 117, 132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T3" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E3", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 117, 132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T4" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E4", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 117, 132 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T6" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E5", "type": "Gene_expression", "trigger": { "text": [ "staining" ], "offsets": [ [ 580, 588 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T9" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E6", "type": "Gene_expression", "trigger": { "text": [ "staining" ], "offsets": [ [ 580, 588 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T10" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E7", "type": "Gene_expression", "trigger": { "text": [ "staining" ], "offsets": [ [ 580, 588 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T11" } ] }, { "id": "PMC-2626671-17-Caption-Figure_1_E8", "type": "Gene_expression", "trigger": { "text": [ "staining" ], "offsets": [ [ 636, 644 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-17-Caption-Figure_1_T12" } ] } ]

[ { "id": "PMC-2626671-17-Caption-Figure_1_1", "entity_ids": [ "PMC-2626671-17-Caption-Figure_1_T4", "PMC-2626671-17-Caption-Figure_1_T5" ] } ]

[]

[ { "id": "PMC-3148254-10-Materials_and_Methods__text", "type": "abstract", "text": [ "Retroviral transduction\nA retroviral vector (pMIP) was used for the stable transduction of cells with HOIP and IKKgamma cDNA constructs. pMIP was constructed by replacing the IRES and GFP encoding sequences in pMIG [31] with the IRES and puromycin resistance gene from pIRESpuro2 (Clontech). FLAG-tagged mouse HOIP cDNA was inserted into the multiple cloning site of pMIP. A pMIP construct encoding mouse IKKgamma with an amino terminal birch profilin peptide (BP)-tag was also prepared. Retroviral particles were generated by transient transfection of 293T cells with pMIP, pMIP-HOIP, or pMIP-IKKgamma and the packaging vector pCL-Eco [32]. Two days after transfection, culture supernatants were harvested and filtered. A20.2J or HOIP-deficient cells were added to 24-well plates (2.5x105 cells/well) with 1 ml virus-containing supernatant and 8 microg/ml polybrene. Plates were centrifuged at 500 x g for 2 hrs at room temperature. Cells were cultured in B cell culture medium for 48 hrs, after which the transduced cells were selected in 3 microg/ml puromycin." ], "offsets": [ [ 0, 1063 ] ] } ]

[ { "id": "PMC-3148254-10-Materials_and_Methods_T1", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 102, 106 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T2", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 111, 119 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T3", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 310, 314 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T4", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 405, 413 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T5", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 580, 584 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T6", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 594, 602 ] ], "normalized": [] }, { "id": "PMC-3148254-10-Materials_and_Methods_T7", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 731, 735 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-10-Materials_and_Methods_E1", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 736, 745 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-10-Materials_and_Methods_T7" } ] } ]

[]

[]

[ { "id": "PMC-2664230-05-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "SDS-PAGE and Immunoblotting (I-kappaBalpha, NF-kappaB p65, and CREB)\nFollowing stimulation, PBMCs were washed with ice-cold PBS and centrifuged to collect a cell pellet. The pellet was resuspended in ice-cold SDS sample buffer supplemented with 100 mM dithiothreitol. Cytoplasmic and nuclear extracts were isolated with NE-PER nuclear and cytoplasmic extraction reagents with 1x Halt Protease Inhibitor Cocktail according to the manufacturer's instructions. Protein concentrations were determined with the BCA protein reagent kit for each sample according to a standardized curve for albumin. Cell lysates were collected by boiling the samples in a 100degreesC water bath for 5 minutes. Ten mug of protein per sample was separated by SDS-polyacrylamide gel electrophoresis through 8-16% tris-glycine polyacrylamide gradient gels and transferred to nitrocellulose membranes. The membranes were blocked with 5% milk in Tris-buffered saline/Tween 20 (Fischer Scientific, Pittsburgh, PA) for 1 hour. Cytoplasmic extracts were incubated with phosphorylated I-kappaBalpha antibody (1:200), while nuclear extracts were incubated with either phosphorylated NF-kappaB p65 antibody (1:500) or phosphorylated CREB antibody (1:500) overnight at 4degreesC in separate experiments. The membranes were washed with Tris-buffered saline/Tween 20 and incubated for 1 hour at room temperature with the secondary antibody, horseradish peroxidase-linked anti-rabbit IgG diluted 1:2000 in blocking solution. After repeated washing of the membrane, the Supersignal West Pico Chemiluminescent Kit was applied for antibody detection per the manufacturer's instructions.\nWestern blot data is presented as a percentage of LPS stimulation. The percentage of LPS stimulation was calculated by dividing the mean band pixel total for each treatment arm divided by the mean pixel total of samples stimulated with LPS and multiplying by 100. Thus, LPS stimulation is reported as 100% and each of the treatment arms is reported as a percent of LPS stimulation." ], "offsets": [ [ 0, 2026 ] ] } ]

[ { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 29, 42 ] ], "normalized": [] }, { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 54, 57 ] ], "normalized": [] }, { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_T3", "type": "Protein", "text": [ "CREB" ], "offsets": [ [ 63, 67 ] ], "normalized": [] }, { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_T4", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 1052, 1065 ] ], "normalized": [] }, { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_T5", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1159, 1162 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_E1", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1037, 1051 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-05-MATERIALS_AND_METHODS_T4" } ] }, { "id": "PMC-2664230-05-MATERIALS_AND_METHODS_E2", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1134, 1148 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-05-MATERIALS_AND_METHODS_T5" } ] } ]

[]

[]

[ { "id": "PMC-3245220-19-Materials_and_Methods__text", "type": "abstract", "text": [ "Annexin V/PI Apoptosis Assay\nCell apoptosis assay was performed as described previously [51] using the Annexin V-FITC apoptosis detection kit (BD PharMingen, San Diego, CA). Briefly, human monocytes (5x106) were incubated with inhibitors for 30 minutes in X-vivo medium and restimulated with 100 ng/ml M-CSF overnight. The cells were removed from the culture dish using Accutase (eBioscience, San Diego, CA) and stained with Annexin V-FITC and PI and analyzed by flow cytometry (FACSCalibur; BD PharMingen). Annexin V-FITC and PI double negative cells were considered non-apoptotic cells for statistical analysis." ], "offsets": [ [ 0, 613 ] ] } ]

[ { "id": "PMC-3245220-19-Materials_and_Methods_T1", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 0, 9 ] ], "normalized": [] }, { "id": "PMC-3245220-19-Materials_and_Methods_T2", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 103, 112 ] ], "normalized": [] }, { "id": "PMC-3245220-19-Materials_and_Methods_T3", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 425, 434 ] ], "normalized": [] }, { "id": "PMC-3245220-19-Materials_and_Methods_T4", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 508, 517 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-20-Caption-Figure_2__text", "type": "abstract", "text": [ "LMP1 Promotes B-1a Lymphomas That Can Escape Allelic Exclusion\n(A) Flow cytometry analysis of splenocytes from a WT or LMP1 transgenic lymphoma for the pan-B cell (CD19), B-1a cell (CD5), and Ig heavy chain (IgM and IgD) and light chain (kappa and lambda) markers. Shown are the results from WT lymphoma 1 and LMP1 transgenic lymphoma 4. This analysis was repeated on four other LMP1 transgenic lymphomas (1, 2, 3, and 6) showing a similar B-1a phenotype, of which lymphomas 2 and 4 were also doubly positive for kappa and lambda light chains.\n(B) Flow cytometry analysis of WT or LMP1 transgenic splenocytes for B-1a (CD19+CD5+) and B-1b or B2 subsets (CD19+CD5-). Percentages of B-1a and B-1b or B2 subsets are shown in each quadrant. This analysis was repeated on three other WT and two other LMP1 transgenic mice with similar results.\n(C) Immunoblot analysis for kappa and lambda light chains of B cells (CD19+) purified from WT and LMP1 transgenic mice. Actin was used as a loading control." ], "offsets": [ [ 0, 995 ] ] } ]

[ { "id": "PMC-2065877-20-Caption-Figure_2_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T2", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 119, 123 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T3", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 164, 168 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T4", "type": "Protein", "text": [ "CD5" ], "offsets": [ [ 182, 185 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T5", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 310, 314 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T6", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 379, 383 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T7", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 581, 585 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T8", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 619, 623 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T9", "type": "Protein", "text": [ "CD5" ], "offsets": [ [ 624, 627 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T10", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 654, 658 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T11", "type": "Protein", "text": [ "CD5" ], "offsets": [ [ 659, 662 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T12", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 796, 800 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T13", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 909, 913 ] ], "normalized": [] }, { "id": "PMC-2065877-20-Caption-Figure_2_T14", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 937, 941 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-1447668-17-Materials_and_Methods__text", "type": "abstract", "text": [ "Western blot analysis.\nHEK 293T cells were plated at a density of 5 x 105 cells/well in six-well culture plates (BD Biosciences) 1 d prior to transfection with the appropriate plasmid DNA (2 mug total) using FuGene 6 transfection reagent (Roche). Cells were harvested 24 h posttransfection for whole-cell lysates in RIPA buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1% Igepal (NP-40), 0.5% sodium deoxycholate, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, and 1x Complete Mini Protease Inhibitor [Roche]). Protein concentration was determined by Lowry assay (Bio-Rad, Hercules, California, United States) and colorimetric reactions were read using a VersaMax microplate reader (Molecular Devices, Sunnyvale, California, United States) at an absorbance of 750 nm. Size fractionation was performed on 20 mug of protein/sample by SDS-PAGE, and the protein was transferred to nitrocellulose or PVDF membranes and subjected to immunoblotting using the indicated antibodies. Foxp3 was detected using rabbit anti-human Foxp3 polyclonal antibody (ab4728 or ab10563; Abcam, Cambridge, United Kingdom) and anti-rabbit IgG-HRP secondary antibody (Cell Signaling Technology, Beverly, Massachusetts, United States). NF-kappaB p65 and CREB-1 were detected using rabbit anti-human polyclonal (p65) or monoclonal antibody (CREB-1; 48H2) (Cell Signaling Technology). Beta-actin was detected using a mouse monoclonal antibody (AC-15; Sigma, St. Louis, Missouri, United States). For coimmunoprecipitation analysis, cell lysates were precleared with 30 mul of protein A/G plus-agarose beads (Santa Cruz Biotechnology, Santa Cruz, California, United States) and then incubated with mouse monoclonal anti-HA antibody (6E2; 1:100; Cell Signaling Technology) and 30 mul of protein A/G plus-agarose beads overnight. The immunoprecipitates were washed four times with RIPA buffer, resuspended in SDS sample buffer, and heated at 95 degreesC for 5 min. Proteins were then treated as described for Western blot analysis." ], "offsets": [ [ 0, 1980 ] ] } ]

[ { "id": "PMC-1447668-17-Materials_and_Methods_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 957, 962 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1000, 1005 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1201, 1204 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T4", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 1209, 1215 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T5", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1266, 1269 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T6", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 1295, 1301 ] ], "normalized": [] }, { "id": "PMC-1447668-17-Materials_and_Methods_T7", "type": "Protein", "text": [ "Beta-actin" ], "offsets": [ [ 1338, 1348 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-1310901-11-RESULTS__text", "type": "abstract", "text": [ "Methylation-sensitive enzymes do not cut specific sites in the IRF-4 promoter in hematopoietic cells\nTo further investigate promoter methylation as a regulatory mechanism of IRF-4 gene expression, restriction-PCR-assays were performed (20,24), where only methylated DNA would not be cut enabling subsequent PCR amplification and vice versa. Genomic DNA from leukemic cells Jurkat, CML-T1, U-937, K-562, EM-2 and BV-173 was digested with the methylation-sensitive enzymes HpaII, Bsh1236I and HaeII-isochizomer Bsp143II. EcoRI, which has no recognition site within the IRF-4 promoter, and the methylation-resistant enzyme MspI served as controls. Two separate amplification reactions were performed, generating two fragments, F1 and F2 (Figure 3A). After digestion with HpaII and Bsp143II a sufficient PCR amplification of F1 and F2 was detected in DNA from IRF-4-negative Jurkat, CML-T1, U-937, K-562 and EM-2 cells, suggesting a promoter methylation (and restriction protection) at the respective recognition sites (Figure 3B and C). Notably, in IRF-4-positive SD-1 cells digestion with the methylation-sensitive enzymes completely inhibited amplification of F1 and F2. In IRF-4-positive BV-173 cells a HpaII, but not a Bsh1236I digestion, significantly reduced the amplifiable DNA message of F2 (Figure 3C), whereas amplification of F1 was not affected (Figure 3B). This implied that IRF-4 transcription in SD-1 and BV-173 cells is associated with less promoter methylation (in BV-173 especially at HpaII sites) as compared with the tested IRF-4-negative cells." ], "offsets": [ [ 0, 1562 ] ] } ]

[ { "id": "PMC-1310901-11-RESULTS_T1", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 63, 68 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T2", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 174, 179 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T3", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 567, 572 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T4", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 856, 861 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T5", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1046, 1051 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T6", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1173, 1178 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T7", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1385, 1390 ] ], "normalized": [] }, { "id": "PMC-1310901-11-RESULTS_T8", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1541, 1546 ] ], "normalized": [] } ]

[ { "id": "PMC-1310901-11-RESULTS_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 185, 195 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T2" } ] }, { "id": "PMC-1310901-11-RESULTS_E2", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 862, 870 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T4" } ] }, { "id": "PMC-1310901-11-RESULTS_E3", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 1052, 1060 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T5" } ] }, { "id": "PMC-1310901-11-RESULTS_E4", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 1179, 1187 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T6" } ] }, { "id": "PMC-1310901-11-RESULTS_E5", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 1391, 1404 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T7" } ] }, { "id": "PMC-1310901-11-RESULTS_E6", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 1547, 1555 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-11-RESULTS_T8" } ] } ]

[]

[]

[ { "id": "PMC-2889865-03-Results__text", "type": "abstract", "text": [ "Induction of inflammatory responses\nThe ability of PMA and HK E. coli to induce an inflammatory response in Jurkat T-cells was evaluated using a multiplex cytokine assay following 24 h stimulation. The cytokine profile revealed an enhanced induction of the pro-inflammatory cytokines IL-2, IL-6, TNF and the chemokine CXCL8. The levels of the anti-inflammatory cytokine IL-10 were unaffected by PMA but were significantly decreased by HK E. coli (Table 1). These results confirmed that PMA and HK E. coli induced an inflammatory response in the Jurkat T-cells. It is interesting to note that PMA was 120-fold more effective at inducing CXCL8 than HK E. coli. PMA-dependent induction of AP-1 and down-regulation of NF-kappaB suggests an involvement of AP-1 in CXCL8 regulation. Determination of the time course of cytokine induction in response to PMA showed that CXCL8 was already released between 2-6 h, while TNF and IL-6 were released between 6-24 h (figure 3). These results indicated that the cytokines were differentially regulated and that the release was not associated with the early transient induction of NF-kappaB. The temporal induction of AP-1 correlated to the CXCL8 levels and preceded the TNF and IL-6 release. This suggests an association between CXCL8 release and AP-1 signalling." ], "offsets": [ [ 0, 1299 ] ] } ]

[ { "id": "PMC-2889865-03-Results_T1", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 284, 288 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T2", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 290, 294 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T3", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 318, 323 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T4", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 370, 375 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T5", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 636, 641 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T6", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 759, 764 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T7", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 863, 868 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T8", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 919, 923 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T9", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 1176, 1181 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T10", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 1214, 1218 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T11", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 1265, 1270 ] ], "normalized": [] }, { "id": "PMC-2889865-03-Results_T12", "type": "Anaphora", "text": [ "the cytokines" ], "offsets": [ [ 994, 1007 ] ], "normalized": [] } ]

[ { "id": "PMC-2889865-03-Results_E1", "type": "Positive_regulation", "trigger": { "text": [ "enhanced" ], "offsets": [ [ 231, 239 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_E2" } ] }, { "id": "PMC-2889865-03-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 240, 249 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T3" } ] }, { "id": "PMC-2889865-03-Results_E3", "type": "Regulation", "trigger": { "text": [ "unaffected" ], "offsets": [ [ 381, 391 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T4" } ] }, { "id": "PMC-2889865-03-Results_E4", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 422, 431 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T4" } ] }, { "id": "PMC-2889865-03-Results_E5", "type": "Positive_regulation", "trigger": { "text": [ "effective" ], "offsets": [ [ 614, 623 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_E6" } ] }, { "id": "PMC-2889865-03-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "inducing" ], "offsets": [ [ 627, 635 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T5" } ] }, { "id": "PMC-2889865-03-Results_E7", "type": "Regulation", "trigger": { "text": [ "involvement" ], "offsets": [ [ 736, 747 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_E8" } ] }, { "id": "PMC-2889865-03-Results_E8", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 765, 775 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T6" } ] }, { "id": "PMC-2889865-03-Results_E9", "type": "Localization", "trigger": { "text": [ "released" ], "offsets": [ [ 881, 889 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T7" } ] }, { "id": "PMC-2889865-03-Results_E10", "type": "Localization", "trigger": { "text": [ "released" ], "offsets": [ [ 929, 937 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T8" } ] }, { "id": "PMC-2889865-03-Results_E11", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1028, 1037 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T7" } ] }, { "id": "PMC-2889865-03-Results_E12", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1028, 1037 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T8" } ] }, { "id": "PMC-2889865-03-Results_E13", "type": "Localization", "trigger": { "text": [ "release" ], "offsets": [ [ 1219, 1226 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T10" } ] }, { "id": "PMC-2889865-03-Results_E14", "type": "Localization", "trigger": { "text": [ "release" ], "offsets": [ [ 1271, 1278 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-03-Results_T11" } ] } ]

[]

[ { "id": "PMC-2889865-03-Results_R1", "type": "Coreference", "arg1_id": "PMC-2889865-03-Results_T12", "arg2_id": "PMC-2889865-03-Results_T7", "normalized": [] }, { "id": "PMC-2889865-03-Results_R2", "type": "Coreference", "arg1_id": "PMC-2889865-03-Results_T12", "arg2_id": "PMC-2889865-03-Results_T8", "normalized": [] } ]

[ { "id": "PMC-2065877-18-Materials_and_Methods__text", "type": "abstract", "text": [ "Antibodies.\nFITC-conjugated goat anti-mouse IgM, rat IgG2akappa anti-mouse IgD (clone 11-26), rat IgG1kappa anti-mouse kappa (clone 187.1), rat IgG2bkappa anti-mouse lambda (clone JC5-1); PE-conjugated goat anti-mouse IgG; un-conjugated goat anti-mouse kappa and anti-mouse lambda were purchased from Southern Biotech. APC-conjugated rat IgG2akappa anti-mouse CD19 (clone 6D5), PE-conjugated mouse IgG2akappa anti-LMP1 (clone S12), un-conjugated mouse IgG2a anti-Rb (clone 2), and anti-Cdk2 (clone 55) were purchased from BD Bioscience. PE-conjugated rat IgG2akappa anti-mouse CD5 (clone 53-7.3) was purchased from eBioscience. Rat anti-LMP1 (clones 8G3, 1G6, 7E10, and 7G8) was purchased from Ascenion. Rabbit anti-pAkt (Ser473), anti-pGSK3alpha/beta (Ser21/9), anti-pStat3 (Tyr705), anti-pStat6 (Tyr641), anti-pmTOR (Ser2448), anti-Stat6, anti-Akt, anti-FoxO1, and anti-p27 were purchased from Cell Signaling. Rabbit anti-Stat3 (H-190), anti-IkappaBalpha (C-21), and goat anti-beta actin (I-19) were purchased from Santa Cruz Biotechnology. Mouse IgG1kappa anti-GSK3 was purchased from Upstate Biotechnology. Rabbit anti-pRb (Thr373) was purchased from EMD Biosciences." ], "offsets": [ [ 0, 1171 ] ] } ]

[ { "id": "PMC-2065877-18-Materials_and_Methods_T1", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 360, 364 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T2", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 414, 418 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T3", "type": "Protein", "text": [ "Rb" ], "offsets": [ [ 463, 465 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T4", "type": "Protein", "text": [ "Cdk2" ], "offsets": [ [ 486, 490 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T5", "type": "Protein", "text": [ "CD5" ], "offsets": [ [ 577, 580 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T6", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 637, 641 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T7", "type": "Protein", "text": [ "pAkt" ], "offsets": [ [ 716, 720 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T8", "type": "Protein", "text": [ "pGSK3alpha" ], "offsets": [ [ 736, 746 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T9", "type": "Protein", "text": [ "beta" ], "offsets": [ [ 747, 751 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T10", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 768, 774 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T11", "type": "Protein", "text": [ "pStat6" ], "offsets": [ [ 790, 796 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T12", "type": "Protein", "text": [ "pmTOR" ], "offsets": [ [ 812, 817 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T13", "type": "Protein", "text": [ "Stat6" ], "offsets": [ [ 834, 839 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T14", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 846, 849 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T15", "type": "Protein", "text": [ "FoxO1" ], "offsets": [ [ 856, 861 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T16", "type": "Protein", "text": [ "p27" ], "offsets": [ [ 872, 875 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T17", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 924, 929 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T18", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 944, 956 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T19", "type": "Protein", "text": [ "beta actin" ], "offsets": [ [ 979, 989 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T20", "type": "Protein", "text": [ "GSK3" ], "offsets": [ [ 1064, 1068 ] ], "normalized": [] }, { "id": "PMC-2065877-18-Materials_and_Methods_T21", "type": "Protein", "text": [ "pRb" ], "offsets": [ [ 1123, 1126 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2889865-17-Caption-Figure_1__text", "type": "abstract", "text": [ "AP-1 activation following long-term exposure of Jurkat T-cells to PMA. Jurkat T-cells were transfected with luciferase reporter plasmids containing the AP-1 cis-elements. (A) Time-dependent AP-1 activation in response to PMA. (B) HK E. coli does not activate AP-1. (C) Dose-dependent activation of AP-1 were performed using PMA alone (grey bars) and in combination with calcium ionophore (CaI 955 muM, black bars). (D) TCR-/- deficient cells responded to PMA (162 nM) by up-regulating AP-1 activity. Statistical significance from the control was determined using Student's t-test. (n = 4). Controls were arbitrarily set to 1." ], "offsets": [ [ 0, 625 ] ] } ]

[ { "id": "PMC-2889865-17-Caption-Figure_1_T1", "type": "Protein", "text": [ "luciferase" ], "offsets": [ [ 108, 118 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-1310901-00-TIAB__text", "type": "abstract", "text": [ "Down-regulation of interferon regulatory factor 4 gene expression in leukemic cells due to hypermethylation of CpG motifs in the promoter region\nAlthough the bcr-abl translocation has been shown to be the causative genetic aberration in chronic myeloid leukemia (CML), there is mounting evidence that the deregulation of other genes, such as the transcription factor interferon regulatory factor 4 (IRF-4), is also implicated in the pathogenesis of CML. Promoter methylation of CpG target sites or direct deletions/insertions of genes are mechanisms of a reversible or permanent silencing of gene expression, respectively. Therefore, we investigated whether IRF-4 promoter methylation or mutation may be involved in the regulation of IRF-4 expression in leukemia cells. Whereas promoter mutations or structural rearrangements could be excluded as a cause of altered IRF-4 expression in hematopoietic cells, the IRF-4 promoter methylation status was found to significantly influence IRF-4 transcription. First, treatment of IRF-4-negative lymphoid, myeloid and monocytic cell lines with the methylation-inhibitor 5-aza-2-deoxycytidine resulted in a time- and concentration-dependent increase of IRF-4 mRNA and protein levels. Second, using a restriction-PCR-assay and bisulfite-sequencing we identified specifically methylated CpG sites in IRF-4-negative but not in IRF-4-positive cells. Third, we clearly determined promoter methylation as a mechanism for IRF-4 down-regulation via reporter gene assays, but did not detect an association of methylational status and mRNA expression of DNA methyltransferases or methyl-CpG-binding proteins. Together, these data suggest CpG site-specific IRF-4 promoter methylation as a putative mechanism of down-regulated IRF-4 expression in leukemia." ], "offsets": [ [ 0, 1785 ] ] } ]

[ { "id": "PMC-1310901-00-TIAB_T1", "type": "Protein", "text": [ "interferon regulatory factor 4" ], "offsets": [ [ 19, 49 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T2", "type": "Protein", "text": [ "bcr" ], "offsets": [ [ 158, 161 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T3", "type": "Protein", "text": [ "abl" ], "offsets": [ [ 162, 165 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T4", "type": "Protein", "text": [ "interferon regulatory factor 4" ], "offsets": [ [ 367, 397 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T5", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 399, 404 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T6", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 658, 663 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T7", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 734, 739 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T8", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 866, 871 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T9", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 911, 916 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T10", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 982, 987 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T11", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1023, 1028 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T12", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1194, 1199 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T13", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1339, 1344 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T14", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1365, 1370 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T15", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1456, 1461 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T16", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1687, 1692 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T17", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1756, 1761 ] ], "normalized": [] }, { "id": "PMC-1310901-00-TIAB_T18", "type": "Anaphora", "text": [ "other genes" ], "offsets": [ [ 321, 332 ] ], "normalized": [] } ]

[ { "id": "PMC-1310901-00-TIAB_E1", "type": "Negative_regulation", "trigger": { "text": [ "Down-regulation" ], "offsets": [ [ 0, 15 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E2" } ] }, { "id": "PMC-1310901-00-TIAB_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 55, 65 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T1" } ] }, { "id": "PMC-1310901-00-TIAB_E3", "type": "Regulation", "trigger": { "text": [ "deregulation" ], "offsets": [ [ 305, 317 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T4" } ] }, { "id": "PMC-1310901-00-TIAB_E4", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 720, 730 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E5" } ] }, { "id": "PMC-1310901-00-TIAB_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 740, 750 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T7" } ] }, { "id": "PMC-1310901-00-TIAB_E6", "type": "Regulation", "trigger": { "text": [ "altered" ], "offsets": [ [ 858, 865 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E7" } ] }, { "id": "PMC-1310901-00-TIAB_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 872, 882 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T8" } ] }, { "id": "PMC-1310901-00-TIAB_E8", "type": "Regulation", "trigger": { "text": [ "influence" ], "offsets": [ [ 972, 981 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E9" } ] }, { "id": "PMC-1310901-00-TIAB_E9", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 988, 1001 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T10" } ] }, { "id": "PMC-1310901-00-TIAB_E10", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 1029, 1037 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T11" } ] }, { "id": "PMC-1310901-00-TIAB_E11", "type": "Positive_regulation", "trigger": { "text": [ "resulted" ], "offsets": [ [ 1134, 1142 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E12" } ] }, { "id": "PMC-1310901-00-TIAB_E12", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 1182, 1190 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T12" } ] }, { "id": "PMC-1310901-00-TIAB_E13", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 1345, 1353 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T13" } ] }, { "id": "PMC-1310901-00-TIAB_E14", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 1371, 1379 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T14" } ] }, { "id": "PMC-1310901-00-TIAB_E15", "type": "Negative_regulation", "trigger": { "text": [ "down-regulation" ], "offsets": [ [ 1462, 1477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T15" } ] }, { "id": "PMC-1310901-00-TIAB_E16", "type": "Negative_regulation", "trigger": { "text": [ "down-regulated" ], "offsets": [ [ 1741, 1755 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_E17" } ] }, { "id": "PMC-1310901-00-TIAB_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1762, 1772 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-00-TIAB_T17" } ] } ]

[ { "id": "PMC-1310901-00-TIAB_1", "entity_ids": [ "PMC-1310901-00-TIAB_T4", "PMC-1310901-00-TIAB_T5" ] } ]

[ { "id": "PMC-1310901-00-TIAB_R1", "type": "Coreference", "arg1_id": "PMC-1310901-00-TIAB_T18", "arg2_id": "PMC-1310901-00-TIAB_T4", "normalized": [] } ]

[ { "id": "PMC-2065877-27-Caption-Table_1__text", "type": "abstract", "text": [ "Summary of Analysis Performed on Wild-Type and LMP1 Transgenic Lymphomas" ], "offsets": [ [ 0, 72 ] ] } ]

[ { "id": "PMC-2065877-27-Caption-Table_1_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 47, 51 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-27-Caption-Table_1_E1", "type": "Gene_expression", "trigger": { "text": [ "Transgenic" ], "offsets": [ [ 52, 62 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-27-Caption-Table_1_T1" } ] } ]

[]

[]

[ { "id": "PMC-3245220-15-Materials_and_Methods__text", "type": "abstract", "text": [ "Electrophoresis of the Mobility Shift Analysis (EMSA)\nNuclear extracts were isolated from MDMs by using a nuclear extraction kit according to the manufacturer's instruction from Active Motif (Carlsbad, CA). Briefly, MDMs were lysed in hypotonic lysis buffer (20 mM Hepes, pH 7.5; 5 mM NaF, 10 microM Na2MoO4 0.5% NP-40 and 0.1 mM EDTA), and then nuclei were resuspended in lysis buffer supplemented with 0.5 mM DTT and 0.2 mM PMSF. The NF-kappaB consensus oligonucleotides (sense: AGTTGAGGGGACTTTCCCAGGC; antisense: GCCTGGGAAAGTCCCCTCAACT) labeled with 32P by T4 polynucleokinase (Promega, Madison, WI) were incubated with nuclear extracts in binding buffer (10 mM Tris pH 7.6, 1 mM DTT, 0.5 mM EDTA, 2 microg polydI-dC and 10% Glycerol) at 30degreesC for 30 minutes. The free DNA and DNA-protein mixtures were resolved in 5% native polyacrylamide gels in 0.5x TBE buffer (45 mM Tris, 45 mM boric acid and 1 mM EDTA, pH 8.3) by electrophoresis. The gel was dried and subjected to autoradiography analysis." ], "offsets": [ [ 0, 1005 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-3148254-02-Results__text", "type": "abstract", "text": [ "Generation of HOIP-deficient B cells via targeted disruption of Rnf31, the gene encoding HOIP\nIn our previous study, we demonstrated that HOIP is recruited to the CD40 signaling complex in two mouse B cell lines [6]. Similar results were obtained with mouse splenocytes, indicating that the interaction of CD40 with HOIP is not limited to transformed B cell lines (unpublished observations). We also found that the recruitment of HOIP to CD40 was TRAF2-dependent and that overexpression of a truncated HOIP mutant partially inhibited CD40-mediated NF-kappaB activation. These results support the hypothesis that HOIP plays a role in CD40 signal transduction. To further define the role and evaluate the importance of HOIP in CD40 signaling, we used somatic cell gene targeting to disrupt the gene encoding HOIP in the mouse B cell line A20.2J. This cell line has been particularly useful in the characterization of CD40 signaling mechanisms due to the relative ease with which its genome can be modified by homologous recombination [7], [8], [9]. We used a targeting vector capable of undergoing homologous recombination with Rnf31 (the gene encoding HOIP) to disrupt the coding sequence of the gene in exon 5 (Fig. 1A). Following introduction of the vector, the neomycin-resistant clones that arose were screened by PCR amplification of genomic DNA to identify cells containing a disrupted Rnf31 allele. To remove the selectable marker gene cassette from the disrupted Rnf31 allele, recombinant cell lines were transiently transfected with a plasmid that encodes Cre recombinase. This step allowed us to perform a second round of targeting and drug selection, generating cells in which both copies of Rnf31 were disrupted. Two independent clonal cell lines were chosen for further analysis. HOIP protein expression was undetectable in both cell lines, as determined by Western blot analysis of cell lysates (Fig. 1B), demonstrating that the targeting process was successful. In the text that follows, the two gene-targeted cell lines are referred to as HOIP-deficient cells.\nTo enable us to confirm that any signaling or functional defects observed in HOIP-deficient cells were due to disruption of the Rnf31 gene, both HOIP-deficient cell lines were transduced with a retrovirus encoding FLAG-tagged wild-type HOIP, thus restoring HOIP protein expression (Fig. 1B). These cells are referred to as HOIP-reconstituted cells. In the experiments that follow, responses by these cells were compared to those of A20.2J cells and HOIP-deficient cells transduced with a retroviral vector (pMIP) lacking a cDNA insert (empty vector)." ], "offsets": [ [ 0, 2626 ] ] } ]

[ { "id": "PMC-3148254-02-Results_T1", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 14, 18 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T2", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 64, 69 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T3", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 89, 93 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T4", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 138, 142 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T5", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 306, 310 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T6", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 316, 320 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T7", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 430, 434 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T8", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 438, 442 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T9", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 447, 452 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T10", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 502, 506 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T11", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 534, 538 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T12", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 612, 616 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T13", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 633, 637 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T14", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 717, 721 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T15", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 725, 729 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T16", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 806, 810 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T17", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 915, 919 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T18", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1126, 1131 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T19", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1151, 1155 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T20", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1391, 1396 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T21", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1470, 1475 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T22", "type": "Protein", "text": [ "Cre recombinase" ], "offsets": [ [ 1564, 1579 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T23", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 1702, 1707 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T24", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1792, 1796 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T25", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2054, 2058 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T26", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2153, 2157 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T27", "type": "Protein", "text": [ "Rnf31" ], "offsets": [ [ 2204, 2209 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T28", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2221, 2225 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T29", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2312, 2316 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T30", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2333, 2337 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T31", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2399, 2403 ] ], "normalized": [] }, { "id": "PMC-3148254-02-Results_T32", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2525, 2529 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-02-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 19, 28 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T1" } ] }, { "id": "PMC-3148254-02-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "disruption" ], "offsets": [ [ 50, 60 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T2" } ] }, { "id": "PMC-3148254-02-Results_E3", "type": "Binding", "trigger": { "text": [ "recruited" ], "offsets": [ [ 146, 155 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T4" } ] }, { "id": "PMC-3148254-02-Results_E4", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 291, 302 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T5" }, { "role": "Theme2", "ref_id": "PMC-3148254-02-Results_T6" } ] }, { "id": "PMC-3148254-02-Results_E5", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 415, 426 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T7" }, { "role": "Theme2", "ref_id": "PMC-3148254-02-Results_T8" } ] }, { "id": "PMC-3148254-02-Results_E6", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 453, 462 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_E5" }, { "role": "Cause", "ref_id": "PMC-3148254-02-Results_T9" } ] }, { "id": "PMC-3148254-02-Results_E7", "type": "Negative_regulation", "trigger": { "text": [ "disrupt" ], "offsets": [ [ 780, 787 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T16" } ] }, { "id": "PMC-3148254-02-Results_E8", "type": "Negative_regulation", "trigger": { "text": [ "disrupted" ], "offsets": [ [ 1381, 1390 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T20" } ] }, { "id": "PMC-3148254-02-Results_E9", "type": "Negative_regulation", "trigger": { "text": [ "disrupted" ], "offsets": [ [ 1460, 1469 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T21" } ] }, { "id": "PMC-3148254-02-Results_E10", "type": "Negative_regulation", "trigger": { "text": [ "disrupted" ], "offsets": [ [ 1713, 1722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T23" } ] }, { "id": "PMC-3148254-02-Results_E11", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1805, 1815 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T24" } ] }, { "id": "PMC-3148254-02-Results_E12", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2059, 2068 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T25" } ] }, { "id": "PMC-3148254-02-Results_E13", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2158, 2167 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T26" } ] }, { "id": "PMC-3148254-02-Results_E14", "type": "Negative_regulation", "trigger": { "text": [ "disruption" ], "offsets": [ [ 2186, 2196 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T27" } ] }, { "id": "PMC-3148254-02-Results_E15", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2226, 2235 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T28" } ] }, { "id": "PMC-3148254-02-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "restoring" ], "offsets": [ [ 2323, 2332 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_E17" } ] }, { "id": "PMC-3148254-02-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2346, 2356 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T30" } ] }, { "id": "PMC-3148254-02-Results_E18", "type": "Positive_regulation", "trigger": { "text": [ "reconstituted" ], "offsets": [ [ 2404, 2417 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T31" } ] }, { "id": "PMC-3148254-02-Results_E19", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2530, 2539 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-02-Results_T32" } ] } ]

[ { "id": "PMC-3148254-02-Results_1", "entity_ids": [ "PMC-3148254-02-Results_T2", "PMC-3148254-02-Results_T3" ] }, { "id": "PMC-3148254-02-Results_2", "entity_ids": [ "PMC-3148254-02-Results_T18", "PMC-3148254-02-Results_T19" ] } ]

[]

[ { "id": "PMC-3279418-15-Materials_and_Methods__text", "type": "abstract", "text": [ "In vitro cytokine secretion by BMDC\nThe BMDC were cultured in triplicate wells of 24-well or 96-well plates at 106 or 105 cells/mL, respectively, in RPMI-1640 complete medium. The cells were washed and stimulated with 100 ng/mL LPS or 25 microg/mL poly I:C. After 24 hours, supernatants were harvested for ELISA analysis. The presence of nitrite in the supernatants was determined using the Griess reagent." ], "offsets": [ [ 0, 406 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2065877-26-Caption-Figure_8__text", "type": "abstract", "text": [ "Analysis of Akt, NFkappaB, and Stat3 Pathways in Contribution to the Growth and Survival of Lymphoma Cells\n(A-D) Immunoblot analysis of wild-type and LMP1 transgenic lymphomas for Akt, NFkappaB, and Stat3 signaling after treatment with (A) an Akt inhibitor, triciribine, (B) an NFkappaB inhibitor, BAY11-7085, and the Stat3 inhibitors (C) cucurbitacin I and (D) AG490, at the indicated concentrations. Arrows indicate the positions of alpha and beta isoforms of Stat3. Actin was used as a loading control." ], "offsets": [ [ 0, 505 ] ] } ]

[ { "id": "PMC-2065877-26-Caption-Figure_8_T1", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 12, 15 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T2", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 31, 36 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T3", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 150, 154 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T4", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 180, 183 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T5", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 199, 204 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T6", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 243, 246 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T7", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 318, 323 ] ], "normalized": [] }, { "id": "PMC-2065877-26-Caption-Figure_8_T8", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 462, 467 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-26-Caption-Figure_8_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 247, 256 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-26-Caption-Figure_8_T6" } ] }, { "id": "PMC-2065877-26-Caption-Figure_8_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 324, 334 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-26-Caption-Figure_8_T7" } ] } ]

[]

[]

[ { "id": "PMC-1447668-13-Materials_and_Methods__text", "type": "abstract", "text": [ "Isolation of primary human CD4+ T cells.\nCD4+ T cells were isolated from cryopreserved healthy donor PBMCs by negative selection with the CD4+ T Cell Isolation Kit II (Miltenyi Biotech, Bergisch Gladbach, Germany) according to manufacturer's guidelines. Purity of negatively selected CD4+ T cells was consistently higher than 96% as determined by flow cytometry." ], "offsets": [ [ 0, 362 ] ] } ]

[ { "id": "PMC-1447668-13-Materials_and_Methods_T1", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 27, 30 ] ], "normalized": [] }, { "id": "PMC-1447668-13-Materials_and_Methods_T2", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 41, 44 ] ], "normalized": [] }, { "id": "PMC-1447668-13-Materials_and_Methods_T3", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 138, 141 ] ], "normalized": [] }, { "id": "PMC-1447668-13-Materials_and_Methods_T4", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 284, 287 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2664230-13-DISCUSSION__text", "type": "abstract", "text": [ "The exposure of inflammatory cells to a variety of extracellular stimuli results in the initiation of transcriptional and posttranscriptional events, which culminate in the production of pro-inflammatory mediators.11-14 TNF-alpha is released very early following shock and is considered an important mediator of the inflammatory cascade, since it regulates the synthesis of several other critical cytokines and chemokines.15 A clear relationship between increased TNF-alpha synthesis and the development of shock and multiple organ dysfunction has been observed in animal models of sepsis.15-17\nBecause of its importance in orchestrating multiple steps of the inflammatory response, strategies aimed at decreasing TNF-alpha levels or attenuating its production seem attractive. PDE inhibitors have been shown to downregulate TNF-alpha production in distinct human cell populations. We have previously shown that, in general, TNF-alpha levels continue to increase after LPS exposure and that concomitant infusion of phosphodiesterase inhibitors can markedly decrease TNF-alpha levels.18-19 In this in vitro study, we verified the sustained attenuation of LPS-induced TNF-alpha expression over time in an isolated human mononuclear cell population.\nThe mechanisms by which PTX, a non-specific phosphodiesterase inhibitor, significantly and consistently decreases TNF-alpha production have not been completely elucidated. It has been postulated that drugs that increase intracellular cAMP exert their anti-inflammatory effects through the activation of PKA. This classic pathway has been challenged as the sole mechanism involved in the modulation of inflammation by cAMP-enhancing drugs, and alternative mechanisms involving PKA-independent pathways have been proposed.6-8 In this series of experiments, we observed a significant attenuation of TNF-alpha production in LPS-stimulated human mononuclear cells following PTX administration, independent of PKA activation.\nWe used a nonspecific phosphodiesterase inhibitor, PTX, in the present study because it has been used clinically in the treatment of a variety of conditions in which inflammation is an important component of the pathophysiology of the disease process.19 Additionally, the use of PTX in sepsis as an adjunct to other treatments to maintain adequate organ function has been explored based upon its effects on TNF-alpha synthesis. However, the reported beneficial effects of PTX are not only related to the downregulation of TNF-alphabut also to PTX's hemorrheologic properties, its ability to reduce neutrophil activation, and its beneficial effects on microcirculation, cardiac performance, and organ injury.20-25 Herein, we demonstrated that the downregulatory effects of PTX in human mononuclear cells involves modulation of pathways that involve NF-kappaB and CREB, two major transcription factors involved in the inflammatory cascade.\nNF-kappaB/Rel constitutes a family of transcriptional factors involved in the regulation of numerous cytokine genes and immune responses in different cell populations. The most abundant form of NF-kappaB is the p50-p65 heterodimer.26 The inactive form of NF-kappaB exists in the cytoplasm bound to an inhibitory complex containing I-kappaBalpha. Following cellular stimulation with LPS and chemotactic factors, NF-kappaB inducible kinase phosphorylates and activates the I-kappaB kinase (IKK) complex consisting of IKK-1 and IKK-2, which in turn phosphorylates the I-kappaBalpha subunit. Phosphorylation, ubiquitination, and subsequent degradation of I-kappaBalpha results in NF-kappaB nuclear translocation. This allows the transcription factor to bind to promoter regions of specific pro-inflammatory genes and influence transcription.27,28 Because a number of potential kappaB sites are present in the nucleotide sequences of the TNF-alpha gene, NF-kappaB is considered to be a critical transcriptional factor involved in TNF-alpha gene expression and protein synthesis.29,30\nIn this set of experiments, we demonstrated that PTX downregulates cytoplasmic I-kappaBalpha phosphorylation, nuclear NF-kappaB p65 phosphorylation/translocation, as well as NF-kappaB DNA-binding after LPS stimulation, suggesting that PTX exerts its function proximal to or at the level of I-kappaBalpha phosphorylation.\nPrevious studies that have evaluated the effects of cAMP-elevating drugs on I-kappaBalpha and NF-kappaB have reported conflicting results. Haddad et al. reported results similar to ours with respect to the effects of PTX on I-kappaBalpha and NF-kappaB in pulmonary epithelial cells.31 Conversely, Neumann et al. proposed that increased intracellular cAMP stabilizes the interaction between I-kappaBalpha and NF-kappaB, therefore reducing NF-kappaB activation.32 In contrast, Takahashi et al. showed no difference in I-kappaBalpha degradation in Jurkat T-lymphocytes in the presence and absence of forskolin, an alternative cAMP inducing compound. This group also demonstrated that forskolin did not inhibit the DNA-binding activity of NF-kappaB and that CREB was not involved in forskolin-induced decrease in p65 transcriptional activity.33 Similar results were reported by Ollivier et al. using THP-1 cells and endothelial cells treated with forskolin or dibutyryl cAMP, two agents known to function through cAMP elevation and subsequent PKA activation.9 The differences between our results and those mentioned above may be explained by the use of different cell types and exogenous stimulants. It is also possible that PTX exerts its anti-inflammatory effects on the NF-kappaB pathway independent of PKA, as suggested by the continued attenuation of LPS-induced TNF-alpha production by PTX in the presence or absence of PKA inhibition observed in this study. This hypothesis is currently under investigation in our laboratory. Furthermore, we utilized a broad PKA inhibitor in this study in addition to H89, but did not examine the effect of specific inhibition of various PKA isoforms. This information may yield more insight into the mechanism by which PTX exerts its down-regulatory effects.\nPDE inhibitors may also downregulate NF-kappaB transcriptional activity by altering the competitive binding of CREB and NF-kappaB to the promoter regions of pro-inflammatory genes. Herein, we showed that the activation and DNA binding activity of CREB is upregulated in a dose-dependent manner by PTX. Of note, the increase in CREB activity was slightly alleviated by the addition of LPS, suggesting competition between PTX-induced CREB-associated gene transcription and those factors, such as NF-kappaB, which may be upregulated by LPS exposure. This competition has been postulated to involve the recruitment of the co-activator CBP and its homologue p30034, suggesting an alternative mechanism that may be involved in the anti-inflammatory actions of PTX. Future studies are planned to delineate the validity of this potential mechanism.\nThe effects of PTX on other transcription factors, such as AP-1, c-fos, and c-jun, cannot be ruled out by our experiments. Activation of AP-1 and its components (c-fos and c-jun) by agents that enhance mononuclear cell activity has been implicated in TNF-alpha expression. Moreover, AP-1 and CREB recognize a similar DNA binding sequence in the promoter region of the TNF-alpha gene35. Given these relationships, it is conceivable that PTX may exert some of its anti-inflammatory actions by affecting AP-1 activation and favoring CREB binding, thus inhibiting TNF-alpha gene transcription. Additional studies are necessary to elucidate the complex interactions between CREB, NF-kappaB, and AP-1 following LPS exposure and PDE inhibition. Furthermore, the effect of PTX on the cGMP pathway after LPS stimulation has not been explored, although we plan to do so in the future.\nIn summary, we have demonstrated that PDE inhibition of human mononuclear cells downregulates TNF-alpha production, at least in part, through a PKA-independent mechanism. In addition, PTX attenuates the activity of NF-B while upregulating CREB activation after LPS stimulation, which may result in modulation of pro-inflammatory mediator synthesis. Therefore, PTX may serve as a potential adjunct therapeutic for the treatment of conditions in which TNF-alpha production plays a significant role." ], "offsets": [ [ 0, 8314 ] ] } ]

[ { "id": "PMC-2664230-13-DISCUSSION_T1", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 220, 229 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T2", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 464, 473 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T3", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 714, 723 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T4", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 825, 834 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T5", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 925, 934 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T6", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1066, 1075 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T7", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1166, 1175 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T8", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1361, 1370 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T9", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1843, 1852 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T10", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 2374, 2383 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T11", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 2489, 2498 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T12", "type": "Protein", "text": [ "p50" ], "offsets": [ [ 3116, 3119 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T13", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3120, 3123 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T14", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 3236, 3249 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T15", "type": "Protein", "text": [ "IKK-1" ], "offsets": [ [ 3420, 3425 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T16", "type": "Protein", "text": [ "IKK-2" ], "offsets": [ [ 3430, 3435 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T17", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 3470, 3483 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T18", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 3556, 3569 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T19", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 3838, 3847 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T20", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 3930, 3939 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T51", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4063, 4076 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T52", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 4112, 4115 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T53", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4274, 4287 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T54", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4381, 4394 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T55", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4529, 4542 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T56", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4695, 4708 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T57", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 4821, 4834 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T58", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 5114, 5117 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T59", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 5669, 5678 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T60", "type": "Protein", "text": [ "CBP" ], "offsets": [ [ 6733, 6736 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T61", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 6755, 6759 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T62", "type": "Protein", "text": [ "c-fos" ], "offsets": [ [ 7008, 7013 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T63", "type": "Protein", "text": [ "c-jun" ], "offsets": [ [ 7019, 7024 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T64", "type": "Protein", "text": [ "c-fos" ], "offsets": [ [ 7105, 7110 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T65", "type": "Protein", "text": [ "c-jun" ], "offsets": [ [ 7115, 7120 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T66", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 7194, 7203 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T67", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 7311, 7320 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T68", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 7503, 7512 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T69", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 7912, 7921 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T70", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 8268, 8277 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T21", "type": "Anaphora", "text": [ "its" ], "offsets": [ [ 746, 749 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T71", "type": "Anaphora", "text": [ "its components" ], "offsets": [ [ 7089, 7103 ] ], "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_T92", "type": "Entity", "text": [ "DNA binding sequence" ], "offsets": [ [ 7260, 7280 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-13-DISCUSSION_E1", "type": "Localization", "trigger": { "text": [ "released" ], "offsets": [ [ 233, 241 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T1" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E2", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 253, 262 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E1" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E3", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 454, 463 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E4" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E4", "type": "Gene_expression", "trigger": { "text": [ "synthesis" ], "offsets": [ [ 474, 483 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T2" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E5", "type": "Negative_regulation", "trigger": { "text": [ "decreasing" ], "offsets": [ [ 703, 713 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T3" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E6", "type": "Negative_regulation", "trigger": { "text": [ "attenuating" ], "offsets": [ [ 734, 745 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E7" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E7", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 750, 760 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T3" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E8", "type": "Negative_regulation", "trigger": { "text": [ "downregulate" ], "offsets": [ [ 812, 824 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E9" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E9", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 835, 845 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T4" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E10", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 954, 962 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T5" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E11", "type": "Negative_regulation", "trigger": { "text": [ "decrease" ], "offsets": [ [ 1057, 1065 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T6" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E12", "type": "Negative_regulation", "trigger": { "text": [ "attenuation" ], "offsets": [ [ 1139, 1150 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E13" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E13", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1158, 1165 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E14" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E14", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1176, 1186 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T7" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E15", "type": "Negative_regulation", "trigger": { "text": [ "decreases" ], "offsets": [ [ 1351, 1360 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E16" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E16", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1371, 1381 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T8" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E17", "type": "Negative_regulation", "trigger": { "text": [ "attenuation" ], "offsets": [ [ 1828, 1839 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E18" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E18", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1853, 1863 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T9" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E19", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 1906, 1915 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E17" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E20", "type": "Regulation", "trigger": { "text": [ "independent" ], "offsets": [ [ 1936, 1947 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E17" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E21", "type": "Regulation", "trigger": { "text": [ "effects" ], "offsets": [ [ 2363, 2370 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E22" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E22", "type": "Gene_expression", "trigger": { "text": [ "synthesis" ], "offsets": [ [ 2384, 2393 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T10" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E23", "type": "Negative_regulation", "trigger": { "text": [ "downregulation" ], "offsets": [ [ 2471, 2485 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T11" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E24", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylates" ], "offsets": [ [ 3451, 3465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T17" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E25", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylation" ], "offsets": [ [ 3493, 3508 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T18" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E26", "type": "Ubiquitination", "trigger": { "text": [ "ubiquitination" ], "offsets": [ [ 3510, 3524 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T18" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E27", "type": "Protein_catabolism", "trigger": { "text": [ "degradation" ], "offsets": [ [ 3541, 3552 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T18" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E28", "type": "Regulation", "trigger": { "text": [ "involved" ], "offsets": [ [ 3918, 3926 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E29" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E29", "type": "Gene_expression", "trigger": { "text": [ "gene expression" ], "offsets": [ [ 3940, 3955 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T20" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E30", "type": "Negative_regulation", "trigger": { "text": [ "downregulates" ], "offsets": [ [ 4037, 4050 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E31" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E31", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 4077, 4092 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T51" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E32", "type": "Negative_regulation", "trigger": { "text": [ "downregulates" ], "offsets": [ [ 4037, 4050 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E33" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E33", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 4116, 4131 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T52" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E34", "type": "Negative_regulation", "trigger": { "text": [ "downregulates" ], "offsets": [ [ 4037, 4050 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E35" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E35", "type": "Localization", "trigger": { "text": [ "translocation" ], "offsets": [ [ 4132, 4145 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T52" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E36", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 4288, 4303 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T53" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E37", "type": "Regulation", "trigger": { "text": [ "effects" ], "offsets": [ [ 4346, 4353 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T54" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E38", "type": "Regulation", "trigger": { "text": [ "effects" ], "offsets": [ [ 4511, 4518 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T55" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E39", "type": "Regulation", "trigger": { "text": [ "stabilizes" ], "offsets": [ [ 4660, 4670 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E40" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E40", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 4675, 4686 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T56" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E41", "type": "Protein_catabolism", "trigger": { "text": [ "degradation" ], "offsets": [ [ 4835, 4846 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T57" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E42", "type": "Regulation", "trigger": { "text": [ "presence" ], "offsets": [ [ 4878, 4886 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E41" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E43", "type": "Regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 4891, 4898 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E41" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E44", "type": "Negative_regulation", "trigger": { "text": [ "attenuation" ], "offsets": [ [ 5642, 5653 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E45" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E45", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 5661, 5668 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E46" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E46", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 5679, 5689 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T59" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E47", "type": "Regulation", "trigger": { "text": [ "presence or absence" ], "offsets": [ [ 5704, 5723 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E44" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E48", "type": "Positive_regulation", "trigger": { "text": [ "Activation" ], "offsets": [ [ 7066, 7076 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T64" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E49", "type": "Positive_regulation", "trigger": { "text": [ "Activation" ], "offsets": [ [ 7066, 7076 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T65" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E50", "type": "Regulation", "trigger": { "text": [ "implicated" ], "offsets": [ [ 7180, 7190 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E51" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E51", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 7204, 7214 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T66" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E52", "type": "Binding", "trigger": { "text": [ "recognize" ], "offsets": [ [ 7240, 7249 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T67" }, { "role": "Site", "ref_id": "PMC-2664230-13-DISCUSSION_T92" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E53", "type": "Negative_regulation", "trigger": { "text": [ "inhibiting" ], "offsets": [ [ 7492, 7502 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E54" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E54", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 7518, 7531 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T68" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E55", "type": "Negative_regulation", "trigger": { "text": [ "downregulates" ], "offsets": [ [ 7898, 7911 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E56" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E56", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 7922, 7932 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T69" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E57", "type": "Regulation", "trigger": { "text": [ "independent" ], "offsets": [ [ 7966, 7977 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_E55" } ] }, { "id": "PMC-2664230-13-DISCUSSION_E58", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 8278, 8288 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-13-DISCUSSION_T70" } ] } ]

[]

[ { "id": "PMC-2664230-13-DISCUSSION_R1", "type": "Coreference", "arg1_id": "PMC-2664230-13-DISCUSSION_T21", "arg2_id": "PMC-2664230-13-DISCUSSION_T3", "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_R2", "type": "Coreference", "arg1_id": "PMC-2664230-13-DISCUSSION_T71", "arg2_id": "PMC-2664230-13-DISCUSSION_T64", "normalized": [] }, { "id": "PMC-2664230-13-DISCUSSION_R3", "type": "Coreference", "arg1_id": "PMC-2664230-13-DISCUSSION_T71", "arg2_id": "PMC-2664230-13-DISCUSSION_T65", "normalized": [] } ]

[ { "id": "PMC-2889865-01-Background__text", "type": "abstract", "text": [ "Cytokines and chemokines are important in immune cell recruitment and in regulation of inflammatory responses [1]. T-cells produce a broad range of inflammatory mediators, including IL-2, IL-6, TNF and CXCL8, all of which are important in cell proliferation, differentiation, communication and initiation of inflammatory responses [2]. Elevated levels of pro-inflammatory cytokines and chemokines, such as TNF, IL-6 and CXCL8, are associated with several human diseases including cystic fibrosis [3-5], pulmonary fibrosis [6,7] and AIDS [8,9]. Induction of CXCL8 has been suggested to be mediated through NF-kappaB in cooperation with AP-1 [10,11], however the precise mechanism is not fully elucidated, and treatment strategies aimed at inhibiting CXCL8 have failed [12]. Persistent production of IL-6 and CXCL8 leads to chronic inflammation and enhanced survival of lymphocytes increasing serum cytokine/chemokine levels. This forms the basis of several autoimmune disorders including plasmacytosis and hyperplasia [13]. To develop viable CXCL8 based treatment strategies, it is necessary to identify the signalling pathways regulating CXCL8 and determine how this is coupled to NF-kappaB, AP-1 and IL-6.\nThe signalling pathways leading to NF-kappaB and AP-1 activation are overlapping, where both are involved in the induction and regulation of cytokines/chemokines. NF-kappaB is activated in response to stress, such as oxidative stress, bacterial toxins, viruses and UV light [14], and is essential for differentiation, proliferation and survival of many cell types including T-lymphocytes [15]. AP-1 activation requires Fos (c-Fos, FosB, Fra-1, Fra-2) and Jun (c-Jun, v-Jun, JunB, JunD) through the formation of homo- and hetero-dimers [16,17], and regulates transcription of a broad range of genes involved in immune responses [18-21]. Both AP-1 and NF-kappaB binding sites have been identified in the promoter region of IL-6 and CXCL8 [12,22], however, the mechanism by which these interleukins are regulated in T-cells is still not clear. CXCL8 is a C-X-C chemokine with properties enabling it to recruit T-cells and basophils and to activate neutrophils and monocytes [23]. IL-6 is a cytokine that possesses both pro- and anti-inflammatory characteristics and that plays a key role in haematopoiesis and acute-phase responses [24,25].\nThe present study suggests that the regulation of CXCL8 and IL-6 is uncoupled. Using Jurkat T-cells exposed to PMA and heat killed (HK) Escherichia coli MG1655 in combination with inhibitors of NF-kappaB, JNK and PKC, we demonstrated that NF-kappaB regulates IL-6 expression while the regulation of CXCL8 more closely correlated to AP-1 activity. These results indicate that inhibition of NF-kappaB is not an effective strategy in countering the high CXCL8 activities in diseases such as cystic fibrosis, AIDS and pulmonary fibrosis." ], "offsets": [ [ 0, 2878 ] ] } ]

[ { "id": "PMC-2889865-01-Background_T1", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 182, 186 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T2", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 188, 192 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T3", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 202, 207 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T4", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 411, 415 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T5", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 420, 425 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T6", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 557, 562 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T7", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 749, 754 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T8", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 798, 802 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T9", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 807, 812 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T10", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 1041, 1046 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T11", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 1138, 1143 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T12", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 1201, 1205 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T13", "type": "Protein", "text": [ "c-Fos" ], "offsets": [ [ 1631, 1636 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T14", "type": "Protein", "text": [ "FosB" ], "offsets": [ [ 1638, 1642 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T15", "type": "Protein", "text": [ "Fra-1" ], "offsets": [ [ 1644, 1649 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T16", "type": "Protein", "text": [ "Fra-2" ], "offsets": [ [ 1651, 1656 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T17", "type": "Protein", "text": [ "c-Jun" ], "offsets": [ [ 1667, 1672 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T18", "type": "Protein", "text": [ "v-Jun" ], "offsets": [ [ 1674, 1679 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T19", "type": "Protein", "text": [ "JunB" ], "offsets": [ [ 1681, 1685 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T20", "type": "Protein", "text": [ "JunD" ], "offsets": [ [ 1687, 1691 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T21", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 1928, 1932 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T22", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 1937, 1942 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T23", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 2048, 2053 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T24", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 2184, 2188 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T25", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 2395, 2400 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T26", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 2405, 2409 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T27", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 2604, 2608 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T28", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 2644, 2649 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T29", "type": "Protein", "text": [ "AP-1" ], "offsets": [ [ 2677, 2681 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T30", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 2796, 2801 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T31", "type": "Anaphora", "text": [ "inflammatory mediators" ], "offsets": [ [ 148, 170 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T32", "type": "Anaphora", "text": [ "Fos" ], "offsets": [ [ 1626, 1629 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T33", "type": "Anaphora", "text": [ "Jun" ], "offsets": [ [ 1662, 1665 ] ], "normalized": [] }, { "id": "PMC-2889865-01-Background_T34", "type": "Anaphora", "text": [ "these interleukins" ], "offsets": [ [ 1984, 2002 ] ], "normalized": [] } ]

[ { "id": "PMC-2889865-01-Background_E1", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 123, 130 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T1" } ] }, { "id": "PMC-2889865-01-Background_E2", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 123, 130 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T2" } ] }, { "id": "PMC-2889865-01-Background_E3", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 123, 130 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T3" } ] }, { "id": "PMC-2889865-01-Background_E4", "type": "Positive_regulation", "trigger": { "text": [ "Induction" ], "offsets": [ [ 544, 553 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T6" } ] }, { "id": "PMC-2889865-01-Background_E5", "type": "Positive_regulation", "trigger": { "text": [ "mediated" ], "offsets": [ [ 588, 596 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_E4" } ] }, { "id": "PMC-2889865-01-Background_E6", "type": "Negative_regulation", "trigger": { "text": [ "inhibiting" ], "offsets": [ [ 738, 748 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T7" } ] }, { "id": "PMC-2889865-01-Background_E7", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 784, 794 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T8" } ] }, { "id": "PMC-2889865-01-Background_E8", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 784, 794 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T9" } ] }, { "id": "PMC-2889865-01-Background_E9", "type": "Regulation", "trigger": { "text": [ "regulating" ], "offsets": [ [ 1127, 1137 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T11" } ] }, { "id": "PMC-2889865-01-Background_E10", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T13" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T17" } ] }, { "id": "PMC-2889865-01-Background_E11", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T13" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T18" } ] }, { "id": "PMC-2889865-01-Background_E12", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T13" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T19" } ] }, { "id": "PMC-2889865-01-Background_E13", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T13" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T20" } ] }, { "id": "PMC-2889865-01-Background_E14", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T14" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T17" } ] }, { "id": "PMC-2889865-01-Background_E15", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T14" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T18" } ] }, { "id": "PMC-2889865-01-Background_E16", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T14" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T19" } ] }, { "id": "PMC-2889865-01-Background_E17", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T14" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T20" } ] }, { "id": "PMC-2889865-01-Background_E18", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T15" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T17" } ] }, { "id": "PMC-2889865-01-Background_E19", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T15" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T18" } ] }, { "id": "PMC-2889865-01-Background_E20", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T15" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T19" } ] }, { "id": "PMC-2889865-01-Background_E21", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T15" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T20" } ] }, { "id": "PMC-2889865-01-Background_E22", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T16" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T17" } ] }, { "id": "PMC-2889865-01-Background_E23", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T16" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T18" } ] }, { "id": "PMC-2889865-01-Background_E24", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T16" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T19" } ] }, { "id": "PMC-2889865-01-Background_E25", "type": "Binding", "trigger": { "text": [ "formation of homo- and hetero-dimers" ], "offsets": [ [ 1705, 1741 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T16" }, { "role": "Theme2", "ref_id": "PMC-2889865-01-Background_T20" } ] }, { "id": "PMC-2889865-01-Background_E26", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 2007, 2016 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T21" } ] }, { "id": "PMC-2889865-01-Background_E27", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 2007, 2016 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T22" } ] }, { "id": "PMC-2889865-01-Background_E28", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 2381, 2391 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T25" } ] }, { "id": "PMC-2889865-01-Background_E29", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 2381, 2391 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T26" } ] }, { "id": "PMC-2889865-01-Background_E30", "type": "Regulation", "trigger": { "text": [ "regulates" ], "offsets": [ [ 2594, 2603 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_E31" } ] }, { "id": "PMC-2889865-01-Background_E31", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2609, 2619 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T27" } ] }, { "id": "PMC-2889865-01-Background_E32", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 2630, 2640 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T28" } ] }, { "id": "PMC-2889865-01-Background_E33", "type": "Negative_regulation", "trigger": { "text": [ "countering" ], "offsets": [ [ 2776, 2786 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-01-Background_T30" } ] } ]

[]

[ { "id": "PMC-2889865-01-Background_R1", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T31", "arg2_id": "PMC-2889865-01-Background_T1", "normalized": [] }, { "id": "PMC-2889865-01-Background_R2", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T31", "arg2_id": "PMC-2889865-01-Background_T2", "normalized": [] }, { "id": "PMC-2889865-01-Background_R3", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T31", "arg2_id": "PMC-2889865-01-Background_T3", "normalized": [] }, { "id": "PMC-2889865-01-Background_R4", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T32", "arg2_id": "PMC-2889865-01-Background_T13", "normalized": [] }, { "id": "PMC-2889865-01-Background_R5", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T32", "arg2_id": "PMC-2889865-01-Background_T14", "normalized": [] }, { "id": "PMC-2889865-01-Background_R6", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T32", "arg2_id": "PMC-2889865-01-Background_T15", "normalized": [] }, { "id": "PMC-2889865-01-Background_R7", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T32", "arg2_id": "PMC-2889865-01-Background_T16", "normalized": [] }, { "id": "PMC-2889865-01-Background_R8", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T33", "arg2_id": "PMC-2889865-01-Background_T17", "normalized": [] }, { "id": "PMC-2889865-01-Background_R9", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T33", "arg2_id": "PMC-2889865-01-Background_T18", "normalized": [] }, { "id": "PMC-2889865-01-Background_R10", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T33", "arg2_id": "PMC-2889865-01-Background_T19", "normalized": [] }, { "id": "PMC-2889865-01-Background_R11", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T33", "arg2_id": "PMC-2889865-01-Background_T20", "normalized": [] }, { "id": "PMC-2889865-01-Background_R12", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T34", "arg2_id": "PMC-2889865-01-Background_T21", "normalized": [] }, { "id": "PMC-2889865-01-Background_R13", "type": "Coreference", "arg1_id": "PMC-2889865-01-Background_T34", "arg2_id": "PMC-2889865-01-Background_T22", "normalized": [] } ]

[ { "id": "PMC-3245220-24-Materials_and_Methods__text", "type": "abstract", "text": [ "Ethics Statement\nAll research involving human blood (Buffy coat) were ordered from American Red cross and have been approved by the Ohio State University review board (ARC IRB Protocol #2001-26)." ], "offsets": [ [ 0, 195 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2791889-01-Introduction__text", "type": "abstract", "text": [ "Interleukin-10 (IL-10) is a cytokine with broad anti-inflammatory properties that inhibits macrophage and dendritic cell (DC) function (Moore et al., 2001). IL-10 limits the immune and inflammatory responses to pathogens and gut flora and prevents damage to the host (Moore et al., 2001; O'Garra and Vieira, 2004), but when dysregulated may result in chronic infection (Brooks et al., 2006; Ejrnaes et al., 2006; Moore et al., 2001). IL-10 is expressed by T helper 2 (Th2) cells, B cells, DCs, and macrophages (Moore et al., 2001), and also by Th1 cells (Anderson et al., 2007; Assenmacher et al., 1994; Del Prete et al., 1993; Gerosa et al., 1996; Jankovic et al., 2007; Pohl-Koppe et al., 1998) and (reviewed in O'Garra and Vieira, 2007; Trinchieri, 2007), certain regulatory (Treg) T cells (Moore et al., 2001; O'Garra and Vieira, 2004; Roncarolo et al., 2006), and Th17 cells (Awasthi et al., 2007; Fitzgerald et al., 2007; McGeachy et al., 2007; Stumhofer et al., 2007).\nIn vitro human CD4+ and CD8+ T cell clones, or mouse CD4+ T cells that produce both interferon-gamma (IFN-gamma) and IL-10, can be differentiated by T cell receptor (TCR)-stimulation in the presence of IL-12 (Chang et al., 2007; Gerosa et al., 1996; Jeannin et al., 1996; Meyaard et al., 1996; Windhagen et al., 1996). Furthermore, Th1 cell clones coproducing IFN-gamma and IL-10 have been isolated from bronchoalveolar lavage (BAL) of active pulmonary tuberculosis (TB) patients (Gerosa et al., 1999). IL-10 production by Th1 cells was also reported in animals infected with Toxoplasma gondii (Jankovic et al., 2002; Shaw et al., 2006) or with Leishmania major (Anderson et al., 2007) and shown to be required for regulation of the immune response in these infections (Anderson et al., 2007; Jankovic et al., 2007). The relative amounts of IL-10 and IFN-gamma produced by Th1 cells may influence the balance between clearance and persistent infection with certain pathogens (Moore et al., 2001; Trinchieri, 2007), thus determining whether chronic infection or immunopathology ensues.\nTh1, Th2, and Th17 cell responses differentiate along distinct signaling pathways (Glimcher and Murphy, 2000; Ivanov et al., 2007; Stockinger and Veldhoen, 2007). Th1 cell development requires signal transducer and activator of transcription (STAT)1 activation, induced by type I IFN or IFN-gamma, the transcription factor T-box 21 (T-bet), and IL-12-induced STAT4 signaling, which can couple with IL-18-induced IRAK and NF-kappaB transcription factors to drive the high amounts of IFN-gamma required to eradicate intracellular pathogens (Glimcher and Murphy, 2000). Th2 cell development, with expression of IL-4, IL-5, and IL-13, requires IL-4, STAT6, and the transcription factor GATA binding protein (GATA)-3 (Glimcher and Murphy, 2000). The development of Th17 cells requires IL-6, TGF-beta, and the STAT3-dependent expression of the transcription factor RORgammat (Ivanov et al., 2007; Stockinger and Veldhoen, 2007).\nTh1 and Th2 cell responses can also be induced by varying the dose of antigen presented to the naive T cell by the antigen-presenting cell (APC). Whereas high doses of antigen, with sustained TCR signaling and extracellular-signal regulated (ERK) mitogen-activated protein kinase (MAPK) phosphorylation, result in Th1 cells producing IFN-gamma via an IL-12-independent mechanism, low doses of antigen, with transient ERK1 and ERK2 activation, favor Th2 responses and IL-4 secretion (Constant et al., 1995; Hosken et al., 1995; Jorritsma et al., 2003; Yamane et al., 2005).\nBecause Th1 and Th2 cells cross regulate each other's development and function and can suppress Th17 cell responses, and all differentiate along distinct signaling pathways (Glimcher and Murphy, 2000; Stockinger and Veldhoen, 2007), IL-10 produced by all these Th cells may thus act as a feedback regulator to control the pathology associated with an overexuberant, albeit efficacious, inflammatory response. Whether IL-10 production by these different Th cell subsets is induced by independent and/or common mechanisms is unknown.\nHere, we showed that in vitro differentiation of IL-10-producing Th1 cells from naive CD4+ T cells required IL-12-induced STAT4 signaling, strong TCR activation (high antigen dose), and sustained ERK1 and ERK2 phosphorylation. Furthermore, we showed that activation of ERK1 and ERK2 is a requirement for production of IL-10 by Th1, Th2, and Th17 cell subsets. This common but highly regulated pathway for IL-10 induction and maintenance ensures its function as a feedback loop to control damage to the host and also allows a protective response to ensue as opposed to chronic infection." ], "offsets": [ [ 0, 4675 ] ] } ]

[ { "id": "PMC-2791889-01-Introduction_T1", "type": "Protein", "text": [ "erleukin-10" ], "offsets": [ [ 3, 14 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T2", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 16, 21 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T3", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 157, 162 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T4", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 434, 439 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T5", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 991, 994 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T6", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1000, 1003 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T7", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1029, 1032 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T8", "type": "Protein", "text": [ "interferon-gamma" ], "offsets": [ [ 1060, 1076 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T9", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1078, 1087 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T10", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1093, 1098 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T11", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1178, 1183 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T12", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1336, 1345 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T13", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1350, 1355 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T14", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1479, 1484 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T15", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1817, 1822 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T16", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1827, 1836 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T17", "type": "Protein", "text": [ "signal transducer and activator of transcription (STAT)1" ], "offsets": [ [ 2254, 2311 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T18", "type": "Protein", "text": [ "type I IFN" ], "offsets": [ [ 2334, 2344 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T19", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2348, 2357 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T20", "type": "Protein", "text": [ "T-box 21" ], "offsets": [ [ 2384, 2392 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T21", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 2394, 2399 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T22", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2406, 2411 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T23", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 2420, 2425 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T24", "type": "Protein", "text": [ "IL-18" ], "offsets": [ [ 2459, 2464 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T25", "type": "Protein", "text": [ "IRAK" ], "offsets": [ [ 2473, 2477 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T26", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2543, 2552 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T27", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2669, 2673 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T28", "type": "Protein", "text": [ "IL-5" ], "offsets": [ [ 2675, 2679 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T29", "type": "Protein", "text": [ "IL-13" ], "offsets": [ [ 2685, 2690 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T30", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2701, 2705 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T31", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 2707, 2712 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T32", "type": "Protein", "text": [ "GATA binding protein (GATA)-3" ], "offsets": [ [ 2743, 2772 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T33", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 2841, 2845 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T34", "type": "Protein", "text": [ "TGF-beta" ], "offsets": [ [ 2847, 2855 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T35", "type": "Protein", "text": [ "STAT3" ], "offsets": [ [ 2865, 2870 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T36", "type": "Protein", "text": [ "RORgammat" ], "offsets": [ [ 2920, 2929 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T37", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 3318, 3327 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T38", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 3335, 3340 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T39", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 3401, 3405 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T40", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 3410, 3414 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T41", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 3451, 3455 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T42", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 3790, 3795 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T43", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 3974, 3979 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T44", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 4138, 4143 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T45", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 4175, 4178 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T46", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 4197, 4202 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T47", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 4211, 4216 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T48", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 4285, 4289 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T49", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 4294, 4298 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T50", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 4358, 4362 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T51", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 4367, 4371 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T52", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 4407, 4412 ] ], "normalized": [] }, { "id": "PMC-2791889-01-Introduction_T53", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 4494, 4499 ] ], "normalized": [] } ]

[ { "id": "PMC-2791889-01-Introduction_E1", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 443, 452 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T4" } ] }, { "id": "PMC-2791889-01-Introduction_E2", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 1047, 1054 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T8" } ] }, { "id": "PMC-2791889-01-Introduction_E3", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 1047, 1054 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T10" } ] }, { "id": "PMC-2791889-01-Introduction_E4", "type": "Gene_expression", "trigger": { "text": [ "coproducing" ], "offsets": [ [ 1324, 1335 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T12" } ] }, { "id": "PMC-2791889-01-Introduction_E5", "type": "Gene_expression", "trigger": { "text": [ "coproducing" ], "offsets": [ [ 1324, 1335 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T13" } ] }, { "id": "PMC-2791889-01-Introduction_E6", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1485, 1495 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T14" } ] }, { "id": "PMC-2791889-01-Introduction_E7", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1837, 1845 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T15" } ] }, { "id": "PMC-2791889-01-Introduction_E8", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1837, 1845 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T16" } ] }, { "id": "PMC-2791889-01-Introduction_E9", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2311, 2321 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T17" } ] }, { "id": "PMC-2791889-01-Introduction_E10", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2323, 2330 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E9" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T18" } ] }, { "id": "PMC-2791889-01-Introduction_E11", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2323, 2330 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E9" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T19" } ] }, { "id": "PMC-2791889-01-Introduction_E12", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2465, 2472 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T25" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T24" } ] }, { "id": "PMC-2791889-01-Introduction_E13", "type": "Positive_regulation", "trigger": { "text": [ "drive" ], "offsets": [ [ 2517, 2522 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E14" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_E9" } ] }, { "id": "PMC-2791889-01-Introduction_E14", "type": "Gene_expression", "trigger": { "text": [ "amounts" ], "offsets": [ [ 2532, 2539 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T26" } ] }, { "id": "PMC-2791889-01-Introduction_E15", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2655, 2665 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T27" } ] }, { "id": "PMC-2791889-01-Introduction_E16", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2655, 2665 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T28" } ] }, { "id": "PMC-2791889-01-Introduction_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2655, 2665 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T29" } ] }, { "id": "PMC-2791889-01-Introduction_E18", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T27" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T30" } ] }, { "id": "PMC-2791889-01-Introduction_E19", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T27" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T31" } ] }, { "id": "PMC-2791889-01-Introduction_E20", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T27" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T32" } ] }, { "id": "PMC-2791889-01-Introduction_E21", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T28" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T30" } ] }, { "id": "PMC-2791889-01-Introduction_E22", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T28" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T31" } ] }, { "id": "PMC-2791889-01-Introduction_E23", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T28" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T32" } ] }, { "id": "PMC-2791889-01-Introduction_E24", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T29" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T30" } ] }, { "id": "PMC-2791889-01-Introduction_E25", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T29" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T31" } ] }, { "id": "PMC-2791889-01-Introduction_E26", "type": "Positive_regulation", "trigger": { "text": [ "requires" ], "offsets": [ [ 2692, 2700 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T29" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T32" } ] }, { "id": "PMC-2791889-01-Introduction_E27", "type": "Positive_regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 2871, 2880 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E28" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T35" } ] }, { "id": "PMC-2791889-01-Introduction_E28", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2881, 2891 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T36" } ] }, { "id": "PMC-2791889-01-Introduction_E29", "type": "Positive_regulation", "trigger": { "text": [ "result" ], "offsets": [ [ 3288, 3294 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E30" } ] }, { "id": "PMC-2791889-01-Introduction_E30", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 3308, 3317 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T37" } ] }, { "id": "PMC-2791889-01-Introduction_E31", "type": "Regulation", "trigger": { "text": [ "independent" ], "offsets": [ [ 3341, 3352 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E30" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T38" } ] }, { "id": "PMC-2791889-01-Introduction_E32", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3415, 3425 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T39" } ] }, { "id": "PMC-2791889-01-Introduction_E33", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 3415, 3425 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T40" } ] }, { "id": "PMC-2791889-01-Introduction_E34", "type": "Positive_regulation", "trigger": { "text": [ "favor" ], "offsets": [ [ 3427, 3432 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E35" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_E32" } ] }, { "id": "PMC-2791889-01-Introduction_E35", "type": "Localization", "trigger": { "text": [ "secretion" ], "offsets": [ [ 3456, 3465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T41" } ] }, { "id": "PMC-2791889-01-Introduction_E36", "type": "Positive_regulation", "trigger": { "text": [ "favor" ], "offsets": [ [ 3427, 3432 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E35" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_E33" } ] }, { "id": "PMC-2791889-01-Introduction_E37", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 3796, 3804 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T42" } ] }, { "id": "PMC-2791889-01-Introduction_E38", "type": "Regulation", "trigger": { "text": [ "act as a feedback regulator" ], "offsets": [ [ 3836, 3863 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E37" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_T42" } ] }, { "id": "PMC-2791889-01-Introduction_E39", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 3980, 3990 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T43" } ] }, { "id": "PMC-2791889-01-Introduction_E40", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 4029, 4036 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E39" } ] }, { "id": "PMC-2791889-01-Introduction_E41", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 4144, 4153 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T44" } ] }, { "id": "PMC-2791889-01-Introduction_E42", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 4299, 4314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T48" } ] }, { "id": "PMC-2791889-01-Introduction_E43", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 4299, 4314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T49" } ] }, { "id": "PMC-2791889-01-Introduction_E44", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 4344, 4354 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T50" } ] }, { "id": "PMC-2791889-01-Introduction_E45", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 4344, 4354 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T51" } ] }, { "id": "PMC-2791889-01-Introduction_E46", "type": "Positive_regulation", "trigger": { "text": [ "requirement" ], "offsets": [ [ 4377, 4388 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E47" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_E44" } ] }, { "id": "PMC-2791889-01-Introduction_E47", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 4393, 4403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T52" } ] }, { "id": "PMC-2791889-01-Introduction_E48", "type": "Positive_regulation", "trigger": { "text": [ "requirement" ], "offsets": [ [ 4377, 4388 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_E47" }, { "role": "Cause", "ref_id": "PMC-2791889-01-Introduction_E45" } ] }, { "id": "PMC-2791889-01-Introduction_E49", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 4500, 4509 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-01-Introduction_T53" } ] } ]

[ { "id": "PMC-2791889-01-Introduction_1", "entity_ids": [ "PMC-2791889-01-Introduction_T1", "PMC-2791889-01-Introduction_T2" ] }, { "id": "PMC-2791889-01-Introduction_2", "entity_ids": [ "PMC-2791889-01-Introduction_T8", "PMC-2791889-01-Introduction_T9" ] }, { "id": "PMC-2791889-01-Introduction_3", "entity_ids": [ "PMC-2791889-01-Introduction_T20", "PMC-2791889-01-Introduction_T21" ] } ]

[]

[ { "id": "PMC-2065877-14-Materials_and_Methods__text", "type": "abstract", "text": [ "Flow cytometry.\nOne million splenocytes were stained with the appropriate primary antibody unconjugated or conjugated to FITC, PE, or APC diluted in stain buffer (PBS with 3% FBS). For BrdU detection, the FITC-BrdU flow kit was used as instructed by the manufacturer (BD Bioscience). Briefly, cells were exposed to EMA (Molecular Probes) for exclusion of dead cells, stained for surface antigens, fixed in paraformaldehyde, and permeabilized with saponin. To expose BrdU epitopes, cells were treated with Dnase and stained with FITC-conjugated anti-BrdU antibody. Flow cytometry was performed on FACScalibur using the CellQuest program (Becton Dickinson). Further analysis was conducted on the Summit v4.2 program (Dako)." ], "offsets": [ [ 0, 721 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2065877-02-Results__text", "type": "abstract", "text": [ "High Levels of LMP1 Expression Correlates with the Development of Lymphoma\nLMP1 expression in IgLMP1 mice was directed to B cells under the control of the Ig heavy chain promoter and enhancer. It has previously been shown that in these transgenic mice, LMP1 expression was restricted to B220+ B cells with lymphoma detected in greatly enlarged spleens [23,26]. To investigate whether LMP1 expression contributes to lymphoma development, B cells were purified from splenocytes by positive selection using anti-CD19 MACS magnetic beads, and equivalent amounts of B cells were analyzed by immunoblotting. LMP1 was detectable in LMP1 transgenic B cells, but upon development of lymphoma, LMP1 expression was stronger in 5/7 lymphomas analyzed with concomitant appearance of degradation products (Figure 1A). To determine whether the higher level of LMP1 detected was due to an expansion of malignant lymphocytes, expression of LMP1 in the spleen was further evaluated by immunohistochemical staining. Immunohistochemistry analysis of spleen sections detected LMP1 in the plasma membrane of cells in both the follicular white pulp and circulating lymphocytes in the red pulp (Figure 1B). LMP1 expression was heterogeneous with strong LMP1 staining interspersed amongst a background of cells staining weakly for LMP1. Upon development to lymphoma, LMP1 expression was more abundantly detected with multiple foci of intense LMP1 staining. This demonstrates that the increased LMP1 detected by immunoblotting upon malignant progression reflects an increase in LMP1 expression and an accumulation of cells expressing high levels of LMP1. This correlation between high LMP1 expression and the development of lymphoma suggests that progression to lymphoma results from increased levels of LMP1." ], "offsets": [ [ 0, 1783 ] ] } ]

[ { "id": "PMC-2065877-02-Results_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 15, 19 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T2", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 75, 79 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T3", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 253, 257 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T4", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 384, 388 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T5", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 509, 513 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T6", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 602, 606 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T7", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 625, 629 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T8", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 684, 688 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T9", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 845, 849 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T10", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 923, 927 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T11", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1055, 1059 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T12", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1183, 1187 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T13", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1229, 1233 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T14", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1306, 1310 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T15", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1342, 1346 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T16", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1417, 1421 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T17", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1469, 1473 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T18", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1552, 1556 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T19", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1623, 1627 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T20", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1659, 1663 ] ], "normalized": [] }, { "id": "PMC-2065877-02-Results_T21", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1778, 1782 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-02-Results_E1", "type": "Positive_regulation", "trigger": { "text": [ "High Levels" ], "offsets": [ [ 0, 11 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E2" } ] }, { "id": "PMC-2065877-02-Results_E2", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 20, 30 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T1" } ] }, { "id": "PMC-2065877-02-Results_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 80, 90 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T2" } ] }, { "id": "PMC-2065877-02-Results_E4", "type": "Regulation", "trigger": { "text": [ "under the control" ], "offsets": [ [ 130, 147 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E3" } ] }, { "id": "PMC-2065877-02-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 258, 268 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T3" } ] }, { "id": "PMC-2065877-02-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "restricted" ], "offsets": [ [ 273, 283 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E5" } ] }, { "id": "PMC-2065877-02-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 389, 399 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T4" } ] }, { "id": "PMC-2065877-02-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "detectable" ], "offsets": [ [ 611, 621 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T6" } ] }, { "id": "PMC-2065877-02-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 689, 699 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T8" } ] }, { "id": "PMC-2065877-02-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "stronger" ], "offsets": [ [ 704, 712 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E9" } ] }, { "id": "PMC-2065877-02-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "higher level" ], "offsets": [ [ 829, 841 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T9" } ] }, { "id": "PMC-2065877-02-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 909, 919 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T10" } ] }, { "id": "PMC-2065877-02-Results_E13", "type": "Gene_expression", "trigger": { "text": [ "detected" ], "offsets": [ [ 1046, 1054 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T11" } ] }, { "id": "PMC-2065877-02-Results_E14", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1188, 1198 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T12" } ] }, { "id": "PMC-2065877-02-Results_E15", "type": "Positive_regulation", "trigger": { "text": [ "strong" ], "offsets": [ [ 1222, 1228 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T13" } ] }, { "id": "PMC-2065877-02-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "weakly" ], "offsets": [ [ 1295, 1301 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T14" } ] }, { "id": "PMC-2065877-02-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1347, 1357 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T15" } ] }, { "id": "PMC-2065877-02-Results_E18", "type": "Positive_regulation", "trigger": { "text": [ "abundantly" ], "offsets": [ [ 1367, 1377 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E17" } ] }, { "id": "PMC-2065877-02-Results_E19", "type": "Positive_regulation", "trigger": { "text": [ "intense" ], "offsets": [ [ 1409, 1416 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T16" } ] }, { "id": "PMC-2065877-02-Results_E20", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1459, 1468 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T17" } ] }, { "id": "PMC-2065877-02-Results_E21", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 1540, 1548 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E22" } ] }, { "id": "PMC-2065877-02-Results_E22", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1557, 1567 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T18" } ] }, { "id": "PMC-2065877-02-Results_E23", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 1597, 1607 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T19" } ] }, { "id": "PMC-2065877-02-Results_E24", "type": "Positive_regulation", "trigger": { "text": [ "high levels" ], "offsets": [ [ 1608, 1619 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E23" } ] }, { "id": "PMC-2065877-02-Results_E25", "type": "Positive_regulation", "trigger": { "text": [ "high" ], "offsets": [ [ 1654, 1658 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E26" } ] }, { "id": "PMC-2065877-02-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1664, 1674 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T20" } ] }, { "id": "PMC-2065877-02-Results_E27", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1758, 1767 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_E28" } ] }, { "id": "PMC-2065877-02-Results_E28", "type": "Gene_expression", "trigger": { "text": [ "levels" ], "offsets": [ [ 1768, 1774 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-02-Results_T21" } ] } ]

[]

[]

[ { "id": "PMC-2889865-24-Caption-Table_1__text", "type": "abstract", "text": [ "Jurkat T-cells were stimulated with 162 nM PMA and 5 x 107 CFU/ml HK E. coli for 24 h." ], "offsets": [ [ 0, 86 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-3148254-14-Materials_and_Methods__text", "type": "abstract", "text": [ "Immunoprecipitations\nImmunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above." ], "offsets": [ [ 0, 1229 ] ] } ]

[ { "id": "PMC-3148254-14-Materials_and_Methods_T1", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 44, 48 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-22-Caption-Figure_4__text", "type": "abstract", "text": [ "Wild-Type and LMP1 Transgenic Lymphoma Cells Survive Independently of IL4/Stat6 Signaling in Culture\n(A) Rnase protection assay for IL4 mRNA from purified B cells (CD19+) from WT and LMP1 transgenic splenocytes. The L32 and GAPDH housekeeping genes were used as a loading control. Arrow indicates the position of the protected probe.\n(B and C) Immunoblot analysis of WT and LMP1 transgenic mice for activated pStat6 in (B) purified B cells (CD19+) at the time of harvest or in (C) whole splenocytes cultured with or without IL4. (B) Actin was used as a loading control, and the white line indicates that intervening lanes have been spliced out.\n(D and E) MTS assay of (D) WT lymphocytes and (E) LMP1 transgenic lymphoma cells cultured with IL4, a neutralizing antibody to IL4, or a rat IgG isotype control at the indicated concentrations. Shown are the results from LMP1 transgenic lymphoma 3. The results are the mean +/- SEM of triplicate samples from a single representative experiment that was repeated twice with similar results." ], "offsets": [ [ 0, 1034 ] ] } ]

[ { "id": "PMC-2065877-22-Caption-Figure_4_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 14, 18 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T2", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 70, 73 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T3", "type": "Protein", "text": [ "Stat6" ], "offsets": [ [ 74, 79 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T4", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 132, 135 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T5", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 164, 168 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T6", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 183, 187 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T7", "type": "Protein", "text": [ "L32" ], "offsets": [ [ 216, 219 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T8", "type": "Protein", "text": [ "GAPDH" ], "offsets": [ [ 224, 229 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T9", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 374, 378 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T10", "type": "Protein", "text": [ "pStat6" ], "offsets": [ [ 409, 415 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T11", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 441, 445 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T12", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 524, 527 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T13", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 695, 699 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T14", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 740, 743 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T15", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 772, 775 ] ], "normalized": [] }, { "id": "PMC-2065877-22-Caption-Figure_4_T16", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 866, 870 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-22-Caption-Figure_4_E1", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 399, 408 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-22-Caption-Figure_4_T10" } ] } ]

[]

[]

[ { "id": "PMC-2664230-00-TIAB__text", "type": "abstract", "text": [ "Insights into the Regulation of TNF-alpha Production in Human Mononuclear Cells: The Effects of Non-Specific Phosphodiesterase Inhibition\nOBJECTIVE\nThe objective of this study was to determine the effect of nonspecific phosphodiesterase inhibition on transcription factor activation and tumor necrosis factor-alpha (TNF-alpha) production in lipopolysaccharide (LPS)-stimulated human mononuclear cells.\nINTRODUCTION\nThe production of TNF-alpha following LPS stimulation is one of the key steps in bacterial sepsis and inflammation. The mechanism by which phosphodiesterase inhibition alters TNF-alpha production in the presence of LPS remains unclear.\nMETHODS\nHuman mononuclear cells were stimulated with LPS (1 mug/mL), in the presence and absence of Pentoxifylline (PTX; 20 mM), a nonspecific phosphodiesterase inhibitor. Western blotting of phosphorylated cytoplasmic I-kappaBalpha, nuclear factor-kappaB p65 (NF-kappaB), and nuclear cAMP-response element binding protein (CREB) was performed. DNA binding of NF-kappaB and CREB was verified by electrophoretic mobility shift assay. TNF-alpha levels were determined in the supernatant of stimulated cells in the presence and absence Protein kinase A inhibition by an enzyme-linked immunosorbent assay (ELISA).\nRESULTS\nPTX was demonstrated to significantly reduce cytoplasmic I-kappaBalpha phosphorylation, nuclear p65 phosphorylation, and the DNA binding activity of NF-kappaB. In contrast, PTX markedly enhanced the phosphorylation and DNA binding activity of CREB. Cells concomitantly treated with PTX and LPS secreted similar levels of TNF-alpha in the presence and absence Protein kinase A inhibition.\nDISCUSSION\nThe increased level of cAMP that results from phosphodiesterase inhibition affects cytoplasmic and nuclear events, resulting in the attenuation of NF-kappaB and the activation of CREB transcriptional DNA binding through pathways that are partially Protein kinase A-independent.\nCONCLUSION\nPTX-mediated phosphodiesterase inhibition occurs partially through a Protein kinase A-independent pathway and may serve as a useful tool in the attenuation of LPS-induced inflammation." ], "offsets": [ [ 0, 2141 ] ] } ]

[ { "id": "PMC-2664230-00-TIAB_T1", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 32, 41 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T2", "type": "Protein", "text": [ "tumor necrosis factor-alpha" ], "offsets": [ [ 287, 314 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T3", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 316, 325 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T4", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 433, 442 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T5", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 590, 599 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T6", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 870, 883 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T7", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 907, 910 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T8", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1084, 1093 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T9", "type": "Protein", "text": [ "I-kappaBalpha" ], "offsets": [ [ 1326, 1339 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T10", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1365, 1368 ] ], "normalized": [] }, { "id": "PMC-2664230-00-TIAB_T11", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1590, 1599 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-00-TIAB_E1", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 18, 28 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E2" } ] }, { "id": "PMC-2664230-00-TIAB_E2", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 42, 52 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T1" } ] }, { "id": "PMC-2664230-00-TIAB_E3", "type": "Regulation", "trigger": { "text": [ "effect" ], "offsets": [ [ 197, 203 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E4" } ] }, { "id": "PMC-2664230-00-TIAB_E4", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 327, 337 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T2" } ] }, { "id": "PMC-2664230-00-TIAB_E5", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 419, 429 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T4" } ] }, { "id": "PMC-2664230-00-TIAB_E6", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 443, 452 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E5" } ] }, { "id": "PMC-2664230-00-TIAB_E7", "type": "Regulation", "trigger": { "text": [ "alters" ], "offsets": [ [ 583, 589 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E8" } ] }, { "id": "PMC-2664230-00-TIAB_E8", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 600, 610 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T5" } ] }, { "id": "PMC-2664230-00-TIAB_E9", "type": "Positive_regulation", "trigger": { "text": [ "in the presence of" ], "offsets": [ [ 611, 629 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E7" } ] }, { "id": "PMC-2664230-00-TIAB_E10", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 843, 857 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T6" } ] }, { "id": "PMC-2664230-00-TIAB_E11", "type": "Negative_regulation", "trigger": { "text": [ "reduce" ], "offsets": [ [ 1307, 1313 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E12" } ] }, { "id": "PMC-2664230-00-TIAB_E12", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1340, 1355 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T9" } ] }, { "id": "PMC-2664230-00-TIAB_E13", "type": "Negative_regulation", "trigger": { "text": [ "reduce" ], "offsets": [ [ 1307, 1313 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E14" } ] }, { "id": "PMC-2664230-00-TIAB_E14", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1369, 1384 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T10" } ] }, { "id": "PMC-2664230-00-TIAB_E15", "type": "Localization", "trigger": { "text": [ "secreted" ], "offsets": [ [ 1563, 1571 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_T11" } ] }, { "id": "PMC-2664230-00-TIAB_E16", "type": "Regulation", "trigger": { "text": [ "presence" ], "offsets": [ [ 1607, 1615 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E15" } ] }, { "id": "PMC-2664230-00-TIAB_E17", "type": "Regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 1620, 1627 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-00-TIAB_E15" } ] } ]

[]

[]

[ { "id": "PMC-2626671-19-Caption-Figure_3__text", "type": "abstract", "text": [ "Key role for Runx3 in effector CTL differentiation. (A) Western analysis of Runx3, Eomes, T-bet, and perforin expression in Runx3+/+ versus Runx3-/- CD8+ SP T cells differentiated for 6 d. beta-Actin was used as a loading control. (B) Northern blot analysis of Prf1 mRNA expression in Runx3+/+ versus Runx3-/- CD8+ T cells differentiated for 6 d. beta-Actin was used as a loading control. (C) Expression of granzyme B, IFN-gamma, TNF, and IL-2 by resting or restimulated (6 h) Runx3+/+ versus Runx3-/- CD8+ SP T cells differentiated for 6 d. The vertical gray line indicates the granzyme B MFI for WT GFP+ cells. Results in A-C are representative of two independent experiments. (D) ChIP analysis of binding of endogenous Runx3 and Eomes to the Prf1 locus. Enrichment of the indicated genomic regions was evaluated by real-time PCR of DNA from immunoprecipitated and input chromatin. The data are the means of duplicate measurements from two chromatin preparations from two independent CD8+ T cell differentiations. The efficiency of recovery of input for the -1-kb region of Prf1 was 0.97% for the Runx3 ChIP and 0.5% for the Eomes ChIP." ], "offsets": [ [ 0, 1138 ] ] } ]

[ { "id": "PMC-2626671-19-Caption-Figure_3_T1", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 13, 18 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T2", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 76, 81 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T3", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 83, 88 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T4", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 90, 95 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T5", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 101, 109 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T6", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 124, 129 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T7", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 140, 145 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T8", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 149, 152 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T9", "type": "Protein", "text": [ "beta-Actin" ], "offsets": [ [ 189, 199 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T10", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 261, 265 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T11", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 285, 290 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T12", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 301, 306 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T13", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 310, 313 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T14", "type": "Protein", "text": [ "beta-Actin" ], "offsets": [ [ 347, 357 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T15", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 407, 417 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T16", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 419, 428 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T17", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 430, 433 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T18", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 439, 443 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T19", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 477, 482 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T20", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 493, 498 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T21", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 502, 505 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T22", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 579, 589 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T23", "type": "Protein", "text": [ "GFP" ], "offsets": [ [ 601, 604 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T24", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 722, 727 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T25", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 732, 737 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T26", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 745, 749 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T27", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 986, 989 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T28", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 1076, 1080 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T29", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1099, 1104 ] ], "normalized": [] }, { "id": "PMC-2626671-19-Caption-Figure_3_T30", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 1127, 1132 ] ], "normalized": [] } ]

[ { "id": "PMC-2626671-19-Caption-Figure_3_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 110, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T2" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 110, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T3" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 110, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T4" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 110, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T5" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E5", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 266, 281 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T10" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E6", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 393, 403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T15" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E7", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 393, 403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T16" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E8", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 393, 403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T17" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E9", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 393, 403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T18" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E10", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 700, 707 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T24" }, { "role": "Theme2", "ref_id": "PMC-2626671-19-Caption-Figure_3_T26" } ] }, { "id": "PMC-2626671-19-Caption-Figure_3_E11", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 700, 707 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-19-Caption-Figure_3_T25" }, { "role": "Theme2", "ref_id": "PMC-2626671-19-Caption-Figure_3_T26" } ] } ]

[]

[]

[ { "id": "PMC-2626671-11-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "FACS-based cytotoxicity assay.\nTo measure cytotoxicity, EL4 thymoma target cells were loaded with 0 or 1 muM Gp33 peptide for 2 h before a 2-h coincubation with P14 CD8+ T cells at the effector-to-target ratios indicated in the figures in 96-well round-bottom plates. After the coincubation period, cells were stained with Annexin V-FITC and anti-CD8-allophycocyanin. Data analysis was performed with FlowJo software (Tree Star, Inc.); EL4 target cells (CD8-negative events) were gated, and the percentage of Annexin V+ target cells was determined." ], "offsets": [ [ 0, 548 ] ] } ]

[ { "id": "PMC-2626671-11-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 165, 168 ] ], "normalized": [] }, { "id": "PMC-2626671-11-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 323, 332 ] ], "normalized": [] }, { "id": "PMC-2626671-11-MATERIALS_AND_METHODS_T3", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 347, 350 ] ], "normalized": [] }, { "id": "PMC-2626671-11-MATERIALS_AND_METHODS_T4", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 454, 457 ] ], "normalized": [] }, { "id": "PMC-2626671-11-MATERIALS_AND_METHODS_T5", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 509, 518 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-30-Caption-Figure_6__text", "type": "abstract", "text": [ "Inhibition of M-CSF-induced PKC reduces NF-kappaB-regulated genes in both MDMs and RAW 264.7 cells.\nMDMs (A and C) and RAW 264.7 (B) cells were pretreated with Ro-31-8220 or solvent control DMSO for 30 minutes prior to M-CSF stimulation for the indicated times. Total RNA was isolated and converted to cDNA. Real-time RT PCR was performed using primers for IkappaBalpha, BCL-xl or GAPDH. Data are expressed as relative fold increase of IkappaBalpha or BCL-xl gene expression upon treatment over non-stimulated cells. Data represent the mean +/- S.E.M for three independent experiments." ], "offsets": [ [ 0, 585 ] ] } ]

[ { "id": "PMC-3245220-30-Caption-Figure_6_T1", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 357, 369 ] ], "normalized": [] }, { "id": "PMC-3245220-30-Caption-Figure_6_T2", "type": "Protein", "text": [ "BCL-xl" ], "offsets": [ [ 371, 377 ] ], "normalized": [] }, { "id": "PMC-3245220-30-Caption-Figure_6_T3", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 436, 448 ] ], "normalized": [] }, { "id": "PMC-3245220-30-Caption-Figure_6_T4", "type": "Protein", "text": [ "BCL-xl" ], "offsets": [ [ 452, 458 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-30-Caption-Figure_6_E1", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 424, 432 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-30-Caption-Figure_6_E2" } ] }, { "id": "PMC-3245220-30-Caption-Figure_6_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 464, 474 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-30-Caption-Figure_6_T3" } ] }, { "id": "PMC-3245220-30-Caption-Figure_6_E3", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 424, 432 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-30-Caption-Figure_6_E4" } ] }, { "id": "PMC-3245220-30-Caption-Figure_6_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 464, 474 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-30-Caption-Figure_6_T4" } ] } ]

[]

[]

[ { "id": "PMC-1447668-01-Introduction__text", "type": "abstract", "text": [ "Immunological tolerance to self-antigens is the result of the deletion of self-reactive T lymphocytes in the thymus (central tolerance) and suppression of the activation of potentially self-reactive T lymphocytes in the periphery (peripheral tolerance) [1]. Suppression of pathogenic T cell responses is mediated by naturally arising CD4+CD25+ T regulatory cells (Tregs) [2,3]. Deficiencies in Treg development and function have been linked to the severe autoimmune disorder known as immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) [4]. In addition, recent studies have provided strong evidence that dysregulation of Treg development and/or function may be a significant factor in the pathogenesis of several autoimmune disorders (e.g., multiple sclerosis [5], myasthenia gravis [6], and type 1 diabetes [7]) and virus-induced immunologic disorders (e.g., human T lymphotropic virus type I [HTLV-I]-associated myelopathy/tropical spastic paraparesis [HAM/TSP], and HIV-induced AIDS [8-10]).\nThe transcription factor Foxp3 is a 431-amino acid (48-kDa) protein expressed at very high levels in CD4+CD25hi T cells and has previously been shown to be absolutely critical for Treg development and function [11-14]. Foxp3 contains a proline-rich amino-terminal domain reported to function as a nuclear factor of activated T cells (NF-AT) and nuclear factor-kappaB (NF-kappaB) binding domain, a central region containing a zinc finger and leucine zipper potentially important for protein-protein interactions, and a carboxyl-terminal forkhead (FKH) domain required for nuclear localization and DNA-binding activity [14-16]. Functional inactivation of Foxp3 by genetic mutations affecting the Foxp3 coding region, as demonstrated in IPEX, or repression of Foxp3 expression by the HTLV-I-encoded transactivator protein Tax, as recently reported in patients with HAM/TSP, results in loss of regulatory activity in CD4+CD25hi T cells [4,8,17]. Although it is clear that Foxp3 regulates T cell proliferation and cytokine production, very little is known concerning the molecular mechanisms of Foxp3 function.\nThe first evidence to indicate how Foxp3 promotes the development and function of regulatory T cells came from a report by Ziegler and colleagues [16], which suggested that Foxp3 could inhibit transcriptional activation by physically interacting with forkhead binding sites located immediately adjacent to critical cis-acting NF-AT binding sites found in various cytokine promoters (e.g., IL-2 promoter). That study also demonstrated that Foxp3 could repress activation of a synthetic reporter vector containing an SV40 promoter and three tandem copies of a forkhead binding site. These results provided additional evidence suggesting that Foxp3 transcriptional repression was mediated by binding in a sequence-specific manner to promoters containing forkhead binding sites. A recent study by Bettelli and colleagues [15] further demonstrated that Foxp3 could inhibit NF-AT as well as NF-kappaB activation, although the mechanism of suppression was shown to involve direct protein-protein interactions between NF-AT or NF-kappaB and Foxp3 rather than binding of Foxp3 to promoter elements adjacent to cis-acting NF-AT or NF-kappaB sites. Collectively, these data suggested that Foxp3 may function as a transcriptional repressor, potentially through the formation of both DNA-protein and protein-protein interactions.\nIn the present study, we expanded upon these observations by defining additional requirements of Foxp3-mediated repression of NF-kappaB activation, and investigated whether Foxp3 could target additional signaling pathways by examining transcriptional activation of NF-kappaB-dependent and NF-kappaB-independent retroviral pathogens. The characterization of the molecular targets of Foxp3 and the mechanism(s) utilized by Foxp3 to support Treg development and function will aid in our understanding of the role Tregs play in the pathogenesis of human autoimmune disease." ], "offsets": [ [ 0, 4015 ] ] } ]

[ { "id": "PMC-1447668-01-Introduction_T1", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 334, 337 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T2", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 338, 342 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1048, 1053 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T4", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1124, 1127 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T5", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 1128, 1132 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T6", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1242, 1247 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T7", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1676, 1681 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T8", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1717, 1722 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T9", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1780, 1785 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T10", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1842, 1845 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T11", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1936, 1939 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T12", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 1940, 1944 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1991, 1996 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T14", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2113, 2118 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T15", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2164, 2169 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T16", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2302, 2307 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T17", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 2518, 2522 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T18", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2568, 2573 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T19", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2769, 2774 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T20", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2977, 2982 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T21", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3162, 3167 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T22", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3191, 3196 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T23", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3307, 3312 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T24", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3543, 3548 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T25", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3619, 3624 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T26", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3828, 3833 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T27", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3867, 3872 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T28", "type": "Anaphora", "text": [ "a 431-amino acid (48-kDa) protein" ], "offsets": [ [ 1057, 1090 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T31", "type": "Entity", "text": [ "leucine zipper" ], "offsets": [ [ 1464, 1478 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T34", "type": "Entity", "text": [ "carboxyl-terminal forkhead (FKH) domain" ], "offsets": [ [ 1541, 1580 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T36", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 1594, 1601 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T41", "type": "Entity", "text": [ "coding region" ], "offsets": [ [ 1723, 1736 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T29", "type": "Anaphora", "text": [ "cytokine promoters" ], "offsets": [ [ 2492, 2510 ] ], "normalized": [] }, { "id": "PMC-1447668-01-Introduction_T47", "type": "Entity", "text": [ "promoter" ], "offsets": [ [ 2523, 2531 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-01-Introduction_E1", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1091, 1100 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T3" } ] }, { "id": "PMC-1447668-01-Introduction_E2", "type": "Positive_regulation", "trigger": { "text": [ "important" ], "offsets": [ [ 1491, 1500 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E3" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_T6" }, { "role": "CSite", "ref_id": "PMC-1447668-01-Introduction_T31" } ] }, { "id": "PMC-1447668-01-Introduction_E3", "type": "Binding", "trigger": { "text": [ "interactions" ], "offsets": [ [ 1521, 1533 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T6" } ] }, { "id": "PMC-1447668-01-Introduction_E4", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 1581, 1589 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E5" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_T6" }, { "role": "CSite", "ref_id": "PMC-1447668-01-Introduction_T34" } ] }, { "id": "PMC-1447668-01-Introduction_E5", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 1602, 1614 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T6" }, { "role": "ToLoc", "ref_id": "PMC-1447668-01-Introduction_T36" } ] }, { "id": "PMC-1447668-01-Introduction_E6", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 1581, 1589 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E7" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_T6" }, { "role": "CSite", "ref_id": "PMC-1447668-01-Introduction_T34" } ] }, { "id": "PMC-1447668-01-Introduction_E7", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 1623, 1630 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T6" } ] }, { "id": "PMC-1447668-01-Introduction_E8", "type": "Negative_regulation", "trigger": { "text": [ "inactivation" ], "offsets": [ [ 1660, 1672 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T7" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_E9" } ] }, { "id": "PMC-1447668-01-Introduction_E9", "type": "Regulation", "trigger": { "text": [ "affecting" ], "offsets": [ [ 1703, 1712 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T8" }, { "role": "Site", "ref_id": "PMC-1447668-01-Introduction_T41" } ] }, { "id": "PMC-1447668-01-Introduction_E10", "type": "Negative_regulation", "trigger": { "text": [ "repression" ], "offsets": [ [ 1766, 1776 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E11" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_T10" } ] }, { "id": "PMC-1447668-01-Introduction_E11", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1786, 1796 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T9" } ] }, { "id": "PMC-1447668-01-Introduction_E12", "type": "Negative_regulation", "trigger": { "text": [ "inhibit" ], "offsets": [ [ 2314, 2321 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E13" }, { "role": "Cause", "ref_id": "PMC-1447668-01-Introduction_E14" } ] }, { "id": "PMC-1447668-01-Introduction_E13", "type": "Positive_regulation", "trigger": { "text": [ "transcriptional activation" ], "offsets": [ [ 2322, 2348 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T17" }, { "role": "Site", "ref_id": "PMC-1447668-01-Introduction_T47" } ] }, { "id": "PMC-1447668-01-Introduction_E14", "type": "Binding", "trigger": { "text": [ "interacting" ], "offsets": [ [ 2363, 2374 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T16" } ] }, { "id": "PMC-1447668-01-Introduction_E15", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 2818, 2825 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T19" } ] }, { "id": "PMC-1447668-01-Introduction_E16", "type": "Binding", "trigger": { "text": [ "interactions" ], "offsets": [ [ 3118, 3130 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T21" } ] }, { "id": "PMC-1447668-01-Introduction_E17", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 3180, 3187 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T22" } ] }, { "id": "PMC-1447668-01-Introduction_E18", "type": "Positive_regulation", "trigger": { "text": [ "formation" ], "offsets": [ [ 3382, 3391 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_E19" } ] }, { "id": "PMC-1447668-01-Introduction_E19", "type": "Binding", "trigger": { "text": [ "interactions" ], "offsets": [ [ 3432, 3444 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-01-Introduction_T23" } ] } ]

[]

[ { "id": "PMC-1447668-01-Introduction_R1", "type": "Coreference", "arg1_id": "PMC-1447668-01-Introduction_T28", "arg2_id": "PMC-1447668-01-Introduction_T3", "normalized": [] }, { "id": "PMC-1447668-01-Introduction_R2", "type": "Coreference", "arg1_id": "PMC-1447668-01-Introduction_T29", "arg2_id": "PMC-1447668-01-Introduction_T47", "normalized": [] } ]

[ { "id": "PMC-2889865-19-Caption-Figure_3__text", "type": "abstract", "text": [ "CXCL8, IL-6 and TNF expression following long-term stimulation with PMA. Jurkat T-cells were either treated with media (white bars) or stimulated with PMA (black bars) and incubated for 1 h, 2 h, 6 h and 24 h. Aged media was added following each centrifugation step representative to the stimulation time (see Materials and methods). Cytokine levels (A) CXCL8, (B) IL-6 and (C) TNF were detected by ELISA. Statistical significance from the control was determined using Student's t-test. (n = 3)." ], "offsets": [ [ 0, 495 ] ] } ]

[ { "id": "PMC-2889865-19-Caption-Figure_3_T1", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-2889865-19-Caption-Figure_3_T2", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 7, 11 ] ], "normalized": [] }, { "id": "PMC-2889865-19-Caption-Figure_3_T3", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 354, 359 ] ], "normalized": [] }, { "id": "PMC-2889865-19-Caption-Figure_3_T4", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 365, 369 ] ], "normalized": [] } ]

[ { "id": "PMC-2889865-19-Caption-Figure_3_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 20, 30 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-19-Caption-Figure_3_T1" } ] }, { "id": "PMC-2889865-19-Caption-Figure_3_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 20, 30 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-19-Caption-Figure_3_T2" } ] }, { "id": "PMC-2889865-19-Caption-Figure_3_E3", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 31, 40 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-19-Caption-Figure_3_E1" } ] }, { "id": "PMC-2889865-19-Caption-Figure_3_E4", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 31, 40 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-19-Caption-Figure_3_E2" } ] } ]

[]

[]

[ { "id": "PMC-2889865-11-Materials_and_methods__text", "type": "abstract", "text": [ "Multiplex cytokine assay\nQuantification of the levels of cytokines IL-2, IL-6, IL-10 and TNF and the chemokine CXCL8 was performed on culture supernatants using multiplexed biomarker immunoassay kits according to manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA). A Bio-Plex(TM) 200 readout System was used (Bio-Rad), which utilizes Luminex(R) xMAP(TM) fluorescent bead-based technology (Luminex Corp., Austin). Levels were automatically calculated from standard curves using Bio-Plex Manager software (v.4.1.1, Bio-Rad)." ], "offsets": [ [ 0, 536 ] ] } ]

[ { "id": "PMC-2889865-11-Materials_and_methods_T1", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 67, 71 ] ], "normalized": [] }, { "id": "PMC-2889865-11-Materials_and_methods_T2", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 73, 77 ] ], "normalized": [] }, { "id": "PMC-2889865-11-Materials_and_methods_T3", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 79, 84 ] ], "normalized": [] }, { "id": "PMC-2889865-11-Materials_and_methods_T4", "type": "Protein", "text": [ "CXCL8" ], "offsets": [ [ 111, 116 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION__text", "type": "abstract", "text": [ "A cell culture system to monitor effector CTL differentiation\nWe used a simple cell culture system to examine the kinetics of effector gene expression during CD8+ T cell differentiation. Naive CD8+ T cells from P14 TCR transgenic mice were activated for 2 d with anti-CD3 and anti-CD28 or with splenic APCs in the presence of Gp33 peptide, and were cultured in media containing 100 U/ml of recombinant human IL-2 (rhIL-2). We used TCR transgenic mice for these experiments because they provide a reliable source of CD8+ T cells that are truly naive; however, we chose not to stimulate cells with antigen in most experiments so as to avoid contamination with proteins and nucleic acids derived from APCs. There were only minor differences in gene expression during differentiation induced by antigen/APC versus anti-CD3/anti-CD28, and the major conclusions presented in this report are the same for both activating conditions.\nUnder our culture conditions, activated CD8+ T cells expanded exponentially and accumulated for >8 d. We limited our analysis to the first 6-8 d after activation, a period that coincides with clonal expansion of CD8+ T cells after activation in vivo." ], "offsets": [ [ 0, 1176 ] ] } ]

[ { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 158, 161 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T2", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 193, 196 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T3", "type": "Protein", "text": [ "CD3" ], "offsets": [ [ 268, 271 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T4", "type": "Protein", "text": [ "CD28" ], "offsets": [ [ 281, 285 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T5", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 408, 412 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T6", "type": "Protein", "text": [ "rhIL-2" ], "offsets": [ [ 414, 420 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T7", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 515, 518 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T8", "type": "Protein", "text": [ "CD3" ], "offsets": [ [ 815, 818 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T9", "type": "Protein", "text": [ "CD28" ], "offsets": [ [ 824, 828 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T10", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 966, 969 ] ], "normalized": [] }, { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_T11", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1138, 1141 ] ], "normalized": [] } ]

[]

[ { "id": "PMC-2626671-02-RESULTS_AND_DISCUSSION_1", "entity_ids": [ "PMC-2626671-02-RESULTS_AND_DISCUSSION_T5", "PMC-2626671-02-RESULTS_AND_DISCUSSION_T6" ] } ]

[]

[ { "id": "PMC-2791889-11-Experimental_Procedures__text", "type": "abstract", "text": [ "Isolation of CD4+ T Cells and of Splenic DC and Cell Culture for T Cell Phenotype Differentiation\nT cells were sorted for CD4+CD62Lhi, CD4+CD62LhiCD25-, or CD4+CD44loCD25- to >98% on a Moflo cytometer (Cytomation) as before (Shoemaker et al., 2006; Veldhoen et al., 2009). In most cases, experiments were reproduced with each type of purified CD4+ T cell population with similar results obtained. Splenic DCs were prepared as described (Hosken et al., 1995), and sort purified CD11c+ cells were added to the T cell culture. Purified DO11.10 CD4+ T cells (1 x 105 cells/ml) were cultured as before (Hosken et al., 1995), in a total volume of 1 ml cRPMI medium in a 48-well plate, with splenic DCs (2 x 104 cells/ml), and varying amounts of OVA and of IL-12. APC-independent differentiation of naive CD4+ T cells into Th1 and Th2 cells used stimulation with anti-CD3 and anti-CD28 and appropriate cytokine conditions, and control Th1 and Th2 cells were cultured as described before (Hosken et al., 1995; Shoemaker et al., 2006). Culture conditions for Th17 cells were as described before (Veldhoen et al., 2006). Importantly, Th1 and Th2 cells could be differentiated in cRPMI or IMDM (Hosken et al., 1995; Shoemaker et al., 2006; Veldhoen et al., 2006), but Th17 cells were only differentiated optimally in IMDM (Veldhoen et al., 2009). When indicated, U0126 or PD184352 (MEK inhibitors), SB203580 (p38 inhibitor), CT99021 (GSK3beta inhibitor), or a similar amount of DMSO were present in the culture. More details of specific culture conditions are provided in Figures S6 and S7." ], "offsets": [ [ 0, 1579 ] ] } ]

[ { "id": "PMC-2791889-11-Experimental_Procedures_T1", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 13, 16 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T2", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 122, 125 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T3", "type": "Protein", "text": [ "CD62L" ], "offsets": [ [ 126, 131 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T4", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 135, 138 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T5", "type": "Protein", "text": [ "CD62L" ], "offsets": [ [ 139, 144 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T6", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 146, 150 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T7", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 156, 159 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T8", "type": "Protein", "text": [ "CD44" ], "offsets": [ [ 160, 164 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T9", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 166, 170 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T10", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 343, 346 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T11", "type": "Protein", "text": [ "CD11c" ], "offsets": [ [ 477, 482 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T12", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 541, 544 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T13", "type": "Protein", "text": [ "OVA" ], "offsets": [ [ 739, 742 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T14", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 750, 755 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T15", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 798, 801 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T16", "type": "Protein", "text": [ "CD3" ], "offsets": [ [ 861, 864 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T17", "type": "Protein", "text": [ "CD28" ], "offsets": [ [ 874, 878 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T18", "type": "Protein", "text": [ "MEK" ], "offsets": [ [ 1371, 1374 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T19", "type": "Protein", "text": [ "p38" ], "offsets": [ [ 1398, 1401 ] ], "normalized": [] }, { "id": "PMC-2791889-11-Experimental_Procedures_T20", "type": "Protein", "text": [ "GSK3beta" ], "offsets": [ [ 1423, 1431 ] ], "normalized": [] } ]

[ { "id": "PMC-2791889-11-Experimental_Procedures_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 1375, 1385 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-11-Experimental_Procedures_T18" } ] }, { "id": "PMC-2791889-11-Experimental_Procedures_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 1402, 1411 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-11-Experimental_Procedures_T19" } ] }, { "id": "PMC-2791889-11-Experimental_Procedures_E3", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 1432, 1441 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-11-Experimental_Procedures_T20" } ] } ]

[]

[]

[ { "id": "PMC-3245220-03-Results__text", "type": "abstract", "text": [ "PKC Inhibition Reduces NF-kappaB Activity in Human MDMs and RAW 264.7 Cells\nSince NF-kappaB is activated by PKC in several cell types [36], we next determined if M-CSF-induced NF-kappaB transcriptional activity was dependent on PKC activation and if calcium, a co-factor for conventional PKC isoform activation, was important. In addition, because of the number of conventional PKCs existing within mononuclear cells, pharmacological inhibitors of PKC family activation was used to determine the relationship of PKC activation to M-CSF-induced cellular survival. MDMs were transfected with the pNF-kappaB-SEAP reporter and then treated with the general PKC inhibitor, Ro-31-8220; the conventional PKCalpha/beta inhibitor Go-6976; or the intracellular calcium blocker BAPTA/AM. Ro-31-8220 significantly suppressed M-CSF-induced NF-kappaB activity compared to cells treated with M-CSF alone (Figure 2A). In addition, Go-6976 and BAPTA/AM also blocked NF-kappaB activity in M-CSF-treated MDMs. Trypan blue exclusion analysis did not indicate cell death suggesting that this suppression was not due to non-specific toxicity. These data indicate that M-CSF mediated NF-kappaB activation through calcium-dependent conventional PKC activation.\nWe next investigated whether PKC inhibition affected NF-kappaB activity in the mouse macrophage cell line, RAW 264.7. Similar to MDMs, PKC inhibitors Ro-31-8220, Go-6976 and BAPTA/AM reduced M-CSF-induced NF-kappaB activity in a dose-dependent manner in RAW 264.7 macrophages (Figure 2B). To ensure that PKC specifically regulated NF-kappaB p65 and not the closely related family member, c-Rel, we co-transfected c-Rel and NF-kappaB-SEAP constructs into the Raw 264.7 cell line and measured NF-kappaB activity in response to M-CSF. There was no increased NF-kappaB activity in cells expressing c-Rel (Figure S1). These observations indicate that PKC functioned upstream of NF-kappaB p65 in MDMs and RAW 264.7 cells." ], "offsets": [ [ 0, 1952 ] ] } ]

[ { "id": "PMC-3245220-03-Results_T1", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 697, 705 ] ], "normalized": [] }, { "id": "PMC-3245220-03-Results_T2", "type": "Protein", "text": [ "beta" ], "offsets": [ [ 706, 710 ] ], "normalized": [] }, { "id": "PMC-3245220-03-Results_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1578, 1581 ] ], "normalized": [] }, { "id": "PMC-3245220-03-Results_T4", "type": "Protein", "text": [ "c-Rel" ], "offsets": [ [ 1625, 1630 ] ], "normalized": [] }, { "id": "PMC-3245220-03-Results_T5", "type": "Protein", "text": [ "c-Rel" ], "offsets": [ [ 1831, 1836 ] ], "normalized": [] }, { "id": "PMC-3245220-03-Results_T6", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1920, 1923 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-03-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 711, 720 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T1" } ] }, { "id": "PMC-3245220-03-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 711, 720 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T2" } ] }, { "id": "PMC-3245220-03-Results_E3", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1558, 1567 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T3" } ] }, { "id": "PMC-3245220-03-Results_E4", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 1558, 1567 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T4" } ] }, { "id": "PMC-3245220-03-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 1820, 1830 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T5" } ] }, { "id": "PMC-3245220-03-Results_E6", "type": "Regulation", "trigger": { "text": [ "functioned" ], "offsets": [ [ 1887, 1897 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-03-Results_T6" } ] } ]

[]

[]

[ { "id": "PMC-3279418-03-Results__text", "type": "abstract", "text": [ "Phenotyping splenic DC and BMDC from WT and cpdm mice\nDC are heterogeneous and can be categorized into multiple subtypes based on surface markers [13]. To determine if the Sharpin mutation affects DC development in lymphoid tissues, mouse spleens were examined for the distribution of conventional DC (cDC; CD11c+CD8alpha+ and CD11c+CD8alpha-) [13] and plasmacytoid DC (pDC; CD11c-PDCA-1+) [14]. The percentages for splenic cDC and pDC were both reduced in cpdm mice when compared with WT controls (Fig. 2A). However, when gated on CD11c+ cDC, the percentages of CD8alpha+ and CD8alpha- cells were not affected by SHARPIN deficiency (Fig. 2A). Since the spleen of cpdm mice is markedly enlarged and contains three times as many cells (Fig. 1C), the different percentages of splenic cDC and pDC between WT and mutant mice reflect the increased number of total spleen cells rather than a reduction in cDC and pDC numbers. These data indicate that the Sharpin mutation does not affect the distribution of the examined DC subsets in the spleen.\nBMDC from in vitro cultures functionally resemble non-lymphoid tissue DC and monocyte-derived inflammatory DC [15], [16]. The yields of BMDC from WT and cpdm mice were similar. BMDC were CD11c+ and MHC II+ with low expression of co-stimulatory molecules CD40, CD80, and CD86. The TLR3 ligand poly I:C and the TLR4 ligand LPS each activate overlapping but different signaling pathways and were used to induce DC maturation [17], [18]. Incubation with the TLR agonists for 24 hours resulted in increased expression of CD40, CD80, and CD86 on BMDC; however, there was no difference in the expression levels of these markers between WT and cpdm BMDC (Fig. 2B). Thus, SHARPIN deficiency did not influence the expression of co-stimulatory molecules by BMDC." ], "offsets": [ [ 0, 1792 ] ] } ]

[ { "id": "PMC-3279418-03-Results_T1", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 172, 179 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T2", "type": "Protein", "text": [ "CD11c" ], "offsets": [ [ 307, 312 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T3", "type": "Protein", "text": [ "CD8alpha" ], "offsets": [ [ 313, 321 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T4", "type": "Protein", "text": [ "CD11c" ], "offsets": [ [ 327, 332 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T5", "type": "Protein", "text": [ "CD8alpha" ], "offsets": [ [ 333, 341 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T6", "type": "Protein", "text": [ "CD11c" ], "offsets": [ [ 375, 380 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T7", "type": "Protein", "text": [ "PDCA-1" ], "offsets": [ [ 381, 387 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T8", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 614, 621 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T9", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 949, 956 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T10", "type": "Protein", "text": [ "CD11c" ], "offsets": [ [ 1228, 1233 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T11", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1295, 1299 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T12", "type": "Protein", "text": [ "CD80" ], "offsets": [ [ 1301, 1305 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T13", "type": "Protein", "text": [ "CD86" ], "offsets": [ [ 1311, 1315 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T14", "type": "Protein", "text": [ "TLR3" ], "offsets": [ [ 1321, 1325 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T15", "type": "Protein", "text": [ "TLR4" ], "offsets": [ [ 1350, 1354 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T16", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1557, 1561 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T17", "type": "Protein", "text": [ "CD80" ], "offsets": [ [ 1563, 1567 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T18", "type": "Protein", "text": [ "CD86" ], "offsets": [ [ 1573, 1577 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T19", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 1704, 1711 ] ], "normalized": [] }, { "id": "PMC-3279418-03-Results_T20", "type": "Anaphora", "text": [ "these markers" ], "offsets": [ [ 1648, 1661 ] ], "normalized": [] } ]

[ { "id": "PMC-3279418-03-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "mutation" ], "offsets": [ [ 180, 188 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T1" } ] }, { "id": "PMC-3279418-03-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "deficiency" ], "offsets": [ [ 622, 632 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T8" } ] }, { "id": "PMC-3279418-03-Results_E3", "type": "Negative_regulation", "trigger": { "text": [ "mutation" ], "offsets": [ [ 957, 965 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T9" } ] }, { "id": "PMC-3279418-03-Results_E4", "type": "Binding", "trigger": { "text": [ "ligand" ], "offsets": [ [ 1326, 1332 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T14" } ] }, { "id": "PMC-3279418-03-Results_E5", "type": "Binding", "trigger": { "text": [ "ligand" ], "offsets": [ [ 1355, 1361 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T15" } ] }, { "id": "PMC-3279418-03-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "resulted" ], "offsets": [ [ 1521, 1529 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E7" } ] }, { "id": "PMC-3279418-03-Results_E7", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1533, 1542 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E12" } ] }, { "id": "PMC-3279418-03-Results_E8", "type": "Positive_regulation", "trigger": { "text": [ "resulted" ], "offsets": [ [ 1521, 1529 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E9" } ] }, { "id": "PMC-3279418-03-Results_E9", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1533, 1542 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E13" } ] }, { "id": "PMC-3279418-03-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "resulted" ], "offsets": [ [ 1521, 1529 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E11" } ] }, { "id": "PMC-3279418-03-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1533, 1542 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E14" } ] }, { "id": "PMC-3279418-03-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1543, 1553 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T16" } ] }, { "id": "PMC-3279418-03-Results_E13", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1543, 1553 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T17" } ] }, { "id": "PMC-3279418-03-Results_E14", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1543, 1553 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T18" } ] }, { "id": "PMC-3279418-03-Results_E15", "type": "Regulation", "trigger": { "text": [ "difference" ], "offsets": [ [ 1609, 1619 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E16" } ] }, { "id": "PMC-3279418-03-Results_E16", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1627, 1637 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T16" } ] }, { "id": "PMC-3279418-03-Results_E17", "type": "Regulation", "trigger": { "text": [ "difference" ], "offsets": [ [ 1609, 1619 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E18" } ] }, { "id": "PMC-3279418-03-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1627, 1637 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T17" } ] }, { "id": "PMC-3279418-03-Results_E19", "type": "Regulation", "trigger": { "text": [ "difference" ], "offsets": [ [ 1609, 1619 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_E20" } ] }, { "id": "PMC-3279418-03-Results_E20", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1627, 1637 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T18" } ] }, { "id": "PMC-3279418-03-Results_E21", "type": "Negative_regulation", "trigger": { "text": [ "deficiency" ], "offsets": [ [ 1712, 1722 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-03-Results_T19" } ] } ]

[]

[ { "id": "PMC-3279418-03-Results_R1", "type": "Coreference", "arg1_id": "PMC-3279418-03-Results_T20", "arg2_id": "PMC-3279418-03-Results_T16", "normalized": [] }, { "id": "PMC-3279418-03-Results_R2", "type": "Coreference", "arg1_id": "PMC-3279418-03-Results_T20", "arg2_id": "PMC-3279418-03-Results_T17", "normalized": [] }, { "id": "PMC-3279418-03-Results_R3", "type": "Coreference", "arg1_id": "PMC-3279418-03-Results_T20", "arg2_id": "PMC-3279418-03-Results_T18", "normalized": [] } ]

[ { "id": "PMC-2065877-25-Caption-Figure_7__text", "type": "abstract", "text": [ "Akt, NFkappaB, and Stat3 Signaling Are Required for the Growth and Survival of Lymphoma Cells\nMTS assay of splenocytes from (A and B) WT or (C and D) LMP1 transgenic lymphomas and (E and F) LMP1 transgenic lymphoctyes. Splenocytes were cultured with or without inhibitors of NFkappaB (BAY11), mTOR (rapamycin), Akt (triciribine), MEK1/2 (U0126), p38 (SB202190), or Stat3 (cucurbitacin I and AG490) at the indicated concentrations. The results are the mean +/- SEM of triplicate samples. Shown are the results for (A and B) WT lymphoma 1, (C and D) LMP1 transgenic lymphoma 2, and (E and F) one out of two LMP1 transgenic mice analyzed. This analysis was repeated with LMP1 transgenic lymphoma 4 yielding similar results." ], "offsets": [ [ 0, 720 ] ] } ]

[ { "id": "PMC-2065877-25-Caption-Figure_7_T1", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 0, 3 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T2", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 19, 24 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T3", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 150, 154 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T4", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 190, 194 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T5", "type": "Protein", "text": [ "mTOR" ], "offsets": [ [ 293, 297 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T6", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 311, 314 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T7", "type": "Protein", "text": [ "MEK1" ], "offsets": [ [ 330, 334 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T8", "type": "Protein", "text": [ "2" ], "offsets": [ [ 335, 336 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T9", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 365, 370 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T10", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 548, 552 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T11", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 605, 609 ] ], "normalized": [] }, { "id": "PMC-2065877-25-Caption-Figure_7_T12", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 668, 672 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-25-Caption-Figure_7_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 261, 271 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-25-Caption-Figure_7_T5" } ] }, { "id": "PMC-2065877-25-Caption-Figure_7_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 261, 271 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-25-Caption-Figure_7_T6" } ] }, { "id": "PMC-2065877-25-Caption-Figure_7_E3", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 261, 271 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-25-Caption-Figure_7_T7" } ] }, { "id": "PMC-2065877-25-Caption-Figure_7_E4", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 261, 271 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-25-Caption-Figure_7_T8" } ] }, { "id": "PMC-2065877-25-Caption-Figure_7_E5", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 261, 271 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-25-Caption-Figure_7_T9" } ] } ]

[]

[]

[ { "id": "PMC-3245220-09-Results__text", "type": "abstract", "text": [ "Identification of PKCalpha as the Upstream Activator of NF-kappaB in Myeloid Cells\nEven though the PKC family consists of 10 members, finding that PKCalpha/beta inhibitors and intracellular calcium inhibitors reduced M-CSF-induced NF-kappaB activity, suggested PKCalpha was involved in NF-kappaB activation after M-CSF treatment. To confirm the role of PKCalpha in NF-kappaB activation in macrophages, constructs for either wildtype (WT)-PKCalpha or kinase-deficient (KD)-PKCalpha was co-transfected with the pNF-kappaB-SEAP reporter gene and SEAP secretion was measured. As shown in Figure 7A, MDMs co-transfected with pNF-kappaB-SEAP and WT-PKCalpha had a 1.8-fold increase in NF-kappaB transcriptional activity after M-CSF activation compared with NS cells (p = 0.05), similar to M-CSF-treated cells expressing only pNF-kappaB-SEAP. Transfecting human macrophages with the KD-PKCalpha construct significantly reduced M-CSF-induced NF-kappaB activity compared to WT-PKCalpha transfected cells (p = 0.016). Similarly, RAW 264.7 cells transfected with WT-PKCalpha had 2.5-fold more NF-kappaB transcriptional activity after M-CSF activation compared to unstimulated RAW 264.7 cells (NS) transfected with WT-PKCalpha (Figure 7B). Expression of the KD-PKCalpha construct into RAW 264.7 cells reduced M-CSF-induced NF-kappaB activity to 1.5-fold (p = 0.045) compared to cells transfected with WT PKCalpha.\nCell survival was also examined in MDMs expressing either WT-PKCalpha or KD-PKCalpha constructs by Annexin V-FITC and PI staining. As expected, M-CSF increased MDM survival as measured by the percent of Annexin V/PI negative cells. Similarly, expression of WT-PKCalpha protected cells from apoptosis. In contrast, expression of KD-PKCalpha decreased M-CSF-induced cell survival (p<0.01) (Figure 7C).\nNext, we examined the effect of expressing the PKCalpha constructs on NF-kappaB phosphorylation. As shown in Figure 7D, expression of KD-PKCalpha in RAW 264.7 cells did not affect the constitutive phosphorylation at Ser536 of NF-kappaB p65, but attenuated the phosphorylation at Ser276. Expression of WT-PKCalpha did not effect the phosphorylation of either residue with or without M-CSF stimulation. These observations demonstrate that PKCalpha is important in M-CSF-regulated cell survival and NF-kappaB activation and likely regulated through phosphorylation of Ser276 of NF-kappaB p65.\nTo further validate the impact that PKCalpha played in M-CSF-induced NF-kappaB transcriptional activity, we next employed PKCalpha siRNA treatment of MDM or RAW cells. A pool of specific PKCalpha siRNA were transfected into MDM or Raw 264.7 cells in the presence or absence or M-CSF. Reducing native PKCalpha expression decreased M-CSF-induced NF-kappaB transcriptional activity in both MDM (Figure 7E) (p = 0.012) and Raw 264.7 cells (Figure 7F) (p = 0.01). We also examined cell survival of the MDMs by Annexin V-FITC and PI staining after PKCalpha siRNA transfection. As shown in Figure 7G, M-CSF-induced MDM survival was reduced in the cells transfected with PKCalpha siRNA compared with cells transfected with control siRNA (p = 0.047). In Figure 7H, we confirmed that PKCalpha siRNA transfection decreased PKCalpha protein expression in both MDM and Raw 264.7 cells. Our results indicated that PKCalpha regulated NF-kappaB activation and M-CSF-regulated cell survival." ], "offsets": [ [ 0, 3366 ] ] } ]

[ { "id": "PMC-3245220-09-Results_T1", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 147, 155 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T2", "type": "Protein", "text": [ "beta" ], "offsets": [ [ 156, 160 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T3", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 261, 269 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T4", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 353, 361 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T5", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 438, 446 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T6", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 472, 480 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T7", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 643, 651 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T8", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 879, 887 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T9", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 968, 976 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T10", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1055, 1063 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T11", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1206, 1214 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T12", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1249, 1257 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T13", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1392, 1400 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T14", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1463, 1471 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T15", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1478, 1486 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T16", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 1501, 1510 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T17", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 1605, 1614 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T18", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1662, 1670 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T19", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1733, 1741 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T20", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1849, 1857 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T21", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 1939, 1947 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T22", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2038, 2041 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T23", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 2106, 2114 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T24", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 2239, 2247 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T25", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2387, 2390 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T26", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 2428, 2436 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T27", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 2514, 2528 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T28", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 2579, 2593 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T29", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 2692, 2700 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T30", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 2897, 2906 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T31", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 2934, 2948 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T32", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 3055, 3069 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T33", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 3166, 3180 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T34", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 3204, 3212 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T35", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 3292, 3300 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T56", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 2018, 2024 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T59", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 2081, 2087 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T36", "type": "Anaphora", "text": [ "either residue" ], "offsets": [ [ 2153, 2167 ] ], "normalized": [] }, { "id": "PMC-3245220-09-Results_T65", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 2367, 2373 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-09-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 161, 171 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T1" } ] }, { "id": "PMC-3245220-09-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 161, 171 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T2" } ] }, { "id": "PMC-3245220-09-Results_E3", "type": "Negative_regulation", "trigger": { "text": [ "kinase-deficient" ], "offsets": [ [ 450, 466 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T6" } ] }, { "id": "PMC-3245220-09-Results_E4", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 485, 499 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T5" } ] }, { "id": "PMC-3245220-09-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 600, 614 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T7" } ] }, { "id": "PMC-3245220-09-Results_E6", "type": "Negative_regulation", "trigger": { "text": [ "KD" ], "offsets": [ [ 876, 878 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T8" } ] }, { "id": "PMC-3245220-09-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 977, 988 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T9" } ] }, { "id": "PMC-3245220-09-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 1035, 1046 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T10" } ] }, { "id": "PMC-3245220-09-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 1186, 1197 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T11" } ] }, { "id": "PMC-3245220-09-Results_E10", "type": "Negative_regulation", "trigger": { "text": [ "KD" ], "offsets": [ [ 1246, 1248 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T12" } ] }, { "id": "PMC-3245220-09-Results_E11", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 1372, 1383 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T13" } ] }, { "id": "PMC-3245220-09-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 1442, 1452 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T14" } ] }, { "id": "PMC-3245220-09-Results_E13", "type": "Negative_regulation", "trigger": { "text": [ "KD" ], "offsets": [ [ 1475, 1477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T15" } ] }, { "id": "PMC-3245220-09-Results_E14", "type": "Negative_regulation", "trigger": { "text": [ "negative" ], "offsets": [ [ 1618, 1626 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T17" } ] }, { "id": "PMC-3245220-09-Results_E15", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1645, 1655 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T18" } ] }, { "id": "PMC-3245220-09-Results_E16", "type": "Negative_regulation", "trigger": { "text": [ "KD" ], "offsets": [ [ 1730, 1732 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T19" } ] }, { "id": "PMC-3245220-09-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 1834, 1844 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T20" } ] }, { "id": "PMC-3245220-09-Results_E18", "type": "Negative_regulation", "trigger": { "text": [ "KD" ], "offsets": [ [ 1936, 1938 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T21" } ] }, { "id": "PMC-3245220-09-Results_E19", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 1975, 1981 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E20" }, { "role": "Cause", "ref_id": "PMC-3245220-09-Results_E18" } ] }, { "id": "PMC-3245220-09-Results_E20", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1999, 2014 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T22" }, { "role": "Site", "ref_id": "PMC-3245220-09-Results_T56" } ] }, { "id": "PMC-3245220-09-Results_E21", "type": "Negative_regulation", "trigger": { "text": [ "attenuated" ], "offsets": [ [ 2047, 2057 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E22" }, { "role": "Cause", "ref_id": "PMC-3245220-09-Results_E18" } ] }, { "id": "PMC-3245220-09-Results_E22", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2062, 2077 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T22" }, { "role": "Site", "ref_id": "PMC-3245220-09-Results_T59" } ] }, { "id": "PMC-3245220-09-Results_E23", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 2089, 2099 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T23" } ] }, { "id": "PMC-3245220-09-Results_E24", "type": "Regulation", "trigger": { "text": [ "effect" ], "offsets": [ [ 2123, 2129 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E25" }, { "role": "Cause", "ref_id": "PMC-3245220-09-Results_E23" } ] }, { "id": "PMC-3245220-09-Results_E25", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2134, 2149 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T22" }, { "role": "Site", "ref_id": "PMC-3245220-09-Results_T56" } ] }, { "id": "PMC-3245220-09-Results_E26", "type": "Regulation", "trigger": { "text": [ "effect" ], "offsets": [ [ 2123, 2129 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E27" }, { "role": "Cause", "ref_id": "PMC-3245220-09-Results_E23" } ] }, { "id": "PMC-3245220-09-Results_E27", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2134, 2149 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T22" }, { "role": "Site", "ref_id": "PMC-3245220-09-Results_T59" } ] }, { "id": "PMC-3245220-09-Results_E28", "type": "Regulation", "trigger": { "text": [ "with or without" ], "offsets": [ [ 2168, 2183 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E24" } ] }, { "id": "PMC-3245220-09-Results_E29", "type": "Regulation", "trigger": { "text": [ "with or without" ], "offsets": [ [ 2168, 2183 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E26" } ] }, { "id": "PMC-3245220-09-Results_E30", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2348, 2363 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T25" }, { "role": "Site", "ref_id": "PMC-3245220-09-Results_T65" } ] }, { "id": "PMC-3245220-09-Results_E31", "type": "Negative_regulation", "trigger": { "text": [ "Reducing" ], "offsets": [ [ 2676, 2684 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E32" } ] }, { "id": "PMC-3245220-09-Results_E32", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2701, 2711 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T29" } ] }, { "id": "PMC-3245220-09-Results_E33", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 3194, 3203 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_E34" }, { "role": "Cause", "ref_id": "PMC-3245220-09-Results_T33" } ] }, { "id": "PMC-3245220-09-Results_E34", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3221, 3231 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-09-Results_T34" } ] } ]

[]

[ { "id": "PMC-3245220-09-Results_R1", "type": "Coreference", "arg1_id": "PMC-3245220-09-Results_T36", "arg2_id": "PMC-3245220-09-Results_T56", "normalized": [] }, { "id": "PMC-3245220-09-Results_R2", "type": "Coreference", "arg1_id": "PMC-3245220-09-Results_T36", "arg2_id": "PMC-3245220-09-Results_T59", "normalized": [] } ]

[ { "id": "PMC-1310901-07-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Bisulfite treatment\nDNA was extracted as described above. Bisulfite treatment of DNA, leading to conversion of unmethylated cytosine to uracil residues and no change of methylated cytosine residues, was performed as described as follows. Briefly, 1 microg of DNA and 2 microg of poly(dA-dT)(poly(dA-dT) copolymers (Amersham Pharmacia Biotech) were denaturated for 20 min at 42degreesC in 0.3 M NaOH in a volume of 50 microl. Fresh solutions of 30 microl of 10 mM hydrochinon (Sigma) and 530 microl of 3 M sodium bisulfite (pH 5.0; Sigma) were added, the solution was gently mixed, overlayed with mineral oil and incubated in the dark for 12-13 h at 50degreesC. The aqueous phase was recovered using the 'Wizard DNA clean-up system' (Promega, Mannheim, Germany). The purified DNA was subsequently mixed with 1 M NaOH to a final concentration of 0.3 M and incubated for 20 min at 37degreesC to ensure complete desulfonisation. DNA was ethanol precipitated in the presence of 1/10 vol of 3 M sodium acetate, washed with 70% ethanol and resuspended in 50 microl H2O. Subsequent PCR amplification of 4 microl bisulfite-treated DNA was used for cloning of two fragments of the IRF-4 promoter (BS-I and BS-II) into pCR2.1 vector with the 'TOPO TA cloning kit' (Invitrogen) (see Figure 3A). The primers used for PCR amplification of the BS-I and BS-II fragments contain the putative altered sequence of the sense strand due to bisulfite treatment (converted cytosine residues are written in bold letters): BS-I-forward 5'-TATTTGGATTTTTAGGGAGTTTTTTTT-3', BS-I-reverse 5'-ACCCAACTCCCTTAAACTATTAAACT-3' (187 bp); BS-II-forward 5'-AGTTTAATAGTTTAAGGGAGTTGGGT-3', BS-II-reverse 5'-CTCACCCTAAACTCAAAACTAAAAAC-3' (674 bp). After bacterial amplification of the cloned PCR fragments by standard procedures, eight clones from each sample were sequenced with an automated sequencer (ABI Prism 377, Applied Biosystems)." ], "offsets": [ [ 0, 1898 ] ] } ]

[ { "id": "PMC-1310901-07-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1171, 1176 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-33-Caption-Figure_9__text", "type": "abstract", "text": [ "Proposed model for M-CSF-induced monocyte survival via PKC regulation by activating NF-kappaB p65 phosphorylation at Ser276." ], "offsets": [ [ 0, 124 ] ] } ]

[ { "id": "PMC-3245220-33-Caption-Figure_9_T1", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 94, 97 ] ], "normalized": [] }, { "id": "PMC-3245220-33-Caption-Figure_9_T4", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 117, 123 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-33-Caption-Figure_9_E1", "type": "Positive_regulation", "trigger": { "text": [ "activating" ], "offsets": [ [ 73, 83 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-33-Caption-Figure_9_E2" } ] }, { "id": "PMC-3245220-33-Caption-Figure_9_E2", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 98, 113 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-33-Caption-Figure_9_T1" }, { "role": "Site", "ref_id": "PMC-3245220-33-Caption-Figure_9_T4" } ] } ]

[]

[]

[ { "id": "PMC-3279418-13-Materials_and_Methods__text", "type": "abstract", "text": [ "BMDC-T cell in vitro interaction\nWT and cpdm BMDC (5x104) were stimulated with medium, 1 microg/mL LPS, 25 microg/mL and 5 microg/mL Pam3CYS. 24 hours later, cells were collected and washed with PBS. Allogeneic naive CD4+ T cells were isolated from spleens of BALB/c mice by negative selection kit (Invitrogen) and were then added at 2.5x105 and co-cultured with activated BMDC. After 5 days, supernatant was collected and the secretion of IFNgamma, IL4, IL2, and IL17A measured by ELISA. Negative controls are 1) stimulated BMDC without co-culture with allogeneic CD4+ T cells; 2) allogeneic CD4+ T cells without co-culture with stimulated BMDC. Both negative controls show no production of aforementioned cytokines." ], "offsets": [ [ 0, 717 ] ] } ]

[ { "id": "PMC-3279418-13-Materials_and_Methods_T1", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 440, 448 ] ], "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_T2", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 450, 453 ] ], "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_T3", "type": "Protein", "text": [ "IL2" ], "offsets": [ [ 455, 458 ] ], "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_T4", "type": "Protein", "text": [ "IL17A" ], "offsets": [ [ 464, 469 ] ], "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_T5", "type": "Anaphora", "text": [ "aforementioned cytokines" ], "offsets": [ [ 692, 716 ] ], "normalized": [] } ]

[ { "id": "PMC-3279418-13-Materials_and_Methods_E1", "type": "Gene_expression", "trigger": { "text": [ "secretion" ], "offsets": [ [ 427, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T1" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E2", "type": "Gene_expression", "trigger": { "text": [ "secretion" ], "offsets": [ [ 427, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T2" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E3", "type": "Gene_expression", "trigger": { "text": [ "secretion" ], "offsets": [ [ 427, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T3" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E4", "type": "Gene_expression", "trigger": { "text": [ "secretion" ], "offsets": [ [ 427, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T4" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E5", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 678, 688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T1" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E6", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 678, 688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T2" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E7", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 678, 688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T3" } ] }, { "id": "PMC-3279418-13-Materials_and_Methods_E8", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 678, 688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-13-Materials_and_Methods_T4" } ] } ]

[]

[ { "id": "PMC-3279418-13-Materials_and_Methods_R1", "type": "Coreference", "arg1_id": "PMC-3279418-13-Materials_and_Methods_T5", "arg2_id": "PMC-3279418-13-Materials_and_Methods_T1", "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_R2", "type": "Coreference", "arg1_id": "PMC-3279418-13-Materials_and_Methods_T5", "arg2_id": "PMC-3279418-13-Materials_and_Methods_T2", "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_R3", "type": "Coreference", "arg1_id": "PMC-3279418-13-Materials_and_Methods_T5", "arg2_id": "PMC-3279418-13-Materials_and_Methods_T3", "normalized": [] }, { "id": "PMC-3279418-13-Materials_and_Methods_R4", "type": "Coreference", "arg1_id": "PMC-3279418-13-Materials_and_Methods_T5", "arg2_id": "PMC-3279418-13-Materials_and_Methods_T4", "normalized": [] } ]

[ { "id": "PMC-1447668-20-Materials_and_Methods__text", "type": "abstract", "text": [ "Statistical analyses.\nThe Mann-Whitney U test was used to compare the data between patients with HAM/TSP and AC." ], "offsets": [ [ 0, 112 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2626671-08-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Antibodies and reagents.\nThe following antibodies used for intracellular or surface stains were obtained from eBioscience: anti-IL-2, anti-IFN-gamma, anti-TNF, anti-granzyme B, anti-CD8, anti-CD25, and anti-CD44. Anti-CD69 was purchased from BD. For ChIP experiments, the anti-Eomes antibody was obtained from Abcam and the anti-Runx3 antibody was produced by the Groner laboratory. The following antibodies were used for immunoblotting: antiperforin (Abcam), anti-Eomes (Abcam), and anti-Pol-II (Santa Cruz Biotechnology, Inc.). The T-bet antibody was provided by L. Glimcher (Harvard School of Public Health, Boston, MA).\nThe following reagents were used for the experiments presented in this report: Annexin V-FITC Apoptosis Detection Kit (BD), CD8 Negative Isolation Kit (Invitrogen), CD8 MicroBeads (Miltenyi Biotec), and SYBR Green PCR Core Reagents (Applied Biosystems). The Gp33 peptide (KAVYNFATC) was synthesized by the Tufts University Core Facility, and 10 mM of stock solutions was prepared in DMSO." ], "offsets": [ [ 0, 1012 ] ] } ]

[ { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 128, 132 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 139, 148 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T3", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 155, 158 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T4", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 165, 175 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T5", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 182, 185 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T6", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 192, 196 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T7", "type": "Protein", "text": [ "CD44" ], "offsets": [ [ 207, 211 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T8", "type": "Protein", "text": [ "CD69" ], "offsets": [ [ 218, 222 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T9", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 277, 282 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T10", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 329, 334 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T11", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 442, 450 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T12", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 465, 470 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T13", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 534, 539 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T14", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 703, 712 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T15", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 748, 751 ] ], "normalized": [] }, { "id": "PMC-2626671-08-MATERIALS_AND_METHODS_T16", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 789, 792 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-13-Materials_and_Methods__text", "type": "abstract", "text": [ "Cell Culture\nThe murine macrophage cell line RAW 264.7 was purchased from ATCC (Manassas, VA). RAW 264.7 cells were maintained in RPMI supplemented with 5% FBS and antibiotic-antimycotic (1000 U/ml penicillin, 1000 microg/ml streptomycin sulfate, and 250 ng/ml amphotericin B) at 37degreesC. Mouse embryonic fibroblasts (MEFs) cell line lacking specific NFkappaB signaling subunits NF-kappaB p65 (p65-/- cell line) [50] were cultured in DMEM medium supplemented with 10% FBS and antibiotic-antimycotic solution." ], "offsets": [ [ 0, 511 ] ] } ]

[ { "id": "PMC-3245220-13-Materials_and_Methods_T1", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 392, 395 ] ], "normalized": [] }, { "id": "PMC-3245220-13-Materials_and_Methods_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 397, 400 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-08-Results__text", "type": "abstract", "text": [ "LMP1 Promotes Tumor Growth and Survival through Activation of Akt, NFkappaB, and Stat3 Pathways\nTo explore which pathways were required for the enhanced growth and survival of LMP1-induced lymphomas, splenocytes from wild-type and LMP1 transgenic mice were cultured in the presence of inhibitors for Akt, NFkappaB, Stat3, mTOR, or MAPK and assayed for growth and survival by the MTS assay. As previously shown, wild-type lymphocytes were not viable in culture and could not be tested with the inhibitors. However, the enhanced viability of LMP1 transgenic lymphocytes was effectively blocked by treatment with triciribine, BAY11-7085, cucurbitacin I, and slightly with SB203580, but not by treatment with rapamycin, U0126, or AG490 (Figure 7). Triciribine inhibits the activation of Akt and at 20 muM has been shown to induce growth arrest in cancer cells with aberrant Akt activity [46]. The effects of triciribine on cell growth of the transgenic lymphocytes and lymphomas were apparent as low as 1 muM, suggesting that activation of Akt is required for the survival and growth of LMP1 transgenic lymphocytes and lymphoma cells (Figure 7). The effects of the inhibitors were assessed by identifying phosphorylated Akt, Stat3, and total levels of IkappaBalpha (Figure 8). Treatment with triciribine effectively blocked phosphorylation of Akt, and phosphorylated Akt was no longer detected past 5 muM. Phosphorylated Stat3 and IkappaBalpha were still present at 25 muM. These findings suggest that triciribine specifically targets Akt and that Akt activation is required for the enhanced viability of the transgenic lymphocytes and lymphoma cells.\nInhibition of NFkappaB signaling rapidly induces cell death of EBV-transformed lymphocytes [17,18]. BAY11-7085, an inhibitor of NFkappaB signaling, also greatly decreased the viability of the LMP1 transgenic lymphocytes and lymphoma cells at doses as low as 1 muM, and at 5 muM the cells were completely nonviable (Figure 7). This is well within the reported IC50 of 10 muM. Phosphorylated Akt, Stat3, and total IkappaBalpha were still present up to treatment with 15 muM and then were no longer detected (Figure 8). This finding suggests that inhibition of NFkappaB can induce cell death in LMP1 transgenic lymphocytes and lymphoma cells without significant effects on activation of Akt or Stat3.\nCucurbitacin I inhibits activation of Stat3 by suppressing the activation of its kinase JAK2. It has been shown to selectively inhibit the growth of tumors with constitutively activated Stat3 [47]. Similarly, LMP1 transgenic lymphocytes and lymphoma cells were susceptible to cucurbitacin I treatment starting at 0.1 muM, a dose that corresponds closely to the reported IC50 of 500 nM (Figure 7) [47]. Phosphorylated Akt, Stat3, and total IkappaBalpha were not detectable past 1 muM and at higher doses all protein levels were greatly decreased, indicative of the total loss of viability (Figure 8). A second reported inhibitor of Stat3, AG490, had no effect on growth (Figure 7), but activation of Akt, Stat3, or levels of IkappaBalpha were also not affected (Figure 8). These findings suggest that inhibition of Stat3 can induce cell death in LMP1 transgenic lymphocytes and lymphoma cells, but Stat3 inhibition also has considerable crossover effects on Akt and NFkappaB signaling.\nLMP1 has also been shown to activate JNK and p38 MAPK pathways [13,48], and LMP1 transgenic lymphocytes were mildly susceptible to growth inhibition by SB202190, an inhibitor of p38 MAPK, but not U0126, an inhibitor of MEK1/2 activity. However, effects of SB202190 were only apparent at high doses (>10 muM), much higher than the reported IC50 of 0.35 muM, suggesting that p38 MAPK does not significantly contribute to the enhanced viability in LMP1 transgenic lymphocytes or lymphoma cells (Figure 7). Interestingly, both wild-type and LMP1 transgenic lymphomas were similarly susceptible to triciribine, BAY11-7085, and cucurbitacin I treatments, but not SB202190, AG490, or U0126 treatment, suggesting that activation of Akt, NFkappaB, and Stat3 but not MAPK pathways are characteristics associated with malignant transformation (Figure 7). rapamycin, an inhibitor of mTOR, did not affect the viability of the transgenic lymphocytes or lymphoma cells, confirming that mTOR is not targeted by Akt activation in LMP1 transgenic lymphocytes or malignant lymphoma cells (Figure 7)." ], "offsets": [ [ 0, 4411 ] ] } ]

[ { "id": "PMC-2065877-08-Results_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T2", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 62, 65 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T3", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 81, 86 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T4", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 176, 180 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T5", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 231, 235 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T6", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 300, 303 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T7", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 315, 320 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T8", "type": "Protein", "text": [ "mTOR" ], "offsets": [ [ 322, 326 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T9", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 540, 544 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T10", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 783, 786 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T11", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 870, 873 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T12", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1036, 1039 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T13", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1083, 1087 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T14", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1216, 1219 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T15", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 1221, 1226 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T16", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 1248, 1260 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T17", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1339, 1342 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T18", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1363, 1366 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T19", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 1417, 1422 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T20", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 1427, 1439 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T21", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1531, 1534 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T22", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 1544, 1547 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T23", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1840, 1844 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T24", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 2038, 2041 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T25", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2043, 2048 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T26", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 2060, 2072 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T27", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2240, 2244 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T28", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 2332, 2335 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T29", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2339, 2344 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T30", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2384, 2389 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T31", "type": "Protein", "text": [ "JAK2" ], "offsets": [ [ 2434, 2438 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T32", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2532, 2537 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T33", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2555, 2559 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T34", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 2763, 2766 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T35", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2768, 2773 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T36", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 2785, 2797 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T37", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 2977, 2982 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T38", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 3045, 3048 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T39", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3050, 3055 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T40", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 3070, 3082 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T41", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3160, 3165 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T42", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3191, 3195 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T43", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 3243, 3248 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T44", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 3303, 3306 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T45", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3331, 3335 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T46", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3407, 3411 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T47", "type": "Protein", "text": [ "MEK1" ], "offsets": [ [ 3550, 3554 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T48", "type": "Protein", "text": [ "2" ], "offsets": [ [ 3555, 3556 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T49", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3776, 3780 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T50", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 3868, 3872 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T51", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 4055, 4058 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T52", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 4074, 4079 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T53", "type": "Protein", "text": [ "mTOR" ], "offsets": [ [ 4202, 4206 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T54", "type": "Protein", "text": [ "mTOR" ], "offsets": [ [ 4302, 4306 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T55", "type": "Protein", "text": [ "Akt" ], "offsets": [ [ 4326, 4329 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T56", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 4344, 4348 ] ], "normalized": [] }, { "id": "PMC-2065877-08-Results_T57", "type": "Anaphora", "text": [ "all protein" ], "offsets": [ [ 2849, 2860 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-08-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 285, 295 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T6" } ] }, { "id": "PMC-2065877-08-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 285, 295 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T7" } ] }, { "id": "PMC-2065877-08-Results_E3", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 285, 295 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T8" } ] }, { "id": "PMC-2065877-08-Results_E4", "type": "Negative_regulation", "trigger": { "text": [ "inhibits" ], "offsets": [ [ 756, 764 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E5" } ] }, { "id": "PMC-2065877-08-Results_E5", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 769, 779 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T10" } ] }, { "id": "PMC-2065877-08-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 1022, 1032 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T12" } ] }, { "id": "PMC-2065877-08-Results_E7", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1201, 1215 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T14" } ] }, { "id": "PMC-2065877-08-Results_E8", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1201, 1215 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T15" } ] }, { "id": "PMC-2065877-08-Results_E9", "type": "Negative_regulation", "trigger": { "text": [ "blocked" ], "offsets": [ [ 1312, 1319 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E10" } ] }, { "id": "PMC-2065877-08-Results_E10", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1320, 1335 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T17" } ] }, { "id": "PMC-2065877-08-Results_E11", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 1348, 1362 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T18" } ] }, { "id": "PMC-2065877-08-Results_E12", "type": "Positive_regulation", "trigger": { "text": [ "detected" ], "offsets": [ [ 1381, 1389 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E11" } ] }, { "id": "PMC-2065877-08-Results_E13", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 1402, 1416 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T19" } ] }, { "id": "PMC-2065877-08-Results_E14", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 1402, 1416 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T20" } ] }, { "id": "PMC-2065877-08-Results_E15", "type": "Regulation", "trigger": { "text": [ "targets" ], "offsets": [ [ 1523, 1530 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T21" } ] }, { "id": "PMC-2065877-08-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 1548, 1558 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T22" } ] }, { "id": "PMC-2065877-08-Results_E17", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 2023, 2037 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T24" } ] }, { "id": "PMC-2065877-08-Results_E18", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 2023, 2037 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T25" } ] }, { "id": "PMC-2065877-08-Results_E19", "type": "Positive_regulation", "trigger": { "text": [ "present" ], "offsets": [ [ 2084, 2091 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E17" } ] }, { "id": "PMC-2065877-08-Results_E20", "type": "Positive_regulation", "trigger": { "text": [ "present" ], "offsets": [ [ 2084, 2091 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E18" } ] }, { "id": "PMC-2065877-08-Results_E21", "type": "Positive_regulation", "trigger": { "text": [ "present" ], "offsets": [ [ 2084, 2091 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T26" } ] }, { "id": "PMC-2065877-08-Results_E22", "type": "Positive_regulation", "trigger": { "text": [ "detected" ], "offsets": [ [ 2144, 2152 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E17" } ] }, { "id": "PMC-2065877-08-Results_E23", "type": "Positive_regulation", "trigger": { "text": [ "detected" ], "offsets": [ [ 2144, 2152 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E18" } ] }, { "id": "PMC-2065877-08-Results_E24", "type": "Positive_regulation", "trigger": { "text": [ "detected" ], "offsets": [ [ 2144, 2152 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T26" } ] }, { "id": "PMC-2065877-08-Results_E25", "type": "Regulation", "trigger": { "text": [ "effects" ], "offsets": [ [ 2307, 2314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E26" } ] }, { "id": "PMC-2065877-08-Results_E26", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2318, 2328 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T28" } ] }, { "id": "PMC-2065877-08-Results_E27", "type": "Regulation", "trigger": { "text": [ "effects" ], "offsets": [ [ 2307, 2314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E28" } ] }, { "id": "PMC-2065877-08-Results_E28", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2318, 2328 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T29" } ] }, { "id": "PMC-2065877-08-Results_E29", "type": "Negative_regulation", "trigger": { "text": [ "inhibits" ], "offsets": [ [ 2361, 2369 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_E30" } ] }, { "id": "PMC-2065877-08-Results_E30", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2370, 2380 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T30" } ] }, { "id": "PMC-2065877-08-Results_E31", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 2522, 2531 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T32" } ] }, { "id": "PMC-2065877-08-Results_E32", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 2748, 2762 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T34" } ] }, { "id": "PMC-2065877-08-Results_E33", "type": "Phosphorylation", "trigger": { "text": [ "Phosphorylated" ], "offsets": [ [ 2748, 2762 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T35" } ] }, { "id": "PMC-2065877-08-Results_E34", "type": "Positive_regulation", "trigger": { "text": [ "detectable" ], "offsets": [ [ 2807, 2817 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T34" } ] }, { "id": "PMC-2065877-08-Results_E35", "type": "Positive_regulation", "trigger": { "text": [ "detectable" ], "offsets": [ [ 2807, 2817 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T35" } ] }, { "id": "PMC-2065877-08-Results_E36", "type": "Positive_regulation", "trigger": { "text": [ "detectable" ], "offsets": [ [ 2807, 2817 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T36" } ] }, { "id": "PMC-2065877-08-Results_E37", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 2881, 2890 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T34" } ] }, { "id": "PMC-2065877-08-Results_E38", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 2881, 2890 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T35" } ] }, { "id": "PMC-2065877-08-Results_E39", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 2881, 2890 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T36" } ] }, { "id": "PMC-2065877-08-Results_E40", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 2964, 2973 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T37" } ] }, { "id": "PMC-2065877-08-Results_E41", "type": "Regulation", "trigger": { "text": [ "affected" ], "offsets": [ [ 3097, 3105 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T40" } ] }, { "id": "PMC-2065877-08-Results_E42", "type": "Negative_regulation", "trigger": { "text": [ "inhibition" ], "offsets": [ [ 3146, 3156 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T41" } ] }, { "id": "PMC-2065877-08-Results_E43", "type": "Negative_regulation", "trigger": { "text": [ "inhibition" ], "offsets": [ [ 3249, 3259 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T43" } ] }, { "id": "PMC-2065877-08-Results_E44", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 3537, 3546 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T47" } ] }, { "id": "PMC-2065877-08-Results_E45", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 3537, 3546 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T48" } ] }, { "id": "PMC-2065877-08-Results_E46", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 4189, 4198 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T53" } ] }, { "id": "PMC-2065877-08-Results_E47", "type": "Regulation", "trigger": { "text": [ "targeted" ], "offsets": [ [ 4314, 4322 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-08-Results_T54" } ] } ]

[]

[ { "id": "PMC-2065877-08-Results_R1", "type": "Coreference", "arg1_id": "PMC-2065877-08-Results_T57", "arg2_id": "PMC-2065877-08-Results_T34", "normalized": [] }, { "id": "PMC-2065877-08-Results_R2", "type": "Coreference", "arg1_id": "PMC-2065877-08-Results_T57", "arg2_id": "PMC-2065877-08-Results_T35", "normalized": [] }, { "id": "PMC-2065877-08-Results_R3", "type": "Coreference", "arg1_id": "PMC-2065877-08-Results_T57", "arg2_id": "PMC-2065877-08-Results_T36", "normalized": [] } ]

[ { "id": "PMC-2889865-08-Materials_and_methods__text", "type": "abstract", "text": [ "Chemicals\nThe following chemicals were used in the present study: PMA (Phorbol 12-myristate 13-acetate, (Sigma #P1585, USA)); NF-kappaB activation inhibitor (NAI), (InSolution(TM) NF-kappaB Activation Inhibitor, Calbiochem #481407, USA); JNK inhibitor, (InSolution(TM) JNK Inhibitor II, Calbiochem #420128, USA); PKC Inhibitor, (InSolution(TM) Bisindolylmaleimide I, Calbiochem #203293, USA); Calcium Ionophore, (Calcium Ionophore A23187 mixed calcium magnesium salt, Sigma #C5149, USA)." ], "offsets": [ [ 0, 487 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-3279418-07-Discussion__text", "type": "abstract", "text": [ "The present report showed that null mutations of the mouse Sharpin gene did not affect the steady-state distribution of splenic DC subsets nor the development and phenotype of BMDC. However, loss of SHARPIN significantly diminished the capacity of BMDC to secrete inflammatory cytokines and nitric oxide. The attenuated cytokine production was not due to the presence of anti-inflammatory inhibitors, and can be largely explained by selective inactivation of NF-kappaB signaling. Stimulated cpdm BMDC exhibited Th2-biased T cell-polarizing capabilities, consistent with the Th2 cytokine-dominant phenotype in cpdm mice. Together, these results indicate an indispensible role of SHARPIN in regulating DC immunological functions, disruption of which may contribute to the development of immune diseases.\nSince WT and cpdm mice are both specific pathogen-free, the nature of the trigger of the severe inflammation in cpdm mice is not obvious. One such initiating factor could be endogenous apoptotic and/or necrotic cells that can release danger-associated molecular patterns (DAMPs) to launch and amplify an inflammatory response [32]. Such 'sterile' inflammation could be initiated and take place in all organs and tissues affected in cpdm mice, thus causing multi-organ inflammatory disorders. This hypothesis is supported by several recent studies. Fibroblasts of cpdm mice are highly sensitive to TNFalpha-induced cell death and the cpdm phenotype can be partially rescued by deletion of TNF [7], [8], suggesting that deficiency of SHARPIN compromises the anti-apoptotic mechanisms in cpdm mice resulting in cell death-induced inflammatory disease. Apoptosis of keratinocytes is a prominent feature of the skin lesions in cpdm mice [33] and this is mediated by caspase-dependent mitochondrial pathways [34]. These induced and/or intrinsic apoptotic cells can release various types of DAMPs that exert their pro-inflammatory properties by activating DC through pattern recognition receptors [32], [35], such as HMGB1 recognized by TLR2/4 [36], [37].\nConsistent with the impaired Th1 immune response in cpdm mice [5], stimulated BMDC weakly polarized Th1 differentiation, but strongly supported the development of Th2 effector cells. Combined with the dramatic effect of IL12 treatment on the phenotype of these mice [5], this suggests that the Th2-biased systemic inflammation in cpdm mice is caused by reduced IL12P70 production from DC. The importance of IL12P70 in regulating Th1 and Th2 immune responses in mice was clearly demonstrated in IL12P35- and IL12P40-deficient mice [38], [39] and through clinical studies in human patients [40]-[42].\nNF-kappaB, TBK/IRF3, and MAPK signaling are important pathways activated by LPS or poly I:C and disruption of either pathway may lead to decreased cytokine expression. NF-kappaB activation was selectively inhibited in LPS and poly I:C stimulated cpdm BMDC compared to wild type, while activation of TBK1/IRF3, ERK1/2, or p38 was not, indicating that disrupted NF-kappaB signaling in cpdm DC is responsible for the defective cytokine expression. These results seem to contradict a recent study that found increased levels of NF-kappaB activation and IL1 transcription in cpdm mice [43]. This difference can probably be attributed to the different cells and tissues used in these studies, and may point to cell- and tissue- type specific functions of SHARPIN. This is consistent with recent reports of tissue-specific effects of NF-kappaB signaling [44]. Ubiquitous activation of NF-kappaB by removing inhibitors such as A20 and ITCH through genetic manipulation results in widespread inflammation, consistent with the role of NF-kappaB in the production of pro-inflammatory mediators [45], [46]. However, selective inhibition of NF-kappaB activation in parenchymal cells of the skin, liver, and intestine results in chronic inflammation driven by NF-kappaB competent leukocytes [47]-[50]. This indicates that a balance between the pro-inflammatory role of NF-kappaB in leukocytes and the anti-inflammatory role in parenchymal cells is critical in the maintenance of tissue homeostasis. Experiments with mice with cell- and tissue-specific deletion of Sharpin, currently under way, will help to elucidate the role of SHARPIN in inflammation.\nDespite defective NF-kappaB activation in the absence of Sharpin expression, there was no significant change in splenic DC populations or expression of co-stimulatory molecules on BMDC. Different NF-kappaB subunits involved in the canonical and non-canonical branches of the NF-kappaB signaling pathway have distinct functions to control specific aspects of DC development and function [51], [52]. The non-canonical pathway (p100 processing to produce p52) appears to be intact in SHARPIN-deficient cells [7], [9] suggesting that the NF-kappaB heterodimer p52/RELB is sufficient to maintain the normal regulation of DC homeostasis and maturation.\nThe molecular basis by which the Sharpin mutation causes reduced NF-kappaB activation in BMDC remains to be determined. LPS and poly I:C used here are well-defined ligands that specifically engage TLR4 and TLR3, respectively. The expression profile of surface TLR4 complexes is similar between WT and cpdm BMDC suggesting that defective NF-kappaB activation is not a result of differential TLR expression on target cells. LPS engages TLR4 to activate MYD88-dependent and TRIF-dependent pathways, whereas TLR3 stimulated by poly I:C only triggers TRIF-dependent signaling [53]. The defective NF-kappaB activation by both stimuli suggests that the Sharpin mutation interferes with the protein adaptors or kinases shared by both signaling pathways, such as RIP1 and TRAF6 [18]. Recent studies demonstrated that SHARPIN interacts with HOIP to form LUBAC that exerts its linear-ubiquitin-chain-ligase activity on NF-kappaB signaling players RIP1 and NEMO [7], an essential step for intact TNFalpha-stimulated NF-kappaB activation. The Sharpin null mutation disrupts the ubiquitylation process and abrogates the TNFalpha-induced NF-kappaB signaling pathway. Since TNFR and TLR partially share their downstream signaling cascades, a similar ubiquitin-mediated regulation may hold true for SHARPIN in LPS- and poly I:C-induced NF-kappaB activation.\nIn summary, the present study identified an indispensible role of SHARPIN in the production of pro-inflammatory mediators and TLR-induced NF-kappaB signaling. The impaired Th1-stimulating ability of Sharpin-deficient DC may account for the Th2-dominant inflammatory phenotype of cpdm mice. The balance between Th1 and Th2 differentiation is critical for immune homeostasis. A better understanding of how such balance is maintained will help design cytokine treatment for human diseases with Th2-biased cytokine secretion similar to the mouse cpdm, such as allergies and hypereosinophilic syndromes." ], "offsets": [ [ 0, 6876 ] ] } ]

[ { "id": "PMC-3279418-07-Discussion_T1", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 59, 66 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T2", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 199, 206 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T3", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 678, 685 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T4", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 1399, 1407 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T5", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 1490, 1493 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T6", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 1534, 1541 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T7", "type": "Protein", "text": [ "HMGB1" ], "offsets": [ [ 2012, 2017 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T8", "type": "Protein", "text": [ "TLR2" ], "offsets": [ [ 2032, 2036 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T9", "type": "Protein", "text": [ "4" ], "offsets": [ [ 2037, 2038 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T10", "type": "Protein", "text": [ "IL12P35" ], "offsets": [ [ 2545, 2552 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T11", "type": "Protein", "text": [ "IL12P40" ], "offsets": [ [ 2558, 2565 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T20", "type": "Protein", "text": [ "IRF3" ], "offsets": [ [ 2665, 2669 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T21", "type": "Protein", "text": [ "TBK1" ], "offsets": [ [ 2949, 2953 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T22", "type": "Protein", "text": [ "IRF3" ], "offsets": [ [ 2954, 2958 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T23", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 2960, 2964 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T24", "type": "Protein", "text": [ "2" ], "offsets": [ [ 2965, 2966 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T25", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 3399, 3406 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T26", "type": "Protein", "text": [ "A20" ], "offsets": [ [ 3569, 3572 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T27", "type": "Protein", "text": [ "ITCH" ], "offsets": [ [ 3577, 3581 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T28", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 4200, 4207 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T29", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 4265, 4272 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T30", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 4347, 4354 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T31", "type": "Protein", "text": [ "p100" ], "offsets": [ [ 4715, 4719 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T32", "type": "Protein", "text": [ "p52" ], "offsets": [ [ 4742, 4745 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T33", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 4771, 4778 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T34", "type": "Protein", "text": [ "p52" ], "offsets": [ [ 4846, 4849 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T35", "type": "Protein", "text": [ "RELB" ], "offsets": [ [ 4850, 4854 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T36", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 4970, 4977 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T37", "type": "Protein", "text": [ "TLR4" ], "offsets": [ [ 5134, 5138 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T38", "type": "Protein", "text": [ "TLR3" ], "offsets": [ [ 5143, 5147 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T39", "type": "Protein", "text": [ "TLR4" ], "offsets": [ [ 5371, 5375 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T40", "type": "Protein", "text": [ "MYD88" ], "offsets": [ [ 5388, 5393 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T41", "type": "Protein", "text": [ "TRIF" ], "offsets": [ [ 5408, 5412 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T42", "type": "Protein", "text": [ "TLR3" ], "offsets": [ [ 5441, 5445 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T43", "type": "Protein", "text": [ "TRIF" ], "offsets": [ [ 5483, 5487 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T44", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 5583, 5590 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T45", "type": "Protein", "text": [ "RIP1" ], "offsets": [ [ 5691, 5695 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T46", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 5700, 5705 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T47", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 5745, 5752 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T48", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 5768, 5772 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T49", "type": "Protein", "text": [ "RIP1" ], "offsets": [ [ 5873, 5877 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T50", "type": "Protein", "text": [ "NEMO" ], "offsets": [ [ 5882, 5886 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T51", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 5921, 5929 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T52", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 5967, 5974 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T53", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 6043, 6051 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T54", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 6219, 6226 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T55", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 6344, 6351 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T56", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 6477, 6484 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T12", "type": "Anaphora", "text": [ "which" ], "offsets": [ [ 742, 747 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T57", "type": "Anaphora", "text": [ "its" ], "offsets": [ [ 5799, 5802 ] ], "normalized": [] }, { "id": "PMC-3279418-07-Discussion_T58", "type": "Anaphora", "text": [ "the ubiquitylation process" ], "offsets": [ [ 5998, 6024 ] ], "normalized": [] } ]

[ { "id": "PMC-3279418-07-Discussion_E1", "type": "Negative_regulation", "trigger": { "text": [ "null mutations" ], "offsets": [ [ 31, 45 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T1" } ] }, { "id": "PMC-3279418-07-Discussion_E2", "type": "Negative_regulation", "trigger": { "text": [ "loss" ], "offsets": [ [ 191, 195 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T2" } ] }, { "id": "PMC-3279418-07-Discussion_E3", "type": "Negative_regulation", "trigger": { "text": [ "disruption" ], "offsets": [ [ 728, 738 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T3" } ] }, { "id": "PMC-3279418-07-Discussion_E4", "type": "Negative_regulation", "trigger": { "text": [ "deletion" ], "offsets": [ [ 1478, 1486 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T5" } ] }, { "id": "PMC-3279418-07-Discussion_E5", "type": "Negative_regulation", "trigger": { "text": [ "deficiency" ], "offsets": [ [ 1520, 1530 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T6" } ] }, { "id": "PMC-3279418-07-Discussion_E6", "type": "Binding", "trigger": { "text": [ "recognized" ], "offsets": [ [ 2018, 2028 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T7" }, { "role": "Theme2", "ref_id": "PMC-3279418-07-Discussion_T8" } ] }, { "id": "PMC-3279418-07-Discussion_E7", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2566, 2575 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T10" } ] }, { "id": "PMC-3279418-07-Discussion_E8", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2566, 2575 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T11" } ] }, { "id": "PMC-3279418-07-Discussion_E9", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2935, 2945 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T21" } ] }, { "id": "PMC-3279418-07-Discussion_E10", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2935, 2945 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T22" } ] }, { "id": "PMC-3279418-07-Discussion_E11", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2935, 2945 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T23" } ] }, { "id": "PMC-3279418-07-Discussion_E12", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2935, 2945 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T24" } ] }, { "id": "PMC-3279418-07-Discussion_E13", "type": "Negative_regulation", "trigger": { "text": [ "was not" ], "offsets": [ [ 2975, 2982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E9" } ] }, { "id": "PMC-3279418-07-Discussion_E14", "type": "Negative_regulation", "trigger": { "text": [ "was not" ], "offsets": [ [ 2975, 2982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E10" } ] }, { "id": "PMC-3279418-07-Discussion_E15", "type": "Negative_regulation", "trigger": { "text": [ "was not" ], "offsets": [ [ 2975, 2982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E11" } ] }, { "id": "PMC-3279418-07-Discussion_E16", "type": "Negative_regulation", "trigger": { "text": [ "was not" ], "offsets": [ [ 2975, 2982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E12" } ] }, { "id": "PMC-3279418-07-Discussion_E17", "type": "Negative_regulation", "trigger": { "text": [ "deletion" ], "offsets": [ [ 4188, 4196 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T28" } ] }, { "id": "PMC-3279418-07-Discussion_E18", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 4336, 4343 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E19" } ] }, { "id": "PMC-3279418-07-Discussion_E19", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4355, 4365 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T30" } ] }, { "id": "PMC-3279418-07-Discussion_E20", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 4779, 4788 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T33" } ] }, { "id": "PMC-3279418-07-Discussion_E21", "type": "Negative_regulation", "trigger": { "text": [ "mutation" ], "offsets": [ [ 4978, 4986 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T36" } ] }, { "id": "PMC-3279418-07-Discussion_E22", "type": "Binding", "trigger": { "text": [ "engage" ], "offsets": [ [ 5127, 5133 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T37" } ] }, { "id": "PMC-3279418-07-Discussion_E23", "type": "Binding", "trigger": { "text": [ "engage" ], "offsets": [ [ 5127, 5133 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T38" } ] }, { "id": "PMC-3279418-07-Discussion_E24", "type": "Binding", "trigger": { "text": [ "engages" ], "offsets": [ [ 5363, 5370 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T39" } ] }, { "id": "PMC-3279418-07-Discussion_E25", "type": "Positive_regulation", "trigger": { "text": [ "stimulated" ], "offsets": [ [ 5446, 5456 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T42" } ] }, { "id": "PMC-3279418-07-Discussion_E26", "type": "Negative_regulation", "trigger": { "text": [ "mutation" ], "offsets": [ [ 5591, 5599 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T44" } ] }, { "id": "PMC-3279418-07-Discussion_E27", "type": "Binding", "trigger": { "text": [ "interacts" ], "offsets": [ [ 5753, 5762 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T47" }, { "role": "Theme2", "ref_id": "PMC-3279418-07-Discussion_T48" } ] }, { "id": "PMC-3279418-07-Discussion_E28", "type": "Positive_regulation", "trigger": { "text": [ "exerts" ], "offsets": [ [ 5792, 5798 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E29" } ] }, { "id": "PMC-3279418-07-Discussion_E29", "type": "Ubiquitination", "trigger": { "text": [ "linear-ubiquitin-chain-ligase activity" ], "offsets": [ [ 5803, 5841 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T49" }, { "role": "Cause", "ref_id": "PMC-3279418-07-Discussion_T47" } ] }, { "id": "PMC-3279418-07-Discussion_E30", "type": "Positive_regulation", "trigger": { "text": [ "exerts" ], "offsets": [ [ 5792, 5798 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E31" } ] }, { "id": "PMC-3279418-07-Discussion_E31", "type": "Ubiquitination", "trigger": { "text": [ "linear-ubiquitin-chain-ligase activity" ], "offsets": [ [ 5803, 5841 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T50" }, { "role": "Cause", "ref_id": "PMC-3279418-07-Discussion_T47" } ] }, { "id": "PMC-3279418-07-Discussion_E32", "type": "Negative_regulation", "trigger": { "text": [ "null mutation" ], "offsets": [ [ 5975, 5988 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T52" } ] }, { "id": "PMC-3279418-07-Discussion_E33", "type": "Negative_regulation", "trigger": { "text": [ "disrupts" ], "offsets": [ [ 5989, 5997 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E29" }, { "role": "Cause", "ref_id": "PMC-3279418-07-Discussion_E32" } ] }, { "id": "PMC-3279418-07-Discussion_E34", "type": "Negative_regulation", "trigger": { "text": [ "disrupts" ], "offsets": [ [ 5989, 5997 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_E31" }, { "role": "Cause", "ref_id": "PMC-3279418-07-Discussion_E32" } ] }, { "id": "PMC-3279418-07-Discussion_E35", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 6485, 6494 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-07-Discussion_T56" } ] } ]

[]

[ { "id": "PMC-3279418-07-Discussion_R1", "type": "Coreference", "arg1_id": "PMC-3279418-07-Discussion_T12", "arg2_id": "PMC-3279418-07-Discussion_T3", "normalized": [] }, { "id": "PMC-3279418-07-Discussion_R2", "type": "Coreference", "arg1_id": "PMC-3279418-07-Discussion_T57", "arg2_id": "PMC-3279418-07-Discussion_T47", "normalized": [] } ]

[ { "id": "PMC-1447668-11-Materials_and_Methods__text", "type": "abstract", "text": [ "Patients and cell preparation.\nPBMCs were prepared by centrifugation over Ficoll-Hypaque gradients (BioWhittaker, Walkersville, Maryland, United States) from eight HAM/TSP patients and eight ACs, and the cells were viably cryopreserved in liquid nitrogen until tested. HAM/TSP was diagnosed according to WHO guidelines [49]. HTLV-I seropositivity was determined by ELISA (Abbott Laboratories, Abbott Park, Illinois, United States), with confirmation by Western blot analysis (Genelabs Technologies, Redwood City, California, United States). Blood samples were obtained after informed consent as part of a clinical protocol reviewed and approved by the NIH institutional review panel." ], "offsets": [ [ 0, 683 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-1447668-07-Results__text", "type": "abstract", "text": [ "CREB Is a Target for Transcriptional Repression by Foxp3\nAlthough Foxp3 could down-regulate Tax-dependent transactivation of the HTLV-I LTR (Figure 4B) and inhibit Tax expression from an infectious molecular clone (Figure 5), Foxp3 failed to modulate Tax function in the absence of the viral promoter (Figure 4D). These results led us to hypothesize that Foxp3 acts on HTLV-I gene expression by interacting with proteins important for driving HTLV-I LTR activity in vivo. Previous studies have demonstrated that the Tax-responsive elements within the HTLV-I LTR play a crucial role in driving Tax-mediated transactivation of the HTLV-I LTR [18]. The Tax-responsive elements have been shown to resemble CREB binding sites, bind CREB in vitro and in vivo, and facilitate HTLV-I LTR activation both in the presence and in the absence of Tax [35,36]. Ching and colleagues [18] demonstrated that addition of a dominant-negative CREB expression vector resulted in nearly complete inhibition of Tax-mediated activation of the HTLV-I LTR, while blocking NF-kappaB activation by addition of a dominant-negative IKKbeta expression vector had no effect on Tax transactivation of the HTLV-I LTR. Therefore, we hypothesized that Foxp3 may inhibit Tax transactivation of the HTLV-I LTR via disruption of the CREB signaling pathway. To test this possibility, HEK 293T cells were transfected with an HTLV-I LTR or synthetic CREB reporter vector along with a control expression vector (EGFP) or expression vectors encoding Foxp3 or deltaFKH. As shown in Figure 6A, Foxp3 down-regulated basal activation of the HTLV-I LTR and transcription of a synthetic CREB reporter vector, suggesting that Foxp3 down-regulates HTLV-I LTR activation by targeting the CREB pathway. Deletion of the FKH domain of Foxp3 dampened the suppressive effect of Foxp3, but did not completely abrogate suppression, as is seen with NF-kappaB-responsive promoters in HEK 293T cells. Like NF-kappaB activation, CREB transcriptional activation was also suppressed by expression of Foxp3, and to a similar extent deltaFKH, in healthy donor CD4+ T cells (Figure 6B). Similarly, Foxp3 and deltaFKH also repressed basal HTLV-I LTR activation in primary human CD4+ T cells (Figure 6C). To our knowledge, this is the first evidence implicating CREB as a molecular target of Foxp3. As observed with NF-kappaB activation, deltaFKH was a more potent inhibitor of CREB activation in CD4+ T cells than in HEK 293T cells, further indicating that a cell type-specific mechanism of action may govern the function of this Foxp3 mutant.\nTo determine whether Foxp3 functioned by directly signaling through CREB, we utilized expression vectors encoding CREB-1 or c-Jun (a member of the activator protein 1 family of transcription factors) fused in-frame to the Gal4-BD (Gal4-BD-CREB-1 and Gal4-BD-c-Jun). As shown in Figure 6D, activation of a Gal4-responsive reporter vector by Gal4-BD-CREB-1 was down-regulated by Foxp3 compared to control vector (EGFP), indicating that Foxp3 functions by directly or indirectly interacting with CREB-1. However, Foxp3 failed to markedly affect transcriptional activation of Gal4-BD-c-Jun (c-Jun has also been demonstrated to bind to the HTLV-I LTR) and Gal4-BD-Tax (see Figure 5). Importantly, the mechanism of Foxp3-mediated inhibition of CREB-dependent transcription was not due to a block in CREB-1 protein expression, as determined by Western blot analysis (Figure 6E). Although these results demonstrate that Foxp3 functions as a co-repressor of CREB activation (in addition to NF-kappaB and NF-AT), we were unable to detect a direct physical interaction between CREB-1 and Foxp3 by coimmunoprecipitation or mammalian two-hybrid analysis (unpublished data). Therefore, our data suggest that Foxp3 may interfere with CREB signaling at an upstream event, such as phosphorylation of CREB or recruitment/function of coactivator proteins CREB-binding protein (CBP)/p300." ], "offsets": [ [ 0, 3942 ] ] } ]

[ { "id": "PMC-1447668-07-Results_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 51, 56 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 66, 71 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T3", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 92, 95 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T4", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 164, 167 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T5", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 226, 231 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T6", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 251, 254 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T7", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 355, 360 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T8", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 593, 596 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T9", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 834, 837 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T10", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 988, 991 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T11", "type": "Protein", "text": [ "IKKbeta" ], "offsets": [ [ 1102, 1109 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T12", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1145, 1148 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1216, 1221 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T14", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 1234, 1237 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T15", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1506, 1511 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T16", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1515, 1523 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T17", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1548, 1553 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T18", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1675, 1680 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T19", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1779, 1784 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T20", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1820, 1825 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T21", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2034, 2039 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T22", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 2065, 2073 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T23", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2092, 2095 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T24", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2129, 2134 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T25", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 2139, 2147 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T26", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2208, 2211 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T27", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2321, 2326 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T28", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 2367, 2375 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T29", "type": "Protein", "text": [ "CREB" ], "offsets": [ [ 2407, 2411 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T30", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2426, 2429 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T31", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2595, 2600 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T32", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 2688, 2694 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T33", "type": "Protein", "text": [ "c-Jun" ], "offsets": [ [ 2698, 2703 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T34", "type": "Protein", "text": [ "activator protein 1" ], "offsets": [ [ 2721, 2740 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T35", "type": "Protein", "text": [ "Gal4" ], "offsets": [ [ 2796, 2800 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T36", "type": "Protein", "text": [ "Gal4-BD-CREB-1" ], "offsets": [ [ 2805, 2819 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T37", "type": "Protein", "text": [ "Gal4-BD-c-Jun" ], "offsets": [ [ 2824, 2837 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T38", "type": "Protein", "text": [ "Gal4" ], "offsets": [ [ 2879, 2883 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T39", "type": "Protein", "text": [ "Gal4-BD-CREB-1" ], "offsets": [ [ 2914, 2928 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T40", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2951, 2956 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T41", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3008, 3013 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T42", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 3067, 3073 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T43", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3084, 3089 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T44", "type": "Protein", "text": [ "Gal4-BD-c-Jun" ], "offsets": [ [ 3146, 3159 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T45", "type": "Protein", "text": [ "c-Jun" ], "offsets": [ [ 3161, 3166 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T46", "type": "Protein", "text": [ "Gal4-BD-Tax" ], "offsets": [ [ 3225, 3236 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T47", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3283, 3288 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T48", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 3367, 3373 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T49", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3486, 3491 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T50", "type": "Protein", "text": [ "CREB-1" ], "offsets": [ [ 3640, 3646 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T51", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3651, 3656 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T52", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3768, 3773 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T53", "type": "Protein", "text": [ "CREB-binding protein" ], "offsets": [ [ 3910, 3930 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T54", "type": "Protein", "text": [ "CBP" ], "offsets": [ [ 3932, 3935 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T55", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 3937, 3941 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T64", "type": "Entity", "text": [ "FKH domain" ], "offsets": [ [ 1765, 1775 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T56", "type": "Anaphora", "text": [ "an upstream event" ], "offsets": [ [ 3811, 3828 ] ], "normalized": [] }, { "id": "PMC-1447668-07-Results_T57", "type": "Anaphora", "text": [ "coactivator proteins" ], "offsets": [ [ 3889, 3909 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-07-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "inhibit" ], "offsets": [ [ 156, 163 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E2" }, { "role": "Cause", "ref_id": "PMC-1447668-07-Results_T2" } ] }, { "id": "PMC-1447668-07-Results_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 168, 178 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T4" } ] }, { "id": "PMC-1447668-07-Results_E3", "type": "Regulation", "trigger": { "text": [ "modulate" ], "offsets": [ [ 242, 250 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T6" }, { "role": "Cause", "ref_id": "PMC-1447668-07-Results_T5" } ] }, { "id": "PMC-1447668-07-Results_E4", "type": "Binding", "trigger": { "text": [ "interacting" ], "offsets": [ [ 395, 406 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T7" } ] }, { "id": "PMC-1447668-07-Results_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1110, 1120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T11" } ] }, { "id": "PMC-1447668-07-Results_E6", "type": "Negative_regulation", "trigger": { "text": [ "Deletion" ], "offsets": [ [ 1749, 1757 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T19" }, { "role": "Site", "ref_id": "PMC-1447668-07-Results_T64" } ] }, { "id": "PMC-1447668-07-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2020, 2030 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T21" } ] }, { "id": "PMC-1447668-07-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2020, 2030 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T22" } ] }, { "id": "PMC-1447668-07-Results_E9", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 2394, 2403 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E10" }, { "role": "Cause", "ref_id": "PMC-1447668-07-Results_T28" } ] }, { "id": "PMC-1447668-07-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 2412, 2422 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T29" } ] }, { "id": "PMC-1447668-07-Results_E11", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2660, 2670 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T36" } ] }, { "id": "PMC-1447668-07-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2660, 2670 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T37" } ] }, { "id": "PMC-1447668-07-Results_E13", "type": "Binding", "trigger": { "text": [ "interacting" ], "offsets": [ [ 3050, 3061 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T41" }, { "role": "Theme2", "ref_id": "PMC-1447668-07-Results_T42" } ] }, { "id": "PMC-1447668-07-Results_E14", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 3197, 3201 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T45" } ] }, { "id": "PMC-1447668-07-Results_E15", "type": "Negative_regulation", "trigger": { "text": [ "block" ], "offsets": [ [ 3358, 3363 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E16" } ] }, { "id": "PMC-1447668-07-Results_E16", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 3382, 3392 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T48" } ] }, { "id": "PMC-1447668-07-Results_E17", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 3620, 3631 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T50" }, { "role": "Theme2", "ref_id": "PMC-1447668-07-Results_T51" } ] }, { "id": "PMC-1447668-07-Results_E18", "type": "Negative_regulation", "trigger": { "text": [ "interfere" ], "offsets": [ [ 3778, 3787 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E19" }, { "role": "Cause", "ref_id": "PMC-1447668-07-Results_T52" } ] }, { "id": "PMC-1447668-07-Results_E19", "type": "Positive_regulation", "trigger": { "text": [ "signaling" ], "offsets": [ [ 3798, 3807 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E22" } ] }, { "id": "PMC-1447668-07-Results_E20", "type": "Negative_regulation", "trigger": { "text": [ "interfere" ], "offsets": [ [ 3778, 3787 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E21" }, { "role": "Cause", "ref_id": "PMC-1447668-07-Results_T52" } ] }, { "id": "PMC-1447668-07-Results_E21", "type": "Positive_regulation", "trigger": { "text": [ "signaling" ], "offsets": [ [ 3798, 3807 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_E23" } ] }, { "id": "PMC-1447668-07-Results_E22", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 3865, 3876 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T53" } ] }, { "id": "PMC-1447668-07-Results_E23", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 3865, 3876 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-07-Results_T55" } ] } ]

[ { "id": "PMC-1447668-07-Results_1", "entity_ids": [ "PMC-1447668-07-Results_T53", "PMC-1447668-07-Results_T54" ] } ]

[ { "id": "PMC-1447668-07-Results_R2", "type": "Coreference", "arg1_id": "PMC-1447668-07-Results_T57", "arg2_id": "PMC-1447668-07-Results_T53", "normalized": [] }, { "id": "PMC-1447668-07-Results_R3", "type": "Coreference", "arg1_id": "PMC-1447668-07-Results_T57", "arg2_id": "PMC-1447668-07-Results_T55", "normalized": [] } ]

[ { "id": "PMC-2065877-12-Materials_and_Methods__text", "type": "abstract", "text": [ "MTS assay.\nThe 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt (MTS) cell cytotoxicity/proliferation assays were performed using the CellTiter 96 aqueous one-solution cell proliferation assay (Promega), according to manufacturer's instructions. For IL4 studies, splenocytes were cultured for 3 d in the presence or absence of 100 ng/ml IL4. Cells were seeded on day 3 in triplicate in a 96-well plate at 2.5 x 106 cells/ml at 100 mul per well. MTS reagent was added for 4 h and absorbance was read at 540 nm; values plotted were subtracted from blanks. For neutralization assays, splenocytes were seeded at 5 x 106 cells/ml at 100 mul per well on day of harvest and IL4, rat IgG1 anti-mouse IL4, or rat IgG1 isotype control (R&D Systems) were added at the concentrations indicated in the figures. Cultures were pulsed for 4 h with MTS reagent 1 d post-seeding. For inhibitor studies, splenocytes were seeded at 1 x 107 cells/ml at 100 mul per well on day of harvest, and inhibitors were added at the concentrations indicated in the figures. The inhibitors BAY11-7085, rapamycin, triciribine, U0126, SB202190, and cucurbitacin I were purchased from EMD Biosciences. For non-malignant splenocyte cultures, B cell activation was induced with 10 mug/ml of goat F(ab') anti-mouse IgM (Jackson ImmunoResearch). Cultures were pulsed for 4 h with MTS reagent 1 d post-seeding." ], "offsets": [ [ 0, 1421 ] ] } ]

[ { "id": "PMC-2065877-12-Materials_and_Methods_T1", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 302, 305 ] ], "normalized": [] }, { "id": "PMC-2065877-12-Materials_and_Methods_T2", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 389, 392 ] ], "normalized": [] }, { "id": "PMC-2065877-12-Materials_and_Methods_T3", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 719, 722 ] ], "normalized": [] }, { "id": "PMC-2065877-12-Materials_and_Methods_T4", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 744, 747 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-22-Materials_and_Methods__text", "type": "abstract", "text": [ "RNA Isolation and Quantitative Real-time PCR\nMDMs or RAW 264.7 cells were serum-starved overnight or for 2 hours, respectively, prior to incubating with inhibitors for 30 minutes. The cells were restimulated with 100 ng/ml M-CSF and total mRNA was extracted from cells with Trizol (Invitrogen) and 1-2 microg of total RNA was used to synthesized cDNA using SuperScript III (Invitrogen). Quantitative real-time (qRT)-PCR was performed using SYBR Green Master Mix (Applied BioSystems, Carlsbad, CA). The reactions were performed using an ABI PRIZM 7700 machine with software Sequence Detector version 1.7 (Applied Biosystems). The target gene values were normalized to the values of GAPDH as a housekeeping gene and expressed as relative fold increase 2(-deltadeltaCt) over the non-stimulated samples (NS)." ], "offsets": [ [ 0, 804 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2791889-07-Results__text", "type": "abstract", "text": [ "IL-10 Production by Th2 and Th17 Cells Also Requires ERK1 and ERK2 Activation\nTo address whether IL-10 production by Th2 and Th17 cells was also dependent on ERK1 and ERK2 activation, we differentiated these cells with anti-CD3 and anti-CD28 in the absence of APCs (Shoemaker et al., 2006; Veldhoen et al., 2009; Veldhoen et al., 2006), in the presence or absence of the MEK inhibitor (PD184352). We showed that ERK1 and ERK2 activation is a common pathway required for induction of IL-10 in different Th cell subsets because IL-10 production by both Th2 and Th17 cells was markedly inhibited in the presence of the MEK inhibitor (PD184352) (Figure 5D and Figure S5B). In contrast, inhibitors of p38 MAPK or of GSK-3beta activation did not affect the expression of IL-10 by these subsets (Figure S5B). Activation of the ERK1 and ERK2 signaling pathway is therefore a common requirement for the induction of IL-10 production by Th1, Th2, and Th17 cells." ], "offsets": [ [ 0, 952 ] ] } ]

[ { "id": "PMC-2791889-07-Results_T1", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T2", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 53, 57 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T3", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 62, 66 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T4", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 97, 102 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T5", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 158, 162 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T6", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 167, 171 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T7", "type": "Protein", "text": [ "CD3" ], "offsets": [ [ 224, 227 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T8", "type": "Protein", "text": [ "CD28" ], "offsets": [ [ 237, 241 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T9", "type": "Protein", "text": [ "MEK" ], "offsets": [ [ 371, 374 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T10", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 412, 416 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T11", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 421, 425 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T12", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 483, 488 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T13", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 526, 531 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T14", "type": "Protein", "text": [ "MEK" ], "offsets": [ [ 616, 619 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T15", "type": "Protein", "text": [ "p38 MAPK" ], "offsets": [ [ 696, 704 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T16", "type": "Protein", "text": [ "GSK-3beta" ], "offsets": [ [ 711, 720 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T17", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 765, 770 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T18", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 820, 824 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T19", "type": "Protein", "text": [ "ERK2" ], "offsets": [ [ 829, 833 ] ], "normalized": [] }, { "id": "PMC-2791889-07-Results_T20", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 907, 912 ] ], "normalized": [] } ]

[ { "id": "PMC-2791889-07-Results_E1", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 6, 16 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T1" } ] }, { "id": "PMC-2791889-07-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "Requires" ], "offsets": [ [ 44, 52 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E1" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E3" } ] }, { "id": "PMC-2791889-07-Results_E3", "type": "Positive_regulation", "trigger": { "text": [ "Activation" ], "offsets": [ [ 67, 77 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T2" } ] }, { "id": "PMC-2791889-07-Results_E4", "type": "Positive_regulation", "trigger": { "text": [ "Requires" ], "offsets": [ [ 44, 52 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E1" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E5" } ] }, { "id": "PMC-2791889-07-Results_E5", "type": "Positive_regulation", "trigger": { "text": [ "Activation" ], "offsets": [ [ 67, 77 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T3" } ] }, { "id": "PMC-2791889-07-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 103, 113 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T4" } ] }, { "id": "PMC-2791889-07-Results_E7", "type": "Positive_regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 145, 154 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E6" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E8" } ] }, { "id": "PMC-2791889-07-Results_E8", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 172, 182 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T5" } ] }, { "id": "PMC-2791889-07-Results_E9", "type": "Positive_regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 145, 154 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E6" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E10" } ] }, { "id": "PMC-2791889-07-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 172, 182 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T6" } ] }, { "id": "PMC-2791889-07-Results_E11", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 375, 384 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T9" } ] }, { "id": "PMC-2791889-07-Results_E12", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 426, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T10" } ] }, { "id": "PMC-2791889-07-Results_E13", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 426, 436 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T11" } ] }, { "id": "PMC-2791889-07-Results_E14", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 457, 465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E15" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E12" } ] }, { "id": "PMC-2791889-07-Results_E15", "type": "Gene_expression", "trigger": { "text": [ "induction" ], "offsets": [ [ 470, 479 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T12" } ] }, { "id": "PMC-2791889-07-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 457, 465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E15" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E13" } ] }, { "id": "PMC-2791889-07-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 532, 542 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T13" } ] }, { "id": "PMC-2791889-07-Results_E18", "type": "Negative_regulation", "trigger": { "text": [ "inhibited" ], "offsets": [ [ 583, 592 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E17" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E19" } ] }, { "id": "PMC-2791889-07-Results_E19", "type": "Negative_regulation", "trigger": { "text": [ "inhibitor" ], "offsets": [ [ 620, 629 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T14" } ] }, { "id": "PMC-2791889-07-Results_E20", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 682, 692 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E21" } ] }, { "id": "PMC-2791889-07-Results_E21", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 721, 731 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T15" } ] }, { "id": "PMC-2791889-07-Results_E22", "type": "Negative_regulation", "trigger": { "text": [ "inhibitors" ], "offsets": [ [ 682, 692 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E23" } ] }, { "id": "PMC-2791889-07-Results_E23", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 721, 731 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T16" } ] }, { "id": "PMC-2791889-07-Results_E24", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 740, 746 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E25" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E20" } ] }, { "id": "PMC-2791889-07-Results_E25", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 751, 761 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T17" } ] }, { "id": "PMC-2791889-07-Results_E26", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 740, 746 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E25" }, { "role": "Cause", "ref_id": "PMC-2791889-07-Results_E22" } ] }, { "id": "PMC-2791889-07-Results_E27", "type": "Positive_regulation", "trigger": { "text": [ "requirement" ], "offsets": [ [ 874, 885 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E28" } ] }, { "id": "PMC-2791889-07-Results_E28", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 894, 903 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_E29" } ] }, { "id": "PMC-2791889-07-Results_E29", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 913, 923 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-07-Results_T20" } ] } ]

[]

[]

[ { "id": "PMC-3148254-12-Materials_and_Methods__text", "type": "abstract", "text": [ "GLepsilon transcript assay\nThe CD40-simulated activation of GLepsilon transcription was evaluated as previously reported [33]. Briefly, 1x106 cells were stimulated overnight with anti-CD40 antibody (10 microg/ml) or an isotype control antibody, with or without 500 U/ml mouse IL-4 (BD Biosciences). RNA was isolated using Trizol (Invitrogen), and reverse-transcribed (Superscript III kit, Invitrogen). Quantitative PCR for GLepsilon and Hprt1 was performed using SYBR GREEN master mix (Applied Biosystems), and an Applied Biosystems 7900HT Fast Real-Time PCR instrument. Expression of GLepsilon in each sample was normalized to the expression of Hprt1." ], "offsets": [ [ 0, 652 ] ] } ]

[ { "id": "PMC-3148254-12-Materials_and_Methods_T1", "type": "Protein", "text": [ "GLepsilon" ], "offsets": [ [ 0, 9 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T2", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 31, 35 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T3", "type": "Protein", "text": [ "GLepsilon" ], "offsets": [ [ 60, 69 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T4", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 276, 280 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T5", "type": "Protein", "text": [ "GLepsilon" ], "offsets": [ [ 423, 432 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T6", "type": "Protein", "text": [ "Hprt1" ], "offsets": [ [ 437, 442 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T7", "type": "Protein", "text": [ "GLepsilon" ], "offsets": [ [ 585, 594 ] ], "normalized": [] }, { "id": "PMC-3148254-12-Materials_and_Methods_T8", "type": "Protein", "text": [ "Hprt1" ], "offsets": [ [ 646, 651 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-12-Materials_and_Methods_E1", "type": "Positive_regulation", "trigger": { "text": [ "simulated" ], "offsets": [ [ 36, 45 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-12-Materials_and_Methods_E2" }, { "role": "Cause", "ref_id": "PMC-3148254-12-Materials_and_Methods_T2" } ] }, { "id": "PMC-3148254-12-Materials_and_Methods_E2", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 46, 56 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-12-Materials_and_Methods_E3" } ] }, { "id": "PMC-3148254-12-Materials_and_Methods_E3", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 70, 83 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-12-Materials_and_Methods_T3" } ] }, { "id": "PMC-3148254-12-Materials_and_Methods_E4", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 571, 581 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-12-Materials_and_Methods_T7" } ] }, { "id": "PMC-3148254-12-Materials_and_Methods_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 632, 642 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-12-Materials_and_Methods_T8" } ] } ]

[]

[]

[ { "id": "PMC-2889865-18-Caption-Figure_2__text", "type": "abstract", "text": [ "NF-kappaB down-regulation by PMA and up-regulation by heat killed E. coli MG1655 following long-term stimulation. Transfection of Jurkat T-cells was performed using luciferase reporter plasmids containing NF-kappaB cis-elements. (A) Time-dependent stimulation of Jurkat T-cells using PMA. NF-kappaB activation was evaluated using HK E. coli in a (B) dose- and (C) time-dependant manner. Calcium ionophore increased NF-kappaB activity following PMA exposure (E) and resulted in a negative regulation in response to HK E. coli stimulation (D). Statistical significance from the control was determined using Student's t-test. (n = 4). Controls were arbitrarily set to 1." ], "offsets": [ [ 0, 667 ] ] } ]

[ { "id": "PMC-2889865-18-Caption-Figure_2_T1", "type": "Protein", "text": [ "luciferase" ], "offsets": [ [ 165, 175 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-01-Introduction__text", "type": "abstract", "text": [ "Monocytes are produced in the bone marrow and circulate in blood for 24-48 hours [1]. In the absence of serum, monocytes die via apoptosis [1], [2]. Macrophage colony-stimulating factor (M-CSF) stimulates mononuclear phagocyte survival and differentiation [3]. Importantly, M-CSF-mediated cell survival and activation is associated with a variety of human diseases, including atherosclerosis, transplant vascular sclerosis and breast cancer metastasis [4], [5], [6].\nWe previously identified that NF-kappaB activation is important in M-CSF-induced monocyte survival [7]. In addition to its role in mononuclear phagocyte survival, the transcription factor NF-kappaB regulates numerous genes that play important roles in cellular signaling, stress response, cell growth, survival, differentiation and inflammation [8]. There are five members in the NF-kappaB family: RelA/p65, p50, p52, c-Rel and RelB. The most common activating complex is the p50/p65 heterodimer, driven by the activation domain in the NF-kappaB p65 subunit. NF-kappaB p65 regulates important developmental processes [9], [10]. Mice lacking NF-kappaB p65 die in utero and have extensive liver damage via enhanced apoptosis [9]. Embryonic macrophages from NF-kappaB p65 null mice are susceptible to TNFalpha-induced apoptosis which is rescued by overexpressing the NF-kappaB p65 subunit [10]. Moreover, inhibiting NF-kappaB induces cell death in many cell types and cytokine-independent survival is mediated by constitutively active NF-kappaB in murine macrophages [11].\nIn monocytes and macrophages, NF-kappaB is an important transcriptional factor for expression of cytokines and cell surface receptors [12]. However, unlike resting T-cells, NF-kappaB is constitutively present in the nuclei of primary monocytes and monocytic cell lines in the absence of exogenous stimuli as demonstrated by mobility shift analysis [13]. Similarly, constitutively active NF-kappaB was observed in human alveolar macrophages [14].\nIn the classic/canonical pathway, the NF-kappaB p50/p65 complex is sequestered in the cytosol by IkappaBalpha [15]. Upon stimulation by cytokines or UV radiation, IkappaBalpha is phosphorylated, ubiquitinated, and degraded, releasing NF-kappaB p50/p65 to translocate to the nucleus and transactivate target genes. After its release from IkappaBalpha, NF-kappaB p65 can undergo post-translational modification to activate gene transcription. The role of NF-kappaB p65 phosphorylation on NF-kappaB transcriptional activity varies by stimulus, time of stimulation and cell type [16]. Previous research shows that phosphorylation of NF-kappaB p65 at Ser276, Ser529 or Ser536 plays an important role in regulating transcriptional activity of NF-kappaB [17]. In TNFalpha-treated murine fibroblasts, Ser276 of NF-kappaB p65 is phosphorylated by MSK1 to enhance NF-kappaB transcriptional activity [18]. In macrophages treated with endotoxin, NF-kappaB transcription activity is associated with phosphorylation on Ser276 and Ser536 that is regulated through protein kinase A (PKA) and IKKbeta respectively[16], [19]. In human T cells, NF-kappaB p65 is constitutively phosphorylated on Ser536 to facilitate NF-kappaB p65 nuclear translocation following cellular stimulation [20]. Accumulating evidence reveals that NF-kappaB p65 phosphorylation at Ser276 is crucial for its transcriptional activity. Upon nuclear translocation, phosphorylation of Ser276 on NF-kappaB p65 by PKA recruits the transcription co-activator, p300 to potentiate NF-kappaB-regulated gene transcription [21]. However, other studies show that PKA inhibits NF-kappaB-regulated gene expression by stabilizing IkappaBalpha [22], [23]. Interestingly, the serine/threonine kinase Pim-1 directly phosphorylates NF-kappaB p65 at Ser276 by stabilizing to prevent ubiquitin-proteasome degradation [24]. Several other phosphorylation sites are also described to enhance NF-kappaB gene transactivation [25].\nHere, we investigate the role of protein kinase C (PKC) in M-CSF-stimulated NF-kappaB activation. PKC proteins are multifunctional kinases that differ in structure, function and co-factor requirement [26]. PKCs are involved in diverse cell responses, including cell growth, survival, differentiation and development [27]. The 12 closely related enzymes of the PKC family are divided into three classes: conventional (cPKCs: alpha betaI betaII and gamma require Ca2+ and diacylglycerol (DAG); novel (nPKCs: delta, epsilon, eta, theta and mu) require DAG; and atypical (aPKCs: xi, iota and lambda) require neither Ca2+ nor DAG. Monocytes and macrophages predominantly express conventional PKC isoforms (PKCalpha PKCbetaI and PKCbetaII) and novel PKCs (PKCdelta and PKCepsilon). Conventional PKCs regulate differentiation of the human promyelocytic leukemia cell line HL60 to macrophages [28]. PKCalpha induces IL-1alpha, iNOS and TNFalpha mRNA production after lipopolysaccharide (LPS) exposure [29]. In addition, accumulating evidence suggests that conventional PKCs like PKCalpha have anti-apoptotic functions. For example, PKCalpha is overexpressed in a variety of tumor cells including gliomas, liver, and lung [30], [31]. In epithelial cells, inhibition of PKCalpha induces PKCdelta-dependent apoptosis [31]. Interestingly, in human monocytes and premonocytic THP-1 leukemia cells, novel PKCs like PKCdelta have the opposite effect on cell survival, Voss et al showed that PKCdelta directly phosphorylates caspase-3 and promotes etoposide-induced apoptosis [32]. Moreover, knockout mouse studies suggest that another novel PKC, PKCepsilon is critically involved in early LPS-mediated signaling in activated macrophages [33].\nPreviously, we reported that M-CSF promotes monocyte survival through the activation of the PI3-K/AKT pathway [3]. In addition to AKT activation, M-CSF stimulates PKC in human monocytes and increases NF-kappaB DNA binding [34]. However, whether PKC and/or NF-kappaB activation is critical in M-CSF-stimulated mononuclear phagocyte survival and/or differentiation is unclear. In other cells, PKC plays an important role in NF-kappaB activation and cell survival [35], however the specific mechanisms of this activation and the biological effects on cellular phenotype are not known. Therefore, we focused at understanding the role of PKC in the regulation of NF-kappaB activation and M-CSF-induced monocyte survival.\nHere we demonstrates that M-CSF upregulated the NF-kappaB transcription and cell survival in human and mouse macrophages. This activity was reduced by the conventional, but not novel, PKC inhibitors, dominant negative PKCalpha constructs or PKCalpha siRNA. Conventional PKC regulated NF-kappaB-regulated gene expression and phosphorylation of Ser276 of NF-kappaB p65 occurred in an M-CSF-dependent fashion correlating with its maximal transcriptional activity. Furthermore, PKCalpha-regulated phosphorylation of Ser276 of NF-kappaB p65 plays an important role in regulating its activity in mononuclear phagocytes and murine embryonic fibroblasts." ], "offsets": [ [ 0, 7033 ] ] } ]

[ { "id": "PMC-3245220-01-Introduction_T1", "type": "Protein", "text": [ "RelA" ], "offsets": [ [ 865, 869 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 870, 873 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T3", "type": "Protein", "text": [ "p50" ], "offsets": [ [ 875, 878 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T4", "type": "Protein", "text": [ "p52" ], "offsets": [ [ 880, 883 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T5", "type": "Protein", "text": [ "c-Rel" ], "offsets": [ [ 885, 890 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T6", "type": "Protein", "text": [ "RelB" ], "offsets": [ [ 895, 899 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T7", "type": "Protein", "text": [ "p50" ], "offsets": [ [ 943, 946 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T8", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 947, 950 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T9", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1013, 1016 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T10", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1036, 1039 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T11", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1118, 1121 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T12", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1232, 1235 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T13", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 1265, 1273 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T14", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1341, 1344 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T15", "type": "Protein", "text": [ "p50" ], "offsets": [ [ 2031, 2034 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T16", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2035, 2038 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T17", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 2080, 2092 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T18", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 2146, 2158 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T19", "type": "Protein", "text": [ "p50" ], "offsets": [ [ 2227, 2230 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T20", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2231, 2234 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T21", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 2320, 2332 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T22", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2344, 2347 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T23", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2446, 2449 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T24", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2622, 2625 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T25", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2796, 2799 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T26", "type": "Protein", "text": [ "MSK1" ], "offsets": [ [ 2821, 2825 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T27", "type": "Protein", "text": [ "IKKbeta" ], "offsets": [ [ 3059, 3066 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T28", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3119, 3122 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T29", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3190, 3193 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T30", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3298, 3301 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T31", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3440, 3443 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T32", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 3492, 3496 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T33", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 3653, 3665 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T34", "type": "Protein", "text": [ "Pim-1" ], "offsets": [ [ 3721, 3726 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T35", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3761, 3764 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T69", "type": "Protein", "text": [ "alpha" ], "offsets": [ [ 4367, 4372 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T70", "type": "Protein", "text": [ "betaI" ], "offsets": [ [ 4373, 4379 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T71", "type": "Protein", "text": [ "betaII" ], "offsets": [ [ 4379, 4385 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T72", "type": "Protein", "text": [ "gamma" ], "offsets": [ [ 4390, 4395 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T73", "type": "Protein", "text": [ "delta" ], "offsets": [ [ 4449, 4454 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T74", "type": "Protein", "text": [ "epsilon" ], "offsets": [ [ 4456, 4463 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T75", "type": "Protein", "text": [ "eta" ], "offsets": [ [ 4465, 4468 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T76", "type": "Protein", "text": [ "theta" ], "offsets": [ [ 4470, 4475 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T77", "type": "Protein", "text": [ "mu" ], "offsets": [ [ 4480, 4482 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T78", "type": "Protein", "text": [ "xi" ], "offsets": [ [ 4518, 4520 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T79", "type": "Protein", "text": [ "iota" ], "offsets": [ [ 4522, 4526 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T80", "type": "Protein", "text": [ "lambda" ], "offsets": [ [ 4531, 4537 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T81", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 4644, 4652 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T82", "type": "Protein", "text": [ "PKCbetaI" ], "offsets": [ [ 4653, 4661 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T83", "type": "Protein", "text": [ "PKCbetaII" ], "offsets": [ [ 4666, 4675 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T84", "type": "Protein", "text": [ "PKCdelta" ], "offsets": [ [ 4693, 4701 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T85", "type": "Protein", "text": [ "PKCepsilon" ], "offsets": [ [ 4706, 4716 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T86", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 4834, 4842 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T87", "type": "Protein", "text": [ "IL-1alpha" ], "offsets": [ [ 4851, 4860 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T88", "type": "Protein", "text": [ "iNOS" ], "offsets": [ [ 4862, 4866 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T89", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 4871, 4879 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T90", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 5014, 5022 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T91", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 5067, 5075 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T92", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 5203, 5211 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T93", "type": "Protein", "text": [ "PKCdelta" ], "offsets": [ [ 5220, 5228 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T94", "type": "Protein", "text": [ "PKCdelta" ], "offsets": [ [ 5344, 5352 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T95", "type": "Protein", "text": [ "PKCdelta" ], "offsets": [ [ 5419, 5427 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T96", "type": "Protein", "text": [ "caspase-3" ], "offsets": [ [ 5452, 5461 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T97", "type": "Protein", "text": [ "PKCepsilon" ], "offsets": [ [ 5574, 5584 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T98", "type": "Protein", "text": [ "dominant negative PKCalpha" ], "offsets": [ [ 6587, 6613 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T99", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 6628, 6642 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T100", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 6750, 6753 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T101", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 6919, 6922 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T36", "type": "Anaphora", "text": [ "its" ], "offsets": [ [ 2303, 2306 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T48", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 2629, 2635 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T49", "type": "Entity", "text": [ "Ser529" ], "offsets": [ [ 2637, 2643 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T50", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 2647, 2653 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T51", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 2776, 2782 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T54", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 2988, 2994 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T55", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 2999, 3005 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T37", "type": "Anaphora", "text": [ "that" ], "offsets": [ [ 3006, 3010 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T58", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 3159, 3165 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T59", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 3194, 3201 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T62", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 3321, 3327 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T64", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 3420, 3426 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T68", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 3768, 3774 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T109", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 6730, 6736 ] ], "normalized": [] }, { "id": "PMC-3245220-01-Introduction_T113", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 6899, 6905 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-01-Introduction_E1", "type": "Negative_regulation", "trigger": { "text": [ "lacking" ], "offsets": [ [ 1100, 1107 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T11" } ] }, { "id": "PMC-3245220-01-Introduction_E2", "type": "Negative_regulation", "trigger": { "text": [ "null" ], "offsets": [ [ 1236, 1240 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T12" } ] }, { "id": "PMC-3245220-01-Introduction_E3", "type": "Gene_expression", "trigger": { "text": [ "overexpressing" ], "offsets": [ [ 1312, 1326 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T14" } ] }, { "id": "PMC-3245220-01-Introduction_E4", "type": "Positive_regulation", "trigger": { "text": [ "Upon" ], "offsets": [ [ 2099, 2103 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E5" } ] }, { "id": "PMC-3245220-01-Introduction_E5", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 2162, 2176 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T18" } ] }, { "id": "PMC-3245220-01-Introduction_E6", "type": "Positive_regulation", "trigger": { "text": [ "Upon" ], "offsets": [ [ 2099, 2103 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E7" } ] }, { "id": "PMC-3245220-01-Introduction_E7", "type": "Protein_catabolism", "trigger": { "text": [ "degraded" ], "offsets": [ [ 2197, 2205 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T18" } ] }, { "id": "PMC-3245220-01-Introduction_E8", "type": "Localization", "trigger": { "text": [ "release" ], "offsets": [ [ 2307, 2314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T22" } ] }, { "id": "PMC-3245220-01-Introduction_E9", "type": "Protein_modification", "trigger": { "text": [ "post-translational modification" ], "offsets": [ [ 2360, 2391 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T22" } ] }, { "id": "PMC-3245220-01-Introduction_E10", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2450, 2465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T23" } ] }, { "id": "PMC-3245220-01-Introduction_E11", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2593, 2608 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T24" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T48" } ] }, { "id": "PMC-3245220-01-Introduction_E12", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2593, 2608 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T24" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T49" } ] }, { "id": "PMC-3245220-01-Introduction_E13", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2593, 2608 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T24" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T50" } ] }, { "id": "PMC-3245220-01-Introduction_E14", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 2803, 2817 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T25" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T26" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T51" } ] }, { "id": "PMC-3245220-01-Introduction_E15", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2969, 2984 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T25" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T54" } ] }, { "id": "PMC-3245220-01-Introduction_E16", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2969, 2984 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T25" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T55" } ] }, { "id": "PMC-3245220-01-Introduction_E17", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 3014, 3023 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E15" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T27" } ] }, { "id": "PMC-3245220-01-Introduction_E18", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 3014, 3023 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E16" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T27" } ] }, { "id": "PMC-3245220-01-Introduction_E19", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylated" ], "offsets": [ [ 3141, 3155 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T28" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T58" } ] }, { "id": "PMC-3245220-01-Introduction_E20", "type": "Localization", "trigger": { "text": [ "translocation" ], "offsets": [ [ 3202, 3215 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T29" }, { "role": "ToLoc", "ref_id": "PMC-3245220-01-Introduction_T59" } ] }, { "id": "PMC-3245220-01-Introduction_E21", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 3302, 3317 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T30" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T62" } ] }, { "id": "PMC-3245220-01-Introduction_E22", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 3401, 3416 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T31" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T64" } ] }, { "id": "PMC-3245220-01-Introduction_E23", "type": "Positive_regulation", "trigger": { "text": [ "by" ], "offsets": [ [ 3444, 3446 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E22" } ] }, { "id": "PMC-3245220-01-Introduction_E24", "type": "Positive_regulation", "trigger": { "text": [ "stabilizing" ], "offsets": [ [ 3641, 3652 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T33" } ] }, { "id": "PMC-3245220-01-Introduction_E25", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylates" ], "offsets": [ [ 3736, 3750 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T35" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T34" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T68" } ] }, { "id": "PMC-3245220-01-Introduction_E26", "type": "Positive_regulation", "trigger": { "text": [ "induces" ], "offsets": [ [ 4843, 4850 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E27" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T86" } ] }, { "id": "PMC-3245220-01-Introduction_E27", "type": "Transcription", "trigger": { "text": [ "production" ], "offsets": [ [ 4885, 4895 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T87" } ] }, { "id": "PMC-3245220-01-Introduction_E28", "type": "Positive_regulation", "trigger": { "text": [ "induces" ], "offsets": [ [ 4843, 4850 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E29" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T86" } ] }, { "id": "PMC-3245220-01-Introduction_E29", "type": "Transcription", "trigger": { "text": [ "production" ], "offsets": [ [ 4885, 4895 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T88" } ] }, { "id": "PMC-3245220-01-Introduction_E30", "type": "Positive_regulation", "trigger": { "text": [ "induces" ], "offsets": [ [ 4843, 4850 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E31" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T86" } ] }, { "id": "PMC-3245220-01-Introduction_E31", "type": "Transcription", "trigger": { "text": [ "production" ], "offsets": [ [ 4885, 4895 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T89" } ] }, { "id": "PMC-3245220-01-Introduction_E32", "type": "Positive_regulation", "trigger": { "text": [ "overexpressed" ], "offsets": [ [ 5079, 5092 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T91" } ] }, { "id": "PMC-3245220-01-Introduction_E33", "type": "Negative_regulation", "trigger": { "text": [ "inhibition" ], "offsets": [ [ 5189, 5199 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T92" } ] }, { "id": "PMC-3245220-01-Introduction_E34", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylates" ], "offsets": [ [ 5437, 5451 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T96" }, { "role": "Cause", "ref_id": "PMC-3245220-01-Introduction_T95" } ] }, { "id": "PMC-3245220-01-Introduction_E35", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 6661, 6670 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E36" } ] }, { "id": "PMC-3245220-01-Introduction_E36", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 6711, 6726 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T100" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T109" } ] }, { "id": "PMC-3245220-01-Introduction_E37", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 6775, 6784 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E35" } ] }, { "id": "PMC-3245220-01-Introduction_E38", "type": "Regulation", "trigger": { "text": [ "regulated" ], "offsets": [ [ 6870, 6879 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_E39" } ] }, { "id": "PMC-3245220-01-Introduction_E39", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 6880, 6895 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-01-Introduction_T101" }, { "role": "Site", "ref_id": "PMC-3245220-01-Introduction_T113" } ] } ]

[ { "id": "PMC-3245220-01-Introduction_1", "entity_ids": [ "PMC-3245220-01-Introduction_T2", "PMC-3245220-01-Introduction_T1" ] } ]

[ { "id": "PMC-3245220-01-Introduction_R1", "type": "Coreference", "arg1_id": "PMC-3245220-01-Introduction_T36", "arg2_id": "PMC-3245220-01-Introduction_T22", "normalized": [] } ]

[ { "id": "PMC-3245220-10-Results__text", "type": "abstract", "text": [ "PKC is Essential in Regulating NF-kappaB Activity\nM-CSF-dependent PKC activity facilitated NF-kappaB p65 phosphorylation at Ser276 but not Ser536. To confirm the role of PKC and p65 Ser276 phosphorylation on NF-kappaB activity, we co-transfected the NF-kappaB-SEAP construct with either WT NF-kappaB p65 or NF-kappaB p65 276S/A constructs in Raw 264.7 cells, then treated cells with the PKC inhibitor Ro-31-8220 in the absence or presences of M-CSF. As expected in cells transfected with vector control, inhibiting PKC reduced M-CSF-stimulated NF-kappaB activity compared to cells treated with M-CSF and the vehicle DMSO (p = 0.001) (Figure 8A). In contrast, expressing WT NF-kappaB p65 (p65 WT) increased NF-kappaB activity, while the general PKC inhibitor Ro-31-8220 decreased this NF-kappaB activity (p = 0.001). Notably, the introduction of NF-kappaB p65 276 S/A construct significantly reduced NF-kappaB activity compared with the WT NF-kappaB p65 construct (p = 0.005) and M-CSF treatment was unable to overcome this inhibition.\nFurthermore, we co-transfected the NF-kappaB-SEAP construct along with either the WT NF-kappaB p65, NF-kappaB p65 276S/A or NF-kappaB p65 536S/A constructs into a NF-kappaB p65-/- murine fibroblast cell line and measured NF-kappaB activity. As predicted, expression of WT NF-kappaB p65 (p65 WT) in NF-kappaB p65-/- cell line constitutively activated NF-kappaB compared to cells transfected with vector control without any stimulation (Figure 8B). In comparison, transfecting the NF-kappaB p65 276S/A construct reduced NF-kappaB activity by 5-fold (p = 0.006, WT NF-kappaB p65 vs. NF-kappaB p65 276S/A), while expressing the NF-kappaB p65 536S/A construct increased NF-kappaB activity in the p65-/- cells to levels similar to WT NF-kappaB p65 transfected cells.\nSince M-CSF-induced PKC activation regulated NF-kappaB activity via Ser276 residue of NF-kappaB p65 in primary human MDMs and RAW 264.7 cells, we next examined if this occurred in NF-kappaB p65-/- fibroblasts in response to a native stimulus for these cells, TNFalpha. NF-kappaB activity was measured in the WT NF-kappaB p65 or NF-kappaB p65 276S/A transfected cells treated with TNFalpha in the absence or presence of Ro-31-8220 (Figure 8C). As expected, TNFalpha increased NF-kappaB activity in NF-kappaB p65-/- cells expressing WT p65 and (p = 0.001) PKC inhibitors decreased NF-kappaB activity to the non-stimulated (NS) level (p = 0.007). Introducing NF-kappaB p65 276 S/A constructs significantly reduced NF-kappaB activity compared with the WT NF-kappaB p65 construct (p = 0.001). Notably, TNFalpha failed to increase NF-kappaB activity in the NF-kappaB p65-/- cells expressing NF-kappaB p65 276S/A constructs. These observations are similar to macrophages overexpressing the NF-kappaB p65 276S/A (Figure 8A). Our data demonstrate that Ser276 of NF-kappaB p65 is essential in regulating NF-kappaB activity and suggests that PKC regulates NF-kappaB activity by modulating the phosphorylation of NF-kappaB p65 at Ser276 residue." ], "offsets": [ [ 0, 3029 ] ] } ]

[ { "id": "PMC-3245220-10-Results_T1", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 101, 104 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T2", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 178, 181 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 300, 303 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T4", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 317, 320 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T5", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 683, 686 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T6", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 688, 691 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T7", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 855, 858 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T8", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 949, 952 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T9", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1130, 1133 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T10", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1145, 1148 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T11", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1169, 1172 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T12", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1208, 1211 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T13", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1317, 1320 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T14", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1322, 1325 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T15", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1343, 1346 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T16", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1524, 1527 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T17", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1607, 1610 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T18", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1625, 1628 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T19", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1669, 1672 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T20", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1726, 1729 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T21", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1773, 1776 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T22", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1892, 1895 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T23", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1986, 1989 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T24", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 2055, 2063 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T25", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2117, 2120 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T26", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2134, 2137 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T27", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 2176, 2184 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T28", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 2252, 2260 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T29", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2303, 2306 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T30", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2330, 2333 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T31", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2462, 2465 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T32", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2557, 2560 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T33", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 2593, 2601 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T34", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2657, 2660 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T35", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2691, 2694 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T36", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2789, 2792 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T37", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 2859, 2862 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T38", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 3007, 3010 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T41", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 124, 130 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T42", "type": "Entity", "text": [ "Ser536" ], "offsets": [ [ 139, 145 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T43", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 182, 188 ] ], "normalized": [] }, { "id": "PMC-3245220-10-Results_T66", "type": "Entity", "text": [ "Ser276" ], "offsets": [ [ 3014, 3020 ] ], "normalized": [] } ]

[ { "id": "PMC-3245220-10-Results_E1", "type": "Positive_regulation", "trigger": { "text": [ "facilitated" ], "offsets": [ [ 79, 90 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_E2" } ] }, { "id": "PMC-3245220-10-Results_E2", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 105, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T1" }, { "role": "Site", "ref_id": "PMC-3245220-10-Results_T41" } ] }, { "id": "PMC-3245220-10-Results_E3", "type": "Positive_regulation", "trigger": { "text": [ "facilitated" ], "offsets": [ [ 79, 90 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_E4" } ] }, { "id": "PMC-3245220-10-Results_E4", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 105, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T1" }, { "role": "Site", "ref_id": "PMC-3245220-10-Results_T42" } ] }, { "id": "PMC-3245220-10-Results_E5", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 189, 204 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T2" }, { "role": "Site", "ref_id": "PMC-3245220-10-Results_T43" } ] }, { "id": "PMC-3245220-10-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 231, 245 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T3" } ] }, { "id": "PMC-3245220-10-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 231, 245 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T4" } ] }, { "id": "PMC-3245220-10-Results_E8", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 659, 669 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T5" } ] }, { "id": "PMC-3245220-10-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "introduction" ], "offsets": [ [ 829, 841 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T7" } ] }, { "id": "PMC-3245220-10-Results_E10", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 1051, 1065 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T10" } ] }, { "id": "PMC-3245220-10-Results_E11", "type": "Gene_expression", "trigger": { "text": [ "co-transfected" ], "offsets": [ [ 1051, 1065 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T11" } ] }, { "id": "PMC-3245220-10-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 1211, 1214 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T12" } ] }, { "id": "PMC-3245220-10-Results_E13", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1290, 1300 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T13" } ] }, { "id": "PMC-3245220-10-Results_E14", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 1346, 1349 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T15" } ] }, { "id": "PMC-3245220-10-Results_E15", "type": "Gene_expression", "trigger": { "text": [ "transfecting" ], "offsets": [ [ 1497, 1509 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T16" } ] }, { "id": "PMC-3245220-10-Results_E16", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 1644, 1654 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T19" } ] }, { "id": "PMC-3245220-10-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 1729, 1732 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T20" } ] }, { "id": "PMC-3245220-10-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 1777, 1788 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T21" } ] }, { "id": "PMC-3245220-10-Results_E19", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 1989, 1992 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T23" } ] }, { "id": "PMC-3245220-10-Results_E20", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 2145, 2156 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T25" } ] }, { "id": "PMC-3245220-10-Results_E21", "type": "Gene_expression", "trigger": { "text": [ "transfected" ], "offsets": [ [ 2145, 2156 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T26" } ] }, { "id": "PMC-3245220-10-Results_E22", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 2306, 2309 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T29" } ] }, { "id": "PMC-3245220-10-Results_E23", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 2316, 2326 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T30" } ] }, { "id": "PMC-3245220-10-Results_E24", "type": "Gene_expression", "trigger": { "text": [ "Introducing" ], "offsets": [ [ 2440, 2451 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T31" } ] }, { "id": "PMC-3245220-10-Results_E25", "type": "Gene_expression", "trigger": { "text": [ "-/-" ], "offsets": [ [ 2660, 2663 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T34" } ] }, { "id": "PMC-3245220-10-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 2670, 2680 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T35" } ] }, { "id": "PMC-3245220-10-Results_E27", "type": "Gene_expression", "trigger": { "text": [ "overexpressing" ], "offsets": [ [ 2760, 2774 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T36" } ] }, { "id": "PMC-3245220-10-Results_E28", "type": "Regulation", "trigger": { "text": [ "modulating" ], "offsets": [ [ 2963, 2973 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_E29" } ] }, { "id": "PMC-3245220-10-Results_E29", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 2978, 2993 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3245220-10-Results_T38" }, { "role": "Site", "ref_id": "PMC-3245220-10-Results_T66" } ] } ]

[ { "id": "PMC-3245220-10-Results_1", "entity_ids": [ "PMC-3245220-10-Results_T5", "PMC-3245220-10-Results_T6" ] }, { "id": "PMC-3245220-10-Results_2", "entity_ids": [ "PMC-3245220-10-Results_T13", "PMC-3245220-10-Results_T14" ] } ]

[]

[ { "id": "PMC-3279418-01-Introduction__text", "type": "abstract", "text": [ "SHARPIN was originally identified in post-synaptic densities of excitatory synapses in the brain of rats [1], but this protein is widely expressed in a variety of tissues [2]. Two allelic, autosomal recessive mutations in the Sharpin gene occurred spontaneously in two inbred strains of mice, C57B/KaLawRij-Sharpincpdm/Sharpincpdm and CBy.Ocb3/Dem-Sharpincpdm-Dem/Sharpincpdm-Dem, resulting in premature termination of mRNA synthesis and absence of a functional protein product [2]. Despite different genetic backgrounds, both mutations cause similar inflammatory disease with severe chronic progressive dermatitis and defective development of secondary lymphoid organs [2]-[4]. The dermatitis becomes clinically apparent at about four weeks of age. There are accumulations of eosinophils, neutrophils and macrophages in the skin of Sharpincpdm/Sharpincpdm mutant mice (hereafter referred to as cpdm mice) associated with increased expression of Th2 cytokines in the skin and in the supernatants of activated splenocytes [5]. The mice have an impaired delayed type hypersensitivity response and decreased secretion of IFNgamma [5], indicating a defect in Th1 immune responses and a bias towards a Th2 immune response. Systemic treatment of cpdm mice with recombinant IL12 caused complete remission of the dermatitis [5]. Neutralization of IL5 by antibody treatment or crosses with IL5-deficient mice reduced the number of circulating and cutaneous eosinophils, but failed to reduce the onset and severity of the dermatitis [6].\nRecently, three independent groups identified SHARPIN as an essential component of the linear ubiquitin chain assembly complex (LUBAC) that regulates TNFalpha-induced canonical NF-kappaB signaling [7]-[9]. SHARPIN-deficient mouse embryonic fibroblast (MEF) were sensitized to TNFalpha-induced apoptosis and cell death was implicated as a factor in the dermatitis of cpdm mice [7]-[9].\nDendritic cells (DC) have a sentinel role in sensing pathogen or danger signals and initiate and direct activation of the adaptive immune response [10]. Activated and mature DC can carry processed antigenic peptides, migrate to lymphoid organs, and induce T-cell-mediated immune responses or tolerance. DC direct the differentiation of CD4+ T cells, and hence the type of immune response, through the selective secretion of cytokines. We hypothesized that defective cytokine secretion by DC contributed to the Th2-biased inflammatory phenotype in SHARPIN-deficient mice. The studies reported here found that lack of SHARPIN protein in BMDC caused defective expression of pro-inflammatory mediators and impaired NF-kappaB activation upon ligand stimulation. The ability of cpdm BMDC to stimulate Th1 cytokine production in allogeneic CD4+ T cells was compromised. Taken together, these results reveal that SHARPIN is a novel regulatory molecule in DC biology and suggest that the dysregulated function of SHARPIN-deficient DC plays a role in the cpdm phenotype." ], "offsets": [ [ 0, 2973 ] ] } ]

[ { "id": "PMC-3279418-01-Introduction_T1", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 0, 7 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T2", "type": "Protein", "text": [ "Sharpin" ], "offsets": [ [ 226, 233 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T3", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 1118, 1126 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T4", "type": "Protein", "text": [ "IL5" ], "offsets": [ [ 1339, 1342 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T5", "type": "Protein", "text": [ "IL5" ], "offsets": [ [ 1381, 1384 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T6", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 1574, 1581 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T7", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 1678, 1686 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T8", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 1734, 1741 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T9", "type": "Protein", "text": [ "TNFalpha" ], "offsets": [ [ 1804, 1812 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T10", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 2460, 2467 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T11", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 2529, 2536 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T12", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 2818, 2825 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T13", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 2917, 2924 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T14", "type": "Anaphora", "text": [ "this protein" ], "offsets": [ [ 114, 126 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T15", "type": "Anaphora", "text": [ "mRNA" ], "offsets": [ [ 419, 423 ] ], "normalized": [] }, { "id": "PMC-3279418-01-Introduction_T16", "type": "Anaphora", "text": [ "a functional protein product" ], "offsets": [ [ 449, 477 ] ], "normalized": [] } ]

[ { "id": "PMC-3279418-01-Introduction_E1", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 137, 146 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T1" } ] }, { "id": "PMC-3279418-01-Introduction_E2", "type": "Negative_regulation", "trigger": { "text": [ "recessive mutations" ], "offsets": [ [ 199, 218 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T2" } ] }, { "id": "PMC-3279418-01-Introduction_E3", "type": "Positive_regulation", "trigger": { "text": [ "resulting" ], "offsets": [ [ 381, 390 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_E4" }, { "role": "Cause", "ref_id": "PMC-3279418-01-Introduction_E2" } ] }, { "id": "PMC-3279418-01-Introduction_E4", "type": "Negative_regulation", "trigger": { "text": [ "termination" ], "offsets": [ [ 404, 415 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_E7" } ] }, { "id": "PMC-3279418-01-Introduction_E5", "type": "Positive_regulation", "trigger": { "text": [ "resulting" ], "offsets": [ [ 381, 390 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_E6" }, { "role": "Cause", "ref_id": "PMC-3279418-01-Introduction_E2" } ] }, { "id": "PMC-3279418-01-Introduction_E6", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 438, 445 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T2" } ] }, { "id": "PMC-3279418-01-Introduction_E7", "type": "Transcription", "trigger": { "text": [ "synthesis" ], "offsets": [ [ 424, 433 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T2" } ] }, { "id": "PMC-3279418-01-Introduction_E8", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 1095, 1104 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_E9" } ] }, { "id": "PMC-3279418-01-Introduction_E9", "type": "Gene_expression", "trigger": { "text": [ "secretion" ], "offsets": [ [ 1105, 1114 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T3" } ] }, { "id": "PMC-3279418-01-Introduction_E10", "type": "Negative_regulation", "trigger": { "text": [ "Neutralization" ], "offsets": [ [ 1321, 1335 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T4" } ] }, { "id": "PMC-3279418-01-Introduction_E11", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1385, 1394 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T5" } ] }, { "id": "PMC-3279418-01-Introduction_E12", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1742, 1751 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T8" } ] }, { "id": "PMC-3279418-01-Introduction_E13", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2468, 2477 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T10" } ] }, { "id": "PMC-3279418-01-Introduction_E14", "type": "Negative_regulation", "trigger": { "text": [ "lack" ], "offsets": [ [ 2521, 2525 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T11" } ] }, { "id": "PMC-3279418-01-Introduction_E15", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2925, 2934 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3279418-01-Introduction_T13" } ] } ]

[]

[ { "id": "PMC-3279418-01-Introduction_R1", "type": "Coreference", "arg1_id": "PMC-3279418-01-Introduction_T14", "arg2_id": "PMC-3279418-01-Introduction_T1", "normalized": [] }, { "id": "PMC-3279418-01-Introduction_R2", "type": "Coreference", "arg1_id": "PMC-3279418-01-Introduction_T15", "arg2_id": "PMC-3279418-01-Introduction_T2", "normalized": [] }, { "id": "PMC-3279418-01-Introduction_R3", "type": "Coreference", "arg1_id": "PMC-3279418-01-Introduction_T16", "arg2_id": "PMC-3279418-01-Introduction_T2", "normalized": [] } ]

[ { "id": "PMC-2664230-07-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Role of PKA on LPS-induced mononuclear cell TNF-alpha production\nTo evaluate the role of PKA on TNF-alpha production in mononuclear cells and its involvement in the attenuation of LPS-induced TNF-alpha production observed following PTX treatment, H89, a specific PKA inhibitor, was utilized. Isolated mononuclear cells were incubated according to the treatment groups described above in the presence and absence of pretreatment with H89 (10 muM) for 1 hour at 37degreesC. The dose of H89 was chosen based on previous work which demonstrated specific and complete inhibition of PKA at this concentration.10 Since the activity of this inhibitor is both specific and consistent at this specified dose, we did not include experiments with additional PKA inhibitors with this set of experiments. The TNF-alpha concentration in the supernatant was measured quantitatively by ELISA. The results are expressed in pg/mL." ], "offsets": [ [ 0, 911 ] ] } ]

[ { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 44, 53 ] ], "normalized": [] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 96, 105 ] ], "normalized": [] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_T3", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 192, 201 ] ], "normalized": [] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_T4", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 795, 804 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E1", "type": "Regulation", "trigger": { "text": [ "Role" ], "offsets": [ [ 0, 4 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E2" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E2", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 19, 26 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E3" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E3", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 54, 64 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_T1" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E4", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 81, 85 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E5" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E5", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 106, 116 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_T2" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E6", "type": "Regulation", "trigger": { "text": [ "involvement" ], "offsets": [ [ 146, 157 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E7" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E7", "type": "Negative_regulation", "trigger": { "text": [ "attenuation" ], "offsets": [ [ 165, 176 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E8" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E8", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 184, 191 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_E9" } ] }, { "id": "PMC-2664230-07-MATERIALS_AND_METHODS_E9", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 202, 212 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-07-MATERIALS_AND_METHODS_T3" } ] } ]

[]

[]

[ { "id": "PMC-2626671-18-Caption-Figure_2__text", "type": "abstract", "text": [ "Regulation of perforin, granzyme B, and IFN-gamma expression by T-bet and Eomes in differentiating CTLs. (A) IFN-gamma expression by WT (Tbx21+/+) and T-bet-deficient (Tbx21-/-) T cells. Naive CD8+ T cells, or cells activated and cultured for 4 or 6 d, were restimulated with PMA and ionomycin for 6 h, and IFN-gamma expression was assessed by intracellular staining. Numbers show the percentage of IFN-gamma+ cells. (B) Northern blot analysis of Prf1 and GzmB mRNA expression in WT or T-bet-deficient CD8+ T cells activated and either left uninfected (uninf) or transduced with retroviruses expressing Eomes-VP16 (Eo-VP16) or an empty IRES-GFP cassette (GFP). Total cellular RNA was analyzed on day 6 of culture. The frequency of transduced cells in the cultures was equivalent for both constructs (~65-70% GFP+ cells; not depicted). (C) Granzyme B and IFN-gamma expression by Tbx21+/+ and Tbx21-/- T cells analyzed in restimulated cells that had been cultured for 5 d. (D) IFN-gamma production by cells transduced with Eo-VP16 or control (GFP) retroviruses (RV) measured on day 4 after 6 h of restimulation with PMA and ionomycin. Numbers show the percentage of GFP+ IFN-gamma+ cells. Results are representative of three (A and C) or two (B and D) independent experiments." ], "offsets": [ [ 0, 1274 ] ] } ]

[ { "id": "PMC-2626671-18-Caption-Figure_2_T1", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 14, 22 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T2", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 24, 34 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T3", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 40, 49 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T4", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 64, 69 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T5", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 74, 79 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T6", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 109, 118 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T7", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 137, 142 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T8", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 151, 156 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T9", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 168, 173 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T10", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 193, 196 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T11", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 307, 316 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T12", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 399, 408 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T13", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 447, 451 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T14", "type": "Protein", "text": [ "GzmB" ], "offsets": [ [ 456, 460 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T15", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 486, 491 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T16", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 502, 505 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T17", "type": "Protein", "text": [ "Eomes-VP16" ], "offsets": [ [ 603, 613 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T18", "type": "Protein", "text": [ "Eo-VP16" ], "offsets": [ [ 615, 622 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T19", "type": "Protein", "text": [ "GFP" ], "offsets": [ [ 641, 644 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T20", "type": "Protein", "text": [ "Granzyme B" ], "offsets": [ [ 839, 849 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T21", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 854, 863 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T22", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 878, 883 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T23", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 891, 896 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T24", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 975, 984 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T25", "type": "Protein", "text": [ "Eo-VP16" ], "offsets": [ [ 1021, 1028 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T26", "type": "Protein", "text": [ "GFP" ], "offsets": [ [ 1041, 1044 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T27", "type": "Protein", "text": [ "GFP" ], "offsets": [ [ 1164, 1167 ] ], "normalized": [] }, { "id": "PMC-2626671-18-Caption-Figure_2_T28", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1169, 1178 ] ], "normalized": [] } ]

[ { "id": "PMC-2626671-18-Caption-Figure_2_E1", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E2" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T4" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 50, 60 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T1" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E3", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E2" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T5" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E4", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E5" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T4" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E5", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 50, 60 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T2" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E6", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E5" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T5" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E7", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E8" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T4" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E8", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 50, 60 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T3" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E9", "type": "Regulation", "trigger": { "text": [ "Regulation" ], "offsets": [ [ 0, 10 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_E8" }, { "role": "Cause", "ref_id": "PMC-2626671-18-Caption-Figure_2_T5" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E10", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 119, 129 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T6" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E11", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 157, 166 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T8" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 317, 327 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T11" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E13", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 461, 476 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T13" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E14", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 461, 476 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T14" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E15", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 492, 501 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T15" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E16", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 592, 602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T17" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 864, 874 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T20" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E18", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 864, 874 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T21" } ] }, { "id": "PMC-2626671-18-Caption-Figure_2_E19", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 985, 995 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-18-Caption-Figure_2_T24" } ] } ]

[ { "id": "PMC-2626671-18-Caption-Figure_2_1", "entity_ids": [ "PMC-2626671-18-Caption-Figure_2_T17", "PMC-2626671-18-Caption-Figure_2_T18" ] } ]

[]

[ { "id": "PMC-1310901-13-RESULTS__text", "type": "abstract", "text": [ "In vitro methylation of an IRF-4 promoter-reporter construct decreases its activity\nTo provide evidence for a direct effect of methylational status on IRF-4 promoter activity we performed reporter gene assays with IRF-4 promoter constructs before and after their in vitro methylation. A complete methylation of these constructs was checked via restriction assays with methylation-sensitive endonucleases (Figure 5A). Intriguingly, methylation of the IRF-4 promoter significantly decreased promoter activity in IRF-4-positive SD-1 cells by 85.0% (Figure 5B). The silencing effect of CpG methylation was not restricted to IRF-4-positive cells, since in vitro methylation led to a 92.9% abrogation of promoter activity in IRF-4-negative Jurkat cells (Figure 5C). In contrast, control methylation of a reporter construct with a different promoter (FasL) as well as an empty vector had no effect on the reporter activity (data not shown). These data proved a direct association between methylation and activity of the IRF-4 promoter." ], "offsets": [ [ 0, 1028 ] ] } ]

[ { "id": "PMC-1310901-13-RESULTS_T1", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 27, 32 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T2", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 151, 156 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T3", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 214, 219 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T4", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 450, 455 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T5", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 510, 515 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T6", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 620, 625 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T7", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 719, 724 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T8", "type": "Protein", "text": [ "FasL" ], "offsets": [ [ 844, 848 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T9", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1013, 1018 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T11", "type": "Entity", "text": [ "promoter" ], "offsets": [ [ 489, 497 ] ], "normalized": [] }, { "id": "PMC-1310901-13-RESULTS_T15", "type": "Entity", "text": [ "promoter" ], "offsets": [ [ 698, 706 ] ], "normalized": [] } ]

[ { "id": "PMC-1310901-13-RESULTS_E1", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 479, 488 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-13-RESULTS_T4" }, { "role": "Site", "ref_id": "PMC-1310901-13-RESULTS_T11" } ] }, { "id": "PMC-1310901-13-RESULTS_E2", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 516, 524 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-13-RESULTS_T5" } ] }, { "id": "PMC-1310901-13-RESULTS_E3", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 626, 634 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-13-RESULTS_T6" } ] }, { "id": "PMC-1310901-13-RESULTS_E4", "type": "Negative_regulation", "trigger": { "text": [ "abrogation" ], "offsets": [ [ 684, 694 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-13-RESULTS_T7" }, { "role": "Site", "ref_id": "PMC-1310901-13-RESULTS_T15" } ] }, { "id": "PMC-1310901-13-RESULTS_E5", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 725, 733 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-13-RESULTS_T7" } ] } ]

[]

[]

[ { "id": "PMC-1447668-19-Materials_and_Methods__text", "type": "abstract", "text": [ "Flow cytometric analysis of Foxp3 protein expression.\nCryopreserved PBMCs from HAM/TSP patients or HTLV-I-infected ACs were thawed and washed with FACS buffer (1x PBS, 0.1% NaN3, 5% FBS). Cells (1.5 x 106) were fixed by sequential formaldehyde/methanol fixation as follows. Cells were carefully resuspended in FACS buffer and fixed with 100 mul of reagent A (Fix & Perm kit; Caltag Laboratories, Burlingame, California, United States) at room temperature for 3 min followed by 2 ml of 70% methanol for 5 min at 4 degreesC. Cells were washed twice and permeabilized with 100 mul of reagent B (Fix & Perm kit) and stained for intracellular Foxp3 with mouse anti-human Foxp3 monoclonal antibody (0.5 mug of ab22510; Abcam) or the appropriate isotype control for 30 min. Cells were washed twice and stained with Cy5-conjugated goat anti-mouse immunoglobulin F(ab')2 secondary antibody (Caltag Laboratories) for an additional 30 min. Cells were washed twice and stained for surface CD4 expression with PE-labeled anti-CD4 (BD) and CD25 expression with FITC-labeled anti-CD25 (BD). Cells were washed twice and analyzed on a FACSCalibur (BD). Data analysis was performed using FlowJo (Tree Star, Ashland, Oregon, United States)." ], "offsets": [ [ 0, 1221 ] ] } ]

[ { "id": "PMC-1447668-19-Materials_and_Methods_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 28, 33 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 638, 643 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 666, 671 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T4", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 977, 980 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T5", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1013, 1016 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T6", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 1026, 1030 ] ], "normalized": [] }, { "id": "PMC-1447668-19-Materials_and_Methods_T7", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 1065, 1069 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-19-Materials_and_Methods_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 42, 52 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-19-Materials_and_Methods_T1" } ] }, { "id": "PMC-1447668-19-Materials_and_Methods_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 981, 991 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-19-Materials_and_Methods_T4" } ] }, { "id": "PMC-1447668-19-Materials_and_Methods_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1031, 1041 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-19-Materials_and_Methods_T6" } ] } ]

[]

[]

[ { "id": "PMC-2889865-05-Results__text", "type": "abstract", "text": [ "NF-kappaB inhibition due to PKC-dependent Bcl10 degradation\nWestern blot analysis revealed an up-regulation of phosphorylated-PKC after 24 h treatment of Jurkat T-cells with PMA or HK E. coli (figure 7a), while IkappaBbeta levels remained unaffected (figure 7b). Bcl10 is a signalling protein that acts upstream of NF-kappaB in concert with CARMA1 and MALT1 and has been suggested to directly regulate NF-kappaB activity in T-cells [27]. Therefore, Bcl10 activation was evaluated in both control and PMA stimulated cells after 10 min, 1 h, 6 h, and 24 h using western blot analysis. The Bcl10 levels decreased following treatment with PMA, while in control cells, Bcl10 returned to higher levels by 24 h (figure 7c). This suggests that Bcl10 is involved in the PMA dependent inhibition of NF-kappaB activation." ], "offsets": [ [ 0, 810 ] ] } ]

[ { "id": "PMC-2889865-05-Results_T1", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 42, 47 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T2", "type": "Protein", "text": [ "IkappaBbeta" ], "offsets": [ [ 211, 222 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T3", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 263, 268 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T4", "type": "Protein", "text": [ "CARMA1" ], "offsets": [ [ 341, 347 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T5", "type": "Protein", "text": [ "MALT1" ], "offsets": [ [ 352, 357 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T6", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 449, 454 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T7", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 587, 592 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T8", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 664, 669 ] ], "normalized": [] }, { "id": "PMC-2889865-05-Results_T9", "type": "Protein", "text": [ "Bcl10" ], "offsets": [ [ 736, 741 ] ], "normalized": [] } ]

[ { "id": "PMC-2889865-05-Results_E1", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 32, 41 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_E2" } ] }, { "id": "PMC-2889865-05-Results_E2", "type": "Protein_catabolism", "trigger": { "text": [ "degradation" ], "offsets": [ [ 48, 59 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_T1" } ] }, { "id": "PMC-2889865-05-Results_E3", "type": "Regulation", "trigger": { "text": [ "unaffected" ], "offsets": [ [ 239, 249 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_T2" } ] }, { "id": "PMC-2889865-05-Results_E4", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 455, 465 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_T6" } ] }, { "id": "PMC-2889865-05-Results_E5", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 600, 609 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_T7" } ] }, { "id": "PMC-2889865-05-Results_E6", "type": "Positive_regulation", "trigger": { "text": [ "returned to higher" ], "offsets": [ [ 670, 688 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2889865-05-Results_T8" } ] } ]

[]

[]

[ { "id": "PMC-2065877-21-Caption-Figure_3__text", "type": "abstract", "text": [ "LMP1 Promotes B Cell Survival and Proliferation In Vitro\n(A) MTS assay of splenocytes from WT and LMP1 transgenic mice. Splenocytes were cultured in the presence (grey bars) or absence (black bars) of IL4 for 3 d. The results are the mean +/- SEM of triplicate samples averaged from multiple mice where \"n\" the number of mice analyzed is as follows: n = 2 for WT lymphocytes and WT lymphomas, n = 11 for LMP1 transgenic lymphocytes, and n = 13 for LMP1 transgenic lymphomas.\n(B) EMA exclusion of CD19+ gated splenocytes from WT and LMP1 transgenic mice showing percentage of viable B cells cultured with (white bars) or without (black bars) IL4 for 2 d.\n(C) Flow cytometry analysis for incorporated BrdU in WT and LMP1 transgenic lymphoma cells cultured with or without IL4 for 2 d. Shown are the results from WT lymphoma 1 and LMP1 transgenic lymphoma 2. Percentages of cells in each quadrant are shown." ], "offsets": [ [ 0, 904 ] ] } ]

[ { "id": "PMC-2065877-21-Caption-Figure_3_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T2", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 98, 102 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T3", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 201, 204 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T4", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 404, 408 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T5", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 448, 452 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T6", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 496, 500 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T7", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 532, 536 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T8", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 641, 644 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T9", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 714, 718 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T10", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 770, 773 ] ], "normalized": [] }, { "id": "PMC-2065877-21-Caption-Figure_3_T11", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 828, 832 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3148254-06-Discussion__text", "type": "abstract", "text": [ "Our results indicate that the protein HOIP is critical for CD40-induced signals that regulate B cell function. Our data show that HOIP-dependent cellular responses include CD40-mediated upregulation of CD80 expression and synthesis of germline RNA transcripts from the immunoglobulin heavy chain locus, two events that are important for T-cell-dependent antibody-mediated immune responses. At the molecular level, our data indicate that HOIP functions downstream of TRAF2 in the CD40 signaling pathway and that HOIP has a key role in promoting the recruitment of the IKK complex to CD40. Consistent with this, CD40-induced activation of NF-kappaB is dependent on the presence of HOIP. In addition, our data show that HOIP facilitates the activation of JNK in response to CD40 engagement. Together, our findings provide support for the conclusion that HOIP is a key component of the CD40 signaling pathway. Given the importance of CD40 signaling in both cellular and humoral immune responses, our results indicate that HOIP has a critical role in the regulation of the immune system.\nThe functional properties of HOIP have only been partially characterized. Initial studies showed that HOIP and the related protein HOIL-1 are components of a large (~600 kDa) protein complex capable of synthesizing linear polyubiquitin chains [5]. Subsequent studies showed that a HOIP-containing complex can interact with IKKgamma and facilitate activation of NF-kappaB via the canonical pathway [16]. These data, considered together with ours, suggest that a HOIP-containing complex mediates recruitment of IKKgamma to the CD40 signaling complex. In addition, CD40-associated HOIP could play a role in activating IKKgamma after its recruitment to the signaling complex [16]. The higher molecular weight forms of IKKgamma we observed in CD40 immunoprecipitates would be consistent with the presence of post-transcriptional modifications including phosphorylation and ubiquitination, which have been suggested to reduce or enhance IKKgamma activity, respectively [16], [17].\nThe mechanisms by which HOIP mediates recruitment of the IKK complex to CD40 and by which HOIP is recruited to CD40 remain unclear. A previous study indicates that HOIP may mediate direct contacts with the IKK complex [16], suggesting that it functions as an adaptor for the recruitment of the IKK complex to CD40. However, the ubiquitin ligase activity of HOIP suggests that it is more than a simple adapter molecule. As IKKgamma appears capable of binding linear polyubiquitin [18], [19], it is possible that HOIP directs formation of linear polyubiquitin chains on a CD40-associated factor, and it is these chains that serve to recruit IKKgamma to the CD40 signaling complex. The molecular interactions necessary for recruitment of HOIP itself to the CD40 signaling complex also remain to be fully characterized. We previously showed that the recruitment of HOIP to the signaling complex is TRAF2-dependent [8]. Potentially, TRAF2 and HOIP directly interact, but it is possible that the ubiquitin ligase activity of TRAF2 [20] (or TRAF2-associated proteins, such as the cIAPs [21]) generates K63-linked polyubiquitin chains to which HOIP can bind and thus associate with the CD40 signaling complex [22].\nWhile our previous work indicated a potentially important link between TRAF2 and HOIP in CD40 signaling, the signals and functions tested here are dependent upon TRAF6 as well as TRAF2. In previous experiments with TRAF-deficient A20.2J cells, we found that the activation of NF-kappaB by CD40 could be mediated by either TRAF2 or TRAF6, while activation of JNK by CD40 was largely dependent on TRAF6 alone [8]. HOIP deficiency compromises the CD40-mediated activation of both NF-kappaB and JNK, indicating that signals mediated by both TRAF2 and TRAF6 likely pass through HOIP. Our previous work also demonstrated that the CD40-mediated activation of NF-kappaB and JNK, while TRAF6-dependent, was not compromised by the disruption of the binding site for TRAF6 in the cytoplasmic domain of CD40 or deletion of the receptor binding domain (the TRAF-C domain) in TRAF6 [8]. These observations indicate that TRAF6 need not directly bind CD40 in order to mediate certain signals, suggesting the assembly of a signaling complex not directly associated with the receptor. If such a complex exists, our results indicate that the absence of HOIP compromises its function as well.\nAlthough the experiments presented here focus on CD40, our results and those of other groups [16], [22] support the possibility that HOIP is important in many signaling pathways in which TRAF2 or TRAF6 are involved, including those associated with various members of the TNF receptor superfamily and the Toll-like receptors. The potential importance of HOIP in immune function and TNFR family signaling is further supported by the recent discovery that HOIP interacts with a protein known as SHARPIN (SHANK-associated RH domain interacting protein in postsynaptic density), which appears capable of working together with HOIP and HOIL to mediate the assembly of linear polyubiquitin [14], [23], [24]. Interestingly, mice with a spontaneous mutation in the gene encoding SHARPIN (chronic proliferative dermatitis (cpdm) mice) exhibit chronic inflammation of the skin and internal organs, defective development of secondary lymphoid tissue, and defects in the production of switched immunoglobulin isotypes [17], [25]. The apparently intimate functional link between SHARPIN and HOIP strongly suggests that at least part of the cpdm phenotype stems from defects in the regulation or function of HOIP." ], "offsets": [ [ 0, 5636 ] ] } ]

[ { "id": "PMC-3148254-06-Discussion_T1", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 38, 42 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T2", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 59, 63 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T3", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 130, 134 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T4", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 172, 176 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T5", "type": "Protein", "text": [ "CD80" ], "offsets": [ [ 202, 206 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T6", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 437, 441 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T7", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 466, 471 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T8", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 479, 483 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T9", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 511, 515 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T10", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 582, 586 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T11", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 610, 614 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T12", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 717, 721 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T13", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 771, 775 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T14", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 851, 855 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T15", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 882, 886 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T16", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 930, 934 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T17", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1018, 1022 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T18", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1112, 1116 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T19", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1185, 1189 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T20", "type": "Protein", "text": [ "HOIL-1" ], "offsets": [ [ 1214, 1220 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T21", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 1406, 1414 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T22", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 1592, 1600 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T23", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1645, 1649 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T24", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1661, 1665 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T25", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 1698, 1706 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T26", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 1797, 1805 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T27", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1821, 1825 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T28", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 2014, 2022 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T29", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2082, 2086 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T30", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 2130, 2134 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T31", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2148, 2152 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T32", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 2169, 2173 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T33", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2222, 2226 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T34", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 2367, 2371 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T35", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2415, 2419 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T36", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 2480, 2488 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T37", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2569, 2573 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T38", "type": "Protein", "text": [ "IKKgamma" ], "offsets": [ [ 2697, 2705 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T39", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2793, 2797 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T40", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2919, 2923 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T41", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 2952, 2957 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T42", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 2986, 2991 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T43", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 2996, 3000 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T44", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 3077, 3082 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T45", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 3194, 3198 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T46", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 3336, 3341 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T47", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 3346, 3350 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T48", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 3354, 3358 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T49", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 3427, 3432 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T50", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 3444, 3449 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T51", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 3554, 3558 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T52", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 3587, 3592 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T53", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 3596, 3601 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T54", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 3630, 3634 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T55", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 3660, 3665 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T56", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 3677, 3681 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T57", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 3709, 3713 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T58", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 3802, 3807 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T59", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 3812, 3817 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T60", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 3838, 3842 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T61", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 3889, 3893 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T62", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 3942, 3947 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T63", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 4021, 4026 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T64", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 4056, 4060 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T65", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 4127, 4132 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T66", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 4171, 4176 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T67", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 4200, 4204 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T68", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 4399, 4403 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T69", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 4487, 4491 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T70", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 4571, 4575 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T71", "type": "Protein", "text": [ "TRAF2" ], "offsets": [ [ 4625, 4630 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T72", "type": "Protein", "text": [ "TRAF6" ], "offsets": [ [ 4634, 4639 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T73", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 4791, 4795 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T74", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 4891, 4895 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T75", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 4930, 4937 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T76", "type": "Protein", "text": [ "SHANK-associated RH domain interacting protein in postsynaptic density" ], "offsets": [ [ 4939, 5009 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T77", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 5059, 5063 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T78", "type": "Protein", "text": [ "HOIL" ], "offsets": [ [ 5068, 5072 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T79", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 5208, 5215 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T80", "type": "Protein", "text": [ "SHARPIN" ], "offsets": [ [ 5503, 5510 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T81", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 5515, 5519 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T82", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 5631, 5635 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T83", "type": "Anaphora", "text": [ "its" ], "offsets": [ [ 1713, 1716 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T84", "type": "Anaphora", "text": [ "post-transcriptional modifications" ], "offsets": [ [ 1886, 1920 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T85", "type": "Anaphora", "text": [ "which" ], "offsets": [ [ 1967, 1972 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T86", "type": "Anaphora", "text": [ "it" ], "offsets": [ [ 2298, 2300 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T125", "type": "Entity", "text": [ "binding site" ], "offsets": [ [ 4004, 4016 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T127", "type": "Entity", "text": [ "receptor binding domain" ], "offsets": [ [ 4080, 4103 ] ], "normalized": [] }, { "id": "PMC-3148254-06-Discussion_T87", "type": "Anaphora", "text": [ "a protein" ], "offsets": [ [ 4911, 4920 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-06-Discussion_E1", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1931, 1946 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T26" } ] }, { "id": "PMC-3148254-06-Discussion_E2", "type": "Ubiquitination", "trigger": { "text": [ "ubiquitination" ], "offsets": [ [ 1951, 1965 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T26" } ] }, { "id": "PMC-3148254-06-Discussion_E3", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 135, 144 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E4" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T3" } ] }, { "id": "PMC-3148254-06-Discussion_E4", "type": "Positive_regulation", "trigger": { "text": [ "mediated" ], "offsets": [ [ 177, 185 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E5" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T4" } ] }, { "id": "PMC-3148254-06-Discussion_E5", "type": "Positive_regulation", "trigger": { "text": [ "upregulation" ], "offsets": [ [ 186, 198 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E6" } ] }, { "id": "PMC-3148254-06-Discussion_E6", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 207, 217 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T5" } ] }, { "id": "PMC-3148254-06-Discussion_E7", "type": "Regulation", "trigger": { "text": [ "downstream" ], "offsets": [ [ 452, 462 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T6" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T7" } ] }, { "id": "PMC-3148254-06-Discussion_E8", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 526, 530 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E9" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T9" } ] }, { "id": "PMC-3148254-06-Discussion_E9", "type": "Positive_regulation", "trigger": { "text": [ "promoting" ], "offsets": [ [ 534, 543 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E10" } ] }, { "id": "PMC-3148254-06-Discussion_E10", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 548, 559 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T10" } ] }, { "id": "PMC-3148254-06-Discussion_E11", "type": "Binding", "trigger": { "text": [ "engagement" ], "offsets": [ [ 776, 786 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T13" } ] }, { "id": "PMC-3148254-06-Discussion_E12", "type": "Binding", "trigger": { "text": [ "interact" ], "offsets": [ [ 1392, 1400 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T21" } ] }, { "id": "PMC-3148254-06-Discussion_E13", "type": "Positive_regulation", "trigger": { "text": [ "mediates" ], "offsets": [ [ 1568, 1576 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E14" } ] }, { "id": "PMC-3148254-06-Discussion_E14", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 1577, 1588 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T22" } ] }, { "id": "PMC-3148254-06-Discussion_E15", "type": "Binding", "trigger": { "text": [ "associated" ], "offsets": [ [ 1650, 1660 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T23" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T24" } ] }, { "id": "PMC-3148254-06-Discussion_E16", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 1679, 1683 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E17" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T24" } ] }, { "id": "PMC-3148254-06-Discussion_E17", "type": "Positive_regulation", "trigger": { "text": [ "activating" ], "offsets": [ [ 1687, 1697 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T25" } ] }, { "id": "PMC-3148254-06-Discussion_E18", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 1717, 1728 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T24" } ] }, { "id": "PMC-3148254-06-Discussion_E19", "type": "Negative_regulation", "trigger": { "text": [ "reduce" ], "offsets": [ [ 1996, 2002 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T28" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_E1" } ] }, { "id": "PMC-3148254-06-Discussion_E20", "type": "Negative_regulation", "trigger": { "text": [ "reduce" ], "offsets": [ [ 1996, 2002 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T28" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_E2" } ] }, { "id": "PMC-3148254-06-Discussion_E21", "type": "Positive_regulation", "trigger": { "text": [ "enhance" ], "offsets": [ [ 2006, 2013 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T28" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_E1" } ] }, { "id": "PMC-3148254-06-Discussion_E22", "type": "Positive_regulation", "trigger": { "text": [ "enhance" ], "offsets": [ [ 2006, 2013 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T28" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_E2" } ] }, { "id": "PMC-3148254-06-Discussion_E23", "type": "Positive_regulation", "trigger": { "text": [ "mediates" ], "offsets": [ [ 2087, 2095 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E24" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T29" } ] }, { "id": "PMC-3148254-06-Discussion_E24", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 2096, 2107 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T30" } ] }, { "id": "PMC-3148254-06-Discussion_E25", "type": "Binding", "trigger": { "text": [ "recruited" ], "offsets": [ [ 2156, 2165 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T31" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T32" } ] }, { "id": "PMC-3148254-06-Discussion_E26", "type": "Positive_regulation", "trigger": { "text": [ "functions as an adaptor" ], "offsets": [ [ 2301, 2324 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E27" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T33" } ] }, { "id": "PMC-3148254-06-Discussion_E27", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 2333, 2344 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T34" } ] }, { "id": "PMC-3148254-06-Discussion_E28", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 2508, 2515 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T36" } ] }, { "id": "PMC-3148254-06-Discussion_E29", "type": "Positive_regulation", "trigger": { "text": [ "serve" ], "offsets": [ [ 2680, 2685 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E30" } ] }, { "id": "PMC-3148254-06-Discussion_E30", "type": "Binding", "trigger": { "text": [ "recruit" ], "offsets": [ [ 2689, 2696 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T38" } ] }, { "id": "PMC-3148254-06-Discussion_E31", "type": "Positive_regulation", "trigger": { "text": [ "necessary" ], "offsets": [ [ 2764, 2773 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E32" } ] }, { "id": "PMC-3148254-06-Discussion_E32", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 2778, 2789 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T39" } ] }, { "id": "PMC-3148254-06-Discussion_E33", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 2904, 2915 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T40" } ] }, { "id": "PMC-3148254-06-Discussion_E34", "type": "Regulation", "trigger": { "text": [ "dependent" ], "offsets": [ [ 2958, 2967 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E33" }, { "role": "Cause", "ref_id": "PMC-3148254-06-Discussion_T41" } ] }, { "id": "PMC-3148254-06-Discussion_E35", "type": "Binding", "trigger": { "text": [ "interact" ], "offsets": [ [ 3010, 3018 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T42" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T43" } ] }, { "id": "PMC-3148254-06-Discussion_E36", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 3203, 3207 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T45" } ] }, { "id": "PMC-3148254-06-Discussion_E37", "type": "Binding", "trigger": { "text": [ "associate" ], "offsets": [ [ 3217, 3226 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T45" } ] }, { "id": "PMC-3148254-06-Discussion_E38", "type": "Negative_regulation", "trigger": { "text": [ "deficiency" ], "offsets": [ [ 3682, 3692 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T56" } ] }, { "id": "PMC-3148254-06-Discussion_E39", "type": "Negative_regulation", "trigger": { "text": [ "disruption" ], "offsets": [ [ 3986, 3996 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T64" }, { "role": "Site", "ref_id": "PMC-3148254-06-Discussion_T125" } ] }, { "id": "PMC-3148254-06-Discussion_E40", "type": "Negative_regulation", "trigger": { "text": [ "deletion" ], "offsets": [ [ 4064, 4072 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T65" }, { "role": "Site", "ref_id": "PMC-3148254-06-Discussion_T127" } ] }, { "id": "PMC-3148254-06-Discussion_E41", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 4195, 4199 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T66" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T67" } ] }, { "id": "PMC-3148254-06-Discussion_E42", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 4388, 4395 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T68" } ] }, { "id": "PMC-3148254-06-Discussion_E43", "type": "Binding", "trigger": { "text": [ "interacts" ], "offsets": [ [ 4896, 4905 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T74" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T75" } ] }, { "id": "PMC-3148254-06-Discussion_E44", "type": "Binding", "trigger": { "text": [ "link" ], "offsets": [ [ 5490, 5494 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T80" }, { "role": "Theme2", "ref_id": "PMC-3148254-06-Discussion_T81" } ] }, { "id": "PMC-3148254-06-Discussion_E45", "type": "Negative_regulation", "trigger": { "text": [ "defects" ], "offsets": [ [ 5590, 5597 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_E46" } ] }, { "id": "PMC-3148254-06-Discussion_E46", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 5605, 5615 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-06-Discussion_T82" } ] } ]

[ { "id": "PMC-3148254-06-Discussion_1", "entity_ids": [ "PMC-3148254-06-Discussion_T75", "PMC-3148254-06-Discussion_T76" ] } ]

[ { "id": "PMC-3148254-06-Discussion_R1", "type": "Coreference", "arg1_id": "PMC-3148254-06-Discussion_T83", "arg2_id": "PMC-3148254-06-Discussion_T24", "normalized": [] }, { "id": "PMC-3148254-06-Discussion_R4", "type": "Coreference", "arg1_id": "PMC-3148254-06-Discussion_T85", "arg2_id": "PMC-3148254-06-Discussion_T84", "normalized": [] }, { "id": "PMC-3148254-06-Discussion_R5", "type": "Coreference", "arg1_id": "PMC-3148254-06-Discussion_T86", "arg2_id": "PMC-3148254-06-Discussion_T33", "normalized": [] }, { "id": "PMC-3148254-06-Discussion_R6", "type": "Coreference", "arg1_id": "PMC-3148254-06-Discussion_T87", "arg2_id": "PMC-3148254-06-Discussion_T75", "normalized": [] } ]

[ { "id": "PMC-1447668-09-Discussion__text", "type": "abstract", "text": [ "In the present study, we show that Foxp3 functions as a potent repressor of NF-kappaB- and CREB-dependent transcriptional activation. Furthermore, the carboxyl-terminal FKH domain appears to be dispensable for mediating these effects, at least in T cell populations. This observation may become important in light of recent reports suggesting that Foxp3 expression in thymic epithelial cells was crucial for directing development of T cells in the thymus [42]. Interestingly, the majority of the genetic mutations associated with IPEX, a severe autoimmune disorder caused by functional inactivation of Foxp3, map to the carboxyl-terminal FKH domain or the leucine zipper domain in the central region of the protein. Only one mutation associated with IPEX to date has been mapped to the amino-terminal proline-rich region [43]. It is possible that the FKH domain has a complex tertiary structure that is particularly sensitive to misfolding caused by genetic mutations and that an intact FKH domain is absolutely critical for promoting Foxp3 function in the nucleus, whereas the structure of the amino-terminal proline-rich region may tolerate certain mutations as long as the NF-kappaB/NF-AT binding motif remains unaltered. This motif may also include the zinc finger domain. A logical region that may be targeted by the amino-terminal proline-rich region of Foxp3 is the Rel homology domain found in both NF-kappaB and NF-AT family proteins. A region that may also be important with respect to Foxp3 function is the leucine zipper domain, as demonstrated by the number of mutations associated with IPEX that have been mapped in this region of Foxp3. The role of this domain in Foxp3 function remains uncharacterized, but may play a role in dimer formation as it does in other Foxp family members [44].\nBecause the pathogenesis of a number of retroviral-induced immunologic disorders such as HIV-1/AIDS and HTLV-I/HAM/TSP have been associated with dysregulation of Foxp3 expression [8,45], we also examined the role of Foxp3 in retroviral gene expression. HIV-1 LTR activation in CD4+ T cells is critically dependent on two tandem NF-kappaB sites located between nucleotide positions -102 and -81 within the HIV-1 enhancer region, whereas HTLV-I LTR activation in the presence or absence of the HTLV-I-encoded transactivator protein Tax is independent of NF-kappaB [18]. To our knowledge for the first time, Foxp3 was shown to have a direct effect on HIV-1 LTR transcription. Deletion of the NF-kappaB sites within the HIV-1 enhancer region reduced the responsiveness of the HIV-1 LTR to Foxp3-mediated suppression. In addition, the FKH domain of Foxp3 was required for this inhibitory effect in HEK 293T cells, but not in Jurkat T cells, similar to Foxp3-mediated suppression of a synthetic NF-kappaB reporter. The direct effect of Foxp3 down-regulating HIV-1 gene expression correlates well with recently reported evidence indicating that higher regulatory activity of CD4+CD25+ T cells from HIV-1-infected patients was associated with lower HIV-1 viral loads in these patients [46].\nFoxp3 also affected two well-known functions of HTLV-I Tax: transactivation of the NF-kappaB pathway and, most surprisingly, transactivation of the HTLV-I LTR. Transactivation of the HTLV-I LTR by Tax involves the interaction of ATF/CREB factors with Tax in the nucleus. Binding of Tax enhances ATF/CREB dimerization and promotes assembly of Tax-ATF/CREB complexes onto specific sequences in the viral promoter known as Tax-responsive elements. This series of steps allows Tax to recruit coactivator proteins CBP/p300 to the viral promoter and facilitate a high level of viral gene expression [24-26]. Transactivation of the NF-kappaB pathway by Tax was inhibited by overexpression of full-length Foxp3, but not deltaFKH, as seen with basal activation of the HIV-1 LTR and a synthetic NF-kappaB reporter in HEK 293T cells. However, Tax-mediated transactivation of the HTLV-I LTR was inhibited by overexpression of both full-length Foxp3 as well as deltaFKH in both HEK 293T cells and CD4+ T cells. We demonstrated that Foxp3 did not directly affect the functioning of Tax, but rather Foxp3 targeted the transcription factors required for Tax transactivation (i.e., NF-kappaB and a then-unknown cellular factor, which we identified in this study as CREB). The negative effect of Foxp3 on HTLV-I gene expression was confirmed utilizing an HTLV-I infectious molecular clone.\nImportantly, we demonstrated that HTLV-I-infected individuals with the highest levels of Foxp3 protein expression within the CD4+CD25+ T cells population exhibited lower proviral loads than did individuals with the lowest levels of Foxp3 protein expression. Previous studies have demonstrated that the HTLV-I proviral load directly correlates with HTLV-I Tax mRNA load, the frequency of immunopathogenic virus-specific CD8+ T cells, and disease severity in patients with HAM/TSP [47]. These results have important implications on the utility of Foxp3 in controlling viral gene expression and thus pathogenesis of HAM/TSP. Therefore, Foxp3 becomes an attractive target for the development of novel therapeutic applications directed at modulating the expression of this important regulatory protein, especially in light of recent observations that the expression of Foxp3 can also be down-regulated by HTLV-I Tax [8].\nAs the activation of the HTLV-I LTR depends primarily on ATF/CREB proteins (whether in the presence or the absence of Tax), we investigated whether Foxp3 could interact with this additional cellular signaling pathway. While the DNA-binding activity of CREB is, in most cases, constitutive, the transactivation potential of CREB is regulated by the phosphorylation of CREB and recruitment of CBP/p300 [48]. Our data demonstrate that Foxp3 interferes with the latter of these two processes and that the recruitment of the coactivator protein p300, and resulting transcriptional activation are blocked by Foxp3. This may be the result of the physical interaction we detected between Foxp3 and p300. With respect to HTLV-I LTR activity, while full-length Foxp3 inhibited both basal and Tax-dependent transcription by ~50%, deltaFKH appeared less effective in suppressing basal activation (~25% inhibition) compared to Tax-dependent activation (~50% inhibition). The effect of deltaFKH on basal activation of the HTLV-I LTR in HEK 293T cells was very similar to that shown for a synthetic CREB reporter, suggesting that the FKH domain of Foxp3 is important at some level. As observed with NF-kappaB activation, the Foxp3 mutant lacking the FKH domain was a stronger inhibitor of CREB activation in CD4+ T cells than in HEK 293T epithelial cells. Therefore, it appears that in CD4+ T cells, the FKH domain is dispensable for the proper functioning of Foxp3 with respect to both NF-kappaB and CREB activation.\nIn summary, this is, to our knowledge, the first direct evidence implicating a role for the Treg-specific transcription factor Foxp3 in regulating retroviral gene expression. In addition, we identify the CREB pathway as a molecular target of Foxp3. Since CREB has been shown to regulate multiple genes involved in transcription (e.g., JunD, c-Fos, signal transducer of activated T cells 3 [STAT3]), cell cycle (e.g., p15INK4b, cyclin A, cyclin D1), and immune regulation (e.g., IL-2, IL-6, T-cell receptor alpha) (reviewed in [48]), the findings presented in this report broaden the potential range of signaling pathways under the control of the regulatory protein Foxp3. Our evidence stresses the importance of Foxp3 expression and Treg function in the development and maintenance of protective immunity against HIV-1 and HTLV-I. Based on recent findings, Foxp3 may limit HIV-1 and HTLV-I transcription by interfering with activation of NF-kappaB and CREB pathways. However, observing that this inhibitory effect is not absolute, a low level of viral gene expression may persist in CD4+ T cells (in particular regulatory T cells, which are known reservoirs of HIV-1 and HTLV-I) and result in the accumulation of viral proteins that either stimulate NF-kappaB and/or CREB activation or directly inhibit Foxp3 expression or function. The imbalance of NF-kappaB and CREB activation caused by these viral gene products may be a crucial step in the pathogenesis of virus-induced immunological disorders such as AIDS and HAM/TSP. Future studies will be directed at identifying and characterizing cellular proteins that interact with Foxp3 both in the nucleus and cytoplasm, in order to better address how Foxp3 functions to guide the development and function of regulatory T cells in health and disease." ], "offsets": [ [ 0, 8676 ] ] } ]

[ { "id": "PMC-1447668-09-Discussion_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 35, 40 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 348, 353 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 602, 607 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T4", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1035, 1040 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T5", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1360, 1365 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T6", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1496, 1501 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T7", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1645, 1650 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T8", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1679, 1684 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T9", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1966, 1971 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T10", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2020, 2025 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T11", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2081, 2084 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T12", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 2334, 2337 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2409, 2414 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T14", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2589, 2594 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T15", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2648, 2653 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T16", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2751, 2756 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T17", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2834, 2839 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T18", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2972, 2975 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T19", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 2976, 2980 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T20", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3087, 3092 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T21", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3142, 3145 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T22", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3284, 3287 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T23", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3338, 3341 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T24", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3369, 3372 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T25", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3429, 3432 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T26", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3560, 3563 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T27", "type": "Protein", "text": [ "CBP" ], "offsets": [ [ 3596, 3599 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T28", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 3600, 3604 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T29", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3733, 3736 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T30", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 3784, 3789 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T31", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 3799, 3807 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T32", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 3919, 3922 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T33", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4018, 4023 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T34", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 4035, 4043 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T35", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 4071, 4074 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T36", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4106, 4111 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T37", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 4155, 4158 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T38", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4171, 4176 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T39", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 4225, 4228 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T40", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4365, 4370 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T41", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4548, 4553 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T42", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 4584, 4587 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T43", "type": "Protein", "text": [ "CD25" ], "offsets": [ [ 4588, 4592 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T44", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 4691, 4696 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T45", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 4814, 4817 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T46", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 4878, 4881 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T47", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5004, 5009 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T48", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5092, 5097 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T49", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5323, 5328 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T50", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 5366, 5369 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T51", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 5493, 5496 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T52", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5523, 5528 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T53", "type": "Protein", "text": [ "CBP" ], "offsets": [ [ 5766, 5769 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T54", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 5770, 5774 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T55", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5807, 5812 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T56", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 5915, 5919 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T57", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 5977, 5982 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T58", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 6055, 6060 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T59", "type": "Protein", "text": [ "p300" ], "offsets": [ [ 6065, 6069 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T60", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 6126, 6131 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T61", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 6157, 6160 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T62", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 6194, 6202 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T63", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 6289, 6292 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T64", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 6347, 6355 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T65", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 6508, 6513 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T66", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 6585, 6590 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T67", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 6668, 6671 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T68", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 6746, 6749 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T69", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 6820, 6825 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T70", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 7005, 7010 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T71", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 7120, 7125 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T72", "type": "Protein", "text": [ "JunD" ], "offsets": [ [ 7213, 7217 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T73", "type": "Protein", "text": [ "c-Fos" ], "offsets": [ [ 7219, 7224 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T74", "type": "Protein", "text": [ "signal transducer of activated T cells 3" ], "offsets": [ [ 7226, 7266 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T75", "type": "Protein", "text": [ "STAT3" ], "offsets": [ [ 7268, 7273 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T76", "type": "Protein", "text": [ "p15INK4b" ], "offsets": [ [ 7295, 7303 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T77", "type": "Protein", "text": [ "cyclin A" ], "offsets": [ [ 7305, 7313 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T78", "type": "Protein", "text": [ "cyclin D1" ], "offsets": [ [ 7315, 7324 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T79", "type": "Protein", "text": [ "IL-2" ], "offsets": [ [ 7356, 7360 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T80", "type": "Protein", "text": [ "IL-6" ], "offsets": [ [ 7362, 7366 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T81", "type": "Protein", "text": [ "T-cell receptor alpha" ], "offsets": [ [ 7368, 7389 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T82", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 7543, 7548 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T83", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 7590, 7595 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T84", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 7735, 7740 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T85", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 7961, 7964 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T86", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 8181, 8186 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T87", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 8506, 8511 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T88", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 8578, 8583 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T98", "type": "Entity", "text": [ "amino-terminal proline-rich region" ], "offsets": [ [ 1322, 1356 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T99", "type": "Entity", "text": [ "leucine zipper domain" ], "offsets": [ [ 1518, 1539 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T89", "type": "Anaphora", "text": [ "this domain" ], "offsets": [ [ 1664, 1675 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T90", "type": "Anaphora", "text": [ "it" ], "offsets": [ [ 1761, 1763 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T91", "type": "Anaphora", "text": [ "this important regulatory protein" ], "offsets": [ [ 5222, 5255 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T92", "type": "Anaphora", "text": [ "the latter of these two processes" ], "offsets": [ [ 5829, 5862 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T93", "type": "Anaphora", "text": [ "This" ], "offsets": [ [ 5984, 5988 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T127", "type": "Entity", "text": [ "FKH domain" ], "offsets": [ [ 6610, 6620 ] ], "normalized": [] }, { "id": "PMC-1447668-09-Discussion_T94", "type": "Anaphora", "text": [ "multiple genes" ], "offsets": [ [ 7165, 7179 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-09-Discussion_E1", "type": "Negative_regulation", "trigger": { "text": [ "blocked" ], "offsets": [ [ 5966, 5973 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E32" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T57" } ] }, { "id": "PMC-1447668-09-Discussion_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 354, 364 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T2" } ] }, { "id": "PMC-1447668-09-Discussion_E3", "type": "Negative_regulation", "trigger": { "text": [ "inactivation" ], "offsets": [ [ 586, 598 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T3" } ] }, { "id": "PMC-1447668-09-Discussion_E4", "type": "Binding", "trigger": { "text": [ "targeted" ], "offsets": [ [ 1306, 1314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T5" }, { "role": "Site", "ref_id": "PMC-1447668-09-Discussion_T98" } ] }, { "id": "PMC-1447668-09-Discussion_E5", "type": "Regulation", "trigger": { "text": [ "play a role" ], "offsets": [ [ 1727, 1738 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E6" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T6" }, { "role": "CSite", "ref_id": "PMC-1447668-09-Discussion_T99" } ] }, { "id": "PMC-1447668-09-Discussion_E6", "type": "Binding", "trigger": { "text": [ "dimer formation" ], "offsets": [ [ 1742, 1757 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T8" } ] }, { "id": "PMC-1447668-09-Discussion_E7", "type": "Regulation", "trigger": { "text": [ "does" ], "offsets": [ [ 1764, 1768 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E6" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T6" }, { "role": "CSite", "ref_id": "PMC-1447668-09-Discussion_T99" } ] }, { "id": "PMC-1447668-09-Discussion_E8", "type": "Regulation", "trigger": { "text": [ "dysregulation" ], "offsets": [ [ 1949, 1962 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E9" } ] }, { "id": "PMC-1447668-09-Discussion_E9", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1972, 1982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T9" } ] }, { "id": "PMC-1447668-09-Discussion_E10", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 3301, 3312 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T23" } ] }, { "id": "PMC-1447668-09-Discussion_E11", "type": "Binding", "trigger": { "text": [ "Binding" ], "offsets": [ [ 3358, 3365 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T24" } ] }, { "id": "PMC-1447668-09-Discussion_E12", "type": "Positive_regulation", "trigger": { "text": [ "promotes" ], "offsets": [ [ 3408, 3416 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E13" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_E11" } ] }, { "id": "PMC-1447668-09-Discussion_E13", "type": "Binding", "trigger": { "text": [ "assembly" ], "offsets": [ [ 3417, 3425 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T25" } ] }, { "id": "PMC-1447668-09-Discussion_E14", "type": "Binding", "trigger": { "text": [ "recruit" ], "offsets": [ [ 3567, 3574 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T26" }, { "role": "Theme2", "ref_id": "PMC-1447668-09-Discussion_T27" } ] }, { "id": "PMC-1447668-09-Discussion_E15", "type": "Binding", "trigger": { "text": [ "recruit" ], "offsets": [ [ 3567, 3574 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T26" }, { "role": "Theme2", "ref_id": "PMC-1447668-09-Discussion_T28" } ] }, { "id": "PMC-1447668-09-Discussion_E16", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3754, 3768 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T30" } ] }, { "id": "PMC-1447668-09-Discussion_E17", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3754, 3768 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T31" } ] }, { "id": "PMC-1447668-09-Discussion_E18", "type": "Gene_expression", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3983, 3997 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T33" } ] }, { "id": "PMC-1447668-09-Discussion_E19", "type": "Gene_expression", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3983, 3997 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T34" } ] }, { "id": "PMC-1447668-09-Discussion_E20", "type": "Positive_regulation", "trigger": { "text": [ "highest" ], "offsets": [ [ 4530, 4537 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E21" } ] }, { "id": "PMC-1447668-09-Discussion_E21", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4562, 4572 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T41" } ] }, { "id": "PMC-1447668-09-Discussion_E22", "type": "Negative_regulation", "trigger": { "text": [ "lowest" ], "offsets": [ [ 4674, 4680 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E23" } ] }, { "id": "PMC-1447668-09-Discussion_E23", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4705, 4715 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T44" } ] }, { "id": "PMC-1447668-09-Discussion_E24", "type": "Regulation", "trigger": { "text": [ "modulating" ], "offsets": [ [ 5193, 5203 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E25" } ] }, { "id": "PMC-1447668-09-Discussion_E25", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 5208, 5218 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T48" } ] }, { "id": "PMC-1447668-09-Discussion_E26", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 5309, 5319 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T49" } ] }, { "id": "PMC-1447668-09-Discussion_E27", "type": "Negative_regulation", "trigger": { "text": [ "down-regulated" ], "offsets": [ [ 5341, 5355 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E26" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T50" } ] }, { "id": "PMC-1447668-09-Discussion_E28", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 5751, 5762 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T53" } ] }, { "id": "PMC-1447668-09-Discussion_E29", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 5751, 5762 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T54" } ] }, { "id": "PMC-1447668-09-Discussion_E30", "type": "Negative_regulation", "trigger": { "text": [ "interferes" ], "offsets": [ [ 5813, 5823 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E28" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T55" } ] }, { "id": "PMC-1447668-09-Discussion_E31", "type": "Negative_regulation", "trigger": { "text": [ "interferes" ], "offsets": [ [ 5813, 5823 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E29" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_T55" } ] }, { "id": "PMC-1447668-09-Discussion_E32", "type": "Binding", "trigger": { "text": [ "recruitment" ], "offsets": [ [ 5876, 5887 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T56" } ] }, { "id": "PMC-1447668-09-Discussion_E33", "type": "Positive_regulation", "trigger": { "text": [ "result" ], "offsets": [ [ 6000, 6006 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E30" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_E34" } ] }, { "id": "PMC-1447668-09-Discussion_E34", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 6023, 6034 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T58" }, { "role": "Theme2", "ref_id": "PMC-1447668-09-Discussion_T59" } ] }, { "id": "PMC-1447668-09-Discussion_E35", "type": "Positive_regulation", "trigger": { "text": [ "result" ], "offsets": [ [ 6000, 6006 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E31" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_E34" } ] }, { "id": "PMC-1447668-09-Discussion_E36", "type": "Positive_regulation", "trigger": { "text": [ "result" ], "offsets": [ [ 6000, 6006 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E1" }, { "role": "Cause", "ref_id": "PMC-1447668-09-Discussion_E34" } ] }, { "id": "PMC-1447668-09-Discussion_E37", "type": "Negative_regulation", "trigger": { "text": [ "lacking" ], "offsets": [ [ 6598, 6605 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T66" }, { "role": "Site", "ref_id": "PMC-1447668-09-Discussion_T127" } ] }, { "id": "PMC-1447668-09-Discussion_E38", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T72" } ] }, { "id": "PMC-1447668-09-Discussion_E39", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T73" } ] }, { "id": "PMC-1447668-09-Discussion_E40", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T75" } ] }, { "id": "PMC-1447668-09-Discussion_E41", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T76" } ] }, { "id": "PMC-1447668-09-Discussion_E42", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T77" } ] }, { "id": "PMC-1447668-09-Discussion_E43", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T78" } ] }, { "id": "PMC-1447668-09-Discussion_E44", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T79" } ] }, { "id": "PMC-1447668-09-Discussion_E45", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T80" } ] }, { "id": "PMC-1447668-09-Discussion_E46", "type": "Regulation", "trigger": { "text": [ "regulate" ], "offsets": [ [ 7156, 7164 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T81" } ] }, { "id": "PMC-1447668-09-Discussion_E47", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 7596, 7606 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T83" } ] }, { "id": "PMC-1447668-09-Discussion_E48", "type": "Negative_regulation", "trigger": { "text": [ "inhibit" ], "offsets": [ [ 8173, 8180 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_E49" } ] }, { "id": "PMC-1447668-09-Discussion_E49", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 8187, 8197 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T86" } ] }, { "id": "PMC-1447668-09-Discussion_E50", "type": "Binding", "trigger": { "text": [ "interact" ], "offsets": [ [ 8492, 8500 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-09-Discussion_T87" } ] } ]

[ { "id": "PMC-1447668-09-Discussion_1", "entity_ids": [ "PMC-1447668-09-Discussion_T75", "PMC-1447668-09-Discussion_T74" ] } ]

[ { "id": "PMC-1447668-09-Discussion_R1", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T89", "arg2_id": "PMC-1447668-09-Discussion_T99", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R2", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T90", "arg2_id": "PMC-1447668-09-Discussion_T89", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R3", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T91", "arg2_id": "PMC-1447668-09-Discussion_T48", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R7", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T72", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R8", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T73", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R9", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T75", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R10", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T76", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R11", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T77", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R12", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T78", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R13", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T79", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R14", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T80", "normalized": [] }, { "id": "PMC-1447668-09-Discussion_R15", "type": "Coreference", "arg1_id": "PMC-1447668-09-Discussion_T94", "arg2_id": "PMC-1447668-09-Discussion_T81", "normalized": [] } ]

[ { "id": "PMC-2791889-03-Results__text", "type": "abstract", "text": [ "IL-10 Production by Th1 Cells Is Dependent on STAT4 but Not on STAT6, IFN-gamma, or IL-4 Signaling\nTo further elucidate the mechanisms required for the development of Th1 cells producing IL-10, we investigated the role of STAT4, one of the signaling pathways activated by IL-12 (Murphy et al., 2000). Naive CD4+ D011.10 T cells deficient in STAT4 (Ouyang et al., 1998) were cultured in the presence of IL-12 and OVA. Again, IL-10-producing Th1 cells were differentiated at the high antigen dose in the presence of IL-12 in DO11.10 T cells (Figure 2A). In contrast, in the absence of STAT4, the percentage of cells expressing IFN-gamma was dramatically diminished as expected and resulted in an increase in the percentage of cells expressing IL-4, but not IL-10 (Figure 2A), suggesting that STAT4 contributes to IL-10 expression by Th1 cells.\nBecause IL-10 expression is associated with an IL-4-induced Th2 cell phenotype, we investigated whether the differentiation of the IL-10-producing Th1 cells depended on signaling through the IL-4 receptor via STAT6 activation (Glimcher and Murphy, 2000; Murphy et al., 2000). The absence of STAT6 did not impair the differentiation of IL-10-producing Th1 cells in the presence of IL-12 and OVA (Figure 2A). In fact, a higher percentage of STAT6-deficient cells compared with WT cells produced both IL-10 and IFN-gamma (Figure 2A), which may be the result of the loss of Th2 cell control over a Th1 cell response. As expected, lack of STAT6 abrogated both IL-4 and IL-10 production by T cells developed with IL-4 or with low antigen dose (Figures 2B and 2C). However, in the absence of STAT4 signaling, IL-10 and IL-4 production by Th2 cells was if anything increased (Figures 2B and 2C). Thus, in contrast to what was observed under Th1 conditions, IL-10 expression by Th2 cells depended on STAT6, but not on STAT4, signaling (Figures 2B and 2C).\nTo investigate whether the inability of STAT4-deficient T cells to produce IL-10 might be due to the absence of IFN-gamma, as suggested before (Shaw et al., 2006), we differentiated DO11.10 or DO11.10 IFN-gamma-deficient naive CD4+ T cells in the presence of IL-12 and increasing doses of OVA. The secretion of IL-10 as induced by high antigen dose, and IL-12 was not affected by an absence of IFN-gamma (Figure 2D), showing that the expression of IL-10 by Th1 cells is independent of IFN-gamma. In the absence of IFN-gamma, we observed an increase in the secreted IL-4 as expected (data not shown).\nWe also tested for any potential role of IL-4 in the development of Th1 cells producing IL-10 by culturing DO11.10 or DO11.10 IL-4-deficient naive CD4+ T cells with IL-12 and increasing doses of antigen. As observed in the absence of STAT6 (Figure 2A), IL-4 deficiency had no effect on the development of Th1 cells producing IL-10 (Figure 2E), but compromised the development of Th2 cells producing IL-10 (Figure 2F). Thus, our data suggested that IL-10 production by Th1 or Th2 cells was dependent on the specific signaling pathways required for their differentiation, given that STAT4 is required for the induction of IL-10 production by Th1 cells and STAT6 for Th2 cells." ], "offsets": [ [ 0, 3163 ] ] } ]

[ { "id": "PMC-2791889-03-Results_T1", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T2", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 46, 51 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T3", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 63, 68 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T4", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 70, 79 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T5", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 84, 88 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T6", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 187, 192 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T7", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 222, 227 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T8", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 272, 277 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T9", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 307, 310 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T10", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 341, 346 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T11", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 402, 407 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T12", "type": "Protein", "text": [ "OVA" ], "offsets": [ [ 412, 415 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T13", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 424, 429 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T14", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 514, 519 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T15", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 583, 588 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T16", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 625, 634 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T17", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 741, 745 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T18", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 755, 760 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T19", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 790, 795 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T20", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 811, 816 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T21", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 850, 855 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T22", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 889, 893 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T23", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 973, 978 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T24", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 1033, 1037 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T25", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 1051, 1056 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T26", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 1133, 1138 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T27", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1177, 1182 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T28", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 1222, 1227 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T29", "type": "Protein", "text": [ "OVA" ], "offsets": [ [ 1232, 1235 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T30", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 1281, 1286 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T31", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1340, 1345 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T32", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 1350, 1359 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T33", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 1476, 1481 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T34", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 1497, 1501 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T35", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1506, 1511 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T36", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 1549, 1553 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T37", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 1627, 1632 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T38", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1644, 1649 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T39", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 1654, 1658 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T40", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1791, 1796 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T41", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 1833, 1838 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T42", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 1851, 1856 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T43", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 1929, 1934 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T44", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 1964, 1969 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T45", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2001, 2010 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T46", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2090, 2099 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T47", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2116, 2119 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T48", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2148, 2153 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T49", "type": "Protein", "text": [ "OVA" ], "offsets": [ [ 2178, 2181 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T50", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2200, 2205 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T51", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2243, 2248 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T52", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2283, 2292 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T53", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2337, 2342 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T54", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2374, 2383 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T55", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2403, 2412 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T56", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2454, 2458 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T57", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2530, 2534 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T58", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2577, 2582 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T59", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2615, 2619 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T60", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 2636, 2639 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T61", "type": "Protein", "text": [ "IL-12" ], "offsets": [ [ 2654, 2659 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T62", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 2723, 2728 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T63", "type": "Protein", "text": [ "IL-4" ], "offsets": [ [ 2742, 2746 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T64", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2814, 2819 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T65", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2888, 2893 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T66", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 2937, 2942 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T67", "type": "Protein", "text": [ "STAT4" ], "offsets": [ [ 3070, 3075 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T68", "type": "Protein", "text": [ "IL-10" ], "offsets": [ [ 3109, 3114 ] ], "normalized": [] }, { "id": "PMC-2791889-03-Results_T69", "type": "Protein", "text": [ "STAT6" ], "offsets": [ [ 3143, 3148 ] ], "normalized": [] } ]

[ { "id": "PMC-2791889-03-Results_E1", "type": "Gene_expression", "trigger": { "text": [ "Production" ], "offsets": [ [ 6, 16 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T1" } ] }, { "id": "PMC-2791889-03-Results_E2", "type": "Positive_regulation", "trigger": { "text": [ "Dependent" ], "offsets": [ [ 33, 42 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E1" } ] }, { "id": "PMC-2791889-03-Results_E3", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 177, 186 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T6" } ] }, { "id": "PMC-2791889-03-Results_E4", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 214, 218 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E3" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T7" } ] }, { "id": "PMC-2791889-03-Results_E5", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 259, 268 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T7" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T8" } ] }, { "id": "PMC-2791889-03-Results_E6", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 328, 337 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T10" } ] }, { "id": "PMC-2791889-03-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 430, 439 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T13" } ] }, { "id": "PMC-2791889-03-Results_E8", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 572, 579 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T15" } ] }, { "id": "PMC-2791889-03-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 614, 624 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T16" } ] }, { "id": "PMC-2791889-03-Results_E10", "type": "Negative_regulation", "trigger": { "text": [ "diminished" ], "offsets": [ [ 652, 662 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E9" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E8" } ] }, { "id": "PMC-2791889-03-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 694, 702 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E12" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E8" } ] }, { "id": "PMC-2791889-03-Results_E12", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 730, 740 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T17" } ] }, { "id": "PMC-2791889-03-Results_E13", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 694, 702 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E14" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E8" } ] }, { "id": "PMC-2791889-03-Results_E14", "type": "Gene_expression", "trigger": { "text": [ "expressing" ], "offsets": [ [ 730, 740 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T18" } ] }, { "id": "PMC-2791889-03-Results_E15", "type": "Positive_regulation", "trigger": { "text": [ "contributes" ], "offsets": [ [ 796, 807 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E16" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T19" } ] }, { "id": "PMC-2791889-03-Results_E16", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 817, 827 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T20" } ] }, { "id": "PMC-2791889-03-Results_E17", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 856, 866 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T21" } ] }, { "id": "PMC-2791889-03-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 979, 988 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T23" } ] }, { "id": "PMC-2791889-03-Results_E19", "type": "Positive_regulation", "trigger": { "text": [ "activation" ], "offsets": [ [ 1057, 1067 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T25" } ] }, { "id": "PMC-2791889-03-Results_E20", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 1122, 1129 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T26" } ] }, { "id": "PMC-2791889-03-Results_E21", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 1183, 1192 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T27" } ] }, { "id": "PMC-2791889-03-Results_E22", "type": "Positive_regulation", "trigger": { "text": [ "in the presence of" ], "offsets": [ [ 1203, 1221 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E21" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T28" } ] }, { "id": "PMC-2791889-03-Results_E23", "type": "Positive_regulation", "trigger": { "text": [ "in the presence of" ], "offsets": [ [ 1203, 1221 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E21" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T29" } ] }, { "id": "PMC-2791889-03-Results_E24", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1287, 1296 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T30" } ] }, { "id": "PMC-2791889-03-Results_E25", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1326, 1334 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T31" } ] }, { "id": "PMC-2791889-03-Results_E26", "type": "Gene_expression", "trigger": { "text": [ "produced" ], "offsets": [ [ 1326, 1334 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T32" } ] }, { "id": "PMC-2791889-03-Results_E27", "type": "Negative_regulation", "trigger": { "text": [ "lack" ], "offsets": [ [ 1468, 1472 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T33" } ] }, { "id": "PMC-2791889-03-Results_E28", "type": "Negative_regulation", "trigger": { "text": [ "abrogated" ], "offsets": [ [ 1482, 1491 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E29" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E27" } ] }, { "id": "PMC-2791889-03-Results_E29", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1512, 1522 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T34" } ] }, { "id": "PMC-2791889-03-Results_E30", "type": "Negative_regulation", "trigger": { "text": [ "abrogated" ], "offsets": [ [ 1482, 1491 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E31" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E27" } ] }, { "id": "PMC-2791889-03-Results_E31", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1512, 1522 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T35" } ] }, { "id": "PMC-2791889-03-Results_E32", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1659, 1669 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T38" } ] }, { "id": "PMC-2791889-03-Results_E33", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1659, 1669 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T39" } ] }, { "id": "PMC-2791889-03-Results_E34", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1699, 1708 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E32" } ] }, { "id": "PMC-2791889-03-Results_E35", "type": "Positive_regulation", "trigger": { "text": [ "increased" ], "offsets": [ [ 1699, 1708 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E33" } ] }, { "id": "PMC-2791889-03-Results_E36", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1797, 1807 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T40" } ] }, { "id": "PMC-2791889-03-Results_E37", "type": "Positive_regulation", "trigger": { "text": [ "depended" ], "offsets": [ [ 1821, 1829 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E36" } ] }, { "id": "PMC-2791889-03-Results_E38", "type": "Negative_regulation", "trigger": { "text": [ "inability" ], "offsets": [ [ 1916, 1925 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E39" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E40" } ] }, { "id": "PMC-2791889-03-Results_E39", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 1956, 1963 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T44" } ] }, { "id": "PMC-2791889-03-Results_E40", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1935, 1944 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T43" } ] }, { "id": "PMC-2791889-03-Results_E41", "type": "Positive_regulation", "trigger": { "text": [ "due" ], "offsets": [ [ 1979, 1982 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E38" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E42" } ] }, { "id": "PMC-2791889-03-Results_E42", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 1990, 1997 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T45" } ] }, { "id": "PMC-2791889-03-Results_E43", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2100, 2109 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T46" } ] }, { "id": "PMC-2791889-03-Results_E44", "type": "Localization", "trigger": { "text": [ "secretion" ], "offsets": [ [ 2187, 2196 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T50" } ] }, { "id": "PMC-2791889-03-Results_E45", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2209, 2216 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E44" } ] }, { "id": "PMC-2791889-03-Results_E46", "type": "Regulation", "trigger": { "text": [ "affected" ], "offsets": [ [ 2257, 2265 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T51" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E47" } ] }, { "id": "PMC-2791889-03-Results_E47", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 2272, 2279 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T52" } ] }, { "id": "PMC-2791889-03-Results_E48", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2323, 2333 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T53" } ] }, { "id": "PMC-2791889-03-Results_E49", "type": "Regulation", "trigger": { "text": [ "independent" ], "offsets": [ [ 2359, 2370 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E48" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T54" } ] }, { "id": "PMC-2791889-03-Results_E50", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 2392, 2399 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T55" } ] }, { "id": "PMC-2791889-03-Results_E51", "type": "Positive_regulation", "trigger": { "text": [ "increase" ], "offsets": [ [ 2429, 2437 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E52" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_E50" } ] }, { "id": "PMC-2791889-03-Results_E52", "type": "Localization", "trigger": { "text": [ "secreted" ], "offsets": [ [ 2445, 2453 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T56" } ] }, { "id": "PMC-2791889-03-Results_E53", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 2522, 2526 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E54" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T57" } ] }, { "id": "PMC-2791889-03-Results_E54", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 2567, 2576 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T58" } ] }, { "id": "PMC-2791889-03-Results_E55", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2620, 2629 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T59" } ] }, { "id": "PMC-2791889-03-Results_E56", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 2712, 2719 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T62" } ] }, { "id": "PMC-2791889-03-Results_E57", "type": "Negative_regulation", "trigger": { "text": [ "deficiency" ], "offsets": [ [ 2747, 2757 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T63" } ] }, { "id": "PMC-2791889-03-Results_E58", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 2804, 2813 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T64" } ] }, { "id": "PMC-2791889-03-Results_E59", "type": "Gene_expression", "trigger": { "text": [ "producing" ], "offsets": [ [ 2878, 2887 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T65" } ] }, { "id": "PMC-2791889-03-Results_E60", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 2943, 2953 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T66" } ] }, { "id": "PMC-2791889-03-Results_E61", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 3096, 3105 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E62" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T67" } ] }, { "id": "PMC-2791889-03-Results_E62", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 3115, 3125 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_T68" } ] }, { "id": "PMC-2791889-03-Results_E63", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 3096, 3105 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2791889-03-Results_E62" }, { "role": "Cause", "ref_id": "PMC-2791889-03-Results_T69" } ] } ]

[]

[]

[ { "id": "PMC-3279418-17-Materials_and_Methods__text", "type": "abstract", "text": [ "Immunoblots\nAfter adding stimulating ligands, 100 ng/mL LPS or 25 microg/mL poly I:C, BMDC were collected and lysed at 0-, 15-, 30-, and 60-minute time points. Immunoblots were performed with antibodies (Cell Signaling Technology) against p-IKK1/2(#2697), p-IkappaBalpha (#9246), IkappaBalpha (#4814), p-TBK1(#5483), p-p38 (#9216), p38 (#9212), p-ERK1/2 (#4376), and ERK1/2 (#4695). Beta-actin (sc-47778, Santa Cruz Biotechnology) was used as loading control." ], "offsets": [ [ 0, 459 ] ] } ]

[ { "id": "PMC-3279418-17-Materials_and_Methods_T1", "type": "Protein", "text": [ "IKK1" ], "offsets": [ [ 241, 245 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T2", "type": "Protein", "text": [ "2" ], "offsets": [ [ 246, 247 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T3", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 258, 270 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T4", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 280, 292 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T5", "type": "Protein", "text": [ "TBK1" ], "offsets": [ [ 304, 308 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T6", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 347, 351 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T7", "type": "Protein", "text": [ "2" ], "offsets": [ [ 352, 353 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T8", "type": "Protein", "text": [ "ERK1" ], "offsets": [ [ 367, 371 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T9", "type": "Protein", "text": [ "2" ], "offsets": [ [ 372, 373 ] ], "normalized": [] }, { "id": "PMC-3279418-17-Materials_and_Methods_T10", "type": "Protein", "text": [ "Beta-actin" ], "offsets": [ [ 383, 393 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3245220-17-Materials_and_Methods__text", "type": "abstract", "text": [ "Transient Transfection of Primary Human Monocytes\nMonocytes were transfected using the human monocyte Amaxa nucleofector kit (Lonza Walkersville Inc, Walkersville, MD) as previously described [51]. Briefly, monocytes were resuspended in Amaxa Nucleofactor solution at a density of 20x106 cells/ml, and 2 microg of total plasmid DNA 100 nM of PKCalpha siRNA or control siRNA was added and transfected using program Amaxa Y-01. For co-transfection studies, PKCalpha or NF-kappaB p65 constructs were mixed at a ratio of 5:1 with the reporter plasmid. Immediately after transfection, cells were washed with 1 ml of RPMI medium containing 2 mM glutamine and 10% FBS or serum free LGM medium (Lonza Walkersville Inc.) then plated at 4x105 cells/well in 24-well plates. The original medium was replaced by serum free LGM medium without or with M-CSF (100 ng/ml) one hour later. The next day, cell-free supernatants were collected for the SEAP analysis. Cells were stained with Annexin V/propidium iodide (PI). For the inhibition studies, cells were pre-incubated with inhibitor for 30 minutes in X-vivo medium prior to the addition of M-CSF." ], "offsets": [ [ 0, 1134 ] ] } ]

[ { "id": "PMC-3245220-17-Materials_and_Methods_T1", "type": "Protein", "text": [ "PKCalpha siRNA" ], "offsets": [ [ 342, 356 ] ], "normalized": [] }, { "id": "PMC-3245220-17-Materials_and_Methods_T2", "type": "Protein", "text": [ "PKCalpha" ], "offsets": [ [ 455, 463 ] ], "normalized": [] }, { "id": "PMC-3245220-17-Materials_and_Methods_T3", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 477, 480 ] ], "normalized": [] }, { "id": "PMC-3245220-17-Materials_and_Methods_T4", "type": "Protein", "text": [ "Annexin V" ], "offsets": [ [ 970, 979 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-3148254-04-Results__text", "type": "abstract", "text": [ "HOIP mediates CD40-stimulated NF-kappaB and JNK activation\nThe results described above show that HOIP plays an important role in CD40-mediated effector functions of B cells. It follows that HOIP is likely a key mediator of CD40 signaling. To test this hypothesis, we stimulated A20.2J and HOIP-deficient cells with CD154 (CD40 ligand) expressed by HI5 insect cells [7], [8] and measured activation of the NF-kappaB and JNK pathways, two of the major transcriptional regulators activated by CD40 [4]. Cell-associated CD154 was used as the stimulus in these experiments as it typically provides more robust, and therefore more readily detected, activation signals than does anti-CD40 antibody. Activation of the canonical NF-kappaB pathway is initiated with the phosphorylation of IkappaB proteins by the IkappaB kinase complex (IKK). In resting cells, IkappaB proteins are responsible for sequestering NF-kappaB subunits in the cytoplasm. Phosphorylation by the IKK complex targets IkappaB proteins for ubiquitination and degradation, allowing NF-kappaB to enter the nucleus and activate gene expression. CD40-mediated phosphorylation and degradation of IkappaBalpha in HOIP-deficient cells was dramatically impaired relative to that observed in parental A20.2J cells (Fig. 4). We also assayed activation of the stress-activated protein kinase JNK in response to CD40 engagement (Fig. 4). CD40-mediated JNK activation in HOIP-deficient cells was impaired as measured by phosphorylation of Thr183 and Tyr185 in JNK. CD40-induced activation of NF-kappaB and JNK in HOIP-reconstituted cells was normal, demonstrating that the defects observed in gene-deficient cells were due to the absence of HOIP expression." ], "offsets": [ [ 0, 1706 ] ] } ]

[ { "id": "PMC-3148254-04-Results_T1", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T2", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 14, 18 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T3", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 97, 101 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T4", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 129, 133 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T5", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 190, 194 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T6", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 223, 227 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T7", "type": "Protein", "text": [ "CD154" ], "offsets": [ [ 315, 320 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T8", "type": "Protein", "text": [ "CD40 ligand" ], "offsets": [ [ 322, 333 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T9", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 490, 494 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T10", "type": "Protein", "text": [ "CD154" ], "offsets": [ [ 516, 521 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T11", "type": "Protein", "text": [ "NF-kappaB subunits" ], "offsets": [ [ 901, 919 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T12", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1104, 1108 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T13", "type": "Protein", "text": [ "IkappaBalpha" ], "offsets": [ [ 1153, 1165 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T14", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1169, 1173 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T15", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1362, 1366 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T16", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1388, 1392 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T17", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1420, 1424 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T18", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 1514, 1518 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T19", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1562, 1566 ] ], "normalized": [] }, { "id": "PMC-3148254-04-Results_T20", "type": "Protein", "text": [ "HOIP" ], "offsets": [ [ 1690, 1694 ] ], "normalized": [] } ]

[ { "id": "PMC-3148254-04-Results_E1", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 335, 344 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T7" } ] }, { "id": "PMC-3148254-04-Results_E2", "type": "Binding", "trigger": { "text": [ "associated" ], "offsets": [ [ 505, 515 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T10" } ] }, { "id": "PMC-3148254-04-Results_E3", "type": "Regulation", "trigger": { "text": [ "responsible" ], "offsets": [ [ 872, 883 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_E4" } ] }, { "id": "PMC-3148254-04-Results_E4", "type": "Negative_regulation", "trigger": { "text": [ "sequestering" ], "offsets": [ [ 888, 900 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T11" } ] }, { "id": "PMC-3148254-04-Results_E5", "type": "Positive_regulation", "trigger": { "text": [ "mediated" ], "offsets": [ [ 1109, 1117 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_E6" }, { "role": "Cause", "ref_id": "PMC-3148254-04-Results_T12" } ] }, { "id": "PMC-3148254-04-Results_E6", "type": "Phosphorylation", "trigger": { "text": [ "phosphorylation" ], "offsets": [ [ 1118, 1133 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T13" } ] }, { "id": "PMC-3148254-04-Results_E7", "type": "Positive_regulation", "trigger": { "text": [ "mediated" ], "offsets": [ [ 1109, 1117 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_E8" }, { "role": "Cause", "ref_id": "PMC-3148254-04-Results_T12" } ] }, { "id": "PMC-3148254-04-Results_E8", "type": "Protein_catabolism", "trigger": { "text": [ "degradation" ], "offsets": [ [ 1138, 1149 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T13" } ] }, { "id": "PMC-3148254-04-Results_E9", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1174, 1183 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T14" } ] }, { "id": "PMC-3148254-04-Results_E10", "type": "Negative_regulation", "trigger": { "text": [ "impaired" ], "offsets": [ [ 1207, 1215 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_E5" } ] }, { "id": "PMC-3148254-04-Results_E11", "type": "Negative_regulation", "trigger": { "text": [ "impaired" ], "offsets": [ [ 1207, 1215 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_E7" } ] }, { "id": "PMC-3148254-04-Results_E12", "type": "Binding", "trigger": { "text": [ "engagement" ], "offsets": [ [ 1367, 1377 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T15" } ] }, { "id": "PMC-3148254-04-Results_E13", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 1425, 1434 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T17" } ] }, { "id": "PMC-3148254-04-Results_E14", "type": "Positive_regulation", "trigger": { "text": [ "reconstituted" ], "offsets": [ [ 1567, 1580 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T19" } ] }, { "id": "PMC-3148254-04-Results_E15", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1695, 1705 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-3148254-04-Results_T20" } ] } ]

[ { "id": "PMC-3148254-04-Results_1", "entity_ids": [ "PMC-3148254-04-Results_T7", "PMC-3148254-04-Results_T8" ] } ]

[]

[ { "id": "PMC-2664230-03-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Human Peripheral Blood Mononuclear Cell Isolation and Stimulation\nHuman mononuclear cells were isolated from the peripheral blood of four healthy human volunteers. The sample size was chosen from our previously published work, which demonstrated reliable results.10 Cell isolation and all subsequent experiments were conducted under sterile and pyrogen-free conditions. Blood collected in heparin tubes was incubated with Dextran T500 and the red cells were sedimented for 40 minutes at room temperature. The resultant serum was then washed with HBSS and separated by Percoll gradient centrifugation according to the manufacturer's instructions. Cell viability was assessed by trypan blue dye exclusion, with purity of greater than 95%. Isolated cells were resuspended in RPMI 1640 supplemented with 10% FBS and 5 mM HEPES at a concentration of 1 x 107cells/mL. Each subsequent experiment listed below was conducted on samples of 5 x 106 cells per treatment group. Isolated cells were stimulated with either HBSS as a negative control, LPS (1 mug/mL), PTX (20 mM), or concomitant LPS / PTX, at the above-mentioned concentrations, for 30 minutes at 37degreesC. Cells were placed on ice for 10 minutes to stop the reaction and the samples were then stored at -70degreesC for further analysis. The stimulation times and concentrations of LPS and PTX utilized in this study were determined in previous pilot studies done in our laboratory, which examined the effects of increasing concentrations of PTX on LPS-induced TNF-alpha production. LPS at a concentration of 1 mug/mL and PTX at a concentration of 20 mM were the minimum concentrations necessary to produce a reproducible and reliable up-regulation and down-regulation in TNF-alpha production, respectively, in quantitative assays (data not shown)." ], "offsets": [ [ 0, 1801 ] ] } ]

[ { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1514, 1523 ] ], "normalized": [] }, { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "TNF-alpha" ], "offsets": [ [ 1725, 1734 ] ], "normalized": [] } ]

[ { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_E1", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1506, 1513 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-03-MATERIALS_AND_METHODS_E2" } ] }, { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_E2", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1524, 1534 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-03-MATERIALS_AND_METHODS_T1" } ] }, { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_E3", "type": "Positive_regulation", "trigger": { "text": [ "up-regulation" ], "offsets": [ [ 1688, 1701 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-03-MATERIALS_AND_METHODS_E4" } ] }, { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_E4", "type": "Gene_expression", "trigger": { "text": [ "production" ], "offsets": [ [ 1735, 1745 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-03-MATERIALS_AND_METHODS_T2" } ] }, { "id": "PMC-2664230-03-MATERIALS_AND_METHODS_E5", "type": "Negative_regulation", "trigger": { "text": [ "down-regulation" ], "offsets": [ [ 1706, 1721 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2664230-03-MATERIALS_AND_METHODS_E4" } ] } ]

[]

[]

[ { "id": "PMC-3279418-08-Materials_and_Methods__text", "type": "abstract", "text": [ "Ethics Statement\nAll mouse work was carried out in strict accordance with protocols approved by the Institutional Animal Care and Use Committees." ], "offsets": [ [ 0, 145 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-2626671-01-INTRODUCTION__text", "type": "abstract", "text": [ "Naive CD8+T cells differentiate into effector CTLs with the ability to lyse antigen-bearing target cells by exocytosis of lytic granules containing perforin and granzymes, and to produce inflammatory cytokines such as IFN-gamma and TNF upon restimulation through the TCR (1,2). In vivo experiments have elucidated many critical parameters governing the development and evolution of primary CTL responses (3,4). In this study, we have used in vitro systems such as those developed to study CD4+T cell differentiation to define the molecular basis of effector CTL differentiation (5,6).The T-box transcription factors Eomesodermin (Eomes) and T-bet are needed for important aspects of effector and memory CTL differentiation (7). In uninfected mice, compound deletion of theTbx21(encoding T-bet) andeomesodermingenes is associated with a selective loss of CD8+T cells with an IL-2Rbeta-high, memory phenotype (8). Mice deficient for both T-bet and Eomes in T cells have impaired expression of cytolytic mediators, manifest poor cytolytic activity, and fail to control acute lymphocytic choriomeningitis virus infection (9). Nevertheless, the specific roles of T-bet and Eomes in clonal expansion and CTL differentiation have not yet been resolved: in particular, it is not known whether these transcription factors function redundantly to control effector CD8+T cell differentiation, and whether they do so directly by targeting specific effector cytokine and cytolytic genes.Runx proteins, a family of three DNA-binding transcription factors, control thymocyte differentiation and the CD4/CD8 lineage decision (10-13). Runx3 and perforin mRNA are expressed by double-positive (DP) thymocytes and CD8+single-positive (SP) thymocytes but not in CD4+SP cells (14). Although Runx3 is not expressed in naive CD4+T cells, its expression is up-regulated during Th1 cell differentiation, and Runx3 influences Th1 cell differentiation and function through direct regulation of theIl4andIfngcytokine genes (15,16). In contrast, all three Runx proteins are expressed in mature CD8+T cells (10,12), and Runx3-deficient CD8+T cells show reduced cytolytic activity (12,13). We therefore tested whether Runx3 influenced cytolytic T cell differentiation.In this report, we show that Runx3 and T-box factors synergistically regulate CTL differentiation and function. T-bet is induced quickly upon TCR stimulation and is required for early programming of cytokine production (17), whereas Eomes is induced later during differentiation and sustains IFN-gamma expression. Runx3 is required for Eomes and perforin expression, and both Eomes and Runx3 bind at thePrf1locus; in contrast, perforin expression is unaffected in T-bet-deficient cells. T cells lacking Runx3 show decreased expression of IFN-gamma and granzyme B, and Runx3 also binds the promoter regions of theIfngandGzmbgenes. Collectively, these results provide evidence for a complex transcriptional network in which Runx3 is a primary regulator ofGzmbexpression but synergizes with T-bet and Eomes, respectively, to promote transcription of theIfngandPrf1genes." ], "offsets": [ [ 0, 3104 ] ] } ]

[ { "id": "PMC-2626671-01-INTRODUCTION_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 6, 9 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T2", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 148, 156 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T3", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 218, 227 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T4", "type": "Protein", "text": [ "TNF" ], "offsets": [ [ 232, 235 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T5", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 489, 492 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T6", "type": "Protein", "text": [ "Eomesodermin" ], "offsets": [ [ 616, 628 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T7", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 630, 635 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T8", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 641, 646 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T9", "type": "Protein", "text": [ "Tbx21" ], "offsets": [ [ 772, 777 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T10", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 787, 792 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T11", "type": "Protein", "text": [ "eomesodermin" ], "offsets": [ [ 797, 809 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T12", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 854, 857 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T13", "type": "Protein", "text": [ "IL-2Rbeta" ], "offsets": [ [ 874, 883 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T14", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 936, 941 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T15", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 946, 951 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T16", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 1158, 1163 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T17", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 1168, 1173 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T18", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1354, 1357 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T19", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1584, 1587 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T20", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1588, 1591 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T21", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1618, 1623 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T22", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 1628, 1636 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T23", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 1695, 1698 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T24", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1742, 1745 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T25", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1770, 1775 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T26", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1802, 1805 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T27", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 1883, 1888 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T28", "type": "Protein", "text": [ "Il4" ], "offsets": [ [ 1970, 1973 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T29", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 1976, 1980 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T30", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 2065, 2068 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T31", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2090, 2095 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T32", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 2106, 2109 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T33", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2187, 2192 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T34", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2266, 2271 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T35", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 2349, 2354 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T36", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2470, 2475 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T37", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2529, 2538 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T38", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2551, 2556 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T39", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2573, 2578 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T40", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 2583, 2591 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T41", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 2613, 2618 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T42", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2623, 2628 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T43", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 2640, 2644 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T44", "type": "Protein", "text": [ "perforin" ], "offsets": [ [ 2664, 2672 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T45", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 2701, 2706 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T46", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2740, 2745 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T47", "type": "Protein", "text": [ "IFN-gamma" ], "offsets": [ [ 2775, 2784 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T48", "type": "Protein", "text": [ "granzyme B" ], "offsets": [ [ 2789, 2799 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T49", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2805, 2810 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T50", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 2849, 2853 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T51", "type": "Protein", "text": [ "Gzmb" ], "offsets": [ [ 2856, 2860 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T52", "type": "Protein", "text": [ "Runx3" ], "offsets": [ [ 2959, 2964 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T53", "type": "Protein", "text": [ "Gzmb" ], "offsets": [ [ 2990, 2994 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T54", "type": "Protein", "text": [ "T-bet" ], "offsets": [ [ 3025, 3030 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T55", "type": "Protein", "text": [ "Eomes" ], "offsets": [ [ 3035, 3040 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T56", "type": "Protein", "text": [ "Ifng" ], "offsets": [ [ 3087, 3091 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T57", "type": "Protein", "text": [ "Prf1" ], "offsets": [ [ 3094, 3098 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T58", "type": "Anaphora", "text": [ "inflammatory cytokines" ], "offsets": [ [ 187, 209 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T59", "type": "Anaphora", "text": [ "they" ], "offsets": [ [ 1394, 1398 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T60", "type": "Anaphora", "text": [ "its" ], "offsets": [ [ 1815, 1818 ] ], "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_T85", "type": "Entity", "text": [ "promoter regions" ], "offsets": [ [ 2826, 2842 ] ], "normalized": [] } ]

[ { "id": "PMC-2626671-01-INTRODUCTION_E1", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 179, 186 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T3" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E2", "type": "Gene_expression", "trigger": { "text": [ "produce" ], "offsets": [ [ 179, 186 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T4" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E3", "type": "Negative_regulation", "trigger": { "text": [ "deletion" ], "offsets": [ [ 757, 765 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T9" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E4", "type": "Negative_regulation", "trigger": { "text": [ "deletion" ], "offsets": [ [ 757, 765 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T11" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E5", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 917, 926 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T14" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E6", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 917, 926 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T15" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E7", "type": "Binding", "trigger": { "text": [ "targeting" ], "offsets": [ [ 1417, 1426 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T16" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E8", "type": "Binding", "trigger": { "text": [ "targeting" ], "offsets": [ [ 1417, 1426 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T17" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E9", "type": "Transcription", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1646, 1655 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T21" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E10", "type": "Transcription", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1646, 1655 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T22" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E11", "type": "Gene_expression", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1783, 1792 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T25" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E12", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1819, 1829 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T25" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E13", "type": "Positive_regulation", "trigger": { "text": [ "up-regulated" ], "offsets": [ [ 1833, 1845 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E12" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E14", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 1953, 1963 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T28" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T27" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E15", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 1953, 1963 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T29" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T27" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E16", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2096, 2105 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T31" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E17", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2358, 2365 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T35" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E18", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 2479, 2486 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T36" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E19", "type": "Positive_regulation", "trigger": { "text": [ "sustains" ], "offsets": [ [ 2520, 2528 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E20" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T36" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E20", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2539, 2549 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T37" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E21", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 2560, 2568 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E22" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T38" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E22", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2592, 2602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T39" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E23", "type": "Positive_regulation", "trigger": { "text": [ "required" ], "offsets": [ [ 2560, 2568 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E24" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T38" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E24", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2592, 2602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T40" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E25", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 2629, 2633 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T41" }, { "role": "Theme2", "ref_id": "PMC-2626671-01-INTRODUCTION_T43" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E26", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 2629, 2633 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T42" }, { "role": "Theme2", "ref_id": "PMC-2626671-01-INTRODUCTION_T43" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E27", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2673, 2683 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T44" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E28", "type": "Regulation", "trigger": { "text": [ "unaffected" ], "offsets": [ [ 2687, 2697 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E27" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_E29" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E29", "type": "Negative_regulation", "trigger": { "text": [ "deficient" ], "offsets": [ [ 2707, 2716 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T45" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E30", "type": "Negative_regulation", "trigger": { "text": [ "lacking" ], "offsets": [ [ 2732, 2739 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T46" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E31", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 2751, 2760 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E32" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_E30" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E32", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2761, 2771 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T47" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E33", "type": "Negative_regulation", "trigger": { "text": [ "decreased" ], "offsets": [ [ 2751, 2760 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E34" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_E30" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E34", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2761, 2771 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T48" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E35", "type": "Binding", "trigger": { "text": [ "binds" ], "offsets": [ [ 2816, 2821 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T49" }, { "role": "Theme2", "ref_id": "PMC-2626671-01-INTRODUCTION_T50" }, { "role": "Site2", "ref_id": "PMC-2626671-01-INTRODUCTION_T85" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E36", "type": "Binding", "trigger": { "text": [ "binds" ], "offsets": [ [ 2816, 2821 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T49" }, { "role": "Theme2", "ref_id": "PMC-2626671-01-INTRODUCTION_T51" }, { "role": "Site2", "ref_id": "PMC-2626671-01-INTRODUCTION_T85" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E37", "type": "Regulation", "trigger": { "text": [ "regulator" ], "offsets": [ [ 2978, 2987 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E38" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T52" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E38", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2994, 3004 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T53" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E39", "type": "Positive_regulation", "trigger": { "text": [ "promote" ], "offsets": [ [ 3059, 3066 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E40" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T54" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E40", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 3067, 3080 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T56" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E41", "type": "Positive_regulation", "trigger": { "text": [ "promote" ], "offsets": [ [ 3059, 3066 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_E42" }, { "role": "Cause", "ref_id": "PMC-2626671-01-INTRODUCTION_T55" } ] }, { "id": "PMC-2626671-01-INTRODUCTION_E42", "type": "Transcription", "trigger": { "text": [ "transcription" ], "offsets": [ [ 3067, 3080 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2626671-01-INTRODUCTION_T57" } ] } ]

[ { "id": "PMC-2626671-01-INTRODUCTION_1", "entity_ids": [ "PMC-2626671-01-INTRODUCTION_T6", "PMC-2626671-01-INTRODUCTION_T7" ] }, { "id": "PMC-2626671-01-INTRODUCTION_2", "entity_ids": [ "PMC-2626671-01-INTRODUCTION_T9", "PMC-2626671-01-INTRODUCTION_T10" ] } ]

[ { "id": "PMC-2626671-01-INTRODUCTION_R1", "type": "Coreference", "arg1_id": "PMC-2626671-01-INTRODUCTION_T58", "arg2_id": "PMC-2626671-01-INTRODUCTION_T3", "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_R2", "type": "Coreference", "arg1_id": "PMC-2626671-01-INTRODUCTION_T58", "arg2_id": "PMC-2626671-01-INTRODUCTION_T4", "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_R3", "type": "Coreference", "arg1_id": "PMC-2626671-01-INTRODUCTION_T59", "arg2_id": "PMC-2626671-01-INTRODUCTION_T16", "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_R4", "type": "Coreference", "arg1_id": "PMC-2626671-01-INTRODUCTION_T59", "arg2_id": "PMC-2626671-01-INTRODUCTION_T17", "normalized": [] }, { "id": "PMC-2626671-01-INTRODUCTION_R5", "type": "Coreference", "arg1_id": "PMC-2626671-01-INTRODUCTION_T60", "arg2_id": "PMC-2626671-01-INTRODUCTION_T25", "normalized": [] } ]

[ { "id": "PMC-1447668-15-Materials_and_Methods__text", "type": "abstract", "text": [ "Foxp3 and HTLV-I Tax expression analysis by real-time RT-PCR.\nReal-time RT-PCR analysis of Foxp3 and HTLV-I Tax expression was performed as previously described [8,47]. Briefly, total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, California, United States) according to manufacturer's guidelines, and cDNA was synthesized by reverse transcription using TaqMan Gold RT-PCR Kit using random hexamer primers (Applied Biosystems, Foster City, California, United States). Foxp3 and HTLV-I Tax mRNA expression was quantified by real-time PCR using ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The normalized values in each sample were calculated as the relative quantity of Foxp3 or HTLV-I Tax mRNA expression divided by the relative quantity of HPRT mRNA expression. The values were calculated by the following formula: normalized Foxp3 or HTLV-I Tax expression = 2Ct value of HPRT - Ct value of Foxp3 or HTLV-I Tax." ], "offsets": [ [ 0, 946 ] ] } ]

[ { "id": "PMC-1447668-15-Materials_and_Methods_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 0, 5 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T2", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 17, 20 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 91, 96 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T4", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 108, 111 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T5", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 484, 489 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T6", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 501, 504 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T7", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 703, 708 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T8", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 719, 722 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T9", "type": "Protein", "text": [ "HPRT" ], "offsets": [ [ 775, 779 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T10", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 861, 866 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T11", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 877, 880 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T12", "type": "Protein", "text": [ "HPRT" ], "offsets": [ [ 907, 911 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 926, 931 ] ], "normalized": [] }, { "id": "PMC-1447668-15-Materials_and_Methods_T14", "type": "Protein", "text": [ "Tax" ], "offsets": [ [ 942, 945 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-15-Materials_and_Methods_E1", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 21, 31 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T1" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 21, 31 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T2" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E3", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 112, 122 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T3" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 112, 122 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T4" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E5", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 505, 520 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T5" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E6", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 505, 520 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T6" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E7", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 723, 738 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T7" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E8", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 723, 738 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T8" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E9", "type": "Transcription", "trigger": { "text": [ "mRNA expression" ], "offsets": [ [ 780, 795 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T9" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E10", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 881, 891 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T10" } ] }, { "id": "PMC-1447668-15-Materials_and_Methods_E11", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 881, 891 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-15-Materials_and_Methods_T11" } ] } ]

[]

[]

[ { "id": "PMC-2065877-16-Materials_and_Methods__text", "type": "abstract", "text": [ "PCR analysis of kappa chain rearrangement.\nDNA was isolated from splenocytes using the Dneasy Tissue Kit (Qiagen), with Rnase treatment. PCR reactions contained 100 ng of genomic DNA, 0.2 muM each primer, 0.2 mM dNTPs, and 2.5 U Taq DNA polymerase (NEB) performed in 1X ThermoPol buffer (NEB). Primers used were Vkappacon and Jkappa5-1degrees and have been described previously [74]. PCR conditions were 94 degreesC for 2 min, 40 cycles of 94 degreesC for 30 s, 63 degreesC for 90 s, and 72 degreesC for 1 min, followed by 1 cycle of 72 degreesC for 5 min." ], "offsets": [ [ 0, 556 ] ] } ]

[ { "id": "PMC-2065877-16-Materials_and_Methods_T1", "type": "Protein", "text": [ "Taq DNA polymerase" ], "offsets": [ [ 229, 247 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-04-Results__text", "type": "abstract", "text": [ "LMP1 Promotes B Cell Survival and Proliferation In Vitro\nPrimary B cell cultures can be maintained through CD40 ligation and supplementation with IL4 [32]. To investigate whether LMP1 affects primary B cell survival and proliferation, splenocytes were cultured in the presence or absence of IL4 and analyzed by MTS as a metabolic marker, by ethidium monoazide (EMA) exclusion for viability, and by 5-bromo-2'-deoxy-uridine (BrdU) incorporation for proliferation. In the MTS assay, as expected, splenocytes from wild-type mice did not survive even with the addition of IL4 due to a lack of CD40 ligation (Figure 3A). In contrast, LMP1 splenocytes had increased metabolism even in the absence of IL4, which was further enhanced upon addition of IL4. Wild-type and LMP1 transgenic lymphoma cells had high levels of MTS activity even in the absence of IL4 (Figure 3A). The LMP1 transgenic lymphoma cells had approximately 4-fold higher MTS activity than the normal transgenic lymphocytes and were at least 2-fold higher than the control lymphoma. As previously published, lymphoma usually develops in mice over 12 mo of age and all mice are sacrificed by 18-20 mo. The ages of the transgenic mice with or without lymphoma ranged between 6 and 20 mo old. There was no correlation between age and MTS activity.\nEMA exclusion of CD19+ gated B cells prepared from two wild-type and two LMP1 transgenic mice indicated a 2-fold increase in viability in the LMP1 transgenic lymphocytes compared to wild-type lymphocytes. Two examples of LMP1 transgenic lymphoma cells had greatly increased viability that was not increased by IL4 treatment, indicating that the lymphoma cells are independent of IL4 co-stimulation (Figure 3B). Enhancement in MTS activity was observed in LMP1 transgenic lymphoma cells by the addition of IL4; however, EMA exclusion did not reveal a similar increase. This could reflect a difference for IL4 requirement in the metabolic activity versus the viability of LMP1 transgenic lymphoma cells. Although expression of LMP1 could enhance survival of non-malignant primary lymphocytes, BrdU incorporation revealed that LMP1 expression alone was not sufficient to induce proliferation in culture (unpublished data). Only lymphoma cells had detectable levels of BrdU incorporation detected by flow cytometry (Figure 3C). Interestingly, LMP1 lymphoma cells had significantly higher levels of proliferation in comparison to the spontaneous lymphoma that developed in an LMP1-negative littermate (25% versus 4%). This higher level of proliferation was observed in lymphomas that express both high (Table 1, LMP1-L2 and LMP1-L3) and low (Table 1, LMP1-L5) levels of LMP1, suggesting that even small amounts of LMP1 is sufficient to induce dramatic effects in proliferation. The level of proliferation was not enhanced upon IL4 addition, confirming the IL4 independence observed in the viability studies (Figure 3C; Table1)." ], "offsets": [ [ 0, 2927 ] ] } ]

[ { "id": "PMC-2065877-04-Results_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T2", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 107, 111 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T3", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 146, 149 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T4", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 179, 183 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T5", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 291, 294 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T6", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 568, 571 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T7", "type": "Protein", "text": [ "CD40" ], "offsets": [ [ 589, 593 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T8", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 629, 633 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T9", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 694, 697 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T10", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 743, 746 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T11", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 762, 766 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T12", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 848, 851 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T13", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 869, 873 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T14", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 1322, 1326 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T15", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1378, 1382 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T16", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1447, 1451 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T17", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1526, 1530 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T18", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 1615, 1618 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T19", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 1684, 1687 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T20", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1760, 1764 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T21", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 1810, 1813 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T22", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 1909, 1912 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T23", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 1975, 1979 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T24", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2030, 2034 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T25", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2129, 2133 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T26", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2344, 2348 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T27", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2476, 2480 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T28", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2612, 2616 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T29", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2624, 2628 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T30", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2651, 2655 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T31", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2670, 2674 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T32", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 2714, 2718 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T33", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 2827, 2830 ] ], "normalized": [] }, { "id": "PMC-2065877-04-Results_T34", "type": "Protein", "text": [ "IL4" ], "offsets": [ [ 2856, 2859 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-04-Results_E1", "type": "Binding", "trigger": { "text": [ "ligation" ], "offsets": [ [ 112, 120 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T2" } ] }, { "id": "PMC-2065877-04-Results_E2", "type": "Negative_regulation", "trigger": { "text": [ "lack" ], "offsets": [ [ 581, 585 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_E3" } ] }, { "id": "PMC-2065877-04-Results_E3", "type": "Binding", "trigger": { "text": [ "ligation" ], "offsets": [ [ 594, 602 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T7" } ] }, { "id": "PMC-2065877-04-Results_E4", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 683, 690 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T9" } ] }, { "id": "PMC-2065877-04-Results_E5", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 837, 844 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T12" } ] }, { "id": "PMC-2065877-04-Results_E6", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2016, 2026 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T24" } ] }, { "id": "PMC-2065877-04-Results_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2134, 2144 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T25" } ] }, { "id": "PMC-2065877-04-Results_E8", "type": "Negative_regulation", "trigger": { "text": [ "negative" ], "offsets": [ [ 2481, 2489 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T27" } ] }, { "id": "PMC-2065877-04-Results_E9", "type": "Gene_expression", "trigger": { "text": [ "express" ], "offsets": [ [ 2584, 2591 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_T31" } ] }, { "id": "PMC-2065877-04-Results_E10", "type": "Positive_regulation", "trigger": { "text": [ "high" ], "offsets": [ [ 2597, 2601 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_E9" } ] }, { "id": "PMC-2065877-04-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "low" ], "offsets": [ [ 2637, 2640 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-04-Results_E9" } ] } ]

[]

[]

[ { "id": "PMC-1310901-15-DISCUSSION__text", "type": "abstract", "text": [ "Many genetic lesions are known to influence gene expression of tumor suppressor genes. Whereas mutations and deletions or insertions have permanent effects, reversible mechanisms are gene methylation, or expression and activation of transcription factors, respectively. We studied a putative cause for absent IRF-4 expression in leukemia cells and first focused on genetic aberrations of the promoter. We observed no genetic alterations in the IRF-4 promoter, which can account for the lack of IRF-4 expression: The detected base pair changes at position -1081 (T to C substitution), at position -1068 (A to C substitution) and at position -116 (A to C substitution) are unlikely responsible for absent IRF-4-expression since the first two mutations were found both in IRF-4-positive and -negative cells whereas the latter change was not detected consistently in all IRF-4-negative or -positive cells and may thus be a polymorphism. All three substitutions did not change any known putative transcription factor binding sites (30,31) and also do not affect any restriction sites or primer binding sites of the used assays. However, permanent genetic variations in the IRF-4 coding sequence, such as deletions or mutations resulting in stop-codons have not been excluded by sequence analysis. Since IRF-4 expression in cell lines and CML can be induced by demethylation and successful IFN-alpha therapy (3), respectively, the existence of such genetic aberrations seems unlikely.\nWe then investigated whether the previously described down-regulation of IRF-4 expression in human myeloid leukemias was due to a differential hypermethylation of the promoter, since the presented re-expression due to AzadC-treatment might also be a result of activation of positive transcriptional regulators of IRF-4. Methylation of CpG sites is a common mechanism of silencing genes in leukemia and has also been shown for another IRF, IRF-7 (35) and for PU.1 (36), an interacting partner of IRF-4. To elucidate the relevance of this mechanism for the regulation of IRF-4 expression, various leukemic cells were treated with demethylating agents and promoters were sequenced after bisulfite treatment. We found that IRF-4 expression could indeed be connected to the methylation status of distinct CpG motifs in the IRF-4 promoter. In Figure 4A, those CpG sites are shown (bottom line), whose hypermethylation may account for the absence of IRF-4 expression in the respective cells. One of them (#54) is adjacent to an identified regulatory element (NFkappaB-site), indicating a possible involvement of this site. At two further CpG sites (#48, 45) the methylation status in IRF-4-positive was lower than that of IRF-4-negative cells. These CpG sites are located in an NFkappaB and an SP1 element (31) and thus may also play a role in regulation of IRF-4 expression. It has been shown that NFkappaB elements play an important role in IRF-4 induction as IRF-4 expression depends on binding of the transactivator c-Rel to these elements in the IRF-4 promoter (31,37). Furthermore, methylation of the central CpG in the NFkappaB element inhibits binding of the NFkappaB protein complexes (38), promoting the significance of the observed methylation differences in IRF-4-positive and -negative cells.\nVia in vitro methylation and reporter gene assays we could clearly appoint the silencing of the IRF-4 promoter to a methylation effect, which may thus be the mechanism of IRF-4 deregulation in vivo. One possible cause for the aberrant methylation in tumorigenesis is an increased level of DNMTs during the pathogenetic process. In colon, lung and hematologic malignancies, overexpression of DNMT1, a maintenance DNMT, has been detected (39-41). Furthermore, it has been shown that CML cells in the acute phase exhibited elevated levels of the three known DNMTs, while CML cells in chronic phase expressed normal levels of DNMTs if compared with normal bone marrow cells (25). Interestingly, a positive correlation between DNMT1 expression levels and hypermethylation of p15INK4b has been detected in AML (25). In this work, we did not detect significant mRNA expression differences of selected DNMT or MBP, making it an unlikely cause for the observed methylation and thus IRF-4 expression differences in leukemia cells.\nThe finding that IRF-4 expression is silenced by promoter hypermethylation might represent a mechanism that accounts for the previously observed loss of IRF-4 expression in CML. Indeed, several clinical trials with leukemia patients and patients with myelodysplastic syndromes demonstrated the potential clinical benefit of a treatment with demethylating agents (42-45).\nThe expression of another IRF, IFN consensus sequence binding protein (ICSBP/IRF-8), is impaired in myeloid leukemias especially CML (27,46,47). But in contrast to IRF-4, the loss of this IRF could not be reverted in ICSBP-negative cell lines (EM-2, CML-T1, K-562 and LAMA-84) by treatment with AzadC (Figure 6) and AzadC has no effect on ICSBP levels in ICSBP-positive U-937 cells (Figure 6). These data suggest a distinct regulatory mechanism for these two IRFs.\nIRF-4, similar to many other classical tumor suppressor genes p15INK4b, p16INK4a or p53, may thus be a subject of alterations in the promoter methylation status leading to expression changes, which might contribute to the initiation and/or progression of cancer. Still, the obvious functional diversity of IRF-4 remains remarkable and cannot be fully explained by the IRF-4 promoter methylation status. For example, IRF-4 is primarily known for its oncogenic features. In multiple myeloma (MM) a translocation on chromosome 14q was reported to lead to a fusion gene of immunoglobulin heavy-chain (IgH) and IRF-4 resulting in a subsequent overexpression of IRF-4 (48,49). In addition, abundant IRF-4 expression was found to be a marker for various subsets of lymphomas, such as diffuse large B-cell lymphomas, primary effusion lymphoma, and marginal zone lymphoma, and adult T-cell leukemia (11,31,50-52). This draws a more complex picture of the role of IRF-4. Down-regulation of IRF-4 may promote leukemogenesis in myeloid cell context (3), which was recently confirmed in IRF-4-/- ICSBP-/- double knock-out mice (53), while IRF-4 up-regulation may induce a growth advantage in lymphomas or MM (48).\nTaken together, our data suggest that IRF-4 promoter methylation regulates IRF-4 expression, and that aberrant expression of IRF-4 in certain types of leukemia may be a consequence of IRF-4 promoter hypermethylation." ], "offsets": [ [ 0, 6552 ] ] } ]

[ { "id": "PMC-1310901-15-DISCUSSION_T1", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 309, 314 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T2", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 444, 449 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T3", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 494, 499 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T4", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 703, 708 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T5", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 769, 774 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T6", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 867, 872 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T7", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1168, 1173 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T8", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1298, 1303 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T9", "type": "Protein", "text": [ "IFN-alpha" ], "offsets": [ [ 1384, 1393 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T10", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1552, 1557 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T11", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1792, 1797 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T12", "type": "Protein", "text": [ "IRF-7" ], "offsets": [ [ 1918, 1923 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T13", "type": "Protein", "text": [ "PU.1" ], "offsets": [ [ 1937, 1941 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T14", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 1974, 1979 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T15", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2048, 2053 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T16", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2198, 2203 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T17", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2297, 2302 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T18", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2422, 2427 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T19", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2656, 2661 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T20", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2694, 2699 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T21", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2830, 2835 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T22", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2915, 2920 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T23", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 2934, 2939 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T24", "type": "Protein", "text": [ "c-Rel" ], "offsets": [ [ 2992, 2997 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T25", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 3023, 3028 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T26", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 3242, 3247 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T27", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 3374, 3379 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T28", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 3449, 3454 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T29", "type": "Protein", "text": [ "DNMT1" ], "offsets": [ [ 3669, 3674 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T30", "type": "Protein", "text": [ "DNMT1" ], "offsets": [ [ 4000, 4005 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T31", "type": "Protein", "text": [ "p15INK4b" ], "offsets": [ [ 4048, 4056 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T32", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 4251, 4256 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T33", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 4316, 4321 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T34", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 4452, 4457 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T35", "type": "Protein", "text": [ "IFN consensus sequence binding protein" ], "offsets": [ [ 4701, 4739 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T36", "type": "Protein", "text": [ "ICSBP" ], "offsets": [ [ 4741, 4746 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T37", "type": "Protein", "text": [ "IRF-8" ], "offsets": [ [ 4747, 4752 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T38", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 4834, 4839 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T39", "type": "Protein", "text": [ "ICSBP" ], "offsets": [ [ 4887, 4892 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T40", "type": "Protein", "text": [ "ICSBP" ], "offsets": [ [ 5009, 5014 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T41", "type": "Protein", "text": [ "ICSBP" ], "offsets": [ [ 5025, 5030 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T42", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5135, 5140 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T43", "type": "Protein", "text": [ "p15INK4b" ], "offsets": [ [ 5197, 5205 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T44", "type": "Protein", "text": [ "p16INK4a" ], "offsets": [ [ 5207, 5215 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T45", "type": "Protein", "text": [ "p53" ], "offsets": [ [ 5219, 5222 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T46", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5441, 5446 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T47", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5503, 5508 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T48", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5551, 5556 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T49", "type": "Protein", "text": [ "immunoglobulin heavy-chain" ], "offsets": [ [ 5704, 5730 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T50", "type": "Protein", "text": [ "IgH" ], "offsets": [ [ 5732, 5735 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T51", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5741, 5746 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T52", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5791, 5796 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T53", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 5828, 5833 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T54", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6089, 6094 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T55", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6115, 6120 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T56", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6209, 6214 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T57", "type": "Protein", "text": [ "ICSBP" ], "offsets": [ [ 6218, 6223 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T58", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6261, 6266 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T59", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6374, 6379 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T60", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6411, 6416 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T61", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6461, 6466 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T62", "type": "Protein", "text": [ "IRF-4" ], "offsets": [ [ 6520, 6525 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T77", "type": "Entity", "text": [ "transcription factor binding sites" ], "offsets": [ [ 991, 1025 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T79", "type": "Entity", "text": [ "restriction sites" ], "offsets": [ [ 1061, 1078 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T80", "type": "Entity", "text": [ "primer binding sites" ], "offsets": [ [ 1082, 1102 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T99", "type": "Entity", "text": [ "NFkappaB elements" ], "offsets": [ [ 2871, 2888 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T63", "type": "Anaphora", "text": [ "these elements" ], "offsets": [ [ 3001, 3015 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T105", "type": "Entity", "text": [ "CpG" ], "offsets": [ [ 3087, 3090 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T106", "type": "Entity", "text": [ "NFkappaB element" ], "offsets": [ [ 3098, 3114 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T112", "type": "Entity", "text": [ "promoter" ], "offsets": [ [ 3380, 3388 ] ], "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_T64", "type": "Anaphora", "text": [ "this IRF" ], "offsets": [ [ 4853, 4861 ] ], "normalized": [] } ]

[ { "id": "PMC-1310901-15-DISCUSSION_E1", "type": "Negative_regulation", "trigger": { "text": [ "absent" ], "offsets": [ [ 302, 308 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E2" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E2", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 315, 325 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T1" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E3", "type": "Negative_regulation", "trigger": { "text": [ "lack" ], "offsets": [ [ 486, 490 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E4" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E4", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 500, 510 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T3" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E5", "type": "Positive_regulation", "trigger": { "text": [ "responsible" ], "offsets": [ [ 680, 691 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E6" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E6", "type": "Negative_regulation", "trigger": { "text": [ "absent" ], "offsets": [ [ 696, 702 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E7" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E7", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 709, 719 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T4" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E8", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 775, 783 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T5" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E9", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 789, 797 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T5" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E10", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 873, 881 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T6" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E11", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 886, 894 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T6" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E12", "type": "Regulation", "trigger": { "text": [ "change" ], "offsets": [ [ 965, 971 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T4" }, { "role": "Site", "ref_id": "PMC-1310901-15-DISCUSSION_T77" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E13", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 1050, 1056 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T4" }, { "role": "Site", "ref_id": "PMC-1310901-15-DISCUSSION_T79" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E14", "type": "Regulation", "trigger": { "text": [ "affect" ], "offsets": [ [ 1050, 1056 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T4" }, { "role": "Site", "ref_id": "PMC-1310901-15-DISCUSSION_T80" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E15", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1304, 1314 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T8" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E16", "type": "Positive_regulation", "trigger": { "text": [ "induced" ], "offsets": [ [ 1344, 1351 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E15" }, { "role": "Cause", "ref_id": "PMC-1310901-15-DISCUSSION_T9" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E17", "type": "Negative_regulation", "trigger": { "text": [ "down-regulation" ], "offsets": [ [ 1533, 1548 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E18" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E18", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1558, 1568 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T10" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E19", "type": "Positive_regulation", "trigger": { "text": [ "due" ], "offsets": [ [ 1600, 1603 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E17" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E20", "type": "Gene_expression", "trigger": { "text": [ "re-expression" ], "offsets": [ [ 1676, 1689 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T10" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E21", "type": "Positive_regulation", "trigger": { "text": [ "result" ], "offsets": [ [ 1729, 1735 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E20" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E22", "type": "Binding", "trigger": { "text": [ "interacting" ], "offsets": [ [ 1951, 1962 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T13" }, { "role": "Theme2", "ref_id": "PMC-1310901-15-DISCUSSION_T14" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E23", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 2034, 2044 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E24" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E24", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2054, 2064 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T15" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E25", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2204, 2214 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T16" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E26", "type": "Positive_regulation", "trigger": { "text": [ "account" ], "offsets": [ [ 2395, 2402 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E27" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E27", "type": "Negative_regulation", "trigger": { "text": [ "absence" ], "offsets": [ [ 2411, 2418 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E28" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E28", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2428, 2438 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T18" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E29", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 2662, 2670 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T19" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E30", "type": "Regulation", "trigger": { "text": [ "role" ], "offsets": [ [ 2808, 2812 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E31" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E31", "type": "Regulation", "trigger": { "text": [ "regulation" ], "offsets": [ [ 2816, 2826 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E32" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E32", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2836, 2846 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T21" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E33", "type": "Regulation", "trigger": { "text": [ "important role" ], "offsets": [ [ 2897, 2911 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E34" }, { "role": "Cause", "ref_id": "PMC-1310901-15-DISCUSSION_T25" }, { "role": "CSite", "ref_id": "PMC-1310901-15-DISCUSSION_T99" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E34", "type": "Positive_regulation", "trigger": { "text": [ "induction" ], "offsets": [ [ 2921, 2930 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T22" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E35", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 2940, 2950 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T23" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E36", "type": "Positive_regulation", "trigger": { "text": [ "depends" ], "offsets": [ [ 2951, 2958 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E35" }, { "role": "Cause", "ref_id": "PMC-1310901-15-DISCUSSION_E37" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E37", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 2962, 2969 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T24" }, { "role": "Theme2", "ref_id": "PMC-1310901-15-DISCUSSION_T25" }, { "role": "Site2", "ref_id": "PMC-1310901-15-DISCUSSION_T99" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E38", "type": "Negative_regulation", "trigger": { "text": [ "inhibits" ], "offsets": [ [ 3115, 3123 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E39" }, { "role": "Cause", "ref_id": "PMC-1310901-15-DISCUSSION_T25" }, { "role": "CSite", "ref_id": "PMC-1310901-15-DISCUSSION_T105" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E39", "type": "Binding", "trigger": { "text": [ "binding" ], "offsets": [ [ 3124, 3131 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T25" }, { "role": "Site", "ref_id": "PMC-1310901-15-DISCUSSION_T106" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E40", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 3248, 3256 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T26" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E41", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 3262, 3270 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T26" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E42", "type": "Negative_regulation", "trigger": { "text": [ "silencing" ], "offsets": [ [ 3357, 3366 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T27" }, { "role": "Site", "ref_id": "PMC-1310901-15-DISCUSSION_T112" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E43", "type": "Regulation", "trigger": { "text": [ "deregulation" ], "offsets": [ [ 3455, 3467 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T28" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E44", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 3651, 3665 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T29" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E45", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4006, 4016 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T30" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E46", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4257, 4267 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T32" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E47", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4322, 4332 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T33" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E48", "type": "Negative_regulation", "trigger": { "text": [ "loss" ], "offsets": [ [ 4444, 4448 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E49" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E49", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4458, 4468 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T34" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E50", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 4674, 4684 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T35" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E51", "type": "Negative_regulation", "trigger": { "text": [ "impaired" ], "offsets": [ [ 4758, 4766 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E50" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E52", "type": "Negative_regulation", "trigger": { "text": [ "loss" ], "offsets": [ [ 4845, 4849 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T35" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E53", "type": "Negative_regulation", "trigger": { "text": [ "reverted" ], "offsets": [ [ 4875, 4883 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E52" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E54", "type": "Gene_expression", "trigger": { "text": [ "negative" ], "offsets": [ [ 4893, 4901 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T39" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E55", "type": "Regulation", "trigger": { "text": [ "effect" ], "offsets": [ [ 4999, 5005 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E56" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E56", "type": "Gene_expression", "trigger": { "text": [ "levels" ], "offsets": [ [ 5015, 5021 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T40" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E57", "type": "Gene_expression", "trigger": { "text": [ "positive" ], "offsets": [ [ 5031, 5039 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T41" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E58", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 5307, 5317 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T42" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E59", "type": "Regulation", "trigger": { "text": [ "changes" ], "offsets": [ [ 5318, 5325 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E58" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E60", "type": "Positive_regulation", "trigger": { "text": [ "resulting" ], "offsets": [ [ 5747, 5756 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E61" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E61", "type": "Positive_regulation", "trigger": { "text": [ "overexpression" ], "offsets": [ [ 5773, 5787 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T52" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E62", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 5834, 5844 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T53" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E63", "type": "Negative_regulation", "trigger": { "text": [ "Down-regulation" ], "offsets": [ [ 6096, 6111 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T55" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E64", "type": "Gene_expression", "trigger": { "text": [ "knock-out" ], "offsets": [ [ 6234, 6243 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T56" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E65", "type": "Gene_expression", "trigger": { "text": [ "knock-out" ], "offsets": [ [ 6234, 6243 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T57" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E66", "type": "Positive_regulation", "trigger": { "text": [ "up-regulation" ], "offsets": [ [ 6267, 6280 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T58" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E67", "type": "Regulation", "trigger": { "text": [ "regulates" ], "offsets": [ [ 6401, 6410 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E68" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E68", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 6417, 6427 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T60" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E69", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 6447, 6457 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_T61" } ] }, { "id": "PMC-1310901-15-DISCUSSION_E70", "type": "Positive_regulation", "trigger": { "text": [ "consequence" ], "offsets": [ [ 6505, 6516 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1310901-15-DISCUSSION_E69" } ] } ]

[ { "id": "PMC-1310901-15-DISCUSSION_1", "entity_ids": [ "PMC-1310901-15-DISCUSSION_T35", "PMC-1310901-15-DISCUSSION_T36", "PMC-1310901-15-DISCUSSION_T37" ] }, { "id": "PMC-1310901-15-DISCUSSION_2", "entity_ids": [ "PMC-1310901-15-DISCUSSION_T49", "PMC-1310901-15-DISCUSSION_T50" ] } ]

[ { "id": "PMC-1310901-15-DISCUSSION_R1", "type": "Coreference", "arg1_id": "PMC-1310901-15-DISCUSSION_T63", "arg2_id": "PMC-1310901-15-DISCUSSION_T99", "normalized": [] }, { "id": "PMC-1310901-15-DISCUSSION_R2", "type": "Coreference", "arg1_id": "PMC-1310901-15-DISCUSSION_T64", "arg2_id": "PMC-1310901-15-DISCUSSION_T35", "normalized": [] } ]

[ { "id": "PMC-2889865-25-Caption-Table_2__text", "type": "abstract", "text": [ "Jurkat T-cells were treated with 10 nM NAI, 10 muM JNK-I or10 nM PKC-I for 2 h followed by induction with 162 nM PMA for 24 h." ], "offsets": [ [ 0, 126 ] ] } ]

[]

[]

[]

[]

[ { "id": "PMC-1447668-03-Results__text", "type": "abstract", "text": [ "The Carboxyl-Terminal FKH Domain Is Not Required for Suppression of NF-kappaB Activation in T Cells\nTo define the requirements of Foxp3 with respect to inhibition of NF-kappaB-dependent transcription, we utilized a mutant of Foxp3 lacking the FKH domain (Figure 2A) [16], similar to the scurfy mutant Foxp3 of mice, and a mutant Foxp3 protein from a patient with IPEX [4,11,14,17]. Unlike full-length Foxp3, which localizes almost exclusively to the nucleus and can bind in a sequence-specific manner to forkhead binding sites, the deltaFKH mutant fails to localize to the nucleus and thus cannot interact with promoter elements or nuclear proteins [16]. Therefore, we utilized the deltaFKH mutant to determine whether nuclear localization (or other function associated with the FKH domain) of Foxp3 was a prerequisite for inhibition of NF-kappaB activation. Although Foxp3 interaction with NF-kappaB presumably takes place in the nucleus, it may also be possible for a cytoplasmic Foxp3 protein to bind to NF-kappaB in the cytoplasm and prevent localization to the nucleus following an activation stimulus. Overexpression of full-length Foxp3, but not of deltaFKH, was able to suppress activation of a cotransfected NF-kappaB reporter vector in HEK 293T cells (Figure 2B). Both Foxp3 and deltaFKH were expressed at very high levels following transfection as detected by real-time RT-PCR (unpublished data). These data appear to suggest that the carboxyl-terminal FKH domain is critically important for Foxp3 to down-regulate NF-kappaB-dependent transcription. However, NF-kappaB activation was blocked to a similar extent by both full-length Foxp3 and deltaFKH in Jurkat T cells (Figure 2C) and primary human CD4+ T cells (Figure 2D). Western blot analysis of NF-kappaB p65 expression demonstrated that Foxp3 and deltaFKH does not block NF-kappaB activation at the level of p65 protein expression (Figure 2E). These results are very interesting with respect to Foxp3 function, because they suggest that the carboxyl-terminal FKH domain, and possibly nuclear localization, are dispensable for Foxp3 function in T cell populations. Alternative interpretations may include the possibility that the localization of deltaFKH differ between epithelial cells and T cells. In either case, these results suggest a cell type-specific mechanism of action for this Foxp3 mutant." ], "offsets": [ [ 0, 2367 ] ] } ]

[ { "id": "PMC-1447668-03-Results_T1", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 130, 135 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T2", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 225, 230 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T3", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 301, 306 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T4", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 329, 334 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T5", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 401, 406 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T6", "type": "Protein", "text": [ "deltaFKH mutant" ], "offsets": [ [ 532, 547 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T7", "type": "Protein", "text": [ "deltaFKH mutant" ], "offsets": [ [ 682, 697 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T8", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 794, 799 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T9", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 868, 873 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T10", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 982, 987 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T11", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1138, 1143 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T12", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1156, 1164 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T13", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1279, 1284 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T14", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1289, 1297 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T15", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1503, 1508 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T16", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1643, 1648 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T17", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1653, 1661 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T18", "type": "Protein", "text": [ "CD4" ], "offsets": [ [ 1710, 1713 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T19", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1771, 1774 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T20", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1804, 1809 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T21", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 1814, 1822 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T22", "type": "Protein", "text": [ "p65" ], "offsets": [ [ 1875, 1878 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T23", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 1962, 1967 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T24", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2093, 2098 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T25", "type": "Protein", "text": [ "deltaFKH" ], "offsets": [ [ 2212, 2220 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T26", "type": "Protein", "text": [ "Foxp3" ], "offsets": [ [ 2354, 2359 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T29", "type": "Entity", "text": [ "FKH domain" ], "offsets": [ [ 243, 253 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T27", "type": "Anaphora", "text": [ "which" ], "offsets": [ [ 408, 413 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T31", "type": "Entity", "text": [ "nucleus" ], "offsets": [ [ 450, 457 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T34", "type": "Entity", "text": [ "nucleus" ], "offsets": [ [ 573, 580 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T36", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 719, 726 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T42", "type": "Entity", "text": [ "nucleus" ], "offsets": [ [ 1066, 1073 ] ], "normalized": [] }, { "id": "PMC-1447668-03-Results_T50", "type": "Entity", "text": [ "nuclear" ], "offsets": [ [ 2051, 2058 ] ], "normalized": [] } ]

[ { "id": "PMC-1447668-03-Results_E1", "type": "Negative_regulation", "trigger": { "text": [ "lacking" ], "offsets": [ [ 231, 238 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T2" }, { "role": "Site", "ref_id": "PMC-1447668-03-Results_T29" } ] }, { "id": "PMC-1447668-03-Results_E2", "type": "Localization", "trigger": { "text": [ "localizes" ], "offsets": [ [ 414, 423 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T5" }, { "role": "ToLoc", "ref_id": "PMC-1447668-03-Results_T31" } ] }, { "id": "PMC-1447668-03-Results_E3", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 466, 470 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T5" } ] }, { "id": "PMC-1447668-03-Results_E4", "type": "Localization", "trigger": { "text": [ "localize" ], "offsets": [ [ 557, 565 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T6" }, { "role": "ToLoc", "ref_id": "PMC-1447668-03-Results_T34" } ] }, { "id": "PMC-1447668-03-Results_E5", "type": "Binding", "trigger": { "text": [ "interact" ], "offsets": [ [ 597, 605 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T6" } ] }, { "id": "PMC-1447668-03-Results_E6", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 727, 739 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T8" }, { "role": "ToLoc", "ref_id": "PMC-1447668-03-Results_T36" } ] }, { "id": "PMC-1447668-03-Results_E7", "type": "Binding", "trigger": { "text": [ "interaction" ], "offsets": [ [ 874, 885 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T9" } ] }, { "id": "PMC-1447668-03-Results_E8", "type": "Binding", "trigger": { "text": [ "bind" ], "offsets": [ [ 999, 1003 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T10" } ] }, { "id": "PMC-1447668-03-Results_E9", "type": "Negative_regulation", "trigger": { "text": [ "prevent" ], "offsets": [ [ 1038, 1045 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E10" }, { "role": "Cause", "ref_id": "PMC-1447668-03-Results_E8" } ] }, { "id": "PMC-1447668-03-Results_E10", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 1046, 1058 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T10" }, { "role": "ToLoc", "ref_id": "PMC-1447668-03-Results_T42" } ] }, { "id": "PMC-1447668-03-Results_E11", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 1074, 1083 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E10" } ] }, { "id": "PMC-1447668-03-Results_E12", "type": "Positive_regulation", "trigger": { "text": [ "Overexpression" ], "offsets": [ [ 1108, 1122 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T11" } ] }, { "id": "PMC-1447668-03-Results_E13", "type": "Positive_regulation", "trigger": { "text": [ "Overexpression" ], "offsets": [ [ 1108, 1122 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T12" } ] }, { "id": "PMC-1447668-03-Results_E14", "type": "Positive_regulation", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1303, 1312 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T13" } ] }, { "id": "PMC-1447668-03-Results_E15", "type": "Positive_regulation", "trigger": { "text": [ "expressed" ], "offsets": [ [ 1303, 1312 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T14" } ] }, { "id": "PMC-1447668-03-Results_E16", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 1333, 1342 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E14" } ] }, { "id": "PMC-1447668-03-Results_E17", "type": "Positive_regulation", "trigger": { "text": [ "following" ], "offsets": [ [ 1333, 1342 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E15" } ] }, { "id": "PMC-1447668-03-Results_E18", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1775, 1785 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T19" } ] }, { "id": "PMC-1447668-03-Results_E19", "type": "Negative_regulation", "trigger": { "text": [ "block" ], "offsets": [ [ 1832, 1837 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E20" }, { "role": "Cause", "ref_id": "PMC-1447668-03-Results_T20" } ] }, { "id": "PMC-1447668-03-Results_E20", "type": "Gene_expression", "trigger": { "text": [ "expression" ], "offsets": [ [ 1887, 1897 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T22" } ] }, { "id": "PMC-1447668-03-Results_E21", "type": "Negative_regulation", "trigger": { "text": [ "block" ], "offsets": [ [ 1832, 1837 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_E20" }, { "role": "Cause", "ref_id": "PMC-1447668-03-Results_T21" } ] }, { "id": "PMC-1447668-03-Results_E22", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 2059, 2071 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T24" }, { "role": "ToLoc", "ref_id": "PMC-1447668-03-Results_T50" } ] }, { "id": "PMC-1447668-03-Results_E23", "type": "Localization", "trigger": { "text": [ "localization" ], "offsets": [ [ 2196, 2208 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-1447668-03-Results_T25" } ] } ]

[]

[ { "id": "PMC-1447668-03-Results_R1", "type": "Coreference", "arg1_id": "PMC-1447668-03-Results_T27", "arg2_id": "PMC-1447668-03-Results_T5", "normalized": [] } ]

[ { "id": "PMC-2626671-13-MATERIALS_AND_METHODS__text", "type": "abstract", "text": [ "Retroviral transduction of primary CD8+ T cells.\nFor transduction experiments, viral supernatants were generated by calcium phosphate transfection of Phoenix cells and concentration by overnight centrifugation at 6,000 g. At ~42 h after the initial TCR activation of 106 CD8+ T cells per well in 12-well plates, the culture media was removed and replaced with complete media supplemented with 8 mug/ml polybrene containing fresh plus concentrated virus. The plates were centrifuged at 700 g for 1 h at RT before returning to 37degreesC for an additional 5 h. Retroviral constructs for Eomes-VP16 and the MIG control empty vector were a gift from S.L. Reiner (University of Pennsylvania, Philadelphia, PA) (8)." ], "offsets": [ [ 0, 709 ] ] } ]

[ { "id": "PMC-2626671-13-MATERIALS_AND_METHODS_T1", "type": "Protein", "text": [ "CD8" ], "offsets": [ [ 271, 274 ] ], "normalized": [] }, { "id": "PMC-2626671-13-MATERIALS_AND_METHODS_T2", "type": "Protein", "text": [ "Eomes-VP16" ], "offsets": [ [ 585, 595 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2889865-13-Materials_and_methods__text", "type": "abstract", "text": [ "Western blot analysis\nFollowing stimulation, Jurkat T-cells were centrifuged at 1000 x g for 8 min and lysed on ice for 2 h using sodium hydroxide with the addition of a protease inhibitor cocktail (Roche, Mannheim). The cells were further centrifuged at 8000 x g, 4degreesC for 10 min and the supernatants were transferred to new tubes. Cytoplasmic proteins (~8 mug) were separated by SDS-PAGE (10%) followed by western blotting using anti-IkappaBbeta, phospho-PKC (pan)(zeta Thr410)(190D10), anti-Bcl10 (Cell Signalling Technology, Boston) and beta-actin (Abcam, Cambridge). Detection was performed following incubation with ECL(TM) Anti-rabbit IgG, horseradish peroxidase linked whole antibodies (Amersham Biosciences, Buckinghamshire) and developed using ECL(TM) Western Blotting Detection Reagents (GE Healthcare, UK)." ], "offsets": [ [ 0, 823 ] ] } ]

[ { "id": "PMC-2889865-13-Materials_and_methods_T1", "type": "Protein", "text": [ "beta-actin" ], "offsets": [ [ 546, 556 ] ], "normalized": [] } ]

[]

[]

[]

[ { "id": "PMC-2065877-23-Caption-Figure_5__text", "type": "abstract", "text": [ "LMP1 Upregulates IL10 Expression and Constitutively Activates Stat3\n(A) Relative expression of IL10, IL15, and IFNgamma mRNA in WT and LMP1 transgenic B cells (CD19+), as detected with an Rnase protection assay. Mouse lymphoma cell lines 967 and K46mu were used as controls. Expression levels were quantified with a phosphorimager and values were normalized to the ribosomal housekeeping gene L32. The cytokine:L32 ratio was set to 1 in the mouse B cell lymphoma line 967.\n(B and C) Immunoblot analysis of activated pStat3 in purified B cells (CD19+) from WT and LMP1 transgenic mice (B) at the time of harvest, and (C) 4 h after culture with or without IL10, a neutralizing antibody to IL10, or a rat IgG1 isotype control. (C) Shown are the results for WT lymphoma 1 and LMP1 transgenic lymphoma 1. Arrows indicate the positions of the alpha and beta isoforms of Stat3. Actin was used as a loading control.\n(D) Immunohistochemistry detection of activated nuclear pStat3 in the spleens of WT and LMP1 transgenic mice. Scale bar, 20 mum." ], "offsets": [ [ 0, 1036 ] ] } ]

[ { "id": "PMC-2065877-23-Caption-Figure_5_T1", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 0, 4 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T2", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 17, 21 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T3", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 62, 67 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T4", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 95, 99 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T5", "type": "Protein", "text": [ "IL15" ], "offsets": [ [ 101, 105 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T6", "type": "Protein", "text": [ "IFNgamma" ], "offsets": [ [ 111, 119 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T7", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 135, 139 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T8", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 160, 164 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T9", "type": "Protein", "text": [ "L32" ], "offsets": [ [ 393, 396 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T10", "type": "Protein", "text": [ "L32" ], "offsets": [ [ 411, 414 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T11", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 516, 522 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T12", "type": "Protein", "text": [ "CD19" ], "offsets": [ [ 544, 548 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T13", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 563, 567 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T14", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 654, 658 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T15", "type": "Protein", "text": [ "IL10" ], "offsets": [ [ 687, 691 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T16", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 772, 776 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T17", "type": "Protein", "text": [ "Stat3" ], "offsets": [ [ 864, 869 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T18", "type": "Protein", "text": [ "pStat3" ], "offsets": [ [ 964, 970 ] ], "normalized": [] }, { "id": "PMC-2065877-23-Caption-Figure_5_T19", "type": "Protein", "text": [ "LMP1" ], "offsets": [ [ 996, 1000 ] ], "normalized": [] } ]

[ { "id": "PMC-2065877-23-Caption-Figure_5_E1", "type": "Positive_regulation", "trigger": { "text": [ "Upregulates" ], "offsets": [ [ 5, 16 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_E2" }, { "role": "Cause", "ref_id": "PMC-2065877-23-Caption-Figure_5_T1" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E2", "type": "Gene_expression", "trigger": { "text": [ "Expression" ], "offsets": [ [ 22, 32 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T2" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E3", "type": "Positive_regulation", "trigger": { "text": [ "Activates" ], "offsets": [ [ 52, 61 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T3" }, { "role": "Cause", "ref_id": "PMC-2065877-23-Caption-Figure_5_T1" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E4", "type": "Transcription", "trigger": { "text": [ "expression" ], "offsets": [ [ 81, 91 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T4" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E5", "type": "Transcription", "trigger": { "text": [ "expression" ], "offsets": [ [ 81, 91 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T5" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E6", "type": "Transcription", "trigger": { "text": [ "expression" ], "offsets": [ [ 81, 91 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T6" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E7", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 506, 515 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T11" } ] }, { "id": "PMC-2065877-23-Caption-Figure_5_E8", "type": "Positive_regulation", "trigger": { "text": [ "activated" ], "offsets": [ [ 946, 955 ] ] }, "arguments": [ { "role": "Theme", "ref_id": "PMC-2065877-23-Caption-Figure_5_T18" } ] } ]

[]

[]