Search is not available for this dataset
text
stringlengths
0
868k
Tuberculosis (tb) is caused by the mycobacterium tuberculosis, a member of the m. tuberculosis complex (mtbc). According to the world health organization (who), in 2010, there were an estimated 12.0 million prevalent cases of tb (equivalent to 178 cases per 100000 individuals) and approximately 1.4 million people died of tb during that year . Most of the cases in 2009 (55%) occurred in asia (1). According to the administration of tuberculosis and leprosy control of the ministry of health and medical education in iran, in 2010, a total of 10485 old and new cases of tb were reported in iran and of these cases, 326 patients (around 2.2%) were hiv positive (2). The diseases caused by mycobacterium complex have become more important in the recent years, particularly in association with the worldwide pandemic situation caused by human immunodeficiency virus (hiv). In 2010, in addition, there were an estimated 0.35 million deaths among tb cases that were hiv - positive . According to who, the incidence of pulmonary tuberculosis in hiv - positive patients in iran was 0.38 (0.28 - 0.51) per 100000 individuals in 2012 (3). Some opportunistic microorganisms such as nocardia spp . Are gram - positive (weakly acid fast) and filamentous with a branching appearance and are not part of the normal human bacterial flora . To date at least sixteen species capable of producing disease in humans have been identified (4). Pulmonary disease is the predominant clinical presentation of this microorganism and can be fatal if untreated . Untreated pulmonary nocardiosis is similar to tuberculosis and n. asteroids is the most frequent cause of pulmonary infection in humans (85%) (5). Since the clinical and radiological manifestations are non - specific, pulmonary nocardiosis could be mistaken with other infections or other bacterial pneumonia . In addition, nocardiosis may be under reported because it is not among the aids - defining criteria (6). Diagnosis of pulmonary nocardiosis is dependent on the isolation or demonstration of the organism from respiratory secretions such as sputum or tissue specimens . Nocardia as a m. tuberculosis is a slow growing organism that requires prolonged incubation for at least 4 - 6 weeks (7). The diagnosis of nocardiosis is currently based on direct examination and conventional culture; serology is usually not useful . Treatment of nocardiosis is different from tuberculosis regarding therapeutic agents, route of administration and duration of therapy (8). Sulfonamides have been the agents of choice for the treatment of nocardiosis, however combination therapy with two or more agents is recommended . Although nocardiosis is an uncommon illness, co - infection of this disease with tuberculosis has been reported (9). The aim of this study was to assess the presence of nocardia spp . And m. tuberculosis in sputum specimens of patients with pulmonary tuberculosis . In the meantime, 32 hiv - infected patients who were suspected of having pulmonary tuberculosis were included in this study in order to evaluate concomitant infection in these patients . A total of 189 sputum samples were obtained from the reference mycobacteriology laboratory, ahvaz jundishapur university of medical sciences from march 2011 to april 2012 . All specimens were processed immediately according to standard routine diagnosis procedures by the naoh / n - acetyl - l - cysteine (nalc) method . Next, concentrated specimens were used for smear preparation, culture and pcr assay (10, 11). Furthermore, 250 l of each concentrated sputum specimen was inoculated onto lowenstein - jensen (l - j) media (merck, germany). Are acid fast and can survive the decontamination of clinical specimens with sodium hydroxide and nalc methods, thereby, they can grow on l - j medium . Cultures were examined weekly and after 8 weeks of incubation, cultures, which showed no growth, were reported negative and discarded . For microscopic examination, using a disposable pasteur pipette, one drop of the sediment of the sputum specimen was spread on each clean microscope slide and after air drying and fixation by heat, the smears were stained by ziehl - neelsen and gram staining (10). After decontamination, the chromosomal dna was extracted using proteinase k and phenol: chloroform, and then precipitated by ethanol and isopropanol, according to standard procedures (12). The purified dna was amplified with specific pairs of primers is1 (5ctcgtccagcgccgcttcgg 3) and is2 (5cctgcgagcgtaggcggtgg 3) for m. tuberculosis complex strains ann microbiol . The pcr protocols were optimized to 35 cycles consisting of 45 seconds at 94c for denaturation, 30 seconds at 68c for annealing and 30 seconds at 72c for extension, followed by a final 5 minute extension at 72c . Primers ng1 (5ctcgtccagcgccgcttcgg3) and ng2 (5cctgcgagcgtaggcggtgg3) were used to amplify a nocardia genus specific 590-bp fragment of 16s rrna . The pcr protocols were optimized to 40 cycles consisting of 45 seconds at 94c for denaturation, 30 seconds at 57c for annealing and 30 seconds at 72c for extension, followed by a final 5 minute extension at 72c . Amplification with these primers was observed by electrophoresis on 2% (w / v) agarose gel stained with ethidium bromide (figure 1). The n. asteroides atcc 19247 and m. tuberculosis h37rv were used as positive reference strains . Two pcrs for each sample were performed in separate tubes with two pairs of primers . One set was dedicated to the m. tuberculosis complex, whereas the other set was for nocardia spp . For each round of pcr the investigators were blinded to clinical data during the experiment for detection of microbial agents co - infection . All specimens were unnamed and labeled by a secure code in the reference mycobacteriology laboratory . A: clinical sample of m. tuberculosis . A total of 189 sputum samples were obtained from the reference mycobacteriology laboratory, ahvaz jundishapur university of medical sciences from march 2011 to april 2012 . All specimens were processed immediately according to standard routine diagnosis procedures by the naoh / n - acetyl - l - cysteine (nalc) method . Next, concentrated specimens were used for smear preparation, culture and pcr assay (10, 11). Furthermore, 250 l of each concentrated sputum specimen was inoculated onto lowenstein - jensen (l - j) media (merck, germany). Are acid fast and can survive the decontamination of clinical specimens with sodium hydroxide and nalc methods, thereby, they can grow on l - j medium . Cultures were examined weekly and after 8 weeks of incubation, cultures, which showed no growth, were reported negative and discarded . For microscopic examination, using a disposable pasteur pipette, one drop of the sediment of the sputum specimen was spread on each clean microscope slide and after air drying and fixation by heat, the smears were stained by ziehl - neelsen and gram staining (10). After decontamination, the chromosomal dna was extracted using proteinase k and phenol: chloroform, and then precipitated by ethanol and isopropanol, according to standard procedures (12). The purified dna was amplified with specific pairs of primers is1 (5ctcgtccagcgccgcttcgg 3) and is2 (5cctgcgagcgtaggcggtgg 3) for m. tuberculosis complex strains ann microbiol . The pcr protocols were optimized to 35 cycles consisting of 45 seconds at 94c for denaturation, 30 seconds at 68c for annealing and 30 seconds at 72c for extension, followed by a final 5 minute extension at 72c . Primers ng1 (5ctcgtccagcgccgcttcgg3) and ng2 (5cctgcgagcgtaggcggtgg3) were used to amplify a nocardia genus specific 590-bp fragment of 16s rrna . The pcr protocols were optimized to 40 cycles consisting of 45 seconds at 94c for denaturation, 30 seconds at 57c for annealing and 30 seconds at 72c for extension, followed by a final 5 minute extension at 72c . Amplification with these primers was observed by electrophoresis on 2% (w / v) agarose gel stained with ethidium bromide (figure 1). The n. asteroides atcc 19247 and m. tuberculosis h37rv were used as positive reference strains . Two pcrs for each sample were performed in separate tubes with two pairs of primers . One set was dedicated to the m. tuberculosis complex, whereas the other set was for nocardia spp . For each round of pcr the investigators were blinded to clinical data during the experiment for detection of microbial agents co - infection . All specimens were unnamed and labeled by a secure code in the reference mycobacteriology laboratory . A: clinical sample of m. tuberculosis . Among the 157 outpatients, 7.6% (12/157) of specimens had positive results for acid fast bacilli by acid fast staining but none of the samples were positive for nocardia spp . After cultures evolution, 10.1% (16/157) of specimens had positive results for mtbc while no specimens grew nocardia spp . During microscopic examination by the gram staining method, we could nt find any particle morphologically similar to nocardia . Out of 157 samples, 7% (11/157) were positive by pcr for mtbc and none of the samples was positive for nocardia by pcr . Among 32 samples in hiv - infected patients, four (12.5%) were culture positive for m. tuberculosis and none of them were positive for nocardia . Furthermore, these four samples were positive by acid fast staining and pcr assay . Out of these four samples, two were positive for nocardia spp . By the pcr method . Based on our data the prevalence of nocardiosis and also concomitant infection with tuberculosis in our study was 6.25% (2/32) in hiv - infected patients and 1.05% (2/189) for all cases . Among the 157 outpatients, 7.6% (12/157) of specimens had positive results for acid fast bacilli by acid fast staining but none of the samples were positive for nocardia spp . After cultures evolution, 10.1% (16/157) of specimens had positive results for mtbc while no specimens grew nocardia spp . During microscopic examination by the gram staining method, we could nt find any particle morphologically similar to nocardia . Out of 157 samples, 7% (11/157) were positive by pcr for mtbc and none of the samples was positive for nocardia by pcr . Among 32 samples in hiv - infected patients, four (12.5%) were culture positive for m. tuberculosis and none of them were positive for nocardia . Furthermore, these four samples were positive by acid fast staining and pcr assay . Out of these four samples, two were positive for nocardia spp . By the pcr method . Based on our data the prevalence of nocardiosis and also concomitant infection with tuberculosis in our study was 6.25% (2/32) in hiv - infected patients and 1.05% (2/189) for all cases . As clinical manifestation of pulmonary tuberculosis and nocardiosis are similar, laboratory tests are required in order to distinguish of nocardiosis from tuberculosis . Nocardia is a slow growing bacteria and the contamination risk of the culture with other bacteria and fungi is high . Therefore, the suggested approach for this problem is molecular techniques, since they are more sensitive than conventional diagnostic methods (15). As two samples were positive for nocardia spp . And mtbc using the pcr method, it is suggested that concurrent pulmonary tuberculosis and nocardiosis may developed coincidently . Nocardiosis has been reported to be more prevalent in hiv infected patients . In these patients, infection with opportunistic agents such as nocardia is attributed to suppression of cell mediated immunity (16). It has been suggested that, the most common condition predisposing patients to nocardiosis is underlying chronic lung disease . In this study it was found that the coincidence of pulmonary tuberculosis and nocardiosis was 1% for the entire study population and 6.25% among hiv - infected patients . The incidence of pulmonary nocardiosis in hiv - infected patients has been previously reported by some investigators . Pulmonary nocardiosis in hiv - infected patients with suspected pulmonary tuberculosis was reported to be 3% by alnaum et al . ; they reported an average of 3 - 4% for this infection (17). Some reports indicate that greater than two - thirds of the patients diagnosed with pulmonary nocardiosis were initially diagnosed as having tuberculosis and about 5% of the patients with proven pulmonary tuberculosis were shown to have co - infection with nocardia (18). Out of 140 sputum samples from african hiv - positive individuals clinically suspected of having tuberculosis (tb), the frequency of nocardiosis was reported as 3.6% (19). In areas where hiv - associated tb is common, only a few case reports of concomitant infection of nocardia and tb have been published in the literature (20). A prevalence of 1.4% for pulmonary nocardiosis was reported in a tuberculosis and chest diseases hospital in amritsar by singh et al . Although, pintado et al . Indicated that the overall incidence of nocardiosis among hiv - infected patients is between 0.1 and 0.4%, and is associated with high morbidity and mortality rates (18). Concurrent pulmonary aspergillosis and nocardiosis was reported in an immunocompromised patient following long - term steroid therapy (22). In this study nocardia was not distinguished in sputum specimens using conventional methods, however, positive samples were determined using the pcr assay . Our study showed that the pcr technique was more sensitive than conventional methods in detection of nocardia . Accordance of molecular techniques with conventional methods has been reported as 70 to 90% by several studies (22, 23). In iran, several studies investigated pulmonary nocardiosis or tuberculosis in patients with various clinical symptoms . Recently, aminzade et al . Reported concomitant pulmonary nocardiosis and tuberculosis in a patient with rheumatoid arthritis (24). In a study by eshraghi and amin, nocardia asteroides was isolated from only one patient suffering from cushing s syndrome with bronchogenic carcinoma amongst 142 patients with advanced symptomatic pulmonary disease in tehran, iran (25). In another study from iran (shojaei et al .) Clinical isolation of n. cyricigeorgica from patients with various clinical manifestations was performed (26). To the best of our knowledge, this is the first study reporting co - infection of nocardiosis and tuberculosis in hiv - positive patients in iran . Concurrent pulmonary tuberculosis and nocardiosis is much more frequent in hiv - infected patients and can be fatal . Although nocardiosis resembles tuberculosis, first line anti - tuberculous drugs are not efficient for its treatment . Therefore, it is important to establish a potent diagnosis method with high sensitivity and specificity such as molecular methods to improve the speed of diagnosis of nocardiosis.
Proton magnetic resonance spectroscopy (h mrs) is a noninvasive technique that allows us to provide an in vivo assessment of brain tissue composition and this gives us an insight into the metabolic processes of neurologic disorders (1, 2). This technique's ability to obtain good spatial localization and serial measurements with high resolution makes in vivo h mrs an ideal investigative tool of brain function, with respect to biochemical interactions (3). The application of this technique creates the possibility of observing major brain metabolites that contributes to the major resonances seen in h mr spectra of the brain, such as n - acetylaspartate (naa), creatine / phosphocreatine (cr), choline - containing compounds (cho), and myo - inositiols (ins) (1 - 3). Using current localization techniques, h mrs spectra can be obtained from regions of 1 - 10 l within the timescale of a clinical examination, and this allows for the definition of spectral changes specific to the motor cortex (3). Early studies of h mrs in stroke have mostly investigated ischemic stroke, and they have shown an increased lactate and decreased naa within the stroke lesion (4 - 6). However, attempts to determine whether the magnitude of neuronal damage, as measured by naa loss, correlates with the disability and impairment in ischemic stroke patients have brought forth inconsistent results (7 - 10). There has been no previous h mrs study that has investigated the metabolic changes in the higher motor cortex following intracerebral hematoma in hemiparetic humans . The aim of this study was to evaluate the local metabolic changes for the primary motor cortex (m-1) and supplementary motor area (sma) in the affected hemisphere (ah) and unaffected hemisphere (uh), according to their axonal injuries at the level of the internal capsule . The m-1/sma of the ah and the uh were studied using h mrs on 9 patients (4 men and 5 women; mean age 54 yr, range 30 - 70 yr, right - handed) with documentable hemiparesis of varying severity . The hemiparesis was caused by deep intracerebral hematoma in the putamen and the thalamus because these locations are directly adjacent to the internal capsule, and an intracerebral hematoma in these areas mostly brings about hemiparesis as a neurologic sequele . The h mrs study was performed on alert patients with definite hemiparesis of the extremities contralateral to the ah . To control the possible h mrs spectral change, we excluded those patients that had undergone any surgical intervention or if they had a major systemic illness, such as uremia . The results were compared with h mrs studies performed on 10 normal control volunteers (five men and five women; mean age 41 yr, range 28 - 59 yr, all right - handed), and they were screened to exclude those people with prior systemic disease or head injury . The institutional review board approved the mr study proctocol and the investigation was conducted in full compliance with accepted standards for research involving humans . The mean duration of the study was approximately 1 yr, with a range of 7 days to 1 yr after development of intracerebral hematoma . In vivo h mrs studies were performed on a 1.5 t mri / mrs system (ge signa advantage, version 4.8; ge medical systems, milwaukee, wi, u.s.a .) Using the stimulated echo acquisition mode (steam) sequence after water suppression with chemical - shift selective (chess) rf pulse and dephasing gradients (11, 12). A standard head coil was used for the routine neurological and research imaging sequences, with image - guided single - voxel spectroscopic acquisition . A 6.4 ml volume in the cortex was selected using the t2-weighted mr images (90 msec te, 2,500 msec tr). For examining the m-1 cortex with the single voxel technique, a cubic volumes of interest (voi) of 181820 mm was placed in the medial precentral gyrus (broadman area 4) anterior to the central sulcus in both hemispheres (ah and uh), and for the sma, the same - sized voi was placed in the medial side of the superior frontal gyrus (broadman area 6) just anterior to the m-1 cortex voi, as is shown in fig . The voxel location was carefully chosen by two investigators to ensure the exact anatomical location of m-1/sma for each patient . The spectral parameters used were: 20 msec te, 2,000 msec tr, 128 averages, 2,500 hz spectral width, and 2,048 data points . The shim procedure was used for optimizing the magnetic field homogeneity over the entire volume of interest that was detected by the receiver coil and focused on the water signal . After an autoprescan, the typical line width (full length at half maximum; fwhm) was usually 2 to 4 hz, and the raw data was processed using a sage data analysis package (ge medical systems). The post - processing was done using zerofilling to 4k, and apodization filtering was used to improve either snr or resolution and/or to reduce the truncation artifacts . Fourier transformation, zero order phase correction, and phase absorption spectra were performed directly along with baseline corrections or resolution enhancement . The peak areas were obtained from the spectra using the marquardt algorithm to fit a lorentzian - gaussian peak type (13). Proton peak assignments of the major in vivo h mrs observable metabolites were naa at 2.00 ppm; cr at 3.00 pm; cho at 3.20 ppm; sum (glx) of glu and gaba at 2.35, and 2.25 ppm; and ins at 3.50 pm (14). After the data was processed by our selected personal " blinded " to the patient's histories and conditions, the results were expressed as meanssd of the naa / cr ratio and the cho / cr ratios . The metabolite ratios in the ah and uh and the controls' values were compared for significant differences using the paired t - test assuming equal variance and independent sample t - test . Probability values of less than 0.05 were considered significant, and values less than 0.01 were considered highly significant . The m-1/sma of the ah and the uh were studied using h mrs on 9 patients (4 men and 5 women; mean age 54 yr, range 30 - 70 yr, right - handed) with documentable hemiparesis of varying severity . The hemiparesis was caused by deep intracerebral hematoma in the putamen and the thalamus because these locations are directly adjacent to the internal capsule, and an intracerebral hematoma in these areas mostly brings about hemiparesis as a neurologic sequele . The h mrs study was performed on alert patients with definite hemiparesis of the extremities contralateral to the ah . To control the possible h mrs spectral change, we excluded those patients that had undergone any surgical intervention or if they had a major systemic illness, such as uremia . The results were compared with h mrs studies performed on 10 normal control volunteers (five men and five women; mean age 41 yr, range 28 - 59 yr, all right - handed), and they were screened to exclude those people with prior systemic disease or head injury . The institutional review board approved the mr study proctocol and the investigation was conducted in full compliance with accepted standards for research involving humans . The mean duration of the study was approximately 1 yr, with a range of 7 days to 1 yr after development of intracerebral hematoma . In vivo h mrs studies were performed on a 1.5 t mri / mrs system (ge signa advantage, version 4.8; ge medical systems, milwaukee, wi, u.s.a .) Using the stimulated echo acquisition mode (steam) sequence after water suppression with chemical - shift selective (chess) rf pulse and dephasing gradients (11, 12). A standard head coil was used for the routine neurological and research imaging sequences, with image - guided single - voxel spectroscopic acquisition . A 6.4 ml volume in the cortex was selected using the t2-weighted mr images (90 msec te, 2,500 msec tr). For examining the m-1 cortex with the single voxel technique, a cubic volumes of interest (voi) of 181820 mm was placed in the medial precentral gyrus (broadman area 4) anterior to the central sulcus in both hemispheres (ah and uh), and for the sma, the same - sized voi was placed in the medial side of the superior frontal gyrus (broadman area 6) just anterior to the m-1 cortex voi, as is shown in fig . The voxel location was carefully chosen by two investigators to ensure the exact anatomical location of m-1/sma for each patient . The spectral parameters used were: 20 msec te, 2,000 msec tr, 128 averages, 2,500 hz spectral width, and 2,048 data points . The shim procedure was used for optimizing the magnetic field homogeneity over the entire volume of interest that was detected by the receiver coil and focused on the water signal . After an autoprescan, the typical line width (full length at half maximum; fwhm) was usually 2 to 4 hz, and the raw data was processed using a sage data analysis package (ge medical systems). The post - processing was done using zerofilling to 4k, and apodization filtering was used to improve either snr or resolution and/or to reduce the truncation artifacts . Fourier transformation, zero order phase correction, and phase absorption spectra were performed directly along with baseline corrections or resolution enhancement . The peak areas were obtained from the spectra using the marquardt algorithm to fit a lorentzian - gaussian peak type (13). Proton peak assignments of the major in vivo h mrs observable metabolites were naa at 2.00 ppm; cr at 3.00 pm; cho at 3.20 ppm; sum (glx) of glu and gaba at 2.35, and 2.25 ppm; and ins at 3.50 pm (14). After the data was processed by our selected personal " blinded " to the patient's histories and conditions, the results were expressed as meanssd of the naa / cr ratio and the cho / cr ratios . The metabolite ratios in the ah and uh and the controls' values were compared for significant differences using the paired t - test assuming equal variance and independent sample t - test . Probability values of less than 0.05 were considered significant, and values less than 0.01 were considered highly significant . The results are summarized in table 2 . The naa / cr ratios of m-1 in the ah and uh were 1.080.12, 1.500.17, respectively . There were significant differences between the ah and uh in the naa / cr ratios of m-1 (p<0.05). The naa / cr ratios of m-1 measured in the ah and controls were 1.080.12, 1.370.12, respectively . There was also significant differences between the ah and controls in the naa / cr ratios of m-1 (p=0.01). However, the naa / cr ratios of m-1 measured in the uh showed no differences when compared with the ratios of normal volunteers (p=0.115). These results showed that the naa / cr ratios of the ah were significantly decreased when compared with those of the uh and normal volunteers and therefore, the metabolic changes had occurred in the high cortical region ipsilateral to the injured hemispheres . However, the naa / cr ratios of m1 in the ah showed no significant correlation with the severity of arm weakness, leg weakness, or the duration of hemiparesis . The naa / cr ratios of the sma measured in the ah and uh were 1.180.15, 1.180.27, respectively . There was no difference between the ah and uh in the naa / cr ratios of the sma (p=0.980). However, when compared with the sma of the controls, the naa / cr ratios of sma in the ah and uh showed significant differences (p<0.05). In terms of cho / cr ratios, no significant differences were found between the following; the m1 cortices of the ah and uh (p=0.316), the smas of the ah and uh (p=0.561), the m-1 cortex and sma of the ah (p=0.745), and the m-1 cortex and sma of the uh (p=0.289). No significant differences were found when comparing the cho / cr ratios of each cortex with those of the normal volunteers . The lactate resonance, which we expected to see at 1.3 ppm, was not observed in any of these cases . The naa / cr and cho / cr ratios of the m1 and sma in the control group did not show any difference between right and left hemispheres . Hemiparesis is the most commonly experienced deficit after stroke, and it acutely affects more than 80% of subjects and chronically affects greater than 40% of the subjects (15). Patients show a wide range for the degree of recovery, and the restorative processes that occur in the brain after stroke remain incompletely understood . This work focused on the neurochemical profile of the motor cortex and the supplementary motor area in relation with pyramidal tract injury caused by deep intracerebral hematoma . H mrs provides chemical information on the local cellular metabolism by using the metabolic ratios of neurochemicals detected in the spectra (11, 12). One of the most important contributions of h mrs to clinical neuroscience is its ability to quantify neuronal loss and to demonstrate reversible neuronal damage (1, 2). H mrs is a useful research tool for elucidating the pathophysiology underlying certain diseases, including brain tumors, head trauma, cerebrovascular, neurodegenerative, and metabolic brain diseases (1). H mrs has been used in attempting better qualification of the brain damage caused by stroke . H mrs allows the in vivo measurement of n - acetyl - containing compounds, creatine, choline, and lactate . The majority of the n - acetyl signal comes from naa, which is present in high concentrations in the brain (16). The function of naa is unclear, although suggestions have included the initiation of protein synthesis, neurotransmission, and the deactivation of glutamate . Naa is of particular interest in studies of the brain because it is located almost exclusively in the neurons of adults (17). Initially, it was suggested that decrease in naa represented neuronal loss (18); however, a reversible decrease in naa has recently been shown to occur for acute lesions in multiple sclerosis and in stroke - like episodes of melas (19). Further, naa synthesis in vitro has been shown to occur in an energy - dependent manner, and this is reduced by mitochondrial inhibitors (20). Therefore, decrease in the naa resonance peak in vivo must be interpreted as an index of neuronal or axonal injury rather than as a marker of neuronal or axonal loss (21). Decrease in naa have been shown to correlate with disability in multiple sclerosis (22), suggesting that axonal injury is responsible for the chronic functional impairment in this disease . Early studies of h mrs for stroke have shown increased lactate and decreased naa within the stroke lesion (4 - 6). Subsequent attempts have been made to determine whether the magnitude of neuronal damage, as measured by the naa loss from the infarcted region, correlated with the disability and impairment in stroke patients . (8) found that the patients who made the most complete recoveries were those in whom naa levels were relatively well preserved . In contrast, gideon et al . (9) found no clear relationship between the level of naa and the patient's clinical outcome . (10) found that naa reduction correlated with the barthel index score at discharge . (7) found that the naa loss measured during the first week after stroke in patients with a speech or motor deficit correlated with the scandinavian stroke scale and the barthel index at 6 months . However, some authors have criticized these findings because it remained unclear whether naa loss was a better prognostic indicator than other measures, such as infarct volume as measured on imaging (21). (21) has pointed out that the above - mentioned studies regarding h mrs and outcome after stroke measured the naa loss from the center of infarcted region, and thus these naa losses were not representative of the total neuronal injury . Moreover, the naa loss was not measured in a specific brain region directly relevant to the chosen outcome measures . To examine the relationship between naa loss after stroke and motor outcome, the researchers studied naa levels in the posterior limb of the internal capsule, which contains the descending motor pathways for patients with motor deficits secondary to a cortical, subcortical, or capsular stroke . In that study, they found that mean internal capsule naa was significantly lower in the patient group and axonal injury in the descending motor pathways at the level of internal capsule correlated with motor deficit for patients after stroke . They suggested a possible anterograde axonal injury might have an important role for this naa loss in strokes involving the internal capsule and the motor and subcortex areas that contains the motor pathway (21). Although there have been many h mrs studies dealing motor deficit in ischemic stroke, h mrs studies investigating the motor system in hemorrhagic stroke, especially in the intracerebral hematoma, are rare . Furthermore, only a few researchers have used h mrs for the detection of biochemical changes in the motor and motor association areas following the subordinate motor pathway damage (3, 23). The biochemical information obtained during the present study shows that the m-1 naa / cr ratios are significantly decreased in the ah for intracerebral hematoma, which induces axonal injury to the internal capsule . The exact pathophysiologic mechanism of naa loss in the normal - appearing motor cortex is unclear . However, reduced levels of naa in normal - appearing white matter have already been shown to occur in those patients with multiple sclerosis and cerebral ischemia that has caused motor stroke (21, 24). We suggest that naa loss in the m-1 in our present study may be caused by a retrograde degeneration according to the axonal injury at the level of internal capsule, and this is due to adjacent intracerebral hematoma . (21) studied eighteen ischemic strokes that caused motor deficit with the use of h mrs, and they have shown that cortical and subcortical stroke induced naa loss in the normal - appearing internal capsule . The metabolic information obtained in our study shows that the naa / cr ratios in the m-1 are significantly decreased in the ah following an intracerebral hematoma . Although the examination time and the time associated with the disease are quite different, with respect to neural injury (i.e. The motor pathway), it is believed that there likely is a significant commonality between the two . Reduced metabolism in the motor cortex has already been documented in a pet study dealing the ischemic stroke (25). In a pet study of 10 patients following recovery from striatocapsular infarction, the comparison of regional cerebral blood flow (rcbf) maps for patients at rest and normal subjects revealed the significantly lower regional cerebral blood flow in the basal ganglia, thalamus, sensorimotor, insular, and dorsolateral prefrontal cortices, in the brainstem, and in the ipsilateral cerebellum in patients, contralateral to the side of the recovered hand (25). These researchers suggest that the cause of decreased rcbf in these areas as a functional deactivation, although structural changes at a microscopic level due to transsynaptic or retrograde degeneration cannot be excluded . The reduction of the naa / cr ratios in the m-1 cortex in our study seems to be concordant with the already documented reduction of rcbf in the sensorimotor cortex by the pet study of recovered ischemic capsular infarction (25). (3), evaluated the motor cortex by using in vivo h mrs in patients with incomplete spinal cord injury who showed a good motor function recovery . In that report, the mean level of the naa / cr ratio was significantly elevated in the motor cortex of patients, as compared with their ipsilateral occipital cortex or the cortical area of controls . They explained this increased naa / cr value as a neural adaptation, which accompanies recovery from spinal cord injury . At first glance, this increased naa / cr value in the motor cortex of the recovered incomplete spinal cord injury study seems to be contrary to our observations of decreased naa / cr values in the ah motor cortex with hemiparesis . However, there are several differences in the patients' characteristics, the methods used for mrs, location of voxels, etc . In a study by puri et al . (3) the subjects were those who had already had shown good recovery of their motor function after neural injury, but we enrolled subjects who had not recovered from hemiparesis . In terms of the technical aspects of h mrs, puri and his co - workers located the voxel in the centrum semiovale, and they used the technique of chemical shift imaging . We found no significant correlation between the severity of weakness and the naa / cr values in the m-1, and we believe that the functional location of the voxel in our study was closer to the trunk and leg homunculus than the arm homunculus . Nevertheless, no correlation was found between the naa / cr values in the affected m-1 and the severity of leg weakness . However, we think it is difficult to draw a definite conclusion with our results because the number of patients enrolled in our study was so small and timing of the h mrs examination after the development of intracerebral hematoma was variable . At this time, it is not clear whether the naa / cr ratio of the ah would increase according to the recovery from hemiparesis in intracerebral hematoma . There is evidence that a significant recovery of naa can occur after acute brain damage (19). For example, reversible decreases in naa were found in two patients with mitochondrial encephalopathy and four patients with demyelinating lesions (24). Further study will be needed with a longer follow - up and larger numbers of subjects to investigate the correlation with the severity of weakness . The sma (m - ii) occupies the medial surface of the superior frontal gyrus rostral to area 4, and this corresponds to the medial part of area 6 (area 6) (26). The sma is considered to be involved in the programming of learned skilled motor sequences and it may play a role in initiating voluntary movement (27). The recruitment of the sma has been described as a normal accompaniment to either the anticipation or sequencing of a motor task (28). Clinical studies suggest that the sma may contribute to the return of motor function after stroke (29, 30). Therefore, to investigate whether there is any biochemical alteration due to capsular injury in intracerebral hematoma, we included the bilateral sma in addition to the m-1 in our study . In our present study, we found a significant reduction of the naa / cr ratios in both the ah and uh, as compared with the normal controls . It is difficult to explain the exact meaning of this reduction of naa / cr ratio in the bilateral smas . However, the sma have striking bilateral influences upon both proximal and distal musculatures in primates, and cortical projections from the sma are ipsilateral to areas 4 - 6, and 7, and to the contralateral sma (26 - 28). Considering that the sma has bilateral influence on motor function, we speculate that unilateral injury to the motor pathway might induce metabolic changes in the bilateral sma by a possible retrograde degeneration . In summary, we sought to determine whether h mrs is able to detect the metabolic changes of the m-1 and sma that follow pyramidal tract injury after intracerebral hemorrhage . We found that the m-1 in the ah has lower naa / cr values than in the m-1 in the uh and in normal volunteers . In addition, the sma also showed bilateral lower naa / cr values in both the ah and uh than in normal volunteers . Though we cannot precisely document the exact meaning of these lower naa / cr ratios, a presumed retrograde degeneration or functional deactivation may play a role in these naa losses in m-1 and sma due to motor tract injury . Further experiments should include longitudinal studies of patients with motor deficit after intracerebral hematomas, and whether there is a reversible component to this naa loss.
Conversion disorder has one or more symptoms that affect voluntary motor or sensory function suggesting a neurological or other medical condition, but they are inconsistent with known neurological or musculoskeletal pathologies . Instead, the symptoms are due to an unconscious expression of a psychological conflict or need . The symptoms are often reinforced by social support from family and friends or by avoiding underlying emotional stress . The symptoms of patients with conversion disorder can be debilitating and include paralysis of one or more limbs, ataxia, tremors, tics, and dystonia . Many other names are used to describe this disorder are functional gait disorder, hysterical paralysis, psychosomatic disorder, conversion reaction, and chronic neurosis . The disorder is more common in adolescence than in childhood . Despite conversion disorders long - documented history, it is often confused with other psychological disorders conversion disorder, remain diagnostic challenges for the clinicians . A 17-year - old female coming from mses who was premorbidly maintaining well came with complaints of asymmetrical repetitive flickering like movement of the right hand which started on the day of her 12 grade board exams . She was observed to have reduced sleep since 1 week before her exams and had relatively less communication with family members . On the day of her exams, by the time she got the question paper her whole of her right arm started having repetitive flickering movement vigorously, and she had to support her right arm with the left to write the exam and had come out of exam hall without completing the exam . Within a few days, the abnormal movements had progressed to her right leg . Informant said that she use to have crying spells and appear sad most of the time as she had not given the exams . She was treated with promethazine and trihexyphenidyl neuroimaging was done which was found to be normal . She showed some improvement after 20 days, but she was not completely resolved, on the day before the day of admission, she developed shivering over her whole body and was admitted to the intensive care unit . It was not associated with loss of consciousness, no urine or fecal incontinence, no frothing from the mouth, no tongue biting, and no up rolling of eyeball . Electroencephalogram computed tomography and magnetic resonance imaging brain were done and were found to be normal ., it was found that she was an above average student in her class and that her family had too much expectation from her . She also said that her younger sister was always given more attention by her mother . Her episodes were provoked when asked to write or hold a pen with her right hand, also when she was asked to walk without assistance . She was also observed to flex her right toe while walking and during stay in the hospital she was observed to be having a sudden onset of asymmetrical repetitive jerky movements of bilateral legs . Routine hemogram, renal function test, liver function test blood sugar, lipid profile, and thyroid function were found to be normal . The patient was prescribed diazepam 4 mg per days and after 2 days it was increased to 6 mg per day, she showed gradual improvement . On the initial days of sessions, her symptoms got aggravated during the sessions and session had to be stopped in between . After few attempts, the patient had ventilated to us how her mother gives less importance to her when compared to her younger sister who is 6 years younger to her . The patient had also said that from her toddler stage till 10 standard she was living with her paternal grandmother and father, and now she moved to a different house along with her parents . Her parents were also included in the sessions and her issues with her mother were discussed . The patient had gradually started walking without difficulty and frequency of abnormal movements had reduced . Diazepam was tapered and stopped within a week and had been stable at the time of discharge . Patient came for a follow - up after 2 weeks, and she had been maintaining well . The clinical picture is indicative of dissociative motor disorder f44.4 according to icd 10 . After taking a detailed history, it was clear that her parents were giving her more pressure to attain high marks in board exam . During interview whenever a patient was asked to hold a pen or to write her symptoms increased . Patient was started on therapy sessions as well as low - dose diazepam . In the sessions, possible causes of these symptoms were discussed, and she was encouraged to hold the pen and write . Her parents were also psychoeducated about the psychosomatic nature of the symptoms and advised to encourage her for a symptom - free lifestyle . They were also given an instruction not to pay attention to her complaints of physical nature ., patient was explained to her that if there is any problem in her nerves, it will be recorded in that study, along with that dose of diazepam was also increased to 6 from 4 mg . After the study, patient showed a dramatic improvement in her symptoms . Failure of treatment in dissociative disorders occurs mostly when we cannot identify the primary stressor or gain . By taking proper history and early identification of the stressor there are case reports where dissociative disorders are managed alone with therapy sessions, and the patient is taught to how to deal with stressful situations . Nerve conduction study is a diagnostic test to evaluate the function, i.e. The electrical conduction of motor or sensory nerve of the human body . It can also be done along with needle electromyography to measure both nerve and muscle function . In this, the study is performed by electrical stimulation of a peripheral nerve and recording of a muscle supplied by this nerve . The time taken for electrical impulses to travel from the stimulation to the recording site is measured . In this patient, this procedure was well explained to the patient, and she showed marked improvement . Conversion disorder, somatoform disorder, and malingering always remain a diagnostic challenges for the clinicians . The prompt history taking, identification of stressors, use of appropriate and validated physical examination manoeuvres, and coordination of care and information exchange between all family members and medical team may facilitate the expeditious care of these patients in a cost - effective manner . The existing literature supports a multidisciplinary treatment approach, with specific interventions, such as cognitive behavior therapy for cognitive restructuring and psychodynamic therapy for addressing symptom connections to trauma and dissociation.
The study protocol was approved by the institutional review board of kim's eye hospital, seoul, korea . All participants provided informed consent prior to enrollment and all procedures conformed to the guidelines of the declaration of helsinki . From june 2006 to july 2011, 134 eyes from 132 patients who underwent agv implantation surgery at kim's eye hospital were analyzed retrospectively . Each subject underwent a full ophthalmic examination, including visual acuity assessment, iop assessment with a goldmann applanation tonometer, anterior segment examination by slit - lamp biomicroscopy, fundus examination with a 90 diopter (d) lens, and 24 - 2 swedish interactive threshold algorithm standard automated visual fieldest (humphrey visual field analyzer; carl zeiss meditec, dublin, ca, usa) before surgery as well as 1 day, 1 month, 2 - 3 months, 4 - 6 months, 11 - 16 months, and 17 - 24 months after surgery . The study included any patient who underwent agv implantation surgery at kim's eye hospital performed using the same technique by 1 of 2 glaucoma specialists (yhs and hkk) with a minimum of 6 months follow - up . The exclusion criteria were: patients' age less than 18 years or more than 80 years, agv implanted in inferior quadrants, previous seton surgery or trabeculectomy in the operated eye, inflammatory or ocular surface disease with severe conjunctival scarring, history of retinal detachment surgery with scleral buckle or vitrectomy in the operated eye, and history of endophthalmitis in the operated eye . Among the 134 eyes from 132 patients, 44 eyes from 42 patients before surgery included: 50 eyes had neovascular glaucoma, 36 eyes had secondary open angle glaucoma, and 4 eyes had primary open angle glaucoma . The agv implantation selection was made by the surgeon based on conjunctival mobility and presence of previous surgical conjunctival scaring, limited subconjunctival space owing to previous ocular surgeries, scarred upper fornix, shallow fornix, and presence of small eyes . Eyes implanted with the fp7 and fp8 agvs were assigned to the fp7 group and fp8 group, respectively . The procedures were performed in a similar manner in all subjects regardless of implant size . The conjunctival incision was made 4 mm posterior to the limbus and, following dissection of the conjunctiva and tenon's capsule toward the fornix and limbus, bipolar cautery was performed . Mitomycin - c (0.02%) was applied with a large piece of soaked cellulose sponge under the conjunctival flap and over the episclera for 3 minutes followed by thorough irrigation of the area with a balanced salt solution . The plate of the implant was then secured to the sclera 8 to 10 mm posterior to the surgical limbus using 2 interrupted 7 - 0 silk sutures . The tube was trimmed to an appropriate length with the bevel facing anteriorly and, after injection of methyl cellulose into the anterior chamber via a clear cornea stab incision, the tube was inserted into the anterior chamber through a corneoscleral track created using a 23-gauge needle . The tube was fixed to the episclera with a 10 - 0 nylon mattress suture . A quadrangular donor scleral patch graft (4 7 mm) was fashioned and secured over the exposed part of the tube using 10 - 0 nylon sutures . The conjunctiva and tenon's capsule were repaired using 8 - 0 vicryl suture material in a running fashion . Dexamethasone (4 mg) and gentamycin (100 mg) were injected subconjunctivally upon procedure conclusion . The postoperative regimen included topical levofloxacin (0.5%) eye drops 4 times per day for 1 week and topical fluorometholone (0.1%) eye drops 4 times per day that was usually tapered over 6 to 8 weeks . Postoperative follow - up visits were scheduled for 1 day, 1 and 2 weeks, and 1, 3, 6, and 12 months after the procedure and every 6 months thereafter . Surgical success was defined as iop maintained below 21 mmhg regardless of the number of iop medications used during the final follow - up observation . The following observations made during follow - up were regarded as surgical failures: an iop greater than 22 mmhg at 2 or more consecutive follow - up visits, an iop less than 5 mmhg at 2 or more consecutive follow - up visits, additional glaucoma surgery was required, and loss of light perception . Independent t - tests and chi - squared tests were performed to compare ocular and demographic variables between the 2 groups . To compare the success rate of surgery between the 2 groups, a log - rank (mantel - cox) test was performed the study protocol was approved by the institutional review board of kim's eye hospital, seoul, korea . All participants provided informed consent prior to enrollment and all procedures conformed to the guidelines of the declaration of helsinki . From june 2006 to july 2011, 134 eyes from 132 patients who underwent agv implantation surgery at kim's eye hospital were analyzed retrospectively . Each subject underwent a full ophthalmic examination, including visual acuity assessment, iop assessment with a goldmann applanation tonometer, anterior segment examination by slit - lamp biomicroscopy, fundus examination with a 90 diopter (d) lens, and 24 - 2 swedish interactive threshold algorithm standard automated visual fieldest (humphrey visual field analyzer; carl zeiss meditec, dublin, ca, usa) before surgery as well as 1 day, 1 month, 2 - 3 months, 4 - 6 months, 11 - 16 months, and 17 - 24 months after surgery . The study included any patient who underwent agv implantation surgery at kim's eye hospital performed using the same technique by 1 of 2 glaucoma specialists (yhs and hkk) with a minimum of 6 months follow - up . The exclusion criteria were: patients' age less than 18 years or more than 80 years, agv implanted in inferior quadrants, previous seton surgery or trabeculectomy in the operated eye, inflammatory or ocular surface disease with severe conjunctival scarring, history of retinal detachment surgery with scleral buckle or vitrectomy in the operated eye, and history of endophthalmitis in the operated eye . Among the 134 eyes from 132 patients, 44 eyes from 42 patients before surgery included: 50 eyes had neovascular glaucoma, 36 eyes had secondary open angle glaucoma, and 4 eyes had primary open angle glaucoma . The agv implantation selection was made by the surgeon based on conjunctival mobility and presence of previous surgical conjunctival scaring, limited subconjunctival space owing to previous ocular surgeries, scarred upper fornix, shallow fornix, and presence of small eyes . Eyes implanted with the fp7 and fp8 agvs were assigned to the fp7 group and fp8 group, respectively . The procedures were performed in a similar manner in all subjects regardless of implant size . The conjunctival incision was made 4 mm posterior to the limbus and, following dissection of the conjunctiva and tenon's capsule toward the fornix and limbus, bipolar cautery was performed . Mitomycin - c (0.02%) was applied with a large piece of soaked cellulose sponge under the conjunctival flap and over the episclera for 3 minutes followed by thorough irrigation of the area with a balanced salt solution . The plate of the implant was then secured to the sclera 8 to 10 mm posterior to the surgical limbus using 2 interrupted 7 - 0 silk sutures . The tube was trimmed to an appropriate length with the bevel facing anteriorly and, after injection of methyl cellulose into the anterior chamber via a clear cornea stab incision, the tube was inserted into the anterior chamber through a corneoscleral track created using a 23-gauge needle . The tube was fixed to the episclera with a 10 - 0 nylon mattress suture . A quadrangular donor scleral patch graft (4 7 mm) was fashioned and secured over the exposed part of the tube using 10 - 0 nylon sutures . The conjunctiva and tenon's capsule were repaired using 8 - 0 vicryl suture material in a running fashion . Dexamethasone (4 mg) and gentamycin (100 mg) were injected subconjunctivally upon procedure conclusion . The postoperative regimen included topical levofloxacin (0.5%) eye drops 4 times per day for 1 week and topical fluorometholone (0.1%) eye drops 4 times per day that was usually tapered over 6 to 8 weeks . Postoperative follow - up visits were scheduled for 1 day, 1 and 2 weeks, and 1, 3, 6, and 12 months after the procedure and every 6 months thereafter . Surgical success was defined as iop maintained below 21 mmhg regardless of the number of iop medications used during the final follow - up observation . The following observations made during follow - up were regarded as surgical failures: an iop greater than 22 mmhg at 2 or more consecutive follow - up visits, an iop less than 5 mmhg at 2 or more consecutive follow - up visits, additional glaucoma surgery was required, and loss of light perception . Independent t - tests and chi - squared tests were performed to compare ocular and demographic variables between the 2 groups . To compare the success rate of surgery between the 2 groups, a log - rank (mantel - cox) test was performed among them, 66 eyes underwent fp7 implant surgery, and 24 eyes underwent fp8 implant surgery . Table 1 summarizes the demographic and clinical characteristics of the study populations . The mean age was 57.6 11.4 years for the fp7 group and 61.0 9.9 years for the fp8 group (p = 0.199). Preoperative iop was 41.9 9.2 mmhg for the fp7 group and 39.0 6.6 mmhg for the fp8 group (p = 0.105). There was no significant difference between the 2 groups in the following variables: sex, systemic disease distribution, glaucoma subtype, baseline visual acuity, number of preoperative antiglaucoma medications, previous ocular surgeries, laterality, and implantation site (p> 0.05) (table 1). The mean follow - up period was 17.2 9.1 months for the fp7 group and 20.3 4.4 months for the fp8 group (p = 0.273). The postoperative visual acuity of the fp8 group was better than that in the fp7 group in some early postoperative periods (1 week, 2 to 3 months, and 7 to 10 months after the surgery; p <0.05); however, after 10 postoperative months, there were no significant differences in visual acuity between the 2 groups through the 3-year follow - up (p> 0.05) (table 2). Postoperative iop was not significantly different between the 2 groups (p> 0.05) except for the iop on postoperative day 1 (11.4 8.4 mmhg for the fp7 group and 7.4 3.9 mmhg for the fp8 group, p = 0.031) (table 3). There were no statistically significant differences between the groups in terms of the number of glaucoma medications after surgery (table 4). In this study, surgical success was considered as iop maintained at less than 21 mmhg regardless of the medication used, no additional glaucoma surgery required, non - occurrence of light sense loss, and no consecutive follow - up visits with low iop . Therefore, the cumulative success rate according to the log - rank test for kaplan - meier survival analysis was 79.2% for the fp8 group and 72.7% for the fp7 group at the 3-year follow - up (p = 0.535) (fig . 1). The main reasons for failure were not significantly different between the 2 groups (table 5). It has been hypothesized that glaucoma drainage implants with large plates produces an increased surface area of encapsulation and a higher degree of iop reduction . In a prospective randomized clinical trial comparing single - plate and double - plate molteno implants, heuer et al . Found a higher success rate and greater iop reduction with the double - plate implants than with single - plate implants, presumably because of the large surface area of the double - plate implants . On the contrary, seah et al . Reported no significant difference in success rates, final iop, number of medications, and rates of complications between the 250 and 350 mm baerveldt glaucoma implants (bgis). In another prospective study comparing the 350 and 500 mm bgis, lloyd et al . Reported that there was no difference in success rates and visual outcomes between the different implant sizes . Britt et al . Also reported that the 500 mm bgi was not superior to the 350 mm bgi for iop control . These results are in agreement with the present study results: no differences were found in vision preservation, iop reduction, or decrease in number of glaucoma medications between the fp7 and fp8 agv implants in adult eyes with glaucoma . Thus far, this is the only study comparing the surgical outcomes between fp7 and fp8 agv implants in adult eyes . Similar surgical outcomes between the fp7 and fp8 groups imply that the plate area may not be the major factor in determining surgical success, and it is likely that there is a maximal surface area beyond which there is minimal improvement in iop control . Kang and kee argued that there is an upper limit of the increase in the surface area at which the implants cease to have a beneficial effect on iop, and it is inferred that the effect of iop decrease does not depend on the area of filter cloth beyond a certain size . This phenomenon may be at least partly responsible for the lack of superior iop reduction of the fp7 agv implants compared to the fp8 agv implants . Another possible explanation is the surgeon's perceived a priori likelihood of failure or complications, because the choice of implant is to some extent influenced by the severity of the glaucoma . It is difficult to compare surgical success rates from different studies because of differences in study design, populations studied, types of implants used, and lengths of follow - up periods . Variable success rates of agv implantation have been reported and range between 64.5% and 95.0%, with follow - up periods of 6 to 24 months . With fp7 after a follow - up of 6 months and 78% was reported by coleman et al ., with fp7 after a follow - up of 12 months . In addition, a success rate of 96% was obtained with the fp7 implant after a follow - up of 12 months . These results are similar to the results ishida et al . Reported: a 94.2% success rate with fp7 implant at 12 months . In 40 eyes from 40 patients with different types of refractory glaucoma, a 92.5% success rate was reported with both fp7 and fp8 after a follow - up period of 6 months . Unfortunately, this study did not report separate success rates between fp7 and fp8 groups . Although materials vary, a 53.8% success rate was reported with the 96 mm agv (model s3, new world medical inc .) And a 92.3% success rate was reported with the 184 mm agv (model s3, new world medical inc .) After a follow - up period of 10 months . In the present study, the success rates were 79.2% for the fp8 group and 72.7% for the fp7 group at the 3-year follow - up, which are comparable with the success rates of other studies . In adult eyes, however, in conditions with conjunctival scarring or limited subconjunctival space, fp7 agv implantation is challenging . In addition, an oversized implant can result in various complications, including implant exposure, extrusion, discomfort, and motility defects . Given that fp7 and fp8 agv implants did not show differences in surgical outcomes, we suggest that fp8 implantation may be a useful surgical option for iop control in adult eyes with insufficient conjunctival or subconjunctival areas . This option may be especially useful for special circumstances in asian eyes since small globes are common in this population . To compare surgical outcomes between fp7 and fp8 agv implants, randomization of subjects who underwent however, in the present study, the type of agv was chosen per the surgeon's clinical judgment without randomization . Other limitations include a relatively small sample size and limited follow - up period . Long - term, prospective, randomized, patient-, and investigator - masked studies are needed to confirm the results of this study . In conclusion, fp7 and fp8 agv implants showed no difference in terms of preservation of vision, iop reduction, or decrease in the number of required glaucoma medications . The fp8 agv implant appears to be a viable option for the management of refractory glaucoma in adult eyes with conjunctival scarring or limited subconjunctival space owing to the previous ocular surgeries, inflammatory ocular disorders, or small eyes.
The use of dental implants to support and retain dental prostheses has been demonstrated to be clinically efficacious . A precise fit between an implant abutment and a superstructure, determining the absence of bone tension, without the occlusal load, is an important factor for the long - term success of implant - supported restorations . Considering the fact that implants are completely surrounded by bone, and that the interface is not elastic, a minimum movement is observed due to bone deformation under loading . Accordingly, it must be anticipated that stress introduced into the implant system as the result of prosthesis misfit may be present many years after placement because of the ankylotic nature of the osseointegration . The present findings support the concern for precision of frameworks with regard to various aspects of fatigue in the long - term perspective2,13 . A widely used solution in implant - anchored prosthesis this abutment is designed to directly engage the implant and thus allows the prosthodontist extending the porcelain subgingivally in areas with extremely limited gingival tissue height . The subgingival placement of the restoration not only improves esthetics but also helps in situations with interocclusal distance limitations20 . The use of such abutments allows correction in angulations for implants inserted at angles other than ideal . For single - tooth restorations, the provision of an antirotational device is necessary; for fixed partial restorations, non - hexed castable ucla abutments present as a better alternative . There has been concern as to whether the use of these custom - made abutments would result in fit of the abutment to the implant that could be comparable to that achieved with use of premachined titanium abutments . An intermediate solution was developed, whereby premachined ucla abutments made of noble metal alloys could be cast onto directly to allow integration of the restoration with the abutment . These hand - operated devices have been developed to correct casting defects in the fitting surface and reduce the abutment / implant misfit . Despite various prosthetic and technical improvements, laboratory procedures used in the fabrication of implant - supported prostheses, especially casting and porcelain baking, this study evaluated the effect of cast rectifiers on the misfit of cast ucla abutments compared to premachined ucla abutments . The influence of casting and porcelain baking on the marginal misfit of these components was also investigated . Two groups of components were analyzed: test group (n=10) castable plastic non - hexed ucla abutments (055021;conexo sistemas de prtese; so paulo, sp, brazil); control group (n=10) non - hexed premachined ucla abutments (055022; conexo sistemas de prtese, so paulo, sp, brazil) (figure 1a). The components of both groups were individually positioned over an implant analogue (013020; conexo sistema de prteses, so paulo, sp, brazil) and sectioned with a diamond bur (34570; microdont, so paulo, sp, brazil) at low speed under water cooling until they were 8 mm in height, keeping the cylindrical shape . The abutments were secured to the sprues and fixated in a sprue former . A silicone - casting ring was adapted to the sprue former and the investment was poured (bellavest t; bego, bremen, germany). Four silicone rings were used, each one containing 5 ucla abutments, adding up to 20 components (10 per group). The patterns were induction cast: abutments of the test group with a nickel - chromium alloy (wiron 99; bego, bremen, germany), and abutments of the control group with a palladium - silver alloy (williams w1; ivoclar vivadent, amherst, ny, usa). Castings were allowed bench cool and were then divested and cleaned with air abrasion . During this process, implant analogues were joined to the abutments to reduce the risk of damage to the abutment / implant interface (figure 1b). Fitting surfaces of the castings made with plastic patterns (test group) were milled with the cast rectifiers (conexo sistema de prteses, so paulo, sp, brazil), by turning the tool against the abutment fitting surface twenty times in a clockwise direction . A single operator performed this procedure (figures 2 and 3) in all 20 specimens, porcelain (omega 900; vita, bad sckingen, germany) was applied to the abutments, carved and then baked according to the manufacturer's recommendations . Porcelain addition was standardized with a teflon cylindrical device perfectly fitted to the implant analogue, which had adequate space for the application of the same bulk of material (nearly 1.5 mm) in all specimens . Misfit measurements were performed with a light microscope (sprint 100; ram optical instrumentation, irvine, ca, usa). A standard threaded 3.75x13-mm implant (517713 screw; conexo sistemas de prtese, so paulo, sp, brazil) was stabilized in the center of a brass support, machined to achieve a final hexagonal configuration, allowing lateral seating on the light microscope (figures 4a - b and 5). Laser marks were created in the abutments and in the implant to allow positioning of the components at the same place during microscopic measurements . The abutments were attached to the implants in the predetermined position and screw was tightened to a torque of 5 ncm, with a torque driver (figure 6). Three microscopic measurements at x460 magnification were made for each aspect of the hexagonal base, at reading points predetermined by laser marks on the lateral aspect of the implant platform, adding up to 18 reading points for each specimen . Marginal misfit measurements in the test group were performed before (m1) and after (m2) the use of rectifiers, and after ceramic application (m3). In the control group, measurements were performed before (m1) and after (m2) casting, and after ceramic application (m3) (figure 7). Means and standard deviations of marginal misfit (in m) for both groups at the 3 test moments (m1, m2, m3) are presented in table 1 . Means followed by the same letters are statistically similar at 5% significance level (tukey's test). The cast ucla abutments (test group m1) showed the greatest discrepancies, with marginal misfit mean of 25.68 m ., there was significant reduction of the marginal misfit of cast ucla abutments, from 25.68 m to 14.83 m . After ceramic application (m3), the cast abutments presented marginal misfit mean (16.18 m) statistically similar to that observed for the premachined abutments at the same interval (14.3 m). Casting of the premachined ucla abutments (control group m2) altered significantly the marginal misfit of these components (from 9.63 m to 14.6 m). There were no significant changes due to the porcelain baking, in both groups investigated . Several studies have demonstrated the success of implantology9,18 . However, despite the evolution of this specialty, clinical complications are still frequent . Numerous studies have been conducted to understand and reduce occasional complications11,16 . In spite of the advances in technology, the materials and techniques employed in the fabrication of prosthetic structures are not dimensionally accurate and require further investigation and development . Distortions of such structures are inevitable and it is impossible to achieve a perfect fit and absolute passivity at the prosthetic interfaces8,17 . Prosthesis misfit favors bacterial colonization, leading to inflammation of the periimplant soft tissues and harming osseointegration3,11 . This lack of precision also contributes to an unfavorable distribution of stresses, which may lead to mechanical complications, such as the loosening or fracture of the screws and prosthetic components, in addition to biological complications, such as periimplant bone loss and impairment of osseointegration in more severe cases6,11,17 . Prosthetic protocols employing machined components reduce these risks, due to the higher accuracy of fit19 . However, to allow more versatility in overcoming angulation and esthetic problems, castable plastic patterns (ucla abutments) permit esthetic restorations to be finished very close to the implant head, solving many esthetic dilemmas . The use of this prosthetic option has increased even though the fit at the abutment to implant interface is not as satisfactory as the fit provided by premachined abutments3,19 . Due to this increased search for components, companies have developed alternatives to reduce misfit, such as the premachined ucla abutments . Other option is the use of castable plastic patterns followed by a laboratory finishing of the fitting surface with a cast rectifier . This device is a manual instrument designed to minimize the marginal misfit of cast ucla abutments, leading to a better mechanical stability of the assembly and reducing the probability of bacterial aggregation . This hand - operated device has been developed only for non - hexed cast ucla abutments (i.e., without the antirotational device). Therefore, it cannot be used for hexed ucla abutments (single - tooth restorations). The present study revealed high values of marginal misfit in the castings made with plastic patterns (test group m1 25.68 m) compared to premachined abutments (9.63 m). The factors that contribute to the distortion of castings, directly impairing the marginal fit between components, include fabrication of acrylic cylinders, limitations of investment processes and casting techniques . The use of cast rectifiers led to a significant reduction of marginal misfit of cast ucla abutments, with a reduction of marginal misfit means from 25.68 m to 14.83 m . The reduction of vertical misfit reduces the mechanical instability of prosthetic components, thereby eliminating the gaps for bacterial colonization . Concerning the premachined abutments used as a reference, the mean marginal misfit after the ceramic application (m3) was 14.3 m . The cast abutments used in the present study, after the use of rectifiers and porcelain baking (m3), exhibited a mean marginal misfit of16.18 m, which was statistically equivalent to the mean observed for premachined components at the same interval (14.3 m). In disagreement with the findings of vigolo, et al.20 (2000), the present investigation demonstrated that, for the group of premachined abutments, even with the carefully conducted laboratory steps, significant changes occurred at the implant / abutment interface during the casting process, with an increase in the mean marginal gap from 9.63 to 14.6 m . Ceramic application did not change the marginal misfit in any the groups . These results are in agreement with the findings of previous studies1,3,4,7, which did not find significant dimensional alteration of the metal secondary to the ceramic application . The seating force used to place the samples on the master cast has an important effect on the vertical misfit . The use of a torque driver, even with the lowest torque available (10 n / cm), may considerably narrow the vertical misfit gaps at the abutment - framework interface9,12,21 . Marginal misfit investigations, in which screws are hand fastened, always by the same investigator, until the first resistance is met, as suggested zervas, et al.21 (1999), allows a more real fit evaluation because no attempt is made to narrow the vertical misfit gaps . However, it seems to be a risky protocol, due to the wide variation in the ability of the clinicians to perceive torque, making difficult the standardization of the screw tightening procedure prior to microscope measurements . In the present study, a special torque driver was fabricated, reducing the torque to 5 n / cm . This way, the screw tightening was standardized with a seating force that did not considerably influence the vertical misfit gaps . It is important to stand out that this seating force (5 n / cm) was used specifically for this in vitro investigation, and must not be used clinically . In the present investigation, microscopic evaluation of the marginal misfit was employed . The measurements were taken by positioning the specimens on the microscope so that the marginal area of connection between the abutment and the implant could be observed from a directly perpendicular perspective . This allows measurement of the marginal discrepancy in a non - destructive manner, with multiple readings of specimens . Even though there are several three - dimensional methods for evaluating prosthetic misfit, the sophisticated equipment required for such analyses are not promptly available10,12 . Utilization of the most common techniques still provides information on the relative fit or misfit of prostheses, even though it is acknowledged that such techniques are not as precise as the three - dimensional methods10 . According to the currently available scientific - based evidences, despite the efficacy of contemporary dental technology employed in the fabrication of prosthetic frameworks that is, the concepts of passivity provide necessary theoretical ideals, yet their achievement is impossible . The accomplishment of accurate clinical and laboratory procedures, combined with the use of rectifiers that may optimize the final outcomes, allow completion of rehabilitation with prostheses that will not impair the longevity of osseointegration . Use of rectifiers in cast ucla abutments reduced significantly the marginal misfit at the implant - abutment interface; 2 . Even with carefully performed laboratory steps, changes at implant interface of premachined ucla abutments occurred; 3.
Diabetic neuropathy is a leading complication of diabetes mellitus, resulting in significant morbidity and mortality . Although its exact pathogenesis is not fully understood, hyperglycemia does not appear to be the sole factor in the development of neuropathy in diabetic patients . Enigmatically, recent reports have described that long - term tight glycemic control may be a major risk factor for the development of diabetic neuropathy [1, 2]. Neuropathy secondary to rapid normalization of chronic hyperglycemia in the setting of poorly controlled diabetes is also emerging as a new disease entity classified as an iatrogenic complication . Symptoms in these patients are typically consistent with a distal sensory polyneuropathy which is appearing shortly after the initiation of intensive glycemic control and is referred to as insulin neuritis or treatment - induced neuropathy and is characterized by acute, severe pain . . However, the parallel worsening of neuropathy and retinopathy from a rapid tightening of glycemic control [4, 5] suggests a common underlying pathophysiology . Hypoglycemia, a potentially devastating neuronal insult, is usually the result of attempting tight control of blood glucose levels with insulin or other hypoglycemic agents [1, 6]. Currently, the only available method for preventing this hypoglycemia - induced neuronal injury in the clinical setting is the delivery of glucose, a treatment that paradoxically may exacerbate the insult . The objective of this present research was to study the molecular mechanisms of acute neuropathic pain induced by insulin and hypoglycemia in an animal model . The expression of c - fos protooncogene, a marker of nociceptive - induced neuronal activity in the spinal cord [7, 8], was also determined . Additionally, the preventive effects of pretreatment with coenzyme q10 (coq10) on hypoglycemia - induced neuropathic pain and stress - sensitive factor expression were explored . All experiments were carried out following the guidelines and protocols of the animal care and use committee of the university of miami, and the protocol was approved by the iacuc committee . C57bl/6j mice served as controls and cba / caj mice, which develop diabetes spontaneously, functioned as the treatment group; they were both obtained from jackson laboratory (bar harbor, maine, usa). All mice were approximately 12 to 14 weeks old which is comparable to young adult in humans . While cba / caj mice spontaneously develop mild hyperglycemia, these mice had not yet developed peripheral neuropathy at the commencement of the study, as assessed by mechanical testing . Mice were housed in groups of five in plastic cages with soft bedding and free access to food and water under a 12 h/12 h light - dark cycle (dark cycle: 7:00 pm7:00 am). Blood from animals for glucose measurement was obtained via a tail tip snip . During collection, the initial blood expressed was discarded and a subsequent sample was analyzed with onetouch glucometer . To examine the effects of acute insulin - induced hypoglycemia on mechanical sensitivity, 1 unit / kg of insulin (novolin, novo nordisk, 2880 bagsvrd, denmark) was injected intraperitoneally in the treatment group, while control animals received equal volumes of normal saline . Blood glucose levels and mechanical sensitivity were tested before injection and periodically throughout the study until blood glucose levels recovered to normal . To determine whether insulin itself or insulin - induced hypoglycemia was the cause of mechanical hypersensitivity, blood glucose levels were clamped in the normal range by the combined administration of insulin (1 unit / kg) and glucose (3.2 g / kg) in an intraperitoneal injection . The primary reason for not utilizing an intravenous infusion was the fact that the mechanical sensitivity measurement is an unrestricted behavior test and the presence of an intravenous access was felt to interfere with measurements . Louis, mo, usa) was dissolved in olive oil (sigma - aldrich) at a concentration of 30 mg / ml dosed at 100 mg / kg . This dose represents the human equivalent doses of 8 mg / kg, based on body surface area . Twice at a volume of 100 l/30 g of body weight before 20 hr and 4 hr of the induction of hypoglycemia . The mechanical allodynia test was conducted with a touch - test sensory evaluator (von frey filaments, north coast medical, inc ., the mouse was placed on a wire mesh platform and was covered with a transparent glass container and a period of 30 minutes was allowed for habituation . The observation of a positive response (paw lifting, shaking, or licking) within five seconds of the application of the filament was then followed by the application of a thinner filament (or a thicker one if the response was negative). The paw withdrawal threshold was measured five times and was expressed as the tolerance level in grams . Normal saline - injected control mice, mice with hypoglycemia induced by insulin, and hypoglycemic mice pretreated with coq10 were sacrificed via an overdose of nembutal and were then decapitated . Part of the samples was fixed in 4% paraformaldehyde in phosphate buffered saline (ph 7.4) overnight, cryoprotected in 0.1 m phosphate buffered saline containing 20% sucrose, and sectioned by cryostat into 15 m thick sections . Sections were incubated overnight at 4c with the primary antibody, anti - c - fos (sigma - aldrich, usa), followed by biotinylated secondary antibody (vector lab, usa) for one hr at 22c . To ensure the specificity of primary antibody, the primary antibody was replaced by the diluent of the antibody in one section in each set of stains so as to exclude nonspecific background staining . Positive c - fos cells were counted in laminar i - ii area of 280 m of dorsal horn of lumbar spinal cord transverse section (the laminar i - ii area is shown by the dotted line in figure 4). The other half of the collected samples were fresh frozen in dry ice and stored at 80c . The levels of mrna of c - fos were evaluated by rt - pcr in the drg and spinal cord tissues . Extraction of total rna was carried out with trizol (invitrogen, grand island, ny, usa) according to the manufacturer's instructions . 1 g of rna was reverse transcribed with 200 u / sample superscript ii (invitrogen) and 250 ng / reaction of random primers (promega, san luis obispo, ca, usa). The genes of c - fos were amplified from 0.1 g aliquots of cdna in a standard pcr buffer (50 mm kcl, 1.5 mm mgcl2, and 10 mm tris - hcl, ph 8.3) containing 10 pmol of forward and reverse primers along with 0.5 u / sample of amplitaq dna polymerase (applied biosystems, grand island, ny, usa). The sequences of primer pairs are the following: -actin forward: ctagacttcgagcaggagatg, reverse: caagaaggaaggctggaaaag, the product is 150 bp; c - fos forward: ccagtcaagagcatcagcaa, reverse: aagtagtgcagcccggagta, the product is 247 bp . Data are presented as mean sem and analyzed using prism 4 software (graphpad software inc ., san diego, ca). The behavior test data was analyzed with two - way analysis of variance with two repeated factors followed by tukey's multiple comparison test . Comparison between two groups was assessed by unpaired, two - tailed student's t - test . Compared to control animals, it appeared that decreased blood glucose levels correlated to increased pain in the insulin treatment group . Both strains demonstrated significant differences in mechanical sensitivity 40, 90, and 150 min after insulin injection (p <0.05 and p <0.001). Figure 1 shows that decreased withdrawal thresholds (mechanical hypersensitivity) were associated with insulin - induced acute hypoglycemia in both strains of mice . A group of normal saline - injected mice served as a control and demonstrated no changes in blood glucose levels or mechanical sensitivity, indicating that handling and injection stress did not affect or confound results . To determine whether insulin alone induces hypersensitivity, blood glucose levels were clamped at normal levels by joint insulin and glucose injection . Table 1 demonstrated the blood glucose levels of two strains of mice in different situation: saline, insulin, or insulin combined with glucose . In the linked administration of insulin and glucose, blood glucose levels remained at an average of 123.33 8.55 and 165.93 10.60 mg / dl for the c57b/6j and cba / caj mice, respectively, and these mice subsequently demonstrated no significant change in hindpaw withdrawal thresholds . Figure 2 indicates that mechanical hypersensitivity did not develop when blood glucose levels remained in normal range after insulin was injected, suggesting that insulin itself is not involved in the hypoglycemia - induced mechanical hypersensitivity . Coq10 has a critical role in producing energy and antioxidant protection for the body . For the scenario of insulin - induced hypoglycemia, we evaluated whether coq10 could play a protective role in the peripheral nerves . Figure 3 indicates that coq10 did not affect the blood glucose level decrease following insulin injection; however, pretreatment with coq10 did prevent the development of mechanical hypersensitivity in insulin - induced hypoglycemic mice . Levels of c - fos mrna and c - fos immunoreactivity within the spinal cord were evaluated in insulin - induced hypoglycemic mice . Figure 4 shows that c - fos positive cells in the dorsal horn of the lumbar spinal cord after insulin injection increased significantly (in cell - counted analysis, positive cells in the insulin - injected group were more numerous than those in the saline - injected group, p <0.01; in rt - pcr analysis, mrna level of c - fos in insulin - injected group is almost two times that in saline - injected group, p <0.001; student's t - test). However, pretreatment with coq10 partially decreased c - fos expression in the spinal cord (in rt - pcr analysis, c - fos mrna levels in the group pretreated with coq10 were significantly lower than those in the insulin - injected group, p <0.05). Studies have suggested that hypoglycemia - induced neuropathy may not simply be the result of glucose deprivation but rather a result of a multifactorial process involving oxidative stress and stress - sensitive factors . The results of the present study demonstrate that insulin - induced hypoglycemia may result in acute neuropathic pain and the increased mechanical sensitivity noted is the result of decreased glycemic levels rather than insulin itself . The immunohistological and rt - pcr results suggest that insulin - induced hypoglycemia results in an increased expression of the stress - sensitive and pain - related factor c - fos in nerve tissues . This in turn may be the mechanism by which acute pain is induced in the body . Furthermore, our results demonstrated that pretreatment with coq10 can prevent hypoglycemia - induced mechanical hypersensitivity and decrease the expression of c - fos . Results further suggest that the protective effects of coq10 on pain sensitivity may be related to a decrease in activation of spinal pathways mediated by the inhibition of oxidative stress and intracellular signaling, preventing neuronal injury . Patients with diabetes may face the difficult situation where tight blood glucose control can reduce the risk of diabetic complications; however, this degree of control may also increase the risk of dangerous hypoglycemic episodes . Studies estimate 30% of diabetics experience serious hypoglycemic episodes annually and hypoglycemia has potentially devastating effects on nervous tissues . Clinicians have described acute severe painful neuropathy occurring during intensive treatment of patients with type 1 and type 2 diabetes treated with oral hypoglycemic agents or with insulin [1, 11]. In 1933, caravati described neuropathic pain resulting from insulin use, insulin neuritis; however, the mechanism remains unclear . Trophic factors and cytokines, including vascular endothelial growth factor (vegf), insulin growth factor (igf), mitogenic cytokine, il-8, il-6, and tnf-, have been implicated in the pathogenesis of diabetic retinopathy, diabetic nephropathy, and diabetic neuropathy . It is hypothesized that upregulation of these trophic factors and cytokines is associated with intensive glycemic control and is responsible for the early worsening of retinopathy and acute pain . Our data suggests that c - fos, an immediate early transcription factor, is involved in insulin - induced hypersensitivity . Elevated cytokine levels, including interleukin-1, interleukin-6, and tumor necrosis factor-, have been associated with impaired autonomic function after experimental hypoglycemia . Thus, acute treatment of diabetes - induced neuropathy and retinopathy notably after intensive glycemic control may have a common pathophysiological mechanism that involves upregulation of proinflammatory cytokines . This concept also suggests an additional hypoglycemia - related pathophysiological mechanism and provides potential targets for therapeutic intervention . Our data demonstrated that when combined, glucose and insulin injections, without subsequent hypoglycemic episodes, do not result in acute painful neuropathy, suggesting that insulin itself does not induce hypoglycemia - induced mechanical hypersensitivity . Thus, acute painful neuropathy is a concern not only for diabetics but also for normal subjects experiencing sudden hypoglycemic episodes . Tight glucose control has been associated with numerous clinical benefits in diabetic patients, including the reduction of diabetic neuropathy; however, this type of treatment significantly increases the risk of severe hypoglycemic episodes . As we have demonstrated, hypoglycemia itself may exacerbate neuropathy and currently the only available method for preventing this hypoglycemia - induced neuronal injury in the clinical setting is the delivery of glucose, a treatment that paradoxically may exacerbate the insult . This study has obvious limitations; most notably, it was conducted solely in mice . It can be difficult to extrapolate data from lower mammals to humans; pain has many complex elements that can be difficult to assess . Autophagy occurs in hypoglycemic peripheral nerves in association with axonal degeneration and regeneration in rats models . Hypoglycemia causes wallerian - type axonal degeneration of large myelinated nerve fibers in the peripheral nerve of insulin - treated diabetic animal models [19, 20]. Neuronal death resulting from hypoglycemia involves excitotoxicity and dna damage . By using cortical neuron cultures, researchers have found that application of poly(adp - ribose) polymerase (parp-1), an endogenous caspase-3 substrate inhibitor, increases neuronal survival in glucose deprivation . Additionally, rat models of insulin - induced hypoglycemia have shown the therapeutic potential of papd-1 inhibitors . Other researches have demonstrated that coq10 inhibits high glucose - induced cleavage of papd-1 and suggest that coq10 prevents oxidative stress - induced apoptosis through inhibition of the mitochondria - dependent caspase-3 pathway . Taken together, our present results indicate that pretreatment with coq10 can prevent hypoglycemia - induced mechanical hypersensitivity and decrease the expression of c - fos and chronic treatment with coq10 may scavenge free radicals instantly and prevent mitochondrial dysfunction in the transient hypoglycemia induced by tight glucose control in diabetics.
It is estimated that between 1.0 and 1.5 million individuals are infected with the human immunodeficiency virus (hiv) in the united states, with the majority likely to develop acquired immunodeficiency syndrome (aids) in the next decade . By mid-1988 over 57,000 cases of aids had been reported to the centers for disease control (cdc). More than one - half of the individuals diagnosed have died, and thousands more are afflicted with aids - related complex (arc). By 1991, more than 270,000 individuals will have been diagnosed with aids and 179,000 will have died from the disease . It is projected that in 1991 alone, 145,000 persons with aids will require medical attention, and 54,000 will die during that time (centers for disease control, 1988). Nationally, 64 percent of all aids cases are reported among homosexual or bisexual males who are not iv (intravenous) drug users; 18 percent among heterosexual iv drug users; 7 percent among homosexual males who are also iv drug users; 4 percent among heterosexual partners of those in high - risk groups; 2 percent among recipients of blood or blood products; 1 percent among persons with hemophilia, and 3 percent of undetermined cause (centers for disease control, 1988). The number of cases of aids in children is growing steadily; in early march 1988, this totaled 865 . Although homosexual or bisexual males continue to account for the largest number of cases nationwide, the disease is spreading most rapidly among iv drug users, blacks, hispanics, women, and children . Aids cases have been reported in each of the 50 states plus puerto rico and other territories . The burden has been greatest in eight states, with new york, california, florida, texas, new jersey, illinois, pennsylvania, and massachusetts each reporting 1,000 or more cases . Most major metropolitan areas have now experienced the impact of the epidemic, most notably new york, san francisco, and los angeles . Although new york has many more total cases, no city has been as affected by the disease as san francisco in terms of the burden of aids relative to its total population (table 1). The response of the city and county of san francisco to the local aids epidemic has been described in some detail elsewhere (arno, 1986; arno and hughes, 1987; silverman, 1987). As early as 1981, the san francisco department of public health (dph) began to coordinate efforts to plan and develop services to respond to the health care needs of growing numbers of persons with aids (pwa's) in the city, most of whom were (and are) homosexual / bisexual males . In early 1982, dph was provided local tax funds by the board of supervisors for the support of aids prevention activities and community psychosocial support services . In late 1982, a multidisciplinary aids outpatient clinic was established at san francisco general hospital (sfgh) to provide screening, diagnosis, treatment, followup, education, and counseling services . The first inpatient aids ward in the united states was opened at sfgh in 1983 . Over the last 6 years the city has provided a substantial level of funding for a wide range of medical and social services for pwa's (city and county of san francisco, 1988). Following is a list of available health and supportive services: aids screening / outpatient services, including dedicated clinics . Practical support for daily living . Emotional support / counseling . Professional counseling and hospital advocacy . Mental health support . Practical support services . In addition, private physicians in fee - for - service practice, community hospitals, the kaiser hospital, and the permanente medical group have become increasingly involved in the care of pwa's . What came to be known as the san francisco model was developed through strong public sector leadership, exemplary medical care, a highly mobilized gay community providing volunteer services, psychosocial support and advocacy, and an early commitment to outpatient, home, and community - based services rather than inpatient hospital care (arno and hughes, 1987). The response to the aids epidemic of both the public and private sectors in san francisco has generated a range of medical, social, psychological, housing, and other services to meet the needs of pwa's . Considerable state and local resources have been directed toward development of a continuum of services appropriate to the complex character of the disease, which has significant and multiple acute and chronic dimensions . Somewhat paradoxically, the success of san francisco in developing a range of services to address this complex of aids care needs has produced a new set of problems for planners and program managers, namely, how to manage the care of pwa's across providers in appropriate, responsive, and cost - effective ways (morrison, 1988). This need to better manage the delivery of health and social services is exacerbated by two other characteristics of aids: (1) the likelihood of precipitous changes in physical and emotional status throughout the course of the illness, resulting in frequent changes in care needs; and (2) the increased incidence of neurological and psychosocial problems, further broadening the range and complexity of care needs . Like many communities that have had to confront the aids epidemic, san francisco has devoted increased attention to development of case management services for pwa's in order to plan and monitor care throughout the course of the illness (benjamin, 1988). Case management refers to a set of support activities designed to complement various direct services provided to persons in need, especially the chronically ill . Although there exists considerable variation in definitions, models, and goals associated with case management (spitz, 1987), these support activities generally are intended to reduce inappropriate use of inpatient hospital care, improve continuity of care, and enhance the client's quality of life in the community (franklin et al ., 1987). Despite the widespread equation of case management with the san francisco model of aids care, the emergence of formal case management as a public policy priority in san francisco has been a relatively recent development . A brief examination of the role of case management within the local service network suggests at least three phases in the formalization and centralization of these support services . The definitions of formalization and centralization in this context will become clearer as these phases are discussed . As suggested earlier, the most striking feature of the period between 1982 and 1985 was the development of a continuum of medical and social services for pwa's, in the form of public services (e.g., inpatient and outpatient care), private sector care provided through public contracting (e.g., home health and hospice care), or volunteer services subsidized by public funds (e.g., housing, practical support / homemaker, food, information, and referral). During this period, case management as a set of activities was relatively informal and decentralized . Case assessment, planning, and monitoring were done by dedicated professionals and community volunteers as pwa's moved from agency to agency . In the early years of the epidemic, hospital discharge planning at sfgh, where more than one - half of the aids population received acute care, was a central (and the most formal) part of this informal case management network . More generally, when a pwa moved from one organization to another for care, case management responsibilities were assumed by professionals in that organization . To the extent that these responsibilities were centralized at all, this occurred through a physician with a large aids caseload and/or a volunteer with the time and expertise to share this role . No single case manager was assigned to follow the patient throughout his or her illness and to plan and facilitate access to needed services . For several years this relatively informal and decentralized system generally proved successful in san francisco for a variety of reasons . First, the sheer number and variety of medical, social, and other support services available to pwa's reduced the likelihood that many persons would fall through the cracks, however informal the case management might be . Second, a cadre of medical and social service professionals dedicated to aids care emerged rapidly in the city, and this group shared a philosophy regarding the importance of home- and community - based services and the need to help pwa's negotiate this network of services . Third, a large number of volunteers (many drawn from the local gay community) filled roles as case advocates when increasingly overworked professionals could not . Fourth, a relatively enlightened political and public health leadership took advantage of the city's then - sound fiscal situation and allocated funds to public and nonpublic aids providers so that the first three conditions were reinforced . Fifth, because dph administers a full range of public health, medical, and long - term care services, it has been able in some important ways to coordinate care within the public sector and with the private sector . Sixth, dph is governed by a broadly representative health commission that enhances public participation in policies and programs of the department . Seventh, the city itself is small and compact, so that, despite the growing aids caseload, there was a small number of core providers (among them, sfgh, shanti, the visiting nurse association and hospice of san francisco, the san francisco aids foundation, and the aids health project) that offered services to most pwa's and were well known to one another, thus facilitating informal planning and management across agencies over time . Finally, the number of aids cases, although large relative to other communities, did not overwhelm the service system in the early years so that informal and decentralized strategies could succeed . This system of case management worked well until the number of pwa's began to increase rapidly in 1985 - 86, at which point more formal but still relatively decentralized variants began to develop . In 1986 various observers began questioning whether the pool of volunteers on which the san francisco model depended could be sustained (arno, 1986; lee, 1987; jenna, 1987) and whether dedicated professionals could continue to coordinate and manage care as an adjunct to their direct service responsibilities . As more community hospitals, including the kaiser hospital, physicians, home care agencies, and other providers, became involved with aids care, informal approaches to case coordination became much more difficult . Growth in the number of intravenous drug users and homeless among persons with aids (although still small proportionally), along with the expanded number of cases with central nervous system involvement, increased the complexity of the (mainly white, homosexual / bisexual male) caseload in the city and demanded more experienced and less episodic attention to the service needs of pwa's than was available from volunteers . The result has been an increased need to formalize and coordinate the case management efforts of individual provider agencies and to plan for a more centralized system of communitywide aids case management in the future . The case of sfgh, which currently provides excellent care to about one - third of the inpatient and outpatient pwa's in the city, illustrates both the strengths and limits of current case management efforts . The highly esteemed designated inpatient unit and outpatient clinic at sfgh have developed a significant capacity for hospital discharge planning and followup for pwa's . Multidisciplinary discharge planning at sfgh begins at the point of inpatient admission or earlier (i.e., in the outpatient clinic). The public health department has helped established formal agreements between the public hospital and other community care providers to facilitate coordinated care outside the hospital . Weekly case conferences at sfgh involving many community providers and volunteers have enhanced case planning and coordination . Because the hospital currently utilizes 40 or more acute care beds for aids patients and provides 2,000 outpatient visits per month, however, sustained case management activities must be limited primarily to the acute episode and its immediate aftermath, rather than to the entire period of illness . Although this hospital and post - hospital period may well be the most difficult for many pwa's, for most it represents 10 percent or less of the duration of the illness . Because even excellent hospital discharge planning is circumscribed in its scope and impact, therefore, these activities need to be articulated with a broader system of case management . Kaiser permanente, the largest health maintenance organization in the region, currently enrolls nearly one - third of pwa's in san francisco . At the same time that kaiser has become a major provider of aids care, it has sought to avoid designation as carrier of choice for pwa's and the adverse selection that might follow from favorable publicity . Kaiser does not provide an expanded service package for aids, although it does flag catastrophic cases and provide out - of - contract services where those will reduce hospital use . Case management services are offered to pwa's and persons with severe arc . Because the kaiser service package is limited (e.g., home care services are not covered) case managers focus upon locating resources, including local programs and medi - cal (medicaid), that will pay for and/or provide needed services to plan members . As at sfgh, case management attention has been given primarily to hospital discharge activities, especially to arranging referrals to nonplan providers . One of the goals of case management at sfgh, at kaiser, and at the community hospitals is to reduce the utilization of inpatient care through the planning and coordination of care provided outside the hospital . In addition to those enrolled in the kaiser health plan, over one - third of san francisco's aids population is covered by private insurance during at least part of their illness . Blue cross, prudential, aetna, and other third - party insurers share an interest in limiting hospital use and managing medical care to reduce costs . Most insurers have established mechanisms for flagging catastrophic cases and for offering case management to these potentially costly enrollees, and aids tends to be included in this general process . Like kaiser, these insurers will pursue those home and community - based alternatives acceptable to the client and considered to have cost - saving potential; however, care for which reimbursement is provided tends to be limited to skilled medical services . Few insurers in california are planning to develop aids - specific case management efforts outside their broader mechanisms for addressing catastrophic illness . As suggested earlier, the most striking feature of the period between 1982 and 1985 was the development of a continuum of medical and social services for pwa's, in the form of public services (e.g., inpatient and outpatient care), private sector care provided through public contracting (e.g., home health and hospice care), or volunteer services subsidized by public funds (e.g., housing, practical support / homemaker, food, information, and referral). During this period, case management as a set of activities was relatively informal and decentralized . Case assessment, planning, and monitoring were done by dedicated professionals and community volunteers as pwa's moved from agency to agency . In the early years of the epidemic, hospital discharge planning at sfgh, where more than one - half of the aids population received acute care, was a central (and the most formal) part of this informal case management network . More generally, when a pwa moved from one organization to another for care, case management responsibilities were assumed by professionals in that organization . To the extent that these responsibilities were centralized at all, this occurred through a physician with a large aids caseload and/or a volunteer with the time and expertise to share this role . No single case manager was assigned to follow the patient throughout his or her illness and to plan and facilitate access to needed services . For several years this relatively informal and decentralized system generally proved successful in san francisco for a variety of reasons . First, the sheer number and variety of medical, social, and other support services available to pwa's reduced the likelihood that many persons would fall through the cracks, however informal the case management might be . Second, a cadre of medical and social service professionals dedicated to aids care emerged rapidly in the city, and this group shared a philosophy regarding the importance of home- and community - based services and the need to help pwa's negotiate this network of services . Third, a large number of volunteers (many drawn from the local gay community) filled roles as case advocates when increasingly overworked professionals could not . Fourth, a relatively enlightened political and public health leadership took advantage of the city's then - sound fiscal situation and allocated funds to public and nonpublic aids providers so that the first three conditions were reinforced . Fifth, because dph administers a full range of public health, medical, and long - term care services, it has been able in some important ways to coordinate care within the public sector and with the private sector . Sixth, dph is governed by a broadly representative health commission that enhances public participation in policies and programs of the department . Seventh, the city itself is small and compact, so that, despite the growing aids caseload, there was a small number of core providers (among them, sfgh, shanti, the visiting nurse association and hospice of san francisco, the san francisco aids foundation, and the aids health project) that offered services to most pwa's and were well known to one another, thus facilitating informal planning and management across agencies over time . Finally, the number of aids cases, although large relative to other communities, did not overwhelm the service system in the early years so that informal and decentralized strategies could succeed . This system of case management worked well until the number of pwa's began to increase rapidly in 1985 - 86, at which point more formal but still relatively decentralized variants began to develop . In 1986 various observers began questioning whether the pool of volunteers on which the san francisco model depended could be sustained (arno, 1986; lee, 1987; jenna, 1987) and whether dedicated professionals could continue to coordinate and manage care as an adjunct to their direct service responsibilities . As more community hospitals, including the kaiser hospital, physicians, home care agencies, and other providers, became involved with aids care, informal approaches to case coordination became much more difficult . Growth in the number of intravenous drug users and homeless among persons with aids (although still small proportionally), along with the expanded number of cases with central nervous system involvement, increased the complexity of the (mainly white, homosexual / bisexual male) caseload in the city and demanded more experienced and less episodic attention to the service needs of pwa's than was available from volunteers . The result has been an increased need to formalize and coordinate the case management efforts of individual provider agencies and to plan for a more centralized system of communitywide aids case management in the future . The case of sfgh, which currently provides excellent care to about one - third of the inpatient and outpatient pwa's in the city, illustrates both the strengths and limits of current case management efforts . The highly esteemed designated inpatient unit and outpatient clinic at sfgh have developed a significant capacity for hospital discharge planning and followup for pwa's . Multidisciplinary discharge planning at sfgh begins at the point of inpatient admission or earlier (i.e., in the outpatient clinic). The public health department has helped established formal agreements between the public hospital and other community care providers to facilitate coordinated care outside the hospital . Weekly case conferences at sfgh involving many community providers and volunteers have enhanced case planning and coordination . Because the hospital currently utilizes 40 or more acute care beds for aids patients and provides 2,000 outpatient visits per month, however, sustained case management activities must be limited primarily to the acute episode and its immediate aftermath, rather than to the entire period of illness . Although this hospital and post - hospital period may well be the most difficult for many pwa's, for most it represents 10 percent or less of the duration of the illness . Because even excellent hospital discharge planning is circumscribed in its scope and impact, therefore, these activities need to be articulated with a broader system of case management . Kaiser permanente, the largest health maintenance organization in the region, currently enrolls nearly one - third of pwa's in san francisco . At the same time that kaiser has become a major provider of aids care, it has sought to avoid designation as carrier of choice for pwa's and the adverse selection that might follow from favorable publicity . Kaiser does not provide an expanded service package for aids, although it does flag catastrophic cases and provide out - of - contract services where those will reduce hospital use . Case management services are offered to pwa's and persons with severe arc . Because the kaiser service package is limited (e.g., home care services are not covered) case managers focus upon locating resources, including local programs and medi - cal (medicaid), that will pay for and/or provide needed services to plan members . As at sfgh, case management attention has been given primarily to hospital discharge activities, especially to arranging referrals to nonplan providers . One of the goals of case management at sfgh, at kaiser, and at the community hospitals is to reduce the utilization of inpatient care through the planning and coordination of care provided outside the hospital . In addition to those enrolled in the kaiser health plan, over one - third of san francisco's aids population is covered by private insurance during at least part of their illness . Blue cross, prudential, aetna, and other third - party insurers share an interest in limiting hospital use and managing medical care to reduce costs . Most insurers have established mechanisms for flagging catastrophic cases and for offering case management to these potentially costly enrollees, and aids tends to be included in this general process . Like kaiser, these insurers will pursue those home and community - based alternatives acceptable to the client and considered to have cost - saving potential; however, care for which reimbursement is provided tends to be limited to skilled medical services . Few insurers in california are planning to develop aids - specific case management efforts outside their broader mechanisms for addressing catastrophic illness . By most indications, the next stage in the evolution of case management in san francisco will be the development of centralized case management that attempts to bridge those services provided by single agencies, organizations, and individuals . The availability in the last 2 years of state and federal funding to support case management initiatives has reinforced local efforts at formalization and encouraged trends toward more centralization . The department of public health in san francisco received a demonstration grant in 1986 from the office of aids (california department of health services) to provide home care and case management services to a small number of pwa's . The success of this modest initiative, which placed more emphasis on service subsidies and data collection than case management, has led the city to apply for more substantial funding from the state to support development of a centralized case management system; that proposal is still pending . At the state level, the california department of health services is seeking a home and community - based waiver for medi - cal - eligible pwa's, and strong provisions for local, centralized case management are included in that pending application . Both initiatives have stimulated planning for new approaches to case assessment, coordination, and monitoring . The case management program for which additional funding has been sought from the state office of aids is designed to establish a case management capacity in the city dph that is expected to serve pwa's referred from sfgh, district health centers, community hospitals (including kaiser), physicians in private practice, community and government agencies, family members and friends, and self - referrals . The proposed program will initially support two case management teams, each of which will follow 40 aids / arc patients from the time of initial inpatient admission (or referral) through the course of the illness . Directed by a public health nurse with assistance from a medical social worker, the team will be responsible for conducting initial and ongoing needs assessment and ensuring access to appropriate services . The experience of san francisco in organizing and managing the delivery of aids care leaves various questions unanswered regarding case management system design and financing . The aids provider community in san francisco remains split on the merits of centralized case management . In a relatively small city with relatively abundant services and strong provider networks the centralization of case management under dph, moreover, may require the adjustment of established interagency linkages at some administrative cost to participants . On the other hand, centralized case management may be essential in those communities where similar resource and collaborative conditions do not exist . Although san francisco has embraced what has come to be known as a brokering model of case management, under which case management involves gaining access to and coordinating existing services, communities with fewer available aids services have adopted a direct service model (wright, sklebar, and heiman, 1987), in which case managers not only plan for care but directly provide those services not otherwise available to pwa's . In the latter model, caseloads must necessarily be smaller than in the brokering model, case management costs are likely to be higher, pressures to ration care will be greater, and the need for centralized administration more obvious . Although everyone endorses a team approach in principle, participants differ in terms of their commitment to medical versus social case management models (usually in the form of nurse versus social worker) and in terms of the extent of professional training needed (i.e., bachelor or masters level). Arguments on both sides usually involve the types of services that should be emphasized and the cost of staffing a case management system . An additional issue concerns the scope of case management and, specifically, whether case managers can reasonably be expected to foster interagency coordination in areas where that is rare (e.g., psychosocial and mental health with medical care). Under some circumstances, professionals trained to manage the care of individual pwa's will confront the need to alter institutional relationships in order to be successful . Such change may only result from the efforts of institutional leadership, not case managers . Case management in san francisco and many other communities has been designed primarily to address the needs of the largest subpopulation of pwa's in those locales, i.e., homosexual and bisexual men . It is likely that case management approaches will have to be adapted to different aids populations, because a system designed for gay, white males is unlikely to be appropriate for minority, male and female intravenous drug users (ivdu) with children who also are infected . At the least, we know that the latter population is not accompanied by the network of volunteers and specialized services established by gay organizations in various communities and that various behavioral problems associated with drug use make planning and monitoring care more difficult . Demonstration and waiver programs in new jersey, new york, and a few cities with large numbers of ivdu - aids cases may cast light on the elements of case management appropriate to this aids population . Special state - funded initiatives and prospective medicaid waivers currently represent the primary sources of funding for case management services . Payment for case management continues to be provided only under exceptional circumstances, and more established and routine sources of funding may be needed if case management is to play a significant role in aids care . Case management has succeeded in san francisco because many of the services needed by pwa's were available for case managers to coordinate . Without additional funding for such services, and most significantly long - term care services, as the number of aids cases grows and the fiscal burden of aids care on governments (especially local ones) increases, it is important also to recognize that funding for indirect services like case management are likely to be reduced before that for harder, direct services . In the absence of a clear understanding of what case management is and which goals it serves (spitz, 1987), the price of such policy choices will be difficult to assess . The literature on case management for the chronically ill elderly, the mentally ill, and others needing a wide range of medical, social, and support services, raises serious questions regarding the capacity of case management to reduce inpatient hospital utilization or to reduce costs (capitman, haskins, and bernstein, 1986; kemper et al . In many cities where aids lengths of stay are twice (or more) those of san francisco, planners remain hopeful nonetheless that the introduction of case management will reduce dependence on inpatient care through the coordinated use of outpatient, home, and community services . Although many factors besides case management explain the shorter length of stay in san francisco (scitovsky, cline, and lee, 1986; arno and hughes, 1987), there remains reason to believe that in other communities, aids may prove the exception to prior findings on the limited impact of case management by demonstrating that these services can shorten hospital stays and thus reduce the overall costs of caring for persons with aids.
Obesity is considered a major health problem and its prevalence has increased dramatically in the last decades, corresponding to the 36.9% of the men and the 38.0% of women worldwide . Obesity is usually accompanied by other diseases, the most common being type 2 diabetes mellitus (t2d), insulin resistance (ir), and cardiovascular complications . Moreover, other metabolic consequences have been related, such as nonalcoholic fatty liver disease (nafld) or even many cancers . Although obesity is not the unique problem in metabolic syndrome, this is becoming more common due to a rise in obesity rates among adults . Over the last few years, the number of people with diabetes mellitus has increased massively, raising prevalence worldwide, and does not focus on the western societies . In the economically advanced countries, the increase will be about 50% in 2030, so it has become one of the most important public health challenges globally . Although great advances have been made in understanding the mechanisms involved in the pathogenesis of t2d, these have still not been fully elucidated . Currently, the only effective therapy is weight loss, including the lately accepted bariatric surgery, and last knowledge about the effectiveness of the physical activity, which is able to decrease specific visceral fat increasing the fat - free mass . Adipose tissue is a key regulator of energy balance, playing an active role in lipid storage and buffering, synthesizing, and secreting a wide range of endocrine products into circulating blood that influence systemic metabolism . A classical paradigm has been the fact that the more adipose tissue, the higher the prevalence of metabolic diseases, and it is this relationship that has interested researchers . However, certain inconsistencies have been found; for example, some extremely obese people are not diabetic, while other overweight people develop severe ir and diabetes . This suggests that the absolute amount of fat stored may not be the most important factor determining the relationship between obesity and diabetes . Obesity - related adverse health consequences therefore appear to be related to fat distribution rather than the total amount of fat . There are many theories linked to obesity: from the simplest excess of energy / lipids intake to the most recent gut microbiota [15, 16]. But a very interesting theory is focused on a limit to the functional capacity of adipose tissue . When this capacity is exceeded, metabolic disorders occur . This suggests that the factor linking obesity, diabetes, and associated comorbidities may not be the absolute amount of fat accumulated but the mismatch between energy surplus and storage capacity . This new vision places the adipose tissue at the same level as other vital organs . Just as one can speak of heart, liver, or kidney failure the aim of this review is to better understand the adipose tissue organ, reviewing the influence of variables that govern its ability to expand and its influence on development of ir and diabetes associated with obesity, mainly based on the studies undertaken by our research team over the last few years . Fat accumulation is determined by the balance between fat synthesis (lipogenesis) and fat breakdown (lipolysis / fatty acid oxidation). Lipogenesis encompasses the processes of fatty acid synthesis and triglyceride synthesis, and takes place in both the liver and in adipose tissue . It has long been accepted that the primary function of adipocytes is to store fuel for distribution to nonadipose tissues in times of need, but adipose tissue is also an important site of endogenous fatty acid synthesis, although lipogenesis in this tissue is considered low and less than that in the liver . Excessive hepatic lipogenesis is a hallmark feature of many models of obesity and diabetes, although the causal relationship between tissue lipid accumulation and insulin resistance is unclear . Some of the most feasible reasons are its relationship with nafld, endoplasmic reticulum (er) stress, the role of the free fatty acids (ffa) or / and ceramides . Lipogenesis is thought to be a relatively minor contributor to whole body lipid stores in a present - day human consuming a typical high fat diet . Nevertheless, under special situations such as a high carbohydrate diet, the total body fat synthesis significantly exceeds de novo lipogenesis . It is well recognized that adipose tissue storage capacity for fatty acids prevents lipotoxicity in other tissues . However, adipose tissue buffering is impaired in obesity through defects in the ability of adipose tissue to respond rapidly . Thus, the lipogenic pathway has been suggested to be downregulated in obesity, at least at the gene expression level . Although in early obesity there is an increase in lipogenic gene expression to store fat rapidly, in long - term obese subjects this expression decreases, perhaps due to a late adaptive process, aimed at limiting further development of fat mass . A possible explanation for this reversal is that once the storage capacity of the adipocytes is reached, the cells reduce their ability to synthesize additional fatty acids, following a natural inhibitory feed - back process . Thus, changes in lipid - storing capacity and lipid mobilization processes in adipocytes represent important elements of adipose tissue dysfunction . Many factors are involved in this action, although we will focus on those our research team has been working on (figure 1) in the last years, some of them are widely known, others are shown as a novel approach . Gene expression patterns play a key role in determining pathogenesis and candidate genes of t2 dm and obesity [30, 31], because of their first step in the transcription and function cascade . Peroxisome proliferator - activated receptor- (ppar) is a regulator of adipogenesis and lipogenesis, being considered the most important regulator of these processes . The behavior of ppar has long been recognized from clinical, pathological, observational and case studies . The activation of ppar leads to adipocyte differentiation and fatty acid storage, whilst it represses genes that induce lipolysis and the release of free fatty acids (ffa) in adipocytes . Failure in the metabolism of this molecule leads to dysregulation in the optimal lipid storage and mobilization, the main problem of obesity . Under normal conditions, ppar mrna expression is highest postprandially and its activation leads to upregulation of genes that mediate fatty acid uptake and trapping, ensuring the storage and relocalization of the excess triacylglycerol . Moreover, ppar has a direct role in the transcriptional control of specific functional nodes of the lipolytic axis through the protein kinase a (pka) complex . On the other hand subjects with ir and obesity have a reduced ppar expression, both fasting and postpandrially [35, 36]. Morbidly obese patients and patients with diabetes have a lower expression of ppar2 mrna in comparison with morbidly obese insulin sensitive patients, both in vat and muscle . This is closely associated with the storage capacity in adipose and muscle tissues, with the mismatch between energy surplus and storage capacity in adipose tissue and muscle tissues possibly being an important factor linking obesity and ir . This lower expression was also found in both ppar and ppar2 mrna in peripheral blood mononuclear cells after a high - fat meal in morbidly obese humans and it was more patent in those who were insulin resistant, indicating an altered response in these individuals . On the other hand, another important molecule in this process is the fatty acid synthase (fasn), which is the central enzyme for de novo synthesis of long - chain saturated fatty acids, and is a key enzyme in lipogenesis . So from this point, concerning carbohydrate metabolism disorders and obesity, we have demonstrated that adipose fasn gene expression is closely related with the hyperglycemic state (higher in normoglycemic individuals compared with those with hyperglycemia). In addition, we have also demonstrated a significant decrease in fasn expression in hypertensive individuals, being more pronounced in obese patients . Another protein recently studied is zinc-2 glycoprotein (zag), a protein expressed in mature adipocytes and in vat and sat and which is involved in body weight control through its lipid - mobilizing activity via interaction with 3-adrenoreceptors, suggesting a role in lipid catabolism . Previous in vivo studies showed that zag induces a loss of body weight in overweight and obese animals through specific depletion of carcass fat . Studying the most extreme form of obesity, we found an inverse relationship between zag expression and body mass index . We suggested that zag may be involved in the regulation of lipid metabolism due to a different expression in vat and sat and its different relation with the genetic expression of lipolytic enzymes . Another way to address the issue of the loss of lipogenic capacity in individuals with ir is the compensation of that loss by tissues and organs other than the adipose tissue . For instance, fatty acid - binding protein 4 (fabp4), a protein linked to insulin sensitivity, lipid metabolism and inflammation, has been described as an important mediator in the crosstalk between adipocytes and macrophages in adipose tissue . We have suggested that the adipose tissue and the liver may act in a balanced manner depending on the ir status, as a decrease in fabp4 expression was observed in adipose tissue from metabolically obese patients versus metabolically healthy humans, while the opposite takes place in the liver, with an increase in fabp4 expression in metabolically obese patients, with the ir status being an important determinant in tissue expression . Another orphan nuclear receptor associated with ir, and which has been studied in our laboratory, is the retinoic acid receptor - related orphan nuclear receptor 1 (ror1), also expressed in human adipose tissue . Ror1 has an important role in adipogenesis and glucose homeostasis, modulating glucose uptake and promoting adipogenesis . Subjects with obesity and a high degree of ir have a clear rise in gene and protein expression of the ror1 receptor in adipose tissue, especially in the visceral depot . This suggests that ror1 may be added to the list of nuclear receptors in adipose tissue that could be used to modulate the ir associated with obesity . Stearoyl - coa desaturase-1 (scd1), which is an endoplasmic reticulum - bound enzyme that converts different saturated fatty acids into mono - unsaturated fatty acids . Studying the regulation of scd1 is of particular interest since alterations in the composition of phospholipids have been implicated in a variety of diseases, including cancers, diabetes and cardiovascular disorders . Mice with a targeted disruption in the scd1 gene are resistant to diet - induced weight gain . In accord with these results, we have reported that scd1 in morbidly obese patients is related to obesity and ir, with a raised scd1 protein level in vat and sat from morbidly obese patients . A recent collaboration has found an adaptive response to compensate the antilipogenic effect associated with ir, maintaining lipid desaturation through preferential scd1 regulation and facilitating fat storage in adipose tissue . Another example of up - regulated molecules in obesity is rab18, which is a gtpase that has been found to regulate intracellular membrane bidirectional trafficking of lipids in lipid droplets; it is involved in the mechanism to release lipids from lipid droplets in adipocytes . Rab18 overexpression increased basal lipogenesis and rab18 silencing impaired the lipogenic response to insulin, suggesting that this protein promotes fat accumulation in adipocytes, performing its activity through the endoplasmic reticulum . On the other hand, there is evidence for the participation of rab18 in the regulation of lipolysis via -adrenergic pathway . Moreover, obesity is associated with an increase in rab18 expression, which suggests that upregulation of this gtpase may be an appropriate response to managing energy excess, an adaptive response to overcome the alterations in lipid metabolism occurring in obesity . This participation in the regulation of lipid processing in adipose tissue takes place under both normal and pathological conditions . And finally, we finished with breast cancer 1 (brca1), a good example of a protein with an important role in the lipogenic and lipolysis pathways involved in the relationship between obesity and its associated metabolic pathologies brca1 is a protein involved in multiple cellular functions, including dna repair, cell cycle checkpoint control, and transcription associated with the dna damage as it has been reported in breast and ovarian cancers, and ubiquitination, activity developed thanks to the heterodimer with bard1, among others . It has been suggested that brca1 helps to maintain fatty acid biosynthesis and lipogenesis under control . This is supported by findings from our laboratory showing an increased brca1 expression in adipose tissue and during adipogenesis that mirror the effects of lipogenic enzymes such as acetyl - coa carboxylase (acc) and fasn . On the other hand, brca1 was found to be up - regulated in adipose tissue from obese subjects independently of whether they had t2d, so we suggest a crosstalk between brca1, lipogenesis, adipogenesis, obesity, and obesity - associated ir . Thus, taking together the increased expression of the brca1 gene and the reduced expression of many lipogenic factors, could be interpreted as the process through which cells reduce their ability to synthesize additional fatty acids once the limit in the storage capacity of the adipocytes is attained . Adipose tissue, as suggested above, can be considered another vital organ, mainly due to its endocrine properties . Adipocytes are the main units in adipose tissue, and this tissue is considered to control the whole body metabolism, so dysregulation can have huge consequences for health . Adipose tissue dysfunction is thought to be the major factor leading to whole body ir . Beyond expandability of adipose tissue, adipose tissue is very dynamic; as much as 10% of the fat cells die and are renewed every year . Lipid excess in at results in increased adipocyte size (hypertrophy) or / and increased numbers of adipocytes (hyperplasia), seen as enlarged sat or vat (figure 2). As it has been noticed, there are metabolic and functional differences between adipose tissue depots; sat is recognized as the safest tag depot, and it is the first to receive excess lipids, whereas visceral deposition occurs only after sat capacity has been exceeded . Thus, vat has a greater capacity to generate free fatty acids and to uptake glucose, while sat is more avid in the absorption of circulating free fatty acids and triacylglycerols . On the other hand, a different impact of subcutaneous and visceral fat cell sizes on lipid and glucose / insulin profiles has been observed . So that, mean fat cell size is associated with metabolic complications but not with systemic or adipose inflammation in morbid obesity, with a region - specific influence: large visceral fat cells are more strongly linked to dyslipidaemia, whereas large subcutaneous fat cells correlate with impaired glucose metabolism, hyperinsulinaemia and insulin resistance . Thus, veilleux et al . Suggested that vat, but not sat, adipocyte hypertrophy is associated with an altered lipid profile independent of body composition and fat distribution in women . These differences may be determinant in the development of obesity and related disorders, with ir being the most important factor linking vat to cardiovascular risk; whereas in states of low ir the expression of most of the enzymes in the lipogenic and lipolytic pathways is greater in sat facilitating triglyceride / fatty acid cycling . However, the large interindividual variability observed in adipocyte size at a given adiposity level suggests that the tendency to fat cell hypertrophy in each fat compartment may differ among individuals . Although it may seem incongruent, strategies that increase the capacity of adipose tissue to store lipid and, therefore, make individuals more obese may in fact confer metabolic benefits . Allowing adipose tissue to store more lipids may prevent secondary metabolic complications caused by lipids being deposited in nonadipose organs . Thus, the ability of adipose tissue to expand and match the storage needs of energy surplus may be a key determinant in protection against the metabolic syndrome associated with obesity . It is therefore very important to understand the signaling factors that control adipose tissue expansion . The wnt family is known to control adipocyte differentiation, and several members of the wnt family have been shown to inhibit the early steps of adipogenesis . Conversely, endogenous inhibitors of wnt signaling were found to promote the generation of adipocytes . One group of these extracellular wnt antagonists is secreted frizzled - related proteins (sfrps, also known as secreted apoptosis - related proteins or sarps); at least five structurally similar sfrps have been identified . In obesity it has been observed that mrna levels of sfrp1 - 4, but not sfrp5, were altered; finding that sfrp1, sfrp2 and sfrp4 are adipokines and their expressions correlated with insulin sensitivity . However, it has been demonstrated that, in the setting of obesity, sfrp5 secretion by adipocytes exerts salutary effects on metabolic dysfunction by controlling inflammatory cells within adipose tissue . On the other hand, there is limited evidence to support a role for endogenous sfrp1 in the physiological and/or pathological development of human obesity and the metabolic syndrome . Accordingly, in collaboration with our team lagathu et al . Suggested a model of adipose tissue expansion characterized by upregulation of sfrp1 in the early stages of obesity . This elevation of sfrp1 could inhibit wnt signaling and, therefore, facilitate adipose tissue expansion, allowing nutrient storage demands to be met . Further weight gain results in sfrp1 levels falling back to the same values as lean subjects, and limiting adipogenesis through increased wnt/-catenin signaling, compromising further adipose tissue expansion (figure 3). Nevertheless, new factors have been discovered that induce adipogenesis, such as thyroid hormone responsive spot 14 (thrsp or s14), another specific factor whose gene expression and protein levels in lipogenic tissues are strongly linked to glucose thyroid hormone, insulin, and glucose and that is directly associated with adipogenesis in human adipocytes but inversely related to obesity and omental fat accumulation . The great revolution in the study of the adipose tissue, though, has been the isolation and characterization of an adipose tissue - derived multipotent stem cell population (ho - msc). This has opened up new possibilities, especially concerning the study of how this multipotent stem cell population resident in the adipose tissue is affected by, or contributes to, tissue dysfunction . Isakson et al . Observed that preadipocytes from obese individuals present a reduced adipogenic potential correlating with an increasing bmi, while cleveland - donovan et al . Observed alterations in the proliferative ability by impaired cell cycle activation . In accordance with these observations, we demonstrated an association between obesity and a loss of stemness in the ho - msc population, featured by impaired multilineage differentiation potential in the stem cell regulatory network . Ho - mscs from obese subjects have greater senescence and this senescence is increased as the degree of obesity rises . Thus, obese subjects have a lower differentiation capacity of their ho - msc to adipose and bone tissue . Several molecular pathways may explain the refractory response of ho - mscs of morbidly obese patients to differentiation . In summary, despite a potential genetic disposition to force the adipogenic cell fate by the upregulation of ppar, the combination of dysregulated genes (mainly members of notch and shh, foxa2 and foxc2; inhibitors of adipogenic differentiation) and mirnas (mirna23b and mir27b, which are ppar and cebp repressors and wnt activators, and mir103, mirna542 - 5p, and mirna320, involved in wnt dependent inhibition of adipogenesis, among others) may cause a block, inducing a failure to enter and/or progress to the adipogenic fate . Thus, ho - mscs from morbidly obese subjects have an impaired capacity to expand and differentiate to other features . This is reflected in the so - called adipose tissue expandability hypothesis, where the pathological expansion of abdominal adipose tissue in morbid obesity reaches a threshold characterized by an inability of adipose tissue to expand because its capacity to recruit new adipocytes is exhausted . This is associated with metabolic complications and ir due to ectopic deposition of excess lipid in nonadipose tissue . Apoptosis is a fundamental mechanism for the homeostasis of mammalian tissues and it has been linked to a variety of disorders . Apoptosis is a form of programmed cell death that occurs under certain physiological and pathological conditions as a common mechanism of cell replacement, tissue remodeling, and elimination of damaged cells . The dysregulation of this process has been suggested to contribute to obesity, differences in regional fat distribution, or lipodystrophy . Recently, a relationship between adipose tissue inflammation and apoptosis has been proposed [85, 86], although apoptosis of adipose tissue is still a relatively poorly studied phenomenon . Many proapoptotic and antiapoptotic molecules are mediated in apoptosis, achieving homeostasis of the mammalian tissues . Modulation of apoptosis is emerging as a promising antiobesity strategy because removal of adipocytes through this process will result in reducing body fat . Two of the main families involved in apoptosis are the caspases and b - cell lymphoma 2 (bcl2) proteins . Recently, we found an increase in proapoptotic casp3/7 gene expression and a decrease in antiapoptotic bcl2 gene expression in adipose tissue (both vat and sat) with the increase in body fat mass . Moreover, in vitro studies demonstrated that culture with proinflammatory factors from adipocytes increases the apoptotic pathway . These phenomena could be as a consequence of obesity - induced inflammation; thus we linked these results with a state of ir as these changes were paralleled by an increase in gene expression of inflammatory cytokines (tnf- and il-6) and macrophage infiltration markers . Many markers have been associated with apoptosis, mainly through inflammation, some with proapoptotic and others with antiapoptotic properties . A multifunctional proapoptotic cytokine belonging to the tnf superfamily, named tnf - like weak inducer of apoptosis (tweak), controls many cellular activities and has emerged as a new player in the inflammatory process . Tweak (and its receptor fn14) is upregulated in severe obesity, because of the modulation of the microenvironment by the infiltrated macrophages and not by hypoxia . In a recent collaboration, we found that a decrease in the soluble form of tweak in severely obese patients may favor the proinflammatory activity of tnf . The latest studies have shown that trail [tnf- (tumor necrosis factor-) related apoptosis - inducing ligand] ameliorates the natural history of diabetes mellitus, associating the changes induced by a significant reduction in proinflammatory cytokines with a modulation of adipose tissue gene expression and apoptosis . Thus, circulating trail levels may indicate the severity of t2d; low circulating levels may precede the onset of t2d whereas higher levels of soluble trail may indicate chronic t2d . Moreover, by binding to trail - r2, trail activates the cleavage of caspase-8 and caspase-3, which in turn cleaves and inactivates ppar. This causes changes in gene expression of lipogenic genes, such as glut4, fasn, and acc, and finally leads to the inhibition of insulin - stimulated glucose uptake and lipogenesis . This reduction in ppar also reduces adipocyte differentiation, consistent with the study of bernardi et al . Who attributed the improvement of metabolic abnormalities of t2d following trail treatment, with its effect on the adiposity, which might then have influenced proinflammatory cytokines levels and glucose metabolism . Adipose tissue is highly vascularized, and each adipocyte is nourished by an extensive capillary network . Thus, adipose tissue expansion is linked to the development of its vasculature . However, in hypertrophy, the increase in vascularization does not happen in parallel . Molecular mechanisms of switching in angiogenic phenotypes, in both healthy and pathological tissues, involve an imbalanced production of overlapping angiogenic factors and inhibitors . It has been documented that abnormalities of angiogenesis may contribute to the pathogenesis of diabetes complications . The vascular endothelial growth factor (vegf) and its receptors play a crucial role in both angiogenesis and vasculogenesis . Vegf has also been recognized as being a potent stimulator of endothelial proliferation and migration; moreover it has been noticed that its signaling is needed for an adequate adipose tissue function . White adipose tissue produces and secretes many different types of proangiogenic factors, such as vegf - a and vegf - b: the two key angiogenic factors produced by adipocytes . Other adipose - tissue derived factors with proangiogenic properties include vegf - c and vegf - d, which have been found to be important for the proper formation and maintenance of the lymphatic network . Overexpression of vegf resulted in increased blood vessels number and size in white and brown adipose tissues . In our laboratory, much interest has been generated after finding that morbidly obese subjects with low insulin resistance had higher adipose tissue vegf - a levels than obese subjects with high insulin resistance, hypothesizing that upregulation of vegf - a in adipose tissue could have a relationship with ir, believing that its upregulation is a compensatory mechanism that replaces the reduction in vegf - b, vegf - c, and vegf - d . Other complications derived from diabetes include dyslipidemia and atherosclerosis, and vegf has also been related with these disorders, with vegf - c rather than vegf - a being more closely related . The data presented in this paper, however, is only a little portion of the problem . Old trends tended to focus on one part, but now we know that everything is much more complex . In obesity, there is not a single cause, due to obesity is a part of a major problem, metabolic syndrome and moreover, other comorbidities as diabetes or cardiovascular diseases . And, for that reason, we must try to understand the problem as a complicated network in which all the pathways are related . In this work, we have focused on the pathologies associated with an adipose tissue failure from a molecular approach, but this is only a tiny part of the story . Thus, summing up, many are the genes that have been related to obesity and its comorbidities such as t2d . Pparg continues being the central actor of the scene, but the dysfunction of many others has been recognized as part / cause of the development of these diseases; some of them belong to the lipogenesis pathway (fasn, fabp4, and scd1) and others used to be associated with other roles (zag, rora1, rab18, and brca1), but now their roles in this dysfunction are emerging . But lipogenesis is not the only process involved; other crucial processes for the normal function of the adipose tissue are adipogenesis, apoptosis, and angiogenesis: necessary processes to help in the adipose tissue expansion in order to avoid future metabolic disturbances caused by the excess of fatty acids . Sfrp1 and spot14 are two genes influenced by the weight gain, involved in adipogenesis, and whose overexpression protects from metabolic disturbances . However, it has been noticed that morbidly obese patients have this process endangered in the same way that occurs with caspases and bcl2 proteins, or tweak and trail, concerning to apoptosis, or with the vegf family in the case of angiogenesis, which are also deregulated in morbidly obese patients and to the increase of fat . Therefore, although obesity has been mainly related to perturbations of the balance between food intake and energy expenditure, other factors must nevertheless be considered (figure 4). At present, many other hypotheses have been developed trying to explain the causes of the adipose tissue hypertrophy and hyperplasia . A hot topic, for example, is the relationship with the gut microbiota; nowadays there is a growing interest in elucidating how these microorganisms can help or aggravate the problem . Various mechanisms have been proposed to explain the influence of the microbiota on metabolic disorders, such as metabolic endotoxemia, modifications in the secretion of the incretins, and butyrate production . Metabolic endotoxemia is generated by the lipopolysaccharides (lps): endotoxins commonly found in the outer membrane of gram - negative bacteria . These lps are absorbed by enterocytes and they are conveyed into plasma coupled to chylomicrons, aggravating inflammation . In this way, dietary fats can be associated with an increase in the absorption of lps which is related to changes in the gut microbiota . Another recent theory is that hypoxia could be a new potential risk factor for the chronic inflammation in obesity . The hypoxia is able to induce inflammation in adipose tissue by induction of gene expression in adipocytes and macrophages . It is believed that local inflammation produced by hypoxia may serve as a physiological signal for angiogenesis, and remodeling of extracellular matrix in adipose tissue, although, when inflammation is out of control, it will promote insulin resistance locally and systemically . During obesity, the enlargement of the vascular network is not sufficient to supply enough oxygen to all adipocytes and local hypoxia occurs, and this hypoxia could be a key trigger of adipose tissue dysfunction . In obesity, hypoxia appears in clusters of adipocytes that become distant from the vasculature as adipose tissue expands . It has been established in mice with the deletion (vegf (ad)) that adipose vascular density is reduced and there is adipose hypoxia, while transgenic mice (vegf (adtg)) have increased adipose vasculature and reduced hypoxia, indicating the important role played by vegf in this phenomenon . Obesity increases the risk for t2d through induction of insulin resistance, and the link has been established with many factors such as inflammation, mitochondrial dysfunction, hyperinsulinemia, and lipotoxicity, but there is not a consensus about the mechanism of insulin resistance . Inflammation could be seen as the best candidate; however, inflammation is not a good target in the treatment of insulin resistance as it has been corroborated in some clinical trials . But as it can be noticed, none of the exposed theories can explain by themselves the complications in the metabolic disorders, and for that reason none of them has led to development of effective drugs and therapies . All the information must be taken into account together, trying to understand that each process interferes in the final status . A better understanding of the role of each of the parts of this orchestra will give us the capacity to understand the relationships and therefore the way and the level to act to obtain the best response.
Intestinal pseudo - obstruction (ipso) is defined as ineffective intestinal propulsion which occurs in the absence of mechanical or obstructive factors (1). Cases, in whom ipso is the primary clinical feature, are typically associated with connective tissue diseases . However, ipso presenting as the first manifestation in systemic lupus erythematosus (sle) is rare, and <30 cases of ipso in patients with sle have been reported (14). Clinical features generally include severe abdominal symptoms, such as distension, pain, nausea and vomiting, while radiographic signs show gaseous small bowel distension with air - fluid levels . Acute lupus pneumonitis (alp) is an uncommon pulmonary manifestation of sle, and lung involvement has only been reported in 3% of sle patients (5,6). Alp is an unusual but life threatening complication of sle, and usually presents with the acute onset of fever, cough, tachypnea and hypoxia . The radiological sign of alp is consolidations in one or more areas, and is often associated with pleural effusion and pulmonary arterial hypertension . The majority of alp responds to steroids and some requires treatment with cyclophosphamide; however, the rate of mortality remains high (5,7). Ipso and alp occurring in a single patient, described as co - manifestation with sle, has not been reported previously . Herein, we report a case in which ipso was the initial presentation of sle, and secondary onset of alp occurred after emergency surgery . A 26-year - old female, complaining of abdominal pain, nausea, vomiting and constipation for 1 day, was admitted to the emergency room of the second affiliated hospital of zhejiang university (hangzhou, china) in june 2013 . Physical examinations showed distress countenance, soft abdomen, absence of bowel sounds, abdominal tenderness but no rebound tenderness . 1a), white blood cell (wbc) count, hemoglobin (hgb), erythrocyte sedimentation rate (esr), c - reactive protein (crp) and urinalysis were normal . Computed tomography (ct) scanning showed that the jejunal wall was thickened and streaky (fig . The patient was thought to have strangulated intestinal obstruction, and an emergency laparotomy was performed . During the operation, ~80 cm of the jejunum showed hyperemia and edema, with multiple petechiae on the serosal surface, and lymph node enlargement in the mesentery . In addition, ~800 ml turbid peritoneal fluid was detected, but no bowel perforation . Peritoneal lavage, segmental resection of the diseased jejunum and placement of a jejunostomy fistula were performed . Pathological examination of the jejunum using hematoxylin (shanghai bioscience & technology co., ltd ., shanghai, china) and eosin (shanghai sss reagent co., ltd ., shanghai, china) (h&e) staining showed chronic inflammation of intestinal mucosa, with submucosal anapetia, congestion, hemorrhage and interstitial edema . Post - operatively, intestinal peristalsis did not recover, and a gastrointestinal decompression tube was placed in the duodenum . Apart from the bowel problem, sporadic rashes and mild fever without clear origin appeared . Following anti - infective treatment (ceftazidimine, 2.5 g intravenous injection, q.8.h; hainan haling chemipharma corporation, ltd ., haikou, china) and careful nursing with electrocardiograph monitoring (mp 30; philips medical systems b.v .) For 10 days, the patient demonstrated clinical improvement (abdominal pain was relieved, and the patient experienced no chills, nausea or vomiting, and vital signs were stable) and was discharged . After 5 days, the patient was readmitted due to high fever (39.2c), upper abdominal pain, nausea and vomiting, particularly after a fatty meal . Abdominal x - ray and ct scanning (the somatom sensation 16; siemens ag, munich, germany) revealed sporadic air - fluid levels and intestinal wall thickness (fig . 2). Anti - infective treatment (cefoperazone and sulbactam, both 1.5 g intravenous infection, q.12.h; pfizer, inc ., new york, ny, usa) was administered, but was ineffective . Multiple rashes on the lower extremities appeared on the fourth day, and laboratory examinations showed a rheumatoid factor of 20.4 iu / ml (increased), antinuclear antibody 1:320 (increased); esr 26.00 mm / h (increased); anti - ribonucleoprotein antibody + + + (strong), anti - smith antibody + + + (strong), anti sjogren's syndrome a antibody + + + (strong) and anti - sjogren's syndrome b antibody + (weak). Antibodies against double stranded - dna was not detected; complement (c3), 0.39 g / l (decreased); crp, 7.0 mg / l (normal); wbc, 2.510/l (decreased) and hgb, 89 g / l (decreased). Furthermore, the patient had experienced hair loss and multiple red rashes in response to strong sunlight the previous year . Sle and lupus - related ipso were then diagnosed according to american college of rheumatology criteria (1997) (8), and the systemic lupus erythematosus disease activity index (sledai) score was 10 (8). The patient was treated with 2 mg / kg / day methylprednisolone (pfizer, inc .) And her general condition improved after 2 days . However, the patient had sudden onset of fever (40.4c) and dyspnea, oxygen saturation (sao2) was 87%, and arterial blood gas analysis revealed a ph of 7.409, pco2, 33.6 mmhg and po2, 83.9 mmhg . Further laboratory examination showed: glutamic pyruvic transaminase, 436 u / l (increased); glutamic oxaloacetic transaminase, 740 u / l (increased); k, 3.36 mmol / l (decreased); and wbc, hgb, crp and urinalysis were normal . On chest ct, both lungs showed ground - glass appearance, with uneven density, interlobular septal thickening and bilateral hydrothorax (fig . Anti - infective treatment (imipenem and cilastatin, 0.5 g intravenous injection, q.8.h) was administered for 3 days; however, fever and dyspnea were not alleviated . A comprehensive infectious work - up (blood, sputum and urine cultures) was negative . A bronchoalveolar lavage (bal; olympus bx43; olympus corporation, tokyo, japan) examination from the affected areas was also negative for gram positive / negative bacteria, viral infections, fungal infections, acid fast bacilli or hemosiderin - laden macrophage . The erythematous rash was accentuated, and pathological biopsy results (using h&e staining) showed subcutaneous fibrous tissue hyperplasia with inflammatory cell infiltration (fig . 3c and d). Alp was finally diagnosed and high - dose (1 g / day) methylprednisolone + gamma globulin therapy was administered . After 3 days treatment, this therapy was followed by 2 mg / kg / day methylprednisolone as maintenance treatment, and glycyrrhizin (minophagen pharmaceutical co., ltd . Repeat chest ct scan showed significant improvement . During long - term tapering period or after stopping corticosteroids (methylprednisolone, pfizer, inc . ), the patient recovered well with no relapse detected . The present study presents a rare case in which ipso was the initial presentation of sle with secondary onset of alp after emergency surgery . To the best of our knowledge, there have been no previous reports of ipso and alp occurring in a single patient . Ipso is defined as the presence of clinical features suggesting intestinal obstruction, but without organic obstruction (9). As in the present case, the clinical manifestations of ipso include abdominal pain, nausea, vomiting, absence of bowel sounds and may include constipation and fever (4). An x - ray and ct scan frequently show air - fluid levels and thickening of the small and/or large intestinal wall . Ipso may be the first manifestation of sle in some patients; however, it usually represents a complication, with few case series described in the literature (1,2,10). Ipso is easily confused with mechanical intestinal obstruction and represents a diagnostic challenge for the surgeon . Ureterohydronephrosis is highly associated with ipso in sle (1,4,10), as repeated urinalysis examination results were negative, ureterohydronephrosis did not occur in this patient . The pathophysiology of ipso secondary to sle remains unclear (9), although the hypotheses have suggested dysmotility due to a primary myopathy or secondary to an immune complex mediated vasculitis (11). The pathological characteristics of the gastrointestinal tract in chronic intestinal pseudo - obstruction (cipo) patients include widespread myocyte necrosis, severe atrophy and fibrosis in the muscularis layer; active serositis with serosal thickening and fibrosis, with little or no evidence of vasculitis or injury (11,12). In the present aipo case, the pathological results of the jejunum showed muscle layer atrophy, with submucosal anapetia, congestion and hemorrhage . Therefore, the present case supports the hypothesis that the clinical features of aipo in sle patients appear to be the result of a primary intestinal smooth muscle myopathy, similar to that in cipo . Alp is an uncommon (112%) manifestation, but may be a life - threatening complication of sle (12). The clinical features of alp are characterized by acute onset of fever, cough, pleurisy and dyspnea . The key radiographic manifestation in the majority of cases is pulmonary infiltration, which appears on ct scan as ground - glass or honeycomb appearance (5,13). The diagnosis of alp is essential to exclude other causes of lung infiltration, particularly infective pneumonia (7). In the present case infective pneumonia was excluded, as a comprehensive infectious work - up was negative and anti - infective treatment was ineffective . Diffuse alveolar hemorrhage was excluded by the negative results of hemosiderin - laden macrophage in bal fluid . Alp was finally diagnosed by the syndrome of acute reversible hypoxemia, the abnormal results of ct scan, and the exclusion of other causes of lung infiltration . The pathophysiology of alp is based on an acute injury to the alveolar capillary units in pulmonary vasculature (7). Alp typically occurs during the active stage of sle, which may partially explain why mortality in alp is ~50% even when treated with large doses of steroids (14). Emergency surgery has been shown to be an independent risk factor for increasing the complication rate and morbidity of sle patients (15,16). In the present case, although the sledai score was 10, alp occurred, which may be explained by the emergency surgery performed for ipso . The trauma of abdominal operation enhances inflammatory function, which may have promoted the activity of autoimmunity in sle patients and eventually caused the occurrence of alp . The patient's clinical symptoms were ameliorated and the radiographic results showed improvement following high - dose methylprednisolone + gamma globulin supplement therapy for 3 days followed by 2 mg / kg methylprednisolone as maintenance treatment . In conclusion, we report the first case of alp and ipso co - existing in a patient with sle . It remains a challenge for the surgeon to establish the correct diagnosis and prevent inappropriate surgical intervention when ipso plays a role in the initial presentation of sle . Alp typically occurs during the active stage of sle, thus emergency surgery may increase the rate of this complication.
Military personnel face multiple stressors in their lives.1,2 studies have reported that stress occurs from risky assignments or missions,35 the demand for physical fitness, problems in interactions with peers and those of higher rank,6 sleep deprivation from shift work,7,8 deployment and separation from family,9 and additional noncombat work assignments such as disaster relief, peacekeeping, and other humanitarian actions.10 home - front problems with spouses and children also have an impact on the lives of military personnel.9,11,12 global defense budget cuts and the downsizing of military manpower increase the workload and stress of the few remaining military personnel.1315 the world health organization s (who) definition of health includes physical, mental and social aspects.16 quality of life (qol) in the context of individual cultural and subcultural systems is associated with personal goals, expectations, standards and values.17 the who has advocated for the goals of promotion of quality of life, preservation of function and well - being as well as prolongation of peoples lives.18 the who quality of life instrument (whoqol) and its brief version (whoqol - bref) are commonly used scales for use among general populations, as well as among disease - specific populations.19 the mental and physical health of military personnel may vary as a result of different administrative, characteristic, and political factors.20 the identification of stressors in military life, as well as the factors that influence health, would enable us to provide proper care for military personnel . Therefore, the relationship between quality of life (qol) and perceived health are crucial for the maintenance of the welfare of military personnel and troop strength . The aim of this study was to evaluate military personnel from select branches of ground forces in taiwan for their perceived health status and qol . Data were collected from basic military units and the taiwan ground forces units within 1 consecutive year through army, air force, and gendarmeries . There were no differences in ethnicity in this study; all of the participants were han chinese in taiwan . Inclusion criteria were: 1) membership in one of the military service branches in taiwan, including mandatory and voluntary entry; 2) the ability to read and write; and 3) agreement that participants personal information and test results could be used in this research . Personal characteristics of the participants included age, sex, rank, level of education, income, marital status, military service, and mandatory or voluntary enrollment . The packet also included the whoqol - bref, taiwan version, and the general health questionnaire-12 (chinese version) (chq)-12.16,24 smoking, alcohol consumption, personal medical conditions, and medical history were also recorded . Our research team sent out 1,200 questionnaires, of which 900 were returned and, of these, 720 could be used; this led to an effective response rate of 60% . The chq-12 was based on goldberg s general health questionnaire (ghq) and translated by cheng.16,21 the chq-12 reduced the number of questions from 60 to 12, and it has been used as a screening instrument for anxiety, depression, insomnia, fatigue, social functioning, and family relationships . Each question has four possible responses ranging from 0 (not at all), to 3 points (felt much more frequently than usual). Previous research revealed that the chq-12 had fair validity and reliability.16,2123 for intrinsic validity, cronbach s alpha coefficient was 0.9 in a community sample and 0.92 in hospital patients; sensitivities were 76% and 77%, respectively . The whoqol - bref, taiwan version was translated by yao et al,24 and it was determined to be both reliable and valid.24,25 the taiwan version added two questions about local culture in addition to the basic 26 questions . This instrument can be used to assess a subject s psychological, physical, social, and environmental conditions over the previous 4 weeks.25 internal consistency ranged from 0.700.77 for the four domains (physical, psychological, social, and environmental), and the test retest reliability reached 0.760.80 at the domain level . The discriminant validity effectively distinguished healthy from unhealthy people and accounted for 60% of the total qol.24 the packet contained part of a self - reported vas of mental health . The vas method is widely used to assess the status of a patient s pain or illness.26,27 it is a cost - effective way to evaluate a patient s health.28,29 the scores range from 0 (the worst) to 100 (the best), and they indicate subjective health over the previous 2 weeks and before the participants entered military service . Spss for windows version 21.0 (ibm corporation, armonk, ny, usa) was used for the statistical analysis . Descriptive results of continuous variables were expressed as mean standard deviation, and categorical variables were expressed as frequency (%). Group differences were determined by pearson s chi - square () and one - way analysis of variance . One - way analysis of variance was also used to analyze the differences in chq and qol between different ranks, levels of education, groups of mandatory or voluntary military services . Logistic regression was used to estimate odds ratios (ors) and 95% confidence intervals for the association between the demographic factors, four whoqol - bref domain scores, and psychological morbidity . Multiple regression analysis was used to identify significant variables associated with chq, qol, and vas of subjective health condition in the past 2 weeks . All statistical tests were two - tailed, and values of p<0.05 were considered statistically significant . Permission for the study was obtained from the institutional review boards of the tri - service general hospital and the national defense medical center . Data were collected from basic military units and the taiwan ground forces units within 1 consecutive year through army, air force, and gendarmeries . There were no differences in ethnicity in this study; all of the participants were han chinese in taiwan . Inclusion criteria were: 1) membership in one of the military service branches in taiwan, including mandatory and voluntary entry; 2) the ability to read and write; and 3) agreement that participants personal information and test results could be used in this research . Personal characteristics of the participants included age, sex, rank, level of education, income, marital status, military service, and mandatory or voluntary enrollment . The packet also included the whoqol - bref, taiwan version, and the general health questionnaire-12 (chinese version) (chq)-12.16,24 smoking, alcohol consumption, personal medical conditions, and medical history were also recorded . Our research team sent out 1,200 questionnaires, of which 900 were returned and, of these, 720 could be used; this led to an effective response rate of 60% . The chq-12 was based on goldberg s general health questionnaire (ghq) and translated by cheng.16,21 the chq-12 reduced the number of questions from 60 to 12, and it has been used as a screening instrument for anxiety, depression, insomnia, fatigue, social functioning, and family relationships . Each question has four possible responses ranging from 0 (not at all), to 3 points (felt much more frequently than usual). Previous research revealed that the chq-12 had fair validity and reliability.16,2123 for intrinsic validity, cronbach s alpha coefficient was 0.9 in a community sample and 0.92 in hospital patients; sensitivities were 76% and 77%, respectively . The whoqol - bref, taiwan version was translated by yao et al,24 and it was determined to be both reliable and valid.24,25 the taiwan version added two questions about local culture in addition to the basic 26 questions . This instrument can be used to assess a subject s psychological, physical, social, and environmental conditions over the previous 4 weeks.25 internal consistency ranged from 0.700.77 for the four domains (physical, psychological, social, and environmental), and the test retest reliability reached 0.760.80 at the domain level . The discriminant validity effectively distinguished healthy from unhealthy people and accounted for 60% of the total qol.24 the packet contained part of a self - reported vas of mental health . The vas method is widely used to assess the status of a patient s pain or illness.26,27 it is a cost - effective way to evaluate a patient s health.28,29 the scores range from 0 (the worst) to 100 (the best), and they indicate subjective health over the previous 2 weeks and before the participants entered military service . The chq-12 was based on goldberg s general health questionnaire (ghq) and translated by cheng.16,21 the chq-12 reduced the number of questions from 60 to 12, and it has been used as a screening instrument for anxiety, depression, insomnia, fatigue, social functioning, and family relationships . Each question has four possible responses ranging from 0 (not at all), to 3 points (felt much more frequently than usual). Previous research revealed that the chq-12 had fair validity and reliability.16,2123 for intrinsic validity, cronbach s alpha coefficient was 0.9 in a community sample and 0.92 in hospital patients; sensitivities were 76% and 77%, respectively . The whoqol - bref, taiwan version was translated by yao et al,24 and it was determined to be both reliable and valid.24,25 the taiwan version added two questions about local culture in addition to the basic 26 questions . This instrument can be used to assess a subject s psychological, physical, social, and environmental conditions over the previous 4 weeks.25 internal consistency ranged from 0.700.77 for the four domains (physical, psychological, social, and environmental), and the test retest reliability reached 0.760.80 at the domain level . The discriminant validity effectively distinguished healthy from unhealthy people and accounted for 60% of the total qol.24 the vas method is widely used to assess the status of a patient s pain or illness.26,27 it is a cost - effective way to evaluate a patient s health.28,29 the scores range from 0 (the worst) to 100 (the best), and they indicate subjective health over the previous 2 weeks and before the participants entered military service . Spss for windows version 21.0 (ibm corporation, armonk, ny, usa) was used for the statistical analysis . Descriptive results of continuous variables were expressed as mean standard deviation, and categorical variables were expressed as frequency (%). Group differences were determined by pearson s chi - square () and one - way analysis of variance . One - way analysis of variance was also used to analyze the differences in chq and qol between different ranks, levels of education, groups of mandatory or voluntary military services . Logistic regression was used to estimate odds ratios (ors) and 95% confidence intervals for the association between the demographic factors, four whoqol - bref domain scores, and psychological morbidity . Multiple regression analysis was used to identify significant variables associated with chq, qol, and vas of subjective health condition in the past 2 weeks . All statistical tests were two - tailed, and values of p<0.05 were considered statistically significant . Permission for the study was obtained from the institutional review boards of the tri - service general hospital and the national defense medical center . We collected 720 useable questionnaires from service members in the army (n=297; 41.3%), air force (n=59; 8.2%), gendarme (n=197; 27.4%), and other participants (n=167; 23.1%). We divided the collected data into three groups according to the subjects military rank: officers (n=162; 31.3%); noncommissioned officers (ncos) (n=104; 20.1%); and enlisted men (n=251; 48.5%). None of the enlisted subjects were female, and both the officer (146/14; 91.3%) and the nco (97/7; 93.3%) groups were predominantly male . The average age of the officers was 30 years, and they were older than the participants in the nco (25.3 years) and enlisted groups (23.7 years). The officer group had a higher level of education (15.2 years versus 14.3 years for ncos and 14.1 years for enlisted men). Most of the officers were volunteers (138/145; 95.4%), as were about half the ncos (50/104; 49%), but very few of the enlisted men were volunteers (13/215; 5.7%), though they were fulfilling their obligatory military duty . Officers had the longest time in service (11.1 years) compared to ncos (4.8 years) and enlisted men (1.5 years). The average monthly income of officers, ncos, and enlisted men were new taiwan dollars (ntd) 28,700 (us $956.70), ntd 25,600 (us $853.30), and ntd 16,100 (us $536.70), respectively . There were no significant differences in smoking or drinking alcohol in the three groups, as 34.8% of the officers had a history of smoking and 8.2% drank alcohol more than once per week . The percentages of a history of smoking and drinking alcohol for ncos and enlisted men were 37.9%/13%, and 35%/10.5%, respectively . There were 104 participants who reported that they had ongoing medical problems, including allergies (n=24), skin rash or itching (n=26), common cold symptoms (n=18), musculoskeletal discomfort (strain or sprain: n=55; self - reported herniated intervertebral disc: n=6; muscle pain: n=12), hepatitis b virus carrier (n=3), peptic ulcer (n=1), hypertension (n=2), and type 2 diabetes mellitus (n=1). The officers had a higher score on the vas of self - reported health (72.5) than did the ncos (67.7) or enlisted men (66.3) (p<0.001), but only for the previous 2 weeks . The vas score for self - reported health before they entered military service showed no significant differences in the three groups (officers: 74.6; ncos: 71.0; enlisted men: 72.0). The ncos and enlisted men felt their health had significantly worsened in recent times when compared to the time that passed before they became enlisted (the average number of years enlisted for officers, ncos, and enlisted men were 11.17.3 years, 4.85.7 years, and 1.52.4 years, respectively). As shown in table 1, officers had lower chq scores (9.62) than did ncos (11.07) and enlisted men (11.51). When we used a score of 9 as the cut - off point (set as the three - quarter cut - off point),22 and considered subjects reporting 10 or more points as unhealthy chq cases or as cases where there was psychological morbidity, the officers had a higher percentage of good health (57.4%) than did the ncos (38.5%) or enlisted men (42.2%). The officers also had higher total qol scores (83.98) than did ncos (80.64) or enlisted men (79.67). When comparing the four domains of the qol, officers still had significantly higher scores in each domain than did the enlisted men . Ncos had significantly lower scores than officers in the physical and environmental domains (table 1 and figure 1). The qol showed borderline differences in the different income statuses, but income had no significant influence after adjusting by regression . Items 1, 3, 4, 5, and 9 on the chq showed significant differences among the three groups . On item 1 (headache) and item 5 (poor sleep quality), ncos scores of 2.06 and 2.52, respectively, were higher than those of officers scores of 1.72 and 2.04, respectively . On item 4 (limb tremor or numbness) and item 5 (poor sleep quality), the enlisted men s scores of 1.62 and 2.48, respectively, were higher than those of officers scores of 1.43 and 2.04, respectively ., officers felt that they had better health (-value: 0.162; or: 0.542), as compared to the enlisted men . Other significant data showed that older personnel had better health (-value: 0.0033; or: 0.967), and smokers accounted for more psychological morbidity in higher chq scores (-value: 0.377; or: 1.458) (table 3). Vas scores for self - reported health also revealed significant differences between the chq cases and the non - chq cases . The participants experiencing one or more physical symptoms accounted for more chq cases (-value: 1.196; or: 27.609). The social and environmental domains on the qol were significantly associated with lower chq case rates (-values: 0.133 and 0.287; ors: 6.944 and 25.905) (table 3). For relationships between the qol domains, vas scores of self - reported health, and chq scores, we adjusted all the risk factors . As shown in table 4, only military rank and ongoing physical illness showed a significant relationship . In this cross - sectional study, the qol and chq scores, and their interactions, were analyzed in different military branches, ranks, and service types (voluntary or obligatory enlisted personnel). A total of 55.3% of all these subjects reported themselves as being unhealthy on the chq; this was higher than in the general population, as rates of 18%33% were reported in different samples.3034 among our subjects, the ncos and enlisted men rated themselves as having poor health (61.5% and 57.8%, respectively). This result was similar to that of a previous report in the uk.35 in previous studies, for military personnel either in training, combat, or peacekeeping missions, the ghq case rates were 19.5%48%, higher than those found in studies of general populations.3640 in one previous study performed in a military hospital,41 the ghq case rates were 22%32% for physicians, nurses, and other staff . This difference may reflect the different tools used and the different nature of stress for people who work for the hospital and for troops . In the present study, 55.3% of all the military subjects were chq cases; this rate was higher than the rates found in the militaries of other countries, and higher than that in our general population, or that found in other professions.33,41 among the different ranks, the chq case rate was 61% for ncos, and this rate was higher than that of the other two groups . The chq case rate for obligatory service members was 58.9%, and this was higher than that for volunteers (48.9%). In table 5, we have reviewed several previously selected studies conducted among different military and nonmilitary populations . In mobilized military personnel, the nature of military stress, rather than age or other demographic data (for example, combat - related deployments, peacekeeping or disaster relief actions, or outbreaks of infectious diseases),35,4147 is most likely to be related to psychological morbidity and poor quality of life . In the peace time contrarily41 and among the general population,48,49 age may play a role in contributing to psychological morbidity and poor qol in one study that was conducted from a military hospital, in two other studies conducted in the general population.41 in previous studies conducted among students,5052 which had a similar age distribution as that of the present study, the ghq rates varied from 29%52% and were higher in the female sex, among subjects experiencing stressful events, those with a basic level of training, those with academic problems, and family social economic status . However, these studies, including the present one, varied greatly in the number of participants, other demographic data, countries, and stress nature in the target population . Furthermore, the present study is a cross - sectional study; the associations between the demographic factors and psychological morbidity or qol are hard to compare with other studies . Some research has shown that the ghq was better at screening for minor psychiatric morbidity such as depression.53,54 in the military, psychological factors, as well as social and environmental problems could be risk factors for suicidal ideations.55 higher case rates require more attention . In a previous study,56 age may have been an independent risk factor for poor psychological health; however, in the present study, age was slightly negatively related to chq scores and, after adjustment by multiple regression analysis for rank, the influence of age on chq disappeared . The reason may be that those with higher ranks in the military are often older than ncos and enlisted men; however, among enlisted men, age still played a role, as most of the subjects rating themselves as healthy were older than those not rating themselves as such (= 0.160; p=0.013). This may reflect the fact that even mandatory personnel who have spent more time in the service can better adapt to the military environment and life . On the other hand, younger soldiers, especially those who were subject to obligatory military enlistment, faced more challenges in adaptation than did the veterans . It is important to help these individuals adapt faster . In previous studies,22,57 people with more education may have a greater ability to express their emotions, and they received higher scores on health questionnaires . In our data, however, the chq was inversely related to higher rank, which represents older age and greater levels of education . The vas of self - reported health a subjective and overall scale for health status was lower in ncos and enlisted men and higher in officers . This suggested that officers with higher rank and more time spent in the military (an average of 13 years) had better subjective health . Although this was not specific to individual domains, this overall finding was similar to the results found for the chq . The vas showed a significant difference between chq cases and non - chq cases, with a disparity of up to 10 points . When multiple regression analysis was used to adjust the risk factors for vas, rank and illness were independent risk factors . Previous studies revealed that vas was a useful tool for quantifying qol,58 and the vas correlated with ghq across specific diseases.59 the present study may suggest that vas could be used as a quick screening tool for mental health, which is suitable for certain emergent stressful missions such as disaster rescue, although more studies are needed . In the analysis of the subitems on the chq, ncos had more headaches and sleep problems than did officers, and the enlisted men had more limb numbness and sleep problems than did officers . This may reflect the frequent shift work due to some security duty and heavy demands of military services loaded on the ncos and enlisted persons . Further study of sleep in military personnel and its relation to mood and health status should be considered . In each domain of qol, officers had better scores than did enlisted men in terms of general qol, physical symptoms (concentration, daily energy levels, physical pain, sleep), sex life, appearance, leisure activities, capacity for work, money, respect (a chq question), and food (a chq question). The whoqol scores may have a negative association with the presence and severity of psychopathology.60,61 in our research, we also found that military personnel who had lower social and environmental domain scores on the whoqol had higher chq case rates . This may indicate an area for future investigation and a way to improve the status of military personnel . First, there were very few female subjects, and the sex - related differences could not be studied well in such a military environment . Given that so many participants did not provide marital status data, it became more difficult to analyze this potential confounder . Although our questionnaire return rate was 60%, there were many units that were unwilling to receive it . We do plan to conduct further qualitative research in this area with sleep or depression instruments such as the pittsburgh sleep quality index62 and the beck depression inventory63 to render the data more complete . Finally, this is a cross - sectional study; the relationship between demographic factors and qol is hard to determine and needs further longitudinal studies . Some analyses could only be compared with those of previous studies, but not exactly under the same demographic data . In addition to the combat readiness of our forces, disaster relief is now an important task . Our military personnel have statistically higher chq case rates than do members of the general population, and the average case rates of other countries military personnel are lower than those noted in our study . Whether there is a higher risk for post - traumatic stress disorder or other mental illnesses when executing rescue or disaster missions is of serious concern . In addition, it is worth noting that rank is an independent factor that affects the mental health of military personnel and their qol . We should pay more attention to our military personnel s mental health, as well as to their physical health . The vas of self - reported health might be a useful tool for screening military mental health . It could be used in a war situation or during emergency mobilization, and it takes less time than administering a more comprehensive survey.
The amateur wrestling community and maybe the entire sports community across the world were shocked by the deaths of 3 college wresters in the usa in six weeks in 1997 . The deaths of the athletes were attributed by autopsy to weight - loss performed in a short time the victims having undergone dehydration of up to 15%1 . Following these deaths in 1997, the national collegiate athletic association (ncaa) initiated and developed new safety precautions in order to prevent unsafe weight practices2 . After studies of this subject, ncaa decided that competition - weighing should be conducted nearer to the competitions and new weight classes should be determined by adding nearly + 3 kg to each weight class3 . Besides, ncaa recommended that weekly weight - loss should not exceed 1.5% of body weight as a part of the wrestling weight certification (wwc) program4 . However, the most important reason why athletes lose weight is that they want to compete in the lowest weight - class possible, and they think that the time between weighing and competition (~16 hours) is sufficient for rehydration after dehydration5 . Nevertheless, studies report that this time period of ~16 hours is not enough to regain the body - weight lost6 and dehydration decreases athletes performances, too7 . It was reported that when athletes of particularly combat sports such as judo, karate, boxing and wrestling perform excessively severe dehydration in a short time (17 days), they undergo some hematologic changes8, 9 . There would be changes not only in posm levels, but also in na, bun and glucose levels due to posm10, 11 . It was reported that athletes who perform weight - loss before competitions undergo not only change their hydration status, but also experience health problems such as sleep disorders, learning and memory difficulties, anxiety, depression, irregular body temperature, vasoconstriction, low sexual performance and dysfunctions in skeletal muscles12 . Skeletal muscle damage can be hematologically detected by analyzing serum levels of ck, and such indicators as ldh, ast and alt enzymes in the cells of many tissues13 . The most important indicator of skeletal muscle damage is serum ck level, because ck in skeletal muscle tissues is the enzyme that exists in higher amounts in the sarcolemma and mitochondrial cells of healthy muscle cells, and is primarily responsible for regulating anaerobic metabolism14 . Observing serum ck and ldh levels may provide useful information about the status of the muscles and their adaptation to physical load because serum ck and ldh levels demonstrate the degree of metabolic adaptation of skeletal muscles to physical exercise . These values increase considerably after intense exercise15 . In physical tissue damage and other inflammatory conditions, c - rp is the main acute phase protein and a very sensitive and objective indicator16, 17 . Indeed, abramson and vaccarino reported that the c - rp level increased after one exercise dependent on the duration and intensity of the exercise18 . On the other hand, booth et al . Reported that c - rp, which was one of the indicators studied in a 12-day military exercise, was 5.005.9 it was also reported that the serum c - rp level of athletes increased with one exercise protocol20, but in prospective studies; that the serum c - rp level of the athletes decreased21 . There are studies in literature of dehydration, skeletal muscle damage and inflammation among elite wrestlers22,23,24 . However, no study has been conducted to determine whether skeletal muscle damage or inflammation occur with dehydration . Accordingly, the present study aimed to identify weight - loss and hydration levels before competitions among elite wrestlers and explore skeletal muscle damage and inflammation levels after dehydration . Trainers and athletes will benefit from information on skeletal muscle damage and inflammation levels caused by dehydration . The study subjects were 72 volunteer elite wrestlers who competed in the turkish inter - university wrestling championship a division, who had at least 5 years sport experience and did at least one exercise on a daily basis . The participant athletes were asked not to use any kinds of medicine or ergogenic aids within 48 hours before competition - weighing in order to ensure standardization of the subjects and those who used medicines or ergogenic aids were excluded from the study . During the study period, no disease that could affect the blood values of the athletes was detected, but three athletes were excluded from the study because their ck levels were above 1,000 u / l (hyper - responder) and their values were considered as lost data . The study was completed with 69 elite wrestlers (22.512.49 years, 174.546.59 cm, 78.9815.87 kg and bmi 25.733.77 the details of dehydration protocols (how long, between which time - periods, with what methods the elite wrestlers achieved weight - loss) were datails of dehydration protocols . Wrestlers reported that they lost weight 17 days before competitions through food and fluid restrictions, sauna and exhausting exercises . In the literature, euhydration is accepted to have a reference range of 280290 mosm / l . Thus, wrestlers with posm 290 were assigned to the dehydrated group and those with posm> 290 to the not dehydrated group25 . Dehydration was calculated using the formula below: posm = (2 * na)+(bun/2.8)+(glucose/18)26 . Determined 1% of dehydration as satisfactory dehydration,> 13% of dehydration as mild dehydration,> 35% of dehydration as high dehydration, and> 5% of dehydration as severe dehydration27 . The percentage of body weight - loss (pbwl) calculation was performed using the formula below: body weight change=[(pre - body weight post - body weight)/pre - body weight] 100 . With the help of specialists, 5 cc of blood was drawn from the forearm veins of the participant wrestlers into 8.5 ml tubes of a vacuatiner blood collection system at the competition place and at the weighing time (one day before the competition, between 06:00 and 06:30 pm) and transported to the laboratory for centrifugation . The blood samples were centrifuged with a nve nf-400 for 5 minutes at 4,000 rpm . For each athlete, serums extracted from blood was preserved in two different eppendorf tubes under 20 c until the time of analysis . On the day of the analysis biochemical analyses [hydration indicators (na, bun, glucose) and analyses of skeletal muscle damage indicators (ast, alt, ldh, ck)] were performed using a beckman coulter au2700 plus biochemical auto - analyzer with beckman coulter kits, while hormone analyses were roche hitachi cobas e601 auto - analyzer with roche kits . C - rp analyses were performed using a beckman coulter immage 800 nephelometer autoanalyzer with roche kits . The independent samples t test was used to compare pairwise group variables that followed a normal distribution, and anova was used for more than two groups . Following variance analyses; lsd multiple comparison test was employed in order to detect which measurement results caused the differences . The responses to the questionnaire show that 55.07% of the elite wrestlers underwent fast weight - loss just before the competition (17 days) (4.55%1.87). The wrestlers who underwent fast weight - loss had higher levels of posm (296.053.14) above the upper limit of reference value (over 290) and suffered from dehydration . When intergroup hydration indicators were assessed, it was found that the na, bun and pbwl levels of the wrestlers who were dehydrated were higher than those of the wrestlers who were not dehydrated (p<0.05), but no differences existed between the groups in terms of glucose levels (p>0.05; table 1table 1.comparison of hydration indicators of wrestlers in terms of hydration statusnhydration statusreference range na (mmol / l)31dehydrated136146142.51.6**38not dehydrated137.52.7bun (mg / dl)31dehydrated82016.43.4 * 38not dehydrated14.33.6glucose (mg / dl)31dehydrated7410697.015.838not dehydrated97.112.5posm (mosm / l)31dehydrated280290296.13.1**38not dehydrated285.35.2pbwl (%) 31dehydrated-4.61.9**38not dehydrated1.01.3*p<0.05, * * p<0.01,: mean,: standard deviation, na: sodium, bun: blood urea nitrogen, posm: plasma osmolarity, pbwl: percentage of body weight loss). * p<0.05, * * p<0.01,: mean,: standard deviation, na: sodium, bun: blood urea nitrogen, posm: plasma osmolarity, pbwl: percentage of body weight loss when skeletal muscle damage and inflammation differences of the elite wrestlers were examined in relation to hydration status, differences in ast, ldh and ck levels (p<0.05) were found, whereas no differences existed between the groups in terms of alt and c - rp levels (p>0.05). Although there were differences between the groups in terms of ast (upper limit: 50 u / l) and ldh (upper limit: 248 u / l) values, these values were within the reference ranges . However, ck levels (upper limit: 171 u / l) of both groups were higher than the reference range (table 2table 2.comparison of skeletal muscle damage and inflammation indicators of the wrestlers in terms of posm levelsnposm (mosm / l)reference range ast (u / l)31dehydrated05024.96.3 * 38not dehydrated21.54.5alt (u / l)31dehydrated05014.29.038not dehydrated14.07.3ldh (u / l)31dehydrated0248207.237.2 * 38not dehydrated185.827.6ck (u / l)31dehydrated0171421.0174.0**38not dehydrated175.880.7c - rp (mg / dl)31dehydrated00.60.30.338not dehydrated0.30.3*p<0.05, * * p<0.01, ast: aspartate aminotransferase, alt: alanine aminotransferase, ldh: lactate dehydrogenase, ck: creatine kinase, c - rp: c - reactive protein, posm: plasma osmolarity). * p<0.05, * * p<0.01, ast: aspartate aminotransferase, alt: alanine aminotransferase, ldh: lactate dehydrogenase, ck: creatine kinase, c - rp: c - reactive protein, posm: plasma osmolarity according to the classification made by casa et al . When investigating skeletal muscle damage and inflammation indicators of the athletes . There were differences between the groups in terms of ast, ldh, and ck levels (p<0.05), but there were no differences between the groups in terms of alt and c - rp levels (p>0.05; table 3table 3.comparison of skeletal muscle damage and inflammation indicators of the wrestlers in terms of pbwl classificationnpbwl (%) classification ast (u / l)22% 0122.04.318%> 1319.95.019%> 3525.65.510%> 526.35.6alt (u / l)22% 0113.65.918%> 1314.17.619%> 3515.311.910%> 513.13.2ldh (u / l)22% 01182.624.118%> 13188.038.619%> 35203.225.810%> 5222.241.1ck (u / l)22% 01191.689.618%> 13214.4125.119%> 35364.5170.810%> 5472.9226.3c - rp ast: aspartate aminotransferase, alt: alanine aminotransferase, ldh: lactate dehydrogenase, ck: creatine kinase, c - rp: c - reactive protein, pbwl: percentage of body weight loss). Represents the differences among the groups . Ast: aspartate aminotransferase, alt: alanine aminotransferase, ldh: lactate dehydrogenase, ck: creatine kinase, c - rp: c - reactive protein, pbwl: percentage of body weight loss generally, many athletes perform fast weight - loss just before competitions (within 17 days) so that they can adapt themselves to different weight classes or compete against rivals who are less strong and weaker than them in order to gain advantage . Weight loss results in dehydration among the athletes by affecting their hydration levels negatively . Studies of dehydration report that dehydration can be detected with urine specific gravity (usg) as well as serum posm2, 28 . When the posm value is 290, hydration is considered normal (euhydration), when it is> 290, hydration is lower than the normal level (dehydration)25 . In the present study, 55.07% of the elite wrestlers underwent fast weight - loss just before the competition (17 days) (table 1). The level of posm of the wrestlers who underwent fast weight - loss was above the reference range (upper limit: 290) (296.053.14) and they suffered dehydration of 4.55% . These results of posm level of the wrestlers were similar to the results of usg29, 30 . Serum na and bun levels were higher among the dehydrated wrestlers due to the increase in posm, but no differences were seen in their glucose values (table 1). In the literature mmol / l . When the na concentration in a blood sample is 135 mmol / l it is defined as hyponatremia, and when it is 145, it is defined as hypernatremia31 . It has been reported that the na+ concentration generally remains high due to long - term physical activities and excessive sweating and deficiency in all body fluids, and that na gradually increases with time32, 33 . It has been recommended that during exercises, athletes should keep serum na concentration within the reference range through a controlled diet34, otherwise nervousness, over - reaction, lethargy, muscle contraction, spasticity, convulsions, coma and even mortality may occur . It is our opinion that the differences in bun values resulted from the fact that wrestlers did long - term exhausting exercises and/or adhered to food and fluid restriction programs for dehydration . Since bun is closely associated with the metabolic functions of the liver, and the filtrating and excreting functions of the kidneys, dehydration may increase35 . Indeed, the study of mashiko et al . Reported that according to measurements before and after a 20 day camp, rugby players lost weight and as a result their bun levels decreased owing to weight loss36 . The fact that there were no differences in the glucose values of the dehydrated wrestlers made us think that adrenaline increased by exercises converts glycogens stored in liver into glucose and glucose flows into blood with the help of glucagons and, as a result, regulates blood glucose levels . Differences in na and bun values affect posm values of the athletes and change their hydration status . It is stated that dehydration of 23% causes cognitive disorders, irregular body temperature, cardiovascular dysfunctions as well as reduced endurance and weakens muscle strength37,38,39 . There were significant differences in terms of the damage to skeletal muscles between the dehydrated wrestlers and not dehydrated wrestlers . The differences between the hydration levels and the skeletal muscle damage was determined according to the classification of casa et al ., and in our study it was noted that there were significant differences in ast, ldh and ck, but no differences were found in alt values (tables 2 and 3) between the two groups . In the study of nathwaniet et al ., it was reported that serum levels of ck, ldh, ast, alt increased following muscle damage13 . Under normal conditions, these elevated levels may be tolerated by the athletes with nutritional and relaxation programs, but among the dehydrated athletes, metabolism consumes low levels of carbohydrate due to food and fluid restrictions and uses an energy combination of fat and proteins; thus, glucose inhibition occurring with high plasma and free fat acids suggest that the damage to the muscles of the wrestlers would continue40, 41 . In clinical practice, ck, ldh, ast, alt were commonly used for the diagnosis of skeletal muscle diseases and skeletal muscle tissue damage42 . The ldh level is accepted to be a specific indicator of fatigue44, 45 . Ast, being a cytoplasmic and mitochondrial enzyme, may increase in many clinical disorders, but alt has been reported to be a specific indicator of liver damage13 . In our study, serum ck and ldh levels, important damage indicators, were higher in the dehydrated group than in the not dehydrated group . Among the dehydrated wrestlers, the high level of serum ck would have affected their performance negatively as well as restricted their movements because of muscle pains . It is also possible that the high level of serum ldh may cause wrestlers to be reluctant and/or unwilling for the next exercise . When aminotransferases were investigated, levels of ast and alt were increased . However, while there was a significant difference in ast levels, no significant difference was seen in alt level, which demonstrates that ast exists in higher amounts in skeletal muscles than alt . Serum levels of all these damage indicators reduced after exercises and correlated with relaxation and feeding after exercises46 . All of the participant wrestlers reported that they did daily exercises and training . Therefore; it is our opinion that the high level of skeletal muscle damage among the dehydrated wrestlers was caused by food and fluid restriction following exercises . C - rp is a major acute phase reactant that increases acutely and quickly in response to tissue damage and infection47 . In a systematic study of c - rp, it was found that as an acute phase response, c - rp temporally increased after a single exercise protocol among trained athletes . However, in prospective studies, it was demonstrated that c - rp (pretest - posttest) levels of the exercise groups reduced . In other words: although physical activity increased c - rp levels, chronic physical exercises reduced c - rp levels48 . C - rp levels of the participant athletes of both groups were low and no difference existed between the groups . Considering the fact that these athletes had a sportive experience of at least five years, it was expected that they would have increased tissue oxygenation because of having regularly exercised for years . Uww (united world wrestling) shortened the resting - time in competitions of the wrestling championships, aiming at muscle endurance among the wrestlers . In a wrestling tournament, the qualifications, semi - finals and even finals, time between bouts will be short, and resting - time not be sufficient for full recovery, lowering the performance of wrestlers who lose weight . Fast and/or higher levels of weight loss before a competition produced differences in wrestlers hydration indicator levels . Damage in skeletal muscles of the dehydrated wrestlers was greater than in those hydrated, but no difference was found in the inflammation levels of the groups . If it is necessary to lose weight before a competition, athletes should do it in a way to achieve a gradual and extended weight loss over a period of time depending on the weight loss targeted . In addition, while athletes are losing weight, they should keep levels of hydration and skeletal muscle damage indicators within their reference ranges through ergogenic aids . Thus, ergogenic aids will play a mediator role for wrestlers wishing to demonstrate maximum performance and to lead a healthy life.
Primary spinal cord tumors represent 4.5% of all cns neoplasms and the most common tumor type is meningioma (24.4%) (1). Spinal meningiomas are more common in elderly patients, mean age varying from 56 up to 66 years in different studies (3 - 6); in sandalcioglu et al.s study, the age range was 17 to 88 years in a review of 131 patients (3). Spinal meningiomas are slow growing tumors and therefore, they lead to symptoms only when they reach a considerable size to compress the spinal cord, causing local pain; however, in a significant number of patients, the diagnosis is not confirmed until neurologic deficits or gait disturbances become evident (3). Intraspinal meningiomas are most commonly located in thoracic region, followed by cervical and lumbar areas (7 - 9). There are only few reports in the literature describing postoperative outcome of spinal meningiomas (10 - 14). In addition, little is known about the different prognostic factors influencing recovery, especially the influence of histopathologic subtype (11). This study is carried out to evaluate the effect of some of these factors specially the effect of histopathologic subtype on the postoperative outcome . All patients with spinal meningioma referred to shohada hospital, tehran, iran for surgical resection of spinal meningioma between october 1998 and january 2012 were included in this study . The patients records including age, sex, address, history, radiologic data, operative notes, tumor location and pathology reports were registered retrospectively . The results of 8 - 120 months post - operative follow up were then classified according to frankel classification (table 1). All patients had plain x - rays and ct - scan of spine and only 14 (36%) had mri for localization of tumor . Three pathologists studied histologic slides independently and diagnoses were made according to who 2007 criteria . Statistical analyses were performed using spss software version 11.0 . Using t - test and fisher s exact test, we compared the results . A total number of 39 patients with spinal meningioma were referred to shohada hospital and underwent neurosurgical resection . Twenty - five were women (64%) and 14 were men (36%). Histological classification according to who criteria was as follows: 34 cases (87%) were who grade i, from which 15 cases (38%) were psammomatous, 7 cases (18%) were meningothelial, 9 cases (23%) were transitional and 3 cases (8%) were fibroblastic . Five patients (13%) were grade ii, 3 of which (7.5%) had clear cell appearance and the remaining 2 (5.5%) had chordoid appearance (figures 1 and 2). A, meningothelial; b, fibroblastic; c, chordoid; d, psammomatous . There was no significant difference in preoperative neurologic signs according to frankel classification between different histological subtypes . Table 2 shows the summary of pre- and post - operative neurologic deficits in 39 patients with spinal meningiomas . Seventy - nine percent of patients had grade d and e, 19% grade c and 2% had grade b. postoperatively 82% improved or not changed and 18% worsened . One patient with psammomatous cervical meningioma with frankel grade c had severe grade b signs after surgery . Following surgery, pain was relieved in all patients; bladder dysfunction (in one case) was cured . Paresthesia remained only in one out of ten patients . From 8 patients who were unable to walk (group b or c), five cases remained at the same status (group b or c) postoperatively from which two cases were psammomatous and three cases were who grade ii meningioma . When comparing surgical outcome between different histologic subtypes, we observed that 6 out of 15 patients with psammomatous meningioma (40%) had worsened results or persistent functional deficit of grade c or worse . All of five cases of who grade ii meningioma worsened after surgery or remained unchanged in grade c. these are significantly different from remaining 19 cases of who grade i meningioma (non - psammomatous), all of which (100%) showed improved results or not changed post - operatively, remaining in grade d or e (p = 0.003 and p <001) (tables 3 and 4). Good outcome means frankel grades d and e; poor outcome means group b and c. the mean age of patients with good postoperative outcome was 51.8 while the mean age of patients with poor outcome was 51.5, so the age does not affect the outcome (p = 0.34). Seven out of 11 patients with poor outcome (63.6%) and 18 of 28 patients with good outcome (64%) were women: sex had no significant influence on the outcome (p = 0.99). Cervical location of tumor was seen in 5 out of 11 patients with poor outcome (45.5%) and in 3 out of 28 patients with good outcome (10.7%): cervical location had significant influence on the outcome (p = 0.027). The mean tumor size was 2.7 cm in greatest dimension in patients with poor outcome and 2.6 cm in cases of good outcome (p = 0.40). Five of the poor - outcome cases have been reported to have adhesion during surgery and incomplete removal (45%), while two of the others have this condition (7%) (p = 0.012). Meningiomas are primary tumors of spines, arisen from the arachnoid cap cells of the meninges; they constitute about 1.2% of all cns meningiomas (3). In our study, spinal meningiomas constitute 7.7% of cns meningiomas; this could be due to the fact that shohada hospital is a referral center for difficult cases of spinal tumor surgery . Psammomatous subtype and grade ii cases had poor postoperative outcome while the other subtypes of who grade i had good outcome in our study . In schaller study (11), psammomatous subtype had a less favorable outcome compared with other subtypes; in roux et al . Study (6), histological subtype did not seem to have any influence on the postoperative outcome . (6), klekamp and samii (5), haegelen et al . (4) and sandalcioglu et al . (3) all revealed significantly higher incidence of meningioma in women as in our study that revealed a female to male ratio of 1.8 to 1 . In the study of roux et al . (6), as in our study sex had no influence on the prognosis . The average age of patients varies between 56 and 66 in studies of roux et al . (6) and haegelen et al . (4) respectively; in our study the average age was 51.6 and prognosis was not influenced by increasing age . In schaller study age less than 60 years was correlated with a good outcome (11). In sandalcioglu study (3) elderly patients proved to harbor an increased risk for surgical morbidity . In our study cervical location of the tumor was related with poor outcome in our study; in schaller study (11), tumor location below c4 seemed to be correlated with a good outcome; in other studies (3, 6, 10, 12) no correlation was found . Incomplete removal of the tumor was seen in about half of the cases with poor outcome and 7% of the other group . Since 80% of the incompletely removed tumors of the first group are of psammomatous subtype, it seems that incomplete removal of the tumor may be the reason of poor outcome in psammomatous subtype in comparison with other subtypes of who grade i, although further studies with larger sample size are needed to confirm this result . Spinal meningioma of who grade i with psammomatous subtype are associated with less favorable postoperative neurologic outcome than other subtypes, with results closer to cases of who grade ii . Incomplete resection of spinal meningioma occurs more frequently in psammomatous subtype and cases of who grade ii and trying to complete resection may cause additional neurological damage . Cervical location is another factor that seems to have a negative correlation with a good outcome . Psammomatous subtype and grade ii cases had poor postoperative outcome while the other subtypes of who grade i had good outcome in our study . In schaller study (11), psammomatous subtype had a less favorable outcome compared with other subtypes; in roux et al . Study (6), histological subtype did not seem to have any influence on the postoperative outcome . (6), klekamp and samii (5), haegelen et al . (4) and sandalcioglu et al . (3) all revealed significantly higher incidence of meningioma in women as in our study that revealed a female to male ratio of 1.8 to 1 . In the study of roux et al . (6), as in our study sex had no influence on the prognosis . The average age of patients varies between 56 and 66 in studies of roux et al . (6) and haegelen et al . (4) respectively; in our study the average age was 51.6 and prognosis was not influenced by increasing age . In schaller study age less than 60 years was correlated with a good outcome (11). In sandalcioglu study (3) elderly patients proved to harbor an increased risk for surgical morbidity . In our study the patients age had no influence on the post - operative outcome . Cervical location of the tumor was related with poor outcome in our study; in schaller study (11), tumor location below c4 seemed to be correlated with a good outcome; in other studies (3, 6, 10, 12) no correlation was found . Incomplete removal of the tumor was seen in about half of the cases with poor outcome and 7% of the other group . Since 80% of the incompletely removed tumors of the first group are of psammomatous subtype, it seems that incomplete removal of the tumor may be the reason of poor outcome in psammomatous subtype in comparison with other subtypes of who grade i, although further studies with larger sample size are needed to confirm this result . Spinal meningioma of who grade i with psammomatous subtype are associated with less favorable postoperative neurologic outcome than other subtypes, with results closer to cases of who grade ii . Incomplete resection of spinal meningioma occurs more frequently in psammomatous subtype and cases of who grade ii and trying to complete resection may cause additional neurological damage . Cervical location is another factor that seems to have a negative correlation with a good outcome.
Cystic fibrosis (cf) is a fatal disorder characterized by chronic and progressive lung disease that determines morbidity and mortality of these patients . Airways of cf patients show a chronic nonresolving neutrophilic inflammation, which increases upon infection and disease progression . Neutrophil products, such as elastase, chitinase - like proteins and chemokines, have been identified as important risk factors of lung damage and lung function decline and are suggested as biomarkers based on both cross - sectional and longitudinal studies in patients with cf [27] and mice with cf - like lung disease . Previous studies also provided evidence that free extracellular dna is highly increased in cf airway specimen, initially referred to as dna derived from necrotic cells . However, several studies have now established that cf airway secretions contain meshwork structures reminiscent of nets [1014]. Traditionally, neutrophils have been known to combat pathogens intracellularly by phagocytosis, a paradigm that was extended and challenged by the finding that neutrophils can immobilize and kill pathogens extracellularly through net formation (netosis) [15, 16]. These released nets consist of a nuclear dna backbone equipped with characteristic granule and cytoplasmic proteins . While netosis has been initially described as a novel form of cell death, recent studies demonstrated that also living neutrophils, eosinophils, and basophils can form extracellular traps (ets) by expelling their mitochondrial dna [1823]. Viable / nonlytic rapid net formation has been further found in response to staphylococcus aureus infection, where phagocytosis, chemotaxis, and net formation worked in a collaborative manner [24, 25]. In this study, we investigated cf airway inflammation with a focus on the abundance of free dna structures characteristic for nets in different airway specimen (sputum and bal) obtained from patients with cf and enac - transgenic (enac - tg) mice with cf - like lung disease [2628] and correlated dna levels with proinflammatory cxc chemokines, characteristic cf pathogens, and measurements of lung function . Our results demonstrate that free airway dna levels correlate with obstructive lung disease and proinflammatory chemokines in cf patients and cf mice and could serve as therapeutic target and potential biomarker in cf lung disease . Nets were visualized and characterized by staining of extracellular dna, citrullinated histones, myeloperoxidase, or elastase . The quantification of free dna was performed using the quant - it picogreen assay (molecular probes, inc ., eugene, or, usa) based on a green fluorescent dye that binds dna . For clsm, samples were collected with poly - d - lysine - precoated cover slides placed on freshly harvested human sputum and were left in place for 510 min in order to adhere . The cover slides were washed in pbs at ph 7.4 and transferred into a fixative of 4% paraformaldehyde for 2 hours . The fixed samples were washed with pbs, permeabilized (0.5% triton x-100 in pbs), and blocked (10% normal goat serum, 10 mm glycine in diluent containing 0.5% bovine serum albumin, 0.5% normal goat serum, and 0.5% triton x-100 in pbs). For visualisation of citrullinated histones, the samples were incubated with the rabbit anti - human citrullinated histone h3 antibody (ab77164, abcam, cambridge, uk). This antibody was detected in clsm by means of a secondary anti - rabbit fitc antibody (ab6717, abcam, cambridge, uk). For visualisation of neutrophil elastase or myeloperoxidase, the samples were incubated with rabbit antineutrophil elastase (ab21595, abcam, cambridge, uk) or mouse antimyeloperoxidase (ab25989, abcam, cambridge, uk) antibodies . Negative controls were initially incubated in 500 u / ml dnase (dnase i recombinant, grade i, roche diagnostics gmbh, vienna, austria) for 20 min at room temperature (rt) and then stopped with 50 mm edta in excess and thereafter treated as mentioned above . The specimens were analysed with a clsm (zeiss lsm 510 meta uv, carl zeiss gmbh, vienna, austria). Relative fluorescence was quantified using zeiss lsm software application . For scanning electron microscopy (sem) studies, sputum samples, collected as described above, the fixed samples were washed with 0.1 m sodium cacodylate at ph7.6 and blocked in 1% bsa for 20 min at rt . Then, samples were dehydrated in ascending series of ethyl alcohol, critical - point - dried, and subsequently sputtered with gold . The specimens were examined in a scanning electron microscope esem xl30 (fei company, philips, eindhoven, netherlands) operating at 20 kv . The negative controls were digested with dnase and thereafter processed in the same way . For transmission electron microscopy (tem) studies, sputum samples were collected with formvar - coated grids placed on freshly harvested sputum and left in place for 60 sec in order to adhere . The grids were then immediately transferred into a fixative of 4% paraformaldehyde in pbs at ph 7.4 for two hours . The fixed samples were washed with pbs, permeabilized, and blocked (10% normal goat serum, 10 mm glycine, 0.2% tween 20 in diluent containing 0.5% bovine serum albumin, and 0.5% triton x-100 in pbs). For visualisation of citrullinated histone h3, the grids were incubated with rabbit anti - human citrullinated histone h3 (citrulline 2 + 8 + 17) antibody [cith3] (ab77164, abcam, cambridge, uk) and a gold - conjugated secondary antibody (ab27237, abcam, cambridge, uk, gold sphere diameter 20 nm or ab27235, abcam, cambridge, uk, for 5 nm gold sphere diameter). Finally, the grids were stained with 1% uranyl acetate (sigma - aldrich, vienna, austria). A second type of negative controls was obtained by omitting the primary antibody . For ultrathin sputum sections, sputum samples were stained with the ruthenium - red - osmium - tetroxide technique to enable the visualization of nets and bacterial glycocalyx . Briefly, the samples were fixed with 1.2% glutaraldehyde (buffered at ph 6.5 with 0.1 m sodium cacodylate) with the addition of 0.05% ruthenium - red for 2 hours at rt . Postfixation was performed with 1% osmium - tetroxide (buffered at ph 6.5 with 0.1 m sodium cacodylate) and 0.05% ruthenium - red for 2 h at rt . Ultrathin sections were examined with a transmission electron microscope leo em 910 (leo elektronenmikroskopie ltd ., oberkochen, germany). Levels of human or murine cxcr2 ligands were quantified by commercial sandwich elisa kits according to the manufacturer's instructions as previously described . Cf patients and healthy control subjects were included in the study (table 1). The diagnosis of cf was based on typical clinical symptoms and positive sweat tests or disease - causing mutations in the cftr gene . Inclusion criteria for cf patients were stable concomitant therapy at least two weeks prior to the study and a forced expiratory volume in 1 second (fev1)> 25% of predicted value . Chronic bacterial and fungal colonization were diagnosed using the leeds criteria, if the organism was present in more than 50% of patient samples in the year prior to analysis . The study was approved by the institutional review board and by the ethics committees of the medical faculty, ludwig - maximilians university, munich, and the university of tbingen, germany . Written informed consent was obtained from all patients and control subjects prior to the study . Induced sputum was obtained after inhalation of 5.85% hypertonic sodium chloride for 15 min . Low - speed (4c, 500 g for 10 min) supernatants obtained from induced sputum were further centrifuged at 4c, 4000 g for 20 min . Bronchoscopy and bal (4 1 ml of 0.9% nacl per kg body weight) were performed as described previously [31, 32]. Because of the high percentage of neutrophils the first fraction of bal was used for subsequent analyses . The generation of enac - tg mice (line 6608) has been previously described . The colony was maintained on a mixed genetic background (c3h / hen c57bl/6n), and enac - tg mice were identified by pcr . Mice were housed in a pathogen - free animal facility and had free access to chow and water . For bronchoalveolar lavage (bal), mice were deeply anesthetized via intraperitoneal injection of a combination of ketamine / xylazine (120 mg / kg and 16 mg / kg, resp . ), the trachea was cannulated, and lungs were carefully lavaged twice with 800 l pbs . Kc and mip2 concentrations were measured in bal supernatant using elisa according to manufacturer's instructions and total cell counts were determined and differential cell counts performed on cytospin preparations . Studies were performed by investigators who were blinded with respect to the genotype and the treatment of the mice . We used invasive pulmonary function devices (forced maneuver system, buxco research systems, wilmington, nc). Mmf (medetomidine, midazolam, and fentanyl), intubated, and placed in a forced pulmonary maneuver system . In a heated plethysmograph chamber, mice were ventilated at an average rate of 140 breaths per minute, and flow, mouth, esophageal pressure and heart rate were monitored to measure forced expiratory volume at 100 ms (fev100). Comparisons among all groups were performed with anova and comparisons between two patient groups were performed with the two - sided t - test . Statistical analysis was performed with prism 4.0 (graphpad software) and stata version 8.2 for windows (stata corporation). Increased extracellular dna fibres with morphological net characteristics were found in airway specimen from cf patients (figures 1(a) and 1(b)). Positive costaining for neutrophil elastase (figure 1(a)) and citrullinated histones (figures 1(a), 1(b), and 1(d)), as characteristic net markers, and negative staining for f - actin (figure 1(d)) supported the notion that the cf airway dna fibres represented nets rather than necrosis - derived dna . Treatment of cf airway fluids with dnase dissolved these dna - net - like structures further confirming their nature as dna strands (data not shown). Ultrastructural imaging methods supported these findings and revealed a complex meshwork of dna strands with bacteria entangled (figure 1(b)). Free dna was present in different cf airway compartments, in particular in sputum (figure 1(a)), bronchoalveolar lavage fluid (bal) (figure 1(c), lower panel), and lung tissue (figure 1(c) upper panel). Remarkably, most abundant free dna was found in cf sputa, whereas in bal and lung tissue, lower amounts of free dna strands were detected, which is consistent with the observation that neutrophilic inflammation is most prominent in the proximal / bronchial airway compartments in cf lung disease . In bal fluid, we observed lower amounts of dna net - like structures, but observed that elastase was associated to free dna structures and also appeared to colocalize with the neutrophil's cellular membrane (figure 1(c), lower panel). In cf airway fluids, we found dna / net - like structures associated with bacteria (figure 1(e)). However, associations of free dna structures with both live and dead bacteria were noted (figure 1(e)). Stratifying cf patients for disease severity, we found that cf patients with poor pulmonary function had higher levels of free dna in their airway fluids than patients with mild lung disease (figure 2(a)). We further found that the airway free dna levels were associated with fungal colonization with aspergillus fumigatus but surprisingly not with bacterial infection (figure 2(a)). Representative net - dna (dapi) staining of cf patient groups stratified for lung disease severity is shown in figure 2(b). Highly increased levels of the cxc chemokines cxcl1 (gro - alpha), cxcl2 (gro - beta), and cxcl8 (il-8) were detected in cf airway fluids (figure 2(c)). Since cxcr1 is proteolytically cleaved on cf airway neutrophils [4, 32], cxcr2 remains the main binding site for these chemokines in the cf airway microenvironment . Cf airway nets correlated positively with levels of the proinflammatory chemokine cxcl2 (figure 2(d)). These findings provide evidence that cf lung disease features free airway dna levels characteristic for netosis and suggest that increased free dna levels are associated with poor lung function of cf patients . To investigate the role of free dna / net formation in vivo, we used transgenic mice with airway - specific overexpression of the amiloride - sensitive epithelial na channel (enac - tg) as a model of cf - like lung disease [26, 27]. These mice phenocopy airway surface liquid depletion, mucociliary dysfunction, and chronic airway disease with neutrophilic airway inflammation, mucus obstruction, and structural lung damage [26, 27, 34]. Similar to human cf airway fluids, levels of the cxcr2 ligands cxcl1 and cxcl2 (figure 3(a)) and free dna (figure 3(b)) were highly increased in the bal airway fluids of enac - tg mice compared to wild - type controls . Also consistent with the data obtained from human cf lung disease samples, the extent of free dna in murine cf airway fluids correlated positively with the levels of the cxcr2 ligand cxcl2 (figure 3(c)) and with pulmonary obstruction parameters (fev100) (figure 3(d)), whereas no correlation was found between free dna and levels of cxcl1 or parameters of pulmonary restriction parameters (data not shown). Netosis is regarded as a double - edged sword in human disease: on one hand, nets can capture, immobilize, and kill pathogens; on the other hand, uncontrolled and infection - independent net formation has the potential to harm host tissue through histones, proteases, or other mechanisms [21, 36, 37]. Related to the latter mechanism, net formation has recently been implicated in the pathogenesis of autoinflammatory and autoimmune disease conditions, such as lupus, preeclampsia, septic shock, and autoimmune vasculitis [3640]. Beyond these conditions, nets were found, in concert with platelets and monocytes, to play a role in thrombus formation and deep vein thrombosis [41, 42]. However, antihost defense and autoinflammatory conditions are not dichotomous in their nature and temporarily overlap upon resolution of infection or progression into chronic infection, especially in immunocompromised conditions . Viewing these findings in combination, the balance between targeted antimicrobial host defense and nontargeted tissue damage of net is delicate, but it is essential for the understanding and therapeutic potential of net formation in human disease conditions . Several studies have now provided evidence for netosis or netosis - like structures in cf lung disease and broadened the potential role of net formation in the complex pathogenesis of infective cf lung disease . We and others have demonstrated previously that free dna net - like structures are abundantly detectable in cf airway secretions [1014]. Recently, a further study found that cf sputum showed netosis characteristics and implicated macrophage migration - inhibitory factor (mif) in the formation of nets in the context of cf lung disease . Here, we confirm and extend these previous observations by showing that cf airway free dna levels correlate with pulmonary obstruction in cf patients and mice . These observations are reasonable, given the continuous and nonresolving neutrophil recruitment and activation within cf airways, being supported by the beneficial effect of recombinant inhaled dnase (dornase alpha) in cf patients with the strongest evidence in moderate and severe disease severity [4446]. Based on the increasing extent of neutrophilic inflammation and pulmonary obstruction, the evidence of free net - like dna structures in cf airways tempts us to speculate that in earlier and milder stages of cf lung disease, net formation may act beneficial in providing extracellular antibacterial and antifungal host defense . At this time, dnase may be used with more caution, since encaptured pathogens might be freed and could cause additional host damage . On the other hand, in later moderate to severe stages of cf lung disease, the amount of mucus and dna accumulation causes airway obstruction, rendering dnase efficient in cleaving dna traps, and this effect probably overweighs the antimicrobial actions of net formation, a hypothesis that awaits to be tested in further in vivo studies and clinical trials . Our correlations between free dna levels and pulmonary obstruction parameters in human patients with cf and a mouse model of cf lung disease suggest that, at least in our cf cohort with a more advanced lung disease severity, nets may cause more harm than good to the host . The obvious limitations of our study and the whole approach of free dna analysis in cf airway fluids remain that the free extracellular dna could result from different forms of cell death in addition to netosis, including necrosis, pyroptosis, and others . In addition, our studies image net formation using fixation of biological samples and are thereby limited by the fact that dna structures reminiscent of netosis cannot be clearly attributed to active net formation, since this would require live cell imaging approaches . Nevertheless, several other previous publications have provided indirect evidence indicating the presence of net structures in cf airway fluids [1014], which is supported methodologically by our studies using confocal laser scanning, scanning electron microscopy, transmission electron microscopy, and atomic force microscopy, decreasing the probability of fixation / staining artefacts . As cf lung disease is typically associated with chronic colonizations and infections with pseudomonas aeruginosa, the effect of this pathogen on net formation has been investigated using different methodologies and modelling systems [11, 13, 4749]. The latter studies found that pseudomonas aeruginosa efficiently induced net formation, particularly in solution in vitro, and demonstrated that nets can kill this pathogen through an extracellular dna - mediated mechanism . At single cell level, authors also showed that neutrophils from cf patients had no cell intrinsic alteration in net formation, supporting the notion that the net accumulation found in cf airway fluids is not specific to cftr mutation - based disease conditions, but rather represent a prototypical picture of severe and chronic neutrophilic inflammation in a body compartment . As cf airway fluids show a low antioxidant activity and are substantially different in their biochemical properties, we speculate that this particular microenvironment favors net formation . While we did not find a statistically significant association of pseudomonas aeruginosa infection status with free dna levels, a positive correlation was found for fungal colonization with aspergillus fumigatus, which is in line with a recent study showing that nets are mainly formed in response to large pathogens, such as fungi . A recent study analyzing neutrophils from a patient with papillon - lefevre syndrome (pls), lacking serine proteases, showed that neutrophils from this patient failed to produce nets, corroborating the concept that serine proteases, particularly elastase, regulate net formation [50, 5254]. Papayannopoulos and coworkers demonstrated that neutrophil elastase, which is highly increased in cf airway fluids and represents a promising therapeutic target [1, 4], enhances sputum solubilization by cleaving histones to enhance the access of exogenous nucleases to dna . The researchers also showed that neutrophil elastase is bound to dna, which downregulates its proteolytic activity and could restrict host tissue damage . This study has been extended by a recent report demonstrating that nets represent a reservoir of active proteases and dnase treatment increases free proteolytic activities, suggesting that cf patients under dnase treatment could benefit from the addition of protease inhibitors . Previous studies found a correlation between airway dna levels, neutrophilic inflammation, and lung function parameters in cf patients [9, 57, 58]. Our study confirms and extends these findings by showing a correlation between free dna levels with lung function, chemokine levels, and fungal colonization in cf patients . The correlation between the neutrophil chemokine cxcl2 and free dna levels in cf airway fluids could, on one hand, reflect increased cxcl2-mediated neutrophil chemotaxis or could also, on the other hand, involve cxcl2 itself as potential trigger for dna release in neutrophils . As there is a lack of convincing data supporting the latter hypothesis, the underlying mechanistic basis for this correlation remains to be dissected in the future . Besides net - associated products, such as proteases, that can cause harm to the host, a recent study identified surfactant protein d as key protein binding to nets, thereby promoting net - mediated trapping of p. aeruginosa this has ample implications for cf lung disease, since surfactant protein d has been found to be degraded / cleaved by both serine and matrix metalloproteases in cf airway fluids [6064], which, as a result, could impair the antibacterial netosis - related effects of surfactant protein d in cf airways in vivo . Regarding surfactant protein d and beyond, proteins that may interfere with net formation and/or net activities could be attractive therapeutic targets for advanced cf lung disease . Our view of net formation has been further extended by the description of rapid net formation in vitro and in vivo [24, 25], unraveling a so far unappreciated mode of collaboration between net formation, chemotaxis, and phagocytosis . While there is convincing data in skin infection models in mice, evidence on human neutrophils is still limited . The potential role of rapid net formation for cf lung disease remains to be dissected . In summary, our study, in line with previous investigations, demonstrates that free dna with net - like characteristics represents an extracellular component of cf airway fluids . In advanced stages of cf lung disease, nets seem to do more harm than good, but experimental data for a causative relationship is lacking . Approaches to interfere with net formation or net - associated products, such as dnases, antiproteases, supplementing surfactant protein d, targeting histones, or a combination thereof, could represent promising therapeutic strategies for cf lung disease and other chronic lung diseases associated with sustained neutrophilic inflammation [38, 40, 43].
Parenting stress escalates at a much faster rate among mothers of disabled children in comparison to mothers of non - disabled children . The addition of a disabled child to a family requires parents to adopt new roles and responsibilities and, in turn, creates a change in the function of the family system . Indeed, disabled children often demand more effort in daily activities and social integration than non - disabled children . For example, in terms of social integration, disabled children who rely on others for an extended period of time due to a lack of independence tend to cause long - term parenting stress in mothers . The personal growth and psychological development of children appear to be influenced by parental attitudes . Specifically, parents mental stability and psychological traits have been found to significantly impact disabled children1 . Further, the behavior and disposition of disabled children are largely affected by their social surroundings and thus, their parents stress3 . Parents who experience repeated parenting stress typically react negatively to children and, due to their parents adverse reaction, children respond with behavior that, once again, evokes poor parenting behavior . Not surprisingly then, higher levels of mother - reported parenting stress are associated with higher levels of denial and coercive parenting behavior . Therefore, parenting stress is considered a salient predictor of inappropriate parenting behavior among mothers1, 3 . Parenting stress among mothers is elicited by psychological and child - related factors as well as environmental factors, such as family income, and supporting factors, including fathers parenting participation4,5,6,7 . Previous studies focused on the role of fathers in reducing the experience of parenting stress among mothers, because, traditionally, they are mothers closest companions8, 9 . By assuming the role of an androgynous father, fathers reduce the negative effects of gender roles by interacting at a deeper level with their children . Therefore, the need to socially introduce a new concept regarding the role of family members through research on fathers parenting participation is being magnified8 . However, fathers parenting participation as a factor for parenting stress in mothers with disabled children has not been adequately studied . Thus, the objective of this study was to examine a novel concept regarding the role of fathers by investigating the relationship between fathers parenting participation and the parenting stress experienced by mothers who are primary caregivers for disabled children . Broadly, this research will examine traditional parenting approaches, which places responsibility on the mother, against more egalitarian parenting . The sample consisted of mothers with disabled kindergarteners who attended a day care center or a rehabilitation center for the disabled in gwangju . One hundred questionnaires were distributed to randomly selected participants, while 83 were completed and returned . As one questionnaire was returned with missing data, 82 the study was carried out in accordance with the international ethical guidelines and the declaration of helsinki and was approved by the local institutional review board . The survey comprised a series of questions about general characteristics (table 1table 1.general characteristics of the household (n=82)classificationfrequency (number)percentage (%) employ status of mothersemployed2834.1unemployed5465.9co - residing family memberscouple7591.5children82100.0father in law44.9mother in law67.3father22.4mother44.9others22.4reason of couple s separationno7591.5occupational issues33.7couple issues00.0divorce33.7death11.2child s gendermale5061.0female3239.0diagnosis of childbrain lesions4554.9down s syndrome33.7intellectual disability1214.6developmental disorder67.3autism33.7others1315.8age of childno response89.836 years old4251.2712 years old2935.4older than 13 years old33.7), parenting participation by fathers, and parenting stress in mothers . The former included age, mother s employment status, education level, type of family couple s co - residence status, and family income, while the latter included gender, age, diagnosis, cause of disease, gestation period, birth weight, and birth order . The study used a modified version of a questionnaire designed by lamb the validity and reliability of which was verified in a previous study on fathers parenting participation, support of a spouse, and parenting role satisfaction10 . The questionnaire of fathers parenting participation consisted of 30 questions: 10 relating to interaction with family, 10 on guidance, 5 on housekeeping activities, and 5 on recognition and leisure activities . For each question, a 5-point likert scale with responses from not at all (1) to strongly agree (5) was used, and the score ranged from 30 points to 150 points . Thus, a high score overall implied high levels of the aforementioned areas of participation . This study measured the parenting stress in mothers by using the parenting stress index / short form (psi / sf), which is based on the 101 questions of the parenting stress index developed by abidin11 . The psi / sf is divided into 3 broad subscales based on the source of the mothers stress parental distress, parent - child dysfunctional interaction, and difficult child for a total of 35 questions . For each question, a 5-point likert scale ranging from not at all (1) to strongly agree (5) was used . Total scores could range from 35 points to 175 points, whereby higher scores are associated with higher levels of parenting stress . A total score higher than 90 points may indicate that the participant requires professional help . Spss version 20.0 for windows (spss inc ., chicago, il, usa) was used to analyze the data . A frequency analysis was conducted to examine the demographic characteristics of the participants . To examine the reliability of the questionnaire, fibally, the pearson s product - moment correlation coefficient was used to examine a correlation between parenting participation by fathers and parenting stress in mothers . The fathers parenting participation mean score was 105.9 points, which indicates that, on average, fathers showed greater than moderate participation in parenting . The mean score on fathers interaction with family, guidance, and recognition, play, and leisure activities accordingly, when the scores on each of the subscales were converted to 100 points, the effective score was mostly found to be over 70 points (table 2table 2.descriptive statistics on the sub - scales of parenting participation by fathers (n=82)classificationmeanstandard deviationinteraction with family35.87.8guidance35.97.3housekeeping activities17.76.2recognition, play, leisure activities16.54.4total score105.922.4). Out of the highest possible score of 175 points, the average mothers parenting stress was 92.7 points . When this was converted into 100 points, the score was found to be about 52 points, indicating that parenting stress in mothers with disabled children was moderate (table 3table 3.descriptive statistics on the sub - scales of parenting participation by mothers (n=82)classificationmeanstandard deviationdistress of mothers34.07.6dysfunctional interaction with children29.16.8difficult child29.66.2total score92.717.2). A higher level of parenting participation by fathers was associated with a lower level of parenting stress in mothers . With reference to the subscales of parenting participation by fathers and parenting stress experienced by mothers, fathers scores on interaction with the family, guidance, housekeeping activities, and recognition, play, and leisure activities showed a significant negative correlation on mothers distress score . However, with reference to the subscales of mothers parenting stress, the score on dysfunctional interaction with children revealed a significant negative correlation with fathers participation in guidance as well as the total score on parenting participation by fathers . Subscale score had a significant negative correlation with guidance, housekeeping activities, and fathers parenting participation total score . Finally, all subscales of parenting stress in mothers were negatively correlated with the total score on parenting participation by fathers (table 4table 4.correlations between the subscales of parenting participation by fathers and parenting stress in mothers (n=82)distress of mothersdysfunctional interactionwith childrendifficult childtotal score on parentingstress in mothersinteraction with the family0.3550.1950.1410.284guidance0.3690.2710.2180.348housekeeping activities0.3290.1990.2990.331recognition, play, and leisure activities0.3670.1910.1090.276total score on parenting participation by fathers0.4070.2490.2250.358*p<0.05, * * p<0.01). The present study aimed to examine the relationship between parenting participation by fathers and parenting stress experienced by mothers with disabled children . It also aimed to provide baseline data for facilitating positive parenting participation by fathers in order to decrease parenting stress experienced by mothers . Results show that higher levels of mother - perceived father participation in parenting are associated with lower levels of distress among mothers . However, although dysfunctional interaction with children and difficult child had significant positive correlations with both fathers parenting participation and mothers parenting stress, the correlation was below a moderate level . The fathers interaction with the family and recognition, play and leisure activities with the child were not significantly correlated . Recently, several studies examined the relationship between fathers parenting participation and mothers parenting stress by focusing on parents with disabled children8, 9 . Son examined a structural relationship among parenting participation by fathers, parenting stress of mothers, and parenting efficacy, and verified a mediating effect of mothers parenting stress on the relationship between fathers parenting participation with disabled children, and fathers parenting efficacy . Furthermore, son found a mediating role of mothers parenting stress on the relationship between fathers parenting participation with disabled children and mother s parenting efficacy8 . In support of this, the present study also found a negative relationship between fathers parenting participation, as perceived by mothers, and mothers self - rated parenting stress . Notably, son s study found that the fathers interaction with the family had the strongest correlation with mothers parenting stress . According to the mothers reports, fathers interactions with their families reflected that fathers respected the mothers opinions, felt responsible for parenting, and tried to respond to their disabled children s questions with enthusiasm . This further implied that high - interaction fathers were committed to investing in and developing a relationship of trust with their children through encouraging and respecting their curiosity . This is particularly true for a family context in which fathers have moved away from a patriarchal role . Such a family context, for instance, would include fathers and mothers resolving family issues together, discussing important topics with each other, and similarly prioritizing the family system . Therefore, fathers may no longer be conceptualized as patriarchal and authoritative by mothers, but rather as key players who invest equally into the family . Furthermore, when fathers participate in parenting, mothers experience a feeling of solidarity, satisfaction, and trust in them . Therefore, mothers with disabled children can feel emotionally and mentally stable in their parenting, which in turn is believed to decrease parenting stress . The present study explored the relationship between fathers parenting participation, as perceived by mothers and mothers parenting stress . Future research investigating the factors that influence fathers parenting participation may be useful as this has yet to be studied . Additionally, because the study s sample size was relatively small (82 participants) and the survey was limited to the gwangju area, results may not be generalizable.
Progressive nodular histiocytosis (pnh) is a rare normolipemic macrophage disorder first described by taunton et al ., in 1978 . It belongs to a subgroup of non - langerhans cell histiocytosis (lchs), the juvenile xanthogranuloma (jxg) family, which includes xanthoma disseminatum (xd), benign cephalic histiocytosis (bch), multiple adult xanthogranuloma (maxg) and generalized eruptive histiocytosis (geh). According to weitzman and jaffee, they present positive reaction to factor xiiia, cd68, cd14 and negative reactions to cd1a and s-100 proteins . These disorders are difficult to categorize, primarily because of the diverse pathological findings and due to overlapping clinical and microscopic features . A 30-year - old gentleman presented to us with complaints of asymptomatic nodular skin lesions all over the body of 10 years duration . At the age of 20 years, he started developing few small skin - colored lesions on the bilateral peri - orbital areas . These lesions continued to increase in size over time and few lesions became pedunculated especially over the calves . Along with the appearance of the cutaneous lesions, he also noticed a gradually progressive, bilateral painless loss of vision . He did not complain of itching, watering, photophobia or discharge from the eyes . He was diagnosed to have eale's disease and underwent laser photocoagulation for the same . He developed premature cataracts of the eyes and was treated with phacoemulsification and posterior capsular intraocular lens implantation in both eyes . Prior to presentation to us, he underwent intra - lesional steroid therapy using triamcinolone acetonide in the peri - orbital lesions with good response seen in smaller lesions but no effect on the larger lesions . The lesions at other sites were removed using various modalities like cryotherapy, radiosurgery and surgical excision of the larger, troublesome lesions . Cutaneous examination revealed multiple, approximately 30 to 40, yellowish to skin - colored, firm, non - tender papules and nodules ranging in diameter from 5 to 40 mm, over the face [figure 1], trunk, extremities, elbows, hands, palms and soles [figure 2] in decreasing order of frequency . These lesions were located almost symmetrically over the peri - orbital area, mostly over the outer canthi, but also over the lower eyelids, leading to ectropion . The smaller lesions on the face were mounted on the skin, while the larger lesions on the calf area were pedunculated . Papular and nodular lesions on the face and eyelid large nodules seen over the elbows, hand and sole visual acuity at the time of presentation was 6/18(r) and 6/60(l). The clinical differential diagnoses considered at the time of presentation to us were multiple eruptive dermatofibromas, xanthoma disseminatum and pnh . Blood examination revealed hemoglobin of 10.5 gm / dl with a microcytic hypochromic blood picture, total leukocyte count of 7200/mm and a normal differential leukocyte count . Fasting lipid profile, renal, total serum proteins and albumin were normal with no reversal of the a: g ratio . A cellular tumor was seen centered in the dermis, composed of sheets of oval to spindle - shaped cells arranged haphazardly, in short fascicles and in a storiform pattern at places [figures 3a - c]. The spindle cells had oval to elongated benign looking nuclei with vesicular chromatin and small nucleoli . On immunohistochemistry the cells were positive for cd68 [figure 4] but negative for s-100, cd34, cd21, cd35 and hmb45 supporting a diagnosis of spindle cell histiocytic tumor . Dab chromogen 100 based on the history, clinical examination and histopathological correlation, his dermatological disorder was diagnosed as pnh . He was started on tab imatinib 400 mg od and some of the lesions developed encrustation but it was stopped after 5 months as he continued to develop new lesions while on this drug . Second - line treatment with pazopanib (800 mg od) was started after stopping tab imatinib, in lines of soft tissue sarcoma . Based at the age of the onset of the lesions, areas of the body involved, progression of disease, lab abnormality (serum lipids), it is possible to differentiate pnh from other forms in the jxg family . Benign cephalic histiocytosis and jxg usually occur in early childhood, but jxg has also been reported in adults and the lesions have a tendency to resolve spontaneously over a period of time . Multiple adult xanthogranuloma is another important differential diagnosis of pnh which has similar features to jxg but occurs in adults . Xanthoma disseminatum was ruled out based on the absence of mucosal and systemic involvement and with normal lipid profile as it usually presents with hyperchylomicronemia and hypertriglyceridemia and diabetes insipidus . Since the accurate diagnosis of a specific disorder within the jxg subgroup is quite difficult, we made the diagnosis of pnh based on the history, presence of the typical skin lesions, progressive course and histopathological demonstration of spindle cells that were positive on immunohistochemistry for histiocyte marker, cd68, but negative for s-100 . Non - langerhan's cell histiocytosis disorders are difficult to diagnose and our case presents another clinical expression of this variable and confusing disorder . To our knowledge this is the first case report of progressive nodular histiocytosis associated with eale's disease.
Desmoplastic fibroma (df), a benign locally aggressive lesion of the bone is recognized as an intra - osseous counterpart of soft tissue fibromatosis and is usually seen affecting the long bones, pelvis and only occasionally presents itself as a jaw lesion . Mandible is most commonly affected when compared to the maxilla and the cranium in the head and neck region . A systematic literature search of the pubmed database of national library of medicine using df and mandible as keywords revealed a total of 57 published cases occurring in the mandible alone from the year 19692014 . The cause for df is unknown and is stipulated to have a varied pathogenesis ranging from genetic, endocrine and traumatic factors to an exuberant reactive proliferation . When differentiating it from other neoplasms that behave aggressively, a history of expansion or perforation of the cortical plates along with the histopathological confirmation would be a pointer in the right direction . A 35-year - old female patient visited the department of oral medicine and radiology, with the chief complaint of slowly growing painless swelling in the left lower back tooth region since 3 years [figure 1]. Clinical extra - oral examination revealed expansion of the left inferior border of the mandible and intra - oral examination revealed a solitary bony hard swelling measuring about 4.0 cm 5.0 cm in size with obliteration of the left buccal vestibule in relation to 37 and 38 [figure 2]. Clinical image showing swelling of left side of lower jaw intra - oral photograph showing obliteration of the left buccal vestibule in relation to 37, 38 a left lateral oblique view of radiograph showed multilocular radiolucencies with fine trabeculations leading to a soap bubble appearance extending from the left angle of the mandible to the mesial root of the mandibular left first molar . No displacement of teeth or resorption of the root was seen [figure 3]. Left lateral oblique view of radiograph showing multilocular radiolucencies a computerized tomography (ct) scan demonstrated buccal and lingual cortical plate expansion and a soap bubble appearance [figure 4]. Computed tomography scan showing buccal and lingual cortical plate expansion surgical excision of the lesion the hematoxylin and eosin stained tissue section showed hypo and hyper - cellular areas with proliferation of plump fibroblasts arranged in interlacing fascicles and dense collagen . Focal areas of the section also revealed dense collagenous stroma with foci of hyalinization [figure 8]. Photomicrograph showing hypo - cellular and hyper - cellular areas with spindle cells arranged in interlacing fascicles (h&e stain, 10) photomicrograph showing hyper - cellular area with proliferating plump fibroblasts, (h&e stain, 20) photomicrograph showing proliferating plump, spindle - shaped fibroblasts in a collagenous stroma (h&e stain, 40) photomicrograph showing a focus of dense collagenous stroma with focal areas of hyalinization (h&e stain, 10) a final diagnosis of df was arrived at after histopathological examination . Df is a rare, locally aggressive myofibroblastic benign tumor of connective tissue origin . As an intra - osseous lesion df was first described by jaffe in 1958 and named as df . In 1965, the first report about a df of the jaw was presented by griffith und irby . The histologic criteria for df as defined by the world health organization is a rare benign bone tumor composed of spindle - shaped cells with minimal cytological atypia and abundant collagen production . Desmoid tumor also called as aggressive fibromatosis, was described before df . About 69% of desmoid tumors are abdominal; the extra - abdominal variety occurring in the bone is the df . Although df can affect any age group, most patients are affected in the first three decades of life . In our case, the average age of patients at the time of the final diagnosis is 15.1 years . Metaphysis of long bones especially tibia, scapula and femur are the most frequent sites of involvement . Mandible is the fourth most common site of involvement and sex predilection remains unclear . In the mandible, the lesions tend to occur posteriorly at the ramus - angle region . This is similar to our case report, where the lesional tissue is in relation to the second and third molars . The symptoms are nonspecific including diffuse, moderate pain in the region of the tumor, both at rest and on movement or when bone bears any weight . In the maxillofacial region, dfs usually are painless, slow - growing firm masses . A similar history of a painless radiographic appearance may vary from uni - locular to multi - locular, with or without expansion or perforation of cortical plates according to frick et al . Radiographs showed osteolytic lesions with coarsened ridge - like trabeculae in 63% of cases, osteolytic lesions in 24% of cases and mixed lytic and mildly sclerotic lesions in 13% cases . Ct revealed radiolucent (65%) or mixed radiolucent and mildly sclerotic (35%) matrix patterns . The ct in our case clearly showed cortical expansion without any resorption or displacement of adjacent teeth . T1-weighted sequences in mri showed that the signal intensities within the lesions were isointense or hypointense to adjacent normal muscle . The hypocellular areas of the tumors with abundant collagen are responsible for the areas of t2-shortening while hyper - cellular parts filled with fibroblasts or necrotic areas are responsible for the higher intensity parts within the lesions . On gross examination, the desmoid tumor appears as firm, rubbery, white, nonencapsulated fibrous growth . Histologically, the df contains mature fibrous connective tissue, low to variable cellularity and spindle - shaped fibroblasts / myofibroblasts with uniform long nuclei in an abundant stroma of collagenous matrix lacking cellular pleomorphism, nuclear hyperchromatism or mitoses . The differential diagnosis to be considered histologically would be spindle cell tumors of which low - grade fibrosarcoma is the most important . Tumors such as fibrous histiocytoma, fibrous dysplasia, or a low - grade intra - osseous osteosarcoma; tumor - like lesions such as aneurysmal bone cyst and the juvenile bone cyst can also present with a similar clinical picture . Though fibrosarcoma exhibits a highly cellular stroma along with high grades of polymorphism and mitosis, the low - grade variant shows a collagen rich tissue with low cell count and no mitotic activity . This is very similar to the histopathological picture of the df and a definitive diagnosis is possible only with postoperative clinical development . Found that df has no immunoreactivity of cd117, estrogen and progesterone receptors; and 50% cases showed positivity for muscle - specific markers and the -catenin pathway does not seem to have the same essential role in the tumorigenesis of df, as it has in desmoid type fibromatosis . Found that the majority of the tumor cells express the mesenchymal marker vimentin and no immunoreactivity for antidesmin and anti - s-100 protein . Df of maxilla or mandible with extra - osseous extensions is treated with complete excision including a margin of uninvolved soft tissue . The recurrence rate of about 40 - 47% is seen in lesions treated by curettage or intra - lesional resection making follow - up a necessity.
In japan, elderly individuals defined as people aged 65 years or more are known to account for more than 25% of the population . As people age, there is a concomitant decrease in muscle strength1 . This age - related change affects their ability to walk2 . As the ability to walk of the elderly decreases, there is an associated decrease in their balance ability3, 4, and independent daily living activities5, and they show an increased risk of fall6 . Therefore it is necessary to maintain the ability to walk of the elderly . Ground reaction force is an external force involved in walking, which affects the acceleration of the body s center of mass7 . The vertical ground reaction force is often measured in gait analysis, and is regarded as a representative measure of walking8 . The two peaks of the vertical ground reaction force during the early stance and late stance phases reflect the support of the body s center of mass . The minimum value in the mid - stance indicates that the vertical force applied to the ground decreases, and thus, the reaction force from the ground to the body also decreases9 . The profile of the vertical ground reaction force correlates with many parameters of gait and functional performance, such as walking speed10, the timed up and go test time and the functional reach distance11 in the elderly . It is also known that the vertical ground reaction force during walking is affected by aging . Elderly people exhibit lower first peak and second peak forces, and a higher minimum value at mid - stance than young people12 . The vertical ground reaction force provides correlative information about the ability to walk of elderly people . Several studies have reported that elderly individuals exhibit age - related alteration in their kinetic profiles of walking . Hip and knee joint moments of the elderly are significantly lower than those of young people13 . Moreover, devita and hortobagyi14 reported that elderly people showed different distributions of joint moments and powers compared to young individuals . Support during the stance phase is achieved by a net extensor pattern of moments at the ankle, knee, and hip joint15 . Age - related alterations in lower extremity joint moment suggest there is a difference in the support strategy between the elderly and the young . To date, it is unclear what causes the difference in the profile of the ground reaction force between the elderly and the young . The results of our previous study16 suggest that both men and women make use of different joint moments for the generation of antero - posterior ground reaction forces as they age, showing an age - related alteration in the motor pattern used to generate the antero - posterior ground reaction force . Moreover, if elderly people exhibit an age - related alteration in support moment of the lower extremity, changes in joint moment may affect the magnitude of the vertical ground reaction force . By analyzing the relationships between vertical ground reaction force and lower extremity joint moments, it would be possible to clarify the difference in the support strategies of elderly and young people . Therefore the purpose of this study was to examine the relationships between the vertical ground reaction force and the hip, knee, and ankle joint moments during walking by the elderly and young individuals . We hypothesized that the relation between the joint moments and vertical ground reaction force differs between the elderly and the young, similar to our previous study16, and that there is an age - related change in the support strategy use for walking . Forty community - dwelling elderly people, 65 years old or older (mean age, 70.1 years; age range, 6580 years), and 40 young people, aged 20 to 29 years (mean age, 23.2 years), participated in this study . There were 20 males and 20 females in each group . The exclusion criteria included neurologic disorders, osteoarthritis, rheumatic arthritis, joint pain affecting walking, and a history of surgery to the lower extremities or spine . All procedures were approved by the hiroshima international university human research ethics committee and all participants gave their written, informed consent prior to enrollment . In the walking trials, all the participants walked barefoot to the end of a 7 m walkway at a self - selected preferred walking speed . A 3d motion analysis system with 8 infrared cameras (vicon mx; vicon motion systems; oxford, uk) and 8 force plates (amti; watertown, ma, usa) was used to record kinematic and kinetic data at sampling frequencies of 100 and 1,000 hz, respectively . The force plate layout was designed to measure the ground reaction force of each limb using four force plates arranged in the longitudinal direction . Participants were instructed to walk placing their foot on the left or right force plate, avoiding stepping on two force plates simultaneously . A total of 30 reflective markers were placed bilaterally, over the following landmarks of each participant: acromion process, olecranon, styloid process of the radius, anterior superior iliac spine, posterior superior iliac spine, greater trochanter, medial and lateral femoral condyles, mid - point between the greater trochanter and the lateral femoral condyles, medial and lateral malleoli, mid - point between the lateral knee joint line and the lateral malleolus, head of the first and fifth metatarsal, and the calcaneal tuberosity . These anatomical markers were used to construct anatomical coordinate systems for the pelvis, thigh, shank, and foot segments . The coordinates of each joint center were calculated following the description of a previous study17 . A 7-link segmental model was developed to calculate the kinematic and kinetic variables of the hip, knee, and ankle joints using the inverse dynamics technique of davis et al.18 and vaughan et al19 . Anthropometric parameters for mass, position of the center of mass, and moment of inertia for the segments were obtained from the report by okada et al20 . We calculated the hip, knee, and ankle joint moments using a local coordinate system with the origin at the joint center . In this study, each joint moment was normalized to the subject s body mass (nm / kg). Walking speed (m / s) was calculated using the center of gravity (cog) of the whole body, and averaged over a 3-s data collection period . Stride length (m) was measured as the antero - posterior distance between the left calcaneal tuberosity marker at one heel contact and at the next heel contact . Initial contact was assumed to occur when the vertical reaction force exceeded 10 n, and toe off was assumed to occur in the first frame following the initial contact when the vertical reaction force fell below 10 n. to account for different builds, ground reaction force was normalized to each subject s body mass (n / kg). First and second peaks of vertical ground reaction force, and the minimum value between the two peaks were extracted from the ground reaction force profile (fig 1.graph representation of the vertical ground reaction forces and the joint moment of the hip, knee, and ankle during a gait cycle). Peak values of each joint moment during the stance phase were extracted from the joint moment profile (fig . Graph representation of the vertical ground reaction forces and the joint moment of the hip, knee, and ankle during a gait cycle two - way analysis of variance was performed to examine the differences between the elderly and the young and the interactions between age and gender, with age, body height, body weight, body mass index (bmi), and spatio - temporal parameters . Two - way analysis of covariance was also performed to examine the difference between the elderly and the young, and the interactions between age and gender with the vertical ground reaction force, and peak values of each joint moment using walking speed as the covariate . Step - wise linear regression was performed to determine the joint moments that predicted the amplitude of vertical ground reaction force in the elderly men, elderly women, young men, and young women . Relationships among the peak values of the hip, knee, and ankle joint moments during the early stance phase and the first peak force, and the minimum value of the vertical ground reaction force, were investigated . Relationships among the peak values of the hip, knee, and ankle joint moments during the late stance phase and the second peak force of the vertical ground reaction force were also investigated . The stepping - method criteria were: an f - value of 0.05 for inclusion in the segmental model, and 0.10 for removal from the model . The baseline demographic characteristics of the study subjects are presented in table 1table 1.characteristics of the subjectvariableelderlyyoungmales (n = 20)females (n = 20)males (n = 20)females (n = 20)age (years)69.45 (4.80)*70.70 (4.62)*22.80 (2.80)23.50 (2.70)height (m)1.64 (0.07)*1.49 (0.04)*1.71 (0.07)1.57 (0.05)weight (kg)62.28 (9.78)52.09 (6.20)64.04 (8.34)52.91 (9.92)bmi (kg / m)23.06 (2.96)*23.25 (2.69)*21.74 (2.63)21.21 (3.30)value: mean (standard deviation: sd). *: significant difference from the young, p <0.05 . : bmi: body mass index . The elderly participants had significantly shorter body height and higher bmi than the younger study participants, but there was no significant difference in their body masses . Value: mean (standard deviation: sd). *: significant difference from the young, p <0.05 . : bmi: body mass index the spatio - temporal parameters and peak values of joint moment are presented in table 2table 2.spatio-temporal parameters and peak values of joint momentvariableelderlyyoungmales (n = 20)females (n = 20)males (n = 20)females (n = 20)walking speed (m / s)1.20 (0.16)*1.15 (0.12)*1.26 (0.12)1.29 (0.10)stride length (% body height)73.63 (6.79)*73.59 (5.48)*77.47 (5.64)81.68 (5.69)first peak force (n / kg) 10.57 (0.94)10.71 (1.06)10.96 (0.75)10.90 (0.79)minimum force (n / kg)7.29 (0.58)7.52 (0.58)7.20 (0.58)7.00 (0.60)second peak force (n / kg) 10.43 (0.50)9.97 (0.61)*10.64 (0.52)10.74 (0.51)hipextension moment (nm / kg) 0.76 (0.31)0.58 (0.29)0.72 (0.19)0.64 (0.29)flexion moment (nm / kg) 0.67 (0.17)0.61 (0.17)0.71 (0.14)0.60 (0.13)kneeflexion moment during early stance (nm / kg)0.23 (0.15)0.21 (0.11)0.08 (0.17)0.15 (0.11)extension moment during early stance (nm / kg)0.58 (0.29)0.74 (0.26)0.71 (0.20)0.76 (0.27)flexion moment during terminal stance (nm / kg)0.21 (0.09)0.10 (0.14)0.18 (0.12)0.19 (0.12)extension moment during terminal stance (nm / kg)0.20 (0.07)*0.26 (0.12)*0.17 (0.08)0.17 (0.10)ankledorsiflexsion moment (nm / kg)0.21 (0.10)0.24 (0.11)0.25 (0.08)0.21 (0.11)plantarflexion moment (nm / kg)1.16 (0.22)*1.02 (0.16)*1.30 (0.11)1.22 (0.19)value: mean (standard deviation: sd). *: significant difference between age groups, p <0.05 . : significant difference between gender groups, p <0.05 . The elderly males and females had significantly slower walking speeds, with shorter stride lengths than the young participants, but there was no significant different in cadence between the two age groups . The second peak of the vertical ground reaction force exhibited a significant interaction between age and gender, and the elderly females had a significantly lower second peak of vertical ground reaction force than the younger females . There was an approximately 7.5 percent difference between the elderly females and the young females groups . On the other hand, the extension moment during the terminal stance phase of the knee was higher in the elderly participants . There were approximately 14.5 and 30.0 percent differences between the elderly and the young groups of both males and females, respectively . Although the flexion moment during the terminal stance phase of the knee exhibited a significant interaction between age and gender, there was no significant difference between the age groups, neither in malese nor in females . Value: mean (standard deviation: sd). *: significant difference between age groups, p <0.05 . : vertical ground reaction force the results of step - wise linear regression analyses of vertical ground reaction force are presented in table 3table 3.models of the vertical ground reaction force by forward step - wise regression analysis.subjectindependent variableunstandardizedcoefficientstandardizedcoefficientadjusted rfirst peak forceelderly femalehip extension moment2.140.610.34young female knee extension moment during early stance1.350.470.22minimum value at mid - stanceyoung maleknee extension moment during early stance1.950.690.48elderly femaleknee extension moment during early stance1.310.510.26young femaleknee extension moment during early stance1.040.540.29second peak forceyoung maleknee extension moment during late stance2.670.450.21elderly female ankle plantarflexion moment2.220.570.33 *: p <0.05 . : vertical ground reaction force, and the joint moments related to the vertical ground reaction force are shown in fig . 2fig . 2.the joint moments that can predict the amplitude of the vertical ground reaction force in each group . Elderly males exhibited no statistically significant factors related to the vertical ground reaction force . *: p <0.05 . : vertical ground reaction force the joint moments that can predict the amplitude of the vertical ground reaction force in each group for the young males and females, and elderly women groups, the knee extension moment during the early stance phase was related to the minimum value of the vertical ground reaction force at mid - stance . For young males, the knee extension moment during the late stance phase was related to the second peak of the vertical ground reaction force . On the other hand, for young females, the knee extension moment during the early stance phase was related to the first peak of the vertical ground reaction force . In contrast, for the group of elderly females, the hip extension moment was related to the first peak of the vertical ground reaction force, and the ankle plantarflexor moment was related to the second peak of vertical ground reaction force . This study examined the relationships between the vertical ground reaction force and hip, knee, and ankle joint moments during walking in young and elderly individuals . The analyses of this study were performed in consideration of gender as well as age . This was done because a previous report21 indicated that there are significant gender differences in walking speed, stride length, kinematics and kinetics . In this study, some parameters exhibited a significant gender difference and interaction between age and gender . Thus, in order to maximize the ability to determine the effects of age on walking, the study subjects were divided by gender . The first peak and the minimum value at mid - stance of the vertical ground reaction force were not significantly different between the elderly and the young . On the other hand, the second peak of the vertical ground reaction force of the elderly women was significantly lower than that of the young women . Yamada and maie11 reported that elderly people have lower first peak and second peak forces, and a higher minimum value at mid - stance than younger people . On the other hand, larish et al.22 reported that there was no significant difference in the first peak force, but a significant difference in the second peak of the vertical ground reaction force . Because the amplitude of the peak vertical ground reaction force is affected by cadence rather than stride length23, there may be no difference between the elderly and young people in the first peak of the vertical ground reaction force . Both the first and second peaks of the vertical ground reaction force correspond to the upward acceleration of the body center of mass8 . The elderly females in this study had low upward acceleration of body center of mass at push - off . This may increase the load on the front limb when producing upward acceleration during the double support phase of elderly females . The plantar flexion moment of the ankle of the elderly was smaller by approximately 14.5 percent than that of the young people . Therefore, the plantarflexor muscles of the elderly exhibited an age - related functional decline . Knee extension moment during early stance had a negative relationship with the minimum value at mid - stance, and the knee extension moment during late stance had a positive relation with the second peak of the vertical ground reaction force the young males . The knee extension moment during early stance had a positive relation with the first peak force, and a negative relation with the minimum value at mid - stance of the ground reaction force of the young females . These results suggest that the vertical ground reaction force may be controlled by knee extension in young people . In our previous study16, the knee extension moment during late stance was associated with the anterior component of the ground reaction force of young males, and the knee joint moment was associated with the antero - posterior component of the ground reaction force of young females . The knee extension moment of young people is important for decreasing the reaction force from the ground to the body at mid - stance, and increasing the ground reaction force during weight acceptance and the push off phase . It is necessary to have muscle strength in order to increase the joint moment during walking . Brown et al.25 reported that there was a relationship between quadriceps strength and walking ability, especially in young people rather than in the elderly . Therefore knee joint function is important for support during walking by young people . In the elderly females of this study, the extension moment of the hip had a positive relationship with the first peak of the ground reaction force . In our previous study16, the extension moment of the hip was associated with the posterior component of ground reaction force in elderly females, and the present result is consistent with the result of that previous study . The elderly females had a large hip extension moment, and their ground reaction force during the early stance phase was relatively high . Although the knee joint moment was associated with the first peak of the vertical ground reaction force in the young females, the hip joint moment was associated with the first peak of the vertical ground reaction force in the elderly females . The elderly and young females in this study made use of different joints to control of the vertical ground reaction force . These results are mostly consistent with our hypothesis that there is an age - related change in the support strategy of walking . Support for the body is provided by a combination of knee extensors and hip extensors during the early stance phase26 . While walking, moreover, elderly people had more forward trunk lean, and a large hip flexion angle during early stance14 . Because the function of the muscles surrounding the knee joint reduces with aging in addition to age - related alternation in the attitude of walking, weight acceptance during the early stance phase of the elderly is accomplished by the hip joint . For weight acceptance in the initial stance, therefore, it is necessary for elderly females to develop a hip extensor . The extension moment during the early stance phase of the knee had a negative relationship with the minimum value of the ground reaction force at mid - stance in the elderly females . This result was similar to the one found for the young females in this study . In order to reduce the mechanical load exerted on the body at mid - stance, it may be important for elderly females to strengthen the quadriceps muscles, and generate a knee extension moment during early stance . Moreover the plantarflexion moment of the ankle had a positive relationship with the second peak of the ground reaction force of the elderly females . Winter15 reported that the ankle plantarflexion moment was the major contributor to support during push - off . The rate of decline in maximal voluntary isometric force with aging is greatest in the plantar flexors28 . It is probables that because the elderly females had a lower plantarflexion moment of the ankle than that of young females, the second peak of the vertical ground reaction force was smaller in the elderly females in this study . A previous study reported the importance of plantarflexor muscles of the ankle during walking by the elderly29 . Therefore it is important to strengthen the plantarflexor muscles of the ankle of elderly females in order to enhance support during late stance . In contrast, no factors related to the first peak and second peak forces and the minimum value of the vertical ground reaction force of the elderly males were found . It has been reported that the contribution of joint moment to the antero - posterior ground reaction force is small in elderly males16 . Because individual variation was greater among the elderly males, factors related to the vertical ground reaction force were found not to be significant, similar to the antero - posterior ground reaction force . The changes in physical function with aging are not equal in males and females30, and physical characteristics, lifestyle, and social background are different between males and females . Therefore there are gender differences in the age - related changes of walking characteristics, and elderly males make use of various joint moment patterns to the control of the vertical ground reaction force . The relationship between the vertical ground reaction force and lower extremity joint moments during walking in both elderly and young subjects were investigated . However, step - wise linear regression analysis did not find a factor related to the vertical ground reaction force in several models, because we analyzed the data divided by age and gender . Using mechanical analysis using equations of motion, kepple et al.26 showed that support of the body was provided by the ankle plantarflexor moment during single limb support, and by a combination of ankle plantarflexors, knee extensors, and hip extensors during double - limb support in younger people . Therefore in order to clarify the age - related changes in walking mechanism of elderly people, it will be necessary to perform detailed analyses of dynamic equations of motion . Furthermore, we were unable to identify the causative factor of age - related changes in the support strategy of walking . Further studies are required to determine the causes of changes in strategy with aging.
The economic impact of influenza is immense due to the large number of lost working hours, hospitalizations, further medical complications, and treatment costs . Although vaccines against influenza exist, the rapid mutation of influenza virus calls for constant surveillance and annual vaccine reformulation . A huge body of sequence data, annotations, and knowledge is available in the literature, online resources, and biological databases such as genbank, uniprot, protein data bank, epiflu database, openflu database, influenza research database (ird), and the immune epitope database (iedb). However, the underlying mechanisms of host / pathogen interaction are still not completely understood . The lack of a universal or broadly neutralizing influenza vaccine can be attributed to, among other factors, combinatorial complexity of the host immune system and the highly variable nature of viral antigens leading to immune escape of the emerging influenza variants [9, 10]. One approach, in an attempt to overcome challenges of immune escape, is to raise a t - cell response against class i or class ii epitopes conserved among viral strains [11, 12]. Public databases represent valuable resource for the study and development of broadly protective t - cell vaccines, but our ability to analyze these data falls behind the pace of data accumulation . They include keyword and text search tools, sequence comparison tools such as the blast algorithm or multiple sequence alignment tools such as mafft, muscle, and the clustal, 3d structure visualization tools [17, 18], hla binding prediction algorithms [1921], and conservation analysis tools [22, 23], among others . The application of these tools in discrete steps can yield valuable information; however the extraction of higher - level knowledge requires integrating data from multiple databases and employing various analytical tools to answer specific questions . For example, when a new infectious influenza strain emerges (such as h9n7 avian flu or a new seasonal flu) it is desirable to rapidly investigate its similarities and dissimilarities with known sequences, its epidemic or pandemic potential in humans, how different it is from the past vaccine strains, and its t- and b - cell epitopes from previously circulating strains and estimate its immune escape potential . Additionally, for new pandemic strains (such as 2009 swine flu) it is desirable to establish origin and identify strains that are useful vaccine candidates . Well - defined workflows enable rapid extraction of such knowledge and automated generation of reports that contain such information, for which knowledge - based systems have previously been utilized [26, 27]. The integration of multistep analysis of multidimensional data for vaccine analysis and discovery requires the automation of analytical workflows . Flukb is a knowledge - based system that integrates multiple types of influenza data and analytical tools into such workflows to support vaccine target discovery . The datasets in flukb consist of curated, enriched, and standardized protein sequence data, immunological data from multiple data sources, and a set of modular analysis tools . The analysis tools infrastructure comprises a library of individual tools along with standard (applicable to multiple pathogens) and specific influenza vaccine target discovery workflows . Furthermore, we developed a standardized nomenclature to enable and speed up data mining using automated workflows . Flukb has a user - friendly web - based interface to access the data, tools, predefined workflows, and workflow reports . Kb - builder consists of seven major functional modules that enable automated data extraction from multiple sources, data cleaning, import to a central repository, integration of basic analysis tools, integration of advanced analysis tools, workflow definition, and update and maintenance . The kb - builder framework enabled setting up a web - accessible knowledge base and the analysis workflows . A workflow takes the user request, performs complex analyses which combines specific data and analytical tools, and feeds the results into subsequent analyses to produce a comprehensive report . These interfaces access search routines, analytical tools, and workflows that use a combination of php, perl, common gateway interface (cgi), and c background software . Development of kb - build and flukb was carried out in centos 5.11 linux environment . The web server used is apache http server 2.2.3 so the access to the web server is per default parallelized for each user . The linux server is a 16-core server with 32 gb ram and should be able to handle the traffic to the website . The data repository within flukb contains four types of data: protein sequence data, hla - related data (t - cell epitopes and hla ligands), 3d crystal structures, and neutralizing antibody - related data . Protein sequences available from influenza a, b, and, c viruses were collected from ird and genbank, while hla - related data were collected from iedb . The complex structures of neutralizing antibodies against influenza virus hemagglutinin (ha) were collected from the protein databank (pdb). The binding and neutralization assays of each neutralizing antibody were collected from primary literature, as described in . The following sequence data and annotations were extracted from the ird: protein sequence, genbank identifiers (gi and accession numbers), uniprot i d, and nomenclature (type, host, location, i d, year, and subtype) when available . The metadata included a vocabulary that comprises the instances of the following terms: protein names, host names, geographic locations, years, and subtypes . The vocabulary comprised correct terms as well as variants of the terms, and erroneous terms . During updates, if all terms within the entry are matched to the correct terms, the entry is automatically annotated and converted into the flukb format . If an erroneous term is identified, the curator is alerted and the correct term is proposed for the entry . The curator then approves the change or manually corrects the entry and updates the vocabulary, when needed . Each new term identified in the update dataset the vocabulary iteratively increases in size with each update and less than 20 new terms are usually identified for each update . This approach enables data curation that is of extremely high quality and can be performed very fast (figure 2 upper path). We converted existing nomenclatures, whenever possible, into standardized formats . To verify the protein annotations of newly added entries, protein assignment of the strain proteomes was done by aligning the entry proteome sequence to a representative influenza reference sequences using the blast algorithm . We selected 10 proteins from uniprot that have detailed annotations as reference sequences for each protein of the two influenza types (a and b). The reference sequences are shown in supplemental table s1 (see supplementary material available online at http://dx.doi.org/10.1155/2015/380975). The immunological data extracted from iedb include t - cell epitope sequence, epitope type (hla binding, naturally processed, or t - cell epitope), pubmed references, experimental methods and results, and hla - allele restriction (figure 2 lower path). Flukb includes entries from iedb that bind hla class i or ii allele with at least one positive result, or those reported as t - cell epitopes . For each neutralizing antibody, the following descriptive information is provided in the flukb: isolation information (from human samples or from antibody phage - display libraries) from the primary literature, the corresponding crystal structure of antibody - ha complex from the pdb database, the b - cell epitope sequence variants detected from experimentally validated strains, and computationally defined b - cell epitopes on ha protein displayed as both sequence and 3d structure with jmol . Each influenza strain sample is annotated using the nomenclature originally proposed by the who providing a shorthand description of influenza virus strains . For example, the nomenclature of an influenza isolate of type a, subtype h2n3, isolated from a duck in heinersdorf in 1986, is written, using the original nomenclature as a / peking duck / heinersdorf/648 - 4/1986(h2n3) a / peking duck / heinersdorf/648 - 4/1986(h2n3) the lack of standardization of nomenclature has led to inconsistent nomenclature and incomplete metadata, thus increasing the difficulty in extraction of specific data subsets for analysis . First the organism name term is erroneous (peking duck is a traditional chinese dish, while second, it is unclear where heinersdorf is located . To ensure a complete access control over the sequence data within flukb each entry the key is represented in flukb as a standardized fasta header that provides a condensed and detailed summary of the sample's information . The flukb data mining key for the heinersdorf sample ha protein is> flu0175850|type: a|host:/mallard;anas platyrhynchos;8839|location: heinersdorf;berlin - germany;de - be|isolate:648 - 4|year:1986|subtype: h2n3|protein: ha|seqtype: complete|variant:1|vaccine:_|genbank: cy117179|geneinfo: 386644010|uniprot:_|original: a / peking duck / heinersdorf/648 - 4/1986|key: yes> flu0175850|type: a|host:/mallard;anas platyrhynchos;8839|location: heinersdorf;berlin - germany;de - be|isolate:648 - 4|year:1986|subtype: h2n3|protein: ha|seqtype: complete|variant:1|vaccine:_|genbank: cy117179|geneinfo: 386644010|uniprot:_|original: a / peking duck / heinersdorf/648 - 4/1986|key: yes this search key compresses detailed sequence annotations into the fasta format enabling easy combination of the results of sequence comparison with the analysis of annotations . Standardized formats for host and geographic location enable proper grouping and mapping of results . For host species, the ncbi - taxonomy ids and bird life international taxonomy (http://www.birdlife.org/datazone/info/taxonomy) names were used as standard terms, including the ncbi taxonomy number . For the geographical locations, two - letter iso codes for the countries and provinces were used (iso-3166, 2012). This allows for each of the host species and each geographic term to be described in nonambiguous terms . The fasta format is easily understandable because of the descriptive nature of the fields in the fasta header . Finally we use the term key: yes for all entries that could be fully annotated allowing them to be utilized within the analysis framework of flukb, while those that could not be fully annotated are assigned with key: no and can only be found by a search . These tools include a selection of keyword searching tools: mafft for multiple sequence alignment (msa) and blast for sequence similarity search . Specialized tools for the analysis of variability include sequence conservation metrics and their visualization using block entropy analysis . The t - cell epitope prediction tools for hla class i and class ii have been integrated within flukb for vaccine - related analyses . Flukb enables conservation analysis of single positions within protein sequences, of linear blocks of amino acids extracted from multiple sequence alignments (msa) of proteins using block entropy . In addition, virtual peptides can be constructed from discontinuous epitopes within msa and can be analyzed using block entropy, enabling the variability analysis of b - cell epitopes . It displays amino acids by their corresponding one - letter code on a graph where all the amino acids present in one position are stacked on top of each other, and the frequency in the position is then based on their individual height in the graph . Blocklogo enables variability analysis of peptides (either linear peptides or discontinuous strings of amino acids), rather than single residues . The combinatorial number of possible blocks that can be created from a weblogo can quickly become very large because of variation in individual positions . Blocklogo only shows the exact peptides that are most frequent for the investigated positions . For class the alleles available for predictions are hla - a02:01, -a03:01, -a11:01, -a2402, -b07:02, -b08:01, and -b15:01, since prediction accuracies for these alleles are relatively high . Additionally, we predict binders to hla - a01:01 since this allele is of very high frequency in the human population, although these predictions are of slightly lower accuracy than the seven benchmarked alleles . Collectively these alleles cover approximately 82% of human population . For class ii mhc predictions we used netmhciipan 3.0, with which users can predict binders to hla - drb101:01, 03:01, 04:01, 07:01, 11:01, 13:01, and 15:01, as these have been benchmarked and validated for high accuracy . The standardized data mining key in flukb enables sequence similarity searching and the display of a sequence's origin on the world map . For this purpose the query sequence is entered in the search window and optionally the maximal number of amino acid mismatches can be selected . It is combined with sequence similarity analysis to allow user to select a query sequence and find its closest matches in flukb and visualize them on the world map . This feature provides visualization of epidemiological information useful for evaluating the spread of a given virus and closely related variants . The flukb sequence repository as of december 2014 contains 402,306 sequence entries from 75,426 unique strains of influenza . There are 67,907 type a, 7,028 type b, 194 type c, and 297 unknown type sequence entries . Out of 330,435 full - length sequences and 71,501 fragments, 370 protein sequences failed to align well to any of the template alignments during the annotation process . Each sequence entry contains information about location, host, and time of isolation, as well as a standardized nomenclature for identification of strains . Each entry contains a protein sequence with standardized, curated, and enriched annotations (table 2). The epitope repository contains a total of 357 unique t - cell epitopes (194 class i and 163 class ii) and 685 unique hla binders (572 class i and 113 class ii). Each record describes the type of epitope (t - cell epitope, naturally processed, or hla binder), epitope sequence type (only exact epitopes are included in the repository), experimental method used for validation, hla - restriction, and literature references . Twenty - eight neutralizing antibodies against influenza virus have crystal structures of ha / antibody complexes available in pdb . Twenty of these antibodies target the globular head of the ha protein, and the binding sites of the remaining eight antibodies are located on ha stem region . All of these antibodies were classified as broadly neutralizing (cross neutralization within subtype or across subtypes) and strain - specific antibodies . We plan to have yearly updates of flukb moving forward as new data and tools become available . The sequence data collected from ird were subject to extensive cleaning, quality control (qc), and enrichment of annotations . We found that 142,232 (38.25%) of the 402.306 entries contained at least one type of error, ambiguity, or missing data . Most errors were in the geographic location fields where 72,340 (17.9%) had an error and 6,821 (12.1%) had missing information in the entry (see table 3). In the initial screen of the data we found 2,977 entries that did not conform to nomenclature standard, including 305 entries that lacked information about host species, 867 entries that lacked separation fields within the nomenclature, and 1,805 other deficiencies . Furthermore, abbreviations, alternative, and misspelled names constituted the largest proportion of errors and were present in more than 10,000 entries . All name - related errors were corrected by the dictionary consolidation using the dictionary of standardized metadata terms . An example of the redundancy is shown in table 1 where the host mallard is found in 16,457 of the flukb entries described by 14 different terms . In total, 96.41% of errors of various types described above were corrected and 469 standardized forms of missing data (such as location and host species) were added by manually searching the original literature . Our effort in the data cleaning and enrichment stage focused on minimizing errors and maximizing data completeness to enhance knowledge extraction for discovery of potential vaccine targets in influenza, as well as genetic and epidemiological modeling of viral strains . Because of the system of reference sequences, templates, and reference msa implemented in flukb, we expect that the majority of future entries will be automatically corrected, if they contain errors and redundancies already encountered by the system . Any new errors will be subject to manual curating and updating of dictionaries . To enable automated data mining and workflows, we created data mining keys from the original nomenclature of influenza viruses with standardized terms . The data mining keys utilized ncbis taxid database for host species and the iso codes for geographical location (iso-3166, 2012). A total of 398,078 sequences (98.95%) were assigned the new developed nomenclature, while 4,228 (1.05%) could not be assigned . The original standard nomenclature is included in the data mining key as a reference for additional literature searches and text mining of article databases . Data mining for vaccine targets often requires the analysis of subsets of data, for example, patient data such as specific hla profile, age group, phenotypes, or other factors . Similarly, epidemiological modelling may need analysis of sequences from certain hosts, for example, specific migrating birds, or limited to geographical locations . The host, time, and location of collection are key information that help determine the spread of specific influenza strains and are central for better understanding of influenza outbreaks . The data mining keys enable such analyses by having a standardized nomenclature, which pattern recognition algorithms can utilize as labels . Entries without the data mining key are made unavailable to the analysis on flukb as inclusion of entries that lack data could affect the reliability and the outcome of the results . The data mining keys are furthermore nomenclature crucial for the automation of computational analyses; standardization of nomenclature fields allows the computer to interpret the data automatically, which previously was limited . For instance, the taxonomy i d of hosts enables host specific analyses that can potentially reveal features important for interspecies transmission of influenza . Proper organization of data allows for grouping of data by ancestral species and the variability can be followed over time . Furthermore the iso codes for the geographical location by country and provinces enhance analyses in, for instance, epidemiological studies where an increased resolution in terms of actual spread can be analysed . This information can be used for the analysis of changes in t - cell and b - cell epitopes . In flukb, two search strategies can be deployed for sequence search: annotation - based or epitope - based . The first is a keyword search that enables the user to extract the data of flukb into specific subsets and the second is a sequence similarity search by blast . These search types are vital for the following data analysis as they enable the user to select the needed datasets based on specific scientific questions . The user can query the sequence entries for information such as the type, protein, subtype, year range, country, province, host, original nomenclature, and sequence type (fragment or full protein) by keyword search . An example of entry page retrieved by i d flu0306481 or strain name a / guangdong/1/2013, protein ha, is shown in figure 3 . Flukb has an indexed database generated from sequence entries that can be searched for sequence similarity using blast algorithm . The standard parameters are used: e value (10), word size (2), substitution matrix (blosom62), gap cost (11) and extension (1), size of the result list (500), and pairwise list (250). Besides sequence search, the flukb entries can be searched for t - cell epitopes and b - cell epitopes . Tab by entering either a list of sequence ids in the query window or a selection of subsets of proteins by name, influenza type, subtype, range of years of identification, country, province, host, or complete sequences / fragments . The protein subsets selection window (supplemental figure s1) can be used for sequence variability analysis and block entropy calculation under appropriate tabs . Epitope block entropy (t - cell epitopes) uses protein subsets selection window that enables the input of epitope sequence . The analysis of variability of viral sequences is important for understanding the emergence of new strains, immune escape, changes in pathogenicity, the extent of spread of viral strains, and vaccine design . The variability analysis can be performed interactively, but the variability analysis tools are also integrated in the t - cell and b - cell mapping tools and relevant workflows . The main tools for the analysis of variability are blast search that can be accessed from individual entries (figure 3, find similar sequences) or from the sequence alignment under the tools tab . The msa can be performed from the results of blast search by selection of sequences and clicking the the positions of variability within the msa results are color - coded for better visual inspection and each sequence is hyperlinked to its record (supplemental figure s2). The sequence variability analysis tool plots entropy (red curve) and the percentage of sequences (blue curve) containing the consensus amino acid at all positions along with the consensus sequence (supplemental figure s3). Block entropy calculation, which visualizes the conservation of peptides of lengths appropriate for immune recognition, rather than individual residues . For example, three t - cell epitope entries are displayed on the record entry page (figure 3). In addition, the prediction of t - cell epitopes can be performed by selecting allele and peptide length in the predicted hla binders the visual display of experimentally verified t - cell epitopes is shown in figure 4(b). T - cell epitope search can also be initiated from the search tab, where epitope can be searched by the sequence . The results will appear as a list of epitopes along with their binding or t - cell restriction specificities . The list is hyperlinked to the epitope record, an example of which is shown in figure 4(a). Finally, t - cell epitope search can be performed using the workflow titled vaccine targets under the workflows tab . After selection of input parameters, for example, allele hla - a0201, protein ha, influenza type a, subtype year(s) 2013 2014, affinity threshold 500 nm, and conservation threshold 95% (and remaining values default), 98 sequences will be selected and the report will be generated . B - cell epitope analysis can be performed from the search tab by selecting antibodies list . By the end of may, 2014, 28 antibodies and their detailed neutralizing and structural information have been deposited in flukb . These antibodies are listed on the webpage, while their respective b - cell epitopes can be displayed on three interactive structures: x-31 strain - specific antibodies on ha structure from 1ken, broadly neutralizing antibodies on ha structure from 1eo8, and influenza b virus antibodies on ha structure from 4fqk . This feature enables visual comparison of antibody - specific b - cell epitopes . For each neutralizing antibody, the isolation information, structure information, and computational identified b - cell epitope information can be accessed . Also, the neutralized motifs and escape motifs extracted from experimentally validated strains from the primary literature are presented as well . In addition, two workflows have been implemented for further analysis: the neutralization coverage estimation and b - cell epitope mapping (supplemental figure s4). The neutralized / escape coverage by a specific existing neutralizing antibody is calculated for the complete population of influenza strains . The strain population coverage by a neutralizing antibody can be assessed within any selected subset of influenza strains, such as year range, specific subtype, and geographic coverage . Cross neutralization coverage of a known neutralizing antibody can be estimated based on sequence comparison to the known neutralizing epitopes . This tentative discontinuous peptide is then compared to the b - cell epitopes of experimentally validated strains . Flukb offers the capability to address complex questions relating to sequence variability on very specific subsets, identification of potential t - cell epitopes, and selection and combination of these epitopes into polyvalent vaccine constructs . The tools and data can be reorganized and more tools can be created to answer additional questions, for example, relating to epidemiological modeling and analysis of cross protective potential of neutralizing antibodies . Publically available influenza data are a valuable resource for computational analyses with applications in vaccine design . Similarly, existing bioinformatics tools provide the means for extraction of information and new knowledge . However, to utilize the full potential of these resources, data preprocessing must be performed and analytical tools must be carefully combined into well - defined workflows . These workflows allow users to ask specific questions (scientific, technical, and clinical) and provide means for systematic data analysis . The infrastructure of data and tools is the backbone of flukb and similar knowledge - based systems [26, 27]. Despite many years of research and available vaccines, influenza remains a major public health burden and a threat of a major new pandemic . Multiple data sources provide information on protein and nucleotide sequences and immune epitopes in influenza [2, 58, 39, 40]. They represent well - maintained catalogues of influenza sequences and annotations, along with a selection of basic search tools . The flukb was developed focusing on a different purpose, the facilitation of data mining for influenza vaccinology and immunology of influenza infection . The flukb has very clean and standardized data, integrating information on antigen sequences, and immunological epitopes . The set of integrated analysis tools and workflows are designed to aid rational vaccine design . This includes the discovery of vaccine targets, assessment of variability, and in - depth analysis of immune epitope . Flukb is a unique data mining system for largely automated knowledge discovery from the ever - increasing body of influenza data with applications in both t - cell and b - cell immunology and vaccinology . Systematic discovery of influenza vaccine targets requires highly accurate, up - to - date, and standardized data of influenza antigens and immune epitopes . The sequence and epitope data available through publications, various reports, and databases vary in quality, granularity, and data formats . The extraction of knowledge and discovery of vaccine targets from diverse and scattered data sources are a challenging and time - consuming task . Flukb integrates the content and the analytical tools in a unified system that enables the automation of complex queries and discovery . Flukb is a contribution to the long - standing quest for universal influenza vaccines [41, 42] by allowing a large - scale analysis on a large collection of annotated influenza sequences.
Nasopharyngeal carcinoma (npc) is an endemic disease within specific regions in the world . The highest incidence is found among southern chinese people, especially those of cantonese origin, whereas among caucasians from north american and other western countries it is sporadic . Radiation therapy (rt), alone or combined with chemotherapy, is a paramount approach as initial treatment option for npc . Distant metastasis, however, remains one of the major problems after radical treatment in patients with locally advanced disease . We report a case of a 68-year - old patient with advanced npc who developed intrathoracic endotracheal metastasis after rt . We believe this to be the first reported case of intrathoracic endotracheal metastasis in an npc patient . A 68-year - old man presented at our in - patient department on september 21, 2004, with a 3-month history of headache and hearing loss . Computed tomography (ct) revealed a nasopharyngeal mass extending into the left parapharyngeal space, left carotid sheath, and skull base . An enlarged cervical lymph node, about 2 2 cm, was found in the left level ii . Pathology showed nasopharyngeal undifferentiated nonkeratinizing carcinoma . According to the 2002 american joint committee on cancer staging system, the patient received an initial dose of 66 gy by conventional rt and a boost dose of 10 gy by three - dimensional conformal radiation therapy (3d - crt) to the primary site . Prophylactic radiation was given to his bilateral neck with doses of 63.3 gy to the upper neck and 50 gy to the lower neck . However, 2 months later, a metastatic nodule about 1.5 1.1 cm was found in the left lower lobe of the lung . He received 4 cycles of chemotherapy with vinorelbine and cisplatin, 2 cycles of chemotherapy with docetaxel and cisplatin, and a 3d - crt dose of 66 gy to the nodule in 33 fractions over 6.5 weeks . Thirty - four months after the initial rt, the patient presented with a cough and hemoptysis . Ct showed the presence of an enlarged lymph node measuring approximately 1.5 1.5 cm in the para - aortic arch . 2). Immunohistochemical analysis found ck (+ +), ck7 (-), ck20 (-), ttf-1 (-), and eber (+ + +), confirming the tumor's nasopharyngeal origin . He was treated with conventional rt with anterior - posterior / posterior - anterior fields to 40 gy to his mediastinum . The patient tolerated the treatment well with no significant acute side effects and no treatment interruption . He died of nonmalignant disease with no signs of tumor recurrence in august 2008, 2 years after treatment completion . Metastatic tracheal tumors are extremely rare; they usually arise from direct invasion by neighboring primary lesions such as carcinomas of the bronchus, larynx, thyroid, or mid - esophagus . Similarly, tracheal metastasis from a very distant site has also been poorly documented and the upper trachea is the most frequently involved site . To the best of our knowledge, there is no report on intrathoracic endotracheal metastasis with nasopharyngeal origin . Distant metastasis after treatment is the main problem in npc patients with advanced disease . In a large cohort study by lee et al ., 2,687 consecutive patients were irradiated with 6-mv photons, and the median total dose was 66 gy . After a median follow - up of 3.4 years, 732 patients (27%) were found with progressive disease, 16% of whom had distant failure a predominant pattern of treatment failure . However, the specific sites of distant failure in that study were not given . Yi et al . Found the bone to be the most common site of distant metastasis, followed by the liver and the lung . The patient we presented here developed solitary metastasis both in the lung and in the para - aortic arch prior to the presence of an intrathoracic endotracheal lesion . It is not certain whether the secondary tracheal tumor is the consequence of the lung metastasis . Anatomically, lung malignancies may spread to the mediastinum and result in mediastinal lymph node involvement through intrapulmonary and hilar lymphatic drainage . The enlarged tracheal nodule in this patient was not likely to be caused by direct invasion of the mediastinal lymph nodes since they were separated anatomically . The presence of endophytic tumor growth and the intact outer layer of the trachea found on ct images suggest that it was most likely a separate metastatic deposit . Hemoptysis with coughing is the most common symptom in patients with endotracheal or endobronchial metastasis, with an incidence of 41 - 62% . Although ct provides valuable information about the tumor location and its effect on the distal lung parenchyma, lymph node status and other metastatic lesions, and helps us to plan further management, bronchoscopy remains the gold standard for quickly establishing the diagnosis and management [8, 9]. The appropriate management of patients with endotracheal metastases depends on tumor stage, tumor location, histopathology, patient's performance, and coexisting disease(s). Since these patients usually present with advanced disease, surgery should not be routinely performed unless the patient is in an emergency situation that needs prompt symptom relief . Bronchoscopic treatment can be considered as an alternative to surgery to avoid excessive morbidity and mortality associated with the procedure . However, if the treatment is not emergent, other modalities such as brachytherapy, external beam radiotherapy and chemotherapy can be considered . In our case, long - term complete tumor control was achieved by conventional rt plus 3d - crt, suggesting external beam rt may be an appropriate management approach to achieve long - term tumor control for this disease.
Though the exact incidence is unknown, it ranges from 3 - 10% in nulliparous population . It is a significant public health threat globally contributing greatly to maternal and perinatal mortality and morbidity . Extensive changes occur in the kidneys as part of the end - organ damage in preeclampsia . Proteinuria occurs as a consequence of reduction in the integrity of glomerular barrier or reduced tubular reabsorption . It remains an important objective criterion for diagnosis of preeclampsia and has been used to classify the severity as well as to predict adverse fetomaternal outcomes in preeclampsia . Among the various methods available to quantify proteinuria, alternative methods like a spot urine sample protein - creatinine (p / c) ratio avoid the influence of variations in urinary solute concentrations and can reduce the delay in diagnosis and management of preeclamptic patients . Though, serum uric acid level is of limited use in the initial diagnosis of preeclampsia, many investigators have shown that it correlates well with the disease severity . In this study, we have tried to correlate spot urine p / c ratio with 24-h urine protein estimation and test its diagnostic accuracy for detecting significant proteinuria . We have also correlated spot urine p / c ratio with serum uric acid levels and tried to analyze the association between proteinuria and hyperuricemia with adverse fetomaternal outcomes in preeclamptic women . This observational correlation clinical study was conducted after obtaining clearance from the hospital ethics committee . This was a prospective study conducted between november 2010 and may 2012, among pregnant women admitted to the hospital with a suspicion of preeclampsia . Primigravida with singleton pregnancy, with cephalic presentation, and a diagnosis of preeclampsia were included in the study . Preeclampsia was diagnosed when blood pressure was 140/90 mm hg or more, on two occasions, at least 4 h apart, or a single diastolic reading of 110 mm hg after the 20 week of pregnancy, and the presence of proteinuria of 1 + as detected by dipstick urine analysis . Women with previous renal disease, chronic hypertension, urinary tract infection, pathological vaginal discharge, and those who required delivery before the completion of a 24-h urine sample were excluded from the study . A total of 75 pregnant women who satisfied the inclusion and exclusion criteria were recruited after informed written consent for participation . Participants were asked to collect a random midstream urine sample for estimating the spot urine p / c ratio . They were then instructed to collect the 24-h urine starting from the second urine sample in the morning (i.e., after discarding the first morning specimen) till the first urine sample the next day morning . The urine p / c ratio was obtained by dividing the urinary protein concentration by the urinary creatinine concentration . Urine protein was measured by the urinary - cerebrospinal fluid protein method, which is an adaptation of the pyrogallol red - molybdate method . Urine creatinine was measured by the crea method, which is a modification of the jaffe's reaction . Serum uric acid was assessed using automated photospectrometric assay approved by the international federation of clinical chemistry for all the patients . All the patients were followed up till their delivery and the various parameters for maternal and fetal outcomes were noted . Fetal outcomes noted were apgar scores at 1 and 5 min, neonatal intensive care unit (nicu) admission, birth weight, any other neonatal complications like neonatal sepsis, stillbirth, seizures, and so on . Adverse maternal outcomes were defined as any maternal complications like abruption, eclampsia, postpartum hemorrhage, disseminated intravascular coagulation (dic), hemolysis, elevated liver enzymes, and low platelets (hellp) syndrome, and so on . R was used to correlate between spot urine p / c ratio, 24-h urine protein and serum uric acid levels . P was used to study the levels of spot urine p / c ratio, 24-h urine protein and serum uric acid level in predicting the fetomaternal outcomes . Receiver operating characteristic (roc) curve analysis was done to evaluate the diagnostic accuracy of spot urine p / c ratio to detect significant proteinuria (> 300 mg / day). The statistical software sas 9.2 was used for the analysis of the data and microsoft word and excel were used to generate graphs, tables, and so on . A total of 75 pregnant women with preeclampsia were recruited in the study after meeting our criteria . Of these, 73.3% had mild preeclampsia (proteinuria of 1 + using urine dipstick analysis) and 26.7% had severe preeclampsia (proteinuria of 2 + with urine dipstick). [table 1] shows the distribution of the patients according to their 24-h urine protein, spot urine p / c ratio, and serum uric acid levels . The pearson's correlation test showed a positive correlation between 24-h urine protein and spot urine p / c ratio (r = 0.373) with a p = 0.001 which was strongly significant [table 2]. Scatter diagram demonstrated a linear correlation between spot urine p / c ratio and 24-h urine protein [figure 2]. Roc curve analysis showed that the optimal cut - off value of spot urine p / c ratio to detect significant proteinuria (> 300 mg / day) was> 0.6, at which, the sensitivity was 73.53% and specificity was 65.85% . Area under curve (auc) was 0.799 (good test) [figure 3]. Though spot urine p / c ratio had a high sensitivity of 96.9%, but specificity was only 19% at cut - off value of spot urine p / c> 0.3 for significant proteinuria . A statistically significant and direct correlation was also found between serum uric acid and spot urine p / c ratio (r = 0.355, p = 0.002) [table 2]. Demographic data: (a) age in years, (b) period of gestation and (c) region - wise distribution distribution of patients according to 24-h urine protein, spot protein / creatinine ratio, and serum uric acid levels pearson's correlation between 24-h urine protein, spot urine protein / creatinine ratio, and serum uric acid scatter diagram showing correlation between spot urine protein / creatinine ratio and 24-hour urine protein as well as between serum uric acid and 24-hour urine protein receiver operating characteristic curves of spot urine protein/ creatinine ratio (bold curve) in reference to 24-hour urine protein (upper dashed curve) and serum uric acid (lower dashed curve). The cut - off value of spot p / c ratio is> 0.6, for which sensitivity is 73.53% and specificity is 65.85% with roc area under curve of 0.799 (good test) though there was no statistically significant association between proteinuria and hyperuricemia with the various fetal and maternal outcome parameters studied, as shown in tables 3, 4, and 5, we had three maternal complications, namely, abruptio placentae, intrapartum eclampsia, and hellp syndrome, which occurred in patients with significant proteinuria and elevated uric acid levels . There were 11 intrauterine growth restrictions (iugrs) in our study and it was most of the time (89%) associated with significant proteinuria . A stillbirth occurred in a patient with severe preeclampsia, induced at 30 weeks, who had significant proteinuria (534 g / day), a spot p / c ratio of 0.9 and normal serum uric acid levels . Fetomaternal outcomes with 24-h urine protein fetomaternal outcomes with spot urine protein / creatinine ratio fetomaternal outcomes with serum uric acid preeclampsia is a multisystemic disorder with endothelial dysfunction which affects 3 - 5% of all pregnancies and contributes greatly to fetomaternal morbidity and mortality . Renal dysfunction leading to proteinuria (a diagnostic hallmark of preeclampsia), along with hyperuricemia have been used to predict adverse pregnancy outcomes . 24-h urine protein estimation has been considered the gold standard for testing proteinuria but has the disadvantage of consuming time, delaying diagnosis, and thus delaying initiation of appropriate management . Alternative testing methods like p / c ratio on a single random urine sample have correlated well with the gold standard . This study was conducted from november 2010-may 2012, to estimate the diagnostic accuracy of spot p / c ratio, to evaluate efficacy of 24-h urinary protein, spot urine p / c ratio and serum uric acid in predicting the outcomes in preeclampsia and to correlate spot urine p / c ratio with serum uric acid levels . In our study, the mean age was 25.35 years and the mean gestational period was 36.9 weeks among 75 preeclamptic women . We found a moderate correlation between 24-h urine protein and spot urine p / c ratio which was statistically significant (r = 0.373, p <0.001). The roc curve analysis revealed a sensitivity of 73.53% and specificity of 65.85% with auc 0.799 (good test) for a cut - off value of spot p / c> 0.6 to detect significant proteinuria . In a similar study done by aggarwal et al ., in 120 preeclamptic women, the mean age was 26 years and mean gestational age was 32 weeks . They reported a significant association between the two tests with a correlation coefficient of r = 0.596 (p <0.01) and the sensitivity and specificity of spot p / c at a cut - off value> 1.14 of 72% and 75%, respectively . But they observed that the values of the spot urine p / c correlated well at higher levels of proteinuria . Thus, they concluded that the test could not rule out mild preeclampsia, and hence should not be used to replace 24-h urine protein estimation . Wheeler et al ., conducted a study among 126 patients admitted for evaluation of preeclampsia and reported a strong correlation of random spot urine p / c ratio with 24-h urine protein levels (pearson's r = 0.88). The optimal p / c cutoff was 0.21 (300 mg per 24 h) and 3.0 (5000 mg per 24 h). Auc was 0.86 for cut - off values of 0.21 and 1.0 for cut - off values of 3.0 . They concluded that though there is a strong association between the spot urine p / c ratio and 24-h urine protein excretion, the former lacks the ability to measure proteinuria quantitatively . Other reports have given conflicting results and report that 24-h urine collection should remain the standard for evaluation of preeclampsia . Durnwald and mercer in their comparative study between 24-h urine protein and spot urine p / c ratio among 220 preeclamptic women had a mean age of 26.1 years and gestational age of 36.5 weeks . They reported a poor correlation with coefficient of 0.41 between 24-h urine and spot urine p / c ratio . The roc analysis revealed no clear shoulder although the auc was 0.8 with a sensitivity of 55.8% and specificity of 81% at a cut - off value of 0.3 for spot urine p / c ratio . Morris et al ., in their systematic review and meta - analysis concluded that on an average, across all studies the optimal threshold of spot p / c ratio to detect significant proteinuria is between 0.30 and 0.35, relating to sensitivity and specificity values above 75% . Proteinuria in preeclampsia occurs due to altered glomerular permeability and/or changes in tubular reabsorption of filtered proteins . The severity of proteinuria has been regarded as a predictor for adverse maternal and fetal outcomes . A 24-h urine protein greater than 300 mg has been considered to be significant proteinuria . In our study, incidence of very low birth weight (<1500 g) increased from 9.8% to 17.6% as the 24-h urine protein exceeded 300 mg . Nicu admission increased from 19.3% to 38.2% and fetal complications like iugr and neonatal sepsis from 9.8 - 26.5% at 24-h urine protein values of 300 mg or more . There was one stillborn when the value of 24-h urine was more than 300 mg . There were three maternal complications namely, one abruptio placentae, one intrapartum eclampsia, and one hellp syndrome, all occurring when 24-h urine protein was> 300 mg . But overall, the differences in maternal and fetal outcomes related to 24-h urine protein levels greater than or less than 300 mg did not attain statistical significance . Similar findings were reflected in the prediction of adverse fetomaternal outcomes using spot p / c ratio . There was no nicu admission, very low birth weights, fetal complications in women with spot p / c <0.3 . Whereas 15.2% had very low birth weight, 37.95% had nicu admission and 19.7% had fetal complications with spot urine p / c> 0.3 . All the three maternal complications were present when spot urine p / c was> 0.3 . But none of the fetal and maternal parameters had significant association with spot p / c . Literature search revealed only one study which compared spot urine p / c in random urine samples with adverse outcomes in hypertensive pregnant women . This study done by martins costa et al ., retrieved the medical charts of 370 hypertensive pregnant women and divided them into three groups based on the spot urine p / c values (group 1: <0.3, group 2: 0.3 - 1.99, group 3 2.0). They compared the groups with composite maternal and perinatal outcomes like, dic, hellp, eclampsia, thrombocytopenia, neonatal sepsis, perinatal death, and small for gestational age . They reported that at random spot urine p / c values> 0.3, there was a high probability of having unfavourable maternal and fetal clinical outcomes, but additional increments were not associated with worsening of such outcomes, indicating the usefulness of the test to be diagnostic but not as a monitor of clinical worsening . Newman et al ., concluded in their study that women with preeclampsia and massive proteinuria did not have increased maternal morbidity compared with women with severe or mild proteinuria . A systematic review of 16 studies for estimation of proteinuria as a predictor of complications of preeclampsia concluded that measure of proteinuria is a poor predictor of either maternal or fetal complications ., questioned the commonly practised management decisions based on severity of proteinuria in preeclamptic women and highlighted the need for large well - designed prospective studies to address this important issue . The utility of serum uric acid as a marker of severity of preeclampsia has been substantiated by several studies . Yassaee found a strong correlation between apgar scores less than 7 and serum uric acid levels 6 mg / dl . In our study there were five iugrs (45%) in women who had uric acid levels more than 5.5 mg / dl and the same number in uric acid levels 3.5 - 5.5 mg / dl . We observed no differences in the occurrence of fetal complications, nicu admissions between the levels of uric acid 3.5 - 5.5 and> 5.5 mg / dl . Yassaee reported an (intra - uterine death) iud rate of 22% at uric acid levels more than 6 mg / dl . In the present study, no still births were found at levels> 5.5mg / dl with only one stillbirth at uric acid level 3.5 - 5.5 mg / dl (2.3%). Overall, we found no statistical significance between serum uric acid levels and the various parameters of fetal outcome in our study . The three maternal complications in our study, namely, abruptio placentae, hellp, and intrapartum eclampsia occurred when the uric acid levels were> 5.5 mg / dl, and we thought, this had a suggestive significance (p <0.063). Yaasaee noted that 22% had eclampsia with serum uric acid> 6mg / dl in their study . They showed a strong significant (p <0.01) relationship of hyperuricemia with maternal outcomes in their study . A retrospective analysis by parrish et al ., showed adverse maternal outcomes in 15.3% of 258 persons in their cohort study . In the present study, adverse maternal outcomes occurred in only 4% of the 75 patients studied . In a systematic review of accuracy of serum uric acid in predicting complications of preeclampsia, thangaratinam et al ., he concluded that serum uric acid is a poor predictor of maternal and fetal complications in women with preeclampsia . In this study as well, we could not confirm the association between serum uric acid and fetomaternal outcomes . The magnitude of proteinuria and hyperuricemia has been correlated with the severity of renal histological finding of glomerular endotheliosis . If so, is there any association between levels of proteinuria and serum uric acid? We tried to correlate proteinuria using spot p / c and 24-h urine protein with serum uric acid levels . Correlation coefficients showed a moderate correlation with urine spot p / c ratio and uric acid (r = 0.355, p <0.002) and poor correlation with 24-h urine protein and uric acid level (r = 0.118, p = 314). However, no studies have been reported till date regarding this and the sample size is very small to generalize the results . There was no blinding of the results of spot p / c ratio which might have influenced decisions regarding management of patients to avoid complications . As preeclamptic women on drugs were not excluded, the influence of these drugs on parameters studied might have been obscured . There were no patients with proteinuria more than 1 g, so we could not assess the impact of high levels of proteinuria on pregnancy outcomes . In the present study, we found a moderate correlation between 24-h urine protein and spot urine p / c ratio which was statistically significant (r = 0.373, p <0.001). The optimal cut - off value of spot urine p / c ratio for significant proteinuria was> 0.6 at which the sensitivity was 73.53% and specificity was 65.85% . The roc curve analysis for spot urine p / c ratio had an auc of 0.799 (good test). There was a moderate correlation between spot urine p / c ratio and serum uric acid (r = 0.355, p <0.002). There was no statistically significant association between proteinuria and serum uric acid with fetomaternal outcomes in preeclampsia.
Acute liver failure (alf) can be caused by the ingestion of mushrooms containing exceptionally powerful hepatotoxins . Among mushroom intoxications, the amatoxin syndrome is of primary importance because it accounts for about 90% of fatalities . It is characterized by an asymptomatic incubation period followed by the gastrointestinal and hepatotoxic phases, leading eventually to multiorgan failure and death . Although the exact incidence of mushroom poisoning is not precisely estimated due to a presumably relatively high number of underreporting cases, amatoxin poisoning is a worldwide problem . Approximately 50100 fatal cases are reported every year in western europe, being less common in the united states; however, cases of amatoxin poisoning from africa, asia, australia, and central and south america have been also described [1, 2]. Amatoxin poisoning is caused by mushroom species belonging to three genera amanita, galerina, and lepiota, with the majority of the fatalities attributable to amanita phalloides, commonly known as the death cap (figure 1). Being the most common and deadly cause of mushroom poisoning, the present paper analyzes the pathogenesis, clinical features, prognostic indicators, and therapeutic strategies of alf secondary to amanita phalloides intoxication . The toxicity of amanita phalloides is related to two distinct groups of toxins: phallotoxins and amatoxins . The phallotoxins consist of at least seven compounds, all of which have seven similar peptide rings . Their toxicity reside in the thiamide bond of the sulphur atom located on the indole ring . These toxins cause damage of the cellular membrane of the enterocytes and are therefore responsible of the initial gastrointestinal symptoms of nausea, vomiting, and diarrhea exhibited by almost all the patients . Even if phallotoxins are highly toxic to liver cells, they add little to the amanita phalloides toxicity as they are not adsorbed from the intestine and do not reach the liver . The amatoxins are bycyclic octapeptides, formed by at least nine different compounds . Of the amatoxins, -amanitin is the main component and along with -amanitin is likely responsible for the toxic effect [6, 7]. They are not destroyed by cooking and can be still present in the mushroom after long periods of cold storage . The lethal dose is very low: as little as 0.1 mg / kg body weight may be lethal in adults and this amount can be adsorbed even by ingesting a single mushroom . The liver is the principal organ affected, as it is the first organ encountered after absorption in the gastrointestinal tract . Once in the liver, amanitins are transported by a nonspecific transport system into hepatocytes, producing an extensive centrolobular necrosis [4, 10]. About 60% of absorbed -amanitin is excreted into the bile and is returned to the liver via the enterohepatic circulation [4, 1115]. However, other organs, especially the kidney, are susceptible to their toxicity . Amatoxins are not significantly protein bound and are cleared from plasma within 48 h of ingestion [16, 17]. They are filtered by the glomerulus and reabsorbed by the renal tubules, resulting in acute tubular necrosis . Finally, in animal and human post - mortem studies, cellular damage also has been found in the pancreas, adrenal glands, and testes [19, 20]. Amanitins directly interact with the enzyme rna polymerase ii in eucaryotic cells and inhibit the transcription, causing a progressive decrease in mrna, deficient protein synthesis, and cell death . For this reason, metabolically active tissues dependent on high rates of protein synthesis, such as the cells of the gastrointestinal tract, hepatocytes, and the proximal convoluted tubules of kidney, are disproportionately affected . Among other potential toxic mechanisms, it has been proposed that alpha - amanitin acts in synergy with endogenous cytokines (e.g., tumor necrosis factor) and that this might cause cell damage through the induction of apoptosis . The clinical picture due to amanita phalloides poisoning can range from a mild subclinical presentation to a lethal fulminant course . As a result, not all patients with amanita phalloides poisoning develop alf and have a fatal outcome . The overall severity of the intoxication depends on the amount of toxin ingested and the time elapsed between ingestion and initiation of treatment . The clinical picture of amanita phalloides intoxication as the toxins are not irritating by themselves, the initial phase is characterized by the absence of any signs or symptoms . The incubation time goes from 6 to 40 hours with an average of about 10 hours . It is important for an early diagnosis to suspect amatoxin intoxication in any case of a relatively prolonged latency period between mushroom ingestion and onset of symptoms, since other toxic mushrooms that do not cause liver involvement usually induce gastrointestinal symptoms much earlier, 1 - 2 h after ingestion [1, 2, 4, 10, 21]. (2) gastrointestinal phase . This phase is characterized by nausea, vomiting, crampy abdominal pain, and severe secretory diarrhea . This gastroenteritic phase may be severe enough to result in acid - base disturbances, electrolyte abnormalities, hypoglycemia, dehydration, and hypotension . This second stage lasts 12 to 24 h. after few hours, the patient seems to be clinically improving, if correction of the dehydration has been achieved . Liver and kidney function tests are usually normal at this point of the illness . If the association with toxic mushrooms is not made, these patients may be erroneously diagnosed with gastroenteritis and discharged home if hospitalized [1, 2, 4, 10, 21]. 3648 h after ingestion, signs of liver involvement may appear . In this third stage, despite the apparent improvement of gastrointestinal symptoms, the effects of toxins are damaging both the liver and kidneys, resulting in a progressive deterioration of liver enzyme tests with an increase of serum transaminases and lactic dehydrogenase . In the last phase, the transaminases rise dramatically and liver and renal function deteriorate, resulting in hyperbilirubinemia, coagulopathy, hypoglycemia, acidosis, hepatic encephalopathy, and hepatorenal syndrome . Multiorgan failure, disseminated intravascular coagulation, mesenteric thrombosis, convulsions, and death may result within 13 weeks after ingestion . In contrast, in those patients with a favourable outcome, a rapid improvement in liver function tests occurs, followed by a full recovery and restoration of a normal quality of life . Diagnosis is based on a careful assessment of history and clinical manifestations and can be confirmed by laboratory tests . The first task is to link the clinical presentation with mushroom ingestion, as the association may be obscured by the delay between symptom onset and the mushroom meal . When interviewing patients or the patient's relatives suspected of suffering from mushroom poisoning, physicians must obtain a detailed history concerning the ingestion . Key questions include the description of the eaten mushroom, the environment from which it was harvested, the number of different types of mushrooms ingested, the storage before consumption, the preparation before ingestion, the onset of similar symptoms in people who have eaten the same mushroom and the time frame between the mushroom ingestion and the onset of symptoms . Amanitins are resistant to heat and are still active after long periods of storage . Thus, in contrast to other toxins or bacterial contamination, cooking or prolonged cold storage may exclude other causes of mushroom intoxication, but not poisoning due to amanita phalloides [10, 24]. Analysis of amatoxin levels in serum is not available for routine use in the clinical setting . The role of this analysis is to confirm or exclude the diagnosis, not to grade the severity . We can use different methods of analysis (ria, elisa, hplc), which are highly sensitive, without false negatives if performed in the first 48 h after ingestion [23, 25]. These procedures for alpha - amanitin urine are quite diffuse and not available only in specialized centers . Furthermore, the relationship between the urinary concentration of -amanitin and the severity of the liver damage is very weak . Finally, the identification by a mycologist of any remaining mushrooms can be crucial for diagnosis . The clinical efficacy of any modality of treatment for amatoxin poisoning is difficult to demonstrate since randomized, controlled clinical trials have not been reported . The management of amatoxin poisoning consists of preliminary medical care, supportive measures, specific therapies, and liver transplantation . A complete analysis of the world experience in treatment of amatoxin poisoning was published in 2002 by enjalbert et al . . Because of the long asymptomatic latency, the clinical utility of these measures seems to be quite limited . Data to support or exclude the use of the emesis induced by ipecac syrup administration are insufficient, as well as for the use of whole bowel irrigation . The first goal should be directed to treat dehydration, electrolyte abnormalities, and metabolic acidosis caused by the gastrointestinal phase of the intoxication . Detoxification procedures consist of two different approaches: the reduction of intestinal absorption and enhancement of excretion . Repeated activated charcoal administration should avoid reabsorption of the toxins due to their enterohepatic circulation, although there is no evidence that its use improves clinical outcome . Gastroduodenal aspiration through a nasogastric tube has been recommended as a sole technique or combined with activated charcoal to remove bile fluids and interrupt enterohepatic circulation, but the actual benefit of these procedures is not documented . If diarrhea has ceased, the use of cathartics is recommended [2, 21]. Intense forced neutral diuresis is no longer recommended, with urinary output of 100200 ml / h for 4 - 5 days being sufficient to increase the renal elimination of amatoxins . Although the real efficacy of this method, or that of the other liver support systems, should be analyzed in appropriate trials, their use may represent a potential additional option to treat patients with severe amanitina poisoning . Mars is a modified dialytic method that mimics the biological features of the hepatocyte membrane by transferring protein - bound and water - soluble toxic metabolites from the blood stream into a dialysate compartment via a special membrane . The method was shown to be efficient in improving liver function by continuously removing protein - bound substances . However, it is generally accepted that extracorporeal decontamination treatment is useful only if started very early, soon after the gastrointestinal symptoms occur . According to retrospective data, most authors indicate that silibinin and n - acetylcysteine (nac) may be effective in the management of patients with amanita phalloides poisoning [1, 2, 4, 21]. Many other drugs were used in the past for amatoxin poisoning: antibiotics, antioxidants, thioctic acids, hormones, and steroids: all have been abandoned . Silibinin, a water soluble silymarin derivate, competes with amatoxins for transmembrane transport and inhibits the penetration of amanitin into hepatocytes, thus having direct hepatoprotective effect . Moreover, silibinin appears to affect also the secondary uptake in the liver mediated through an enterohepatic recirculation . Administration of silibinin is recommended if the patient is seen within 48 hours of ingestion . The doses are 2050 mg / kg / day intravenously and treatment should be continued for 4896 hours . Silymarin capsules may also be given in dose from 1.4 to 4.2 g / d orally [30, 31]. Penicillin g seems to have a similar mechanism of action, displacing amanitin from the binding to plasma protein and thus promoting its excretion and preventing its hepatic uptake . Penicillin g is used in continuous intravenous administration of high doses of na / k penicillin g (1,000,000 iu / kg for the first day, then 500,000 iu / kg for the next two days). Although combined treatment with silibinin and penicillin has been suggested, there are no clinical data to support that this approach is superior to monotherapy with silibinin . Data suggesting hepatoprotection by antioxidants support the use of free radical scavengers, such as n - acetylcisteine (nac), in the management of amatoxin intoxication . Nac is used in many centers in patients with alf not induced by paracetamol and its administration has been proposed also in cases of amatoxin poisoning although the data are quite limited . N - acetylcysteine is usually administered intravenously in 5% dextrose, but 0.9% saline may be also used . The suggested dosage is 150 mg / kg over 15 min intravenously, followed by 50 mg / kg over 4 hours intravenously, followed by 100 mg / kg over 16 hours intravenously . Infusion of the initial dose over 30 to 60 minutes (rather than 15 minutes) may reduce incidence of anaphylactoid reactions [33, 34]. Amatoxin poisoning may progress into alf and eventually death, if liver transplantation (lt) is not performed . On the basis of the available data, the mortality rate after amanita phalloides poisoning ranges from 10 to 20% [2, 29, 30]. Patients with severe liver injury should be admitted to intensive care unit connected to a liver transplant centre . Two surgical options, orthotopic liver transplantation (olt) and auxiliary partial liver transplantation (apolt), have been developed . Olt is a well - established procedure requiring long immunosuppression to prevent graft rejection . Because some patients with partial hepatectomy and temporary support may have complete morphological and functional recovery of their own liver, only a portion of the native liver is removed and the remainder is left in situ; the transplant provides temporary assistance until the native liver recovers and the immunosuppression can be withdrawn . The major dilemma in patients with alf is to find the right timing for transplantation . If the surgical procedure is performed too early, the patient could have survived without impaired quality of life . If the search for a liver graft starts too late, the patient may die before a suitable donor organ becomes available . Several sets of criteria to decide the timing of liver transplantation in patients with alf have been proposed, although they are not universally accepted (table 2). Since the number of patients with amatoxin poisoning evaluated for lt is quite small, the most widely used criteria for urgent lt in patients with alf are those of the king's college hospital described by o'grady et al . Which include different parameters for paracetamol and nonparacetamol induced alf . These criteria are based on prothrombin time (pt), age, etiology, time elapsing between appearance of jaundice and onset of encephalopathy, and bilirubin concentration . In contrast, the clichy criteria for urgent lt are based on factor v, age, and encephalopathy . However, some of these criteria cannot be easily transferred in patients with amatoxin poisoning . Retrospectively analyzed the outcome of a large series of amatoxin intoxication cases and found that predictors of death were the prothrombin index in combination with the serum creatinine level on 310 days after ingestion . However, although the presence of hepatic encephalopathy is an absolute requirement for the diagnosis of alf in king's and clichy criteria, this clinical manifestation was not adequately investigated in the paper by ganzert et al . Because of imprecise data in the patient's records . Thus, these authors proposed that a patient with amatoxin poisoning should be listed for urgent lt regardless of the presence of hepatic encephalopathy, if the prothrombin index is less than 25% and serum creatinine greater than 106 mol / l at the third day after ingestion . Also escudi et al ., in a retrospective study including 27 patients admitted for amanita phalloides poisoning, suggested that encephalopathy should not be an absolute prerequisite for deciding liver transplantation . Nonetheless, independently of any other variables, a decrease in prothrombin index below 10% of normal (inr> 6) 4 days or more after ingestion should lead to consider urgent lt . Interestingly, these authors proposed that an interval between the ingestion of toxic mushrooms and the onset of diarrhea shorter than 8 h should prompt an especially careful monitoring because of the high risk of fatal outcome . Finally, it should be taken into account that most of studies on the efficacy of prognostic criteria for urgent lt in patients with alf have been carried out in countries where graft is usually available within a short time . However, the waiting time on the emergency transplant list, if it exists, may be very prolonged in other parts of the world, and liver transplant may never be performed in others . In these situations, the use of new therapies (i.e., mars) could be useful as well as the availability of other surgical techniques, such as apolt.
Exogenous endophthalmitis generally arises from a direct breech of external - ocular barrier as a complication of ocular trauma or intraocular surgery . Endogenous endophthalmitis is a rare form of endophthalmitis as it accounts for only 28% of all endophthalmitis cases [1, 2]. Endogenous endophthalmitis is caused by breeching of the blood - ocular barrier by pathogens and is spread by blood - borne route originating from infective foci, for example, endocarditis, liver abscess, urinary tract infection (uti), and meningitis . Although the infective foci can often be identified, isolated occurrence from iatrogenic source such as dental surgery and contaminated intravenous fluids are also possible [3, 4]. A number of systemic conditions might predispose patients in developing endogenous endophthalmitis, including diabetes mellitus, cardiac diseases, underlying malignancy, immunosuppression, and intravenous drug abuse . The causative organisms of endogenous endophthalmitis have been found to vary largely between different geographical locations [57]. In most published series, which contained both fungal and bacterial endogenous endophthalmitis, fungal infections were the most common causes [810]. For bacterial endogenous endophthalmitis, gram - positive organisms were more prevalent in north america and europe, while gram - negative organisms were more commonly found in asia . Prompt diagnosis and treatment of endogenous endophthalmitis are important as the final visual outcome of endogenous endophthalmitis is potentially devastating . Studies have suggested that endogenous endophthalmitis due to fungal infection, in particular candida species, were more likely to result in better visual outcome [810]. The aim of this study is to evaluate the clinical features, causative organisms, infective sources, and outcomes of endogenous endophthalmitis in three tertiary eye centers in hong kong over an 8-year period . We also aimed to assess whether the type of infection would influence the visual outcome by comparing eyes with bacterial endogenous endophthalmitis versus those with fungal endogenous endophthalmitis . This was a retrospective study of consecutive cases of infective endogenous endophthalmitis in three hospitals including hong kong eye hospital, queen elizabeth hospital, and prince of wales hospital in hong kong . Inclusion criteria included diagnosis of infective endogenous endophthalmitis proven by blood culture from 2000 to 2007 . Exclusion criteria included patients with ocular surgery within one year of presentation, those with history of ocular trauma, and delayed onset of exogenous endophthalmitis . The clinical information studied included age and gender, preexisting ocular and medical conditions, presenting ocular features, infective foci and microbiological results, treatment, final visual outcome, and survival . The study was performed in accordance with the declaration of helsinki and was approved by an institutional review board . All data were entered into a spreadsheet program (microsoft excel for mac 2011, microsoft inc ., redmond, wa, usa) and analyzed using a statistical software (statplus: mac 2009, analystsoft inc ., the main outcome measure of the study was the visual outcome at the latest follow - up visit, in particular, the proportion of eyes with vision of finger counting (fc) or better . Eyes which had been enucleated or eviscerated were assigned to have vision of no light perception (nlp). Categorical variables were compared using the chi - square test, and odds ratios were calculated . Based on the study by connell et al ., we hypothesized that eyes with fungal endogenous endophthalmitis will have a better visual prognosis, with 90% of eyes having vision of fc or better, compared with 50% of eyes for bacterial endogenous endophthalmitis . With an alpha of 5%, our sample size of 16 eyes with bacterial endogenous endophthalmitis and 6 eyes with fungal infection will have a 54% power to detect a significant difference between the two groups a total of 22 eyes of 21 patients (one patient with bilateral involvement) was identified to have endogenous endophthalmitis during the study period (table 1). The mean standard deviation (sd) age of the patients at presentation was 61.8 13.9 years (range: 22 to 89 years). The mean follow - up duration of the patients was 2.7 2.2 years (range: 1 month to 6.3 years). Twenty (95.2%) of the 21 patients presented within 30 days of the onset of ocular symptoms such as blurring of vision, eye redness, or eye pain, with only one patient presenting 90 days after the onset of ocular symptoms . The median and mean duration from the onset of ocular symptoms to presentation was 2 and 12 days, respectively (range: 1 to 90 days). Preexisting medical conditions that predisposed the development of endogenous endophthalmitis included diabetes mellitus (11 eyes, 50%), urinary tract infection (8 eyes, 36.4%), septicemia (7 eyes, 31.8%), recent general surgery (5 eyes, 22.7%), liver abscess (4 eyes, 18.2%), and malignancy (4 eyes, 18.2%). Two subjects (9%) had undergone renal transplant and were on systemic immunosuppressive therapy . Other medical conditions included indwelling catheter, intravenous drug use, pneumonia, and soft tissue abscess in one case each . All eyes at presentation were found to have inflammation involving the anterior chamber with cells of 1 + or more . Other common ocular clinical findings included vitritis (19 eyes, 86.4%), hypopyon (13 eyes, 54.5%), conjunctival chemosis (10 eyes, 45.5%), posterior synechiae (6 eyes, 27.7%), and keratic precipitates (6 eyes, 27.7%). At presentation, eight (36.4%) eyes had vision of fc or better and the remaining had visual acuity of hand motion (hm) or worse . Eyes that had endogenous endophthalmitis due to fungal infection were more likely to have vision of fc or better compared with eyes that had endogenous endophthalmitis due to bacterial infection (83.3% versus 25% resp ., odds ratio = 15.0, chi - square test, p = 0.013). Following the onset of endogenous endophthalmitis, all patients had diagnostic tapping for ocular specimen for microbiological investigations, including vitreous tap in 15 (68.2%) eyes and aqueous tap in 10 (45.5%) eyes . All diagnostic taps were performed at the time of initial presentation with ocular symptoms and prior to commencement of intravitreal antimicrobial therapy . Four samples from the vitreous tap and two samples from the aqueous tap were found to be culture positive . Blood cultures were also performed in the patients and were positive in all (100%) cases . Gram - negative organisms were found to be the causative microorganism in 11 eyes (50%), gram - positive organisms in 5 eyes (22.7%), and fungus in 6 eyes (27.3%) (table 2). The most common microorganisms were klebsiella pneumoniae (8 cases) followed by candida sp . The most common primary focus was urinary tract (7 eyes, 31.8%), followed by liver (4 eyes, 18.2%) (table 1). Topical antibiotics (17 eyes), intravitreal antibiotics (16 eyes), and systemic antibiotics (17 eyes) were used in the treatment of bacterial endogenous endophthalmitis . Antifungal drugs, given as intravitreal injection (5 eyes) and/or systemically (6 eyes), were used in cases with fungal endogenous endophthalmitis . Topical corticosteroid treatments were also used in 9 selected cases to reduce the extent of ocular inflammation . Systemic corticosteroid was also used in one patient to control the severe intraocular inflammation associated with neovascularization of the iris . Pars plana vitrectomy (ppv) was performed in 4 (18.2%) eyes following the development of endogenous endophthalmitis, and 6 (27.3%) eyes were enucleated or eviscerated due to uncontrollable infection with nlp vision . There was a suggestive trend of having more enucleation or evisceration in eyes that had bacterial endogenous endophthalmitis (6 eyes, 37.5%) compared with fungal endogenous endophthalmitis (0 eye, 0%) but the difference failed to reach the level of statistical significance (chi - square test, p = 0.07). Ten (45.5%) eyes had va of nlp, with five eyes having final va between 20/400 and 20/200 . There was no significant difference in the proportion of eyes having vision of fc or better at the latest follow - up between bacterial and fungal cases (25% versus 16.7%, p = 0.68). Eyes with more acute presentation (within 48 hours of the onset of symptoms) were less likely to have a final vision of fc or better compared with those who presented later (7.7% versus 44.4%, odds ratio = 0.10, p = 0.041). The final visual acuity of one patient was not available as the patient died 1 month after presentation of endogenous endophthalmitis . There were 3 (14.3%) deaths during the follow - up period, two of which were related to systemic sepsis and the third death was due to disseminated nasopharyngeal carcinoma with multiple metastases . Endogenous endophthalmitis is a rare form of endophthalmitis which occurs when pathogen crosses the blood - ocular barrier and causes intraocular infection . Diagnosis of endogenous endophthalmitis is mainly based on clinical findings, and empirical treatment is usually administered while waiting for the microbiological investigations results from blood or intraocular specimens . Endogenous endophthalmitis is commonly associated with systemic conditions that can cause a relative immunocompromised state . In a major review of 267 cases of bacterial endogenous endophthalmitis by jackson et al ., 56% of patients had an underlying condition that increased the risk of infections . In our current study, 90.9% of patients had one or more identifiable preexisting predisposing condition and the commonest systemic condition found was diabetes mellitus (50%). Other coexisting potential risk factors included uti (36.4%), septicemia (31.8%), liver abscess (18.2%), malignancy (18.2%) and renal transplant (9.1%) with use of immunosuppressive therapy . Similar results can also be found in the literature as studies have demonstrated that up to 42% of endogenous endophthalmitis patients had underlying diabetes mellitus [6, 11]. Connell et al . Also reported that 14.2% with bacterial infection had coexisting malignancy . In our series the most common source was urinary tract in 36.4%, followed by liver abscess in 18.2% and soft tissue abscess and pneumonia in 4.5% each . Chung et al . Reported in their series of korean patients that 22.2% had pneumonia and 16.7% had liver abscess, while wong et al . Reported in a singapore cohort that 48% of bacteremia arose from the hepatobiliary tract . Intravenous drug use (ivdu) was reported to be another risk factor more commonly in the west . Connell et al . Reported a figure of 48.1% of fungal infection cases that had ivdu, while leibovitch et al . Showed that that 23.1% were ivdu and all of them suffered from fungal infection . In our series, only 1 case (4.5%) of ivdu was identified but the patient had staph . This relatively low positive rate revealed the difficulty of making a microbiological diagnosis in endogenous endophthalmitis . In order to improve the sensitivity and the speed of diagnosis, the use of polymerase chain reaction (pcr) technique for diagnosing endogenous endophthalmitis has been advocated . However, the technique is not without disadvantages as there is a false - positive rate of 5% due to sample contamination and antibiotics sensitivity cannot be determined with pcr . Most of the published series that have included both fungal and bacterial endogenous endophthalmitis showed that fungal endogenous endophthalmitis was more common compared with bacterial cause [811]. In our current series the commonest species found was klebsiella pneumoniae, which was present in 8 eyes (36.3%). These results were different compared with those reported in north america and europe, where the majority of organisms found were fungal or gram - positive bacteria . There has been a rising trend of gram - negative organisms causing endogenous endophthalmitis recently, especially in the south east asia [7, 10, 12, 1416]. The exact cause for the higher proportion of cases with gram - negative endogenous endophthalmitis is unknown but might be due to the higher prevalence of hepatobiliary infections in asian countries [12, 17, 18]. Endogenous endophthalmitis associated with klebsiella sp . Is well documented to be associated with a poorer prognosis [19, 20]. In our series, 50% eyes requiring enucleation or evisceration were infected with klebsiella sp . 62.5% klebsiella infection coexisted with diabetes mellitus and 50% of them had liver abscess . In a 20-year review, ang et al . Concluded that, in endogenous klebsiella endophthalmitis, presence of hypopyon and unilateral involvement are associated with poorer prognosis . Similar association of worse prognosis in eyes with hypopyon was also observed in our patients with klebsiella endogenous endophthalmitis . Six (75%) of eight eyes with klebsiella endogenous endophthalmitis had hypopyon at presentation and all ended having nlp vision with 50% requiring evisceration . For the two (75%) eyes without hypopyon, the va at presentation was hm and fc, respectively, but the final va of these two cases both improved to 20/100 after prompt treatment . Treatment modality for bacterial endogenous endophthalmitis employed in our series included intravitreal and systemic antibiotics and antifungal as well as surgical treatments like ppv . Intravitreal antibiotics are generally essential in treating bacterial endogenous endophthalmitis as most topical or systemic antibiotics do not reach sufficient therapeutic level in the vitreous . The use of intravitreal antibiotics has been reported to reduce the chance of evisceration or enucleation but it did not significantly improve the visual prognosis . Ppv is another important treatment option as previous study has demonstrated that ppv can result in an 85% anatomical success rate with 80% retained a vision of fc or better after surgery . In addition, the chance of requiring enucleation or evisceration was also reduced after ppv . Despite treatment, although previous studies suggested that fungal endogenous endophthalmitis was associated with better vision compared with bacterial endogenous endophthalmitis [810], our findings showed no significant difference in the proportion of eyes with fc or better vision at the latest follow - up . This highlights the need to have better therapeutic agents for intraocular fungal infections . In conclusion, in contrast with previous studies, our series showed that bacterial causes in particular gram - negative bacteria were more common than fungal causes of endogenous endophthalmitis . Despite recent advances in the medical and surgical treatment of postoperative exogenous endophthalmitis, there appeared to be little improvement in the clinical outcome of endogenous endophthalmitis in the recent years . A higher index of suspicion with early diagnosis with new molecular techniques and aggressive treatment might hopefully improve the prognosis in the future.
Disc herniation protrudes mediolaterally into the spinal canal, the migration of the lumbar intervertebral disc fragment to the posterior epidural space is a rare event . Rapid advances in neurosurgical knowledge and technology are putting increased pressure on neurosurgeons to process huge quantities of information, with requirements for continuous learning and updating scientific knowledge and skills which are time - consuming but essential, and significant advances occurred in investigative methods such as magnetic resonance imaging and computerized tomography (ct) heralded a revolution in noninvasive imaging of the spinal disorder, this revolution leaded to increase the preoperative diagnosis of posterior epidural migrated lumbar disc, and 61 cases have been reported to date . We report the case of a 46-year - old woman presented with perforation of her ligamentum flavum (lf) by sequestrated posterior epidural lumbar intervertebral disc . To the best of our knowledge, there are no previously reported cases of perforation lf by a posterior epidural migrated sequester disc . A 46-year - old woman presented with left side radiculopathy started 2 weeks before admission . Clinical examination revealed steppage gait and a strength score of three - fifth on dorsiflexion of feet . Patellar reflex was depressed, and there were no sphincter dysfunction or no saddle anesthesia . Magnetic resonance imaging showed a sequestrated disc fragment in the posterior epidural space of the left l4l5 level that compressed the dural sac [figures 1 and 2]. Axial magnetic resonance imaging sequestrated posterior epidural lumbar disc sagittal images of the case the patient underwent surgery using posterior approach before performing left l4 hemipartial laminectomy, perforation of lf by posterior epidural migrated lumbar disc was noted [figure 3]. When the sequestered fragment was followed downward, it was clearly seen that the disc fragment was posteriorly and laterally compressing the l5 root from the axilla . The extruded disk fragment was gently removed without incising lf and l4l5 interspace was explored . Operative picture shows the perforated ligamentum flavum by sequestrated posterior lumbar disc fragment postoperative computed tomography images of patient the patient underwent surgery using posterior approach before performing left l4 hemipartial laminectomy, perforation of lf by posterior epidural migrated lumbar disc was noted [figure 3]. When the sequestered fragment was followed downward, it was clearly seen that the disc fragment was posteriorly and laterally compressing the l5 root from the axilla . The extruded disk fragment was gently removed without incising lf and l4l5 interspace was explored . Operative picture shows the perforated ligamentum flavum by sequestrated posterior lumbar disc fragment postoperative computed tomography images of patient one of its causes is lumbar disc which may migrate superiorly, inferiorly, or laterally . Posterior migration of sequestered disc fragment is very uncommon, but we first time report the perforation of lf by such a disc fragment . Our case should not be surprised because the intervertebral disc is the larger of two types of weight - bearing joints that make up the repeating vertebral motion segments in the spine . . One of this structures is lf from the axis to sacrum extending downward from the lamina of the respective anatomic segment . The lf is thick and short and is symmetrical on both the left and right sides . On each side the upper attachment of the medial portion is to the lower half of the ventral surface of the lamina, and the attachment of the lateral portion is to the inferior aspect of the pedicle . The medial portion passes to the back of the next lower lamina and attaches to the upper quarter or so of the dorsal surface of that lamina . The lateral portion passes in front of the zygapophysial joint formed by the two vertebrae that the ligament connects . The most lateral fibers extend along the root of the superior articular process as far as the next lower pedicle to which they are attached . This part of the lateral portion of the lf has continuous fibrous connections with the synovium . This two layer anatomy of ligamentum flavum may have for its perforation . For entering the epidural space, surgeon should remove the superficial layer of the lf, and dissect the deep layer from its attachment to the anterosuperior portion of the caudal lamina, which can best be accomplished with the use of a small angled curette alone or with a kerrison rongeur . At each level however, our present case indicates that lateral part of flavum may not be as strong as medial part . To the best of our knowledge, this is the first case characterizing the perforation of lf by a lumbar disc fragment . This degenerative process is multifactorial, irreversible and may be associated with a mechanical dysfunction . Our case is 46 years old, has no degenerative, spinal stenosis or age - related changes of her spine . In this case, the lf was perforated by sequestrated disc at the left side . In literature, this point for epidural disc migration is interesting; we agree that this point should be investigated . Human body, which appears symmetrical along the midline grossly, is, in fact, asymmetrical both morphologically and physiologically . Low back pain has long been connected to postural and structural asymmetries . While externally there is a difference in bilateral dimensions of various body parts and musculature, internally, it is due to asymmetrical positioning of viscera as well as variations in bilateral skeletal dimensions . More stress and strain on the dominant side may cause differences between the sides, often referred to as directional asymmetry . Wolff's law says bone formation occurs along lines of stress the bones and muscles respond by growing more vigorously and increasing in density on exposure to repeated high levels of mechanical loading . Left - sided epidural disc herniations in reported human studies may be explained by this way . Asymmetric features of epidural disc migration, and should be investigated, because treatment of spine pathologies should consider anatomic rule . Posterior epidural migrated lumbar disc fragments are an extremely rare disorder . To the best of our knowledge, there are no previously reported cases of perforation lf by a posterior epidural migrated sequester disc . Our case is important if indeed one is the first to report something and that something is of value.
Mosseri et al.1) reported that conduction disturbances were more frequent in patients with compromised blood flow of the septal branches after coronary artery bypass grafting (cabg) operation . They analyzed the association of conduction disturbance and the location of cad in 43 patients, who had permanent pacemaker implantation and coronary angiography (cag), by classifying coronary pathology into 4 categories (table 1), and reported that compromised blood flow to septal branch and right coronary artery (rca, type iv anatomy) was significantly associated with severe conduction disturbances.2) henceforward, several studies reported the predominance of type ii and type iv anatomy in patients with severe conduction disturbance.3)4) although there are several studies supporting the causal relationship of conduction disturbances and underlying coronary anatomy, this association is not clear, particularly from the view of avb reversibility . In a study by omeroglu et al.5) 8 patients with cad and complete avb were treated with cabg operation, but none of these patients recovered from complete avb after revascularization . Yesil et al.6) investigated 53 patients who had third - degree avb and significant cad, and the result showed only a small percentage of patients recovered from a third - degree avb (19% in medical and 27% in interventional treatment) without statistically significant difference . These studies may indicate that revascularization is not helpful in the recovery of conduction disturbances . In this regards, we evaluated the association of avb and cad, to elucidate whether avb is reversible in patients with cad . This study was approved by the institutional review board of seoul national university hospital (irb no . H-1109 - 011 - 376). From january 2005 to june 2011, 280 consecutive patients with clinically - significant new - onset avb admitted to seoul national university hospital via outpatient clinic or emergency department were enrolled . Clinically - significant avb requiring pacemaker was defined as follows; complete avb and advanced avb including 2: 1 avb . Ninety - two patients, who underwent pacemaker revision and implantable loop recorder insertion, were excluded and total 188 patients were analyzed in this study (fig . Baseline demographic variables of gender, age, height, weight, body mass index (kg / m), smoking status and amount of smoking in pack - year, history of diabetes mellitus, hypertension, hypercholesterolemia, renal insufficiency, cerebrovascular accident, atrial fibrillation, cad, prior revascularization therapy (including percutaneous coronary intervention and cabg), other prior open heart surgeries, cardiomyopathies, congenital heart disease, valvular heart disease, a family history of sudden cardiac death, and a family history of premature cad in first - degree relatives (<55 years in males and <65 years in females) were identified based on the electronic medical records . Coronary artery disease was determined on the result of cag, coronary ct angiography, and myocardial single photon emission computerized tomography (spect). Significant cad was defined as> 50% stenosis of epicardial coronary artery by cag and coronary ct angiography, or perfusion decrease of myocardial spect . Coronary pathologies were classified into 4 types according to classification of mosseri et al.2); type i, lesions not related to septal branches or the atrioventricular (av) node; type ii, lesions compromising blood supply to septal branches emerging from the left anterior descending artery (lad); type iii, lesions compromising blood supply to the av node; and type iv, lesions compromising blood supply both to septal branches emerging from the lad and to the av node (table 1). When determining coronary pathologies, results of myocardial spect were not counted, as it could not designate the specific location . The test or the fisher exact test was used for categorical variables . To evaluate the association of cad and conduction disturbance which require implantation of permanent pacemaker, univariate and multivariate all statistical analyses were performed with software, statistical package for the social sciences (spss) 18.0 (spss inc ., chicago, il, usa) and a p<0.05 was considered statistically significant . This study was approved by the institutional review board of seoul national university hospital (irb no . H-1109 - 011 - 376). From january 2005 to june 2011, 280 consecutive patients with clinically - significant new - onset avb admitted to seoul national university hospital via outpatient clinic or emergency department were enrolled . Clinically - significant avb requiring pacemaker was defined as follows; complete avb and advanced avb including 2: 1 avb . Ninety - two patients, who underwent pacemaker revision and implantable loop recorder insertion, were excluded and total 188 patients were analyzed in this study (fig . Baseline demographic variables of gender, age, height, weight, body mass index (kg / m), smoking status and amount of smoking in pack - year, history of diabetes mellitus, hypertension, hypercholesterolemia, renal insufficiency, cerebrovascular accident, atrial fibrillation, cad, prior revascularization therapy (including percutaneous coronary intervention and cabg), other prior open heart surgeries, cardiomyopathies, congenital heart disease, valvular heart disease, a family history of sudden cardiac death, and a family history of premature cad in first - degree relatives (<55 years in males and <65 years in females) were identified based on the electronic medical records . Coronary artery disease was determined on the result of cag, coronary ct angiography, and myocardial single photon emission computerized tomography (spect). Significant cad was defined as> 50% stenosis of epicardial coronary artery by cag and coronary ct angiography, or perfusion decrease of myocardial spect . Coronary pathologies were classified into 4 types according to classification of mosseri et al.2); type i, lesions not related to septal branches or the atrioventricular (av) node; type ii, lesions compromising blood supply to septal branches emerging from the left anterior descending artery (lad); type iii, lesions compromising blood supply to the av node; and type iv, lesions compromising blood supply both to septal branches emerging from the lad and to the av node (table 1). When determining coronary pathologies, results of myocardial spect were not counted, as it could not designate the specific location . The test or the fisher exact test was used for categorical variables . To evaluate the association of cad and conduction disturbance which require implantation of permanent pacemaker, univariate and multivariate logistic regression analysis all statistical analyses were performed with software, statistical package for the social sciences (spss) 18.0 (spss inc ., chicago, il, usa) and a p<0.05 was considered statistically significant . Irreversible avb was observed in 173 patients (ib group) who had undergone implantation of a permanent pacemaker . There were significant differences in gender, smoking status, and serum level of high density lipoprotein - cholesterol (hdl - c) and c - reactive protein (crp) between the 2 groups . In the ib group, 75 (43.4%) were male and 11 (6.4%) were current smokers, while rb group had 11 (73.3%) males and 4 (26.7%) current smokers (p=0.031 for gender, p=0.021 for smoking status). Serum level of hdl - c was higher in ib group (46.5610.95 mg / dl vs. 40.0010.07 mg / dl, p=0.030), whereas crp was higher in rb group (0.531.24 mg / dl vs. 1.991.80 mg / dl, p=0.014). There was no difference in other characteristics between the two groups . In the ib group, 129 (74.6%) had no cad on admission, 40 (23.1%) had stable angina, 2 (1.2%) presented with unstable angina, and 2 (1.2%) presented with acute myocardial infarction (ami). In contrast, the rb group had 13 (86.7%) with ami, one (6.7%) with stable angina, and one (6.7%) without cad on admission (p<0.001). On the aspect of cad type and reversibility of avb, 13/15 (86.7%) patients had ami, 0/2 (0%) had unstable angina, and 1/41 (2.4%) with stable angina had reversible avb (fig . The proportion of reversible avb in patients with ami was significantly higher than other groups; patients without cad, with stable angina, and with unstable angina . The reversibility of avb was analyzed according to the distribution of coronary pathology (table 3). 43 (24.9%) of 173 patients in the non - ami group and 15 (100.0%) of 15 patients in the ami group had cad . Avb was rarely reversible in the non - ami group as only one of 43 patients (2.3%) showed reversible avb . In contrast, 13 of 15 patients with ami (86.7%) had reversible avb and there were significant difference between non - ami group and ami group (p<0.001). Among 15 patients with ami, 11 patients had inferior wall st - segment elevation myocardial infarction (stemi) and 1 patient had anterior wall stemi . There were 2 patients with ami in ib group, showing inferior and anterior wall stemi for each . Rca lesions were found in 25 (15.0%) in the non - ami group and 14 (93.3%) in the ami group (p<0.001) by cag . The proportion of reversible avb among patients with rca lesion was also significantly higher in ami group (p<0.001). According to mosseri et al's2) classification, the number of patients with cad in the non - ami group were: 4 (9.3%) type i anatomy, 9 (20.9%) type ii anatomy, 7 (16.3%) type iii anatomy, and 23 (53.5%) type iv anatomy . One patient whose avb was reversible had type iii anatomy . In the ami group, according to this same classification system, no patients had type i anatomy, 1 (6.7%) patient had type ii, 5 (33.3%) patients had type iii, and 9 (60.0%) patients had type iv . The proportions of reversible avb in type iii and type iv were higher in the ami group (p=0.072 for type iii and p<0.001 for type iv). The composite of type ii and iv, in which septal blood flow of lad is compromised in common, was found in 32 (74.4%) patients from the non - ami group and avb was irreversible in all patients, while the composite was found in 10 (66.6%) patients of ami group and 9 (90.0%) patients had reversible avb (p<0.001). Among demographic variables and the status of cad on admission, we identified factors that showed significant association with reversibility of avb by univariate and multivariate logistic regression analysis (table 4). Univariate analysis revealed several significant factors; male gender {odds ratio (or) 3.593, 95% confidence interval (ci) 1.101 - 11.732, p=0.034}, current smoker (or 5.355, 95% ci 1.464 - 19.594, p=0.011), cad (or 41.045, 95% ci 5.245 - 321.208, p<0.001), and ami on admission (or 555.750, 95% ci 72.302 - 4271.773, p<0.001). Multivariate analysis was used to clarify these uncertainties and showed an obvious result; ami on admission was the only associated factor (or 350.409, 95% ci 21.406 - 5736.146, p<0.001). Irreversible avb was observed in 173 patients (ib group) who had undergone implantation of a permanent pacemaker . There were significant differences in gender, smoking status, and serum level of high density lipoprotein - cholesterol (hdl - c) and c - reactive protein (crp) between the 2 groups . In the ib group, 75 (43.4%) were male and 11 (6.4%) were current smokers, while rb group had 11 (73.3%) males and 4 (26.7%) current smokers (p=0.031 for gender, p=0.021 for smoking status). Serum level of hdl - c was higher in ib group (46.5610.95 mg / dl vs. 40.0010.07 mg / dl, p=0.030), whereas crp was higher in rb group (0.531.24 mg / dl vs. 1.991.80 mg / dl, p=0.014). In the ib group, 129 (74.6%) had no cad on admission, 40 (23.1%) had stable angina, 2 (1.2%) presented with unstable angina, and 2 (1.2%) presented with acute myocardial infarction (ami). In contrast, the rb group had 13 (86.7%) with ami, one (6.7%) with stable angina, and one (6.7%) without cad on admission (p<0.001). On the aspect of cad type and reversibility of avb, 13/15 (86.7%) patients had ami, 0/2 (0%) had unstable angina, and 1/41 (2.4%) with stable angina had reversible avb (fig . The proportion of reversible avb in patients with ami was significantly higher than other groups; patients without cad, with stable angina, and with unstable angina . The reversibility of avb was analyzed according to the distribution of coronary pathology (table 3). 43 (24.9%) of 173 patients in the non - ami group and 15 (100.0%) of 15 patients in the ami group had cad . Avb was rarely reversible in the non - ami group as only one of 43 patients (2.3%) showed reversible avb . In contrast, 13 of 15 patients with ami (86.7%) had reversible avb and there were significant difference between non - ami group and ami group (p<0.001). Among 15 patients with ami, 11 patients had inferior wall st - segment elevation myocardial infarction (stemi) and 1 patient had anterior wall stemi . There were 2 patients with ami in ib group, showing inferior and anterior wall stemi for each . Rca lesions were found in 25 (15.0%) in the non - ami group and 14 (93.3%) in the ami group (p<0.001) by cag . The proportion of reversible avb among patients with rca lesion was also significantly higher in ami group (p<0.001). According to mosseri et al's2) classification, the number of patients with cad in the non - ami group were: 4 (9.3%) type i anatomy, 9 (20.9%) type ii anatomy, 7 (16.3%) type iii anatomy, and 23 (53.5%) type iv anatomy . One patient whose avb was reversible had type iii anatomy . In the ami group, according to this same classification system, no patients had type i anatomy, 1 (6.7%) patient had type ii, 5 (33.3%) patients had type iii, and 9 (60.0%) patients had type iv . The proportions of reversible avb in type iii and type iv were higher in the ami group (p=0.072 for type iii and p<0.001 for type iv). The composite of type ii and iv, in which septal blood flow of lad is compromised in common, was found in 32 (74.4%) patients from the non - ami group and avb was irreversible in all patients, while the composite was found in 10 (66.6%) patients of ami group and 9 (90.0%) patients had reversible avb (p<0.001). Among demographic variables and the status of cad on admission, we identified factors that showed significant association with reversibility of avb by univariate and multivariate logistic regression analysis (table 4). Univariate analysis revealed several significant factors; male gender {odds ratio (or) 3.593, 95% confidence interval (ci) 1.101 - 11.732, p=0.034}, current smoker (or 5.355, 95% ci 1.464 - 19.594, p=0.011), cad (or 41.045, 95% ci 5.245 - 321.208, p<0.001), and ami on admission (or 555.750, 95% ci 72.302 - 4271.773, p<0.001). Multivariate analysis was used to clarify these uncertainties and showed an obvious result; ami on admission was the only associated factor (or 350.409, 95% ci 21.406 - 5736.146, p<0.001). The main finding of this study is that avb in patients with ami is usually reversible, while avb in patients with cad other than ami is usually irreversible . This result indicates that permanent pacemaker implantation should be delayed in cases of ami . To our knowledge, the present study is the first to describe the reversibility of avb in each type of cad . Although we could not provide the optimal timing to confirm the reversibility of avb in each type of cad, the results of this study deserve special consideration . The causal relationship between avb and inferior wall ami avb complicates inferior wall ami in 10% to 15% of cases,7 - 9) and most of these patients can be recovered from avb by revascularization.10 - 12) however, the association of cad other than ami and reversibility of avb is still unclear and is rarely studied . In this context, we tried to evaluate the association of avb and cad, in order to elucidate whether avb is reversible in patients with cad . The blood supply of the av node is from the posterior interventricular artery, which is a branch of rca in right - dominant individuals . In the remainder of individuals, the av node is still supplied by the posterior interventricular artery, but that artery is a branch of the left circumflex artery; the coronary circulation of these individuals is considered left - dominant . Intraventricular conduction system is supplied by septal branches from lad, especially the first septal perforator branch from proximal lad.13) this physiologic background has been supported by several studies . Mosseri et al.2) reported that a compromised blood flow of the septal branch and the rca were associated with conduction disturbances . Tandoan et al.,3) yesil et al.,14) and wei et al.4) reported similar results; stenoses of septal branch from lad or rca are associated with avb . However, revascularization of the stenosed coronary artery could not reverse conduction disturbances.5)6) in the present study, status of cad on admission showed significant difference between the ib group and the rb group . The majority of the ib group had no evidence of cad, while the rb group was mainly consisted of ami patients . Patients with ami recovered from avb after revascularization therapy in most of cases, which is concordant with previous reports.10 - 12) in contrast, almost all patients without ami eventually underwent implantation of a pacemaker, as they did not recover to sinus rhythm . With this result, we can postulate that patients with avb and ami have a higher chance to return to sinus rhythm by coronary revascularization, and it is not applied to the patients without ami . Patients with new - onset avb might present with ami, unstable angina, or stable angina . When planning implantation of pacemaker in these patients, it should be noted that dual - antiplatelet therapy is usually required after pci in the era of drug - eluting stent.15) on the other hand, dual - antiplatelet therapy at the time of pacemaker implantation might increase the risk of bleeding complication and extend procedure time.16 - 18) considering this clinical aspect and our study results, we recommend application of different therapeutic strategies for each entity (fig . If a patient of new - onset avb presents with ami, revascularization therapy is definitely required for treatment of ami . But for the treatment of avb which is a resultant feature of ami, pacemaker implantation should be delayed as this type of avb has very high probability to return to sinus rhythm after appropriate revascularization . If a patient with avb presents with unstable angina, we recommend that the patient undergo pacemaker implantation first, and then revascularization therapy . In the present study, considering the necessity of dual - antiplatelet therapy after coronary interventions,15) it would be rational to undergo pacemaker implantation prior to revascularization . If patients of new - onset avb have no evidence of ami or unstable angina, then pacemaker implantation would be the most important treatment, because the reversibility of avb in these patients is hardly expected . The result of multivariate analysis in table 4 confirmed the strong causal relationship between ami and new - onset avb . Male gender, smoking status, and existence of cad were significantly associated factors on univariate analyses, but not on multivariate analysis . As male gender and smoking status are distinct risk factors of cad, it seems that gender and smoking status are not major components in the reversibility of avb . The most important aspect of this result is the strong association of ami and reversibility of avb, but not cad itself . This result also poses a question of whether cag as a routine procedure prior to implantation of permanent pacemaker is mandatory . The location of pathologic coronary artery among patients with irreversible avb showed similar distribution, compare to the results of previous several studies (table 5).2 - 6)14) in the present study, type iv was the most common type of coronary pathology and type ii was the second most common type in ib group; type i anatomy observed in 9.1% of patients with cad, type ii in 22.7%, type iii in 15.9%, and type iv in 52.3% . In the study by yesil et al.14) the distribution of coronary pathology was 9.6% type i, 38.7% type ii, 16.0% type iii, and 35.0% type iv . Tandoan et al.3) studied 78 patients who had pacemaker implantation and angiographically proven cad, and the distribution was 19% type i, 24% type ii, 11% type iii, and 45% type iv . In the study by mosseri et al.2) type i and iv were the most frequently observed types (44.4% for each type) among 36 matched patients with permanent pacemaker . Generously, type ii and type iv were much more frequently observed in patients with irreversible avb which required implantation of permanent pacemaker . Thus, our study result supports the association of avb and underlying cad, which compromise the blood flow to septal branch or the rca . The similarity shared by our result and previous studies not only supports the validity of our study, but also increases the potential for generalization . By screening all patients with new - onset avb who visited our hospital, majority of patients had no evidence of cad, while only 2 patients presented with unstable angina . Second, this was an observational retrospective study, based on the electronic medical records . No standardized protocol was used to indicate tests in advance, although attending physicians referred to guidelines for managing avb . Third, a further prospective study is required to investigate the effect of revascularization on the reversibility of avb . Our results show that avb in patients with ami is usually reversible after revascularization treatment, while patients with avb (without ami) usually required implantation of a permanent pacemaker, irrespective of the presence of cad . Avb in patients with cad other than ami is usually irreversible, therefore implantation of a pacemaker should be considered on a preferential basis . Majority of patients had no evidence of cad, while only 2 patients presented with unstable angina . Second, this was an observational retrospective study, based on the electronic medical records . No standardized protocol was used to indicate tests in advance, although attending physicians referred to guidelines for managing avb . Third, a further prospective study is required to investigate the effect of revascularization on the reversibility of avb . Our results show that avb in patients with ami is usually reversible after revascularization treatment, while patients with avb (without ami) usually required implantation of a permanent pacemaker, irrespective of the presence of cad . Avb in patients with cad other than ami is usually irreversible, therefore implantation of a pacemaker should be considered on a preferential basis.
End - stage renal disease (esrd) is a major healthcare problem worldwide, especially in developing countries . According to centers for disease control and prevention (cdc), more than 10%, or more than 20 million, people aged 20 years and older in the usa have chronic kidney diseases (ckd). In india, due to the absence of national registry, a recent indian study has shown that the burden of incident esrd in india continues to be substantial and is going to be a major health problem . Moreover, due to the economic constraints, less than 10% of the patients receive definite renal replacement therapy . Malnutrition, which is multifactorial in origin, is one of the major hurdles (18 - 75%), contributing to mortality of dialysis patients . Restricted diet, metabolic acidosis, gastroparesis, appetite suppression as a side effect of the drugs, chronic volume overload, presence of acute or chronic systemic diseases that cause inflammatory responses, and dialysis itself contribute to malnutrition in these patients . Serum leptin is increased in ckd and may be responsible for the anorexia malnutrition syndrome . However, other studies show that malnutrition in renal failure may be due to chronic inflammatory process reflected by increase in crp . The short half - life of leptin (25 min) requires that it be rapidly cleared from blood either via degradation in peripheral tissues or via filtration across the glomerular basement membrane . Studies available in the literature show controversial results for the role of serum leptin in malnutrition, and very few studies are available in indian population to explore such relationship . Crp is a member of the class of acute - phase reactants, as its levels rise dramatically during inflammatory processes occurring in the body . This increment is due to a rise in the plasma concentration of il-6, which is produced predominantly by macrophage as well as adipocytes . Inflammation (increase in crp) is also one of the contributory factors for malnutrition . Due to paucity of studies that demonstrate the effect of serum leptin and crp on body mass index (bmi) in patients with esrd on hemodialysis in india, this study was planned with the aim of reviewing the association of bmi with serum leptin and crp levels in esrd patients, and comparing the effectiveness of using serum leptin as a biomarker vis - - vis crp to predict nutritional status . Study results were compared with those of age-, gender-, and bmi - matched (control) indian population . The study group comprised 40 patients with esrd on maintenance hemodialysis for more than 3 months at lok nayak hospital . Patients suffering from any acute infection, acute renal failure, or any endocrine disorder except diabetes mellitus, and those who were taking glucocorticoids 8 weeks prior to or during the study were excluded from our study . The control group consisted of 40 healthy hospital staff members of both genders; routine hematologic investigations such as hemogram, kidney function tests, and lipid profile were carried out in the control group and found to be within normal limits . Complete medical history was obtained, and relevant clinical examination including the following anthropometric tests was performed: (a)standing height with bare feet was measured accurately to nearest 0.5 cm. (b)body weight was recorded with an avery weighing scale accurately to within 50 g.(c)body surface area (bsa) in square meter (m) was calculated from the height and weight using dubois formula.bsa (m) = wt (kg) ht (cm) 0.007184(d)lean body mass (lbm)/body fat estimation is the difference between total body mass (weight in kg) and weight of the body fat . It can be derived from the following formula: lean body weight (men) = (1.10 weight (kg)) 128 (weight/(100 height (m)))lean body weight (women) = (1.07 weight (kg)) 148 (weight/(100 height (m)))(e)bmi in kg / m was calculated from total body mass (m, i.e., weight in kilograms) and height (h in meters) using the formula bmi (kg / m) = m/(h h). Bmi is a reliable indicator for estimation of body fat, wherein a high bmi value usually indicates high levels of body fat and vice versa . Body weight was recorded with an avery weighing scale accurately to within 50 g. body surface area (bsa) in square meter (m) was calculated from the height and weight using dubois formula . Bsa (m) = wt (kg) ht (cm) 0.007184 lean body mass (lbm)/body fat estimation is the difference between total body mass (weight in kg) and weight of the body fat . It can be derived from the following formula: lean body weight (men) = (1.10 weight (kg)) 128 (weight/(100 height (m))) lean body weight (women) = (1.07 weight (kg)) 148 (weight/(100 height (m))) bmi in kg / m was calculated from total body mass (m, i.e., weight in kilograms) and height (h in meters) using the formula bmi (kg / m) = m/(h h). Bmi is a reliable indicator for estimation of body fat, wherein a high bmi value usually indicates high levels of body fat and vice versa . Routine hematologic investigation (hemogram, blood sugar, urea, and lipid profile) and special investigations (serum leptin and crp) were carried out . Drg leptin elisa kit, which is a solid - phase enzyme - linked immunosorbent assay based on sandwich principle, was used for the quantitative determination of leptin levels in serum . It is based on the principle of measurement of antigen - antibody reaction by end - point method using turbidimetric immunoassay . Student's t - test was used for analysis and p> 0.05 was considered as significant . Complete medical history was obtained, and relevant clinical examination including the following anthropometric tests was performed: (a)standing height with bare feet was measured accurately to nearest 0.5 cm. (b)body weight was recorded with an avery weighing scale accurately to within 50 g.(c)body surface area (bsa) in square meter (m) was calculated from the height and weight using dubois formula.bsa (m) = wt (kg) ht (cm) 0.007184(d)lean body mass (lbm)/body fat estimation is the difference between total body mass (weight in kg) and weight of the body fat . It can be derived from the following formula: lean body weight (men) = (1.10 weight (kg)) 128 (weight/(100 height (m)))lean body weight (women) = (1.07 weight (kg)) 148 (weight/(100 height (m)))(e)bmi in kg / m was calculated from total body mass (m, i.e., weight in kilograms) and height (h in meters) using the formula bmi (kg / m) = m/(h h). Bmi is a reliable indicator for estimation of body fat, wherein a high bmi value usually indicates high levels of body fat and vice versa . Body weight was recorded with an avery weighing scale accurately to within 50 g. body surface area (bsa) in square meter (m) was calculated from the height and weight using dubois formula . Bsa (m) = wt (kg) ht (cm) 0.007184 lean body mass (lbm)/body fat estimation is the difference between total body mass (weight in kg) and weight of the body fat . It can be derived from the following formula: lean body weight (men) = (1.10 weight (kg)) 128 (weight/(100 height (m))) lean body weight (women) = (1.07 weight (kg)) 148 (weight/(100 height (m))) bmi in kg / m was calculated from total body mass (m, i.e., weight in kilograms) and height (h in meters) using the formula bmi (kg / m) = m/(h h). Bmi is a reliable indicator for estimation of body fat, wherein a high bmi value usually indicates high levels of body fat and vice versa . Routine hematologic investigation (hemogram, blood sugar, urea, and lipid profile) and special investigations (serum leptin and crp) were carried out . Drg leptin elisa kit, which is a solid - phase enzyme - linked immunosorbent assay based on sandwich principle, was used for the quantitative determination of leptin levels in serum . It is based on the principle of measurement of antigen - antibody reaction by end - point method using turbidimetric immunoassay . Student's t - test was used for analysis and p> 0.05 was considered as significant . The study and control groups were similar in terms of anthropometric parameters such as age, height, weight, and bmi [table 1]. Comparison of anthropometric data in study and control groups on comparing the biochemical parameters across the study and control groups [table 2], we observed the following: comparison of biochemical parameters in study and control groups serum electrolytes (sodium and potassium) and lipid profile [cholesterol, triglycerides, high - density lipoprotein (hdl), and low - density lipoprotein (ldl)] were similar across the two groups.hemoglobin levels were significantly lower in the study group.blood sugar and kidney function test (urea) levels were observed to be significantly higher in the study group . Serum electrolytes (sodium and potassium) and lipid profile [cholesterol, triglycerides, high - density lipoprotein (hdl), and low - density lipoprotein (ldl)] were similar across the two groups . Blood sugar and kidney function test (urea) levels were observed to be significantly higher in the study group . Special investigations were conducted to measure serum leptin and crp levels in the study and control groups [table 3]. Comparison of serum leptin (ng / ml) and c - reactive protein (mg / dl) in study and control groups serum leptin levels were significantly higher in the study group (1.44 0.72 ng / ml) compared to that in the control group (0.68 0.55 ng / ml). Similar observation holds true when we analyze the serum leptin levels in male and female patients separately . 0.001, i.e., highly significant.crp levels were also higher in the study group (3.93 1.20 mg / ml) compared to that in the control group (0.28 0.24 mg / ml). Similar observation holds true when we analyze the crp levels in male and female patients separately . The difference in the study and control groups was significant at p <0.001, i.e., highly significant . Serum leptin levels were significantly higher in the study group (1.44 0.72 ng / ml) compared to that in the control group (0.68 0.55 ng / ml). Similar observation holds true when we analyze the serum leptin levels in male and female patients separately . The difference in the study and control groups was significant at p <0.001, i.e., highly significant . Crp levels were also higher in the study group (3.93 1.20 mg / ml) compared to that in the control group (0.28 0.24 mg / ml). Similar observation holds true when we analyze the crp levels in male and female patients separately . The difference in the study and control groups was significant at p <0.001, i.e., highly significant . On further analyzing the correlation of serum leptin and crp with bmi in the study group [figure 1], we observed the following: correlation of serum leptin and c - reactive protein with body mass index serum leptin and bmi have a statistically significant positive correlation (r = 0.314), with a p value of 0.048.crp and bmi did not show any significant correlation (r = 0.126) with a p value of 0.438 . Serum leptin and bmi have a statistically significant positive correlation (r = 0.314), with a p value of 0.048 . Crp and bmi did not show any significant correlation (r = 0.126) with a p value of 0.438 . The above results indicate that serum leptin might be a better biomarker than crp for predicting nutritional status in esrd patients on maintenance hemodialysis . This study was an effort to find the association of body weight with serum leptin levels and crp in patients with chronic renal failure on hemodialysis . This study comprised 80 subjects, i.e., reasonably good subjects of either gender spread over a wide age range (20 - 70 years), thus justifying a better exploration of the correlation between serum leptin and bmi in esrd patients on hemodialysis in indian population . In the complex chronic renal failure syndrome the markers of malnutrition were strongly associated with poor quality of life . Although many causes of malnutrition have been mentioned in the literature, one of the most talked about causes is the increase in serum leptin levels . Reported that hormone leptin increases in ckd and may be responsible for the anorexia malnutrition syndrome . Serum leptin levels in this study were significantly higher in patients with ckd on maintenance hemodialysis than that in controls (p <0.001). This may be because kidney is responsible for about 80% of leptin clearance in healthy individuals . It is cleared from the circulation by the process of glomerular filtration followed by metabolic degradation in renal tubules . In patients with normal renal function, there is a net renal intake of 12% of circulating leptin, whereas in patients with ckd there is no renal uptake of leptin . These findings are in close agreement with those reported by many indian as well as western work . Bmi is a simple, accurate, and reproducible calculation based on height and weight . Many studies are available in the literature to correlate the relationship between serum leptin levels and bmi in patients with esrd on hemodialysis with controversial results . Few studies reported by iglesias et al ., nizhizawa et al ., and lonnqvist et al . Had shown a strong direct correlation between serum leptin levels and bmi . Had shown that there was no correlation between plasma leptin levels and history of weight change during dialysis . The present study further reinforces the direct correlation of serum leptin with bmi in ckd patients on hemodialysis, which is in accordance with the theory of reverse epidemiology . However; the control group did not show any significant correlation to document the same . A recent study reported by pecoits et al . On hemodialysis patients suggested a paradoxically inverse association between higher serum leptin levels and markers of nutritional status, a finding that was consistent with the theory of reverse epidemiology given by kalantar et al . In the same year inflammation has generally been agreed to be one of the reasons for anorexia and hypoalbuminemia in hemodialysis patient . Subsequently, nordfors et al . Proposed that among the patients with esrd, leptin gene expression is higher in those who have elevated crp . Hence it was of interest to examine crp, the marker of inflammation, and correlate with bmi in hemodialyzed patients . The mean levels of crp in this study were significantly and markedly higher in patients with ckd compared with that in controls . This study failed to establish any correlation between the crp levels and bmi in patients with esrd on maintenance hemodialysis . This finding is in close agreement with those reported by stenvinkel et al . And viikari ., this study demonstrates the superiority of serum leptin vis - - vis crp as a biomarker to assess nutritional status in patients with esrd on hemodialysis.
There have been questions about its class i versus ii versus iii classification, or it being a lever in the first place [1416] and the loading assumptions . But it is the lever model, coupled with the bending beam analogy of the mandible that form the foundation of the generally accepted (longitudinal) stress distribution pattern depicted in figure 1(a) [1821] and its variant, figure 1(b) [18, 20, 22, 23]. The lever is an oversimplified structural representation of the jaw, so biomechanical concepts derived from it should be suspect . In the present context, the lever's intrinsic vertical - only occlusal force is its primary drawback . Thus, the principal purposes of this paper are to demonstrate, with basic analytical engineering mechanics, but barebones mathematics, the shortcomings of the lever / beam model - based concepts that relate to the surgery of the mandible . More specifically, the central issues involve (1) the relationship between occlusal force direction and the associated stress distributions within an intact mandible and (2) the extrapolation of those stress fields to a plated fractured mandible . Figure 2(a) is a partial (because dimensions irrelevant to this discussion are omitted) free - body diagram (fbd) of the frame- (versus lever-, figure 1) idealized mandible . An fbd, used in equilibrium analysis, shows all external loads (forces and moments) that act on an isolated object (i.e., the mandible or a portion of it) of interest . For the purposes of this project, the crucial difference between the lever (figure 1) and the frame model is that in the latter, the direction of force vector t is not necessarily vertical, figures 2 and 3 . The fbd in figure 2(b) is of an imaginary or real (i.e., fractured) segment of the mandible that is anterior to the arbitrarily defined (at distance from the occlusal contact) circle,, on the approximated centroidal axis (dashed line) of the mandible . And represent the internal shear and normal (perpendicular) forces, respectively, and represents the internal moment .,, and symbolize the net internal loads at the interface (real or imaginary) that are necessary to maintain the static equilibrium of the anterior segment when occlusal force t acts on it . Applying static equilibrium conditions to the fbd in figure 2(b) yields (1)forcesvertical=0:ty=0 or =ty,forceshorizontal=0:+tx=0 or =tx,moments abouto=0:tytx=0or =tytx . The right hand sides of the equations are known because they are specified or calculated . For the purposes of this project, it is important only to recognize that and are determined by ty and tx, respectively, and that is a function of both ty and tx, as well as anatomy () and the horizontal distance () between the section and the occlusal contact . The analysis is based on the range of occlusal force directions represented in figure 3(a). Occlusal contact can occur between a maxillary cusp distal incline and a mandibular cusp mesial incline (t0, t1, and t2), a maxillary cusp mesial incline against a mandibular cusp distal incline (t4) or flat - plane occlusion (t3, also in figure 1). (according to classic friction principles, assuming frictionless contact, the direction of a contact force between surfaces must be perpendicular to their common tangent . T 04 can be characterized by the positions of their lines - of - action (loa) relative to the circle, . T1 passes above (or equivalently, behind) it, thus requiring a clockwise (cw) moment,, for equilibrium . Equilibrium dictates that must be counterclockwise (ccw) with t2, t3, and t4, because they pass below or in front of . The second relevant characteristic of a t is the direction of its horizontal component . T0, t1, and t2 are directed posteriorly; therefore, for equilibrium, must be to the right . Because t3 (the lever analogue) is vertical, = 0 . Thus, the 5 ts generically represent the permutations of the loa orientations relative to and the horizontal force component directions . It is emphasized that (1)) and figures 24 (essentially,,, and) apply identically to the imaginary anterior segment of an intact mandible and to an actual fractured - off section, but that is where the similarity ends . The physical manifestations of,, and in the two scenarios are fundamentally distinct . The system that is equivalent to,, and is produced by the stresses within the bone . In the plated mandible, it is produced by the loads in the plates and by contact between the fractured bone surfaces . Elementary engineering beam theory is used to determine the stress systems (figure 5) that are equivalent to a specific set of +,, and (figure 4). (the identical engineering principles are implicitly behind the generally accepted as obvious figure 1 stresses .) A uniform compression is the equivalent to an anteriorly directed (c in figures 5(a), 5(b), and 5(c)). Similarly, uniform tensile stress, t, is the equivalent to the posteriorly directed in figure 5(e). (there is no uniform tension or compression associated with t3, figure 5(d), because t3, being vertical, requires that = 0 for equilibrium .) The equivalents of a cw (figure 5(b)) and a ccw (figures 5(c), 5(d), and 5(e)) are stress gradients with compression - on - top / tension - on - bottom (c on top / t on bottom) and the opposite, respectively . (a uniform stress, without a gradient, is sufficient for t0 equilibrium, figure 5(a).) For completeness, the shear stress equivalent of is included in figure 5, but as generally done in the literature, it is henceforth ignored . As noted above, figures 24 and (1)) also apply exactly to a plated fractured mandible (figure 6(a)). However, the system that is equivalent to a specific set of +,, and (figure 4) is provided by the loads (hu, vu, mu, hl, vl, ml,, and) identified in the fbd of the plated fractured segment in figure 6(b) not the distributed bone stresses at the imaginary section (figures 1 and 5). H (), v (), and m () are the unknown forces and moments acting within the upper and lower plates directly overlying the bone fracture, figure 6(b). And are representative of the normal (perpendicular) and shear contact forces, respectively, on the fractured bone surface if the two segments touch . (according to basic friction theory, the maximum, max =, where is the coefficient of friction between bones . This is likely to influence the results of experimental studies in which the mandible analogue plastic has a different than bone .) Similar to the derivation of (1)), three independent simultaneous equations of static equilibrium, based on the fbd in figure 6(b), can be obtained by summing forces in the vertical (2) and horizontal (3) directions and by summing moments ((4) about the tooth contact point (2)ty++vu+vl=0, (3)tx+huhl=0, (4)duhuvu+mudlhlvl+ml=0 . Because there are fewer independent equations than unknown forces and moments (only tx and ty are known), this (statically indeterminate) problem cannot be solved using only the principles of static equilibrium . Fortunately, solving the problem is not a goal . Equations (2)(4) serve as explicit evidence of the complexity of plating biomechanics . As consequence of loa position (figure 3), t1 produces a counterclockwise (ccw) moment (rotation) about the circle; t0 does not cause a rotation; t2, t3, and t4 produce clockwise (cw) rotations . For the equilibrium of the intact or fractured mandible, these moments, and t's horizontal and vertical components, must be opposed by the internal loads,, and, respectively, figures 2(b) and 4 and (1)). In the intact mandible,,, and are expressed as equivalent stress distributions, figure 5 . The sums, according to the superposition principle, of those individual stress distributions (excluding the -associated shear stress) yield the net longitudinal tension / compression stress gradients shown in figure 7 . (the result in figure 7(d) is identical to that depicted in figure 1(a).) In a plated mandible, the load system that is equivalent to, and is supplied by the loads on the plates and by the contacts between bone fragments . But even a simplified plated assembly (figure 6) is far too intricate to solve with the methods of basic static equilibrium . Equations (1)(4) clearly indicate the complex relationships between what is known / given and what is unknown . Three - dimensional (3d) numerical [26, 27] and experimental models often lead to questions about the prevailing lever - based (tot / cob) stress distribution dogma . However, those previous criticisms involve the location of occlusal forces; the focus of this paper is on the direction of those forces . Specifically, the lever - based two - dimensional (2d) model, figure 1, consists of one force component direction (vertical) and one moment component direction (perpendicular to the page by the right - hand rule). The model in figure 2, the basis for the presented analysis, adds the horizontal force component . This is the most general 2d model that is possible, and it is used to demonstrate serious deficiencies in the lever method without having to resort to the complexities of a 3d approach . For convenience, and/or perhaps because of the lever model legacy, studies have generally been limited to occlusal forces in one (usually vertical, t3) direction . (in some experimental setups, the occlusal plane is slightly canted, so with a vertical force, the effect is similar to t4 .) But there is no reason to believe that a bolus of food would necessarily elicit a vertical, or any particular, occlusal force direction . If, instead, crown - crown contact is assumed, then the vertical force assumption restricts analyses solely to frictionless flat - plane or edge - to - edge occlusions . This study is framed in the context of crown - crown contacts, so the specified contact angle (i.e., cusp incline angulation or incisal guidance) generally defines a nonvertical orientation of the occlusal force . Some readers may prefer to attribute nonvertical occlusal forces to the interactions of muscle activity with the presence of a bolus of food . In either case, there is no compelling justification for the vertical occlusal force simplification, and as demonstrated, occlusal force direction is a critical determinant of the mechanical environment,,, and, within a mandible . The fbd in figure 3(b) can serve the same purpose as the fbd in figure 2(b). However, the former is presented to emphasize that without the (entirely superfluous) mandible outline, this is actually a mundane static equilibrium problem in which a force, t, is being applied at a point located in a specified (by and) position relative to another point,, where the reactions, and are of interest . Therefore, for this aspect of the analysis, the only things that matter are the direction of t's loa and its position relative to (i.e., distance from). For specific quantitative values of,, and, the magnitude of t would also be needed . But for the qualitative analysis, the relative magnitudes of,, and are sufficient, and because this is a linear model, these relative magnitudes do not change with changes in t magnitude . Another purpose for presenting figure 3(b) as an alternative is to illustrate that the human mandible drawing in figure 2(b) could easily be replaced with a nonhuman mandible, a machine part, and so forth . Without any effects on,, and . The 5 occlusal forces, t04, but instead of a continuum of directions, it is more practical to consider categories of force directions defined by the positions of their loa's relative to, combined with the directions of their horizontal components . For example, whenever the loa of a force passes through, generically represented by t0, the results presented herein for t0 apply . Naturally, the angulation of t0 (defined by and) would be different for incisal versus molar contact, nonetheless, qualitatively, the stress distributions would be identical . This concept is already being taken for granted with t3, because the stress distribution in figure 1 is not specified for any particular contact location . T2's loa is bounded by t3 and t0, shaded region in figure 5(c), so the associated stress distribution can be seen to morph, left to right in figure 7(c), from the tot / cob of t3 (figure 7(d)) to the complete compression of t0, (figure 7(a)). Similar trends, but with less defined endpoints, occur with t1 and t4 because their loa's are bound only on one side by t0 and t3, respectively . The stress distribution within the body of the mandible, there is a decreasing tension gradient from the gingival height, and near the mid - level, there is a reversal to an increasing gradient of compression toward the inferior border . This tension on top compression on bottom (tot / cob) stress distribution is consistent with the inherent vertical occlusal force of the lever . But in reality, in general, there must also be a nonzero horizontal bite force component, figure 3, whenever inclined planes (cusps) contact each other . And as demonstrated, its presence has the potential to profoundly alter the stress distribution within the mandible from the generally accepted tot / cob (figures 1, 5(d), and 7(d)) to, as an example, exactly the opposite (figure 7(b), left). The depictions of the relative magnitudes of the stress distributions in figures 5 and 7 are not drawn to scale because the mathematical complexities of the governing equations, necessary for quantitative results, are being circumvented and because such detail would be unnecessarily obfuscating . Serendipitously, the simplifications are perfectly suited to the mathematics - minimized approach of this paper, because the critical nuances of figure 7 can be examined without resorting to rigorous mathematics . If t acts through the circle, t0, then the longitudinal stress in the body of the mandible is entirely a uniform compression, figures 5(a) and 7(a). (as illustrated in figure 4(a), t0 requires that = 0 for equilibrium, hence the uniform stress .) That, of course, is contrary to the tot / cob lever - based stress distribution, figures 1 and 7(d). The sums of the 1 associated uniform compression (c) and the cw 1 associated c t gradients of t1, figures 4(b) and 5(b), can combine to produce 3 different net stress distribution patterns, figure 7(b). Because both 1 and 1 are associated with compression in the top part of the mandible (c and c, respectively), there is no doubt that the top part will be in compression . In the bottom part of the mandible, 1 is associated with compression (c), but 1 is associated with tension (t). Thus, depending on the relative magnitudes of c and t, the net longitudinal stress in the bottom part of the mandible can be tensile, zero or compressive (left, middle, and right, respectively, in figure 7(b)). To determine which of the three stress patterns reflects the actual stress, the governing beam equations would have to be solved . But for the present purposes, it suffices simply to note that all 3 potential t1 results are at variance with the lever's tot / cob stress distribution . T 2 (figures 4(c) and 5(c)), like t1, produces a uniform compression consistent with 2, but because 2 is ccw, its associated gradient is t c. so, when these 2 longitudinal stress distributions are superimposed, figure 7(c), it is certain that the bottom part of the mandible is in compression, but depending on the position of t2's loa within the shaded region in figure 5(c), the top part can be in tension, stress - free, or in compression . More specifically, as t2 approaches vertical, its longitudinal stress distribution (figure 7(c), left) looks more - and - more like the (vertical) t3-associated stress (figure 7(d)). As t2's direction approaches t0, its stress distribution, figure 7(c) right, starts to resemble the t0 produced stress, figure 7(a). T 3 (the lever replica, figures 4(d) and 5(d)) is vertical, so there is no 3 equivalent stress . Its tot / cob stress distribution, figures 1 and 7(d), is entirely the equivalent of the ccw 3 . And finally, t4 (figures 4(e) and 5(e)) is different from the others, because the 4 equivalent stress is a uniform tension . Combined with the ccw 4's t c gradient, the top portion of the mandible will be in tension, but the bottom portion can be in tension, stress - free, or in compression, figure 7(e). Thus, of the 11 possibilities depicted in figure 7, only 3 (left in figure 7(c), figure 7(d), and right in figure 7(e)) are in concert with the lever's tot / cob longitudinal stress distribution . (oral surgeons are intimately familiar with the biomechanical principles at work here . During extraction, the tooth can be considered as a vertical analogy to the mandible that is loaded as in figures 5(b) and 5(c). When the tooth is luxated back and forth, are generated, and to reduce the associated tensile longitudinal stress in the root, a compressive (intrusive) force is applied concurrently, thereby reducing or eliminating the tension, analogous to the right sides of figures 7(b) and 7(c) turned 90 degrees . A lever model of extraction would not account for the critical intrusive force component () that prevents tension - induced root fracture .) For the plated mandible, figure 6(b), there are an insufficient number of equations to solve for all unknowns . This statically indeterminate problem can be numerically modeled, typically with fea [2936], but whatever the solution may be, it must satisfy (2)(4). Thus, as evidenced by the equations, everything is intertwined in a complex manner . Furthermore, if the fracture were at an angle, or if the plates were not horizontal or parallel, then (2)(4) would be further complicated by trigonometric functions, different values for the upper and lower plates, and so on . This is clearly not a problem that is amenable to commonsensical analysis, especially with intuition that is based on the nonapplicable lever paradigm of the intact mandible . Consider plates, ab and cd, secured with single screws at their ends, figure 8(a). Abdc, figure 8(b), forms a 4-bar linkage in which b and d are constrained to move along arcs of circles that are centered at a and c, respectively . Therefore, if for any reason b moves to b, d must move to d, because the bone dimension, bd (= bd), remains unchanged . Thus, with virtually any occlusal force, these plate constraints dictate a downward displacement with a ccw rotation of the anterior segment from bd to bd, hence the inferior border distraction . When the concepts and terminology from the intact mandible are applied to this outcome, it is ascribed to compression on top and tension on the bottom [26, 37]. But, in fact, the top plate, ab, is in tension and cd, the bottom plate, is in compression, and except for the compression at the bone - bone contact on top, there is no tension (which would be impossible anyway at a fracture) or compression in bone anywhere along the fracture . Thus, contrary to popular notion, the enlarged gap at the inferior border is not caused by tension; on the contrary, it is caused by compression in cd. There are, of course, many other 4-bar linkage configurations that would produce different interfragmentary displacements . Because plate ab, as the example, is secured by single screws at its ends, it can only transmit pure compression or tension it is a 2-force member . (if, in figure 6, the top plate was affixed with single screws at both ends, then hu 0, but vu = mu = 0 .) Accounting for friction (between bone / plate or screw / plate), or even just one additional screw, would immensely complicate the problem by necessitating the inclusion of the shear forces (i.e., vu 0 in figure 6(b)) and the bending moments (i.e., mu 0 in figure 6(b)) in the plates . The relative bone movements would then depend mostly on plate deformations caused by those forces and moments . Clinically, however, it would be advantageous to conceptualize plate - imposed constraints in terms of linkages rather than the intact mandible paradigm . (neither is realistic, but in this context, the intact idealization is entirely irrelevant and misleading .) Although the focus is on plates, similar discussions would pertain to other modes of fixation . For example, in a sagittal split osteotomy, the transverse shear stresses within the bicortical screws and bone - bone friction produce the,, and equivalent system . As with plating, a mandible in function, intact or plated, is a complicated 3d statically indeterminate structure that is subjected to the complex interactions of variable anatomy and highly changeable muscle and occlusal forces . And, for many reasons, obvious and subtle, a plated fractured mandible is an entirely different and more complex load bearing structure than an intact mandible . If for no reason other than the impossibility of tensile stresses acting across a break, the tot / cob stress distributions illustrated in figures 1, 5, and 7 are not possible at, or near, a fracture . According to saint venant's principle, these stress distributions can be present only at some distance away from plated areas . Nevertheless, the figure 1 tot / cob representations are often invoked explicitly [18, 20, 22, 23, 31] or implicitly in matters of fracture repairs . Although the demonstrated analytical method is inadequate for the solution of these problems, it is the best instructional approach, and it is conceptually far more realistic than the ubiquitous lever model . This analysis is appropriate for conceptualizing mandibular biomechanics and for casting doubt on the status quo . In conclusion, (1) the lever - based tension - on - top / compression - on - bottom (tot / cob) stress gradient should not be assumed in the intact mandible . It is only one of several possible stress distributions that depend on the direction of the occlusal force and the relative location of the section in question . (2) internal forces (and) and moment () are necessary for the equilibrium of all mandibles, intact or fixed . Beyond sharing,, and, there are no valid comparisons between intact, plated, screwed, and so forth mandibles . (3) the stress distribution within an intact mandible should not be extrapolated to a plated, or otherwise stabilized, mandible.
Saccades are described as fast eye movements in which a target is tracked by registering the image of that target on the fovea . The saccade neural network requires involvement of a series of neurons designed to imitate the behavior of actual neuronal populations in the horizontal saccade controller . A generic neuron model is therefore desired to quantify the neural stimulations meticulously, thus reflecting the physiology linked to the dendrite, cell body, axon, and presynaptic terminal of each neuron . The continuing research effort in demonstrating such a model has been driven by the need to provide the means to develop a network of neurons, tailored to the complexity involved with inherent physiological evidence . To encompass all of the desired neural behaviors for the other neurons, several modifications to the generic neuron model seem necessary that directly impact its firing rate trajectory [13]. The widespread use of spiking neural networks (snns) lies in leveraging efficient learning algorithms to the spike response models . A spike pattern association neuron identified five classes of spike patterns associated with networks of 200, 400, and 600 synapses, with success rates of 96%, 94%, and 90%, respectively . Hybrid analog - digital circuitry was laid out to implement an snn that outputs the postsynaptic potential by integrating the filtered action potentials . Brainstem saccadic circuitry, corroborated by several contributions of local field potentials (lfps) to the dynamics of neuronal synaptic activity between three neural populations in generating horizontal and vertical saccades in two rhesus monkeys, was introduced by van horn et al . . The extracellular recordings, including spike trains and lfps, were taken from the saccadic burst neurons (sbns) in the paramedian pontine reticular formation (pprf) at the premotor level, the omnipause neurons in the nucleus raphe interpositus, and the motoneurons at the motor level . It was concluded that lfps from each neuron encode the eye velocity in both the ipsilateral and contralateral directions . In addition, lfp response amplitude of the sbns was described as a function of saccade direction (in 400 saccades) by fitting gaussian curves to data (see figure 8(b) in), indicating that the sbn lfps can be fine - tuned over all the directed saccades . A neural system comprised of a persistent firing sensory neuron, a habituating synapse, and a motoneuron was developed to illustrate the spike - timing dependency of the working memory . The persistent firing neuron stems from the izhikevich neuron model, the habituating synapse is a conductance - based model, and the motor neuron captures the essence of the hodgkin huxley (hh) model . These studies provide abundant evidence that an snn is well suited to evoke the properties of the firing patterns of the premotor neurons during the pulse and slide phases of a saccade . However, none of the studies have presented a demonstration of the neural circuits reproducing electrophysiological responses in a network of neurons at both premotor and motor levels . To encompass all of the desired neural behaviors, neural circuitry is used to match the firing rate trajectory of the premotor neurons . We model the saccade - induced spiking activities at the premotor level with an hh model for the bursting neurons and with a modified fitzhugh - nagumo (fhn) model for the tonic spiking neurons . Time - optimal control theory of the horizontal saccades establishes the fact that there is a minimum time required for the eyes to reach their destination by involving thousands of neurons . Conjugate goal - directed horizontal saccades were well characterized by a first - order time - optimal neural controller . The analytical solutions of neural innervation signals and the active - state tensions were found to be well matched to the experimental data . It is important that this new, more complex time - optimal controller ascertains that the firing rate of the motoneurons does not change as a function of saccade magnitude during the pulse innervation of the oculomotor plant . The muscle fiber model (mfm) improves the oculomotor plant model by using several configurations of muscle fibers in series or parallel to drive the eyes to their destination . In other words, it elevates the whole muscle model to the level of muscle fiber model by calculating the viscosity and elasticity of the latter model in terms of the parameter values in the former model . As demonstrated, increasing the number of muscle fibers results in a closer saccadic agreement between the two muscle models . It is indicated that the muscle fiber model substantiates the fact that the number of motoneurons firing has the highest influence on the accuracy of saccade controller, contradicting the control strategy of adjusting the firing rates among the whole neurons . Investigation of muscle fiber model is imperative because it allows for recognizing the effects of the firing of individual neurons, as well as the number of active neurons firing maximally, in controlling the saccades . This investigation as well provides an optimum fit for the agonist and antagonist neural controllers to match the experimental data for the small saccades . In this paper, we focus on neural control of horizontal monkey saccades . A neural network model of saccade - related neural sites in the midbrain is first presented . We next characterize the underlying dynamics of each neural site in the network, which needs to be treated in the case of spiking neurons . In consequence, to match the dynamics of the neurons and the synapses, saccadic circuitry, including omnipause neuron (opn), premotor excitatory burst neuron (ebn), inhibitory burst neuron (ibn), long lead burst neuron (llbn), tonic neuron (tn), interneuron (in), and motoneurons of abducens nucleus (an) and oculomotor nucleus (on), finally, the motoneuronal control signals drive a time - optimal controller that stimulates a mfm model of the oculomotor plant . We abbreviate the conjugate goal - directed horizontal monkey saccade with the term saccade throughout the paper . The terms motoneurons and agonist (antagonist) neurons are also substitutable in this paper . Neurophysiological evidence and developmental studies indicate that important neural populations, consisting of the cerebellum, superior colliculus (sc), thalamus, cortex, and other nuclei in the brainstem, are involved in the initiation and control of saccades [13, 1315]. The studies also provided evidence that saccades are generated through a parallel - distributed neural network, as shown in figure 1 . Neural coordinated activities of the sc and the fastigial nucleus (fn) of the cerebellum are identified as the saccade initiator and terminator, respectively . The two sides of the symmetric network in figure 1 are known as the ipsilateral side and the contralateral side . The ipsilateral side exhibits coordinated activities in the initiation and control of the saccade in the right eye, while the contralateral side simultaneously synapses with the ipsilateral side to generate a saccade in the left eye . Each neuron in the parallel - distributed network fires in response to other neurons to stimulate the final motoneurons on both sides of the network in a determined manner to execute a saccade . The neural populations on each side of the midline excite and inhibit one another sequentially to ensure that this coactivation leads to the coordination of movement between the eyes . In the context of the neuroanatomical connectivity structure in figure 1, the saccade neural network includes neuron populations to imitate the behavior of actual neuronal populations in the initiation, control, and termination of the saccadic burst generator . A description of the synaptic properties of the major neural sites involved in execution of a saccade provides the basis for developing quantitative computational models of the neural network . Here, we outline the characteristics of the premotor neurons in the pprf and the in . The pprf encompasses neurons that show dominantly increasing burst frequencies of up to 1,000 hz during the saccade and remain inactive during the periods of fixation . The llbn and the medium lead burst neuron (mlbn) are the two types of burst neurons in the pprf . The llbn forms an excitatory synapse to the ibn and an inhibitory synapse to the opn . There are two types of neurons in the mlbn: the ebn and the ibn . The primary inputs to this neuron are the excitatory input of the sc and the inhibitory input from the contralateral ibn and opn the ibn, though, controls the firing of the ebn as well as the tn, both of which are on the opposite side of the network to the corresponding ibn . This neuron receives excitatory inputs from the fn of the cerebellum on the opposite side and the llbn on the same side and an inhibitory input from the opn . The cerebellum aggregates most of these ins whose functionality depends on the anatomical aspects and properties of their membranes . The in receives the excitatory and inhibitory inputs from the corresponding tn and ibn, respectively . It consecutively provides the step component to the agonist and antagonist neural controllers . As with the tn, the utility of the modified fhn model under the tonic bursting mode exhibits this particular neural spiking activity . The following section characterizes the underlying dynamics of each neural site in the neural network . The saccade generator investigated in this work is built upon the extant research [13, 13, 14, 16, 17]. Monkey saccades are categorized into two different modes of operation, namely, small (ranging from 3 to 8) and large (above 8). The differentiation between these two modes has been governed by the fact that when the saccade size increases, more active neurons are firing synchronously to form the agonist neural input for small saccades . For large saccades, however, the number of active neurons firing maximally remains unchanged, consistent with the time - optimal controller described by enderle and wolfe . The model is first - order time - optimal; that is, it does not depend on the firing rate of the neurons to determine the saccade magnitude . We next demonstrate features of the structure of the proposed saccade neural network to highlight the important neurological control implications . The structure of the saccade neural network leverages neural coding so that burst duration is transformed into saccade amplitude under the time - optimal condition . Such coding manifests activities, including the onset of burst firing before saccade, peak firing rate, and end of firing with respect to the saccade termination, for each neuron on the basis of the physiological evidence . These characteristics are provided for the neural sites as a framework for our simulations . Table 1 summarizes the activities in initiating, controlling, and terminating the burst firing through the neural network, generating a saccade in the right eye . Note that the agonist and antagonist tonic firing is governed by the ipsilateral in activity under the tonic firing operation mode . The firing rate trajectories of a medium lead burst neuron of monkey data for saccades of 4, 8, 12, 16, and 20 are provided . It is explained that such trajectories are in agreement with the data published in the literature [19, 20]. This illustration of the trajectories in figure 2 here aids in comprehending the foundations of the first - order time - optimal neural controller . The entire active agonist neurons fire maximally during the pulse interval of the saccade . For small saccades, the controller is constrained by a required minimum duration of the agonist pulse . Knowing this, the saccade magnitude depends on the number of active neurons, firing maximally, in accord with the physiological evidence [3, 12]. Note that the number of active neurons is the only parameter that varies in the mfm among different saccades in an adaptive control strategy of the oculomotor plant . It is demonstrated [3, 12] that adjusting this parameter provides significant analytical convenience in controlling the small saccades as opposed to changing the firing rate of all active neurons as a function of saccade magnitude . For the large saccades, the duration of the agonist pulse is the dominant factor that determines the saccade magnitude according to the main - sequence diagrams the fn in the cerebellum records the duration of the agonist pulse and the number of active neurons in arranging the end of the saccade . As motoneurons receive excitatory input from the ipsilateral ebn, the burst discharge in them during a saccade is adequately similar to the ebn bursting . Such burst discharge in the motoneurons is responsible for the movement of the rectus muscles during a saccade . The firing rate trajectory of the ebn is of prime importance in control of such a saccade . The presented ebn model showed a constant plateau of bursting during the second portion of the burst before the decay occurs . We model the ebn firing rate by applying the firing rate trajectory in which a slow linear reduction in firing rate is assumed [3, 21]. We also consider this trajectory for the sc current stimulation of the llbn, which is in accord with the different simulations in examining the effects of several depolarizing stimulus currents in the ebn axon (specifically, see figure 2.10 in). It should be emphasized at this point how the sc contributes to the optimal control of the saccades by driving the llbn . The movement fields within the sc are indicators of the number of neurons firing for different small and large saccades (see locus of points on a detailed view of the sc retinotopic mapping in figure 2.14 in). It is implied that the number of cells firing in the llbn is determined by the number of cells firing in the sc as long as there is a feedback error maintained by the cerebellar vermis . The number of the opn cells firing after inhibition from the llbn determines, in turn, how many ebn cells are released from inhibition . Finally, the number of ebn cells firing determines the number of motoneurons driving the eyes to their destination . The saccade completion involves the evolution of some events in an orderly sequence in the neural sites . The output of each block indicates the firing pattern at each neural site manifested during the saccade: saccade starts at time zero, and t represents the saccade termination . The negative time for each neural site refers to the onset of the burst before saccade (see table 1). The neural activity within each block is represented as pulses and/or steps, consistent with the described burst discharge mechanism, to reflect the neural operation as timing gates . Ultimately, motoneurons innervate rectus muscles in both eyes at the end interaction level of the block diagram . The following description outlines eight steps required to implement the saccade control strategy in the context of figure 3 . It represents the sequence of events accounted for by enderle and zhou, with modifications made in steps (iv)(vii) to indicate the function of local neural integrators (tn and in) in providing the step component to the motoneurons.the deep layers of the sc initiate a saccade based on the distance between the current position of the eye and the desired target.the ipsilateral llbn and ebn are stimulated by the contralateral sc burst cells . The contralateral fn also stimulates the ipsilateral llbn and ebn.when the opn ceases firing, the mlbn (ebn and ibn) is released from inhibition.the ipsilateral ibn is stimulated by the ipsilateral llbn and the contralateral fn of the cerebellum . When released from inhibition, the ipsilateral ebn responds with a postinhibitory rebound burst for a brief period of time . The ebn, when stimulated by the contralateral fn (and perhaps the sc), enables a special membrane property that causes a high - frequency burst that decays slowly until being inhibited by the contralateral ibn . The in follows closely the same integration mechanism as that of the tn.the burst firing in the ipsilateral ibn inhibits the contralateral ebn, in, and an, as well as the ipsilateral on.the burst firing in the ipsilateral ebn causes the burst in the ipsilateral an, which then stimulates the ipsilateral lateral rectus muscle and the contralateral on . With the stimulation of the lateral rectus muscle by the ipsilateral an and the inhibition of the ipsilateral medial rectus muscle via the on, a saccade occurs in the right eye . Simultaneously, the contralateral medial rectus muscle is stimulated by the contralateral on, and, with the inhibition of the contralateral lateral rectus muscle via the an, a saccade occurs in the left eye . Hence, the eyes move conjugately under the control of a single drive center . During the fixation periods, the ins provide the steady - state tensions required to keep the eyes at the desired destination.at the termination time, the cerebellar vermis, operating through the purkinje cells, inhibits the contralateral fn and stimulates the ipsilateral fn . Some of the stimulation of the ipsilateral llbn and ibn is lost because of the inhibition of the contralateral fn . The contralateral ibn then inhibits the ipsilateral ebn, tn, and an and contralateral on . This inhibition removes the stimulus to the agonist muscle.the ipsilateral fn stimulation of the contralateral ebn allows for modest bursting in the contralateral ebn . Once the sc ceases firing, the stimulus to the llbn stops, allowing the resumption of opn firing that inhibits the ipsilateral and contralateral mlbn, hence terminating the saccade . The deep layers of the sc initiate a saccade based on the distance between the current position of the eye and the desired target . The ipsilateral llbn and ebn when the opn ceases firing, the mlbn (ebn and ibn) is released from inhibition . The ipsilateral ibn is stimulated by the ipsilateral llbn and the contralateral fn of the cerebellum . When released from inhibition, the ipsilateral ebn responds with a postinhibitory rebound burst for a brief period of time . The ebn, when stimulated by the contralateral fn (and perhaps the sc), enables a special membrane property that causes a high - frequency burst that decays slowly until being inhibited by the contralateral ibn . The burst firing in the ipsilateral ibn inhibits the contralateral ebn, in, and an, as well as the ipsilateral on . The burst firing in the ipsilateral ebn causes the burst in the ipsilateral an, which then stimulates the ipsilateral lateral rectus muscle and the contralateral on . With the stimulation of the lateral rectus muscle by the ipsilateral an and the inhibition of the ipsilateral medial rectus muscle via the on, a saccade occurs in the right eye . Simultaneously, the contralateral medial rectus muscle is stimulated by the contralateral on, and, with the inhibition of the contralateral lateral rectus muscle via the an, a saccade occurs in the left eye . Hence, the eyes move conjugately under the control of a single drive center . During the fixation periods, the ins provide the steady - state tensions required to keep the eyes at the desired destination . At the termination time, the cerebellar vermis, operating through the purkinje cells, inhibits the contralateral fn and stimulates the ipsilateral fn . Some of the stimulation of the ipsilateral llbn and ibn is lost because of the inhibition of the contralateral fn . The contralateral ibn then inhibits the ipsilateral ebn, tn, and an and contralateral on . The ipsilateral fn stimulation of the contralateral ebn allows for modest bursting in the contralateral ebn . Once the sc ceases firing, the stimulus to the llbn stops, allowing the resumption of opn firing that inhibits the ipsilateral and contralateral mlbn, hence terminating the saccade . The advances in computational neural modeling have supplied us with abundant information at different structural scales, such as the biophysical [4, 5], the circuit [3, 6, 7], and the systems levels . The following includes our modeling of the premotor and motor neurons at the circuit level . We introduce a neural circuit model that can be parameterized to match the described firing characteristics of each type of neuron . A typical neuron embodies four major components: cell body, dendrites, axon, and presynaptic terminals, as shown in figure 4 . Dendrites act as the synaptic inputs for the preceding excitatory and inhibitory neurons . Upon this stimulation of the neuron at its dendrites, the permeability of the cell's plasma membrane to sodium intensifies, and an action potential moves from the dendrite to the axon . The transmission of action potential along the axon is facilitated by means of nodes of ranvier in the myelin sheath . At the end of each axon, there are presynaptic terminals, from which the neurotransmitters diffuse across the synaptic cleft . A complete understanding of the properties of a membrane by means of standard biophysics, biochemistry, and electronic models of the neuron will lead to a better analysis of membrane potential response . This response is dependent on how much neurotransmitter is received from the presynaptic terminal of the adjacent neurons; thereby, the neuron becomes hyperbolized or depolarized . A generic neuron circuit model is introduced in this section, together with the description of the modifications required to populate a neural network for control of saccades . The saccade neural network includes eight neuron populations at premotor and motor levels as seen in figure 1:long lead burst neuron (llbn),omnipause neuron (opn),excitatory burst neuron (ebn),inhibitory burst neuron (ibn),tonic neuron (tn),interneuron (in),abducens nucleus (an),oculomotor nucleus (on). Long lead burst neuron (llbn), omnipause neuron (opn), excitatory burst neuron (ebn), inhibitory burst neuron (ibn), abducens nucleus (an), oculomotor nucleus (on). The saccade circuitry underlies the dynamics of the above eight distinct neurons, each of which contributes to the control mechanism of the saccade . Except for the opn, the proposed parallel - distributed neural network proposed parallel - distributed neural network accommodates two of each of the other neurons in the network . The dendrite model delineated below is adjustable to the stimulation mechanism of all eight neurons . The axon model for all spiking neurons, except the ebn and opn, adheres to the hodgkin - huxley (hh) model . The tn integrates its input and is modeled with a fitzhugh - nagumo (fhn) model under the tonic bursting mode . The presynaptic terminal elicits a pulse train stimulus whose amplitude depends on the membrane characteristics of the postsynaptic neuron . The dendrite is partitioned into a number of membrane compartments, each of which has predetermined length and diameter . Each compartment in the dendrite has three passive electrical characteristics: electromotive force (emf), resistance, and capacitance, as shown in figure 5 . The presynaptic input to the dendrite is modeled as a pulse train current source (is). The node equation for the first dendrite compartment is (1) cmdvm1dt+vm1vthreq+vm1vm2ra = is, where vm1 is the membrane potential of the first compartment and vm2 is the membrane potential of the second compartment . The membrane resistance req, capacitance cm, and the emf vth characterize each compartment . There are two inputs: the input from the previous compartment's membrane potential and the input from the next compartment's membrane potential . The node equation for the second compartment is (2)cmdvm2dt+vm2vthreq+vm2vm1ra+vm2vm3ra=0, where vm3 is the membrane potential of the third compartment . The last dendrite compartment receives just one input from its preceding compartment . The corresponding node equation is (3) cmdvmndt+vmnvthreq+vmnvm(n1)ra=0, where the membrane potential vmn is related to the preceding compartment's membrane potential (vm(n1)) through the axial resistance ra . The neurons' dendrite model is realized by experimental tuning of the parametric capacitance and resistance properties of the basic dendrite model . This parametric adaptation allows for the accommodation of the synaptic transmission in the neural network as required to stimulate each postsynaptic neuron . Each neuron's dendrite rise time constant determines the delay to emulate the postsynaptic potential propagation along the dendrite, consistent with the initiation of firing with respect to the saccade onset provided in table 1 . Table 2 includes the membrane resistance and capacitance of the dendrite compartments for each neuron . Computational efficiency accrues when the minimum number of compartments in the dendrite model is required . We chose to include 14 compartments in the dendrite to achieve the desired membrane properties in each type of neuron . For example, the ebn dendritic membrane potential across the first, second, third, and last compartments is illustrated in figure 6 . The farther the compartment is along the dendrite, the smoother its potential response is to the pulse train current source . The hodgkin - huxley (hh) model of the axon serves as the basis for the neurons modeled here only the ebn and opn are based on a modified hh model . This nonlinear model describes the membrane potential at the axon hillock caused by conductance changes . The circuit diagram of an unmyelinated portion of squid giant axon is illustrated in figure 7 . The node equation that expresses the membrane potential vm as a function of stimulus current i m from the dendrite and voltage - dependent conductance of the sodium and potassium channels is (4)gkn4(vmek)+gnam3h(vmena) + (vmel)rl+cmdvmdt = im, where (5)dndt=n(1n)nn, dmdt=m(1m)mm, dhdt=h(1h)hh, gk=36103 s, gna=120103 s. the coefficients in the above first - order system of differential equations are related exponentially to the membrane potential vm; that is, (6)n=0.01v+10e((v+10)/10)1 ms1,n=0.125e(v/80) ms1,m=0.1v+25e((v+25)/10)1 ms1,m=4e(v/18) ms1, h=0.07e(v/20) ms1,h=1e((v+30)/10)+1 ms1,v = vrpvm mv, where the resting potential vrp is 60 mv . The neural firing rate of the entire burst neurons has been adjusted to meet the peak firing rate requirement in table 1 . This adjustment is intended for each neuron to contribute to the generation of the saccade by mimicking the required physiological properties . To this end, the right - hand side of the n, m, and h differential expressions in (4) is multiplied by appropriate coefficients to achieve the desired peak firing rates . For instance, the required coefficient for the ebn has been 35,000; thereby, it presents a peak firing rate at 1,000 hz . Note that the above description of the basic hh model of the axon has been used for all burst neurons, except for the ebn and the opn . For these latter neurons, the modified hh model is used to change the threshold voltage from 45 mv to 60 mv . Through illustrative examples, it has been shown that this variation causes ebn to fire autonomously without the existence of any excitatory stimulus . From the description of the dominant effect of the sodium channel current on the changes in threshold voltage at the beginning of the action potential, threshold voltage in the ebn axon model the opn axonal threshold voltage of firing has been adjusted following the same modification by (7). This alteration of the threshold voltage for the ebn and the opn enables them to fire spontaneously without any significant depolarization from peripheral current stimuli . Table 2 lists the firing threshold voltage and the coefficient required to adjust the peak firing rate for each neuron . The axon transfers an action potential from the spike generator locus to the output end of the synaptic mechanism . The transmission along the axon thus amounts to introducing a time delay, after which the action potential appears at the synapse . This is modeled by excitatory or inhibitory pulse train stimuli to stimulate the dendrite of the postsynaptic neuron more realistically . In the chain of synaptic transmission, the amplitude and width of each single pulse are chosen experimentally to provide the desired postsynaptic behavior in the neurons based on timing constraints in table 1 . The width is constrained by the two points at which the action potential crosses a constant level of the axonal potential . The synapse can be in that sense thought of as a voltage - to - frequency converter that releases a pulse train output . Figure 8 shows a number of action potentials and the synaptic current pulses of the ebn toward the end of the burst firing interval . Note that the time delay between each action potential and the corresponding current pulse is evident . In addition to the transmission time delay along the axon, all chemical synapses introduce a small delay before excitatory or inhibitory pulse train . This delay accounts for the time required for the release of neurotransmitters and the time it takes for them to distribute through the synaptic cleft . This small synaptic delay was taken into effect by increasing the rise time constant of the following postsynaptic dendritic compartments . As indicated, the amplitude and width of synaptic current pulses for each neuron are uniquely chosen in order that the postsynaptic neurons exhibit the desired behavior . This table summarizes all the differences (dendritic, axonal, and synaptic) among eight distinct neurons whose realization is important in the time - optimal control of the saccade . We next describe a linear homeomorphic muscle model that captures the nonlinear properties of the muscle, namely, force - velocity and length - tension relationships . The time - optimal controller model was investigated to obtain the saccadic eye movement model solution that drives the eyeball to its destination for different saccades [3, 17]. Here, we explain that the saccadic eye movement model solution is characterized by realization of the agonist and antagonist controller models, thereby providing the active - state tensions as inputs to a linear homeomorphic model of the oculomotor plant . The first - order time - optimal controller model is defined by two complementary controllers: agonist controller model and antagonist controller model . These models describe how the neural innervation signals from motoneurons are converted to the active - state tensions to drive the agonist and antagonist muscle during the saccade (assuming that there is an oculomotor plant with a given order). In what follows, the active - state tensions are defined as the low - pass filtered neural innervation signals . The agonist controller is a first - order pulse - slide - step neuronal controller that describes the agonist active - state tension as the low - pass filtered neural stimulation signal . The neural stimulation signal is the firing rate of the ipsilateral an and that of the contralateral on . The slide is meant to model the transition between the pulse and the step exponentially . The expression of low - pass filtering of the neural innervation input to the agonist controller model is (8)fag = nagfagag, where (9)ag=gac(u(tt1)u(tt2))+gdeu(tt2), where nag represents the agonist neural innervation input from which the agonist active - state tension, fag, is generated . The agonist time constant ag is expressed by two step functions dependent on the agonist activation time constant, gac, and the deactivation time constant gde . T1 indicates that the saccade has the latent period, and t2 is the start of the transition slide interval for the agonist controller . It is noteworthy that the activation (deactivation) time constant in the model accounts for the different dynamic characteristics of muscle upon increasing (decreasing) stimulation . The antagonist muscle is unstimulated by a pause during the saccade and remains fixed by a step input to keep the eyeball at its destination . To serve this purpose, the neural stimulation signal to the controller is the firing rate of the ipsilateral on and that of the contralateral an . The antagonist active - state tension can be expressed as the low - pass filtered pause - step waveform: (10)fant = nantfantant, where (11)ant=tde(u(tt1)u(tt3))+tacu(tt3), where nant denotes the antagonist neural innervation input and the fant is the antagonist active - state tension generated . The antagonist time constant is describable by two step functions, introducing the antagonist deactivation time constant, tde, and the activation time constant tac . T1 takes into account the latent period, and t3 is the onset of the change to the step component necessary to keep the eyeball steady at its destination . The time - optimal controller has been found to be reasonably consistent with the characteristics of the main - sequence diagrams . In what follows, a linear homeomorphic muscle fiber model (mfm) of the oculomotor plant is presented . A linear homeomorphic mfm that captures the nonlinear properties of the muscle, namely, force - velocity and length - tension relationships, is investigated . The muscle fiber is known as the basic structural unit of the muscle that exhibits the same mechanical functionality as the whole muscle model . The significance of introducing a muscle fiber model is that it accommodates multiple neurons to drive the eyes to their destination . Accordingly, the effect of the number of active neurons in controlling the saccade magnitude can be investigated in an adaptive control paradigm of the oculomotor plant . In contrast to the whole muscle model, information about the muscle fibers is not aggregated into just a few parameters in the mfm . The entire 100 muscle fibers are similar in terms of the parameters and the stimulation from the active state tension generator model . The rigorous analysis of the mfm including both the length - tension and the force - velocity characteristics indicates that this model agrees with the previous results from the whole muscle model [3, 12]. The experiments with the mfm are illustrated for different combinations of columns of series of muscle fibers, load mass, and active state tension . The focus of our attention herein is the description of an oculomotor plant in which the mfms of the agonist and antagonist rectus eye muscles are incorporated . The mfm is parameterized using the scaled estimates of the parameters from the whole muscle oculomotor plant . Figure 9 shows the studied oculomotor plant with two parallel networks of the muscle fibers attached to the eyeball . Is the angle of displacement of the eyeball from the primary position, and x denotes the respective change in length of arc . The changes in the length of the agonist muscle on the left and the antagonist muscle on the right are shown by xag and xant, respectively . There are 2n columns of muscle fibers, each of which has m muscle fibers in series . Each column of muscle fibers also includes two tendon elements, whose viscous and elastic elements are b2 and kse, at the top and bottom of it . Each structural unit of muscle fiber is modeled by a viscous element, b1, an elastic element, klt, and an active state generator, fj, where 1 i 2n and 2 j m + 1 . The change from the primary position at node j in the muscle fiber column i is denoted by xj . Note that nj exhibits the input to the agonist and antagonist controller models stated formerly . Motoneurons provide the saccadic neural innervation signals to each muscle fiber in our time - optimal controller . The advantage of the state - variables approach facilitated the mathematical descriptions of the oculomotor plant and its implementation in the matlab / simulink . With definition of y1 = xag x2, the net torque developed by the agonist mfm is (12)tag=i=1n(ksey1i+b2y1i), where, for the two tendon elements in each column (j = 1 and m + 2), the state equation is (13)yji=(ti+kseyji)b2, and the state equation that represents the dynamics of muscle fibers in each column (2 j m + 1) is (14)yji=tikltyji+fjib1, where ti is the tension generated by each muscle fiber column . In a similar approach for the antagonist mfm (n + 1 i 2n), after definition of y1 = xant x2, the net torque developed by the antagonist mfm is (15)tant=i = n+12n(ksey1i+b2y1i), where the state equation for the two tendon elements in each column (j = 1 and m + 2) is (16)yji = tikseyjib2, and the dynamics of muscle fibers in each column (2 j m + 1) are represented by (17)yji = tikltyjifjib1, where ti denotes the tension developed by each muscle fiber column . Consequently, the third - order linear differential equation to solve for the optimal solution for a saccade is (18)tagtant = jpr+bpr+kpr, where jp denotes the moment of inertia of the eyeball, bp denotes the viscous element of the eyeball, and the passive elasticity of the eyeball is represented by kp . It is assumed that the muscles are primarily stretched by 3.705 mm [1, 3]. Note that the above expressions show that the inputs to the mfm are the agonist and antagonist active - state tensions . These tensions are obtained by low - pass filtering of the motoneurons' innervation signals as previously described for both the pulse - slide - step and pause - step controllers . The analytical solutions for all fj were yielded in the previous work, and it was found that different characteristics of saccades are very well matched to those of the experimental data . The estimation routine involved estimation of 25 parameters of the oculomotor plant, neural inputs, and active - state tensions . The parameters' physiological accuracy was corroborated by the previously published experimental findings for human and monkey . Note that no empirical parameters are involved herein other than the parameters of the whole muscle model of the oculomotor plant for monkey (see page 47 in). Two small saccades (4 and 8) and three large saccades (12, 16, and 20) have been the focal point of our simulations of horizontal monkey saccades under the first - order time - optimal control strategy . All neural populations consisted of 14 dendrite compartments with membrane properties included in table 2 . The determination of the rise time constant for each neuron's dendrite plays a vital role in the integration of current pulses at the synapse . Analyses of the dendritic membrane potentials were performed with the ni multisim circuit design suite, and the neural network was simulated in the matlab / simulink environment . The saccade - induced spiking activities at the premotor level are modeled with an hh model for the bursting neurons . The tonic spiking behavior of the tn / in is implemented by a modified fhn model as well . Transmission along the axon introduced a delay after the presence of action potential at the axon hillock, after which an action potential appears at the synapse . Synaptic connections between functionally modeled neuron populations are modeled following a current - based synapse scheme (see table 2 for differences in the membrane parameters among the neurons). The onset delay before saccade, peak firing rate, and burst termination time for the different neuron populations we arranged 100 identical muscle fibers (n = 1 and m = 100), since this coordination provided sufficient resolution in matching the experimental data . As described, the number of active neurons impacts the control of saccades instead of the variations in the firing rate of those neurons under the time - optimal control strategy . In addition, the number of active neurons differs from saccade to saccade, as evident by the dynamics observed in the main - sequence diagrams [3, 12]. As demonstrated, this system parameter is determined by reducing from a maximum of 100 active neurons until the eye position estimate from the mfm and the whole muscle model match . The active - state tension for each of the agonist neurons that are not activated is modeled to exponentially decay (during the pulse) and rise (during the slide) using the same time constants in the agonist controller model . The number of active agonist neurons for the 4 and 8 saccades is reported to be 48 and 76, respectively . The neural innervations from this number of neurons for each small saccade of the muscle fiber oculomotor plant tend to be in excellent agreement with those of the whole muscle oculomotor plant . Each active neuron exhibits the pause - slide - step firing trajectory as later shown in figure 11, substantiating the physiological accuracy of the agonist controller model . The adjustment of the number of active neurons for the large saccades is empirically carried out to maximize the correlation between the whole muscle oculomotor plant and the muscle fiber oculomotor plant . The number of active neurons is estimated to be 75 neurons for the 12 saccade, 100 neurons for the 16 saccade, and 92 neurons for the 20 saccade . Table 3 lists the number of active neurons and the duration of the burst (agonist pulse), for the five different saccades in this work . The termination time of the saccades solely depends on the duration of burst under the time - optimal control strategy . The selection of the duration of the burst is in accord with the saccade duration - saccade magnitude characteristic of the main - sequence diagrams . For sample illustrations, the plots of dendritic membrane potential (first column), axonal membrane potential (second column), and synaptic current pulse train (third column) of the ipsilateral burst neurons and in in generation of the 16 saccade recall that the train of action potentials is converted to a train of the current pulses in the presynaptic terminal of the neuron to provide excitatory or inhibitory input to the succeeding neurons based on the neural connections in figure 1 . This current pulse flows through the postsynaptic dendritic compartments of the latter neurons, thus providing the smooth postsynaptic potentials to prime the axonal compartment . It appears that upon increasing the stimulus current pulse magnitude, the depolarization of the postsynaptic membrane intensifies . It is obvious that the synapse propagation raises different excitatory and inhibitory postsynaptic potentials in the dendritic compartments of each postsynaptic neuron (shown in the first column of figure 10). One can realize that, in view of the trajectory of changes in the membrane potential among the compartments, each postsynaptic neuron, in turn, can either become closer to firing an action potential chain or be inhibited from firing . It is clear that, as the presynaptic input pulses are closely spaced in time, each succeeding postsynaptic potential is smaller than the basic single - pulse response, but the postsynaptic response to each input pulse is demonstrable . It is worth noting that the llbn membrane response is different from the rest, since it is stimulated by the contralateral sc current input formerly introduced . Furthermore, the burst onset and offset for each premotor neuron in figure 10 agreed with its place within saccadic circuitry's hierarchical processing order in generating the final motoneuronal signals . When the ipsilateral ebn is weakly stimulated by the contralateral fn, it renders a special membrane property that tends to a high - frequency burst mechanism until inhibition from the contralateral ibn and the opn . Recall that the in is responsible for keeping the agonist and antagonist muscles steady during the periods of fixation . During the pulse phase, however, the ipsilateral tn is inhibited by the contralateral ibn, while the ipsilateral in is inhibited by the ipsilateral ibn . The in forms an excitatory synapse with the an to provide it with the step component of the innervation . Obviously, the burst - tonic firing activity of the an (figure 10(q)) reflects the burst firing of the ebn and the tonic firing of the in . Presented in figure 11 are the ipsilateral agonist (first and third rows) and antagonist (second and last rows) burst - tonic firing rates with their respective active - state tensions for the saccades . It is of interest to note that the firing rate of each an in all scenarios does not vary as a function of saccade magnitude, thus proving that the proposed time - optimal controller is well capable of mimicking the physiological properties of the saccade . The agonist and antagonist active - state tensions during the periods of fixation are found as functions of eye position at steady state (see page 47 in). The corresponding tonic firing rates are readily determined based on a linear transformation that scales the tonic firing rate to the active - state tension . From figure 11, it follows that the agonist - antagonist firing patterns fairly well match the estimated waveforms based on the system identification approach (see figure 1.19 in). The ipsilateral control simulation results of eye position for the two small saccades under the time - optimal control strategy are demonstrated in figure 12 . The parameterized saccadic oculomotor plant for the trend of changes in muscle tensions involved in each saccade is such that neuron - data - derived active - state tensions drive the muscle fiber oculomotor plant . Shown in figure 13 are the ipsilateral control simulation results of eye position for the three large saccades under the time - optimal control strategy . It is of interest to note that, as envisioned [1, 18], the investigated oculomotor plant does not considerably influence the main - sequence diagrams . The entire neural stimulation signals and eye movements on the contralateral side were in close coordination with their corresponding ipsilateral signals for all the simulated conjugate saccades . The simulation results show remarkable agreement with those provided by analytical descriptions of the agonist and antagonist neural inputs and the corresponding active - state tensions (see figure 1.19 in). The trajectory of variation in the agonist pulse magnitude among these saccades is consistent with the agonist pulse magnitude - saccade magnitude characteristic for the large saccades (refer to figure 1.25(a) in). The burst duration is found to show similar correlation with the mlbn duration of burst firing from the extracellular single - unit recordings . As evident by different firing rate trajectories for the ebn, this however, the duration of the second portion of the burst discharge (gradual drop) varied among them based on the entire duration of the burst firing in table 3 . As indicated in table 1, the ebn firing lags behind the saccade by 68 ms, whereas the an starts burst firing 5 ms before the saccade (see figure 10). Finding the dendrite parameters for both of these neurons in meeting the required onset time delay was experimentally challenging . Implementing the opn dendrite and synapse models in order that this neuron stops inhibiting the ebn about 10 ms before the saccade and resumes its inhibition almost when the saccade ends was subject to numerous experimental tunings (see table 1). Without this coordination in timing of the burst firing in the ebn this rebound burst, in turn, causes the saccade to deviate from the normal characteristics . It also was vital that the end of the ibn inhibition of the antagonist motoneurons coincides with the resumption of tonic firing in them such that no deviation from the normal saccade is present . While the midbrain coordination mechanism in generating saccades is qualitatively studied [13, 15], complete neural circuitry that includes both the premotor and motor neurons in quantifying the final motoneuronal command to eye muscles has not yet been attended . The utility of snns to the biophysical modeling of interconnected neurons [4, 5] elucidates broad insights into modeling at higher structural scales, such as the circuit [3, 6, 7] and the systems levels . The computer simulations of neural circuitry herein allow synaptic stimuli to propagate through the saccade pathways so that the motoneurons ultimately drive the oculomotor plant . A time - optimal neuronal control strategy for human saccadic eye movements was first proposed based on experimental data analysis . We used the first - order time - optimal controller that includes the activation and deactivation time constants in agonist and antagonist controller inputs to the muscle fiber oculomotor plant . This controller has been proven to agree with the experimental findings [25, 26]. Realization of the suitable time constants for both the agonist and antagonist controllers, as expressed in (9) and (11), was key in providing the required steady - state active - state tensions to the muscle fiber oculomotor plant . The estimated activation and deactivation time constants from the system identification approach [1, 3] best satisfy this specification . Without such appropriate parameters, the set of agonist - antagonist control inputs to the muscle fiber oculomotor plant supports the time - optimal controller in which the motoneurons' firing rate does not determine the saccade magnitude . The application of the mfm in the oculomotor plant proves important in accommodating the constraint on the number of active neurons firing maximally in controlling the saccade magnitude . The number of the active neurons is a key parameter whose adjustment in the mfm is vital in providing the desired saccade control simulation results . It follows from our observations that the duration of the agonist burst firing and the number of active agonist neurons are integral to determining the saccade size (see table 3). It is noteworthy that the duration of agonist burst discharge is of prime significance in determining the saccade magnitude as seen in figure 11 . It is concluded that the neural network is constrained by a minimum duration of the agonist pulse and that the most dominant factor in determination of the amplitude is the number of active neurons for the small saccades . For the large saccades, however, the duration of agonist burst firing is directly related to the saccade magnitude . The number of active neurons for the 16 and 20 saccades remains relatively the same, although the 12 saccade aggregates fewer active neurons as seen in table 3 . The discussion by enderle and sierra is enlightening as to the increasing movement field of activity within the sc for saccades up to 12 for the monkey data . Furthermore, from the velocity profiles for the simulated saccades, it was found that monkey saccade has larger peak velocity than that of the human . The final eye position results establish evidence for the acceptable performance of the proposed neural circuitry and the exploited time - optimal controller in modeling the horizontal monkey saccades . The dependence of these different saccades on the agonist pulse duration has been found to be well presented by our time - optimal controller . The simulation results substantiate the time - optimal controller by the close agreement obtained with the analytical solutions of saccade characteristics [3, 12]. This agreement gives rise to the accuracy of the experimentally found membrane parameters in modeling of each neuron listed in table 2 . We simulated five different conjugate goal - directed horizontal monkey saccades: 4, 8, 12, 16, and 20, under the first - order time - optimal control strategy . A parallel - distributed neural network model of the midbrain was first presented . To develop the quantitative computational models that establish the basis of this functional neural network model a neural circuit model was then demonstrated and parameterized to match the firing characteristics of eight neuron populations at both the premotor and motor stages . In this context, we elevated the neural modeling from a single neuron to a network of neurons . Our control strategy was to define two controllers, namely, agonist and antagonist controller models, characterized by the pulse - slide - step and pause - step waveforms, respectively . The horizontal monkey saccades were well characterized by integrating the neural controllers into a third - order linear muscle fiber oculomotor plant . 100 identical muscle fibers were connected in series in both the agonist and antagonist muscles in the oculomotor plant . Under the time - optimal strategy, the number of neurons that actively fire and the duration of the agonist pulse determined the saccade magnitude . The choice of the number of active neurons proved accurate in adapting the muscle fiber model to provide the desired control simulation results . The proposed saccadic circuitry is thus a complete model of saccade generation since it not only includes the neural circuits at both the premotor and motor stages of the saccade generator, but also uses a time - optimal controller to yield the desired saccade magnitude for both the small and large saccades . The saccade characteristics were found to be well correlated with those found by analytical descriptions and experimental data.
Electronic cigarettes are battery - operated devices that deliver nicotine to the lungs by evaporation of a liquid . Chronic idiopathic neutrophilia is a condition characterized by elevated white blood cell and neutrophil counts without any underlying disease; smoking has been implicated as a potential cause . A male caucasian patient, born in 1977, presented in september 2005 with asymptomatic elevation of white blood cell and neutrophil count, and mildly - elevated c - reactive protein levels . He was a smoker since 1996 and was treated with 20 mg / day of simvastatin since 2003 due to hyperlipidemia . Clinical examination, and laboratory and imaging investigations ruled out any infectious, haematological, rheumatological, or endocrine conditions . He had 2 unsuccessful attempts to quit smoking; one was unassisted and the second was performed with the use of both varenicline and nicotine replacement therapy (patches). During the subsequent 6.5 years, his leukocyte and c - reactive protein levels were repeatedly elevated; the condition was consistent with chronic idiopathic neutrophilia . In february 2012, he started using electronic cigarettes and he managed to quit smoking within 10 days . After 6 months, laboratory examination showed normalized leukocyte count and c - reactive protein levels, confirmed immediately by a second laboratory and by repeated tests after 1 and 2 months . Smoking cessation with the use of electronic cigarette led to reversal of chronic idiopathic neutrophilia . The daily use of electronic cigarette may help preserve the beneficial effects of smoking cessation . Cigarette smoking is a major cause of disease, affecting several systems in the human body.1,2 although reducing cigarette consumption does not improve prognosis,3 smoking cessation has important beneficial socioeconomic and health - related implications.4,5 however, quitting smoking is a very difficult task . Smokers that try to quit without any medical aid or treatment have extremely low success rate.6 although several pharmaceutical products are available for smoking cessation, long term quit - rates are relatively low.7 therefore, tobacco harm reduction strategies and products have been developed, with the main goal to reduce the amount of harmful substances administered to the human body.8 electronic cigarettes have been introduced to the market in recent years as an alternative to smoking . They are hand - held electronic nicotine - delivery devices consisting of a battery, a cartridge containing liquid, and an electrical resistance that is heated through the battery power and evaporates the liquid . They deal with the chemical addiction by delivering nicotine to the lungs and consequently to the circulation . Although millions of people use them all over the world, there is lack of clinical evidence on their efficacy in reversing smoking - related disease and conditions . Chronic idiopathic neutrophilia (cin) is a condition characterized by asymptomatic elevation of white blood cells (wbcs) and neutrophil count that persists for years without any underlying disease.9 smoking has been implicated as a cause of this condition,9,10 and leukocyte count is a predictor of future cardiovascular events.11,12 to the best of our knowledge, we report for the first time a case study of a subject with cin that was reversed by smoking cessation with the daily use of electronic cigarettes . Written informed consent was obtained from the patient for presenting this case report . A male caucasian, born in 1977, was presented in september 2005 with an elevated wbc count found during a routine check - up . At this time, he had been a smoker since 1996 (9 pack - years at the time of presentation). He had a positive family history of premature coronary heart disease and hyperlipidemia, which was treated with simvastatin at 20 mg / day since 2003 . Complete blood count tests performed 9 and 18 months earlier were normal (wbc: 89009700/l, neutrophils: 41834462/l, lymphocytes: 40054268/l, eosinophils: 89194/l, basophils: 623776/l). At presentation, his wbc count was 14,600/l (8614/l neutrophils, 5256/l lymphocytes, 292/l eosinophils and 438/l basophils). He was completely asymptomatic, had no history of recent infections or trauma and reported no fever . He had no changes in body weight or appetite over the past months; his body mass index (bmi) was 27.7 kg / m at presentation . C - reactive protein was elevated at 14 mg / l (normal range <5 mg / l). Rheumatologic and infectious disease work - up (including ana, anti - dsdna, le - test, ra - test, asto, cmv and ebv antibodies, wright test and widal reaction) were all negative for disease . He was invited for a repeat complete blood count after 2 months, with wbc reaching 21,000/l (neutrophils: 14,280/l, lymphocytes: 5250/l, eosinophils: 630/l, basophils: 840/l). Once again he was asymptomatic and with no signs of infection or any other inflammatory condition . He was instructed to stop intake of simvastatin and repeat the examination in another 2 months . In january 2006, leukocytosis was still present (wbc: 17,900/l, neutrophils: 11635/l, lymphocytes: 5012/l, eosinophils: 537/l, basophils: 716/l). The diagnosis of cin was suspected and he was offered a bone marrow aspiration biopsy to rule out other conditions . All results were consistent with cin, and mild elevations in c - reactive protein were also noted (fig . 2). He did not receive any other medications during this period besides antipyretics for 2 episodes of common cold; all laboratory examinations were performed at least 10 weeks far from the common cold episodes . He had two unsuccessful attempts to quit smoking, one without any medical treatment in 2006 and one with varenicline plus nicotine patches in 2010 . A change in statin prescription from atorvastatin (20 mg / day) to rosuvastatin (20 mg / day) was done in may 2010, but no difference was observed in wbc count in subsequent measurements . In february 2012 it should be mentioned that use of electronic cigarettes was a personal choice of the patient; no advice or recommendation to use it was provided by the physicians, since it has not been approved as a smoking cessation method . One month earlier, his complete blood count was consistent with cin . In august 2012, routine follow - up showed no leukocytosis (wbc: 8800/l, neutrophils: 4400/l, lymphocytes: 3344/l, eosinophils: 352/l, basophils: 704/l). Further tests, 1, 2 and 3 months later revealed no leukocytosis . During this period, he was using the electronic cigarette daily, consuming liquid with nicotine concentration of 9 mg / ml . Smoking abstinence was confirmed during his last three visits by measuring carbon monoxide in exhaled breath; it was within normal limits (4 ppm). To the best of our knowledge, this is the first study which reports that smoking cessation with the use of electronic cigarette leads to reversal of chronic idiopathic neutrophilia . The most important message is that despite the daily use of electronic cigarette by this patient, the beneficial effects of smoking cessation were maintained . Electronic cigarettes were invented in 2003, with awareness and use increasing significantly over the past 3 years.13 they have been introduced to the market as tobacco harm - reduction products and they may have a unique role in this field . They work by evaporating a nicotine - containing liquid, which is subsequently inhaled by the user . In addition to nicotine, the constituents of liquids used for evaporation are limited to propylene glycol, glycerol, and flavorings . Since they deliver nicotine and at the same time resemble the act of smoking by production of visible vapor, they deal with both the chemical (nicotine delivery) and behavioral components of cigarette addiction.14 a non - randomized study by polosa et al15 and an internet survey by siegel et al16 suggested that they may be effective as a smoking cessation tool . The absence of tobacco and the lack of combustion are important features in the health - related profile of these products . Until recently, research on the composition, toxicology, and clinical effects of electronic cigarettes was scarce . Thus, fda and who publicly expressed serious concerns about electronic cigarette use in 2009, recommending that their use should be avoided . Cahn and siegel14 summarized several chemical analyses performed until 2011, showing that electronic cigarette liquid contents are far less harmful compared to tobacco.14 for nitrosamines they mentioned that, when present, the amount was 500-fold to 1400-fold reduced in electronic compared to tobacco cigarettes.14 substances produced from combustion of tobacco cigarettes, like polycyclic aromatic hydrocarbons, were not present in any of the liquids tested . Although still inadequate, research on electronic cigarettes has progressed over the past year . During the 14th annual meeting of the society for research on nicotine and tobacco europe, romagna et al17 presented a cytotoxic study comparing electronic cigarette vapor with tobacco cigarette smoke; they found that vapor extract from 10 different commercially available liquids were not cytotoxic to cultured mammalian cells compared to significant cytotoxicity observed from tobacco smoke extract.17 only three clinical studies on the effects of electronic cigarettes on human health have been performed . Vardavas et al18 found that 5 minute use of electronic cigarette produced a mild but significant elevation in pulmonary resistance.18 however, no comparison with the effects of tobacco cigarettes was performed . Flouris et al19 found that no elevation in wbc count was found after electronic cigarette use; in comparison, wbc and neutrophil counts were significantly elevated immediately after tobacco cigarette smoking.19 farsalinos et al20 studied smokers and electronic cigarette users with echocardiography before and after smoking and electronic cigarette use respectively.20 acute diastolic dysfunction was observed in smokers immediately after smoking 1 cigarette, while diastolic function was preserved after using the electronic cigarette for 7 minutes . Interestingly, although electronic cigarette users were previously heavy smokers, it took them on average only 2 days to quit smoking with the use of the device . Despite all this data and the fact that no study has found that electronic cigarettes are more harmful when compared to tobacco cigarettes, it must be emphasized that research is still in its infancy . More studies are needed, especially clinical studies, on their long - term effects . It will take several years, however, before such studies are published as awareness and use of electronic cigarettes has increased only recently . Delay will also occur as the knowledge that smoking - related disease and the beneficial effects of smoking cessation take several years before becoming clinically evident . Until that time, research should focus on the pathophysiological mechanisms by which smoking causes disease and should proceed on both laboratory and clinical level . The crucial scientific question that should be addressed is whether electronic cigarettes are less harmful compared to tobacco cigarettes, since they should be marketed solely as a tobacco harm reduction product and not as a new habit for the general population . In any case, regulation and specific quality standards should be implemented as the use of non - pharmaceutical grade nicotine or other constituents may lead to the presence of toxic tobacco impurities in the liquids, which will be subsequently inhaled by the user.14 although we cannot exclude that some constituents of electronic cigarette vapor may have had beneficial effects in reducing wbc count in our patient, the most probable explanation is that reversal of cin was caused by smoking cessation itself . Smoking causes diseases by a variety of mechanisms, including inflammation.21 it causes a 20%25% increase in peripheral blood leukocyte count22 in addition to elevated levels of inflammatory markers like c - reactive protein.23 cin is an uncommon condition associated with greater elevation in wbcs and neutrophils than those observed in the majority of smokers . The patient had persistently elevated wbc count and mildly elevated c - reactive protein levels, without any underlying disease . This may represent a state of low - grade inflammation, which is a risk factor for future cardiovascular disease.24 although he was a smoker several years before cin developed, we could not find any specific underlying cause for the development of the condition at the particular time of presentation . We know however that inflammatory markers have a temporal relationship to smoking,25 and this might explain the delay in cin presentation . Cigarette smoking was suggested as a potential cause for this condition in our patient after an extensive diagnostic analysis excluded other possible conditions or intake of medications such as corticosteroids and lithium which are associated with neutrophilia.9 despite the use of medically - approved methods, the patient failed to quit smoking . Finally, with the aid of electronic cigarettes, he was able to quit smoking in a timely manner . Five months later, cin was reversed, although he was using the electronic cigarette on a daily basis . In conclusion, we presented a case of a young smoker having cin and low - grade inflammation which was reversed after smoking cessation . Electronic cigarette use was successful as a smoking - cessation tool, after two failures to quit smoking (one with the use of currently - approved pharmaceutical methods). The daily use of electronic cigarettes did not hinder the beneficial effects of smoking cessation in this patient . Undoubtedly, this case report is in no way conclusive about the effects of electronic cigarettes on health . However, it indicates that research on the potential efficacy and health consequences of electronic cigarettes as a tobacco harm reduction product should be intensified . Until that time, we cannot recommend their use, but physicians will face two important ethical dilemmas in daily practice . Should they advise patients who have managed to quit smoking by using electronic cigarettes (like our patient) to stop using them, with the risk of smoking relapse? And should patients who have repeatedly failed to quit smoking by currently approved methods, such as the patient in this study, be denied the possibility, however small it may be, to quit smoking by using electronic cigarettes?
Based on the results of 5 randomized clinical trials (rcts), mechanical thrombectomy using the stent - retriever has been approved as standard treatment for acute anterior circulation stroke due to occlusions of the internal carotid artery (ica) or the m1 segment of the middle cerebral artery (mca). Recent studies regarding meta - analysis of the 5 rcts showed that stent - retriever thrombectomy is associated with considerable improvement of functional independence compared with standard medical care . After its acceptance as an effective treatment option, the next steps will be to further establish patient selection criteria and to generalize stent - retriever thrombectomy to a broader class of stroke patients with acute large vessel occlusions . To further broaden treatment indications for stent - retriever thrombectomy, although there exist a few studies that have investigated prognostic factors that predict outcomes after stent retriever thrombectomy in patients with acute anterior circulation stroke, these studies are limited by small sample size and the inclusion of patients with posterior circulation stroke [4 - 8]. Thus, this study aimed to investigate clinical, imaging, and procedural factors predictive of good outcome and mortality after stent - retriever thrombectomy in a large cohort of patients with acute anterior circulation stroke from december 2010 to november 2015, a total of 356 consecutive patients presenting with acute ischemic stroke due to ica or mca occlusions were treated with stent - retriever thrombectomy at a comprehensive regional stroke center . Mri examinations were performed using a 1.5-t unit (signa hdxt; ge medical systems, milwaukee, usa). Mri sequences included dwi, gradient echo imaging, flair sequence, 3-dimensional tof mra, and perfusion imaging . Dwi sequences were obtained in the axial plane using a single - shot, spin - echo echo - planar technique with following parameters: tr of 9,000 ms, te of 80 ms, slice thickness of 4 mm, interslice gap of 0 mm, fov of 260260 mm, and b values of 0 and 1,000 sec / mm . Of 356 patients, those who had a prestroke modified rankin scale (mrs) score 3 (n=11) or concomitant posterior circulation infarctions (n=8) or who were lost to follow - up (n=2) we prospectively collected the following clinical, imaging, and procedural data of these 335 patients: demographic features, cerebrovascular risk factors, nihss scores on admission, use of iv thrombolysis, time to endovascular treatment, procedure time, time to reperfusion, revascularization status, underlying intracranial atherosclerotic stenosis, tandem occlusion at the proximal cervical portion of the ica, intracranial hemorrhage on post - therapeutic ct scans or gradient echo mri, alberta stroke prognosis early ct score (aspects) applied to dwi (dwi - aspects), and clinical outcomes at 3 months . The institutional ethics committee approved this retrospective analysis and waived informed consent based on the study design . Upon admission, the inclusion criteria for stent - retriever embolectomy were as follows: (1) the procedure started within 6 hours of symptom onset, (2) baseline nihss score 4, (3) occlusion of ica or mca, (4) no intracranial hemorrhage detected on the cranial ct or mri, and (5) infarct volume less than one - third of the mca territory on dwi (determined as dwi - aspects> 3) or non - enhanced ct (determined by alteplase thrombolysis for acute noninterventional therapy in ischemic stroke [atlantis] criteria). For each patient, written informed consent for endovascular therapy was obtained from a family member . Endovascular therapy was performed under conscious sedation . In cases of agitation, an intravenous bolus of midazolam stent - based thrombectomy with a solitaire stent (covidien, irvine, usa) or trevo stent (stryker, kalamazoo, usa) was performed as the first - line endovascular treatment . When stent - based thrombectomy was unsuccessful, additional mechanical approaches were performed, including manual aspiration thrombectomy with a penumbra reperfusion catheter (penumbra, alameda, usa) or navien catheter (covidien, irvine, usa). Intracranial angioplasty with or without stenting was performed when severe (> 70%) underlying intracranial atherosclerotic stenosis was observed . When the patient had a tandem occlusion at the proximal cervical portion of the ica, carotid angioplasty and stenting were performed prior to stent - retriever thrombectomy . Revascularization status was assessed on the final angiogram and was classified according to the modified tici scale, and successful revascularization was defined as a modified tici grade of 2b or 3 . All patients underwent non - enhanced ct scans immediately and 24 hours after endovascular treatment and gradient echo mri 24 - 36 hours after treatment . Intracerebral hemorrhages were assessed on posttreatment ct and gradient echo mr images and classified as hemorrhagic infarction (hi) or parenchymal hemorrhage (ph) based on the european cooperative acute stroke study (ecass) criteria . Symptomatic intracranial hemorrhage was defined as any intracranial hemorrhage that caused neurological deterioration (increase of 4 points in nihss score or deterioration of 1 point in the level of consciousness on nihss). Clinical outcome was assessed by a stroke neurologist using the modified rankin scale (mrs) during an outpatient visit 3 months after treatment . If patients were unable to attend the outpatient clinic, outcomes were obtained via a telephone interview . First, the relationship between each clinical and procedural characteristic and 3-month outcome was determined . The 2 test or fisher exact test was used for comparing categorical variables, and the mann - whitney u test was used for comparing continuous variables . Second, independent associations between good outcome (mrs 0 - 2) and clinical and procedural factors were determined with a multivariate logistic regression analysis . The variables tested in the multivariate logistic regression models were those with p<0.05 in the univariate analysis . Third, a multivariate logistic regression analysis was performed to identify independent predictors for mortality at 3 months . Variables with a p value of <0.05 in the univariate analysis on mortality were included in a multivariate logistic regression analysis . All statistical analyses were performed with spss software (version 21.0; ibm spss, chicago, il, usa). A p value from december 2010 to november 2015, a total of 356 consecutive patients presenting with acute ischemic stroke due to ica or mca occlusions were treated with stent - retriever thrombectomy at a comprehensive regional stroke center . Mri examinations were performed using a 1.5-t unit (signa hdxt; ge medical systems, milwaukee, usa). Mri sequences included dwi, gradient echo imaging, flair sequence, 3-dimensional tof mra, and perfusion imaging . Dwi sequences were obtained in the axial plane using a single - shot, spin - echo echo - planar technique with following parameters: tr of 9,000 ms, te of 80 ms, slice thickness of 4 mm, interslice gap of 0 mm, fov of 260260 mm, and b values of 0 and 1,000 sec / mm . Of 356 patients, those who had a prestroke modified rankin scale (mrs) score 3 (n=11) or concomitant posterior circulation infarctions (n=8) or who were lost to follow - up (n=2) we prospectively collected the following clinical, imaging, and procedural data of these 335 patients: demographic features, cerebrovascular risk factors, nihss scores on admission, use of iv thrombolysis, time to endovascular treatment, procedure time, time to reperfusion, revascularization status, underlying intracranial atherosclerotic stenosis, tandem occlusion at the proximal cervical portion of the ica, intracranial hemorrhage on post - therapeutic ct scans or gradient echo mri, alberta stroke prognosis early ct score (aspects) applied to dwi (dwi - aspects), and clinical outcomes at 3 months . The institutional ethics committee approved this retrospective analysis and waived informed consent based on the study design . The inclusion criteria for stent - retriever embolectomy were as follows: (1) the procedure started within 6 hours of symptom onset, (2) baseline nihss score 4, (3) occlusion of ica or mca, (4) no intracranial hemorrhage detected on the cranial ct or mri, and (5) infarct volume less than one - third of the mca territory on dwi (determined as dwi - aspects> 3) or non - enhanced ct (determined by alteplase thrombolysis for acute noninterventional therapy in ischemic stroke [atlantis] criteria). For each patient, written informed consent for endovascular therapy was obtained from a family member . Endovascular therapy was performed under conscious sedation . In cases of agitation, an intravenous bolus of midazolam stent - based thrombectomy with a solitaire stent (covidien, irvine, usa) or trevo stent (stryker, kalamazoo, usa) was performed as the first - line endovascular treatment . When stent - based thrombectomy was unsuccessful, additional mechanical approaches were performed, including manual aspiration thrombectomy with a penumbra reperfusion catheter (penumbra, alameda, usa) or navien catheter (covidien, irvine, usa). Intracranial angioplasty with or without stenting was performed when severe (> 70%) underlying intracranial atherosclerotic stenosis was observed . When the patient had a tandem occlusion at the proximal cervical portion of the ica, carotid angioplasty and stenting were performed prior to stent - retriever thrombectomy . Revascularization status was assessed on the final angiogram and was classified according to the modified tici scale, and successful revascularization was defined as a modified tici grade of 2b or 3 . All patients underwent non - enhanced ct scans immediately and 24 hours after endovascular treatment and gradient echo mri 24 - 36 hours after treatment . Intracerebral hemorrhages were assessed on posttreatment ct and gradient echo mr images and classified as hemorrhagic infarction (hi) or parenchymal hemorrhage (ph) based on the european cooperative acute stroke study (ecass) criteria . Symptomatic intracranial hemorrhage was defined as any intracranial hemorrhage that caused neurological deterioration (increase of 4 points in nihss score or deterioration of 1 point in the level of consciousness on nihss). Clinical outcome was assessed by a stroke neurologist using the modified rankin scale (mrs) during an outpatient visit 3 months after treatment . If patients were unable to attend the outpatient clinic, outcomes were obtained via a telephone interview . First, the relationship between each clinical and procedural characteristic and 3-month outcome was determined . The 2 test or fisher exact test was used for comparing categorical variables, and the mann - whitney u test was used for comparing continuous variables . Second, independent associations between good outcome (mrs 0 - 2) and clinical and procedural factors were determined with a multivariate logistic regression analysis . The variables tested in the multivariate logistic regression models were those with p<0.05 in the univariate analysis . Third, a multivariate logistic regression analysis was performed to identify independent predictors for mortality at 3 months . Variables with a p value of <0.05 in the univariate analysis on mortality were included in a multivariate logistic regression analysis . All statistical analyses were performed with spss software (version 21.0; ibm spss, chicago, il, usa). Of the 335 patients with acute anterior circulation stroke, 233 patients had occlusions in the mca and 102 in the ica . Successful revascularization (modified tici 2b or 3) was achieved in 81.8% (n=274/335) and a good outcome in 45.1% of patients (n=151/335). Parenchymal hemorrhage occurred in 8.9% (n = 30/335) and symptomatic hemorrhage in 3.9% (n=13/335). Seventy - one patients (21.2%) received manual aspiration thrombectomy as a rescue therapy after failed stent - retriever thrombectomy . Forty patients (11.9%) had underlying intracranial atherosclerotic stenosis, and 36 (10.7%) had a tandem occlusion at the proximal cervical portion of the ica . In the entire cohort (n=335), the median dwi - aspects was 7 (iqr, 6 - 8). Patients with good outcome had a higher dwi - aspects score compared to those with poor outcome (8 vs. 7; or, 1.278; p<0.001). In univariate analysis, the following variables were identified as predictors of a good outcome at 3 months: younger age, absence of hypertension, dwi - aspects, mca occlusions (vs. ica occlusions), low baseline nihss, no need for rescue therapy, successful revascularization, absence of parenchymal hemorrhage or symptomatic hemorrhage, shorter procedure time, and a shorter time to revascularization . When dichotomized, patients aged 80 years had more frequent poor outcome (mrs 3 - 6) than those aged <80 years (69.6% vs. 51.1%; or, 2.2; p=0.007) in univariate analysis . In multivariate analysis, younger age (or, 0.965; 95% ci, 0.944 - 0.986; p=0.001), successful revascularization (or, 4.658; 95% ci, 2.240 - 9.689; p<0.001), low baseline nihss (or, 0.908; 95% ci, 0.855 - 0.965; p=0.002), and absence of parenchymal hemorrhage (or, 0.150; 95% ci, 0.049 - 0.460; p=0.001) were independent predictors of good outcome at 3 months (table 2). In univariate analysis, age, history of previous stroke / transient ischemic attack (tia), revascularization status, symptomatic hemorrhage, and baseline nihss score were associated with mortality at 3 months . Patients aged 80 years had a higher mortality rate than those aged <80 years (18.8% vs. 8.6%; or, 2.2; p=0.015) in univariate analysis . In multivariate analysis, age (or, 1.043; 95% ci, 1.002 - 1.086; p=0.041), history of previous stroke / tia (or, 3.124; 95% ci, 1.340 - 7.281; p=0.008), revascularization (or, 0.171; 95% ci, 0.079 - 0.370; p<0.001), and parenchymal hemorrhage (or, 2.961; 95% ci, 1.059 - 8.276; p=0.038) were independent predictors of mortality at 3 months (table 3). The main findings of our study are summarized as follows: 1) age, revascularization status, and parenchymal hemorrhage are significant independent predictors of not only good clinical outcome but also mortality at 3 months; 2) in addition, nihss score on admission is independently associated with good outcome, whereas a history of previous stroke / tia is independently associated with mortality . Several studies have evaluated independent predictors of clinical outcome after stent - retriever thrombectomy in patients with acute ischemic stroke due to intracranial large vessel occlusion [4 - 8]. These previous studies have identified that younger age, lower admission nihss score, successful recanalization, shorter procedure time, smaller early ischemic changes on pretreatment ct, and lower serum glucose level were independent predictors of good outcome [4 - 8]. Symptomatic ich, baseline dwi - aspect score, baseline nihss 20, and onset to recanalization> 5 hours have been identified as independent predictors of mortality after stent - retriever thrombectomy . However, these studies are limited by small sample sizes and inclusion of posterior circulation stroke . The strengths of our study include a large sample size, inclusion of only anterior circulation stroke, and consistency in patient selection and endovascular procedures . In our study, age a good outcome was significantly less frequent among patients 80 years than among those <80 years (30.4% vs. 48.9%) and mortality was significantly more frequent among patients 80 years (18.8% vs. 8.6%) in the present study . Patient age 80 years was associated with a 2.2-fold increase in both poor outcome and mortality compared with the younger cohort . The results of our study are in agreement with those of north american solitaire stent - retriever acute stroke (nasa) registry, which included 354 patients . In the nasa registry, patients> 80 years showed less favorable outcome (27.3% vs. 45.4%, p=0.02) and increased mortality (43.9% vs. 27.3%, p=0.01) compared with patients 80 years in age . However, a meta - analysis of 4 recent randomized trials showed a trend toward better outcome (mrs 0 - 2 at 90 days; 38% vs. 19%) and a significant reduction in mortality (20% vs. 41%, adjusted or 3.7; p=0.01) in patients 80 years who received solitaire stent thrombectomy when compared to those received medical treatment alone . Thus, old age should not be used as exclusion criteria for stent - retriever thrombectomy in patients with acute large vessel occlusions . Our study suggests that successful recanalization is still a strong predictor of clinical outcome after endovascular treatment for acute ischemic stroke in this recent era of mechanical thrombectomy . In the present study, successful recanalization (defined as modified tici 2b) occurred in 82% of patients and was the most powerful independent predictor of both good clinical outcome and mortality . Our results are consistent with 2 previous reports, which demonstrated that successful recanalization is one of the independent predictors of good outcome . With regard to association between recanalization and mortality, the nasa registry showed that successfully recanalized patients had lower mortality (25.2% vs. 46.9%, p<0.001 in a univariate analysis) after solitaire stent thrombectomy . In the nasa registry, proximal occlusion (ica or basilar artery occlusion), high admission nihss score (18), and need for rescue therapy were predictors of mortality in successfully recanalized patients . The results of our study together with previous studies strongly suggest that neurointerventionalists should make every effort to achieve successful recanalization in order to increase good outcome and decrease mortality . Parenchymal hemorrhage is considered the most catastrophic complication of reperfusion therapy for acute ischemic stroke and is known to be one of predictors of clinical outcome . In our study, parenchymal hemorrhage occurred in 8.9% of patients . Patients with parenchymal hemorrhage had good outcome less frequently (13.3% vs. 48.2%) and mortality more frequently (23.3% vs. 9.5%) compared to those without it . Our findings are consistent with a recent multicenter retrospective study, which included 1,122 patients with anterior circulation large vessel occlusion strokes who received multimodal endovascular therapy . In that study, parenchymal hemorrhage occurred in 8.6% of patients (96 of 1122) and was associated with a higher rate of poor outcome (or=6.24, p<0.001) and higher mortality (or=3.52, p<0.001). In that study, atrial fibrillation (or=1.61, p=0.045) was an independent predictor of parenchymal hemorrhage . In addition, mishra et al . Suggested that the presence of a severely hypoperfused lesion on pretreatment imaging (defined as a very low cerebral blood volume on perfusion mri) is a strong predictor of parenchymal hemorrhage (or=33, p<0.001) in patients undergoing endovascular therapy for acute stroke . However, there was no significant clinical or procedural predictor of parenchymal hemorrhage in univariate or multivariate analysis in our study . Although the occurrence of parenchymal hemorrhage after endovascular therapy is multifactorial, careful patient selection based on pretreatment imaging studies, judicious management of blood pressure, and reduced use of contrast agents and thrombolytic drugs during the endovascular procedure are all needed to decrease the occurrence of parenchymal hemorrhage . Interestingly, a history of previous stroke / tia was independently associated with mortality in our study, which has not been previously reported in stent retriever thrombectomy studies . Mortality occurred more frequently in patients with previous stroke / tia (23.1% vs. 8.5%) than those without it . Although this is a novel finding in studies regarding mechanical thrombectomy using stent retrievers, a history of previous stroke / tia has been found as a predictor of short - term and long - term mortality in patients with acute ischemic stroke compared with healthy control subjects in observational studies . The results of our study and previous studies indicate that more improved management of vascular risks is needed to prevent secondary stroke and subsequent cardiovascular mortality in patients with first - ever stroke . In our study, nihss score on admission was independently associated with good outcome but not with mortality . Reported that baseline nihss score (or=1.228, p=0.002) was an independent predictor of poor outcome at 3 months . Jiang et al . Showed that patients with lower baseline nihss score (score <20) had good outcome less frequently (21.1% vs. 56.9%, or=5.25) compared with those nihss score 20 . In addition, shi et al . Reported that baseline nihss score was an independent predictor of functional dependence (mrs 3 - 6) despite successful revascularization (or=1.13, p=0.0074) in 109 patients treated with the trevo stent - retriever . However, like advanced age, severe stroke should not be used as exclusion criteria because patients with severe stroke do even worse with medical therapy alone . Baseline aspects measured by ct or mri has been found to be an independent predictor of clinical outcome after stent retriever thrombectomy in two previous studies . In the present study, dwi - aspects was significantly higher in patients with good outcome than those with poor outcome in a univariate analysis (or=1.278, per 1-point increase, p<0.001). However, dwi - aspects was not an independent predictor of both good outcome and mortality in multivariate analyses . Similarly, a recent study showed that there were no differences in outcomes between patients with high dwi - aspect scores of 7 - 10 and those with intermediate scores of 4 - 6 who underwent stent retriever thrombectomy for acute anterior circulation stroke . This finding may be because of the high rate of successful revascularization with stent retrievers in that study and the disparity between aspect score and infarct lesion volume . In addition, some potential confounding factors, such as blood glucose level were not analyzed in our study . Admission blood glucose level is known to be associated with poor outcome, increased hemorrhage, and mortality following iv thrombolysis or stent - retriever thrombectomy . We did not analyze blood glucose level in this study because it was missing for some patients . Finally, the fact that 21.2% of patients received manual aspiration thrombectomy as a rescue therapy after failed stent - retriever thrombectomy may limit the accuracy of data in regard to interpretation related to the value of stent retriever thrombectomy . In conclusion, age, revascularization status, and parenchymal hemorrhage are independently associated with both good outcome and mortality after stent - retriever thrombectomy in patients with acute anterior circulation stroke . In addition, nihss score on admission is independently associated with good outcome, whereas a history of previous stroke is independently associated with mortality . Our results suggest that achieving successful revascularization and trying to reduce parenchymal hemorrhage are priorities when performing stent retriever thrombectomy in patients with acute anterior circulation stroke . The data also suggest a novel finding that a history of previous stroke / tia can be considered a predictor of mortality in patients receiving stent retriever thrombectomy.
A 65-year - old man with intermittent, colicky periumbilical pain which first occurred two months earlier was admitted to hospital . He had an eight - year history of congestive heart failure caused by mitral valvular regurgitation and atrial fibrillation . He was nonalcoholic, and there was no history of diarrhea, hematochezia, or melena . Vital signs at admission were stable, and laboratory findings including white blood cell count, a liver function test and electrolytic balance were within the normal ranges . Electrocardiography revealed atrial fibrillation, and chest radiography demonstrated cardiomegaly (not shown). To exclude acute appendicitis, initial ultrasonography (us) was performed, and this demonstrated diffuse, segmental, concentric wall thickening of the terminal ileum just proximal to the ileocecal valve . Nonspecific ileitis, crohn's disease, intestinal tuberculosis or ischemic enteritis were suggested as possible causes of the bowel wall thickening, and in order to evaluate the terminal ileum, colonoscopic examination was performed . The ascending colon was found to be completely obstructed by a circumferential mass lesion, and the colonoscopic fiber could not be advanced further . Subsequent ct scanning showed a markedly dilated small bowel and ascending colon, with concentric, hyperattenuating, focal wall thickening in the hepatic flexure of the ascending colon (fig . In addition, the terminal ileum was dilated and showed diffuse, concentric wall thickening of its long segments with heterogeneous contrast enhancement . In the thickened wall, there appeared to be several possible diagnoses, including ischemic enterocolitis caused by thromboembolism of mesenteric vessels arising from atrial fibrillation, inflammatory bowel disease involving the ascending colon and terminal ileum, and ischemic or infectious enteritis associated with colon cancer . Stool culture yielded lactose - fermenting gram - negative bacillus, urine culture yielded citrobacter freundii, and gram staining of urine revealed the presence of gram - negative rods; no organisms were isolated from blood cultures . In addition to conservative management of congestive heart failure, the patient underwent antibiotic therapy with amoxacillin, tobramycin or aztreonam for two weeks and ciprofloxacin for several days . Symptoms such as abdominal pain ameliorated, the level of bowel sound decreased, and laboratory findings continued to be within normal ranges . Vital signs were stable, except for intermittent fever of up to 38.2 until 30 days after admission . At this time,, the hepatic flexure of the ascending colon was found to be completely obstructed by a hard concentric mass, and about 15 cm of the terminal ileum, just proximal to the ileocecal valve, was markedly dilated and diffusely thickened . A cut section of the thickened terminal ileum revealed marked submucosal edema to a depth of approximately 10 mm, though there was no evidence of mucosal lesion . Microscopic examination also showed that the mucosal folds of thickened ileal loop were blunted by submucosal edema and there was extensive inflammatory reaction, with infiltrations of neutrophils . In some areas of the thickened bowel wall neutrophil infiltration extended into the subjacent muscular layer and even to the serosa (fig . 1d). The inflammatory reactions provided no evidence of granuloma formation, and the histologic findings were consistent with phlegmonous enteritis phlegmonous enterocolitis is a rare inflammatory bowel disease with a high mortality rate of at least 60% . The association between this disease entity and a variety of liver diseases has been well documented (1 - 3), though cases associated with lobar pneumonia, pharyngitis, infected peritoneojugular venous shunt and septicemia have been reported, and it has also occurred in healthy individuals (1, 4 - 6). Several kinds of pathognomic bacteria have been demonstrated in culture or histologically (1 - 6): gram staining of intestinal lesions has revealed a variety of entities such as streptococci, gram - positive cocci, and gram - negative or -positive rods . The mortality rate associated with this disease continues to be high due to delayed diagnosis (1 - 5). Thus, most cases reported in the literature were discovered at autopsy or after the examination of surgical specimens following surgery (1 - 6). Some reports have suggested that earlier diagnosis and surgical resection of diseased bowel, together with the use of broad- spectrum antibiotics, has led to a good outcome (1, 6). The pathogenesis of this disease entity is not clear: ito et al . First, the direct toxic effect of alcohol may affect the gastrointestinal tract, and prolonged alcohol ingestion leading to changes in the intestinal mucosa, with increased intestinal permeability; subsequent penetration of the lamina propria by antigens (organisms) from the intestinal lumen results in a local antibody response . Second, in chronic alcoholism, the systemic and mucosal immune mechanisms are impaired, and this may exacerbate bacterial infection . It is not known why the organisms involved in phlegmonous enteritis are confined to the submucosa . Bowel wall edema associated with portal hypertension has been described in liver cirrhosis, and the loose connective tissue in the submucosa can be excellent soil for the rapid and diffuse spread of the organisms involved in an episode of bacteremia (5). First, the patient was not alcoholic and had no evidence of liver disease or septicemia . Second, his clinical course was silent for a long period, being discovered only at surgery; previously reported cases, on the other hand, manifested an acute and serious clinical course, one which led even to sudden death . In our case, the early use of broad - spectrum antibiotics might have helped his condition to persist . The literature in english includes only one case report dealing with the radiologic findings pertaining to this disease . Mooney et al . (6) reported the ct findings in one case, in which only nonspecific small bowel wall thickening with a small amount of ascites was noted . In our case, the terminal ileum showed marked wall thickening, and thumbprinting and blunted mucosal folds were revealed by ultrasonography . The hypoattenuating focal areas in this thickened wall, shown at microscopic examination to be submucosal abscesses, are, in our case, thought to provide a clue to the diagnosis of phelgmonous enteritis.
Neuroblastoma is the most common extracranial solid tumor in childhood and accounts for 7% of malignancies in patients younger than 15 years . It originates from the sympathetic nervous system, and in particular from a developing and incompletely committed precursor cell derived from neural - crest tissues . Neuroblastoma occurs sporadically in 98% of cases; a genetic defect is involved in the rare familial neuroblastoma . In the subset of cases of neuroblastoma presenting in the context of other congenital abnormalities of the neural crest, the association with a germline loss - of - function mutation of homeobox gene phox2b has been demonstrated; on the other hand, familial neuroblastoma not associated with other congenital disorders of the neural crest arises from activating mutations of the anaplastic lymphoma kinase (alk) oncogene, whose somatic mutations are, however, observed in sporadic cases of the disease . Due to the widespread presence of the sympathetic nervous tissue in various body organs and apparatus, the presenting features of neuroblastoma may be variable, depending not only on the location of the primary tumor but also on the frequent metastases . Furthermore, in young children, neuroblastoma exceptionally manifests with paraneoplastic opsoclonus - myoclonus - ataxia (poma) due to antineuronal nuclear (anti - hu) antibodies which have also been associated with gastrointestinal disturbances, such as constipation, gut dismotility and paralytic ileus . On the contrary, watery diarrhea due to aberrant vasoactive intestinal peptide secretion proteinuria is not part of the presenting features of childhood cancer . In patients with neuroblastoma we report a case where proteinuria was the initial reason for medical evaluation in a child with neuroblastoma . A 10-month - old girl was admitted to our hospital for investigations for nephrotic - range proteinuria . She was born to unrelated, italian, healthy parents, by spontaneous delivery at the 38th week of an uncomplicated pregnancy; her birth weight was 3,110 g. her growth and development were normal until the age of nine months, when she began vomiting, feeding poorly, sweating copiously, and losing weight . On admission, her weight was 7,220 g (<3th percentile), reduced from having previously reached 8,450 g; her length was 68 cm; her body temperature was 37.5c with a heart rate of 150 beats / min and respiratory rate of 46 breaths / min; blood pressure was normal on repeated measurements (82/43 mm hg). Complete blood cell count showed leukocytes 12,800/mm, red cell count 7,160,000/mm, hemoglobin 15.7 g / dl, platelets 501,000/mm . Blood urea nitrogen was 28 mg / dl (10.23 mmol / l), creatinine 1.5 mg / dl (132.60 mol / l), glucose 92 mg / dl (5.1 mmol / l), ast 25 iu / l, alt 42 iu / l; total plasma protein level was 7.9 g / dl, with albumin 56.9% (4.2 g / dl), a1 7.3%, a2 21.3%, 1 6.3%, 2 3.4%, 4.8%; uric acid was 8.5 mg / dl, sodium 138 mmol / l, potassium 3.2 mmol / l, chloride 88 mmol / l, venous ph 7.55 with a partial pressure of carbon dioxide of 29.2 mm hg (probably due to crying and hyperventilation), bicarbonate 27.8 mmol / l and be + 4 . The at iii activity was 100%, prothrombin activity 100% and aptt 29 s, serum lactate dehydrogenase was 376 iu / l and ferritin 5.9 mol / l (normal value for age 7140 mol / l). She had polyuria and hypostenuria (diuresis 125 ml / kg/24 h); urinalysis revealed nephrotic - range proteinuria (6,100 mg/24 h) with albuminuria 4,540 mg/24 h, urinary loss of igg 107 mg/24 h, and a1 microglobulin 29.4 mg/24 h; mild glucosuria (39 mg / dl) and aminoaciduria were also found, without hematuria or casts; urinary ph was 7.5 and urinary density 1,005 . Electrocardiogram revealed sinus tachycardia 180 beats / min; echocardiogram showed very mild concentric left ventricular hypertrophy, however, without pathological features . An endocrinologic evaluation revealed increased plasma renin (8 g / l / h; reference range 1.0 - 4.5 g / l / h) and aldosterone (4.83 nmol / l; reference range 0.1 - 0.8 nmol / l) levels, while cortisol and thyroid hormones were within the normal range; plasma erythropoietin was 42.6 mu / ml (reference range 3.7 - 37.5 mu / ml). Urinary excretion of vanillylmandelic acid was increased to 11 mg/24 h (1.57 mg / kg/24 h; reference range 0.1 - 0.18 mg / kg/24 h), while catecholamines were in the normal range, except for the normetanephrine and noradrenaline, which were also elevated (normetanephrine 1,537 g/24 h, reference range 88 - 440 g/24 h; noradrenaline 120 g/24 h, reference range 010 g/24 h). The ultrasound abdomen examination revealed a solid, suprarenal mass on the left side, sized 2 2 cm; the right kidney showed slightly increased echogenicity on the upper side . High - resolution ct showed an abdominal mass sized 5 5.8 10.7 cm, localized between the vertebral bodies d9 and l3 and the aorta, enveloping the celiac tripod, the superior mesenteric artery and bilaterally the renal vessels . The upper half of the right kidney showed an area of reduced perfusion, while the left kidney showed abnormal tissue density . Adrenal glands were not identifiable in the context of the tumor mass, in which some calcifications were recognizable . Histopathology showed a tumor with a low grade of neuroblastic differentiation, with mitosis - karyorrhexis index (<2%) and elevated mitotic activity . In this patient, the presenting signs and symptoms of neuroblastoma included severe dehydration, polyglobulia, tubulointerstitial damage with acute kidney injury and renal insufficiency, electrolyte and acid - base unbalancing and heavy glomerular proteinuria . Although diarrhea and dehydration may be observed at presentation of neuroblastoma, tubular alterations are definitely unusual . We have been able to identify only one case previously: a 4-year - old boy affected by neuroblastoma presenting with nephrotic syndrome has been described in 1979 and renal histology demonstrated membranous glomerulonephritis due to immune complex . On the other hand, poma syndrome and gastrointestinal disturbances are associated with anti - hu antibodies, and furthermore, the development of immune complex has been demonstrated in mice with c1300 neuroblastoma tumors confirming the tendency of neuroblastoma to produce immunologic paraneoplastic diseases . Nevertheless, in a recent study performed on a broad series of adults with solid tumors, the prevalence of rheumatic syndromes was only 2.65%, and none of them manifested nephropathy, which shows the exceptionality of those manifestations also in adult patients . In our opinion, the physiopathology of the complex clinical picture of the case we describe herein is not ascribable to autoimmune pathogenesis, but rather to a hemodynamic mechanism, subsequently complicated by a series of other physiopathologic phenomena . The initial event was the development of the tumor mass from the adrenal glands and its extension upwards to envelope the great abdominal blood vessels and bilaterally the renal vessels . The meaningful feature is that the disruption of renal blood supply and the hemodynamic consequences have been different in the various areas of renal tissue, as revealed by sonography and ct findings . So, local increased intraglomerular pressure could prime the development of the hyponatremic - hypertensive syndrome, characterized by glomerular hyperfiltration with proteinuria, polyuria, acid - base and electrolyte unbalancing, as rarely described in children with renovascular systemic hypertension [9, 10, 11]. Although in those circumstances, as expected, the consequence of the proteinuria is the development of nephrotic syndrome, in other cases the plasma albumin inexplicably remains at a normal level, even in case of lasting and massive albuminuria, as in our patient [11, 12, 13, 14]. We could speculate that the severe dehydration, following copious sweating, vomiting and polyuria, caused such hypovolemia with hemoconcentration that plasma albumin concentration persisted beyond the threshold of edema . Also the polyglobulia could be explained by the same mechanism, even if another factor could have been the increased production of erythropoietin, probably stimulated by local renal parenchyma hypoxia . Hypovolemia was also responsible for the mild activation of the renin - angiotensin - aldosterone system and perhaps for metabolic alkalosis with hypochloremia and hypokalemia, but the loss of chloride through sweating was likely the most important cause of this phenomenon . Hypovolemia and the disruption of local renal blood circulation caused acute kidney injury and the signs and symptoms of proximal tubular damage, as glucosuria and aminoaciduria . On the other hand, the profound hypochloremia was the cause of the metabolic alkalosis, instead of metabolic acidosis typically associated with proximal tubular damage . Increased vasoactive amine secretion from neuroblastoma is not infrequent, and may cause elevated, although usually not severe, hypertension . In conclusion, in our 10-month - old child, alteration of the renal function, at both the glomerular and tubular levels, were the presenting features of neuroblastoma, resulting from multiple pathogenic mechanisms . Our report furthermore emphasizes the high variability and various facets of the clinical manifestations of neuroblastoma.
Mature mirnas are short single - stranded rna molecules, approximately 1923 nucleotides in length . The mirna sequence is encoded in a stem - loop structure in the primary transcript that is cleaved in the nucleus by the ribonuclease iii enzyme drosha to form the precursor mirna (pre - mirna). The pre - mirna is subsequently exported to the cytoplasm by the exportin and then is cleaved by another ribonuclease iii enzyme dicer to form mature mirna [13]. Mature mirnas can regulate the expression of a large number of genes at the posttranscriptional level . Mirna is partially complementary to the sequence of mirna recognition elements (mre) in the 3 untranslated regions (utrs) of target mrnas . The seed sequence with seven nucleotides in mirna determines the specificity of mrna targeting, whereas the remaining mirna sequence is supposed to stabilize the mirna - target complex . Mirna can inhibit translation of target mrnas by blocking protein translation machinery or by sequestering the mrna transcript away from ribosomal interaction . Mirna can also induce target mrna degradation in a similar way like rna interference [1, 5]. Mirnas have been identified in a wide range of species, and computational analysis shows that nearly 30% of protein - coding genes can be modulated by mirnas . In general, mirnas negatively regulate the expression of their targets . However, it is also reported that mir-369 - 3p can upregulate the expression of its target, tumor necrosis factor- (tnf-). Mirnas have been demonstrated to play important roles in many biological processes, such as cell cycle control, proliferation, apoptosis, differentiation, metabolism, hemopoiesis, and development . A rapidly growing body of evidence shows that mirnas also have comprehensive functions in tumor progression . Some mirnas may function as oncogenes (also called oncomirs) while some mirnas are supposed to be tumor suppressors . The importance of mirnas in cancer is highlighted by the fact that half of all mirna genes are located in cancer - associated regions or fragile sites, which are frequently altered or deleted in cancer . Many tumor types show unique mirna signatures; thus, mirnas may be of use in cancer diagnosis and prognosis [11, 12]. Pituitary adenomas are usually benign intracranial neoplasms, accounting for 1015% of diagnosed brain tumors . Pituitary adenomas can be derived from a single mutant cell of five differentiated cell types within pituitary gland: somatotropes, lactotropes, corticotropes, thyrotropes, and gonadotropes, which, respectively, secrete growth hormone (gh), prolactin (prl), adrenocorticotrophic hormone (acth), thyroid - stimulating hormone (tsh), and gonadotropins (follicle - stimulating hormone (fsh) and luteinizing hormone (lh)). According to the hormonal activity, pituitary adenomas can be defined as functioning, causing endocrine dysfunction such as cushing's disease in acth - secreting pituitary adenomas, acromegaly in gh - secreting pituitary adenomas, galactorrhea and amenorrhea in prl - secreting pituitary adenomas, and hyperthyroidism in tsh - secreting pituitary adenomas . On the other hand, nonfunctioning pituitary adenomas (nfa) do not give rise to hormone hypersecretion . Pituitary adenomas might be small lesions with slow growth . However, some pituitary adenomas grow rapidly and cause tumor mass effect, the local compressive effect of large pituitary tumors on brain structures and cranial nerves . They can also invade downwards into the paranasal sinuses, laterally into the cavernous sinuses and upwards into the parenchyma of the brain . Occasionally, malignant pituitary carcinomas metastasize to distant locations in the central nervous system, lymph nodes, liver, and other sites throughout the body . In recent years nevertheless, the correlation and function of mirnas and their target genes in pathogenesis of pituitary adenomas remain largely unknown . Only a small number of mirnas with their target genes in pituitary adenomas have been validated so far . In this review, we summarize recent advances in the study of mirnas and their validated or potential targets in pituitary adenomas and discuss the future perspectives . Aberrant expressions of mirnas have been demonstrated so far (table 1). Mir-15a and mir-16 - 1 are the first two mirnas shown to have differential expression in pituitary adenomas . Mir-15a and mir-16 - 1 genes are located at chromosome 13q14, a region which is frequently deleted in pituitary tumors . Previous studies have suggested that the genes in this locus may be responsible for the progression of pituitary adenoma to a more aggressive form . In 2005, mir-15a and mir-16 - 1 were reported to have lower expression in both gh - secreting and prl - secreting pituitary adenomas than in normal tissues, and their downregulation was correlated with greater tumor volume and impaired secretion of p43, a potent anticancer cytokine, suggesting that mir-15a and mir-16 - 1 may function as tumor suppressors and their inactivation may contribute to tumor growth in pituitary adenomas . In another study on acth - secreting pituitary tumors, mir-15a and mir-16 were also expressed at a lower level, but no association between mirnas expression and tumor size was observed in this study . This is in accordance with the result of a subsequent report which showed no correlation between downregulation of mir-15a and gh - secreting pituitary tumor size . Mutations in mir-16 - 1 gene have been reported to be partially responsible for its altered expression in chronic lymphocytic leukemia (cll) patients . Thus, it is worth exploring whether there are similar mutations in pituitary adenoma patients . Family members are located at chromosomal regions that are often altered or deleted in human tumors . Downregulation of let-7 has been reported in breast, lung, colon, and others cancers [3033] and let-7 is considered a tumor suppressor by targeting ras oncogene . Recently, some studies revealed that high - mobility group a2 (hmga2) is negatively regulated by the let-7 mirnas in vitro [35, 36]. Hmga2 plays diverse roles in many biological processes such as embryogenesis, differentiation, and neoplastic transformation . Overexpression of hmga2 is a hallmark of various tumors, including pituitary adenomas, and is associated with highly malignancy [38, 39]. The transgenic mice with overexpressed hmga2 developed pituitary adenomas, indicating that hmga2 may be involved in pituitary tumorigenesis . In 2009, hmga2 was frequently upregulated in pituitary adenomas including prl, acth, fsh / lh, or null cell adenomas but relatively rare in gh and mixed gh / prl adenomas . Hmga2 overexpression and the decrease of let-7 were significantly correlated with tumor proliferation, growth, invasion, and tumor grade, which lead to a hypothesis that let-7 may also function as a tumor suppressor in pituitary adenomas by targeting hmga2 . Decreased expression of let-7a in pituitary adenomas was also reported in other studies [27, 41], suggesting the general downregulation of let-7 in pituitary adenomas . On the other hand, some other mirnas such as mir-98 can also regulate hmga2 expression, indicating that hmga2 may have multiple mirnas regulators . During pituitary development, let-7b / c was proposed to operate with the rna - binding protein ksrp in a negative feedback loop, in which ksrp induces the maturation of let-7b / c, and let-7b / c posttranscriptionally downregulates the expression of ksrp itself . As pituitary adenomas can be derived from differentiated cell types within pituitary gland, different subtypes of pituitary adenomas could display distinct mirna profiles, and these specific profiles might be useful to distinguish pituitary adenoma subtypes . In 2007, the most representative ones were mir-212, mir-026a, mir-150, mir-152, mir-191, and mir-192, which were upregulated in pituitary adenomas, while mir-024 - 1 and mir-098 were downregulated in tumor samples . Twenty - nine mirnas were identified to be able to predict pituitary adenoma histotype (acth-, gh-, prl - secreting adenomas, and nfa). For the limit of sample numbers, the authors only analyzed the association of deregulated mirnas and tumor diameter in the nfa group . Five mirnas were upregulated (mir-140, mir-099a, mir-099b, mir-030b, and mir-030c) and only one (mir-138 - 2) was downregulated in macroadenomas compared to microadenomas . In 2009, amaral et al . Investigated the differential expression of some mirnas in acth - secreting pituitary tumors . In addition to the decrease of let-7a, mir-15a, and mir-16, they also found underexpression of mir-21, mir-141, mir-143, mir-145, and mir-150 in acth - secreting pituitary adenomas compared with normal pituitary tissues . Among these mirnas, mir-143 expression was decreased in human lung and colorectal cancers [46, 47] and was reported to inhibit kras translation in colorectal cancer cell . Mir-145 was downregulated in human breast, lung, and colorectal cancers [30, 46, 47, 49]. Mir-145 could regulate the expression of various targets in different tumors: fscn1 in esophageal squamous cell carcinoma, oct4, egfr, and nudt1 in lung adenocarcinoma [51, 52], and fli1 in colon cancer . Mir-150 was overexpressed in hematopoietic progenitor / stem cells and was demonstrated to target notch3 in human t - cell development in a recent study . Studies were conducted with the aim of investigating the aberrant expression of mirnas in gh - secreting pituitary adenomas . In 2010, mao et al . Identified totally fifty - two mirnas to be differentially expressed in gh - secreting pituitary adenomas . Mir-184, mir-524 - 5p, mir-629, and mir-766 were upregulated, while mir-124, mir-222, mir-32, mir-744, and mir-765 were downregulated . In 2012, another set of mirnas were identified to be differentially expressed in gh - secreting pituitary adenomas . Eighteen mirnas, including mir-34b, mir-326, mir-432, mir-548c-3p, mir-570, and mir-603, were drastically and constantly downregulated in gh adenomas, whereas only mir-320 was significantly upregulated . Mir-34b and mir-548c-3p were demonstrated to regulate both hmga1 and hmga2 expression, whereas mir-326, mir-432, and mir-570 target hmga2 only . Mir-326 and mir-603 could decrease the expression of the e2 transcription factor 1, e2f1 . Besides, mir-107 was found to be overexpressed in gh - secreting and nonfunctioning pituitary adenomas and inhibited the expression of pituitary tumor suppressor gene aryl hydrocarbon receptor - interacting protein (aip). Recently, palumbo et al . Identified 17 mirnas which were differentially expressed in gh - secreting pituitary tumors . Specifically, five mirnas (mir-26b, mir-26a, mir-212, mir-107, and mir-103) were upregulated and twelve mirnas (mir-125b, mir-141, mir-144, mir-164, mir-145, mir-143, mir-15b, mir-16, mir-186, let-7b, let-7a3, and mir-128) were downregulated . Mir-26b and mir-128 controlled pituitary cell properties through regulation of their direct targets, pten, and bmi1, respectively . Mirnas are also dysregulated in nonfunctioning pituitary adenomas (nfa). In 2011, butz et al . Expressions of smad3, smad6, smad9, meg, and dlk1 were significantly decreased in nfa . Through pathway analysis and in silico target prediction, a specific subset of mirnas was identified that may potentially downregulate tgf- signaling pathway in nfa . Five mirnas predicted to target smad3 (mir-135a, mir-140 - 5p, mir-582 - 3p, mir-582 - 5p, and mir-938) were overexpressed, of which mir-140 - 5p has already been validated to target smad3 directly . In addition, an inverse correlation between tumor size and the expression of eighteen mirnas was observed . Six mirnas of them (mir-450b-5p, mir-424, mir-503, mir-542 - 3p, mir-629, and mir-214) were significantly underexpressed, while one mirna (mir-592) was significantly overexpressed in nfa compared to normal pituitary tissues . In another study, mir-124a was the most upregulated mirna, and mir-31 was the most downregulated mirna in nonfunctioning pituitary adenomas . In gonadotropin - secreting pituitary adenomas, a study demonstrated that mir-10b was upregulated and mir-503 was downregulated . Furthermore, the integration and coordination of hormones and pituitary cells are important for the regulatory function of pituitary tissues . Gonadotropin - releasing hormone (gnrh) acts on pituitary gonadotropes to stimulate lh and fsh synthesis and secretion . Gnrh induces expressions of mir-132 and mir-212 in lt2 pituitary gonadotrope cells to regulate cellular morphology and migration . The p250rhogap protein is a downstream target of mir132/212 and its downregulation is involved in the morphological change and migration altered by gnrh . It is well known that the dysfunction of cell cycle control is a critical step in initiation and progression of human cancers . Some oncoproteins or tumor suppressors play important roles in cell cycle control by interacting with critical cell cycle regulators, such as cyclin, cyclin - dependent - kinase (cdk), or cell cycle inhibitors . During tumor progression, the genes involved in cell cycle control often have aberrant expression, resulting in unlimited tumor cell growth . Some reports suggested that the deregulated mirnas might also regulate cell cycle of pituitary adenomas at the post - transcriptional level (figure 1). Mir-128a, mir-155, and mir-516a-3p target 3-utr of wee1, and exogenous overexpression of these mirnas inhibited wee1 expression . Mir-128a is a brain - enriched mirna and was reported to be decreased in pituitary adenomas . Its ectopic overexpression reduced neuroblastoma cell motility and invasiveness, suggesting its tumor suppressive role . Mir-516a-3p was involved in glioblastoma development and was associated with progression of breast cancer . These mirnas may take part in the regulation of cell cycle in pituitary adenomas together with other related mirnas . Hmga2 is associated with the e1a - regulated transcriptional repressor p120 (e4f), interfering with p120 (e4f) binding to the cyclin a promoter . Ectopic expression of hmga2 resulted in the activation of cyclin a promoter and induction of endogenous cyclin a expression . Moreover, chromatin immunoprecipitation experiments showed that hmga2 was associated with cyclin a promoter only when the gene was transcriptionally activated . These data indicate cyclin a as a cellular target of hmga2 and, for the first time, lead to a mechanism of hmga2-dependent cell cycle regulation . Thus, let-7, as a regulator of hmga2, may exert its effects in cell cycle control of pituitary adenomas by targeting hmga2 . Mir-23b and mir-130b, which were reduced in gh, gonadotroph, and nfpa adenomas, overexpression of mir-23b and mir-130b arrested the cells in the g1 and g2 phase of the cell cycle . Recently, a study revealed that mir-15a and mir-16 - 1 cluster could modulate prostate cancer by targeting multiple genes, including cyclin d1 . Regarding the deregulation in pituitary adenomas, mir-15a and mir-16 - 1 may exert their roles as tumor suppressors by regulating cell cycle . Previous study has shown that mir-126 could modulate phosphatidylinositol 3-kinase (pi3k) signaling by limiting the pi3k regulatory subunit beta (p85b). Loss of mir-126 would eliminate the check point and increase pi3k signaling, which facilitate tumor growth during colon carcinogenesis . Mir-145 was downregulated in gh - secreting pituitary adenomas, which is in line with the results in 11 samples of cortitropinomas . The potential targets of mir-145 include myc, kras, fos, yes, fli, cyclin d2, and mapk transduction proteins, indicating that mir-145 might function in cell cycle control by targeting multiple genes . Mir-503 has been validated to directly target cyclin d1 and is thought to be a tumor suppressor . Furthermore, an important potential target of mir-503 is the cell cycle regulator cdc25 . Mir-26b and mir-128 were found to directly regulate pten and bmi1, respectively . Moreover, mir-128 regulated pten expression and akt activity in the pituitary tumor cells by interfering with the binding of bmi1 to pten promoter . Since pten - akt pathway plays important roles in cell cycle control, mir-26b and mir-128 might regulate cell cycle through pten - akt pathway . Moreover, mir-26a was also overexpressed in acth - secreting pituitary adenomas and plays an important role in cell cycle control by modulating protein kinase c delta . Apoptosis, the process of programmed cell death, is an important barrier for tumor cells . During malignant transformation and tumor progression, tumor cells have to escape this regulated cell death to obtain an advantage in growth and expansion . At the early stage of apoptosis, cells receive death signals, and then the apoptotic trigger is controlled by pro- or antiapoptotic members of b - cell lymphoma 2 (bcl-2) family and other regulatory proteins . Accumulating evidence have shown that mirnas can regulate cancer cell apoptosis by targeting bcl-2 family or other apoptosis regulators (figure 1). Mir-15a and mir-16 - 1 were demonstrated to induce apoptosis by targeting bcl-2 in cll . Bcl-2 is a founding member of the bcl-2 family, a family of antiapoptotic proteins governing mitochondrial death signaling . Bcl-2 is frequently overexpressed in many types of human cancers, including carcinomas, lymphomas, and leukemias . In cll, some other apoptosis related genes were identified to be targets of mir-15a and mir-16 - 1 cluster, such as mcl1, which could enhance cell survival by inhibiting apoptosis . Therefore, it is possible that, in pituitary adenomas, mir-15a and mir-16 - 1 influence apoptosis by targeting multiple antiapoptotic genes . Besides, mir-214 and mir-629, two mirnas overexpressed in nfa and negatively correlated with tumor size, also potentially target bcl2 . Mir-21 was differentially expressed in acth - secreting pituitary adenomas compared with normal pituitary tissues . Mir-21 has been identified to be upregulated in human breast, lung, colorectal and other cancers [30, 46, 49, 75]. Suppression of mir-21 by antisense oligonucleotides or mir-21 knockdown was associated with increased apoptotic activity and inhibition of tumor cell growth, probably by downregulating the target tumor suppressor genes . Mir-21 may exert its function in apoptosis by targeting tumor suppressor pdcd4 and pten . Overexpression of pdcd4 was able to result in apoptotic death, and pten can induce apoptosis through phosphoinositol-3-kinase / akt dependent and independent pathways . Putative targets of mir-212 include death effector domain - containing protein (dedd), a protein involved in apoptotic signaling, as well as other proteins participating in apoptosis . Mir184 was markedly upregulated in gh - secreting pituitary adenomas and was correlated with tumor diameter . Contrary to that, another study reported that ectopic overexpression of mir-184 resulted in increased apoptosis . Study of cheng et al . Suggested that the upregulated mir-150, mir-152, mir-191, and mir-192 may also be involved in apoptosis . Mir-26b was found to be upregulated in gh - secreting pituitary tumors and directly regulate pten . Mir-200c, which has been characterized as a tumor suppressor or oncogene in different cancers, also inhibited apoptosis in pituitary adenoma cells by targeting the pten / akt signaling pathway . Intriguingly, a novel marine drug, sz-685c that was isolated from the secondary metabolites of a mangrove endophytic fungus was reported to induce apoptosis of mmq pituitary tumor cells by downregulating mir-200c . Tgf- has been shown to inhibit proliferation and induce apoptosis in hp75 cells, a cell line derived from a clinically nfa . Thereby, the mirnas targeting tgf- signaling (mir-135a, mir-140 - 5p, mir-582 - 3p, mir-582 - 5p, and mir-938) may have effects in apoptosis . However, as tgf- can also promote cancer cell invasion by inducing epithelial - mesenchymal transition (emt), it is rational to conclude that mirnas targeting tgf- pathway may suppress invasion and metastasis by blocking emt, as mir-300 does in human epithelial cancer . Therefore, mirnas that regulate tgf- pathway play controversial roles in tumor initiation and progression . Deregulation of bmi1 has been revealed to affect apoptosis; thus, mir-128, which was downregulated in gh - secreting pituitary tumors, could also affect apoptosis by directly regulating bmi1 . These data together lead to the hypothesis that many mirnas may function in a network to regulate apoptosis in pituitary adenomas . Although invasion and metastasis are rare in pituitary tumors, studies provide some clues of mirnas' function in pituitary tumor invasion and metastasis (figure 1). Significant correlation between hmga2 overexpression and tumor cell invasion has been detected in breast cancer and gastric cancer [89, 90]. In oral squamous cell carcinomas, strong staining of hmga2 and loss of e - cadherin expression were observed at the invasive front of tumor . Previous studies also demonstrated that tumor - specific downregulation of e - cadherin and h - cadherin was related to invasiveness of pituitary adenoma . Hmga2 may be involved in tumor cell invasion due to its association with epithelial - mesenchymal transition that facilitates tumor cell invasion . Since let-7 regulates hmga2 expression in pituitary adenomas, let-7 may also take a role in pituitary adenoma invasion . In amaral et al . 's study, although no association between mirnas expression and tumor size was observed, the patients with acth - secreting pituitary tumors expressing reduced mir-141 had more chance of remission after transsphenoidal surgery, suggesting that mir-141 may regulate pituitary genes involved in tumor growth and local invasion . Pttg protein 1 is a target of both mir-126 and mir-381, which were downregulated in gh - secreting pituitary adenomas . Aggressive pituitary adenomas and carcinomas frequently have a deletion in regions near the rb gene [94, 95]. In 2010, stilling et al . More mirnas were deregulated between pituitary adenomas and normal pituitaries compared to carcinomas and normal pituitaries . In pituitary carcinomas compared to acth adenomas, mir-122 and mir-493 were upregulated, and, in all three metastatic sites of acth carcinomas, mir-122 expression was markedly increased . Recently, palumbo et al . Identified mir-26b to be upregulated and mir-128 to be downregulated in gh - secreting pituitary tumors . Inhibition of mir-26b and overexpression of mir-128 suppressed colony formation and invasiveness of pituitary tumor cells . Interestingly, the inhibition of mir-26b and overexpression of mir-128 had a synergistic effect on suppressing the tumorigenicity and invasiveness of pituitary tumors . Since deregulation of pten and bmi1 correlates with the invasive and metastatic phenotype of several human cancer types [97, 98], it is possible that mir-26b and mir-128 regulate invasiveness of pituitary tumor cells by directly targeting pten and bmi1, respectively . Although metastatic pituitary carcinomas are rare, these data suggest that altered expression of mirnas may provide diagnostic information to distinguish pituitary adenomas and carcinomas before they metastasize . The symptoms of mass effect and hormonal hypersecretion caused by pituitary adenomas could be reversed by surgical resection or debulking of the adenoma, radiotherapy, or medical treatment . Medical treatment is the primary choice for prolactinomas and the secondary option for acromegaly, cushing's disease, gonadotropin - secreting tumours, and tsh - secreting adenomas . Some studies provide evidence that mirnas were differentially expressed before and after pharmacological treatment, and the altered mirna profile could provide useful information of responsiveness of pituitary adenomas patients to pharmacological treatment (figure 1). In 2007, a microarray was carried out to analyze the mirna profiles in pituitary adenomas and normal pituitary samples . To elucidate whether mirnas profile is altered by pharmacological treatment, differentially expressed mirnas were identified in nfa from patients with pharmacological treatment or patients without treatment . Six mirnas were found to be differentially expressed: mir-29b, mir-29c, and mir-200a were upregulated, while mir-134, mir-148, and mir-155 were downregulated after treatment . Thus, the mirna expression could differentiate treated patient samples from nontreated patient samples . In 2010, another study aimed to identify altered expression of mirnas in gh - secreting pituitary adenomas . Fifteen pituitary adenomas patients were treated with lanreotide for four months before surgery, while six patients did not receive any presurgical medical treatments . Patients with> 50% reduction of gh secretion after lanreotide treatment were considered somatostatin analogs (ssa) responders, while patients with <50% gh secretion were considered ssa nonresponders . Thirteen mirnas were differentially expressed between gh - secreting pituitary adenomas from patients with lanreotide treatment and those without treatment . Eight mirnas (mir-183, mir-193a-5p, mir-222, mir-516b, mir-524 - 5p, mir-601, and mir-629, 99b) were upregulated and five mirnas (mir-124, mir-32, mir-574 - 5p, mir-744, and mir-96) were downregulated . Putative targets of these mirnas are mainly igfbp family members, igfals, scp1, and matrix metalloproteinase-9 . Accumulating evidence demonstrates that a large number of mirnas have altered expression in pituitary adenomas, and these mirnas may play important roles in tumor progression by targeting multiple genes . The molecular mechanism of the regulation of mirnas in pituitary adenomas is still a mystery . Some proofs indicate that genetic or epigenetic alterations may contribute to the deregulated expression of mirnas . For example, mutations in the mir-16 - 1 gene have been reported to be partially responsible for its aberrant expression in cll patients, and expressions of mir-124 and mir-203 are decreased because of cpg methylation . Some mirnas have been demonstrated to target multiple genes, indicating that they may have different roles in pituitary tumors . On the other hand, a gene involved in pituitary adenomas progression can be modulated by more than one mirna . Therefore, the mirnas and their targets could regulate pituitary adenomas progression in a complex network . Advances in the technology to investigate mirnas make it easier and faster to explore more exactly the roles of mirnas in pituitary adenomas . As some mirnas signatures can be used to distinguish pituitary adenomas and normal pituitaries and even subtypes of pituitary tumors, it is also possible to develop mirna based diagnosis and therapies of pituitary adenomas . The knowledge of pituitary pathogenesis is still limited . Continuing study on mirnas and their targets will shed more light on mechanisms of pituitary adenomas.
Altmetrics creates a new approach to evaluating the impact of publications by considering the number of downloads, shares, and discussions on social networks.1 this approach does not replace the traditional bibliometric indicators, such as impact factor and h - index, but rather focuses on new aspects of publication impact.2 although still in its infancy, altmetrics has the potential to become a valid assessment strategy for the evaluation of publication impact.3 altmetric tools capture information through the use of metrics from html views and downloads of articles, blog posts, tweets, bookmarks, etc . All of these sources are alternative indicators of impact that go beyond traditional citation, focusing on the content and uses of the social web,4 with this information provided in real time . Altmetrics elucidate not only the impact of scientific research by researchers but also the impact of the research on the public through social media.2,5 in fact, through altmetrics, the impact of research can be measured at the individual - article level, using a combination of such data as the number of times that a particular paper has been downloaded, discussed, shared, and cited.6 this approach allows not only researchers but also institutions to analyze postpublication activity around a paper in near - real time using various online resources.5 to use this new tool, we focused on the italian researchers of the simpar group, which was founded in pavia in 2007 . This group has rapidly become an eminent translational group in the pain field, with its annual meeting now considered a major international pain conference (www.simpar.eu). In addition to the authors of this study, the other nine members of the simpar group are drs marco baciarello, dario bugada, christian compagnone, andrea fanelli, stefano govoni, maurizio marchesini, cristina e minella, carolina muscoli, and william raffaeli . Simpar s multidisciplinary collaboration has included several professionals of different disciplines and has produced a number of publications on the personalization of pain therapy through a multidisciplinary approach, including traditional medical, genetic, epigenetic, and table s1 lists each of the 18 papers published by at least two simpar members in collaboration between 2010 and 2015 . As described herein, we have been able to obtain statistically significant results regarding the force of the group as a whole in both the research and public communities . For each of the 12 researchers of which our team is comprised, we created an orcid (open researcher and contributor i d) account (www.orcid.org), in addition to an impact story (https://impactstory.org) account that imported our data and synchronized it with the unique orcid identifiers . Collected items were assigned to specific categories, such as cited (or highly cited), saved (or highly saved), or discussed . In doing so, our impact story provided us with data regarding the number of times an article was saved by scholars, cited by other researchers, publicly discussed (facebook, etc), and cited by the general public (blog posts, wikipedia). These metrics were classified along two dimensions: audience (scholars or the public) and type of engagement with the online research products (viewed, discussed, saved, cited).7 from impact story, we were able to retrieve all altmetrics data for the 12 researcher accounts (paper citations, discussions, views by the research community or public). Through the personal profiles of altmetrics, for each member of the simpar group, we were able to count the number of citations, times a paper was saved, and discussions from the public community for each paper published . Then, we compared the simpar group percentages of articles cited (or highly cited), saved (or highly saved), or discussed relative to those published by single authors (either written alone or in collaboration with coauthors who were not members of the simpar group) by means of fisher s exact test . Quantitative variables are described as median and interquartile range (iqr), ie, the 25th and 75th percentiles and compared to collective simpar data or individual publication articles by means of a nonparametric mann the association between citations from scopus and the altmetric score or its components (eg, facebook posts, tweets, mendeley readers) was expressed through a nonparametric spearman s -correlation coefficient . All analyses were performed utilizing stata 14 (statacorp lp, college station, tx, usa). Through the personal profiles of altmetrics, for each member of the simpar group, we were able to count the number of citations, times a paper was saved, and discussions from the public community for each paper published . Then, we compared the simpar group percentages of articles cited (or highly cited), saved (or highly saved), or discussed relative to those published by single authors (either written alone or in collaboration with coauthors who were not members of the simpar group) by means of fisher s exact test . Quantitative variables are described as median and interquartile range (iqr), ie, the 25th and 75th percentiles and compared to collective simpar data or individual publication articles by means of a nonparametric mann the association between citations from scopus and the altmetric score or its components (eg, facebook posts, tweets, mendeley readers) was expressed through a nonparametric spearman s -correlation coefficient . All analyses were performed utilizing stata 14 (statacorp lp, college station, tx, usa). The median number of articles by the authors was 17 (iqr 1027), and the median year of publication was 2013 (iqr 20112014). Altmetrics demonstrated that simpar group publications were more likely to be saved (78% vs 53%, p=0.05) and publicly discussed (61% vs 4%, p<0.0001) than individual publications . However, no significant difference emerged between the simpar group publications and individual publications in terms of being cited (cited 44% vs 36%, highly cited 22 vs 11%; p=0.20) and publicly viewed (11% vs 3%, p=0.25). Notably, eleven of 18 articles published collectively by the simpar group received a tweet (median 1, iqr 13), while only 36 of 151 individual publications received a tweet . Moreover, 15 articles from the simpar group collectively were accessed through mendeley readers (median times accessed 4, iqr 111) versus 85 of the individual publications (median times accessed 2, iqr 08; p=0.01). We describe the correlation between scopus citations and the single components of the analyzed alternative metrics in table 1 . We found that the alternative metrics were generally low, with the exception of those for mendeley readers (=0.47, p<0.0001) (figure 1). We found significant correlations between the simpar group collective publications and their impact on the indicator linked to research activity (mendeley readers), although not to public discussion (such as facebook and tweets). However, the impact of collective simpar group articles was high also on general public items, even though it did not reach statistical significance . This is meaningful, as funders, universities, and publishers increasingly demand indicators of the impact of science on society.8 moreover, we are confident that the new metrics of medical groups could have an impact on the pain - patient community as well . Through online platforms, such as twitter and facebook, like - minded people can form their own communities to discuss their shared experiences, problems, and more . Our results also illustrate how collaborative multidisciplinary teams and their projects improve the overall impact of researchers work on the researchers themselves . If collaborative efforts are more widely disseminated than individual publications, as our study suggests, such efforts can potentially provide additional exposure to group members, which may result in greater career enhancement than individual publications . Through these avenues, researchers can leverage social media opportunities to their own professional and academic advantage.9 enhanced exposure allows for the sharing of ideas and research among respective networks, spotlighting pain studies both nationally and internationally . Finally, as the simpar group take research ethics seriously, we opine that our collaborative approach is an ethical one as well as an effective one . Ways to increase the yield from biomedical research have been identified as an imperative.10 as our collaborative efforts have been demonstrated to enhance access to meaningful, clinically relevant research results, our approach results in more bang for the buck by more readily disseminating useful information to practicing clinicians, as well as to other researchers interested in building upon the fund of data obtained through our investigations . The 18 papers published from italian simpar group (from at least two members) analyzed in the paper are as follows: perotti l, cusato m, ingelmo p, et al . A comparison of differences between the systemic pharmacokinetics of levobupivacaine and ropivacaine during continuous epidural infusion: a prospective, randomized, multicenter, double - blind controlled trial . Postoperative analgesia after laparoscopic ovarian cyst resection: double - blind multicenter randomized control trial comparing intraperitoneal nebulization and peritoneal instillation of ropivacaine . 2015;22(5):759766.casale r, di matteo m, minella ce, fanelli g, allegri m. reduction of painful area as new possible therapeutic target in post - herpetic neuropathic pain treated with 5% lidocaine medicated plaster: a case series . 2014;7:353357.bugada d, allegri m, lavandhomme p, de kock m, fanelli g. inflammation - based scores: a new method for patient - targeted strategies and improved perioperative outcome in cancer patients . Biomed res int . 2014;2014:142425.gigliuto c, de gregori m, malafoglia v, et al . Pain assessment in animal models: do we need further studies? Clinical pharmacokinetics of morphine and its metabolites during morphine dose titration for chronic cancer pain . 2014;36(3):335344.compagnone c, tagliaferri f, allegri m, fanelli g. ethical issues in pain and omics research . Some points to start the debate . Croat med j. 2014;55(1):12.bugada d, guardia nicola f, carboni v, allegri m. transversus abdominis plane catheter infusions after major abdominal surgery in morbidly obese patients: reply to comments . 2014;80(6):747.fanelli a, ghisi d, allegri m. is spinal anaesthesia a suitable technique for ultra - short outpatient procedures? 2013;84(1):7680.bugada d, guardia nicola f, carboni v, allegri m. tap block for opioid - free postoperative analgesia in obese surgery . Genetic variability at comt but not at oprm1 and ugt2b7 loci modulates morphine analgesic response in acute postoperative pain . Consequences of the 118a> g polymorphism in the oprm1 gene: translation from bench to bedside? 2013;6:331353.allegri m, clark mr, de andrs j, fanelli g. pain treatment: a new approach to link bench to bedside gregori s, de gregori m, ranzani gn, allegri m, minella c, regazzi m. morphine metabolism, transport and brain disposition . 2010;11(3):276282.allegri m, de gregori m, niebel t, et al . Pharmacogenetics and postoperative pain: a new approach to improve acute pain management . Spontaneous cervical (c1-c2) cerebrospinal fluid leakage repaired with computed tomography - guided cervical epidural blood patch . Perotti l, cusato m, ingelmo p, et al . A comparison of differences between the systemic pharmacokinetics of levobupivacaine and ropivacaine during continuous epidural infusion: a prospective, randomized, multicenter, double - blind controlled trial . Postoperative analgesia after laparoscopic ovarian cyst resection: double - blind multicenter randomized control trial comparing intraperitoneal nebulization and peritoneal instillation of ropivacaine . Casale r, di matteo m, minella ce, fanelli g, allegri m. reduction of painful area as new possible therapeutic target in post - herpetic neuropathic pain treated with 5% lidocaine medicated plaster: a case series . J pain res . 2014;7:353357 . Bugada d, allegri m, lavandhomme p, de kock m, fanelli g. inflammation - based scores: a new method for patient - targeted strategies and improved perioperative outcome in cancer patients . Gigliuto c, de gregori m, malafoglia v, et al . Pain assessment in animal models: do we need further studies? 2014;10(5):673684 . De gregori s, minella ce, de gregori m, et al . Clinical pharmacokinetics of morphine and its metabolites during morphine dose titration for chronic cancer pain . Compagnone c, tagliaferri f, allegri m, fanelli g. ethical issues in pain and omics research . Bugada d, guardia nicola f, carboni v, allegri m. transversus abdominis plane catheter infusions after major abdominal surgery in morbidly obese patients: reply to comments . Fanelli a, ghisi d, allegri m. is spinal anaesthesia a suitable technique for ultra - short outpatient procedures? Bugada d, guardia nicola f, carboni v, allegri m. tap block for opioid - free postoperative analgesia in obese surgery . Genetic variability at comt but not at oprm1 and ugt2b7 loci modulates morphine analgesic response in acute postoperative pain . Consequences of the 118a> g polymorphism in the oprm1 gene: translation from bench to bedside? Allegri m, clark mr, de andrs j, fanelli g. pain treatment: a new approach to link bench to bedside the simpar meeting 2011 . . De gregori s, de gregori m, ranzani gn, allegri m, minella c, regazzi m. morphine metabolism, transport and brain disposition . Spontaneous cervical (c1-c2) cerebrospinal fluid leakage repaired with computed tomography - guided cervical epidural blood patch.
Clinical presentation is variable and may include: skin manifestations like recurrent oral or genital ulcers as well as, cns, articular, and ocular signs as described by the international study group of behet's disease as the key diagnostic features1). Diverse vasculopathies and thrombophilia of any size and in any vessel, encompass vascular accidents of arterial, venous vasculitis, and thrombosis in behcet's disease ., we describe a case of behet's disease that was complicated by cardiac tamponade with hemorrhagic pericarditis, ttp, dvt, coronary artery stenosis and a coronary artery pseudo aneurysm, the latter of which occurred during disease evolution . A 37-year - old woman was transferred to our emergency room with the history of syncope . Three days previously, she experienced chest discomfort, dyspnea, palpitations and a low grade fever, but had no relevant past medical history or co - morbidity . At presentation her blood pressure was 80/50 mmhg, pulse rate 76/min, respiratory rate 36/min and body temperature 37.5. the physical examination was remarkable for: dyspnea, orthopnea, absence of normal heart sounds, and jugular vein dilatation; additional tests revealed: low voltage ecg, sinus tachycardia and a large cardiac shadow on x - ray . Laboratory findings showed a ph of 7.37, paco2 18.8 mmhg, pao2 88.5 mmhg, hco3 10.8 mmol / l on abga, hemoglobin 9.2 g / dl, white blood cell of 12900/l, and platelet 476000/l on cbc . The patient had a suspected cardiac tamponade therefore a transthoracic echocardiography (tte) was performed immediately and revealed moderate pericardial effusion and a hypokinetic lv at the anterior, anterolateral and apex portions of the heart (figure 1). The drained fluid had a white blood cell 225 (pml 100%), red blood cell 90,000/l ldh 1064u / l, and glucose 190 mg / dl; there were no organism on gram stain and culture . A class i cytology, indicating acute and chronic inflammation was revealed . On postoperative day 3, fever, dyspnea, oliguria and mental status changes developed and the patient deteriorated rapidly . A follow - up evaluation showed the serum hemoglobin to be 6.9 g / dl, white blood cell 14900/l, platelets 18000/l and ast, alt and cpk of 272, 151, and 247 blood urea nitrogen was 40.6 mg / dl, creatinine 4.9 mg / dl, ldh 2279 u / l, pt 11.6 seconds and aptt of 32 seconds . A peripheral blood smear was remarkable for schistocytosis, anisocytosis, normoblasts and a thrombocytopenia, suggestive of microangiopathic hemolytic anemia (figure 2). All of these findings were compatible with the diagnosis of thrombotic thrombocytopenic purpura (ttp). Treatment with methylprednisolone pulse therapy was started (1 g / day for 3 days). Investigation for the etiology of ttp revealed that the patient had suffered from severe recurrent oral and genital ulcers . The ulcers were reported to be as frequent as 3 to 4 per month and were exacerbated by menstruation after the age of 20 . The patient also reported taking medications intermittently for painful skin indurations and eruptions as well as arthralgia . Considering the clinical symptoms in total the diagnosis, of behcet's disease complicated by ttp and hemorrhagic pericarditis, was made . Treatment with methylprednisolone pulse therapy resulted in a dramatic response with improvements of the cbc, lft, azotemia, and improved mental status . The patient went on to fully recover and returned to normal activities of daily living within a few days . Follow - up evaluation with tte after complete recovery showed a normal right and left ventricular heart function and a minimal pericardial effusion . After discharge, the patient continued taking medication including colchicine 1.2 mg / day and prednisolone 5 mg / day . She presented with a sudden onset left leg swelling and pain that was diagnosed as a left proximal femoral vein thrombosis by duplex scan . The patient was treated with catheter directed thrombolysis using urokinase, thrombectomy and venoplasty and then started on combination anticoagulation therapy (figure 3). Six months after maintenance therapy with coumadin, colchicines, and sulfasalazine was started, a homogenous soft tissue mass was found, incidentally, on routine laboratory and radiologic follow up . The soft tissue density was attached to the left perihilar area by the pulmonary conus (figure 4). The laboratory tests showed a hemoglobin of 11.1 g / dl, platelet 324000/l, wbc 6000/l, esr 39 mm / h, crp 1.59 mg / dl, albumin 4.5 g / dl, ldh 503 u / l, bun 11.8 mg / dl, creatinine 1.0 mg / dl, pt 29.7 second, inr 2.95 . Chest ct angiography and cardiac mri revealed a 5x5 cm sized round aneurysmal sac between the left atrium and left ventricle adjacent to the proximal pulmonary artery, but no definite stalk from the origin could be found (figure 5). A doppler echocardiography demonstrated holosystolic ejection flow from the surface of the left ventricle (figure 6). Despite the fact that the origin of aneurysmal stalk could not be identified, the pressure gradient calculated by the color doppler flow from the aneurysmal stalk to lumen was about 9 mmhg . The dilated vascular sac appeared to be a pseudo aneurysm with a coronary artery origin . The scan revealed a reversible perfusion defect on the antero - septal wall (figure 7). Subsequent coronary angiography allowed us to confirm the diagnosis of a pseudo aneurysm from the mid - left anterior descending artery (lad), which interrupted distal flow by creating indentations and diffuse stenotic lesions along the whole length of the right coronary artery (rca). In addition, a well developed collateral circulation was observed from the lad and the left circumflex artery (lcx). An emergency operation was planned for aneurysmal resection and coronary artery bypass grafting (cabg). However, because of the size and thus the risk of rupture, we opted instead for balloon angioplasty with a u - pass and graft stent . Implantation proceeded using a graftmaster 3.019 mm at the mid lad the origin of pseudo aneurysm (figure 8). Because of the compromised distal flow of the rca, the lad would be of no advantage to the outcome of the cabg . If packed completely, it was expected that the aneurysmal sac would not grow any more and would regress by resorption and fibrosis . The administration of high dose glucocorticoid therapy (prednisolone 1 mg / kg / day) with azathioprine (150 mg / day) in addition to the mechanical intervention were both highly effective management as demonstrated by a follow - up tte and coronary angiography which showed no further diversion of flow from the lad and regression of the aneurysmal size to 3.93.8 cm from 55 cm initially . And a preserved heart function (lvef 60%) (figure 9). Six months after discharge, the patient was asymptomatic and only a vestige of the aneurysm was evident by routine chest x - ray (figure 10). Behet's disease has a heterogenous presentation with variable symptoms including: mucocutaneous, ophthalmic, neurological, cardiovascular, pulmonary, gastrointestinal, urogenital and musculoskeletal involvement . The prevalence of vascular involvement in behet's disease has been reported to range from 7.7 to 60.6% . Kabbaj et al reported 85% venous involvement, 10% arterial and 5% combined arterial and venous involvement2 - 4). Deep vein thrombosis, has been found to occur earlier in the course of disease than arterial disease, which develops after a median of 7 years . Deep vein thrombosis occurs primarily in the lower extremities, but involvement is possible at any site5). Although the pathogenesis of thrombotic events in behet's disease has not been elucidated, microscopic examinations of veins and arteries involved have demonstrated vasculitis . It has been postulated that a genetic predisposition to certain agents might result in damage and/or functional impairment of the vascular wall and endothelium of vessels . This observed damage may be due to impaired prostacyclin production, significantly higher levels of plasma endothelin-1,2, von willebrad factor, or anti - endothelial cell antibodies . The role of thrombophilia in behet's disease with protein c or s, or antithrombin deficiency, in the presence of antiphospholipid antibodies or factor v leiden have been investigated but results have been conflicting6, 7). Cardiac involvement in behet's disease is rare, but pericarditis, myocardial infarction, coronary arteritis, valvular regurgitation (especially aortic valve regurgitation), and an impaired conduction abnormalities have been reported8). In our case, hemorrhagic pericarditis was identified as a presenting abnormality with no other identifiable sign or symptom . Reported on the possibility of a link between behet's disease and ttp and came to the conclusion that ttp had developed due to some other cause, e.g., the drugs administered or infection . Others reported hemolytic uremic syndrome (hus) in patients with behet's disease treated with cyclosporin9 - 11). In our case, the patient had a history of prior surgery under general anesthesia, along with exposure to several medications (mainly antibiotics) before the onset of ttp . Nevertheless, she recovered completely and dramatically on high doses of glucocorticoid and conservative maintenance of antibiotics . The prevalence of arterial occlusion in behet's disease has been reported to range from 0.5 to 1.5% and can involve the coronary, subclavian, carotid, renal, pulmonary, or any peripheral artery and cause myocardial infarction, pulseless disease, stroke, hypertension, respiratory failure, or intermittent claudication6). Common sites are the aorta and pulmonary, femoral, popliteal, subclavian and common carotid arteries, but any artery can be affected6, 12). It is significant that aneurysmal rupture is the leading cause of death in behcet's disease patients6), and thus it should be deliberate to counter thrombophilia with anticoagulant therapy despite the presence of the thrombotic event . Degeneration at the anastomotic site and thrombosis are not rare complications in the postoperative period12). Ozeren et al . Reported a pseudo aneurysm originating from the proximal left anterior descending artery and a true aneurysm of the right coronary artery with fistulization to the right atrium . They surgically corrected the pseudo aneurysm under cardiopulmonary bypass support by closing the neck of the false aneurysm using an endo - aneurysmal approach with a gore - tex patch13). In our case several studies have been undertaken to examine graft stent implantation in behet's disease . However, there is no prior report of the involvement of the coronary artery . The main advantages of endovascular treatment are lower mortality rates, e.g., 0.6% to 3.5%, even in high risk groups, and higher success rates (97%). Other advantages are shorter hospital stay and a shorter convalescence period before returning to normal life . In addition, the avoidance of general anesthesia and surgical dissection, this is especially important in behet's disease because of its propensity for healing impairment12, 14, 15). Here, we report on a behcet's disease patient with rare complications related to the cardiovascular system during disease evolution ., these problems included: hemorrhagic pericarditis, ttp, dvt, coronary artery stenosis, and a coronary artery pseudo aneurysm . The coronary pseudo aneurysm was treated with a combined approach of immunosuppression and endovascular non - surgical intervention . Cardiovascular complications of bechet's disease must be treated with aggressive immunosuppression using a combination of corticosteroid and a cytotoxic agents . Anticoagulants and antiplatelet agents are judiciously required to address the risk of hemorrhage during the vasculitic process and that of aneurysmal rupture in cases of thrombotic complications6, 16). In patients with graft stent implantation, as evidenced by the present case, anticoagulants like coumadin may cause aneurysm formation and growth in behet's disease . Therefore, for patients with behet's disease the early detection of cardiovascular complications is of cardinal importance as they are the leading cause of mortality . We recommend that physicians pay close attention to even minor complaints and that physical changes be scrutinized and that regular screening protocols are established for the early detection of cardiovascular complications in behet's disease.
Like most other cells and organisms, bacteria and archaea need to handle the threat of viral infection that kill the organism or reduce their fitness . It matters little how successful an organisms is at other aspects of its life if it cannot deal with its viruses . That fact contributes to the multitude of anti - virus defense mechanisms we see in nature . The defenses can be divided into innate systems, which recognize certain pre - set features to limit infection, and adaptive systems, that are able to learn to recognize threats that were previously not recognized . Microorganisms contain a variety of innate defense mechanisms, such as preventing dna injection, cleaving certain sequences using restriction - modification systems, preventing phage proliferation by bacteriophage exclusion, and even committing altruistic suicide by abortive infection systems to prevent viruses to spread in a population . However, for a long time we humans, along with other vertebrates, had the only known adaptive immune system . The presence of an adaptive immune system in microorganisms was unanticipated when what is now known as the crispr - cas systems were suggested in 2005 and subsequently demonstrated in 2007 . The system is based on storing fragments of genetic material from viruses in a locus called clustered regularly interspaced short palindromic repeats (crispr) in the cells genome . The transcribed crispr rna (crrna) is used to guide crispr associated (cas) proteins to destroy the virus' genetic material . In the many hundreds of articles since published, detailed molecular understanding of the crispr - cas systems have been generated: how the system learns to recognize new viruses, which the components of the systems are and how they are produced, how the virus is recognized and destroyed, what countermeasures the viruses use, and which non - immunity processes crispr - cas components participate in . The diversity of the system is explored and today there are 6 basic types described along with numerous subtypes . A key question that has been surprisingly peripheral over the years is the actual function and importance of the system in nature . In sequenced genomes, convincing crisprs have been found in slightly less than half (45%) of bacteria and almost all (85%) archaea . The numbers may be interpreted as crispr - cas systems being important, though not essential . However, crispr - cas systems have evolved from mobile genetic elements, and appear to have retained a capability to horizontally transferring themselves between cells (though this have not yet been demonstrated experimentally). This mobility is the reason for crispr - cas phylogeny not being very related to the family tree of the organisms they inhabit . The mobility also means that prevalence is not a good indicator of importance, as crispr - cas systems can be regarded as selfish genetic elements . Further, a recent investigation of uncultured microorganisms headed by jillian banfield indicate that in some major bacterial lineages, only 10% contain crispr - cas systems . The authors suggest that restriction enzymes serve as the most important virus defense in the studied lineages . The finding underlines that that investigation of natural communities are important for understanding the importance of crispr - cas systems . The dynamics of crispr - cas immunity was first demonstrated in another study by jillian banfields team where virus - host interaction in acid mine drainage biofilms in california was investigated . The extreme environment of the chosen site was found to harbor only a few species of microorganisms, which allowed an in - depth study normally prevented by the complexity of microbial ecosystems . Using large - scale sequencing of dna directly from environmental samples (at least in terms of what possible at the time) viruses quickly acquired mutations that circumvented the defenses, so called escape virus (or escape phage), by introducing changes in the regions targeted by the spacer . In the case of the acid mine drainage viral community, early experiment on the role of crispr - cas in virus - host interaction in laboratory settings was published in 2013 using the bacterial dairy workhorse streptococcus thermophilus and its d2972 phage . S. thermophilus is convenient for such studies as most phage - resistance is generated by the crispr - cas system . By following the bacteria - phage co - evolution in the population it was clear that crispr spacer diversification and phage evolution was very quick, and it was also discovered that certain regions of the phage genome were preferred as targets for the crispr - cas system . Another study on the same species demonstrated that in addition to the expected competition between crispr - cas immunity and phage escape mutants, there were some unanticipated results: phages could establish themselves in a culture containing one (but not 2) spacers targeting it, bacteria without crispr - cas immunity persist in cultures despite presence of a large amount of phage, and bacteria with 2 spacers targeting a phage could still not establish themselves in a population of phage - sensitive bacteria . The authors conclude that for a full understanding of the interaction of phage and their host bacteria, a model beyond a simple iterative process of crispr - cas immunity and phages escaping it is needed . A key question for understanding the dynamics of virus defense is the relative importance of different anti - virus mechanisms . Which system is most important and under what conditions? When comparing constitutively active (like constitutively costly receptor mutations) and inducible systems (like temporarily costly crispr - cas systems), which is most useful? This question was addressed by edze westra, angus buckling and coworkers, using a combination of theoretical modeling and experimental evolution . As a model system they used pseudomonas aeruginosa bacteria and its dms3vir phage . Unlike s. thermophilus, p. aeruginosa frequently become resistant to phage not just by using its crispr - cas system, but also by mutating the receptor that the phage uses for infection . Under nutrient - rich conditions the authors demonstrated that the flood of infections during nutrient - rich conditions makes a constitutive defense favorable, while the crispr - cas system is favored under nutrient - poor conditions as the cells then only rarely encounter a phage . Having addressed the issue of balancing constitutive and inducible virus defense, the westra and buckling teams turned their attention to the role of immune system diversity . The basic question, as described in the article by van houte et al . Came from the observation that while phage readily generates escape mutants, the dms3vir phages still became extinct after some time in p. aeruginosa cultures . Studies on disease and parasites in plants and animals demonstrate that genetic diversity improves the resistance of a population . Could the phage onslaught result in a diversity of crispr - cas immunity sufficient to over - power escape phage development? The teams set up a study to examine the relationship between crispr diversity and the systems effectiveness by mixing and infecting cultures consisting of different number of clonal strains, where each strain had a different spacer matching the phage but were otherwise identical . Phages readily evolved escape mutants and established themselves in single - strain cultures, but found life increasingly difficult the more diversity there was in the culture, and in mixtures of 2448 strains the phages quickly became extinct . The most diverse cultures could even outcompete a receptor mutant that was constitutively phage resistant . The reason was demonstrated to be that phages are unable to generate mutants resistant to all clones in a mixture . In the most diverse cultures, no escape phages were detected at all . In diverse cultures, an escape phage may be able to infect some strains, but eventually the phage will encounter a resistant cell that will destroy the phage . The sensitive clones are probably prevented from being wiped out in a mixture of strains by the effect known as herd immunity, where disease is unable to spread between a few sensitive individuals in a majority of resistant individuals . To confirm that the interplay between diversity and immunity was not limited to the type i - f crispr - cas system of p. aeruginosa, the role of diversity in type ii - a system on infection of s. thermophilus by virus 2972 in was tested . The result was essentially the same as for p. aeruginosa though phage infection was more persistent, probably due to the lower rate of spacer acquisition in s. thermophilus . The ability of a population with high diversity in crispr - cas immunity to successful protect themselves from viral escape mutants may be a selection pressure driving the evolution of other anti - crispr strategies . Though anticipated after the discovery of the crispr - cas immune system, it took several years for the first cases of phage - encoded anti - crispr proteins to be described . Indeed, a dms3vir phage encoding an anti - crispr protein affected high - diversity crispr populations in the same manner as crispr monocultures, demonstrating that the usefulness of crispr - cas immunity is basically nullified . What impact anti - crispr proteins have on the evolution of crispr - cas system is not clear, but they likely contribute to the evolution of diversity in crispr - cas systems and explain why many microorganisms have several different systems . The findings described above demonstrate that microbial model systems can be used to describe the functional role of virus defense systems . The small but increasing number of studies in the field has provided an increase in our understanding of the interaction between viruses and their hosts, a key process in evolution, ecology and population biology . We will hopefully see more investigation of virus - host interaction in the wake of the above work, e.g. Determining the role of predator - prey models such as the kill - the winner hypothesis and co - evolution models such as the red queen hypothesis . The use of laboratory experiments of phage - host interaction is valuable for hypothesis driven research and is an important addition to direct analysis of natural populations with their higher degree of complexity in species composition and virus interaction.
Two classes of agents, those targeting the m2 ion - channel and those targeting neuramindase, are available to treat or prevent influenza infection . The emergence of resistance to the m2 ion - channel inhibiting drugs, amantadine and rimantadine, has limited their clinical utility . Resistance to neuraminidase inhibitors, including oseltamivir, has also been observed in several seasonal influenza a strains . Drug resistance mutations can emerge in almost all influenza a subtypes / strains, including the pandemic 2009 h1n1 virus, limiting the clinical efficacy of the currently approved drugs . The three largest genomic rna segments encode the viral rna - dependent rna polymerase (rdrp) consisting of the polymerase acidic protein (pa) and polymerase basic proteins 1 (pb1) and 2 (pb2). The pa subunit: (i) has endonuclease activity, (ii) is involved in viral rna (vrna)/complementary rna (crna) promoter binding, and (iii) interacts with the pb1 subunit . Pa has two domains, pan (a 25 kda n - terminal domain; residues 1197) and pac (55 kda c - terminal domain; residues 239716). Crystal structures of pac have been determined in complexes with n - terminal fragments of pb1 . The structure of pan has been solved in several crystal forms both unliganded and with various ligands . Influenza rdrp is responsible for the replication and transcription of the segmented viral rna genes . Viral mrna transcription involves a cap - snatching mechanism in which the polymerase binds to the host cellular mrna via the 5-cap and cleaves the mrna 1213 nucleotides downstream . This cleaved rna fragment, which contains the 5 cap, acts as a primer for viral mrna synthesis . Cap - snatching is an important event in the life cycle of all members of the orthomyxoviridae family of viruses, including influenza a, b, and c viruses . Because the host cell has no analogous activity, inhibitors of cap - snatching may be selective against all influenza subtypes and strains, including oseltamivir - resistant influenza a viruses, without interfering with the host cell . These include 2,4-dioxobutanoic acid derivatives, 5-hydroxy-1,6-dihydropyrimidine-4-carboxylic acid derivatives, and flutimide and its derivatives, 2-hydroxyphenyl amide derivatives, as well as tetramic acid derivatives . Recently, in silico screening with in vitro and ex vivo follow up studies identified hexanetetrones and trihydroxyphenyls as endonuclease inhibitors with anti - influenza activity . As correctly hypothesized, the endonuclease activity of influenza polymerase belongs to the two metal ion group of phosphate - processing enzymes . From an x - ray crystallographic screening campaign of a fragment library targeting the influenza a endonuclease enzyme, we identified the 5-chloro-3-hydroxypyridin-2(1h)-one as a bimetal chelating ligand at the active site of the enzyme . Using this information, we have reported the structure activity relationships for two new series of compounds, 3-hydroxypyridin-2(1h)-ones and 3-hydroxyquinolin-2(1h)-ones, as endonuclease inhibitors (figure 1). Structures and of 5-(p - fluorophenyl-3-hydroxypyridin-2(1h)-one (5-fphp), 6-(p - fluorophenyl)-3-hydroxypyridin-2(1h)-one (6-fphp), 6-(p - fluorophenyl)-3-hydroxyquinolin-2(1h)-one (6-fphq), and 7-(p - fluorophenyl)-3-hydroxyquinolin-2(1h)-one (7-fphq). Phenyl substituted derivatives of 3-hydroxypyridin-2(1h)-ones are among the more potent inhibitors of influenza a endonuclease . While 4-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one did not exhibit significant activity, both 5-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one and 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)one had ic50 values <1.0 m . The present study was undertaken to determine the relative effects of aza substitution at various positions of phenyl substituted 3-hydroxypyridin-2(1h)-ones on their potential to inhibit influenza a endonuclease . This dione can tautomerize to either 5- or 6-(4-fluorophenyl)-3-hydroxypyrazin-2(1h)-one (1b, 1c). The 2,3-dichloropyrazine was treated with excess sodium methoxide to form 2,3-dimethoxypyrazine as previously described . Bromination of 2,3-dimethoxypyrazine with n - bromosuccimide in dmf provided the 5-bromo derivative, which under suzuki coupling conditions with 4-fluorophenylboronic acid gave 5-(4-fluorophenyl)-2,3-dimethoxypyrazine . Treatment of this dimethoxypyrazine with a (1:1) mixture of dioxane and 2 n hcl provided 1 . Suzuki coupling of this intermediate with 4-fluorophenylboronic acid provided 6-(p - fluorophenyl)-4,5-dimethoxypyrimidine, which in a 1:1 mixture of dioxane and 2 n hcl produced 5-methoxy-6-(4-fluorophenyl)pyrimidin-4(3h)-one . The synthetic approach employed for the preparation of various substituted 2-phenyl 5-hydroxypyrimidin-4(3h)-ones is outlined in scheme 3 . 2-chloro-4,5-dimethoxypyrimidine, prepared from 2,4-dichloro-5-methoxypyrimidine, was a common intermediate for these 2-phenyl 5-hydroxypyrimidin-4(3h)-ones . Suzuki coupling with the appropriate phenylboronic acid provided the desired 2-phenyl 4,5-dimethoxypyrimidine derivative, which was initially hydrolyzed with 1:1 dioxane and 2 n hcl to provide the requisite 2-phenyl 5-methoxypyrimidin-4(3h)-one . Further treatment of these 5-methoxypyrimidin-4(3h)-ones with bbr3 in ch2cl2 provided the 2-(fluorophenyl) derivatives 35 as well as the various 2-biphenyl derivatives 68 . In a similar manner, the 2-(4-cyanophenyl) and 2-(3-cyanophenyl) 5-methoxypyrimidin-4(3h)-ones were prepared and treated with and bbr3 in ch2cl2 to form the 5-hydroxypyrimidin-4(3h)-ones 9 and 10 . Treatment of 9 or 10 with sodium azide in dmf in the presence of a catalytic amount of acetic acid gave the 5-tetrazoyl derivatives 11 and 12, respectively . Formation of the 2-methoxymethyl derivative of 4,5-dichloropyridazin-3(2h)-one, followed by selective replacement of the 4-chloro substituent with a methoxyl group, provided 2-methoxymethyl-5-chloro-4-methoxypyridazin-3(2h)-one . This mom - protected chloropyridazin-3(2h)-one was reacted with 4-fluorophenylboronic acid under suzuki coupling conditions to provide 2-methoxymethyl-5-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one . The synthesis of various 6-phenyl substituted pyridazin-3(2h)-ones was accomplished as outlined in scheme 5 . Commercially available 3,4,6-trichloropyridazine was converted to 6-chloro-3,4-dimethoxypyridazine, which was subsequently used with either 4-fluorophenylboronic acid or 4-cyanophenylboronic acid under suzuki coupling conditions to form the 6-phenyl-3,4-dimethoxypyridazine intermediates . Treatment of these dimethoxypyridazines with a 1:1 mixture of dioxane and 2 n hcl provided the 4-methoxypyridazine-3(2h)-ones, which were subsequently treated with bbr3 in ch2cl2 to provide 14 and 15 . Treatment of 15 with sodium azide in dmf in the presence of a catalytic amount of acetic acid provided the 6-(4-(tetrazol-5-yl)phenyl) derivative, 16 (table 1). The tautomeric forms of 5-(4-fluorophenyl)-1,4-dihydropyrazine-2,3-dione, 1b and 1c (5- and 6-(4-fluorophenyl)-3-hydroxypyrazin-2(1h)-one), represent the 4-aza derivatives of both 5- and 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one, respectively . Upon the basis of its nmr spectra, however, the most dominant tautomeric form of 1 is the 1,4-dihydropyrazine-2,3-dione, 1a, with only minor amounts of tautomers 1b and 1c . Alternatively, should 1b or 1c form to an appreciable extent under the enzyme assay conditions, the presence of a 4-aza substituent adjacent to the 3-hydroxyl group of either tautomer 1b or 1c may be associated with reduced intrinsic activity as an inhibitor . The lack of activity observed for 2 is consistent with previous structure activity relationships observed with various 4-substituted 3-hydroxypyridin-2-ones . The presence of a phenyl group or other relatively large substituents at the 4-position of various 3-hydroxypyridin-2-ones is associated with a dramatic loss in potency as an inhibitor . It is noteworthy that when the 4-fluorophenyl substituent is at the 2-postion of 5-hydroxypyrimidin-4(3h)-ones, which is comparable to the 6-position of 3-hydroxypyridin-2-ones, significant activity in terms of endonuclease inhibition is observed (ic50 = 0.58 m). This 4-fluorophenyl derivative is more than twice as potent as either of the 3- or 2-fluorophenyl isomers, 4 and 5 . Steric factors may be responsible for the decreased activity observed for the 4- and 2-biphenyl derivatives 6 and 8, relative to 7 . The structure activity studies performed with 3-hydroxypyridin-2-ones indicated 6-[(4-tetrazoyl)phenyl]-3-hydroxypyridin-2-one had pronounced activity as an endonuclease inhibitor (ic50 = 0.085 m). On the basis of this observation, 2-[(tetrazoyl)phenyl] derivatives of 5-hydroxypyrimidin-4(3h)-one and their 2-(cyanophenyl) precursors were targeted for synthesis and evaluation as endonuclease inhibitors . The 3-cyanophenyl derivative 10 is approximately twice as potent compared to the 4-cyanophenyl isomer 9 . However, the 4-(tetrazoly)phenyl derivative 11 is the most potent of 5-hydroxypyrimidin-4(3h)-ones evaluated (ic50 = 0.15 m) with 3-fold greater potency than the 3-(tetrazoly)phenyl derivative 12 . Previously formed crystals of apo pandemic 2009 influenza endonuclease were soaked in a solution containing 11 as described previously (supporting information, table 1s). The crystal structure revealed that 11 chelates to the two active site metal ions in a mode similar to the 3-hydroxypyridin-2(1h)-one containing compounds (figure 2). The n1 atom of the pyrimidine ring forms hydrogen bond interactions with a network of water molecules present near the active site . N3 interacts with tyr130 through two bridging waters . Similar to the 5-[4-(tetrazoly)phenyl] containing pyridinone compounds, the 2-[4-(tetrazoly)phenyl] makes bidentate hydrogen bond interactions with arg124 . The 2-phenyl ring is rotated 90 relative to the 5-phenyl seen previously and is coplanar with the pyrimidine ring due to the lack of steric restraint from additional ring substitutions as seen previously . Stereoview image of a crystal structure of 11 (yellow) bound to pan(cyan) superposed with a previously published structure (pdb i d: 4m5u) of 5-(4-(1h - tetrazol-5-yl)phenyl)-6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one (green). Metal - coordinating bonds are depicted as black dashed lines whereas hydrogen or electrostatic bonds are depicted in blue . Electron density calculated from an omit map is contoured at 4.0 (blue mesh). Consistent with the structure activity relationships observed with 4-phenyl substituted 3-hydroxy - pyridin-2(1h)-ones, 13 did not exhibit significant activity as an endonuclease inhibitor . These 6-phenylpyridazin-3(2h)-ones 1416 are more active than the 4-fluorophenylpyrazine derivative 1 but are at least an order of magnitude less active than analogous 2-phenyl-5-hydroxypyrimidin-4(3h)-ones . The most active derivative was the 6-(4-tetrazoyl)phenyl-4-hydroxypyridazin-3(2h)-one 16 (ic50 = 3.0 m). Interestingly, 5-substituted 3-hydroxypyridin-2(1h)-ones and 6-substituted 4-hydroxypyridazin-3(2h)ones as well as variously substituted 3-hydroxyquinolin-2(1h)ones have been previously established as d - amino acid oxidase (daao) inhibitors . However, none of these similarly structured aza - analogues of 3-hydroxypyridin-2(1h)-ones that were synthesized in the present study were evaluated for their relative activity as daao inhibitors . Data on the relative activity of these aza 3-hydroxypyridin-2(1h)-one derivatives indicate that 2-phenyl-5-hydroxypyrimidin-4(3h)-ones, which are the 5-aza analogues of 6-phenyl-3-hydroxypyridin-2(1h)-ones, can exhibit comparable activity as inhibitors of endonuclease . However, 6-phenyl-4-hydroxypyridazin-3(2h)-ones, which are the 6-aza analogues of 5-phenyl-3-hydroxypyridin-2(1h)-ones, are 2.38.2-fold less active . Although the tautomers of 5-(4-fluorophenyl)-1,4-dihydropyrazine-2,3-dione can be viewed as 4-aza - analogues either 5- or 6-(4-fluorophenyl)-3-hydroxypyridin-2(1h)-one, they were more than 80 times less potent than either of these 3-hydroxypyridin-2(1h)-ones . The relative ranking of comparable phenyl substituted pyridin-2(1h)-ones and their aza derivatives in terms of endonuclease inhibition is 3-hydroxypyridin-2(1h)-one 5-hydroxypyrimidin-4(3h)-ones> 4-hydroxypyridazin-3(2h)-ones 1,4-dihydropyrazine-2,3-dione . Reaction monitoring and follow - up were done using aluminum backed silica g tlc plates with uv254 (sorbent technologies), visualizing with ultraviolet light . Flash column chromatography was done on a combi flash rf teledyne isco using hexane, ethyl acetate, dichloromethane, and methanol . The h (400 mhz) and c (100 mhz) nmr spectra were done in cdcl3, methanol - d4, and dmso - d6 and recorded on a bruker avance iii (400 mhz) multinuclear nmr spectrometer . Data is expressed in parts per million relative to the residual nondeuterated solvent signals, spin multiplicities are given as s (singlet), d (doublet), dd (doublet of doublets), t (triplet), dt (doublet of triplets), q (quartet), m (multiplet), and bs (broad singlet), and coupling constants (j) are reported in hertz . Analytical hplc was performed on a shimadzu lc-20at prominence liquid chromatograph using a 150 mm 4.6 mm princeton spher-100 rp c18 1000a 5 column using 0% water for 2 min and a 0100% water / methanol gradient over a 5 min period and 5 min at 100% methanol at a 2.0 ml / min flow rate monitoring uv absorbance at 254 and 296 nm . Using this method of analysis, the purity of all compounds used in bioassays was determined to be 95% . Hrms experiments were conducted by washington university resource for biomedical and bioorganic mass spectrometry department of chemistry . 5-(4-fluorophenyl)-2,3-dimethoxypyrazine (100 mg, 0.43 mmol) was dissolved in a mixture of dioxane (5 ml) and 2 n hcl (5 ml). The reaction mixture was then refluxed for 21 h. after the reaction was completed, it was cooled to room temperature . Then solvent was removed under reduced pressure . The white suspension was filtered and solid was collected and dried to give 5-(4-fluorophenyl)pyrazine-2,3(1h,4h)-dione as a white solid (75 mg, 85%); mp 285287 c . H nmr (400 mhz, dmso - d6) 11.55 (s, 1h), 11.46 (s, 1h), 7.57, (dd, j = 9 hz, j = 5 hz, 2h), 7.237.19 (m, 2h), 6.59 (d, j = 3 hz, 1h). C nmr (100 mhz, dmso - d6) 161.8 (jc, fjc, f = 243 hz), 156.9, 155.7, 128.1, 127.6 (jc, f = 9 hz), 121.0, 115.5 (jc, f = 21 hz), 107.1 . F nmr (376 mhz, dmso - d6) 114.0 . Hrms (esi) calculated for c10h7fn2o2na (m + na) 229.0384, found 229.0382 . 5-bromo-2,3-dimethoxypyrazine (150 mg, 0.69 mmol), (4-fluorophenyl)boronic acid (144 mg, 1.03 mmol), pd(pph3)4 (80 mg, 0.069 mmol), and na2co3 (218 mg, 2.06 mmol) were dissolved in a mixture of dioxane (6 ml) and water (2 ml). Then, the reaction mixture was refluxed for 5 h. because the reaction was not completed, additional (4-fluorophenyl)boronic acid (48 mg, 0.34 mmol) was added . It was then again refluxed for 16 h. it was cooled to room temperature, and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 010% etoac / hexane . This afforded 5-(4-fluorophenyl)-2,3-dimethoxypyrazine as a white solid (123 mg, 77%); mp 108110 c . H nmr (400 mhz, cdcl3) 8.03 (s, 1h), 7.90 (dd, j = 9 hz, j = 5 hz, 2h), 7.157.10 (m, 2h). C nmr (100 mhz, cdcl3) 163.06 (jc, f = 247 hz), 149.43, 149.41, 140.29, 132.66 (jc, f = 3 hz), 127.77, 127.73, 127.69 (jc, f = 8 hz), 115 . F nmr (376 mhz, cdcl3) 113.7 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0880 . 2,3-dimethoxypyrazine (565 mg, 4.03 mmol) and nbs (754 mg, 4.23 mmol) were dissolved in dmf (5 ml). Then, the resulting residue was diluted with dcm, and the organic layer was washed with satd nahco3, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure to provide 5-bromo-2,3-dimethoxypyrazine as a white solid (384 mg, 43%); mp 5456 c . H nmr (400 mhz, cdcl3) 7.86 (s, 1h), 4.03 (s, 3h), 3.88 (s, 3h). C nmr (100 mhz, cdcl3) 161.2, 150.0, 141.7, 138.1, 56.6, 55.1 . 2,3-dichloropyrazine (1.04 ml, 10 mmol) was added to meoh (10 ml). It was treated with naome (5.4 g, 100 mmol) and allowed to warm to room temperature . The resulting white suspension was filtered, and the filtrate was concentrated under reduced pressure . The residue was diluted with dcm and washed with water, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure to reveal a colorless liquid . 2,3-dimethoxypyrazine was crystallized as a white solid (1.13 g, 81%); mp 2123 c . H nmr (400 mhz, cdcl3) 7.47 (s, 2h), 3.88 (s, 6h). C nmr (100 mhz, cdcl3) 150.3, 131.7, 53.4 . 6-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one (107 mg, 0.49 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and the 1 m in dcm bbr3 (5 ml, 5 mmol) was added . It was then allowed to warm to room temperature and stirred for 24 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with satd nahco3, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to provide 6-(4-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (50 mg, 50%); mp 285287 c . H nmr (400 mhz, dmso - d6) 12.67 (bs, 1h), 9.83 (bs, 1h), 8.20 (dd, j = 9 hz, j = 6 hz, 2h), 7.87 (s, 1h), 7.297.25 (m, 2h). C nmr (100 mhz, dmso - d6) 161.9 (jc, f = 245 hz), 158.7, 141.1, 138.5, 136.0, 132.3, 130.7 (jc, f = 8 hz), 114.8 (jc, f = 21 hz). Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0568 . 4-(4-fluorophenyl)-5,6-dimethoxypyrimidine (134 mg 0.57 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 12 h. it was then cooled to room temperature . The reaction mixture was put under the vacuum to remove the solvent, which gave white residue . The solid was collected and gave 6-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one as a white solid (109 mg, 87%); mp 204206 c . H nmr (400 mhz, dmso - d6) 12.76 (s, 1h), 8.07 (s, 1h), 8.04 (dd, j = 9 hz, j = 6 hz, 2h), 7.337.28 (m, 2h), 3.34 (s, 3h). C nmr (100 mhz, dmso - d6) 162.5 (jc, f = 246 hz), 158.8, 147.4, 143.7, 142.9, 131.7, 131.2 (jc, f = 8 hz), 115.0 (jc, f = 21 hz), 58.8 . Hrms (esi) calculated for c11h10fn2o2 (m + h) 221.0721, found 221.0721 . 4-chloro-4,5-dimethoxypyrimidine (165 mg, 0.95 mmol), (4-fluorophenyl)boronic acid (99 mg, 1.42 mmol), pd(pph3)4 (110 mg, 0.095 mmol), and na2co3 (300 mg, 2.84 mmol) were dissolved in a mixture of dioxane (9 ml) and water (3 ml). Then the reaction mixture was refluxed for 19 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 010% etoac / hexane . This afforded 4-(4-fluorophenyl)-5,6-dimethoxypyrimidine as a white solid (181 mg, 82%); mp 6264 c . H nmr (400 mhz, cdcl3) 8.53 (s, 1h), 8.07 (dd, j = 9 hz, j = 6 hz, 2h), 7.177.11 (m, 2h), 4.07 (s, 3h), 3.73 (s, 3h). C nmr (100 mhz, cdcl3) 163.7 (jc, f = 249 hz), 164.0, 154.3, 152.0,139.4, 131.4 (jc, f = 8 hz), 131.3, 115.3 (jc, f = 21 hz), 60.2, 54.2 . F nmr (376 mhz, cdcl3) 111.0 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0882 . 4,6-dichloro-5-methoxypyrimidine (300 mg, 1.68 mmol) was added to meoh (10 ml). It was treated with naome (99 mg, 1.85 mmol) and allowed to warm to room temperature . After the reaction was completed, it was put under the vacuum to remove meoh . The resulting residue was diluted with etoac, which was then washed with satd nh4cl, followed by brine . The residue was purified by flash chromatography on silica gel, eluting with 010% etoac / hexane to provide 4-chloro-5,6-dimethoxypyrimidine as a white solid (168 mg, 57%); mp 5355 c . H nmr (400 mhz, cdcl3) 8.27 (s, 1h), 4.03 (s, 3h), 3.88 (s, 3h). C nmr (100 mhz, cdcl3) 163.6, 151.6, 151.3, 138.2, 60.7, 54.8 . 2-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one (58 mg, 0.26 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and the 1 m in dcm bbr3 (3 ml, 3 mmol) was added . It was then allowed to warm to room temperature and stirred for 24 h. then the solvent was removed under reduced pressure . It was filtered, and the solid was collected and dried under vacuum to provide 2-(4-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (23 mg, 42%); mp 252254 c . H nmr (400 mhz, dmso - d6) 12.88 (bs, 1h), 9.64 (bs, 1h), 8.05 (dd, j = 9 hz, j = 5 hz, 2h), 7.54 (s, 1h), 7.337.29 (m, 2h). C nmr (100 mhz, dmso - d6) 163.4 (jc, f = 246 hz), 159.0, 146.9, 143.4, 131.7, 129.4 (jc, f = 9 hz), 129.1, 115.5 (jc, f = 22 hz). Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0566 . 2-(4-fluorophenyl)-4,5-dimethoxypyrimidine (187 mg, 0.799 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 12 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with satd nahco3, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 50100% etoac / hexane to give 2-(4-fluorophenyl)-5-methoxypyrimidin-4(3h)-one as a white solid (41 mg, 23%); mp 229231 c . H nmr (400 mhz, dmso - d6) 12.79 (s, 1h), 7.68 (s, 1h), 8.08 (dd, j = 9 hz, j = 5 hz, 2h), 7.357.30 (m, 2h), 3.79 (s, 3h). C nmr (100 mhz, dmso - d6) 163.6 (jc, f = 247 hz), 158.1, 148.4, 145.4, 130.4, 129.6 (jc, f = 9 hz), 129.1, 115.5 (jc, f = 22 hz), 56.0 . F nmr (376 mhz, dmso - d6) 110.2 . Hrms (esi) calculated for c11h9fn2o2na (m + na) 243.0540, found 243.0546 . 2-chloro-4,5-dimethoxypyrimidine (500 mg, 2.86 mmol), (4-fluorophenyl)boronic acid (601 mg, 4.30 mmol), pd(pph3)4 (330 mg, 0.29 mmol), and na2co3 (910 mg, 8.59 mmol) were dissolved in a mixture of dioxane (12 ml) and water (4 ml). The air was evacuated and replaced with n2 . Then, the reaction mixture was refluxed for 5 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 010% etoac / hexane . This afforded 2-(4-fluorophenyl)-4,5-dimethoxypyrimidine as a white solid (123 mg, 77%); mp 114116 c . H nmr (400 mhz, cdcl3) 8.37 (dd, j = 9 hz, j = 6 hz, 2h), 8.12 (s, 1h), 7.167.12 (m, 2h), 4.17 (s, 3h), 3.98 (s, 3h). C nmr (100 mhz, cdcl3) 163.1 (jc, f = 248 hz), 159.7, 155.3, 141.0, 137.2, 133.6 (jc, f = 3 hz), 129.6 (jc, f = 8 hz), 115.3 (jc, f = 22 hz), 56.4, 54.0 . F nmr (376 mhz, cdcl3) 111.9 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0878 . 2,4-dichloro-5-methoxypyrimidine (2.37 g, 13.2 mmol) and k2co3 (1.8 g, 13.2 mmol) were dissolved in meoh (50 ml) and stirred for 19 h at room temperature . The resulting residue was dissolved in etoac and washed with distilled water, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 020% etoac / hexane to give 2-chloro-4,5-dimethoxypyrimidine as a white solid (1.70 g, 73%); mp 6567 c . H nmr (400 mhz, cdcl3) 7.84 (s, 1h), 4.03 (s, 3h), 3.88 (s, 3h). C nmr (100 mhz, cdcl3) 161.2, 150.0, 141.7, 138.2, 56.6, 55.0 . 2-(3-fluorophenyl)-5-methoxypyrimidin-4(3h)-one (100 mg, 0.45 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (4.54 ml, 4.54 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with 2 n hcl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(3-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (87 mg, 93%); mp 210212 c . H nmr (400 mhz, dmso - d6) 7.89 (d, j = 8 hz, 1h), 7.84 (dd, j = 10 hz, j = 2 hz, 1h), 7.61 (s, 1h), 7.577.52 (m, 1h), 7.36 (td, j = 8 hz, j = 2 hz, 1h). C nmr (100 mhz, dmso - d6) 162.1 (jc, f = 243 hz), 158.9, 146.5, 143.8, 134.7, 131.5, 130.6 (jc, f = 8 hz), 123.0, 117.2 (jc, f = 20 hz), 113.6 (jc, f = 24 hz). Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0565 . 2-(3-fluorophenyl)-4,5-dimethoxypyrimidine (390 mg, 1.67 mmol) was dissolved in a mixture of 2 n hcl (10 ml) and dioxane (10 ml). The reaction mixture was then refluxed for 18 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with water, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 0100% etoac / hexane to give 2-(3-fluorophenyl)-5-methoxypyrimidin-4(3h)-one as a white solid (237 mg, 63%); mp 122124 c . H nmr (400 mhz, dmso - d6) 12.86 (bs, 1h), 7.91 (d, j = 8 hz, 1h), 7.877.83 (m, 1h), 7.71 (s, 1h), 7.587.53 (m, 1h), 7.37 (td, j = 8 hz, j = 2 hz, 1h), 3.81 (s, 3h). C nmr (100 mhz, dmso - d6) 162.1 (jc, f = 242 hz), 157.9, 147.8, 145.5, 134.7, 130.7 (jc, f = 9 hz), 130.1, 123.2 (jc, f = 9 hz), 117.5 (jc, f = 22 hz), 113.8 (jc, f = 24 hz), 56.1 . F nmr (376 mhz, dmso - d6) 112.5 . Hrms (esi) calculated for c11h10fn2o2 (m + h) 221.0721, found 227.0722 . 2-chloro-4,5-dimethoxypyrimidine (300 mg, 1.72 mmol), (3-fluorophenyl)boronic acid (343 mg, 2.58 mmol), pd(pph3)4 (199 mg, 0.17 mmol), and na2co3 (546 mg, 5.15 mmol) were dissolved in a mixture of dioxane (12 ml) and water (4 ml). Then the reaction mixture was refluxed for 8 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 010% etoac / hexane . This afforded 2-(3-fluorophenyl)-4,5-dimethoxypyrimidine as a white solid (393 mg, 98%); mp 8385 c . H nmr (400 mhz, cdcl3) 8.09 (dt, j = 8 hz, j = 1 hz, 1h), 8.03 (s, 1h), 8.017.98 (m, 1h), 7.387.33 (m, 1h), 7.07 (tdd, j = 8 hz, j = 3 hz, j = 1 hz, 1h), 4.09 (s, 3h), 3.90 (s, 3h). C nmr (100 mhz, cdcl3) 163.1 (jc, f = 242 hz), 159.5, 154.6 (jc, f =3 hz), 141.3, 139.8 (jc, f = 8 hz), 136.9, 129.7 (jc, f = 8 hz), 123.1 (jc, f = 3 hz), 116.4 (jc, f = 22 hz), 114.3 (jc, f = 23 hz), 56.2, 53.9 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0879 . 2-(2-fluorophenyl)-5-methoxypyrimidin-4(3h)-one (100 mg, 0.45 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (4.54 ml, 4.54 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with 2 n hcl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(2-fluorophenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (89 mg, 96%); mp 187189 c . H nmr (400 mhz, dmso - d6) 12.80 (bs, 1h), 9.73 (bs, 1h), 7.65 (t, j = 7 hz, 1h), 7.59 (s, 1h), 7.55 (t, j = 7 hz, 1h), 7.367.30 (m, 2h). C nmr (100 mhz, dmso - d6) 159.3 (jc, f = 248 hz), 158.2, 144.6, 143.9, 132.2 (jc, f = 8 hz), 132.1, 130.8, 124.5 (jc, f = 3 hz), 121.8 (jc, f = 12 hz), 116.1 (jc, f = 21 hz). F nmr (376 mhz, dmso - d6) 115.2 . Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0565 . 2-(2-fluorophenyl)-4,5-dimethoxypyrimidine (400 mg, 1.71 mmol) was dissolved in a mixture of 2 n hcl (10 ml) and dioxane (10 ml). The reaction mixture was then refluxed for 18 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with water, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 0100% etoac / hexane, followed by 010% meoh / dcm to give 2-(2-fluorophenyl)-5-methoxypyrimidin-4(3h)-one as a white solid (300 mg, 80%); mp 159161 c . H nmr (400 mhz, dmso - d6) 12.81 (bs, 1h), 7.70 (s, 1h), 7.66 (t, j = 8 hz, 1h), 7.607.55 (m, 1h), 7.377.31 (m, 1h), 3.80 (s, 3h). C nmr (100 mhz, dmso - d6) 159.3 (jc, f = 248 hz), 157.3, 145.9, 132.4 (jc, f = 9 hz), 130.8 (jc, f = 8 hz), 130.2, 124.5 (jc, f = 3 hz), 121.8, 121.6, 116.1 (jc, f = 22 hz), 56.0 . F nmr (376 mhz, dmso - d6) 115.2 . Hrms (esi) calculated for c11h10fn2o2 (m + h) 221.0721, found 221.0721 . 2-chloro-4,5-dimethoxypyrimidine (300 mg, 1.72 mmol), (2-fluorophenyl)boronic acid (343 mg, 2.58 mmol), pd(pph3)4 (199 mg, 0.17 mmol), and na2co3 (546 mg, 5.15 mmol) were dissolved in a mixture of dioxane (12 ml) and water (4 ml). The air was evacuated and replaced with n2 . Then, the reaction mixture was refluxed for 18 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . This afforded 2-(2-fluorophenyl)-4,5-dimethoxypyrimidine as a white solid (402 mg, 100%); mp 7274 c . H nmr (400 mhz, cdcl3) 8.11 (s, 1h), 7.97 (td, j = 8 hz, j = 2 hz, 1h), 7.347.29 (m, 1h), 7.15 (td, j = 8 hz, j = 1 hz, 1h), 7.117.06 (m, 1h), 4.06 (s, 3h), 3.90 (s, 3h). C nmr (100 mhz, cdcl3) 161.0 (jc, f = 253 hz), 159.5, 154.2 (jc, f = 4 hz), 140.9, 137.0, 131.4 (jc, f = 2 hz), 130.9 (jc, f = 8 hz), 126 . 0 (jc, f = 9 hz), 123.8 (jc, f = 4 hz), 116.7 (jc, f = 22 hz), 56.2, 54.1 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0877 . 2-(4-biphenyl)-5-methoxypyrimidin-4(3h)-one (50 mg, 0.18 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (1.80 ml, 1.80 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with 2 n hcl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(4-biphenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (46 mg, 96%); dec 259261 c . H nmr (400 mhz, dmso - d6) 12.85 (bs, 1h), 9.68 (bs, 1h), 8.13 (d, j = 8 hz, 2h), 7.80 (d, j = 8 hz, 2h), 7.75 (d, j = 7 hz, 2h), 7.62 (s, 1h), 7.50 (t, j = 8 hz, 2h), 7.41 (t, j = 7 hz, 1h). C nmr (100 mhz, dmso - d6) 159.1, 147.5, 143.5, 141.9, 139.0, 131.7, 131.3, 129.0, 128.0, 128.5, 126.7, 126.7 . Hrms (esi) calculated for c16h13n2o2 (m + h) 265.0972, found 265.0973 . 2-(4-biphenyl)-4,5-dimethoxypyrimidine (343 mg, 1.73 mmol) was dissolved in a mixture of 2 n hcl (15 ml) and dioxane (15 ml). The reaction mixture was then refluxed for 18 h and became a white suspension . The suspension was filtered and solid was collected to give 2-(4-biphenyl)-5-methoxypyrimidin-4(3h)-one as white solid (256 mg, 78%); mp 292294 c . H nmr (400 mhz, dmso - d6) 12.83 (bs, 1h), 8.14 (d, j = 8 hz, 2h), 7.81 (d, j = 8 hz, 2h), 7.777.72 (m, 3h), 7.50 (t, j = 8 hz, 2h), 7.42 (t, j = 7 hz, 1h), 3.81 (s, 3h). C nmr (100 mhz, dmso - d6) 158.0, 148.8, 145.6, 142.1, 139.0, 131.2, 130.4, 129.0, 128.0, 127.7, 126.74, 126.70, 56.1 . Hrms (esi) calculated for c17h15n2o2 (m + h) 279.1128, found 279.1128 . 2-chloro-4,5-dimethoxypyrimidine (400 mg, 2.29 mmol), 4-biphenylboronic acid (681 mg, 3.44 mmol), pd(pph3)4 (264 mg, 0.23 mmol), and na2co3 (728 mg, 6.87 mmol) were dissolved in a mixture of dioxane (12 ml) and water (4 ml). The air was evacuated and replaced with n2 . Then the reaction mixture was refluxed for 8 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . This afforded 2-(4-biphenyl)-4,5-dimethoxypyrimidine as a white solid (670 mg, 100%); mp 115117 c . H nmr (400 mhz, cdcl3) 8.43 (d, j = 8 hz, 2h), 8.15 (s, 1h), 7.70 (d, j = 8 hz, 2h), 7.67 (j = 7 hz, 2h), 7.47 (t, j = 8 hz, 2h), 7.37 (t, j = 7 hz, 1h), 4.19 (s, 3h), 3.98 (s, 3h). 142.5, 141.1, 140.7, 137.3, 136.4, 128.8, 128.1, 127.5, 126.1, 56.4, 54.0 . Hrms (esi) calculated for c18h17n2o2 (m + h) 293.1285, found 293.1286 . 2-(3-biphenyl)-5-methoxypyrimidin-4(3h)-one (100 mg, 0.36 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and the 1 m in dcm bbr3 (3.60 ml, 3.60 mmol) was added . It was then allowed to warm to room temperature and stirred for 6 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with 2 n hcl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(3-biphenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (34 mg, 36%); mp 221223 c . H nmr (400 mhz, dmso - d6) 8.30 (s, 1h), 7.99 (d, j = 7 hz, 1h), 7.88 (d, j = 8 hz, 1h), 7.81 (d, j = 8 hz, 2h), 7.66 (s, 1h), 7.63 (t, j = 8 hz, 1h), 7.52 (t, j = 8 hz, 2h), 7.43 (t, j = 7 hz, 1h). C nmr (100 mhz, dmso - d6) 158.9, 147.5, 143.7, 140.4, 139.5, 133.1, 132.3, 129.2, 128.9, 128.5, 127.7, 126.8, 126.0, 125.0 . Hrms (esi) calculated for c16h13n2o2 (m + h) 265.0972, found 265.0973 . 2-(3-biphenyl)-4,5-dimethoxypyrimidine (670 mg, 2.29 mmol) was dissolved in a mixture of 2 n hcl (15 ml) and dioxane (15 ml). The reaction mixture was then refluxed for 18 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with water, followed by brine . The solid was collected to give 2-(3-biphenyl)-5-methoxypyrimidin-4(3h)-one as a white solid (493 mg, 77%); mp 209211 c . H nmr (400 mhz, dmso - d6) 12.97 (br s, 1h), 8.34 (s, 1h), 8.04 (d, j = 8 hz, 1h), 7.837.80 (m, 3h), 7.73 (s, 1h), 7.59 (t, j = 8 hz, 1h), 7.51 (t, j = 8 hz, 2h), 7.41 (t, j = 7 hz, 1h), 3.82 (s, 3h). C nmr (100 mhz, dmso - d6) 157.9, 148.9, 145.8, 140.4, 139.4, 132.9, 130.5, 129.3, 128.9, 128.8, 127.8, 126.9, 126.2, 125.2, 56.1 . Hrms (esi) calculated for c17h15n2o2 (m + h) 279.1128, found 279.1129 . 2-chloro-4,5-dimethoxypyrimidine (400 mg, 2.29 mmol), 3-biphenylboronic acid (681 mg, 3.44 mmol), pd(pph3)4 (264 mg, 0.23 mmol), and na2co3 (728 mg, 6.87 mmol) were dissolved in a mixture of dioxane (12 ml) and water (4 ml). The air was evacuated and replaced with n2 . Then the reaction mixture was refluxed for 8 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . This afforded 2-(3-biphenyl)-4,5-dimethoxypyrimidine as a white solid (670 mg, 100%); mp 7274 c . H nmr (400 mhz, cdcl3) 8.62 (s, 1h), 8.36 (d, j = 8 hz, 1h), 8.15 (s, 1h), 7.71 (d, j = 7 hz, 2h), 7.67 (d, j = 8 hz, 1h), 7.54 (t, j = 8 hz, 2h), 7.497.45 (m, 3h), 7.37 (t, j = 7 hz, 1h), 4.18 (s, 3h), 3.97 (s, 3h). C nmr (100 mhz, cdcl3) 159.7, 156.1, 141.4, 141.17, 141.15, 137.9, 137.2, 128.9, 128.8, 128.6, 127.4, 127.3, 126.6, 126.4, 56.4, 54.0 . Hrms (esi) calculated for c18h17n2o2 (m + h) 293.1285, found 293.1286 . 2-(2-biphenyl)-5-methoxypyrimidin-4(3h)-one (50 mg, 0.18 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and the 1 m in dcm bbr3 (1.80 ml, 1.80 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . The resulting residue was diluted with etoac, which was washed with 2 n hcl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(2-biphenyl)-5-hydroxypyrimidin-4(3h)-one as a white solid (31 mg, 64%); mp 271273 c . H nmr (400 mhz, dmso - d6) 7.707.65 (m, 2h), 7.56 (t, j = 8 hz, 2h), 7.48 (s, 1h), 7.39 (t, j = 7 hz, 2h), 7.33 (t, j = 7 hz, 1h), 7.23 (d, j = 7 hz, 2h). C nmr (100 mhz, dmso - d6) 158.6, 156.9, 148.3, 140.8, 140.5, 139.4, 131.9, 130.4, 130.1, 129.9, 128.6, 128.2, 127.2 . Hrms (esi) calculated for c16h13n2o2 (m + h) 265.0972, found 265.0974 . 2-(2-biphenyl)-4,5-dimethoxypyrimidine (309 mg, 1.06 mmol) was dissolved in a mixture of 2 n hcl (15 ml) and dioxane (15 ml). The reaction mixture was then refluxed for 18 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with water, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 2-(2-biphenyl)-5-methoxypyrimidin-4(3h)-one as colorless oil (158 mg, 54%). H nmr (400 mhz, dmso - d6) 12.51 (bs, 1h), 7.59 (t, j = 8 hz, 1h), 7.557.47 (m, 4h), 7.36 (t, j = 7 hz, 2h), 7.30 (t, j = 7 hz, 1h), 7.23 (d, j = 7 hz, 2h), 3.72 (s, 3h). C nmr (100 mhz, dmso - d6) 157.1, 151.0, 145.4, 140.3, 139.8, 133.0, 131.5, 131.4, 130.03, 130.01, 129.8, 128.6, 128.2, 127.2, 55.8 . Hrms (esi) calculated for c17h15n2o2 (m + h) 279.1128, found 279.1129 . 2-chloro-4,5-dimethoxypyrimidine (500 mg, 2.86 mmol), 2-biphenylboronic acid (851 mg, 4.30 mmol), pd(pph3)4 (266 mg, 0.29 mmol), and na2co3 (909 mg, 8.58 mmol) were dissolved in a mixture of dioxane (21 ml) and water (7 ml). The air was evacuated and replaced with n2 . Then the reaction mixture was refluxed for 8 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . H nmr (400 mhz, dmso - d6) 8.26 (s, 1h), 7.84 (dd, j = 7 hz, j = 1 hz, 1h), 7.547.45 (m, 2h), 7.40 (dd, j = 7 hz, j = 1 hz, 1h), 7.307.24 (m, 3h), 7.08 (d, j = 7 hz, 2h), 3.85 (s, 3h), 3.30 (s, 3h). C nmr (100 mhz, dmso - d6) 158.1, 157.2, 142.2, 141.1, 140.0, 137.7, 137.3, 130.4, 130.2, 128.9, 128.6, 127.8, 127.2, 126.2, 56.0, 52.9 . Hrms (esi) calculated for c18h17n2o2 (m + h) 293.1285, found 293.1290 . 4-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile (50 mg, 0.22 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (2.2 ml, 2.2 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . It was filtered, and the solid was collected and dried under vacuum to provide 4-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile as a white solid (15 mg, 32%); mp 324326 c . H nmr (400 mhz, dmso - d6) 13.05 (bs, 1h), 9.91 (bs, 1h), 8.18 (d, j = 8 hz, 2h), 7.95 (d, j = 8 hz, 2h), 7.64 (s, 1h). C nmr (100 mhz, dmso - d6) 158.8, 132.5, 129.4, 127.6, 127.2, 127.1, 126.7, 118.4, 112.5 . Hrms (esi) calculated for c11h8n3o2 (m + h) 214.0611, found 214.0618 . 4-(4,5-dimethoxypyrimidin-2-yl)benzonitrile (53 mg, 0.22 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 5 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with satd nahco3, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 05% meoh / dcm to give 4-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile as a white solid (50 mg, 100%); mp 297299 c . H nmr (400 mhz, dmso - d6) 12.99 (bs, 1h), 8.19 (d, j = 8 hz, 2h), 7.96 (d, j = 8 hz, 2h), 7.75 (s, 1h), 3.81 (s, 3h). C nmr (100 mhz, dmso - d6) 157.8, 147.4, 146.2, 136.5, 132.5, 130.0, 127.8, 118.4, 112.8, 56.1 . Hrms (esi) calculated for c12h10n3o2 (m + h) 228.0768, found 228.0770 . 2-chloro-4,5-dimethoxypyrimidine (100 mg, 0.57 mmol), (4-cyanophenyl)boronic acid (126 mg, 0.86 mmol), pd(pph3)4 (66 mg, 0.06 mmol), and na2co3(182 mg, 1.72 mmol) were dissolved in a mixture of dioxane (9 ml) and water (3 ml). Then the reaction mixture was refluxed for 4 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated in vacuo, and the resulting residue was purified by flash chromatography on silica gel, eluting with 020% etoac / hexane . This afforded 4-(4,5-dimethoxypyrimidin-2-yl)benzonitrile as a white solid (69 mg, 74%); mp 170172 c . H nmr (400 mhz, cdcl3) 8.49 (d, j = 9 hz, 2h), 8.18 (s, 1h), 7.76 (d, j = 9 hz, 2h), 4.20 (s, 3h), 4.02 (s, 3h). C nmr (100 mhz, cdcl3) 159.8, 154.0, 141.8, 141.5, 137.0, 132.3, 128.0, 119.0, 113.0, 56.4, 54.2 . Hrms (esi) calculated for c13h12n3o2 (m + h) 242.0924, found 242.0929 . 3-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile (50 mg, 0.22 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (2.2 ml, 2.2 mmol) was added . It was then allowed to warm to room temperature and stirred for 18 h. then the solvent was removed under reduced pressure . It was filtered, and the solid was collected and dried under vacuum to provide 3-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile as a white solid (27 mg, 58%); mp 294296 c . H nmr (400 mhz, dmso - d6) 8.44 (s, 1h), 8.35 (d, j = 8 hz, 1h), 7.93 (d, j = 8 hz, 1h), 7.68 (t, j = 8 hz, 1h), 7.61 (s, 1h). C nmr (100 mhz, dmso - d6) 159.3, 146.4, 143.9, 134.3, 133.4, 131.9, 131.5, 130.4, 129.8, 118.4, 111.7 . Hrms (esi) calculated for c11h8n3o2 (m + h) 214.0611, found 214.0613 . 3-(4,5-dimethoxypyrimidin-2-yl)benzonitrile (138 mg, 0.57 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 6 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with satd nahco3, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 3-(5-methoxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile as a white solid (56 mg, 43%); mp 255257 c . H nmr (400 mhz, dmso - d6) 12.93 (bs, 1h), 8.44 (s, 1h), 8.34 (d, j = 8 hz, 1h), 7.99 (d, j = 8 hz, 1h), 7.747.70 (m, 2h), 3.82 (s, 3h). C nmr (100 mhz, dmso - d6) 157.9, 147.5, 145.9, 133.9, 133.7, 131.7, 130.7, 130.4, 129.9, 118.3, 111.7, 56.1 . Hrms (esi) calculated for c12h10n3o2 (m + h) 228.0768, found 228.0767 . 2-chloro-4,5-dimethoxypyrimidine (100 mg, 0.57 mmol), (3-cyanophenyl)boronic acid (126 mg, 0.86 mmol), pd(pph3)4 (66 mg, 0.06 mmol), and na2co3(182 mg, 1.72 mmol) were dissolved in a mixture of dioxane (9 ml) and water (3 ml). Then the reaction mixture was refluxed for 5 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated in vacuo, and the resulting residue was purified by flash chromatography on silica gel, eluting with 020% etoac / hexane . This afforded 3-(4,5-dimethoxypyrimidin-2-yl)benzonitrile as a white solid (138 mg, 100%); mp 134136 c . H nmr (400 mhz, cdcl3) 8.61 (s, 1h), 8.54 (d, j = 8 hz, 1h), 8.09 (s, 1h), 7.65 (d, j = 8 hz, 1h), 7.51 (t, j = 8 hz, 1h), 4.13 (s, 3h), 3.95 (s, 3h). C nmr (100 mhz, cdcl3) 159.8, 153.6, 141.7, 138.5, 137.0, 132.8, 131.6, 131.3, 129.2, 118.9, 112.6, 56.4, 54.2 . Hrms (esi) calculated for c13h12n3o2 (m + h) 242.0924, found 242.0928 . 4-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile (68 mg, 0.32 mmol) and nan3 (79 mg, 1.21 mmol) were dissolved in anhydrous dmf (1 ml). It was sealed, and then it was heated at 130 c for 17 h. the reaction was cooled to room temperature and gave a brownish suspension . The resulting residue was suspended in water and filtered to give 2-(4-(1h - tetrazol-5-yl)phenyl)-5-hydroxypyrimidin-4(3h)-one as a dark - brown solid (42 mg, 51%); dec 290292 c . H nmr (400 mhz, dmso - d6) 8.08 (d, j = 9 hz, 2h), 8.03 (d, j = 8 hz, 2h), 7.55 (s, 1h). C nmr (100 mhz, dmso - d6) 161.0, 160.2, 148.9, 143.3, 133.8, 132.4, 131.6, 126.9, 125.5 . Hrms (esi) calculated for c11h9n6o2 (m + h) 257.0781, found 257.0791 . 3-(5-hydroxy-6-oxo-1,6-dihydropyrimidin-2-yl)benzonitrile (108 mg, 0.50 mmol) and nan3 (131 mg, 2.02 mmol) were dissolved in anhydrous dmf (1 ml). It was sealed, and then it was heated at 130 c for 18 h. the reaction was cooled to room temperature and gave a brownish suspension . The greenish solid was suspended in 2 n hcl, followed by second filtration to provide 2-(3-(1h - tetrazol-5-yl)phenyl)-5-hydroxypyrimidin-4(3h)-one as a beige solid (32 mg, 25%); dec 295297 c . H nmr (400 mhz, dmso - d6) 8.67 (s, 1h), 8.11 (d, j = 8 hz, 1h), 7.97 (d, j = 8 hz, 1h), 7.63 (s, 1h), 7.56 (t, j = 8 hz, 1h). C nmr (100 mhz, dmso - d6) 162.3, 159.1, 158.7, 148.0, 143.4, 133.1, 130.4, 128.9, 127.9, 126.5, 125.1 . Hrms (esi) calculated for c11h9n6o2 (m + h) 257.0781, found 257.0785 . 5-(4-fluorophenyl)-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one (55 mg, 0.21 mmol) was dissolved in anhydrous dcm (10 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (2.1 ml, 2.1 mmol) was added . It was then allowed to warm to room temperature and stirred for 24 h. then the solvent was removed under reduced pressure . This gave 5-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one, which was again recharged with 1 m in dcm bbr3 (2.1 ml, 2.1 mmol). The filtered solid was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm . This gave 5-(4-fluorophenyl)-4-hydroxypyridazin-3(2h)-one as a white solid (6.2 mg, 14%); mp 274276 c . H nmr (400 mhz, dmso - d6) 12.70 (s, 1h), 7.76 (s, 1h), 7.58 (j = 8 hz, j = 5 hz, 2h), 7.217.17 (m, 2h). C nmr (100 mhz, dmso - d6) 161.2 (jc, f = 243 hz), 161.9, 154.6, 132.7, 132.4 (jc, f = 8 hz), 127.2 (jc, f = 4 hz), 115.8, 114.2 (jc, f = 21 hz). F nmr (376 mhz, dmso - d6) 114.1 . Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0575 . 5-chloro-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one (58 mg, 0.28 mmol), (4-fluorophenyl)boronic acid (140 mg, 0.43 mmol), pd(pph3)4 (32 mg, 0.028 mmol), and na2co3 (90 mg, 0.85 mmol) were dissolved in a mixture of dioxane (9 ml) and water (3 ml). The air was evacuated and replaced with n2 . Then the reaction mixture was refluxed for 14 h. after the reaction was completed, it was cooled to room temperature, and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated in vacuo, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . This afforded 5-(4-fluorophenyl)-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one as a white solid (56 mg, 74%); mp 123125 c . H nmr (400 mhz, cdcl3) 7.95 (s, 1h), 7.53 (dd, j = 9 hz, j = 6 hz, 2h), 7.117 . 07 (m, 2h), 5.48 (s, 2h), 3.93 (s, 3h), 3.49 (s, 3h). C nmr (100 mhz, cdcl3) 162.6 (jc, f = 247 hz), 161.6, 154.8, 132.3 (jc, f = 8 hz), 128.5, 125.7, 120.7, 112.9 (jc, f = 22 hz), 81.6, 57.9, 57.3 . F nmr (376 mhz, cdcl3) 112.6 . Hrms (esi) calculated for c13h14fn2o3 (m + h) 265.0983, found 265.0992 . 4,5-dichloro-2-(methoxymethyl)pyridazin-3(2h)-one (84 mg, 0.40 mmol) was added to meoh (10 ml). Then the reaction mixture was cooled to 0 c . It was treated with naome (24 mg, 0.44 mmol) and allowed to warm to room temperature . The reaction mixture was then stirred for 18 h at room temperature . After the reaction the resulting residue was diluted with etoac, which was then washed with satd nh4cl, followed by brine . The residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane to provide 5-chloro-4-methoxy-2-(methoxymethyl)pyridazin-3(2h)-one as a white solid (59 mg, 72%); mp 101103 c . H nmr (400 mhz, cdcl3) 7.85 (s, 1h), 5.45 (s, 2h), 4.08 (s, 3h), 3.44 (s, 3h). C nmr (100 mhz, cdcl3) 159.1, 155.1, 127.1, 116.9, 81.9, 57.9, 57.8 . Hrms (esi) calculated for c7h10cln2o3 (m + h) 205.0374, found 205.0384 . 4,5-dichloropyridazin-3(2h)-one (200 mg, 1.21 mmol) and 4-dimethylaminopyridine (15 mg, 0.12 mmol) were dissolved in anhydrous dcm (20 ml). Then the reaction mixture was cooled to 0 c and treated with net3 (0.29 ml, 1.70 mmol), followed by momcl (0.110 ml, 1.454 mmol). The reaction mixture was allowed to warm to room temperature and stirred for 17 h. it was then poured into dcm, and it was washed with satd nh4cl, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane to provide 4,5-dichloro-2-(methoxymethyl)pyridazin-3(2h)-one as a white solid (84 mg, 33%); mp 6567 c . H nmr (400 mhz, cdcl3) 7.78 (s, 1h), 5.41 (s, 2h), 3.43 (s, 3h). C nmr (100 mhz, cdcl3) 156.9, 137.0, 136.0, 134.9, 82.4, 58.1 . 6-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one (16 mg, 0.074 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (0.74 ml, 0.74 mmol) was added . It was then allowed to warm to room temperature and stirred for 36 h. then the solvent was removed under reduced pressure . It was filtered, and the solid was collected and dried under vacuum to provide 6-(4-fluorophenyl)-4-hydroxypyridazin-3(2h)-one as a white solid (5 mg, 35%); mp 281283 c . H nmr (400 mhz, dmso - d6) 13.10 (bs, 1h), 11.02 (bs, 1h), 7.87 (dd, j = 9 hz, j = 5 hz, 2h), 7.307.26 (m,2h), 7.19 (s, 1h). C nmr (100 mhz, dmso - d6) 162.6 (jc, f = 245 hz), 157.6, 155.4, 145.2, 132.0 (jc, f = 3 hz), 128.0 (jc, f = 9 hz), 115.6 (jc, f = 22 hz), 106.0 . F nmr (376 mhz, dmso - d6) 113.0 . Hrms (esi) calculated for c10h8fn2o2 (m + h) 207.0564, found 207.0567 . 6-(4-fluorophenyl)-3,4-dimethoxypyridazine (122 mg 0.52 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 11 h. it was then cooled to room temperature . The reaction mixture was diluted with etoac and washed with satd nahco3, followed by brine . The resulting residue was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm to give 6-(4-fluorophenyl)-4-methoxypyridazin-3(2h)-one as a white solid (41 mg, 36%); mp 211213 c . H nmr (400 mhz, dmso - d6) 13.05 (br s, 1h), 7.96 (dd, j = 9 hz, j = 6 hz, 2h), 7.347.29 (m, 2h), 7.28 (s, 1h), 3.92 (s, 3h). C nmr (100 mhz, dmso - d6) 162.7 (jc, f = 245 hz), 156.2, 155.7, 144.3, 132.0 (jc, f = 3 hz), 128.2 (jc, f = 8 hz), 115.6 (jc, f = 22 hz), 104.4, 56.2 . F nmr (376 mhz, dmso - d6) 112.9 . Hrms (esi) calculated for c11h10fn2o2 (m + h) 221.0721, found 221.0727 . 6-chloro-3,4-dimethoxypyridazine (101 mg, 0.58 mmol), (4-fluorophenyl)boronic acid (122 mg, 0.87 mmol), pd(pph3)4 (67 mg, 0.06 mmol), and na2co3(184 mg, 1.74 mmol) were dissolved in a mixture of dioxane (15 ml) and water (5 ml). Then the reaction mixture was refluxed for 3 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 020% etoac / hexane . This afforded 6-(4-fluorophenyl)-3,4-dimethoxypyridazine as a white solid (109 mg, 80%); mp 103105 c . H nmr (400 mhz, cdcl3) 7.88 (dd, j = 9 hz, j = 5 hz, 2h), 7.107 . 06 (m, 2h), 7.00 (s, 1h), 4.14 (s, 3h), 3.93 (s, 3h). C nmr (100 mhz, cdcl3) 163.7 (jc, f = 247 hz), 156.5, 155.7, 148.9, 132.9 (jc, f = 3 hz), 128.5 (jc, f = 9 hz), 115.8 (jc, f = 21 hz), 104.7, 55.7, 55.2 . F nmr (376 mhz, cdcl3) 112.2 . Hrms (esi) calculated for c12h12fn2o2 (m + h) 235.0877, found 235.0885 . 3,4,6-trichloropyridazine (200 mg, 1.09 mmol) was added to meoh (15 ml). It was treated with naome (117 mg, 2.17 mmol) and allowed to warm to room temperature . After the reaction was completed, it was put under the vacuum to remove meoh . The resulting residue was diluted with etoac, which was then washed with satd nh4cl, followed by brine . The residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane to provide 4-chloro-5,6-dimethoxypyrimidine as a white solid (101 mg, 53%); mp 117119 c . H nmr (400 mhz, cdcl3) 6.71 (s, 1h), 4.08 (s, 3h), 3.88 (s, 3h). C nmr (100 mhz, cdcl3) 156.9, 151.1, 149.8, 108.4, 56.2, 55.3 . 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile (109 mg, 0.48 mmol) was dissolved in anhydrous dcm (5 ml). The reaction mixture was cooled to 0 c, and then 1 m in dcm bbr3 (4.8 ml, 4.8 mmol) was added . It was then allowed to warm to room temperature and stirred for 20 h. then the solvent was removed under reduced pressure . The solid was dry loaded on silica gel and was purified by flash chromatography on silica gel, eluting with 010% meoh / dcm . This afforded 4-(5-hydroxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile as a white solid (75 mg, 73%); mp 305307 c . H nmr (400 mhz, dmso - d6) 13.29 (s, 1h), 11.15 (bs, 1h), 8.03 (d, j = 9 hz, 2h), 7.92 (d, j = 9 hz, 2h), 7.29 (s, 1h). C nmr (100 mhz, dmso - d6) 157.7, 154.6, 144.4, 139.8, 132.7, 126.5, 118.6, 111.4, 106.0 . Hrms (esi) calculated for c11h8n3o2 (m + h) 214.0611, found 214.0615 . 4-(5,6-dimethoxypyridazin-3-yl)benzonitrile (125 mg, 0.52 mmol) was dissolved in a mixture of 2 n hcl (5 ml) and dioxane (5 ml). The reaction mixture was then refluxed for 4 h. it was then cooled to room temperature and then put under reduced pressure . The product 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile was collected as a white solid (82 mg, 70%); mp 271273 c . H nmr (400 mhz, dmso - d6) 13.97 (bs, 1h), 8.02 (d, j = 8 hz, 2h), 7.94 (d, j = 8 hz, 2h), 6.62 (s, 1h), 3.96 (s, 3h). C nmr (100 mhz, dmso - d6) 156.3, 155.9, 143.5, 139.7, 132.7, 126.7, 118.6, 111.4, 104.3, 56.3 . Hrms (esi) calculated for c12h10n3o2 (m + h) 228.0768, found 228.0774 . 6-chloro-3,4-dimethoxypyridazine (298 mg, 1.71 mmol), (4-cyanophenyl)boronic acid (376 mg, 2.56 mmol), pd(pph3)4 (198 mg, 0.17 mmol), and na2co3(543 mg, 5.12 mmol) were dissolved in a mixture of dioxane (15 ml) and water (5 ml). The air was evacuated and replaced with n2 . Then the reaction mixture was refluxed for 15 h. after the reaction was completed, it was cooled to room temperature and it was diluted with etoac and washed with satd nh4cl, followed by brine . The organic layer was dried over na2so4 and concentrated under reduced pressure, and the resulting residue was purified by flash chromatography on silica gel, eluting with 030% etoac / hexane . This afforded 4-(5,6-dimethoxypyridazin-3-yl)benzonitrile as a white solid (130 mg, 31%); mp 187189 c . H nmr (400 mhz, cdcl3) 8.10 (d, j = 8 hz, 2h), 7.77 (d, j = 8 hz, 2h), 7.14 (s, 1h), 4.23 (s, 3h), 4.03 (s, 3h). C nmr (100 mhz, cdcl3) 157.1, 154.7, 149.1, 140.9, 132.6, 127.3, 118.5, 113.0, 104.9, 55.9, 55.3 . Hrms (esi) calculated for c13h12n3o2 (m + h) 242.0924, found 242.0931 . 4-(5-methoxy-6-oxo-1,6-dihydropyridazin-3-yl)benzonitrile (56 mg, 0.26 mmol) and nan3 (69 mg, 1.06 mmol) were dissolved in anhydrous dmf (1 ml). It was sealed, and then it was heated at 130 c for 21 h. the reaction was cooled to room temperature and gave a brownish suspension . The suspension was filtered and gave a white solid, which was treated with 2 n hcl and filtered again . This afforded 6-(4-(1h - tetrazol-5-yl)phenyl)-4-hydroxypyridazin-3(2h)-one as a white solid (33 mg, 48%); dec 273275 c . H nmr (400 mhz, dmso - d6) 11.13 (s, 1h), 8.09 (d, j = 8 hz, 2h), 7.95 (d, j = 7 hz, 2h), 7.25 (s, 1h). C nmr (100 mhz, dmso - d6) 158.0, 157.7, 154.9, 145.7, 135.8, 128.9, 126.6, 126.2, 105.9 . Hrms (esi) calculated for c11h9n6o2 (m + h) 257.0781, found 257.0791 . Pandemic h1n1 endonuclease (residues 1204) was expressed and purified as described previously . The bl21 (ril) cells (stratagene) were grown to an od600 of 0.8 and induced with 0.15 mm iptg at 17 c for 17 h. cells were harvested by centrifugation and purified on ni - nta (qiagen) according to manufacturers recommendations, except the final elution was completed with 500 mm imidazole containing buffer . The endonuclease was further purified by size exclusion chromatography using hiload 26/60 superdex 75 (ge healthcare). The buffer used for size exclusion and the final buffer for storage of the protein was 100 mm nacl and 20 mm tris ph 8.0 . The protein was concentrated to 5 mg / ml using an ultrafree 10k (millipore), aliquoted, and stored at 80 c . Crystals are formed by mixing in a 1:1 ratio endonuclease (5 mg / ml) with crystallization buffer containing 200 mm mes ph 6.7, 27% peg8000, 200 mm ammonium sulfate, 1 mm manganese chloride, 10 mm magnesium acetate, 10 mm taurine, and 50 mm sodium fluoride . Crystals form within a few hours and grow to maximum size in 12 weeks at 20 c . Crystal structures of compounds 11 were determined in complex with endonuclease as previously described.11 was soaked into preformed crystals by stepwise gradient shifting the surrounding crystallization solution to 1 mm manganese sulfate, 200 mm hepes ph 7.7, 25% (w / v) peg 8000, 50 mm ammonium sulfate, 5 mm magnesium acetate, 80 mm l - arginine, 10% dmso containing 100 mm 11, and 10% (v / v) ethylene glycol . Crystals were then soaked with the ligand for 2 h at 20 c before being placed into liquid nitrogen for storage . X - ray diffraction data collection was performed at the cornell high energy synchrotron source (chess) f1 beamline . The diffraction data were indexed, processed, scaled, and merged using hkl2000 . The structure was solved and refined using the software phenix . The endonuclease assay used a single - stranded dna probe with the sequence (6-fam)tggcaatatcagctccaca(mgbnfq) (applied biosystems). Reaction buffer contained 50 mm tris ph 7.5, 50 mm sodium chloride, 1 mm dtt, 5 mm magnesium chloride, 0.5 mm manganese sulfate, and 1 mm chaps . Dna probe (50 nm), endonuclease (25 nm), and compound were mixed on ice and then placed in a varioskan fluorimeter (thermo scientific) preincubated at 37 c to detect fluorescence with an excitation of 488 nm and emission of 518 nm . Fluorescence is measured at various time points, and activity / inhibition is calculated with graphpad prism 6.0b.
A 57-year - old woman was admitted to our hospital for further evaluation of a mass located in the upper abdomen, and this mass was incidentally detected by an abdominal ultrasound exam during a medical checkup . The patient presented with recurrent abdominal distension without any other complaints . Her medical history was unremarkable except for cholecystolithiasis and a fatty liver that were diagnosed two years previously . On admission, the laboratory tests showed an extremely high level of -fetoprotein (afp)> 35,350 ng / ml (reference: <20 ng / ml). The carbohydrate antigen (ca) 19 - 9, ca125, blood amylase, aspartate transferase (ast), alanine transferase (alt) and bilirubin levels were within the normal ranges . Pre - contrast and contrast - enhanced spiral ct of the abdomen was performed, including the arterial phase, portal venous phase and equilibrium phase following bolus injection of intravenous contrast material . The pre - contrast ct scan revealed a 4.5 cm in diameter, smooth - marginated, solitary, heterogeneous mass occupying the pancreatic neck and body (fig . Two hypodense lesions were discovered in the liver and they measured 4.7 4.3 cm and 7.0 6.8 cm, respectively, displaying minimal diffuse heterogeneous enhancement (fig . The high density within the large mass in the left hepatic lobe indicated central hemorrhage . Since pancreatic cancer is sometimes associated with an elevated afp level (although not so high as in this patient) and more often the hepatic metastases, an initial diagnosis of conventional pancreatic adenocarcinoma was made . The patient underwent neoadjuvant chemotherapy that consisted of fluorouracil, tetrahydrofolate and cisplatin, yet this had little effect and the serum afp level did not decrease . An encapsulated mass measuring about 4 cm in diameter was discovered in the pancreatic neck and body . In addition, two metastatic lesions 5.0 4.0 cm and 4.0 3.0 cm in size, were found in the iii, iv and vii hepatic segments . Tumor resection that included the primary pancreatic neoplasm and the right hepatic metastatic mass was carried out . For the left hepatic mass, hepatic segmentectomy (segments ii and iii and part of segment iv) was performed . The immunohistochemical examination demonstrated that the tumor cells were diffusely positive for afp, placental alkaline phosphatase (plap) and carcino - embryonic antigen (cea), but they were negative for ca19 - 9 . The afp level was notably decreased after surgery (2,097,> 1,200,> 500 ng / ml on the postoperative 3rd, 9th and 25th day, respectively). To exclude the existence of primary gonadal germ cell tumor, further clinical and ultrasound examinations were conducted on the genital system of this patient, but no abnormality was found . A month after the operation, the patient received systematic chemotherapy with the bep regimen (bleomycin, etoposide and cisplatin). A total of three cycles of therapy were performed with an interval of three weeks between cycles . During chemotherapy, the ct examination was repeated and it revealed no tumor recurrence in the pancreas . Of all the genital tumors, yolk sac tumors are relatively uncommon and they are mostly discovered in infants and adolescents (median age, 19 years) (3). Although they typically arise from the gonads, ysts have already been reported in many extragonadal sites . Generally, the mediastinum, the sacrococcygeal region, the brain, the retroperitoneal space and the female reproductive tract are relatively common locations . Exceedingly rare sites such as liver, kidney, omentum, stomach, spinal cord, etc have also been previously reported (4 - 6). To the best of our knowledge, there has been no report about primary yst arising in the pancreas, and especially occurring in a 57-year - old woman . Because of their rarity, there has been no systematic study on the ct features of extragonadal ysts with a large number of cases . In a previous case report, this tumor was usually described as a large, multi - lobulated, solid heterogeneous, hypodense mass that showed moderate and heterogeneous enhancement (7). Central necrotic and/or cystic changes were observed on the ct images by wong et al . Choi et al . (9) evaluated the ct findings of ysts of the ovary in ten patients, and they characterized these tumors as large, smooth - marginated, well enhancing, solid masses with a cystic, hemorrhagic or necrotic portion . In the present case, the non - contrast ct scan showed an oval - shaped, heterogeneous soft - tissue mass with a central hypodense area, and the mass displayed moderate inhomogeneous enhancement . The imaging findings were verified by the morphological observations of an encapsulated tumor with focal necrosis . Central hemorrhage was detected in the hepatic metastatic lesion, which might be attributed to the notable proliferative and vascularization activities of the tumor cells . In some studies, ysts have shown infiltrative growth into the adjacent soft tissues, and higher magnification revealed a microcystic growth pattern of tumor cells that formed reticular or glandular structures, which contributed to the cystic or necrotic changes seen on the ct images . Since ysts usually show high malignancy, the duration from the onset of symptoms to the admission is always short and metastasis may already exist at the time of the patient's admission, like the case presented here . An extremely high afp level may be a clue for making the diagnosis of ysts . Because of the extreme rarity of primary yst of the pancreas, metastatic germ cell tumor from the gonads or other primary or metastatic pancreatic neoplasms should be excluded ., we present here the first case of primary yst arising in the pancreas with hepatic metastasis in an adult woman . This unique case is of value for reminding radiologists and oncologists to be aware of the diagnosis of yst when a patient presents with an extremely high level of afp and an oval - shaped or multilobulated, heterogeneous, soft tissue mass is discovered in the pancreas displaying moderate and inhomogeneous enhancement on ct images . Making a careful differential diagnosis
Rheumatoid arthritis (ra) is the most common rheumatoid condition and affects approximately 2% of adult population . The onset of the disease usually takes place between the 45 and 55 year of age and, if not diagnosed early, it rapidly leads to permanent deformities of the motor organs . The most frequently affected anatomic area in the course of ra is the hand (anatomically, the hand is made up of the wrist, metacarpus and fingers). The term rheumatoid hand denotes the hand deformed in the course of ra, which results from: the injury to the ligamentous complex of the midcarpal, carpometacarpal, metacarpophalangeal and interphalangeal joints; deformity of the bone bases that compose the joints as well as post - inflammatory lesions in the tendon sheaths and tendons (fig . Rheumatoid hand in the patient with a long - term ra at present, due to the advancement of knowledge concerning the pathogenesis of ra and the development of diagnostic methods, including imaging techniques such as ultrasound (us) and magnetic resonance imaging (mri), controlling the ailments and symptoms of the disease are not the only main aims of rheumatoid arthritis management . Ra is diagnosed early, which allows for rapid implementation of the treatment preventing the advancement of the disease into its irreversible form that results in hand deformities . Thus, contemporary treatment is not merely symptomatic, but also partially causal since, thanks to the knowledge of the pathogenesis, it is possible to inhibit certain pathogenetic mechanisms, which hinders ra advancement . Radiological examinations of bones, which for many years constituted the only imaging modality in ra diagnostics, reveal advanced, irreversible lesions such as erosions, inflammatory cysts (geodes) and joint deformities . Although they are non - specific and initially discrete, their detection allows for the commencement of treatment in an early stage of the disease . As a result, we will observe the classical image of the rheumatoid hand, deformed by the disease, more and more rarely . Us examination is commonly performed in rheumatoid patients primarily for the purposes of evaluating the soft tissues of the joints . Rheumatoid arthritis affects the sites in which the synovial membrane may be found (articular cavities, bursae and sheaths) and therefore, all these sites are subject to a thorough evaluation . Moreover, one should remember about the limited volume of the osteofibrous carpal tunnel in which all pathologies, both inflammatory (synovitis of the radiocarpal and midcarpal joints as well as tenosynovitis of the flexor tendons) and non - inflammatory ones (e.g. Muscle anomalies, osseous lesions), will predispose to the median nerve compression a neuropathy which does not necessarily require retinacular incision . In a rheumatologist's everyday practice, us examination is conducted at the stage of diagnosis as well as to monitor the treatment and to confirm the remission if the clinical picture is ambiguous . At the stage of diagnosis, us examination aims at visualizing or excluding inflammatory lesions and in the case of their presence determining their localization and intensity (degree of activity). Finally, although radiography is the main method in this area, us examination enables to detect erosions which attest to the advancement of the disease and completely change the prognosis . During us examination the following are assessed: articular cavities (in search for the signs of synovitis and effusions), bone outlines (in terms of geodes and erosions), tendons and their sheaths (searching for the signs of synovitis, effusion and tendon damage) and bursae (in the hand below the second compartment of the extensors; in search for synovitis and effusion). The synovial membrane lines the inner surface of the articular capsule, tendon sheaths and bursae . In normal conditions, in healthy persons, it is not visible on us scans . In the course of ra, however, the subsequent stages of its evolution, which correspond to the lesions presented in our previous articles, are observed . The hyperplasia of the intimal layer and inflammatory edema of the subintimal layer are visible in the form of synovial thickening (figs . 2, 3). A coexistent joint effusion is frequently observed and, contrary to the thickened synovium the effusion in the articular cavities, sheaths and bursae results from the malfunction of the synovial membrane which is affected by inflammation . The aim of the us examination is not to measure its thickness, but to determine, by means of the probe - induced compression, whether it is of low, medium or high pressure . Moreover, enhanced vascularization in the synovium, observed in power doppler ultrasound examination (pdus), attests to the process of neoangiogenesis (figs . 4, 5). During us examination, one should specify the localization of the pathologically altered synovium and determine whether the process is generalized, e.g. All metacarpophalangeal joints (mcp) or the sheaths of all extensor compartments are involved, or whether it is limited to single or several joints or sheaths . From the pathogenetic point of view, capsular synovitis, flexor or extensor tenosynovitis (tendovaginitis) or bursitis are manifested by synovial membrane thickening . Depending on the moment at which us examination is performed, the hyperemia of the synovium may not yet be visible, some single vessels may be observed and finally, the most typically for ra, intensive vascularization of the synovium may be present . The assessment of the degree of hyperemia is subjective, semiquantitative and is based on pdus . For instance, the 03 score classification where 0 marks the lack of flow, 1 visible one or two vessels in the area of the synovium, 2 numerous vessels occupying approximately 50% of the thickened synovium, and 3 numerous vessels that occupy more than 50% of the synovium . In another exemplary scale, score 0 means correct vascularization of the synovium (no or single vessels), 1 low - degree hyperemia, 2 moderate hyperemia, 3 intense vascularization of the synovium . An example of the quantitative assessment, however, is the measurement of cf indicator (color fraction) which is a ratio of color pixels and all pixels in a marked area of interest . The analysis of the vascularization of the synovial membrane in pdus is of clinical significance which is proven by the correlations between synovitis assessed in pdus and the count of th17 proinflammatory and destructive lymphocytes in the synovial fluid of patients with ra . Thickening of the synovium in the druj, radiocarpal and midcarpal joints (synovitis) thickening of the synovium of the extensor carpi ulnaris tendon sheat (tenosynovitis) a. thickening with vascularization of the synovium of the mcp joint (synovitis). B. joint's pannus, which is an inflammatory granulation tissue composed of numerous tiny vessels and chronic inflammatory infiltrates . H&e staining, 100 thickening with vascularization of the synovium of the flexor carpi radialis tendon (tenosynovitis) active pannus (i.e. Synovial membrane with active inflammation) leads to the damage of the articular structures . In the case of articular cavities, initially they are peripheral, i.e. Occur in the region of the osseous junction of the articular capsule, and subsequently, subchondral, due to the damage of the articular cartilage . Geodes, however, attest to the presence of another diseased area in the subchondral osseous tissue . Geodes are visible on us image as defects in the subchondral layer covered with cortical layer . Erosions, on the other hand (analogically to a radiographic examination), are visible as an interruption in the outline of the cortical layer . The synovium is frequently detected within the erosion and it may undergo fibrosis or be vascularized . The latter observation attests to the presence of an active process of articular structure deterioration (so called, active erosion) (fig . The us access to the bone surfaces which compose the joints of the hand is limited . Therefore, sonography constitutes a supplementation of a radiographic examination, which, however, does not enable to visualize all the erosions either due to overlapping dorsal and ventral osseous masses . Active erosions in mcp joint with active pannus the inflammatory process of the sheath, on the other hand, may also involve the tendon, which is defined as the inflammation of the tendon and tendon sheath (fig . The acute and active condition manifests itself with the hyperemia of the synovial sheath and hyperemia of the tendon . Chronic inflammatory condition and frequently accompanying mechanical factors connected with tendon movement over uneven bone surfaces, which are deteriorated by the inflammation, often leads to a partial or complete tendon rupture (fig . Hypoechoic tears are visible in the region of the thickened tendon . In the case of a complete rupture prior to a planned surgery, it is essential to determine the distance between the stumps and their morphological condition . A. tendovaginitis and tendinitis of the extensor carpi ulnaris . 100 complete tear of the extensor pollicis longus tendon: a. empty sheath at the level of the dorsal tubercle of the radius; b. distal stump of the torn tendon, which is thickened, degenerated, with intrasubstance tears in the hand, the model of the cascade of inflammatory and destructive changes, which are brought about by the active pannus, is the distal radioulnar joint (druj) (fig . 9). Here, the articular capsule and ligaments that stabilize the joint become damaged, erosions in the articular epiphyses occur and articular surfaces undergo damage . This results in the instability of the joint and dorsal dislocations or subluxations of the ulna . In the situation of the deterioration of the dorsal capsule - ligamentous complex of druj, the bands of the extensor of finger 5 rub directly against a saw - like erosion site on the surface of the dorsal epiphysis of the distal ulna . Moreover, the pannus in the tendon sheath of the extensor carpi ulnaris may infiltrate into the tendon with its subsequent damage which is favored by the subluxation of the ulna bone and friction of the tendon against the deteriorated head of the ulna . Active tendovaginitis with tendinitis of the extensor carpi ulnaris in us examination, one may observe anomalous joint position, which may be caused not only by damage to the articular surfaces in the late stages of the rheumatoid disease . Also in the early phase, a dynamic us examination may reveal the contracture of capsule - ligamentous structures of the interphalangeal joints (constraint in the natural hyperextension in the proximal interphalangeal joint they are most frequently caused by a failure to begin rehabilitation at the onset of arthritis . Therefore, based on us examination, it is not possible to distinguish between individual rheumatoid entities, which would be desirable for instance, in the case of undifferentiated (unclassified) arthritis (ua). In this respect, the role of sonography is more difficult than x - ray scan in which the differentiation is based on the localization of the lesions and characteristic radiological features . There is probably only one instance when us differential diagnosis might be attempted, i.e. When a patient manifests inflammatory changes of the distal interphalangeal joint that coexist with entesopathy of the capsular and tendoligamentous attachments, including erosive and destructive changes with simultaneous proliferative lesions in the region of the epiphyses, which is pathognomonic for psoriatic arthritis (fig . What is more, ultrasound symptoms characteristic of rheumatoid diseases (mainly synovitis, tenosynovitis and bursitis) may occur in the course of overuse, post - traumatic and degenerative changes . Finally, the ultrasound image of the rheumatoid patients currently diagnosed in a very early stage (in a, so called, therapeutic window) is frequently different from the one familiar from course books, mainly from the radiological images . We are not familiar with radiological images (x - ray, us or mri) of early phases of rheumatoid diseases and without proper clinical data we cannot differentiate between them yet . Pathogenetic knowledge and rheumatoid practice indicate that each instance of pain or edema of the joint should be explained within 6 weeks . Thanks to this, in the case of the diagnosis of inflammation, we might recommend a treatment in the period of, so called, therapeutic window, i.e. Within 3 months from the onset of symptoms . Erosive and proliferative inflammatory lesions in dip3 joint of the hand to sum up, sonography, a non - invasive and available examination, constitutes one of the supplementary examinations in the diagnosis of rheumatoid patients . It allows for the diagnosis of early inflammatory lesions in the soft tissues of the joints . Due to the fact that more and more patients report with an early stage of the disease, whose advancement, with a high probability, may be hindered by the implemented therapy, the significance of us examinations increase, it prevents the differentiation of rheumatoid diseases from degenerative, overuse or post - traumatic changes (such as overlap syndrome of ra and osteoarthritis or post - traumatic arthritis). Finally, it does not allow for the differentiation of the cause of persistent synovial membrane thickening or mean effusion in chronically ill patients (chronic inflammation or synovial membrane fibrosis? ), which affects subsequent therapeutic decisions . Authors do not report any financial or personal links with other persons or organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication.
Osteoarthritis (oa) is the most common form of arthritis and the leading cause of disability, especially among older adults . The disease process leads to limitation of joint movement, joint deformity, tenderness, inflammation, and severe pain . Oa is characterized by progressive loss of cartilage from the articulating surfaces of diarthrodial joints . Although the pathophysiologic mechanisms of osteoarthritis remain unresolved, chondrocytes in oa cartilage demonstrated morphologic changes that are characteristic features of apoptosis, which suggests apoptosis plays an important role in the development of oa [36]. Conventional approaches for the treatment of oa range from conservative measures, to surgical intervention, and eventually joint replacement [79]. Currently, there is no curative treatment for the disease . Even though total joint replacement surgery is relatively successful for the treatment for oa, the lifespan of artificial joints is limited, and there are still significant problems such as implant loosening and failure, and the expensive cost . Non - steroidal anti - inflammatory drugs (nsaids) are among the most widely prescribed drugs in the treatment of osteoarthritis (oa) to alleviate pain and thereby maintain the ability to perform normal daily physical activities, even in treatment of knee replacement surgery . The clinical efficacy of nsaids is primarily related to the inhibition of cyclooxygenase 2 (cox-2) but not cyclooxygenase 1 . Celecoxib, as one of the first selective cox-2 inhibitors, has been shown to be an effective anti - inflammatory and analgesic drug in patients with rheumatoid arthritis and oa, comparable to that of traditional nsaids, such as naproxen, diclofenac and ibuprofen [912]. A significant reduction of gastrointestinal adverse events with selective cox-2 inhibitors compared to non - selective nsaids has been frequently demonstrated . Currently, several in vitro studies have shown celecoxib has a positive effect on human osteoarthritic cartilage, but it remains controversial as to what effects these agents have on the progression of oa . Herein, based on surgically - induced osteoarthritis model, we performed a study to determine whether celecoxib could inhibit the apoptosis of chondrocytes and ameliorate type ii collagen synthesis to relieve symptoms of oa . One hundred and thirty wistar rats (3~4 months old) were purchased from the laboratory animal center, chongqing medical university . An oa model in wistar rats was induced using the surgical resection of the left achilles tendon, resulting in a decrease in joint stress, performed as previously described . The left knee was used as the experimental side and the right knee as the control side . The experiments were done with reference to the long - term toxicity test methods in the methodology of pharmacological experiments . Animals were randomly divided into 4 groups: celecoxib group (ce), ibprofen group (ibp), indomethacin group (in) and normal saline group (ns). The daily drug dosages were: ce 24 mg / kg (american silver pharmaceutical company), ibp 72 mg / kg (chongqing southwest pharmaceutical co.ltd . ), in 9 mg / kg (chongqing kerui pharmacy co.ltd . ), and ns (sichuan kelun pharmaceutical co. ltd . ). If there were more than 50 g in the weight difference between rats, the drug would be administered individually . At the end of the 3, 6, and 9 months of treatment after the surgically - induced model the knees were dissected from each animal, then fixed in 4% paraformaldehyde and 70% ethanol, and decalcified with 10% edta . After he staining, chondrocytes, cartilage surface, cartilage matrix and tide line were observed with the microscope . Type ii collagen antibody, the sabc kit and dab are purchased from boston corp . The ihc stainings of cartilage matrix and chondrocyte were observed and photographed using an olympus microscope . Beijing aviation medical image analysis system was adopted to calculate the average density of positive staining in every field . The apoptosis detection kit was purchased from mannheim company (germany), and the procedure of tunel detection was performed according to the manual . The positive cells presented yellow particles distributed throughout the nuclear material, and the negative cells showed blue staining (hematoxylin). Apoptosis proportion was calculated by the formula: the number of positive cells / the total number of cells . Five hundred chondrocytes were counted in every slide and per 1000 chondrocytes in different periods of each group . The rats were killed by vertebrae dislocation, the left knees were exposed and the weight loading area of femoral condyle (22 mm) was obtained . The specimens were fixed with 1% osmium tetroxide, decalcified with 10% edta, dehydrated in a graded series of ethanol and acetone, and finally embedded in epoxy resin and semithin section . Ultrathin sections were cut using an ultramicrotome, double stained, and examined and photographed with a transmission electron microscope . The quantitative and semi - quantitative data analyses, including the analysis of variance, and q - test, were performed with sas 6.12 software, and the significance level was set at =0.05 . One hundred and thirty wistar rats (3~4 months old) were purchased from the laboratory animal center, chongqing medical university . An oa model in wistar rats was induced using the surgical resection of the left achilles tendon, resulting in a decrease in joint stress, performed as previously described . The left knee was used as the experimental side and the right knee as the control side . The experiments were done with reference to the long - term toxicity test methods in the methodology of pharmacological experiments . Animals were randomly divided into 4 groups: celecoxib group (ce), ibprofen group (ibp), indomethacin group (in) and normal saline group (ns). The daily drug dosages were: ce 24 mg / kg (american silver pharmaceutical company), ibp 72 mg / kg (chongqing southwest pharmaceutical co.ltd . ), in 9 mg / kg (chongqing kerui pharmacy co.ltd . ), and ns (sichuan kelun pharmaceutical co. ltd . ). If there were more than 50 g in the weight difference between rats, the drug would be administered individually . At the end of the 3, 6, and 9 months of treatment after the surgically - induced model, the rats were killed . The knees were dissected from each animal, then fixed in 4% paraformaldehyde and 70% ethanol, and decalcified with 10% edta . After he staining, chondrocytes, cartilage surface, cartilage matrix and tide line were observed with the microscope . Type ii collagen antibody, the sabc kit and dab are purchased from boston corp ., the ihc stainings of cartilage matrix and chondrocyte were observed and photographed using an olympus microscope . Beijing aviation medical image analysis system was adopted to calculate the average density of positive staining in every field . The apoptosis detection kit was purchased from mannheim company (germany), and the procedure of tunel detection was performed according to the manual . The stainings were observed and photographed using an olympus microscope . The test included a positive and negative control . The positive cells presented yellow particles distributed throughout the nuclear material, and the negative cells showed blue staining (hematoxylin). Apoptosis proportion was calculated by the formula: the number of positive cells / the total number of cells . Five hundred chondrocytes were counted in every slide and per 1000 chondrocytes in different periods of each group . The rats were killed by vertebrae dislocation, the left knees were exposed and the weight loading area of femoral condyle (22 mm) was obtained . The specimens were fixed with 1% osmium tetroxide, decalcified with 10% edta, dehydrated in a graded series of ethanol and acetone, and finally embedded in epoxy resin and semithin section . Ultrathin sections were cut using an ultramicrotome, double stained, and examined and photographed with a transmission electron microscope . The quantitative and semi - quantitative data analyses, including the analysis of variance, and q - test, were performed with sas 6.12 software, and the significance level was set at =0.05 . The surface of articular cartilage became slightly rough, where is the focus of the stress . The toluidine blue staining was mildly uneven . Because of death of the rats in the in group, the experiment in the 9th month could not be completed . At the 3, 6, 9 months of treatment after surgically induced animal model of oa, the ns group and ce group showed similar in different periods, which was the progressive development of oa . In the 3 month, the surface of the stress concentration area was rough, and double - columnar, nested chondrocyte hyperplasia was observed . In the 6 month, the superficial layer of articular cartilage shed, and there was a large amount of chondrocyte hyperplasia . In the 9 month, the superficial layer of the articular cartilage became rougher . The chondrocytes in the ns group decreased, while the chondrocytes in the ce group slightly decreased . To the in group, in the 3 month the layer of the cartilage became thinner and appeared villous . Chondrocytes were arranged in irregular clusters . At the 6 month, the changes as mentioned above further progressed, and chondrocyte necrosis occurred . In the ibp group, in the 9 month, the thickness of the articular cartilage became thin and deteriorated . As shown in table 1, at the 3, 6 and 9 months, ibp promoted the expression of type ii collagen, but in inhibited its expression . As shown in table 2, at the 3 month of treatment, ce suppressed chondrocyte apoptosis, while ibp and in promoted chondrocyte apoptosis, especially in . Ibp significantly increased chondrocyte apoptosis, but chondrocyte apoptosis maximized at the 3 month of treatment, and then began to reduce . At the 9 month of treatment, ce still inhibited chondrocyte apoptosis . Taken together, ce inhibited chondrocyte apoptosis and retained the degeneration of cartilage, while in and ibp promoted chondrocyte apoptosis and aggravated the degeneration of cartilage . In the ns and ce groups, the chondrocytes of articular cartilage appeared similar . The shape of cells was normal, with integrated nuclear membrane, slight aggregated chromatin and abundant cytoplasm . In the ce group, there were a large number of rough endoplasmic reticulum (rer), mitochondria and glycogen in the chondrocytes . In the ibp group, the perinuclear halo gradually disappeared, cell shape was irregular, chromatin structure was obscure, the number of golgi complex and rough endoplasmic reticulum reduced and they shrank, and the structure of mitochondria was unclear . There are many microfilament and lysosome - related organelles in the cytoplasm . In the in group, the electron density of chondrocytes significantly increased, and many had lytic necrosis . The structure of collagen fiber in the matrix also became unclear (figure 3). The surface of articular cartilage became slightly rough, where is the focus of the stress . The toluidine blue staining was mildly uneven . Because of death of the rats in the in group at the 3, 6, 9 months of treatment after surgically induced animal model of oa, the ns group and ce group showed similar in different periods, which was the progressive development of oa . In the 3 month, the surface of the stress concentration area was rough, and double - columnar, nested chondrocyte hyperplasia was observed . In the 6 month, the superficial layer of articular cartilage shed, and there was a large amount of chondrocyte hyperplasia . In the 9 month, the superficial layer of the articular cartilage became rougher . The chondrocytes in the ns group decreased, while the chondrocytes in the ce group slightly decreased . To the in group, in the 3 month the layer of the cartilage became thinner and appeared villous . Chondrocytes were arranged in irregular clusters . At the 6 month, the changes as mentioned above further progressed, and chondrocyte necrosis occurred . In the ibp group, in the 9 month, the thickness of the articular cartilage became thin and deteriorated . The expression of type ii collagen was detected using immunohistochemistry (figure 1). As shown in table 1, at the 3, 6 and 9 months, ibp promoted the expression of type ii collagen, but in inhibited its expression . Chondrocyte apoptosis was detected by tunel staining (figure 2). As shown in table 2, at the 3 month of treatment, ce suppressed chondrocyte apoptosis, while ibp and in promoted chondrocyte apoptosis, especially in . At the 6 month of treatment, ce still inhibited chondrocyte apoptosis . Ibp significantly increased chondrocyte apoptosis, but chondrocyte apoptosis maximized at the 3 month of treatment, and then began to reduce . At the 9 month of treatment, ce still inhibited chondrocyte apoptosis . Taken together, ce inhibited chondrocyte apoptosis and retained the degeneration of cartilage, while in and ibp promoted chondrocyte apoptosis and aggravated the degeneration of cartilage . The shape of cells was normal, with integrated nuclear membrane, slight aggregated chromatin and abundant cytoplasm . In the ce group, there were a large number of rough endoplasmic reticulum (rer), mitochondria and glycogen in the chondrocytes . In the ibp group, the perinuclear halo gradually disappeared, cell shape was irregular, chromatin structure was obscure, the number of golgi complex and rough endoplasmic reticulum reduced and they shrank, and the structure of mitochondria was unclear . There are many microfilament and lysosome - related organelles in the cytoplasm . In the in group, the electron density of chondrocytes significantly increased, and many had lytic necrosis . The structure of collagen fiber in the matrix also became unclear (figure 3). The pathological changes and the chemical indicators of cartilage in rat oa models which are noted in human oa have been widely used in the oa research . We adopted the resection of the tendon of the rats, which decreased the cartilage stress of the same side, and induced the instability of the joint and the irregularity of load conduction, resulting in the degeneration of the articular cartilage and then inducing oa . The pathological changes in the 3, 6 and 9 months were similar to the slow pathological development of human oa . Surgically - induced oa, which largely mimics the pathological process of oa, represents an ideal platform to study the early pathological changes associated with the disease, as well as being of use in the study on cartilage metabolism response to the drugs . Recent in vitro and in vivo data on celecoxib have shown positive effects on cartilage of oa [1821]. These studies showed that celecoxib has favorable effects on the turnover of collagen metabolism of oa cartilage . Late in oa, the balance between synthesis and degradation of type ii collagen is destroyed and the amount of type ii collagen in the cartilage matrix markedly decreases . In our study, at the 3, 6 and 9 months of treatment, ce had no effect on the expression of the type ii collagen in oa chondrocytes, which indicates ce possibly does not interfere with the metabolism of type ii collagen in articular cartilage when it plays a role in anti - inflammatory and analgesics . In contrast, ibp promotes the expression of type ii collagen in chondrocytes and increase the synthesis of type ii collagen, which compensates for the loss of type ii collagen during oa . Moreover, in inhibits the expression of type ii collagen in chondrocytes, decreases the synthesis of type ii collagen, and restrains the metabolism of type ii collagen in degenerative cartilage . Accumulating evidences indicates chondrocyte apoptosis may represent an important component in the pathogenesis of oa [36]. In our study, a high frequency of chondrocyte apoptosis existed in articular cartilage during oa . Chondrocyte apoptosis is positively associated with degree of cartilage matrix damage, which is consistent with previous reports [2527]. Moreover, ce suppressed chondrocyte apoptosis and retained the degeneration of articular cartilage, while in and ibp promoted chondrocyte apoptosis and aggravated the degeneration of articular cartilage . . Recently showed a beneficial effect of celecoxib in normal cartilage under the influence of il-1 and tnf-, but no effects in normal healthy cartilage . Human articular chondrocytes stimulated with cytokines such as il-1 or tnf produce high levels of no . Chondrocytes are the cellular components of cartilage metabolic activity, which is associated with the synthesis and degradation of cartilage matrix . The morphology of chondrocytes is related with metabolic activity and the synthesis of proteoglycan . In our study, ce promoted the number of golgi complex and rough endoplasmic reticulum, and enlarged their size . In the long - term use of nsaids in treatment of oa, ce displays better therapy and toleration, and retained the degeneration of oa cartilage, and may be the ideal choice for treatment of chronic destructive joint disease.
Although the introduction of dopamine agonists in the management of acromegaly has opened new doors for a non - invasive approach to this clinical problem, this therapy has not proved wholly satisfactory . Long - term treatment with such compounds has resulted in normalization of levels of plasma growth hormone in about 30 percent of patients . The short half - life of natural somatostatin, as well as the rebound hypersecretion of growth hormone that occurs after its infusion, has rendered the native peptide impractical for therapeutic use . The long - acting somatostatin analogue, sms 201 - 995, (sandoz, basel, switzerland) recently became available for clinical use . This peptide exerts a strong and prolonged inhibitory effect on growth hormone release without producing rebound hypersecretion as does the natural form . In application to acromegalics, a large population of these patients had effects of growth hormone release, but a subcutaneous dose of 50 g had suppressed growth hormone release in the acromegalics for about 8 hours . Kinetic studies with sms 201 - 995 have shown that the plasma half - lives for intravenous and subcutaneous injection of the agent are 43 and 113 minutes, respectively . Plewe et al reported a fall in plasma growth hormone concentrations to normal or nearly normal levels that lasted for nine hours in a group of subjects with acromegaly who received a single subcutaneous injection of 50 g . Treatment of acromegaly with dopamine agonists can reduce the size of some somatotrophic - cell adenomas, but this is considered to occur rarely in comparison with the frequent shrinkage of pituitary prolactinomas treated with these agents . Human gh (hgh) is now recognized as a heterogeneous family of proteins, consisting of several molecular forms (isohormones). The predominant form of hgh present in plasma was 22k, which accounted for approximately 85% of all immunoreactive hgh, and up to approximately 7% of minor forms showed 20k . This abnormal form of hgh might be a member of a group of pathogenetic controls . The treatment logic of various medical treatments, especially dopamine (da) agosts and somatostatin, is concerned with hypothalamic control of hormones, growth hormone releasing hormone (ghrh) and somatostatin (sms). Also, this implied that factors concerning the pathogenesis of acromegaly were not a single factor, but were compound and multiple factors in vivo . In this paper, we report the growth hormone response to sms 201 - 995 treatment in acromegalics and investigate the pathogenesis of acromegaly via hypothalamic regulatory hormone mediation . Eight patients with acromegaly (six women and two men, aged from 27 to 52 years) were studied . The diagnostic criteria were the classical clinical findings of enlargement of extremities, characteristic facial appearance and excessive perspiration . They also had radiologic evidence of a pituitary tumor on computed tomography scan and an elevated fasting growth hormone (gh) concentration above 20 ng / ml that was not suppressed to less than the 5 ng / ml that level after oral glucose loading (100 g). The clinical chief complaints were headache (3 patients), weight gain (2 patients), arthralgia (2 patients) and malaise (1 patient). Blood samples were taken hourly from 8 a.m. for eight hours in order to check the diurnal variation of the serum gh levels . On the second day of the study, the same preparations were made and the patients were injected with 50 g of sms 201 - 995 at 8 a.m. as baseline, then blood sampling for gh was performed hourly for 8 hours . The patients were classified into two groups, responders and non - responders depending upon the gh responses to 50 g of sms 201 - 995 . On the third day of the study, the patients were prepared by the above method and stimulated with 400 g of thyrotropin releasing hormone (trh), then blood sampling for gh was conducted every 30 min for two hours to determine the paradoxical response to trh administration . On the fourth day of the study, the patients were prepared by the previous method and stimulated with 100 g of synthetic ghrh, then blood samples were taken every 30 min for 2 hours to assess the stimulatory response to ghrh injection . The positive response to a single administration of sms 201 - 995 was defined as more than a 50% suppression of gh from the basal level of gh at over 4 hours from the time of injection of 50g of sms 201 - 995 . The positive response groups for trh and ghrh were identified as those having over a twofold increase from baseline levels within 60 min after stimulation . The positive response group of diurnal variation was designated as that in which the gh level increased or decreased twofold from the previous gh levels more than once in the period of study . The initial response to a single injection of 50 g of sms 201 - 995 showed two patterns, i.e. Responder and non - responder . Patients 1, 2, 6 and 8 belonged to the responder group and the others belonged to the non - responder group (patients 3, 4, 5 and 7). The responder group showed gh suppression to a single injection of sms 201 - 995 which lasted about six to eight hours, then returned to basal gh levels . The pattern of suppression was dramatic and more than a ten fold suppression was noted in every responder . The non - responder group revealed two patients (patients 3 and 7) with a similar pattern to that of responder group, but the suppression did not last for 4 hours . The other two patients (patients 4 and 5) had irregular curves of gh response which were not suppressed . (fig . 1 .) The paradoxical response of gh to trh stimulation showed that 3 of 4 responders (patients 1, 2 and 8) had a paradoxically responded curve pattern on stimulation which peaked at 30 to 60 min after stimulation . One other responder (patient 6) had a flat response curve pattern . Also, 3 of 4 non - responders showed a responded curve pattern on trh stimulation, but the curves were not a monotonous pattern, and transiently decreased from the previous value at a time point of 30 or 60 min . Patient 5 had no response on sms and trh stimulation and had high levels of gh with stimulation of trh (over 200 ng / ml). The gh response to ghrh stimulation in the responder group showed a tendency to gradually increase in a time dependent fashion, but the response of this group did not conform to our positive response criteria . Three patients of this group noted an increasing tendency of gh response curve, but the remaining patient showed a flat pattern of the gh curve at the high level (over 180 ng / ml). In the non - responder group two patients of this group (patients 3 and 4) showed peak levels at a time of 30 min ., but these values did not exceed twice the basal levels . The other two patients of this group revealed that one (patient 5) had a high, flat curve (more than 200 ng / ml) and the other (patient 7) had a low, flat curve (less than 25 ng / ml) (fig . 3 . ). In the responder group, only one responder (patient 2) showed a positive pattern of the gh diurnal curve, the other three did not satisfy our positive criteria . But, the non - responder group had three patients with positive gh patterns during the 8 hour period of the study (patients 3, 4 and 5). Thus, the responder group to sms administration had only one positive patient, but in the non - responder group, three patients satisfied the criteria . The responsiveness to trh or ghrh was not related to the responsiveness to the sms analog, while the diurnal pattern of gh in the morning and afternoon was closely related to that of the sms analog . The initial response to a single injection of 50 g of sms 201 - 995 showed two patterns, i.e. Responder and non - responder . Patients 1, 2, 6 and 8 belonged to the responder group and the others belonged to the non - responder group (patients 3, 4, 5 and 7). The responder group showed gh suppression to a single injection of sms 201 - 995 which lasted about six to eight hours, then returned to basal gh levels . The pattern of suppression was dramatic and more than a ten fold suppression was noted in every responder . The non - responder group revealed two patients (patients 3 and 7) with a similar pattern to that of responder group, but the suppression did not last for 4 hours . The other two patients (patients 4 and 5) had irregular curves of gh response which were not suppressed . The paradoxical response of gh to trh stimulation showed that 3 of 4 responders (patients 1, 2 and 8) had a paradoxically responded curve pattern on stimulation which peaked at 30 to 60 min after stimulation . One other responder (patient 6) had a flat response curve pattern . Also, 3 of 4 non - responders showed a responded curve pattern on trh stimulation, but the curves were not a monotonous pattern, and transiently decreased from the previous value at a time point of 30 or 60 min . Patient 5 had no response on sms and trh stimulation and had high levels of gh with stimulation of trh (over 200 ng / ml). The gh response to ghrh stimulation in the responder group showed a tendency to gradually increase in a time dependent fashion, but the response of this group did not conform to our positive response criteria . Three patients of this group noted an increasing tendency of gh response curve, but the remaining patient showed a flat pattern of the gh curve at the high level (over 180 ng / ml). In the non - responder group, there was also no response to ghrh stimulation . Two patients of this group (patients 3 and 4) showed peak levels at a time of 30 min ., but these values did not exceed twice the basal levels . The other two patients of this group revealed that one (patient 5) had a high, flat curve (more than 200 ng / ml) and the other (patient 7) had a low, flat curve (less than 25 ng / ml) (fig . In the responder group, only one responder (patient 2) showed a positive pattern of the gh diurnal curve, the other three did not satisfy our positive criteria . But, the non - responder group had three patients with positive gh patterns during the 8 hour period of the study (patients 3, 4 and 5). Thus, the responder group to sms administration had only one positive patient, but in the non - responder group, three patients satisfied the criteria . The responsiveness to trh or ghrh was not related to the responsiveness to the sms analog, while the diurnal pattern of gh in the morning and afternoon was closely related to that of the sms analog . Anomalous gh responses to trh and glucose occur in patients with acromegaly (25 to 30%) and a variety of diseases, but in healthy adults, synthetic and purified ovine crh (corticotropin releasing hormone) has specific acth - releasing activity and gh levels are not influenced . Observed paradoxical response of gh to trh might originate from the presence of dedifferentiated gh receptors of the gh producing cells in acromegalic patients . The study of circadian regulation of gh secretion in acromegalics treated with surgery showed that gh secretion returned to normal physiological regulation after surgery in 3 out of 8 cases and bromocriptine therapy did not induce the resumption of physiological gh secretion patterns despite the fact that gh levels were significantly reduced . Although transphenoidal hypophysectomy of pituitary microadenomas (less than 1 cm in diameter) has a high probability of success, at diagnosis most patients have developed macroadenomas for which the cure rate is 50% or less . Pituitary radiation rarely leads to a cure and the reduction in circulating gh levels is usually delayed, sometimes for years . Many drugs have been tried, but almost all have failed to provide continued benefit with the possible exception of a da agonist, bromocriptine . Administration of this drug results in therapeutic responses in up to half of all patients with acromegaly, although not all investigators agree . The therapeutic modalities of acromegalics are treatment with da agonists and somatostatin analogs, pituitary surgery, and irradiation etc . Comparative studies between the effects of somatostatin and da agonists on the release of gh in acromegaly have given conflicting results, i.e. The same effect of sms and da agonists were observed, which failed to show any correlation between the gh lowering effects of sms and bromocriptine . These different study results were due to different pathogenetic mechanisms of gh release in acromegalics . In an in vitro study, the injection of da into the third ventricle of rats increased the release of somatostatin into the portal vessels . These results might guess that an axonal relationship was present between the dopaminergic nerve endings and median eminence . Therefore, a gh lowering effect observed during da infusion might have been mediated through the release of endogenous somatostatin from the median eminence . Moreover, in vitro studies have shown that bromocriptine and da itself inhibit the release of gh from pituitary adenomas in acromegalic patients . Other evidence of dopaminergic inhibitory action has shown that an infusion of da inhibited both insulin - induced hypoglycemia and l - dopa stimulated gh release at the pituitary and/or median eminence level . In the therapeutic aspect of the newly developed somatostatin analog, sms 201 - 995, this drug has suppressed gh levels for several hours without any rebound hypersecretion of gh . Lambert et al investigated the gh lowering effect of sms 201 - 995 in acromegalics and found clinical and biochemical improvement of acromegaly with a sms 201 - 995 dose of 200300 g bid or tid . This phenomena concerned us, and we tried to investigate the effect of sms 201 - 995 (50 g bid) on 4 acromegalics who were unresponsive to bromocriptine therapy . The results showed continued suppression of gh levels and improved clinical symptoms for up to 6 months in 2 acromegalics . But the suppressability of sms 201 - 995 was variable and responsiveness to this drug differed among the patients . The paradoxical gh response to trh and unresponsiveness to ghrh were reported in many acromegalics, and circadian variation of the gh was also noted in acromegalics . Therefore, we investigated the gh secretory patterns to various stimuli and to circadian rhythm in a group of 4 responders to sms 201 - 995 and a group of 4 non - responders . The observed results showed that there was no correlation between gh paradoxical response to trh stimulation, ghrh stimulation and sms 201 - 995 responsiveness . But, a close correlation was observed between the circadian rhythm of gh and sms responsiveness . In the sms responder group, a circadikan rhythm of gh our suggested pathogenetic mechanism of acromegaly based on this study is revealed in figure 5 . The mechanism of acromegaly is traditionally believed to originate from the pituitary itself and the secondary effect of excessive ghrh with defective somatostatin activity in the hypothalamus . If the acromegaly had originated from the pituitary, there would be no observed circadian rhythm, but we observed circadian rhythm of gh in 4 patients . According to our possible mechanism of acromegaly, patients 1, 6 and 8 without circadian rhythm responded to sms which might mean a defect in endogenous somatostatinergic activity . The relatively increased ghrh activity, due to defective somatostatin activity, might then have a secondary role for tumor growth in the pituitary gland . In contrast with the above situation, patients with the presence of circadian rhythm of gh (patients 4, 5 and 7) did not respond to sms . These patients might be considered to have normal or increased somatostatin levels and excessive secretion of ghrh might be the primary event . Then, the gh, stimulated by ghrh, affected positive feedback to somatostatin activity . These serial phenomena may elicit no response to sms 201 - 995 . Also, excitable ghrh secretory capacity might occur with diurnal variation of gh in our study . Moreover, if this status continues for a long time (duration is not predictive), the tumor begins to have an autonomous character, then both circadian rhythm and responsiveness to sms might disappear (patient 3). It is too difficult to make a definitive conclusion to the pathogenetic mechanism of acromegaly due to the small number of participants in our study, but the logical role of this concept will be criticized by further prospective study models.
The potential relevance of endothelial activation biomarkers to sepsis has been raised in both this journal and others [1 - 3]. Biomarkers for sepsis associated with the endothelial glycocalyx remain relatively unknown, however, and this commentary attempts to reverse this omission . The term glycocalyx (sweet husk) was introduced 50 years ago to describe an extracellular polysaccharide coating of cells . Whilst electron microscopy revealed that the luminal surface of the endothelium expressed this structure, it was thought to be of little consequence or functional significance . What has become increasingly evident, however, is that the glycocalyx - now estimated to extend up to 1 m from the endothelial cell membrane - represents a substantial intravascular compartment contributing significantly to vascular wall homeostasis . Specifically, roles of the glycocalyx include maintenance of the vascular permeability barrier, mediation of shear - stress - dependent nitric oxide production, and housing vascular protective enzymes (for example, superoxide dismutase) and a wide array of coagulation inhibition factors such as antithrombin, the protein c system and tissue factor pathway inhibitor . The glycocalyx also modulates the inflammatory response by preventing leukocyte adhesion and binding numerous ligands, including chemokines, cytokines and growth factors [4 - 6]. Negatively charged and with a mesh - like structure, the endothelial glycocalyx is comprised of glycoproteins, proteoglycans, glycosaminoglycans (gags) and associated plasma proteins including albumin . Proteoglycans consisting of a core membrane - bound protein of the syndecan or glypican families with attached heparan or chondroitin sulphate gag side chains are a prominent feature . Hyaluronan - a nonsulphated, uncharged gag with water - retaining properties - is attached or adsorbed onto other cell - surface anchored proteins (for example, cd44) and helps to stabilise the glycocalyx structure . Alteration in the composition of the glycocalyx following exposure to an inflammatory insult is one of the earliest features of endothelial activation . It is now accepted that tnf, oxidised lipoproteins, lipopolysaccharide, thrombin, ischaemia / reperfusion, hyperglycaemia and growth factors all cause glycocalyx disruption via the action of proteases - leading either to partial degradation with release of gag side chains, or to more severe damage characterised by shedding of core proteins . Several studies have evaluated circulating levels of syndecan-1 and gags in patients with sepsis [10 - 13]. Plasma gag levels were higher in patients with septic shock than in matched controls, and were significantly higher in nonsurvivors . In the same study, syndecan-1 levels were also increased and correlated with the sequential organ failure assessment score . In an additional study of 150 patients either with severe sepsis or septic shock or post - abdominal surgery without the systemic inflammatory response syndrome and healthy volunteers, significant increases in plasma syndecan-1 and heparan sulphate were observed in the sepsis and surgery groups . The highest syndecan-1 levels were detected in patients with sepsis and correlated with those of il-6 . A further study showed greater syndecan-1 levels in patients with septic shock compared with healthy controls, together with a positive correlation with vascular adhesion protein-1 and with day 1 sequential organ failure assessment scores . Finally, hyaluronan levels, in addition to those of syndecan-1 and heparan sulphate, have been shown to increase with severity of sepsis . Whilst the care of patients with sepsis has improved over the last decade the failure of two promising drugs, eritoran tetrasodium and drotrecogin alfa, to confer significant reduction in mortality suggests that novel approaches to sepsis research are required . Given the fundamental, but perhaps relatively overlooked, role of the endothelial glycocalyx in regulating vascular integrity and functions central to the pathophysiology of sepsis, identifying interventions aimed at protecting or repairing it might prove a promising therapeutic target . Some clinically established therapies used for the treatment of sepsis (such as glucose control and steroid administration) and also approaches used in experimental studies (such as tnf inhibition, antithrombin iii, infusion of albumin and avoidance of natriuretic peptide release) are known to reduce glycocalyx disruption . However, drugs that might specifically increase the synthesis of glycocalyx components, refurbish the glycocalyx or selectively prevent protease degradation are not currently available . Future endeavours in the field of sepsis research, which are urgently required, should not only include components of the endothelial glycocalyx in the list of biomarkers, but also consider their potential as therapeutic targets for the development of new therapies.
Aldose reductase (ar) is a key enzyme in the polyol pathway known to play important roles in the cataract formation and the pathogenesis of diabetic complications such as neuropathy, nephropathy, and retinopathy . Several naturally occurring and synthetic ar inhibitors with diverse structures have been studied in experimental animals and clinical trials to determine their effectiveness in preventing cataract formation and diabetic complications . Natural products are an excellent source of chemical structures with a wide variety of biological activities . The development and progression of diabetic complications can be prevented by controlling blood glucose, but it is difficult to maintain normal blood glucose levels in a diabetic patient . Ar inhibition is recognized as an important strategy for the prevention and attenuation of long - term diabetic complications . Ar inhibitors are being studied as potential therapeutic agents for use in treating diabetic complications [3, 4]. Apart from diabetic microvascular disease, advanced glycation end products (ages) have also been implicated in a wide and seemingly disparate range of pathologies such as connective tissue diseases particularly in rheumatoid arthritis and neurological conditions such as alzheimer's disease and end - stage renal disease . In vitro work has mostly shown age to be part of complex interactions within oxidative stress and vascular damage, particularly in atherosclerosis and in the accelerated vascular damage that occurs in diabetes . The complex fluorescent age molecules formed during the maillard reaction can lead to protein cross - linking and contribute to the development and progression of several diabetic complications, such as cataracts, atherosclerosis, nephropathy, and neuropathy . Increased oxidative stress is a widely accepted contributor to the development and progression of diabetes and its complications . Diabetes is usually accompanied by an increased production of free radicals and impaired antioxidant defenses [7, 8]. Therefore, inhibitors of ar and age formation provide an alternative mode of diabetes treatment, which is not dependent on the control of blood glucose level . These inhibitors should be useful in the prevention or reduction of certain diabetic complications . Prunella vulgaris, with almost 15 known individual species, is widely distributed in europe, asia, northwest africa, and north america, where it is generally known as self - heal herb . P. vulgaris is used to cure high blood pressure, headaches, lymphatic system disorders, goiter, tuberculosis, and tumors [1113]. More recently, a hot water infusion of this plant has been used to treat sores in the mouth and throat . Phytochemical studies indicate that p. vulgaris contains oleanolic, betulinic, ursolic, 2, 3-dihydroxyurs-12-en-28-oic, and 2, 3-ursolic acids, triterpenoids, flavonoids, tannins, and anionic polysaccharide called prunellin [11, 14]. The current study aimed to evaluate the ar and age inhibitory of p. vulgaris extract . These studies are important in understanding the inhibitory effects of p. vulgaris on diabetic complications . Dl - glyceraldehyde, the reduced form of nicotinamide adenine dinucleotide phosphate (nadph), bovine serum albumin (bsa), sodium phosphate, and quercetin used in this study were purchased from sigma (st . Louis, mo, usa). Human recombinant aldose reductase was purchased from wako pure chemical industries (osaka, japan). Ric-1021) was deposited at regional innovation center, hallym university, republic of korea . (1 kg) was extracted with water (5 l 2 times) for 2 h at 100c . The extract was suspended in distilled water and partitioned sequentially with n - hexane, methylene chloride (ch2cl2), ethyl acetate (etoac), and n - butanol (buoh), respectively . Ch2cl2 fraction was further purified by using a medium pressure liquid chromatography (lichroprep rp-18 glass column (36 460 mm; 2540 m particle size); mobile phase meoh / h2o (40 to 50%); flow rate 10 to 5 ml / min) resulted in the isolation of compounds 5 (10.9 mg) and 6 (13.5 mg). Since the etoac fraction showed the ar inhibitory activity, this fraction (2.2 g) was further purified by using a medium pressure liquid chromatography (lichroprep rp-18 glass column (36 460 mm; 2540 m particle size); mobile phase meoh / h2o (40 to 50%); flow rate 10 to 5 ml / min) resulted in the isolation of compounds 1 (102.8 mg), 2 (53.3 mg), 3 (10.6 mg), and 4 (27.9 mg). Crude rat lens aldose reductase (rar) was prepared as follows: lenses were removed from sprague - dawley rats weighing 250280 g and frozen at 70c until use . The rat lens homogenate was prepared according to the method of hayman and kinoshita with some modifications [1517]. Noncataractous transparent lenses were pooled and homogenate was prepared in 0.1 m phosphate buffer saline (ph 6.2). After centrifugation at 10,000 rpm for 20 min in a refrigerated centrifuge, the supernatant containing the rar was collected . Ar activity was assayed spectrophotometrically by measuring the decrease in the absorption of nadph at 340 nm over a 4 min period according to the method of hayman and konoshita with some modifications, using dl - glyceraldehyde as the substrate . Each 1.0 ml cuvette contained equal units of the enzyme, 0.10 m sodium phosphate buffer (ph 6.2), 0.3 mm nadph, with or without 10 mm of the substrate, and an inhibitor [18, 19]. The concentration of inhibitors giving 50% inhibition of enzyme activity (ic50) was calculated from the least - squares regression line of the logarithmic concentrations plotted against the residual activity . Reaction mixtures consisted of 0.1 m potassium phosphate, 0.16 mm nadph, 2 mm of recombinant human aldose reductase (rhar) with varied concentrations of substrate dl - glyceraldehyde and ar inhibitor in a total volume of 200 l . Concentrations were ranged from 0.1 to 1 mm for dl - glyceraldehyde, and from 0.1 to 1 mm for active compound . Recombinant human aldose reductase activity was assayed spectrophotometrically by measuring the decrease in absorption of nadph at 340 nm after substrate addition using bio tek power wave xs spectrophotometer (bio tek instruments, vt, usa). Lenses isolated from 10-week - old male rats were cultured for 6 d in tc-199 medium that contained 15% fetal bovine serum 100 units / ml penicillin and 0.1 mg / ml streptomycin under sterile conditions in an atmosphere of 5% co2 and 95% air at 37c . The lenses were divided into 5 groups and cultured in medium containing 5 mm glucose, 30 mm galactose, and rosmarinic acid or caffeic acid ethylene ester . Galactitol was determined by hplc after its derivatization by reaction with benzoic acid to a fluorescent compound . Blood sample was collected in heparin - containing polypropylene tube from 10-week - old male rats . For sugar and sugar alcohol analysis, erythrocytes from heparinized blood were separated from the plasma and buffy coat by centrifuging at 2000g for 10 min . The cells were washed thrice with normal saline (0.9% nacl) at 4c . In the final washing, the cells were centrifuged at 2000 g for 10 min to obtain a consistently packed cell preparation . The packed cells (1 ml) were then incubated in a krebs - ringer bicarbonate buffer (ph 7.4) containing 30 mm galactose in the presence or absence of samples at 37c in 5% co2 for 3 h. the erythrocytes were washed with cold saline by centrifuging at 2000 g for 10 min, precipitated by adding 6% of cold perchloric acid (3 ml), and centrifuged again at 2000 g for 10 min . The supernatant was neutralized with 2.5 m k2co3 at 4c and used for galactitol determination . Hplc analysis for sugar and sugar alcohol in blood was performed with this supernatant of red blood cell homogenate after being benzoylated . The modified procedure of lee et al . Was followed . Bovine serum albumin (10 mg / ml) was incubated with 5 mm methylglyoxal in sodium phosphate buffer (100 mm; ph 7.4). All of the reagent and samples were sterilized by filtration through 0.2 m membrane filters, and the mixture was incubated at 37c for 7 days . The fluorescence intensity was measured at an excitation wavelength of 330 nm and an emission wavelength of 410 nm with a ls50b fluorescence spectrometer (perkin - elmer ltd . The abts diammonium salt (2 mm) and potassium persulfate (3.5 mm) were mixed and diluted in distilled water kept in the dark at room temperature for 24 h before use . After addition of abts solution to 10 l of antioxidant compounds were recorded at after 10 min reaction . The percentage inhibition of absorbance at 750 nm is calculated and potted as a function of concentration of antioxidants . The constituents of the dried p. vulgaris were extracted with water . In order to identify the active fractions from p. vulgaris the ch2cl2 soluble and etoac soluble fractions were isolated by using a medium pressure liquid chromatography . Their chemical structures were elucidated by chemical and spectral analysis as caffeic acid (1), protocatechuic acid (2), p - hydroxycinnamic acid (3), rosmarinic acid (4), caffeic acid ethylene ester (5), and protocatechualdehyde (6). Compounds 2, 3, and 5 were isolated for the first time from this plant . The present study was conducted to identify new potential rar inhibitors from p. vulgaris, which might have potential uses in the treatment of diabetic complications . We showed that water extract of p. vulgaris inhibited the activity of rar . In order to identify the active compounds from p. vulgaris the extract was divided into several fractions that were tested for their rar inhibitory activity . The etoac fraction had high inhibitory activity against rar with ic50 value of 2.99 0.10 g / ml . These results are shown in table 1 . Previous studies used quercetin as a positive control when comparing the inhibitory activity of active compounds isolated from natural products against lens or human recombinant aldose reductase [9, 30, 31]. We compared the inhibition of rar and rhar by compounds 16 and quercetin, a natural aldose reductase inhibitor . Compounds 35 had ic50 values of 8.35 0.51, 2.77 0.48, and 3.2 0.55 m, respectively, for ar while compounds 4 and 5 had ic50 values of 18.62 0.40 and 12.58 0.32 m, respectively, for rhar . Of the compounds tested, rosmarinic acid had the most potent rar inhibitory activity, while caffeic acid ethylene ester showed almost the same activity at the same concentration . Compounds isolated from p. vulgaris had potent inhibitory effects on rhar, especially caffeic acid ethylene ester . To determine the type of inhibition activity produced by compounds 4 and 5, a kinetic study was conducted using dl - glyceraldehyde as a substrate (concentration: 0.11 mm) at 3 different concentrations for each compound . The lineweaver - burk plots of 1/velocity and 1/concentration for compounds 4 and 5 are shown in figure 2 . Changes in the concentration of the substrate dl - glyceraldehyde resulted in different slopes and different x axis intersects being obtained with the uninhibited enzyme and the 3 different concentrations for each compound . The results indicated that the inhibition type of rhar by rosmarinic acid (4) and caffeic acid ethylene ester (5) was noncompetitive, showing that the inhibitor was unable to bind to either the substrate - binding region or the nadph - binding region of rhar . We also studied the effects of compounds 4 and 5 on galactitol accumulation in rat erythrocytes and lenses (table 3). Rat lens incubation for 6 d in 30 mm galactose resulted in an increased intracellular accumulation of galactitol . Compounds 4 and 5 inhibited galactitol accumulation in rat erythrocyte by almost 35.5 and 31.7% at 5 g / ml, respectively . Quercetin (the positive control) inhibited galactitol accumulation in rat erythrocyte by 30.5% and in rat lenses by almost 36.9 and 22.5% at 5 g / ml, respectively . The etoac fraction had high inhibitory activity against age with an ic50 value of 141.34 1.27 g / ml, showing almost the same activity with positive control (table 4). Inhibitory activity against age formation by the isolated compounds was tested using aminoguanidine as a positive control . Caffeic acid ethylene ester (5) exhibited potent inhibitory activity against age formation with an ic50 value of 33.16 0.54 m, compared with the positive control ic50 value of 1944.86 8.39 m (table 5). Oxidative stress might have a key role in the pathogenesis of vascular complications in diabetes, both microvascular and macrovascular, and it provides an early marker of such damage in the development of endothelial dysfunction [33, 34]. Abts inhibitory activity of the isolated compounds was tested using trolox as the positive control . P - hydroxycinnamic acid (3) had the strongest inhibitory activity with an ic50 value of 5.94 1.01 m, and caffeic acid ethylene ester (5) also had potent inhibitory activity with an ic50 value of 10.52 0.28 m, compared to a positive control ic50 value of 15.34 0.40 m (see tables 6 and 7). The present study isolated six compounds from p. vulgaris by using a medium pressure liquid chromatography . Among these compounds, caffeic acid ethylene ester (5) has potent ar, age inhibitory activity, and antioxidant . Specifically, this compound exhibited the most potent inhibition with age, with an ic50 of 33.16 0.54 m . The inhibitory effect of this compound was 58.0-fold stronger than that of the positive control aminoguanidine (ic50 = 1944.86 8.39 m). These results suggest that this compound and p. vulgaris could potentially provide a new natural treatment for diabetic complications . However, further studies on the mechanism of age action of caffeic acid ethylene ester (5) and more in vivo evidence from diabetic animals are required.
The study design included a one - group (internal) comparison in which each intersection acted as its own control through comparison of the number of pedestrian motor vehicle collisions (per intersection - month) before and after pcs installation . Ethics approval for the study was provided by the ethics review board of the hospital for sick children . Intersections with controlled traffic signals where pcs were introduced during the study period (january 2000 to december 2009) were eligible for inclusion . Intersections were excluded from the analysis if there was less than 6 months between the installation of a traditional traffic signal (controlled traffic signal with a walk phase, flashing don't walk phase and a solid don't walk phase) and installation of a pcs . This exclusion reduced the likelihood of measuring novel effects associated with the installation of a traffic signal . Exposure time was calculated using the number of months each intersection contributed to the study period before and after the installation of pcs . The outcome of interest was the frequency of reported pedestrian motor vehicle collisions between january 2000 and december 2009 . Data were extracted from motor vehicle collision reports filed by the toronto police service and were obtained from the city of toronto, transportation services division . Motor vehicle collision records were excluded from the analysis if: (1) the location code (eg, intersection / mid - block) was missing; (2) the collision occurred on private property or in a parking lot; (3) the collision occurred before a traditional signal was installed at the respective intersection; (4) the collision occurred outside a 30-m radius of the intersection where a pcs was installed; (5) the collision occurred on the same day the pcs was installed; and (6) the collision occurred at an intersection where there was less than 6 months between the installation of a traditional traffic signal and the installation of a pcs . Age was included as a potential effect modifier to determine if pcs were equally effective for all pedestrians . The following age classes were used to conduct stratified analysis: 015, 1659 and over 60 years.22 records with missing data for age were excluded from the age - stratified analysis . Toronto police services categorise injuries sustained from a collision into five types: no injury; minimal (no medical attention required); minor (emergency department treatment only); major (hospital admission required); and fatal . Previous research has reported police misclassification of injury is most likely to be associated with minor injury.2325 in this study, minimal and minor injury categories were combined . Census geography from 1996 was used to geocode collisions as occurring in either the urban or inner suburban parts of what is now the city of toronto . The inner suburbs are a more recently constructed part of the city region, where auto mode share for work and other activities is typically higher than elsewhere in toronto.26 collisions and intersections with pcs were mapped onto the city of toronto centerline shapefile using latitude and longitude coordinates using arcgis, arcmap version 10 . Arcgis was used to create a pcs intersection dataset and to attach collision data to the set of intersections where pcs installation occurred . Crude incidence rates per 1000 intersection - months were calculated for all collisions and by strata, pre and post - pcs installation . Poisson regression analysis with repeated measures (generalised estimating equations) was used to estimate the rr and 95% ci of collisions adjusted for clustering, as predicted by pcs status (pre - pcs / post - pcs). To look for effect modification, separate models were fit for total, each age group (015, 1659 and over 60 years), each injury severity classification (no injury, minor / minimal, major and fatal) and each location (pre - amalgamated toronto and inner suburbs). In all models, pcs, as a predictor of collision counts, was considered statistically significant at p0.05 . Intersections where there was less than 6 months between the installation of a traditional traffic signal and the installation of a pcs (n=113) were excluded from the analysis . A total of 1965 intersections were included in the analysis . From 1 january 2000 to 31 december 2009, there were 23 428 pedestrian motor vehicle collisions in toronto . Collision records missing data for location (n=2984), and collisions that occurred in a parking lot or on private property (n=289), outside a 30-m radius from an intersection where a pcs was (eventually) installed (n=10 486), before the installation of a traditional traffic signal (n=385), on the same day as the pcs installation (n=3) and at intersections where there was less than 6 months between the installation of a traditional traffic signal and the installation of a pcs (n=19) were excluded, producing a final sample of 9262 collisions . There were 226 records with missing data for age; these were excluded from the age - stratified analysis . The number of collisions per year was plotted and no significant secular trend could be identified, either in collisions occurring at intersections with pcs, or in total pedestrian motor vehicle collisions (figure 1). Pcs analysis of pedestrian motor vehicle collisions, toronto, canada, 20009 reference group is pre - pedestrian countdown signal (pcs) intersections . Base: n=1965 intersections; location: pre - amalgamated toronto (n=622 intersections); inner suburbs (n=1343 intersections). Overall, the crude incidence rates (per 1000 intersection - months) remained fairly stable pre and post - pcs installation, 40.73 and 41.30, respectively (table 1). When modelled, a rr of 1.014 (95% ci 0.958 to 1.073) indicated no significant relationship between pcs and collisions, after adjusting for clustering . The stratified analysis by age revealed that the majority of the collisions (n=6482, 72%) occurred among adults 1659 years of age . Pre and post - crude incidence rates (per 1000 intersection - months) were similar for this age group, 28.30 and 29.79, respectively . When modelled, the rr (rr 1.038, 95% ci 0.972 to 1.108) revealed no effect of pcs on collisions among this age group . Among the most vulnerable road users, children (015 years of age) and older people (over 60 years of age), there was a slight decrease in crude incidence rates; however, the rr for children (015: rr 0.941, 95% ci 0.792 to 1.119) and older people (over 60 years: rr 0.967, 95% ci 0.844 to 1.108) indicated no significant effect of pcs on collisions . The majority of collisions resulted in minor / minimal injury (n=7949, 86%). Crude incidence rates remained similar among the pre and post - pcs periods for all types of injury severity . When modelled, no significant effect of pcs was seen on collisions of differing severity (no injury: rr 0.838, 95% ci 0.626 to 1.121; minor / minimal: rr 1.026, 95% ci 0.965 to 1.090; major: rr 0.984, 95% ci 0.826 to 1.173; fatal: rr 0.968, 95% ci 0.594 to 1.578). The crude incidence rates by location revealed higher rates of collisions per intersection in pre - amalgamated toronto compared with the inner suburbs for both time periods; however, when modelled, there was no effect of pcs on either location (toronto: rr 0.943, 95% ci 0.866 to 1.027; inner suburbs: rr 1.042, 95% ci 0.967 to 1.122). Intersections where there was less than 6 months between the installation of a traditional traffic signal and the installation of a pcs (n=113) were excluded from the analysis . From 1 january 2000 to 31 december 2009, there were 23 428 pedestrian motor vehicle collisions in toronto . Collision records missing data for location (n=2984), and collisions that occurred in a parking lot or on private property (n=289), outside a 30-m radius from an intersection where a pcs was (eventually) installed (n=10 486), before the installation of a traditional traffic signal (n=385), on the same day as the pcs installation (n=3) and at intersections where there was less than 6 months between the installation of a traditional traffic signal and the installation of a pcs (n=19) were excluded, producing a final sample of 9262 collisions . There were 226 records with missing data for age; these were excluded from the age - stratified analysis . The number of collisions per year was plotted and no significant secular trend could be identified, either in collisions occurring at intersections with pcs, or in total pedestrian motor vehicle collisions (figure 1). Pcs analysis of pedestrian motor vehicle collisions, toronto, canada, 20009 reference group is pre - pedestrian countdown signal (pcs) intersections . Base: n=1965 intersections; location: pre - amalgamated toronto (n=622 intersections); inner suburbs (n=1343 intersections). Overall, the crude incidence rates (per 1000 intersection - months) remained fairly stable pre and post - pcs installation, 40.73 and 41.30, respectively (table 1). When modelled, a rr of 1.014 (95% ci 0.958 to 1.073) indicated no significant relationship between pcs and collisions, after adjusting for clustering . The stratified analysis by age revealed that the majority of the collisions (n=6482, 72%) occurred among adults 1659 years of age . Pre and post - crude incidence rates (per 1000 intersection - months) were similar for this age group, 28.30 and 29.79, respectively . When modelled, the rr (rr 1.038, 95% ci 0.972 to 1.108) revealed no effect of pcs on collisions among this age group . Among the most vulnerable road users, children (015 years of age) and older people (over 60 years of age), there was a slight decrease in crude incidence rates; however, the rr for children (015: rr 0.941, 95% ci 0.792 to 1.119) and older people (over 60 years: rr 0.967, 95% ci 0.844 to 1.108) indicated no significant effect of pcs on collisions . The majority of collisions resulted in minor / minimal injury (n=7949, 86%). Crude incidence rates remained similar among the pre and post - pcs periods for all types of injury severity . When modelled, no significant effect of pcs was seen on collisions of differing severity (no injury: rr 0.838, 95% ci 0.626 to 1.121; minor / minimal: rr 1.026, 95% ci 0.965 to 1.090; major: rr 0.984, 95% ci 0.826 to 1.173; fatal: rr 0.968, 95% ci 0.594 to 1.578). The crude incidence rates by location revealed higher rates of collisions per intersection in pre - amalgamated toronto compared with the inner suburbs for both time periods; however, when modelled, there was no effect of pcs on either location (toronto: rr 0.943, 95% ci 0.866 to 1.027; inner suburbs: rr 1.042, 95% ci 0.967 to 1.122). This study found no difference in pedestrian motor vehicle collision rates before and after the installation of pcs . Rates were also similar pre and post - pcs installation when collisions were stratified by age, injury severity and location . Similar to pulugurtha et al,19 this study was restricted to collisions that occurred at signalised intersections where a pcs was eventually installed . Therefore, a reasonable explanation for the findings is that while controlled traffic signals in general (regardless of the signal head) are highly effective in reducing the number of pedestrian motor vehicle collisions,27 the addition of a pcs does not change the overall impact . This study also found no negative impact of pcs on collision counts, which is similar to the findings of botha et al.10 where the work of botha et al10 was limited by a small sample size, low statistical power and a short post - pcs installation period, the sample size of this study addressed these concerns . The results reported contrast with findings from the work of markowitz et al.11 markowitz et al11 reported a 52% reduction in collisions post - pcs installation; however, this finding was based on the analysis of nine high collision intersections; effect size may have been partly due to regression to the mean . Collision history was not a factor in the present study; in fact, some of the intersections included did not experience collisions during the study period . Pulugurtha et al19 found pcs are most effective at high crash and high volume intersections . This may explain the differences in the effect size of pcs between studies . While pcs appears to have no impact overall in the city of toronto, it is possible that the effect of pcs is different in some places than in others . Elements of the built environment are important to consider when analysing the effectiveness of pcs . Location was included in this analysis to understand the impact of pcs by urban design . Many aspects of urban design affect pedestrian safety, notably vehicle speed, which is further determined by driver behaviour . Higher vehicle speeds are associated with an increased risk of pedestrian motor vehicle collisions and the severity of pedestrian injury.2831 an 80% risk of pedestrian death has been estimated when a vehicle is travelling at 50 km / h.28 while it was not possible to include reliable data on vehicle speed in this analysis, we can comment on road density by type within each location . Posted road speed and vehicle volumes increase up the road type hierarchy, from local roads to expressways.32 we divided toronto into two locations: pre - amalgamated toronto and the inner suburbs . Pre - amalgamated toronto includes the commercial downtown as well as higher density residential neighbourhoods and pre - second world war traditional neighbourhoods, whereas the inner suburbs include mainly lower residential and commercial densities . Neighbourhoods in the inner suburbs are closer in design to the post - war, car - oriented suburban aesthetic; however, there are some high density residential neighbourhoods . Differences between locations were noteworthy for two road types . Collector roads are designed to provide access to property and move traffic (2500 to 8000 vehicles per day), have posted speed limits of 4050 km / h (40 km / h is more common in inner suburbs)33 and pavements on both sides of the road.32 the most notable difference in road density by type is for collector roads; 34.55 km/100 000 population in the inner suburbs compared with 19.82 km/100 000 population in pre - amalgamated toronto . Major arterial roads are primarily designed for traffic movement (> 20 000 vehicles per day), have posted speed limits of 5060 km / h and pavements on both sides of the road (sidewalks).32 there are slightly more major arterial roads in the inner suburbs compared with pre - amalgamated toronto; 29.56 km/100 000 population versus 24.28 km/100 000 population, respectively . Pedestrians in the pre - amalgamated (downtown) region were exposed to a different built environment compared with pedestrians in the suburbs . Without detailed area - wide measures of walking we cannot comment on exposure per se, but differences in road design, control and potentially driver behaviour indicate that both pcs and other interventions could work differently here compared with the inner suburbs . Although pcs was not an effective intervention in either location, it is likely that any combined intervention (including pcs) will be different in different traffic environments . It is an exploratory research study on the relationship between pcs and collisions in toronto . A parsimonious approach was taken to develop a model to understand the rr between pcs and collisions . These models do not adjust for potential confounders, such as changes in pedestrian exposure . The use of collision rates per intersection - month did not account for population differences between the urban and inner suburban areas of the city of toronto . This study was not able to account for exposure measures related to pedestrian and vehicle volumes . A strength of the study conducted by pulugurtha et al19 was the inclusion of vehicle volume data . These data would have been useful to understand secular trends associated with walking and driving behaviours or practices, but were not available in sufficient detail for our analysis . Data quality concerns have been documented for police reported collision data.23 24 34 35 motor vehicle collision reports are completed when there is an injury; therefore, it is likely that collisions between pedestrians and motor vehicles not involving injury are underrepresented in the data.35 in addition, this data source is limited to collisions reported to the police . Previous studies conducted in the usa have estimated that police reported motor vehicle collision data underestimate the number of injured pedestrians involved in motor vehicle collisions by approximately 21%.23 this number remains similar among paediatric populations in the usa (under 15 years of age), where it is estimated that pedestrian motor vehicle collisions are underreported by 20%.25 behavioural aspects, including changes in pedestrian and driver actions and conditions, could not be captured by collision data . Observational studies examining behavioural changes in response to pcs are important to provide insight into how pcs are being used in the road traffic environment, and how to make changes to improve pcs as an intervention . The city of toronto transportation services are currently conducting an observational study of pedestrian behaviour pre and post - pcs installation . The results are based on controlled intersections where a pcs was installed over the study period, and does not examine collisions that occurred at adjacent, uncontrolled, unchanged intersections or road segments in toronto . To understand fully the public health impact of pcs as a modification to the built environment, all collisions in toronto would need to be analysed . Outcome measure data over a 10-year period provided adequate statistical power and permitted stratified analyses . The use of secondary data, collected independently of the intervention, prevented bias that may have influenced previous observational studies through observer effects and a lack of blinding . The intersections included in the analysis comprised 95% of the total eligible intersections, and are representative of toronto . The repeated measures design and one - group comparison provided control over extraneous variables associated with the geographical location of the intersection, including factors such as posted road speed, land use mix, road type and other unknown confounders . The installation of pcs at 1965 signalised intersections in toronto did not reduce the frequency of pedestrian motor vehicle collisions at these intersections . Reducing pedestrian motor vehicle collisions at intersections requires more than simply installing pcs . Other changes to lights or their use might have safety benefits, for example, increasing walking times, prohibiting drivers from turning on red lights or allowing pedestrian scrum crossings in all directions with no cars in the intersection . More fundamental changes to cities, which intentionally build pedestrian safety advantages into the environment, pcs may be an important component of future strategies to make pedestrians safer in cities, but the toronto experience does not suggest that widespread installation of pcs alone will have important benefits for pedestrian safety . This is the first population - based study to describe the effectiveness of pcs at reducing pedestrian motor vehicle collisions, over a 10-year period . This study provides evidence that the installation of pcs in toronto, canada, was not associated with a reduction in pedestrian motor vehicle collisions . Public health interventions designed to create pedestrian - friendly cities should include additional components, as pcs alone are not likely to have important safety benefits . Other changes to lights or their use might have safety benefits, for example, increasing walking times, prohibiting drivers from turning on red lights or allowing more fundamental changes to cities, which intentionally build pedestrian safety advantages into the environment, might increase both the popularity and safety of walking . Pcs may be an important component of future strategies to make pedestrians safer in cities, but the toronto experience does not suggest that widespread installation of pcs alone will have important benefits for pedestrian safety . This is the first population - based study to describe the effectiveness of pcs at reducing pedestrian motor vehicle collisions, over a 10-year period . This study provides evidence that the installation of pcs in toronto, canada, was not associated with a reduction in pedestrian motor vehicle collisions . Public health interventions designed to create pedestrian - friendly cities should include additional components, as pcs alone are not likely to have important safety benefits.
Briefly, the reveal registry is a multicenter observational, prospective registry involving 55 university - affiliated and community hospital - based pulmonary hypertension centers in the united states . Each of the participating sites received institutional review board approval (e - table 1). Patients with pah (who group 1 pulmonary hypertension; venice 2003 definition), confirmed by right - sided heart catheterization, were enrolled consecutively from march 2006 through december 2009 after providing informed consent . For this analysis we evaluated only patients with newly diagnosed disease with qualifying right - sided heart catheterization within 90 days of enrollment with hemodynamics measured at rest . Only patients with pulmonary capillary wedge pressure 15 mm hg were included . First - time postenrollment hospitalizations were independently reviewed by three investigators (c. d. b., p. k. l., and r. e. s.) and categorized as pah related or not primarily related to pah (hereafter referred to as pah unrelated) based on information in case report forms (dates of hospital admission and discharge, primary discharge diagnosis, reason for hospitalization, disease characteristics, and treatments prior to admission). Secondary diagnoses were not available, so the determination of pah related vs pah unrelated was made based only on the primary diagnosis . Categories for pah - related hospitalization were determined before review, and any one of these categories would have constituted a pah - related hospitalization . Categories for the pah - unrelated hospitalizations were also determined before review, but some modifications were made afterward to cover all categories with more than one admission any single discharge diagnosis that did not fit in a category was classified as other . More than one category could have been present at any given admission, and in those situations the primary discharge diagnosis was the determinate of hospitalization causality . Group differences in patient demographics and disease characteristics determined at enrollment were tested with pearson, mantel - haenszel, or t tests for binary, ordinal, and continuous variables, respectively . For variables with highly skewed distributions, kaplan - meier estimates for freedom from hospitalization and for survival were computed for distinct at - risk periods: (1) for the full cohort (ie, hospitalized and nonhospitalized patients), the risk period began at enrollment; (2) for patients with a first - time hospitalization, the risk period (for freedom from event following hospitalization) began at hospital discharge; (3) for patients event - free through the first year of follow - up, the at - risk period for future follow - up began at 365 days after enrollment . Of 862 patients in the analysis cohort, 490 (56.8%) had at least one hospitalization during follow - up on study, and 372 (43.2%) had none (fig 1). Of the 490 first - time hospitalizations, 257 (52.4%) were for causes clearly related to pah, 214 (43.7%) were for pah - unrelated causes that were considered related to comorbidity, and 19 (3.9%) could not be characterized as pah related or unrelated because of insufficient data (fig 1). The median time from right - sided heart catheterization diagnosis to study enrollment was 26 days . Pah = pulmonary arterial hypertension; pcwp = pulmonary capillary wedge pressure; reveal = registry to evaluate early and long - term pah disease management . Among the 257 patients hospitalized for pah - related causes, congestive heart failure (n = 81, 31.5%) and placement or removal of a central venous catheter (n = 63, 24.5%) were the two most common causes cited at admission (table 1). Other common causes for first - time hospitalization were the initial iv line insertion (n = 30, 11.7%), which represents the initiation of iv therapy, and the escalation of therapy for pah (n = 23, 8.9%). A total of 21 pah - related hospitalizations (8.2%) were associated with catheter infection: 11 occurring in the first year, three in the second year, and seven in the third year or later . Reasons for first - time hospitalization related and unrelated to pah reasons are not mutually exclusive; a patient could have been hospitalized for more than one reason . . Includes angina and myocardial infarction . Among the 214 patients hospitalized for pah - unrelated causes, non - line - related infections were cited most commonly: pah - unrelated infections (n = 38, 21.1%) and pneumonia (n = 34, 15.9%) (table 1). Other common diagnoses at the time of first hospitalization were surgery / procedures (n = 24, 11.2%) and hemorrhage (n = 19, 8.9%). Patients hospitalized for any reason were more likely than patients not hospitalized to have comorbidities (diabetes and depression) and to have more severe pah at enrollment, as measured by functional class, presence of pericardial effusion, higher mean atrial pressure, lower cardiac index, and higher reveal registry risk score . Patients with hospitalizations also had significantly longer follow - up from enrollment than patients without hospitalizations (table 2). Patient demographics and disease characteristics at enrollment all patients with 1 hospitalization (c) includes patients with pah - related (a) and pah - unrelated (b) hospitalizations . 6mwd = 6-min walk distance; bnp = brain natriuretic peptide; chd = congenital heart disease; ctd = connective tissue disease; iqr = interquartile range; mpap = mean pulmonary arterial pressure; mrap = mean right atrial pressure; nyha = new york heart association; poph = portopulmonary hypertension; pvod = pulmonary veno - occlusive disease; pvr = pulmonary vascular resistance . The total number of patients in each cohort with data at enrollment for each parameter is assumed to be 257 (a), 214 (b), 471 (c), and 372 (d), unless otherwise noted . Comparison between pah - related and pah - unrelated groups revealed few differences at enrollment . In particular, patients with pah - related hospitalizations were less likely than patients with pah - unrelated hospitalizations to be <18 years of age and more likely to have more severe pah, as measured by functional class and lower cardiac index . Length of follow - up from enrollment was also shorter for the pah - related group (table 2). Hospitalization - related characteristics were similar overall between the pah - related and pah - unrelated groups, with the notable exception that patients with pah - related hospitalizations were more likely to be on parenteral therapy, to be in functional class iii or iv prior to hospitalization, and to have a higher reveal registry risk score prior to hospitalization (table 3). Further description of the type and timing of pah - related hospitalizations, including distribution of specific causes for hospitalization over time, is provided in the online supplement (e - figs 1, 2, e - table 2). Characterization of hospitalizations, by type of hospitalization all patients with 1 hospitalization (c) includes patients with pah - related (a) and pah - unrelated (b) hospitalizations . See table 1 legend for expansion of other abbreviation . The total number of patients in each cohort with data at enrollment for each parameter is assumed to be 257 (a), 214 (b), and 471 (c), unless otherwise noted . P value is computed using fisher exact test . For the entire analysis cohort at 3 years from enrollment, 45.4% 1.8% of patients remained free from hospitalization (fig 2a). Among patients who were hospitalized and discharged alive following the first hospitalization, 25.4% 3.2% of patients with pah - related and 31.0% 4.0% of patients with pah - unrelated first hospitalization remained free from a second hospitalization at 3 years postdischarge (p = .11) (fig 2b). For patients who remained hospitalization - free for 1 year postenrollment, 53.7% 2.5% remained free from admission after an additional 3 years of follow - up (fig 2c). A - c, kaplan - meier estimates of freedom from hospitalization for (a) all patients from time of enrollment; (b) patients with a first - time hospitalization from time of discharge, by type of hospitalization; and (c) patients with no hospitalization in the first year of follow - up (including patients with no hospitalizations and patients with first - time hospitalizations occurring after the first year of follow - up) from 1 y after enrollment . Mortality was significantly higher for pah - related hospitalizations compared with pah - unrelated hospitalizations (5.4% vs 1.4%, p = .024) (table 3). Among those discharged alive following first - time hospitalization, the survival estimate at 3 years postdischarge was lower for patients with pah - related hospitalization than for patients with pah - unrelated hospitalization (56.8% 3.5% vs 67.8% 3.6%, p = .037) (fig 3a). Among patients who remained hospitalization - free for 1 year postenrollment, survival after 3 additional years of follow - up was 77.8% 1.9% (fig 3b). A, b, kaplan - meier estimates of survival for (a) patients with a first - time hospitalization from time of discharge, by type of hospitalization; and (b) patients with no hospitalization in the first year of follow - up (including patients with no hospitalizations and patients with first - time hospitalizations occurring after the first year of follow - up) from 1 y after enrollment . Of 862 patients in the analysis cohort, 490 (56.8%) had at least one hospitalization during follow - up on study, and 372 (43.2%) had none (fig 1). Of the 490 first - time hospitalizations, 257 (52.4%) were for causes clearly related to pah, 214 (43.7%) were for pah - unrelated causes that were considered related to comorbidity, and 19 (3.9%) could not be characterized as pah related or unrelated because of insufficient data (fig 1). The median time from right - sided heart catheterization diagnosis to study enrollment was 26 days . Pah = pulmonary arterial hypertension; pcwp = pulmonary capillary wedge pressure; reveal = registry to evaluate early and long - term pah disease management . Among the 257 patients hospitalized for pah - related causes, congestive heart failure (n = 81, 31.5%) and placement or removal of a central venous catheter (n = 63, 24.5%) were the two most common causes cited at admission (table 1). Other common causes for first - time hospitalization were the initial iv line insertion (n = 30, 11.7%), which represents the initiation of iv therapy, and the escalation of therapy for pah (n = 23, 8.9%). A total of 21 pah - related hospitalizations (8.2%) were associated with catheter infection: 11 occurring in the first year, three in the second year, and seven in the third year or later . Reasons for first - time hospitalization related and unrelated to pah reasons are not mutually exclusive; a patient could have been hospitalized for more than one reason . . Includes angina and myocardial infarction . Among the 214 patients hospitalized for pah - unrelated causes, non - line - related infections were cited most commonly: pah - unrelated infections (n = 38, 21.1%) and pneumonia (n = 34, 15.9%) (table 1). Other common diagnoses at the time of first hospitalization were surgery / procedures (n = 24, 11.2%) and hemorrhage (n = 19, 8.9%). Patients hospitalized for any reason were more likely than patients not hospitalized to have comorbidities (diabetes and depression) and to have more severe pah at enrollment, as measured by functional class, presence of pericardial effusion, higher mean atrial pressure, lower cardiac index, and higher reveal registry risk score . Patients with hospitalizations also had significantly longer follow - up from enrollment than patients without hospitalizations (table 2). Patient demographics and disease characteristics at enrollment all patients with 1 hospitalization (c) includes patients with pah - related (a) and pah - unrelated (b) hospitalizations . 6mwd = 6-min walk distance; bnp = brain natriuretic peptide; chd = congenital heart disease; ctd = connective tissue disease; iqr = interquartile range; mpap = mean pulmonary arterial pressure; mrap = mean right atrial pressure; nyha = new york heart association; poph = portopulmonary hypertension; pvod = pulmonary veno - occlusive disease; pvr = pulmonary vascular resistance . The total number of patients in each cohort with data at enrollment for each parameter is assumed to be 257 (a), 214 (b), 471 (c), and 372 (d), unless otherwise noted . Comparison between pah - related and pah - unrelated groups revealed few differences at enrollment . In particular, patients with pah - related hospitalizations were less likely than patients with pah - unrelated hospitalizations to be <18 years of age and more likely to have more severe pah, as measured by functional class and lower cardiac index . Length of follow - up from enrollment was also shorter for the pah - related group (table 2). Hospitalization - related characteristics were similar overall between the pah - related and pah - unrelated groups, with the notable exception that patients with pah - related hospitalizations were more likely to be on parenteral therapy, to be in functional class iii or iv prior to hospitalization, and to have a higher reveal registry risk score prior to hospitalization (table 3). Further description of the type and timing of pah - related hospitalizations, including distribution of specific causes for hospitalization over time, is provided in the online supplement (e - figs 1, 2, e - table 2). Characterization of hospitalizations, by type of hospitalization all patients with 1 hospitalization (c) includes patients with pah - related (a) and pah - unrelated (b) hospitalizations . The total number of patients in each cohort with data at enrollment for each parameter is assumed to be 257 (a), 214 (b), and 471 (c), unless otherwise noted . For the entire analysis cohort at 3 years from enrollment, 45.4% 1.8% of patients remained free from hospitalization (fig 2a). Among patients who were hospitalized and discharged alive following the first hospitalization, 25.4% 3.2% of patients with pah - related and 31.0% 4.0% of patients with pah - unrelated first hospitalization remained free from a second hospitalization at 3 years postdischarge (p = .11) (fig 2b). For patients who remained hospitalization - free for 1 year postenrollment, 53.7% 2.5% remained free from admission after an additional 3 years of follow - up (fig 2c). A - c, kaplan - meier estimates of freedom from hospitalization for (a) all patients from time of enrollment; (b) patients with a first - time hospitalization from time of discharge, by type of hospitalization; and (c) patients with no hospitalization in the first year of follow - up (including patients with no hospitalizations and patients with first - time hospitalizations occurring after the first year of follow - up) from 1 y after enrollment . See figure 1 legend for expansion of abbreviation . In - hospital mortality was significantly higher for pah - related hospitalizations compared with pah - unrelated hospitalizations (5.4% vs 1.4%, p = .024) (table 3). Among those discharged alive following first - time hospitalization, the survival estimate at 3 years postdischarge was lower for patients with pah - related hospitalization than for patients with pah - unrelated hospitalization (56.8% 3.5% vs 67.8% 3.6%, p = .037) (fig 3a). Among patients who remained hospitalization - free for 1 year postenrollment, survival after 3 additional years of follow - up was 77.8% 1.9% (fig 3b). A, b, kaplan - meier estimates of survival for (a) patients with a first - time hospitalization from time of discharge, by type of hospitalization; and (b) patients with no hospitalization in the first year of follow - up (including patients with no hospitalizations and patients with first - time hospitalizations occurring after the first year of follow - up) from 1 y after enrollment . The reveal registry represents the largest database so far of patients newly diagnosed with pah (who group 1) analyzed for characteristics of first - time hospitalization . The burden of disease in patients with pah is substantial, as evidenced by the high incidence of hospitalization (57%) in this cohort of patients with newly diagnosed disease from the prospective reveal registry . Our findings clearly demonstrate that all - cause hospitalization is very common among patients with newly diagnosed disease . In particular, the rate of pah - unrelated hospitalizations in this reveal registry cohort is relatively high, suggesting that the term pah - unrelated is a misnomer and that this category of hospitalization actually reflects a degree of risk conferred by the pah comorbidity . For example, a primary discharge diagnosis of pneumonia on the case report form would result in a categorization of that patient s hospitalization as pah - unrelated . However, if pah predisposes the patient to non - line - related infections such as pneumonia or if an infection such as pneumonia were to precipitate congestive heart failure, then one could argue that the hospitalization is truly pah related . Although 53% of patients had first - time hospitalizations that were clearly related to pah, it is unclear what proportion of so - called pah - unrelated hospitalizations were truly incidental or precipitated by the pah comorbidity to some extent . Patients in this analysis who were hospitalized for any reason had a higher prevalence of comorbidities and more severe pah at enrollment, as measured by functional class, pericardial effusion, mean right atrial pressure, and reveal registry risk score, compared with patients without hospitalizations . Fewer differences at enrollment distinguished between patients with pah - related and pah - unrelated hospitalizations, although patients with pah - related hospitalizations presented with more severe pah at the time of first admission . The lack of differences between the pah - related and pah - unrelated groups at enrollment is an important point, given our finding that both in - hospital and postdischarge survival are significantly worse for patients hospitalized for pah - related reasons, despite the similar frequencies at which pah - related and pah - unrelated hospitalizations occur . The worse outcomes were seen in the pah - related group despite> 46% use of parenteral prostanoids at the time of the first hospitalization compared with 22% in the pah - unrelated group . Hospital readmission is common for patients with pah, especially those whose first hospitalization was pah related . Only 25.4% of patients discharged after a pah - related hospitalization remained free from readmission 3 years later . Furthermore, hospitalization for any cause increases overall risk of death, an association that has been documented previously . Even for patients with no hospitalizations in the first year after enrollment, almost one - half experience at least one hospitalization over the subsequent 3 years, despite treatment of pah, indicating that surviving the first year hospitalization - free does not strongly relate to the likelihood of future hospitalization . Mean total hospital days in the year after first admission (inclusive of first admission) for all patients with at least one hospitalization was 15.3 days (median, 7.0 days), which represents a significant burden for both the health - care system as a whole and for individual patients . For our analysis, we did not evaluate the burden of cost for pah - related hospitalization . One retrospective study estimated total per - patient per - month costs (including inpatient and outpatient costs) at $4,021 for patients with pah . Extrapolating from that figure, we calculate that total costs for pah were about $188 million in 2012 (assuming a prevalence of 12.4 cases per million and 313.9 million people in the united states in 2012). Based on the attention currently paid to left - sided heart failure by regulatory and reimbursement third parties, for which total costs are estimated at $30 billion in the united states in 2013, one might expect similar emphasis to be directed at pah - related hospitalizations, particularly those for heart failure . First, the analysis presented here was retrospectively determined and may be limited by the biases inherent to any analysis that is not fully prespecified prospectively before the data are collected . We chose to focus on patients with newly diagnosed disease to minimize survivor bias, but it must be noted that there was, typically, a delay of about 1 month between diagnosis and enrollment . Perhaps more importantly, at the time of the first hospitalization, patients no longer had newly diagnosed disease, but rather those results should be generalized to patients being discharged after their first postdiagnosis hospitalization . Second, the categorization of hospitalization as pah related or unrelated was made based on specific retrospective data available from the case report form, and in 42 cases (16.3%) of hospitalization causality related to pah could not be determined . Access to full patient charts was not available at the time of investigator review of the data . For example, placement or removal of a central venous catheter may overlap with some of the overlap was mitigated by ensuring that the category pah - unrelated infection excluded both (pah - unrelated hospitalization), so that these three categories of infection were considered separately . Fourth, the significantly longer period of follow - up for patients with hospitalizations, compared with patients without hospitalizations, may be a source of bias, since the likelihood of a hospitalization event increases with time . Pah is associated with a considerable burden of disease (as measured by all - cause hospitalization). Patients who are more severely ill (ie, with more severe pah or multiple comorbidities) are at higher risk for all - cause hospitalization . The degree of freedom from hospitalization is very poor after the first hospitalization, regardless of the cause . Prognosis is relatively better for patients with no hospitalizations in the first year or first hospitalization occurring after 1 year, but it nevertheless remains poor.
Idiopathic intracranial hypertension (iih), previously termed pseudotumor cerebri and benign intracranial hypertension, is a syndrome of increased intracranial pressure (icp) of unknown etiology, without clinical, laboratory or radiological evidence of intracranial pathology . While the exact pathogenesis remains unclear, the chronic increased icp in this condition may lead to morphological intracranial changes . Though traditionally performed to exclude lesions that produce intracranial hypertension, imaging in recent years has been shown to detect changes involving the orbit, sella and sinovenous system, providing important clues to the diagnosis . We describe the case of a lady with chronic headache, where magnetic resonance imaging (mri) showed features suggestive of iih, and in addition, highlight the dramatic reversal of these findings following csf drainage, allowing diagnosis to be made with certainty . A 45-year - old housewife presented to the neurology outpatient department with chronic headache for 10 years and recent aggravation for 1 month . Though she ignored these symptoms for long, they now hampered her daily household activities . Ophthalmological examination showed 6/6 vision in both the eyes, a normal fundus and no visual field defect on perimetry . Saggital oblique images through the optic nerve revealed distended perioptic subarachnoid space as well as buckling of the orbital portion of the optic nerve [figure 1a]. A partial empty sella with postero - inferiorly compressed pituitary having a concave superior border and posteriorly displaced infundibulum was also noted [figure 2a]. Tof venography showed paucity of the cortical veins and non - visualization of the right transverse sinus (ts) [figure 3a]. Lumbar puncture (lp) done following the mr study showed raised opening pressure of csf of 28 cm of water . Twenty milliliters of csf fluid was removed and sent for biochemical and microbiological examination, which was normal . Following csf withdrawal, significant improvement in symptoms was noted . Repeat mri done 3 days later showed straightening of the intraorbital optic nerve and reduction in perioptic subarachnoid space [figure 1b]. In addition, restoration of the infundibular position with a normal appearing pituitary having a flat superior margin was seen [figure 2b]. Mr tof showed improved visualization of the cortical veins and right ts [figure 3b]. The patient was discharged on acetazolamide, and on follow - up at 2 and 6 months, was asymptomatic . T2 fat saturated oblique saggital image through the optic nerve (a, b) shows the optic nerve buckling with prominent perioptic subarachnoid space (a). Post - lp, the optic nerve straightens with some reduction in the perioptic fluid (b) saggital images of the sella show " partial empty sella " (a), which, following csf drainage, is normalized (b) paucity of the cortical veins and non visualized right transverse sinus (a) is reversed following csf drainage with distension of the sinuses and better visualization of the cortical veins (b) in this tof venogram . Possible explanations suggest a lesion of the hematoencephalic barrier with increased interstitial fluid . Increased movement of the interstitial fluid into the ventricles with equivalent resorption of csf and subsequent rapid venous efflux maintains the flow of intracranial fluids, allowing for the raised icp . Changes observed in the orbit in iih are a consequence of the direct transmission of the raised csf pressure . These may be appreciated on mr imaging as prominent perioptic subarachnoid space and vertical orbital optic nerve tortuousity . Additional orbital findings include intraocular protrusion of the prelaminar optic nerve and posterior scleral flattening . With severe or chronic pressure, permanent degeneration of varying degrees similarly, owing to the progressive rise of pressures in patients with iih, sellar changes may be seen . Results from arachnocele herniation through a defect in the diaphragma sella with subsequent pituitary compression and posterior infundibular stalk displacement . Acetazolamide and other diuretics including furesemide have been used in the medical management of iih . Lumboperitoneal shunting may be required in cases unresponsive to medication, while patients with deteriorating vision may need optic nerve sheath fenestration . Both the orbital and pituitary changes have shown reversibility following csf drainage . This dramatic flip - flop with straightening of the optic nerve, normalization of the pituitary appearance and restoration of the pituitary stalk position was similarly observed in our patient following the lp.cc mr imaging in iih may additionally show bilateral ts narrowing which may cause venous outflow obstruction . Whether the ts narrowing is the cause or effect is still uncertain . Theories have implicated congenital stenosis as the occasional primary cause of iih . As an effect of iih, stenosis may present either as a long, smooth, tapered narrowing attributed to cerebral baedema, or as an fd raised csf pressures . Venography in our patient showed paucity of the cortical veins in the pre - lp mr with improved visualization post - lp . Rohr et al, proposed mrv pre- and post - csf diversion in suspected iih patients to distinguish reversible and fixed transverse sinuses stenosis . In conclusion, mr imaging has an important role in evaluation and follow - up of patients with iih, avoiding repeated lumbar punctures to monitor pressures . Signs in iih involving the optic nerve, posterior sclera, pituitary, and sinovenous system are a direct consequence of the longstanding raised icps in this disease . The reversibility of these signs on mr and tof venogram following csf drainage not only confirms the diagnosis of iih but also suggests a decrease in csf pressure indicating a positive response to therapy . In addition, it also aids in differentiating venous sinus thrombosis from reversible stenosis in iih.
Schizophrenia, affecting around 1% of the population, is a severe disorder involving chronic or recurrent psychosis and long - term deterioration in functional capacity (1). The characteristic onset of schizophrenia in early adulthood, its lifelong course, and debilitating symptoms, plus its high burden on caregivers and the society make it one of the most disabling and economically catastrophic disorders (1). Despite the improvement of antipsychotic medications, as the main - stay of treatment for patients with schizophrenia, the symptom response is not always optimal, side - effects are frequent, and treatment adherence is often poor (2 - 4). Therefore, still a large number of studies are ongoing for identifying new drugs of different classes that may be effective in the treatment of schizophrenia (2). Zinc (zn) is the second most abundant trace element in the body after iron (5). It is essential for over 300 processes such as enzymatic catalysis, gene transcription, gene expression, dna replication, protein synthesis, tissue repair, and hormonal storage (6, 7). It is required for development of the brain and also for its function; zn deficiency can cause neuronal damage (9 - 11). While zn deficiency is reported in patients with alzheimer s disease (ad), cognitive improvement has also been demonstrated in these patients after supplementation with zn in some preliminary studies (11). Some studies, however, few in number, have also shown the efficacy of zn in improvement of attention deficit hyperactivity disorder (adhd) in children and adolescents (12 - 14). Antidepressant effects of zn have also been reported in a number of experimental and some clinical studies (15, 16). Moreover, effects of adjuvant zn therapy in the treatment of obsessive - compulsive disorder (ocd) have been reported as well (6). There is growing the body of evidence implicating over activation of n - methyl - d - aspartate (nmda) receptors in the pathophysiology of schizophrenia (17, 18). Moreover, zn can modulate fast excitatory transmission by a number of mechanisms (19), suppress the increase in extracellular glutamate (19), and inhibit nmda receptors (16). It can also facilitate the release of gamma - amino butyric acid (gaba) (6, 19, 20). Evidences of gabaergic involvement in the pathophysiology of schizophrenia have also been discussed in several studies (21 - 23). There are also many findings implying cholinergic dysfunction in schizophrenia (25, 26). In one study, the concentration of zn in scalp hair of patients with schizophrenia was significantly lower than that in healthy volunteers (27). Reduced serum zn levels have also been reported in patients with schizophrenia (28). Zinc supplements are commonly used to alleviate a number of conditions, including zn deficient states, such as diarrhea, age - related macular degeneration, and wound healing (5). To the best of our knowledge, thus far, the efficacy of zn in the treatment of schizophrenia has not been investigated in clinical trials . The purpose of the present study was to assess the efficacy of zn sulfate as an adjuvant therapy in the treatment of schizophrenia in a 6-week, double - blind, and placebo - controlled trial . This randomized, double - blind, placebo - controlled trial was undertaken in zare psychiatric hospital affiliated to the mazandaran university of medical sciences in sari city, iran . This trial is registered with the iranian clinical trials registry (irct registration number: 138801241457n3). The trial was performed in accordance with the ethical standards laid down in the 1995 declaration of helsinki (as revised in edinburgh 2000). All patients and their legally authorized representatives were informed that they could withdraw from the experiment at any time . All of them signed an informed consent form prior to their inclusion in the study . The protocol was approved by the appropriate ethics committee on human experimentation of the mazandaran university of medical sciences . All participants were inpatients, in the active phase of the disorder, who met diagnostic and statistical manual of mental disorders, fourth edition, text revision (dsm - iv - tr) criteria for schizophrenia . A minimum score of 80 on the positive and negative syndrome scale (panss) was required for entering the study . Complete blood count, liver enzymes, and creatinine tests, plus electrocardiography were undertaken at baseline . In addition, a urine test was performed to detect morphine and/or cannabis in urine samples of the patients at baseline . The exclusion criteria included any severe medical conditions (e.g. Cardiovascular, renal, hepatic, pulmonary, metabolic, endocrine diseases, or immune system disorders), active peptic ulcer, any clinically significant neurological disorder, current or previous history of psychiatric disorders other than schizophrenia, current substance use or history of substance dependency, history of allergy to zn or multidrug reaction, taking any medication during the study (except for risperidone, trihexyphenidyl, and lorazepam). Pregnant or lactating women and those of reproductive age without using at least one medically accepted mean of birth control were also excluded . Three of them were not eager to enter the trial, and nine other patients excluded due to different conditions including four with the history of drug dependency, two due to abnormal liver enzyme levels, one due to cardiac arrhythmias, one having blood in the urine sample, and another patient who had skin sensitivity . Thirty of the screened patients (male / female = 28/2, age range of 18 - 65 year old) who met the inclusion criteria and did not meet the exclusion criteria of the trial entered the study . The patients did not receive antipsychotics from a week prior to entering the trial or depot antipsychotics at least 2 months before the study . Risperidone (produced by sobhan pharmaceutical company) was administered in all patients as their standard antipsychotic treatment . It was started with 1 mg twice daily and titrated up to 6 mg / day in all patients during the week . Participants were randomly allocated into two equal groups (n = 15); to one group received risperidone 6 mg / day plus capsules of zn sulfate 220 mg (each containing 50 mg elemental zn) three times a day and another group received risperidone 6 mg / day plus identical placebo capsules three times a day for 6 weeks . Placebo capsules were prepared in the pharmaceutical sciences laboratory of pharmacy school, mazandaran university of medical sciences . Patients also received trihexyphenidyl if they faced extrapyramidal symptoms and they received lorazepam in case of agitation or insomnia . The panss was applied to assess the psychotic symptoms at baseline and week 2, 4, and 6 of the study by a trained third - year resident of psychiatry . The panss is a common scale in the assessment of schizophrenia including 30 items, which measures both positive and negative symptoms, as well as general psychopathology by means of a semistructured patient interview . Intensity of each item will be identified by scoring from 1 to 7 in a manner that more severe symptoms get higher scores (29). The panss supplemental aggression risk subscale was also used to evaluate the aggression risk in patients at the same times that the panss was applied (30). The mean decrease in panss score from baseline there was no significant difference in psychotic symptoms of two groups of patients according to the panss scores at baseline (p> 0.05). We were aware of zn sulfate possible side effects and were looking for them in patients . So far, the only side - effect of zn sulfate that has been reported to occur significantly more than placebo is a metallic taste (14, 31). Gastrointestinal discomfort (nausea, vomiting, abdominal pain, and diarrhea) has also been reported with the same rate as placebo (14, 31). Skin dermatitis caused by the zn element of dental fillings has been reported before (32). In the present study, side - effects reported either by the patients or the nurses in the psychiatric ward were recorded . Only one patient in zn sulfate group withdrew from the trial due to generalized maculopapular reaction . Eligible participants were stratified based on age (<25, 25 - 45, or 45 years old), gender (male, female), and subtype of schizophrenia (paranoid or nonparanoid). Then, by 1:1 ratio using a computer generated code the patients were assigned to receive either zn sulfate or placebo ., a person who administrated the medications, the panss rater, and the patients were all blind to the assignments . For descriptive analysis of data, statistical indicators like mean and standard deviation (sd) were used, and the repeated measure analysis of variance (anova) (time - treatment interaction) was used to assess the effects of treatment . Two groups were considered as the between - subjects factor and four measurements during treatment were considered as the within - subjects factor (time). This was done for positive, negative, general psychopathology subscale, total panss, and supplemental aggression risk scores . California, usa) was used to analyze, graph and present scientific data . Differences with p this randomized, double - blind, placebo - controlled trial was undertaken in zare psychiatric hospital affiliated to the mazandaran university of medical sciences in sari city, iran . This trial is registered with the iranian clinical trials registry (irct registration number: 138801241457n3). The trial was performed in accordance with the ethical standards laid down in the 1995 declaration of helsinki (as revised in edinburgh 2000). All patients and their legally authorized representatives were informed that they could withdraw from the experiment at any time . All of them signed an informed consent form prior to their inclusion in the study . The protocol was approved by the appropriate ethics committee on human experimentation of the mazandaran university of medical sciences . All participants were inpatients, in the active phase of the disorder, who met diagnostic and statistical manual of mental disorders, fourth edition, text revision (dsm - iv - tr) criteria for schizophrenia . A minimum score of 80 on the positive and negative syndrome scale (panss) was required for entering the study . Complete blood count, liver enzymes, and creatinine tests, plus electrocardiography were undertaken at baseline . In addition, a urine test was performed to detect morphine and/or cannabis in urine samples of the patients at baseline . The exclusion criteria included any severe medical conditions (e.g. Cardiovascular, renal, hepatic, pulmonary, metabolic, endocrine diseases, or immune system disorders), active peptic ulcer, any clinically significant neurological disorder, current or previous history of psychiatric disorders other than schizophrenia, current substance use or history of substance dependency, history of allergy to zn or multidrug reaction, taking any medication during the study (except for risperidone, trihexyphenidyl, and lorazepam). Pregnant or lactating women and those of reproductive age without using at least one medically accepted mean of birth control were also excluded . Three of them were not eager to enter the trial, and nine other patients excluded due to different conditions including four with the history of drug dependency, two due to abnormal liver enzyme levels, one due to cardiac arrhythmias, one having blood in the urine sample, and another patient who had skin sensitivity . Thirty of the screened patients (male / female = 28/2, age range of 18 - 65 year old) who met the inclusion criteria and did not meet the exclusion criteria of the trial entered the study . The patients did not receive antipsychotics from a week prior to entering the trial or depot antipsychotics at least 2 months before the study . Risperidone (produced by sobhan pharmaceutical company) was administered in all patients as their standard antipsychotic treatment . It was started with 1 mg twice daily and titrated up to 6 mg / day in all patients during the week . Participants were randomly allocated into two equal groups (n = 15); to one group received risperidone 6 mg / day plus capsules of zn sulfate 220 mg (each containing 50 mg elemental zn) three times a day and another group received risperidone 6 mg / day plus identical placebo capsules three times a day for 6 weeks . Placebo capsules were prepared in the pharmaceutical sciences laboratory of pharmacy school, mazandaran university of medical sciences . Patients also received trihexyphenidyl if they faced extrapyramidal symptoms and they received lorazepam in case of agitation or insomnia . The panss was applied to assess the psychotic symptoms at baseline and week 2, 4, and 6 of the study by a trained third - year resident of psychiatry . The panss is a common scale in the assessment of schizophrenia including 30 items, which measures both positive and negative symptoms, as well as general psychopathology by means of a semistructured patient interview . Intensity of each item will be identified by scoring from 1 to 7 in a manner that more severe symptoms get higher scores (29). The panss supplemental aggression risk subscale was also used to evaluate the aggression risk in patients at the same times that the panss was applied (30). The mean decrease in panss score from baseline there was no significant difference in psychotic symptoms of two groups of patients according to the panss scores at baseline (p> 0.05). We were aware of zn sulfate possible side effects and were looking for them in patients . So far, the only side - effect of zn sulfate that has been reported to occur significantly more than placebo is a metallic taste (14, 31). Gastrointestinal discomfort (nausea, vomiting, abdominal pain, and diarrhea) has also been reported with the same rate as placebo (14, 31). Skin dermatitis caused by the zn element of dental fillings has been reported before (32). In the present study, side - effects reported either by the patients or the nurses in the psychiatric ward were recorded . Only one patient in zn sulfate group withdrew from the trial due to generalized maculopapular reaction . Eligible participants were stratified based on age (<25, 25 - 45, or 45 years old), gender (male, female), and subtype of schizophrenia (paranoid or nonparanoid). Then, by 1:1 ratio using a computer generated code the patients were assigned to receive either zn sulfate or placebo . The assignments were kept in sealed opaque envelopes until data analysis . Throughout the study, a person who administrated the medications, the panss rater, and the patients were all blind to the assignments . For descriptive analysis of data, statistical indicators like mean and standard deviation (sd) were used, and the repeated measure analysis of variance (anova) (time - treatment interaction) was used to assess the effects of treatment . Two groups were considered as the between - subjects factor and four measurements during treatment were considered as the within - subjects factor (time). This was done for positive, negative, general psychopathology subscale, total panss, and supplemental aggression risk scores . Graphpad prism software version 5 (graphpad software inc ., california, usa) was used to analyze, graph and present scientific data . Differences with p from a total of 42 patients screened for the study, 30 cases were randomly allocated into two groups for trial medication (15 patients in each group) (figure 1). No significant difference was found between patients randomly assigned to zn or placebo group regarding basic demographic data including age, gender, marital status, level of education, and subgroup of schizophrenia (table 1). The mean standard deviation of positive symptoms scale, negative symptoms scale, the general psychopathology scale, total panss score, and the supplemental aggression risk subscale of two groups of patients are shown in table 2 . There were no significant differences between the two groups at week 0 (baseline) on positive symptoms on panss (p = 0.55), negative symptoms on panss (p = 0.62), general psychopathology on panss (p = 0.69), and panss total score (p = 0.48). Moreover, there was no significant difference between the two groups at baseline regarding risk of aggression (p = 0.12). The differences between the two groups on the positive scale, negative scale, the general psychopathology scale, total panss score, and the panss supplemental aggression risk subscale scores are demonstrated in figures 2 - 6, respectively . P = 0.007, p = 0.001, p = 0.040, different from control groups (* not significant). P = 0.002, p = 0.020, different from control groups (* not significant). P = 0.001, p = 0.033, different from control groups (* not significant). P = 0.002, p = 0.001, different from control groups (* not significant). From a total of 42 patients screened for the study, 30 cases were randomly allocated into two groups for trial medication (15 patients in each group) (figure 1). No significant difference was found between patients randomly assigned to zn or placebo group regarding basic demographic data including age, gender, marital status, level of education, and subgroup of schizophrenia (table 1). The mean standard deviation of positive symptoms scale, negative symptoms scale, the general psychopathology scale, total panss score, and the supplemental aggression risk subscale of two groups of patients are shown in table 2 . There were no significant differences between the two groups at week 0 (baseline) on positive symptoms on panss (p = 0.55), negative symptoms on panss (p = 0.62), general psychopathology on panss (p = 0.69), and panss total score (p = 0.48). Moreover, there was no significant difference between the two groups at baseline regarding risk of aggression (p = 0.12). The differences between the two groups on the positive scale, negative scale, the general psychopathology scale, total panss score, and the panss supplemental aggression risk subscale scores are demonstrated in figures 2 - 6, respectively . P = 0.007, p = 0.001, p = 0.040, different from control groups (* not significant). P = 0.002, p = 0.020, different from control groups (* not significant). P = 0.001, p = 0.033, different from control groups (* not significant). P = 0.002, p = 0.001, different from control groups (* not significant). Schizophrenia is estimated to be the 8th leading cause of disability - adjusted life years worldwide in the age group 15 - 44 years (1). It is characterized by a diverse range of symptoms, including positive symptoms (such as hallucinations and delusions), negative symptoms (such as social withdrawal and diminished affective responsiveness), and cognitive deficits (33). Its treatment involves a combination of psychosocial rehabilitation and pharmacotherapy (3). Despite the improvement of antipsychotics, treatment of schizophrenia thus, several studies are ongoing for identifying drugs of different classes, other than dopamine antagonists, that may enhance the response to antipsychotics, or that may even have efficacy as monotherapy (2, 17, 34). The results obtained in the present trial demonstrate that adding zn to an atypical antipsychotic regimen is effective in the improvement of symptoms of schizophrenia and risk of aggression in patients with schizophrenia . Both studied groups, treated with risperidone during the 6-week trial, showed a significant improvement on panss total score and on its all subscales as well as the supplemental aggression risk subscale . The zn group had significantly greater improvement in total score of panss, positive and negative symptoms, and risk of aggression over the 6-week trial . Baseline characteristics of patients including sex, age, marital status, level of education, and subgroup of schizophrenia did not differ between the groups; thus, cannot explain differences in the therapeutic outcome . To the best of our knowledge, this study was the first double - blind and placebo - controlled clinical trial investigating the efficacy of zn in the treatment of schizophrenia . Complementary medicines, such as trace element supplements, can be assumed as proper candidates for investigation in chronic psychiatric disorders due to lower risk of side - effects as well as better acceptance among people (35). Zinc is an essential trace element in the body (6, 7), which is required for development of the brain and also for its function (9 - 11). So far, positive effects of supplemental zn on depression (15, 36, 37), ocd (6), adhd (14, 31), and ad (11) have been reported in other studies . To the best of our knowledge, there is no report of kinetic interactions between zn sulfate and risperidone . This leads us to assume that the therapeutic effect observed by zn sulfate on symptoms of schizophrenia is likely to result from a pharmacodynamic mechanism . It has been reported that zn serves as an endogenous neuromodulator of several important transmitters (19) and this role can be used for explaining its mechanism of action in the improvement of schizophrenia . There is growing the body of evidence implicating glutamatergic system in the pathophysiology of schizophrenia (4, 17, 18, 38). Along with the studies reporting the efficacy of nmda receptor allosteric agonists at the glycinb site in schizophrenia (4) some scientists have hypothesized the possible efficacy of nmda antagonists in this disorder (4, 39). A preliminary study has even shown the probable efficacy of memantine as a noncompetitive nmda antagonist in improvement of schizophrenia (39). Also, zn can modulate fast excitatory transmission by a number of mechanisms (19). It suppresses the increase in extracellular glutamate (19) and inhibits nmda receptors (16). An ex - vivo study has suggested that low - affinity nmda receptor antagonists might even interact with dopamine receptors by binding the dopamine transporters (40). Evidences of gabaergic involvement in the pathophysiology of schizophrenia have also been discussed in several studies (22, 23). However, a recent meta - analysis did not find significant therapeutic benefits in addition of benzodiazepines to the antipsychotic regimen of schizophrenic patients (41). In a small preliminary randomized trial, selective benzodiazepine acting at the gabaa receptor improved working memory in patients with schizophrenia (22). Although a similar investigation in a greater sample size showed only little benefit of that prodrug, this receptor remains a promising target (42). Moreover, zn facilitates the release of gaba (6, 19, 20) and may improve symptoms of schizophrenia via this mechanism . There are also many findings implying cholinergic dysfunction in schizophrenia (25, 26, 43). In two preliminary studies, a cholinergic nicotinic partial agonist (25) and muscarinic cholinergic agonist (43) showed some efficacy in improving symptom scores and cognition in patients with schizophrenia, which the results are in line with ours . The impact of zn on improvement of negative symptoms of schizophrenia can also be due to its antidepressant implications, which have been reported in previous studies (15, 36, 37). Zinc also has antioxidant properties (5, 8), which can be considered as another explanation for its effectiveness in schizophrenia . There are studies reporting increased production of reactive oxygen or decreased antioxidant protection in patients with schizophrenia that strengthen the hypothesis suggesting the role of excessive free radical production or oxidative stress in the pathophysiology of this disorder (33). In one study, the concentration of zn in scalp hair of schizophrenic patients was significantly lower than that in healthy volunteers (37). Reduced serum zn levels have also been reported in patients with schizophrenia (28). However, the extracellular zn concentration may not be a good indicator of zn concentration in the body (19). In our study, adding zn to risperidone was effective in reducing aggression . A study demonstrated that mean plasma zn values were significantly lower in criminal schizophrenic men compared with noncriminal subjects (44). Another study had also reported that blood copper / zn ratios in assaultive young males were high when compared to a control group of young males with no history of an assaultive behavior (45). Administration of 220 mg of zn sulfate three times a day was well - tolerated, and no major clinical side - effects were detected . However, due to the lack of systematic recording of side - effects during the trial, which should be considered as a shortcoming of this study, there may have been some missed side - effects that were neither reported by our patients nor observed by the nurses . Other limitations of the present study include using only one dose of zn sulfate, the small number of participants, short period of follow - up, and lack of a plasma zn concentration that all indicate the need for future studies . In line with our hypothesis, adding zn to an atypical antipsychotic was particularly effective in the improvement of positive and negative symptoms subscales on panss, general psychopathology subscale, and total score of panss as well as risk of aggression in patients with schizophrenia.
The findings reported here draw on answers to questions added to the two major cohort studies of hiv - positive people in ontario, the ontario hiv treatment network cohort study (ocs) (http://www.ohtncohortstudy.ca/) (n = 959) and the positive spaces, healthy places cohort study (pshp) (http://www.pshp.ca/) (n = 442) plus in - depth qualitative interviews with 122 ocs participants . Drawing from all three data sources allows for broad representation of people living with hiv in accord with the epidemiology of hiv prevalence in ontario as measured by risk group, age, gender, sexual orientation, and ethno - cultural origin . Of the 122 interviews, 8 were conducted in french in ottawa, the rest being in english in toronto (n = 93) and ottawa (n = 21) where 83% of hiv - positive people in ontario live . Ten interviews were with people who had some kind of direct experience with the criminal justice system either as complainants, defendants (including some who were convicted of charges related to non - disclosure or exposure to hiv), or former sex partners contacted by police for testimony in hiv - related trials . The cohort surveys asked study participants about their expectations of casual sexual partners to disclose to them and then of their own disclosure practices with partners . As well the pattern of response was then analyzed for variation by a range of demographic categories: age, ethnicity, language of interview, income, education, sexual orientation, gender, as well as having had a casual sexual partner in the previous three months . A subset of ocs study participants, broadly representative of the demographics of hiv prevalence in ontario, were then invited to be interviewed to gain further insight into perceptions of disclosure expectations and responsibilities . Questions asked about recent sexual interactions and the circumstances leading to (non)disclosure, as well as a subsequent specific question, there is a lot of debate about people s responsibility to disclose their hiv status . Do you think there are circumstances when someone with hiv should be charged with a crime, and perhaps sent to prison, for (a) having oral sex without a condom without telling?, (b) for having unprotected vaginal or anal sex without telling sexual partners he or she has hiv beforehand?, (c) for having unprotected sex with an undetectable viral load? Interviews were transcribed and examined for common themes using constant comparative analysis with nvivo software . The study proposal was reviewed in accord with the tri - council policy statement: ethical conduct for research involving humans by research ethics boards at the university of windsor and the university of ottawa . A community advisory committee with representatives from hiv - positive people, aids service, and legal organizations plus the provincial ministry of health assisted the development of the research project . An honorarium of $30 was provided to interview participants in recognition of time and travel expenses . Overall, study participants from the three data sources have the following demographic characteristics shown in table 1 . Questions added to the two large cohort studies show the expectations of people living with hiv regarding their disclosure to sexual partners and partners disclosure to them (table 2). Since ocs study participants could check off more than one rationale regarding the decision to disclose, the pattern of multiple responses was also examined . The most frequent overlap of responses was 15 of those who indicated it was not necessary to tell a partner because they had protected sex, also checked off that they tell some partners that they were hiv - positive but not others . Statistical analysis (pearson) of the pshp data reveals some variation in attitudes and practices in different populations . Overall 18.3% do not expect a sexual partner to disclose hiv status but this varies by sexual orientation with gay men having less expectation (26.7%), followed by bisexual men (23.1%), heterosexual men (10.0%), and finally heterosexual women having the greatest expectation that sexual partners will disclose (5.1%) (p = .015). The ocs data show a similar pattern but with even higher numbers of gay men not expecting disclosure: gay men (40.2%), bisexual men (27.6%), heterosexual men (11.5%), and heterosexual women (10.7%). This same variation is evident by ethnicity where a greater proportion of african, caribbean, and aboriginal populations are female or heterosexual when compared to white study participants . The expectation that sexual partners will not disclose is 20.3% among white people, 11.1% among african and caribbean people, and 8.9% among aboriginal people (p = .048). For the ocs, the comparable numbers are 33.3% among white people, 17.0% among african and caribbean people, and 25.0% among aboriginal people (p <.01). With hiv - negative partners and partners of unknown hiv status, 44.7% of pshp respondents told all partners that they are hiv - positive, while 32.4% had no partners of this type (48% of ocs respondents report no partners who were hiv - negative or of unknown status). Between 1 and 9% report alternative strategies to disclosure, including not telling any partners, telling some partners, and dropping hints about hiv status . Others feel it is unnecessary to tell because they had protected sex, because partners should presume everyone is positive, because a partner was willing to have unprotected sex, or because it is a partner s responsibility to use a condom if he or she wants to . Between 3 and 6% unemployed respondents in the pshp cohort are more likely not to disclose (10.3%, p = .008), to drop hints (8.5%, p = .016), to feel disclosure is unnecessary with protected sex (15.4%, p = .009), and to be afraid to disclose (21.4%, p = .003). Gay and bisexual men are a little more likely to disclose to only some partners (bisexual 19.2%, gay 11.3%, p = .020), to drop hints (gay 7.2%, p = .047), and to feel disclosure is unnecessary with protected sex (12.0%, p = .031). Compared to those without casual partners, respondents with casual partners are more likely to tell only some partners (13.9%, p <.0001), feel it is unnecessary to disclose with protected sex (16.4%, p <.0001), feel it is unnecessary to disclose because a partner should presume everyone is positive (8.0%, p = .002), because a partner is willing to have unprotected sex (5.5%,p = .013), or because it is a partner s responsibility to use a condom (7.5%, p <.0001). This finding is comparable to a recent study in british columbia that found lower rates of disclosure among those reporting sex with a stranger (hirsch allen et al ., 2014). Most hiv - positive people in this survey, then, either disclose to, or do not have, partners who are hiv - negative or of unknown status . Non - disclosure strategies and assumptions are reported by relatively small sets of people with some variation according to employment status, sexual orientation, gender, ethnicity, and having had a casual partner . How these disclosure strategies work in everyday life is revealed in interviews where context and conflicting dynamics create situations that prove difficult to navigate . Several people articulate the double bind created by the obligation to disclose and fear of rejection, leading to emotionally fraught choices in deciding to disclose . One interviewee, who was prosecuted for non - disclosure, reflects on the tension inherent in disclosure decisions.i went through a depression because now i was totally alone . I do nt remember how many women, but a number of women for many years and i did nt tell them well after i found out i was positive, it was hard for me to disclose . I felt if i told anybody that i would be judged and nobody would want to be close to me again . It took me a couple years of program to realize that was a very selfish move i was afraid i was going to lose her and i did nt want to tell her . I did nt know what to tell her and i did nt want to because i was afraid if i told her, you ll walk away, you ll never see me again and i would lose and i was nt trying to get you sick like me or trying to get you infected or anything . I do nt remember how many women, but a number of women for many years and i did nt tell them well after i found out i was positive, it was hard for me to disclose . I felt if i told anybody that i would be judged and nobody would want to be close to me again . It took me a couple years of program to realize that was a very selfish move i was afraid i was going to lose her and i did nt want to tell her . I did nt know what to tell her and i did nt want to because i was afraid if i told her, you ll walk away, you ll never see me again and i would lose and i was nt trying to get you sick like me or trying to get you infected or anything . (041, african / caribbean, heterosexual, male, 40s) others experience disclosure as an obligation that runs against a tacit norm of silence around hiv questions: a few times i have disclosed or they ve asked me flat out, are you positive or negative? And i will tell them but often it s not discussed . Guys do nt want to talk about it, whether they re positive or negative . It kind of kills the romance or the sort of kind of hotness of the potential for getting together . (013, white, gay, male, 50s) as far as i can see, from people i ve talked to, i d say 99.9% of the people never tell anyone they re positive, unless they re asked . (011, white, gay, male, 50s) a few times i have disclosed or they ve asked me flat out, are you positive or negative? And i will tell them but often it s not discussed . Guys do nt want to talk about it, whether they re positive or negative . It kind of kills the romance or the sort of kind of hotness of the potential for getting together . (013, white, gay, male, 50s) as far as i can see, from people i ve talked to, i d say 99.9% of the people never tell anyone they re positive, unless they re asked . (011, white, gay, male, 50s) the result is a tendency to engage in a tacit dance of assumptions and intuitions, along with reading of context, in order to assess the viability of disclosure in personal interactions.the last time was in a bathhouse situation . Although we did nt exchange words in the situation, we both kind of knew where we were coming from . (006, african / caribbean, gay, male, 40s) the last time was in a bathhouse situation . So there was already a bit of a connection . Although we did nt exchange words in the situation, we both kind of knew where we were coming from . (006, african / caribbean, gay, male, 40s) considerable effort may go into testing the waters to determine how understanding the other person may be . One study participant describes the disclosure process as one of feeling under siege in a context where disclosure may elicit a stigmatizing reaction.the whole night i talked about fashion cares, hiv, act [aids committee of toronto], me doing outreach . (i: like you did as much as possible without saying it to infer that you were?) It might sound like beating around the bush but i really did kind of like i mean do i have to fucking write it on my forehead for real? I probably told more before but now, i m very wary because i do nt know sometimes when i m chatting to somebody i ll kind of drop some hints and if they do nt seem to pick it up, then i ll just walk away because i ll say, well i do nt think this person is positive, so you know what, i m just going to leave it people who are hiv that i ve had discussions with, also feel under siege and maybe less likely to bring up some things or just to look for totally anonymous sex where not even your name is asked . (078, white, gay, male, 40s) the whole night i talked about fashion cares, hiv, act [aids committee of toronto], me doing outreach . (i: like you did as much as possible without saying it to infer that you were?) It might sound like beating around the bush but i really did kind of like i mean do i have to fucking write it on my forehead for real? (054, white, gay, male, 50s) i probably told more before but now, i m very wary because i do nt know sometimes when i m chatting to somebody i ll kind of drop some hints and if they do nt seem to pick it up, then i ll just walk away because i ll say, well i do nt think this person is positive, so you know what, i m just going to leave it people who are hiv that i ve had discussions with, also feel under siege and maybe less likely to bring up some things or just to look for totally anonymous sex where not even your name is asked . (078, white, gay, male, 40s) for some, reading the situation, especially in a gay context where men are presumed to be largely in the know about hiv issues, can lead to the inference that the other may also be an hiv - positive man who is cautious about disclosing.if someone wants to do something unprotected, that s a big signal . It s someone s telling you (pause) by action, not verbally, that they are hiv . (022, white, gay, male, 40s)from a gay s perspective, we know generally, you know, when i do nt ask or they do nt ask, it s a given we re both hiv and we re going to have probably unprotected sex if he says, i ll only play wrapped, then i will respect that and play wrapped . (069, white, gay, male, 40s) if someone wants to do something unprotected, that s a big signal . It s someone s telling you (pause) by action, not verbally, that they are hiv . (022, white, gay, male, 40s) from a gay s perspective, we know generally, you know, when i do nt ask or they do nt ask, it s a given we re both hiv and we re going to have probably unprotected sex if he says, i ll only play wrapped, then i will respect that and play wrapped . (069, white, gay, male, 40s) sometime tacit assumptions can lead to misunderstanding or to the perception of outright deception reported by some individuals as the circumstance that led to their own exposure to hiv: i asked him if he had ever been tested and like the phrasing i would have used was, are you clean? And then i went and got all my tests done and then he was like, i did that too. What the fuck, you did nt do it, do you know what i mean? And he did nt . (i: so then you just come back and you say, i m good?) I m good, now you want to because i was trying to go through all the like motions of like now we re going to be in this monogamous relationship . (073, white, queer, female, 20s)i went in for standard blood work because it s required by our insurance company and they said, well you re hiv - positive, and i said that s impossible because i ve only been playing around with two people and one is my partner of four years and the other one is a friend of ours . I found out he knew he had it and he s telling everybody he does nt . (018, white, gay, male, 40s) i asked him if he had ever been tested and like the phrasing i would have used was, are you clean? And then i went and got all my tests done and then he was like, i did that too. What the fuck, you did nt do it, do you know what i mean? And he did nt . (i: so then you just come back and you say, i m good?) I m good, now you want to because i was trying to go through all the like motions of like now we re going to be in this monogamous relationship . (073, white, queer, female, 20s) i went in for standard blood work because it s required by our insurance company and they said, well you re hiv - positive, and i said that s impossible because i ve only been playing around with two people and one is my partner of four years and the other one is a friend of ours . I found out he knew he had it and he s telling everybody he does nt . (018, white, gay, male, 40s) those interviewed for this study, then, point toward a number of circumstances and factors that make routine disclosure a complex and emotionally difficult accomplishment . Perhaps most fundamental is the difficulty of setting oneself up for rejection in the process of seeking affection and support . Some perceive that they are required to rupture a norm of silence or at least feel obliged to ease prospective partners into the realization that they may be positive . Disclosure is an undertaking fraught with emotional pitfalls complicated by personal histories of having misread cues or having felt deceived leading up to their own sero - conversion, then having to negotiate a stigmatized status with new people.whenever i tell somebody, the person run away so this creates a very huge problem for me . (023, latin american, heterosexual, male, 50s)i was raised a certain way and i got infected at the age of 18 . 15 years i ve had to deal with this, 15 years of being dumped because i disclosed or guys do nt want to be with me or you know, it hurts, it damn well hurts and i know it does . (055, white, gay, male, 30s) whenever i tell somebody, the person run away so this creates a very huge problem for me . (023, latin american, heterosexual, male, 50s) i was raised a certain way and i got infected at the age of 18 . 15 years i ve had to deal with this, 15 years of being dumped because i disclosed or guys do nt want to be with me or you know, it hurts, it damn well hurts and i know it does . Some seek to resolve disclosure problems by pursuing other hiv - positive people for sexual or romantic connection . At the same time, a good many express reluctance to have unprotected sex even with other hiv - positive people (adam, husbands, murray, & maxwell, 2005).my strain might be totally different than your strain and while i may pick up your strain and it may not cause me any further ill effects, it may produce a rather nasty new strain that i m capable of passing on or vice versa . Or it may have a hell of an impact on my drug regimen . (002, white, gay, male, 60s)i wo nt infect him with my hiv and i certainly do nt want to get infected with his hiv if i have to go on his medication at some point, i do nt want to be immune to it it pisses me off when they know they re hiv - positive and they re out there infecting person after person after person and they know it . (015, white, gay, male, 40s)if i have sex with somebody who is positive, i do nt want she s kind of virus, strain, to have it . (030, african / caribbean, heterosexual, male, 30s) my strain might be totally different than your strain and while i may pick up your strain and it may not cause me any further ill effects, it may produce a rather nasty new strain that i m capable of passing on or vice versa . Or it may have a hell of an impact on my drug regimen . (002, white, gay, male, 60s) i wo nt infect him with my hiv and i certainly do nt want to get infected with his hiv if i have to go on his medication at some point, i do nt want to be immune to it it pisses me off when they know they re hiv - positive and they re out there infecting person after person after person and they know it . (015, white, gay, male, 40s) if i have sex with somebody who is positive, i do nt want she s kind of virus, strain, to have it . (030, african / caribbean, heterosexual, male, 30s) others believe that when having sex with a partner who is also hiv - positive, safer sex is less of a concern or experience a sense of relief at no longer having to feel like a pariah.i got mixed up and had a bit of a crystal meth problem and through that, i met there s a whole community of guys who were just on disability, never worked, did nt seem to want to work again . I think part of it for me was just for so many years i had drummed into my head, you ve got to have safe sex, and then suddenly to me the whole group of people who you do nt feel like you re a pariah or everybody was just fine with it [unprotected sex]. (020, white, gay, male, 40s)i will admit to being fairly flexible or accommodating of the other person s wishes to go barrier free . It s probably reflective of the fact that condoms are nt a terrible amount of fun and i m guilty i guess of being all too happy to go along with it . (042, white, gay, male, 30s)online i ve already posted, so but generally i clarify like by the way, i m positive. If the [hiv - positive] person is open to not using condoms, that s their choice and i m not going to fight them on that . (089, asian, gay, male, 20s) i got mixed up and had a bit of a crystal meth problem and through that, i met there s a whole community of guys who were just on disability, never worked, did nt seem to want to work again . I think part of it for me was just for so many years i had drummed into my head, you ve got to have safe sex, and then suddenly to me the whole group of people who you do nt feel like you re a pariah or everybody was just fine with it [unprotected sex]. (020, white, gay, male, 40s) i will admit to being fairly flexible or accommodating of the other person s wishes to go barrier free . It s probably reflective of the fact that condoms are nt a terrible amount of fun and i m guilty i guess of being all too happy to go along with it . (042, white, gay, male, 30s) online i ve already posted, so most of the time they ve read it and sometimes they havent . But generally i clarify like by the way, i m positive. If the [hiv - positive] person is open to not using condoms, that s their choice and i m not going to fight them on that . (089, asian, gay, male, 20s) the pressure to disclose, then, produces a disparate array of effects in everyday interaction: heightened fear of rejection that makes disclosure even harder to accomplish, indirect or partial disclosure, readings of tacit signs and assumptions about partners sero - statuses, and avoidance of the need to disclose by pursuing other hiv - positive partners . Many study participants reflect on the meaning of responsibility in hiv exposure or transmission . For many, their sense of responsibility is consistent with a larger societal rhetoric of individualism, personal responsibility, consenting adults, and contractual interaction, a moral reasoning widely propagated by government and business today that constructs everyone as a self - interested individual who must take responsibility for himself in a marketplace of risks (adam, 2005).im an adult, they re an adult . You take responsibility for yourself and if you give me something, it s my own fault for having sex with you and not finding out . (011, white, gay, male, 50s)when people have sex, they should always protect themselves . You re responsible for yourself and that s why i do nt understand why they re being charged . (017, aboriginal, gay, male, 40s)you have to take some responsibility for your life some place . We ca nt have a nanny state where everything is just perfect you re not mentally incapable and you re not being raped and you re not being forced in to this; nobody is bending your arm . You re having sex because you want to have sex so why are you not taking care of yourself? (021, white, gay, male, 50s) i m an adult, they re an adult . You take responsibility for yourself and if you give me something, it s my own fault for having sex with you and not finding out . (011, white, gay, male, 50s) when people have sex, they should always protect themselves . You re responsible for yourself and that s why i do nt understand why they re being charged . (017, aboriginal, gay, male, 40s) you have to take some responsibility for your life some place . We ca nt have a nanny state where everything is just perfect you re not mentally incapable and you re not being raped and you re not being forced in to this; nobody is bending your arm . You re having sex because you want to have sex so why are you not taking care of yourself? (021, white, gay, male, 50s) many of the men interviewed articulated a strong sense of individual obligation where responsibility should not be conceived as exclusively or primarily a problem falling to hiv - positive people and that all have a responsibility for their own health.its a personal choice that you choose . You have to live by the consequences of our decisions right . That s the way i look at it . (024, african / caribbean, gay, male, 40s)i do nt think the onus should be on the person who s positive necessarily or the person who knows that they re positive . (054, white, gay, male, 50s)you know what decisions you take you have to be responsible yourself for your own decisions . I m not there to impose my thoughts on anybody he should nt go to prison for that . It s for the other person to force, the other person to say, put on a condom. (f14, white, gay, male, 30s) translated from french . You have to live by the consequences of our decisions right . That s the way i look at it . (024, african / caribbean, gay, male, 40s) i do nt think the onus should be on the person who s positive necessarily or the person who knows that they re positive . (054, white, gay, male, 50s) you know what decisions you take you have to be responsible yourself for your own decisions . I m not there to impose my thoughts on anybody he should nt go to prison for that . It s for the other person to force, the other person to say, put on a condom. (f14, white, gay, male, 30s) translated from french . It is noteworthy that male voices are strongly represented in these constructions of the self as an autonomous male actor responsible for protecting himself against hiv . In many ways, then, dominant discourses circulating in neoliberal societies provide moral precepts and rationales for individualized constructions of responsibility that preclude a need for disclosure, notions consistent with longstanding messaging on safe sex from aids service organizations to treat all prospective sex partners as potentially hiv - positive . Others express a sense of responsibility embedded in collective or interpersonal loyalties rather than individualism.i have no shame whatsoever . I am very open about it and it s the first thing i tell anybody . If they ask me, fine, or i ll mention it . I mention the fact i m gay, i mention the fact i m hiv - positive . The positive person is the responsible one 100% and the other person maybe 50 or 70% for the negative person for their responsibility too . (016, white, gay, male, 60s)what shocked me was the fact that somebody would have sex with another person without letting him or her know that they re hiv and that there s a possibility of transmission . I have a lover that i ve been with for 46 years and we still have sex . He is not hiv and he does not have hep c. we do it in such a way that there is no transmission or whatever of fluids, even though my counts in hiv have been undetectable for the last 8 or 10 years and now the hep c is down to supposedly zero . The fear of passing something on unknowingly or knowingly has become part of my life . (001, white, gay, male, 60s) i have no shame whatsoever . I am very open about it and it s the first thing i tell anybody . If they ask me, fine, or i ll mention it . I mention the fact i m gay, i mention the fact i m hiv - positive . The positive person is the responsible one 100% and the other person maybe 50 or 70% for the negative person for their responsibility too . (016, white, gay, male, 60s) what shocked me was the fact that somebody would have sex with another person without letting him or her know that they re hiv and that there s a possibility of transmission . I have a lover that i ve been with for 46 years and we still have sex . He is not hiv and he does not have hep c. we do it in such a way that there is no transmission or whatever of fluids, even though my counts in hiv have been undetectable for the last 8 or 10 years and now the hep c is down to supposedly zero . The fear of passing something on unknowingly or knowingly has become part of my life . (001, white, gay, male, 60s) a tension between individualized and collective notions of responsibility circulates through a number of the narratives, reflecting the lineaments of moral reasoning in the larger society (rangel & adam, 2014). Constructions of the self as individual actors in a marketplace of risk co - exist with the sexual etiquette developed in gay communities throughout the aids era of care of the self and other through safer sex (weeks, 1995). In casual sexual encounters, where partners may not be well known, marketplace presumptions come to the fore in a sexual field (green, 2014) characterized by brevity and anonymity . Combined with the difficulties of disclosure, individualized notions of responsibility may gain the upper hand . As court cases have acquired extensive media attention over the last decade, that coverage in turn has influenced the general public, risk populations, and hiv - positive people . The result has been a feedback loop, accelerating through the 2000s, where criminal prosecutions for failure to disclose hiv status have generated publicity that has implicitly instructed the public on how to respond to hiv . One participant in this study testifies thatmy ex was charged and he was found guilty (i: charged by you?) No it was really like the police that put it in my head to charge which was kind of like weird and fucked up . (073, white, queer, female, 20s) my ex was charged and he was found guilty (i: charged by you?) No it was really like the police that put it in my head to charge which was kind of like weird and fucked up . (073, white, queer, female, 20s) when official agencies like the police and public health put it in my mind to prosecute, then criminalization rises to the status of a primary response to hiv transmission rather than a recourse of last resort . At the same time, increasing reliance on the criminal justice system to enforce a principle of near universal disclosure of hiv - positive status, even when transmission is unlikely, presses hiv - positive people into an untenable double bind: they must place themselves into the risky position of heightening the possibility of rejection, stigmatization, and prosecution . Double binds constitute a shaky foundation for consistent practice and for effective public policy . As interviews with people living with hiv show, examination of everyday disclosure decisions shows a range of incommensurable rationalities that shape these decisions such as personal ethics and morality, ethical precepts circulating in the larger society, the fear of rejection, degree of intimacy between partners, and capacity for self - assertion, as factors in disclosure dynamics . This in turn leads to ways in which notions of responsibility figure in the reflections of people living with hiv . The gap between these everyday practices and situations on the one hand and the rational deterrence presumptions of criminal justice proceedings on the other point towards ways in which the criminalization of hiv may work at cross - purposes to effective hiv prevention . Perhaps paradoxically, the elevation of disclosure as a strategy of hiv prevention by the courts and media coverage shifts perceptions and negotiations of hiv management in ways that may actually undermine effective hiv prevention by making disclosure feel more risky for hiv - positive people when it becomes an act subject to legal scrutiny . As well it may create a generalized expectation that hiv - positive people will always disclose, and therefore condom use is unnecessary because non - disclosure comes to signify hiv - negative status . Obscured by criminalization trends is the fact that protected sex, especially in a situation where treatment has succeeded in attaining an undetectable viral load in the hiv - positive partner, continues to be a much more reliable method of avoiding hiv (as well as several other sexually transmitted infections) than disclosure . The elevation of disclosure to a primary strategy for hiv prevention, then, exerts increasing pressure on a double bind that cannot be relied on to result in decreased hiv risk and may divert attention from or undermine safe sex practice.
The control of pain, a complex and subjective experience, is critical to clinical success in caring for patients . Opioids such as oxycodone, methadone and morphine are the recommended therapy by the world health organization and the european association for palliative care for moderate to severe pain . However, the use of opioids in pain management requires careful dose escalation and empirical adjustments based on clinical response and the presence of side effects or adverse drug reactions (adrs). Unfortunately, successful pain management treatment - defined as adequate analgesia without excessive adverse effects - can be challenging . Unpleasant opioid side effects, such as nausea, vomiting, constipation and sedation, are common and can lead to absence from work, poor performance at work and the resulting risk of job loss, and a diminished quality of life . The most serious issues involve the risk of sedation, depression of respiration and unintentional death due to inability or poor ability to metabolize the medications successfully . An individual's genetic makeup may predispose the patient to these adverse effects and reduced efficacy . Pharmacogenomic approaches offer insight into the genetic variables that can affect a drug's uptake, transport, activation of its target, metabolism, interaction with other medications and excretion . The use of pharmacogenomics in patients requiring pain management can lead to more efficient opioid selection, dose optimization and minimization of adrs to improve patient outcome . P - glycoprotein is an efflux transporter also called adenosine triphosphate - binding cassette, subfamily b, member 1 (abcb1) or multidrug resistance 1 (mdrd1). It is expressed in hepatic, intestinal and renal epithelial cells and also on the luminal side of endothelial cells in the blood - brain barrier, and it is a major determinant of the pharmacokinetics and pharmacodynamics of several opioids (such as morphine, methadone and fentanyl) commonly used to treat pain . Genetic variants (such as 3435c> t) in p - glycoprotein have been associated with variability of pain relief in cancer patients treated with morphine . The analgesic effects of morphine are mediated by its interaction at the -opioid receptor located in the central nervous system (cns). P - glycoprotein can limit the concentration of pain management drugs, such as morphine, in the brain because it actively pumps drugs out of the cns . As a result, homozygous carriers of the 3435c> t variant (tt carriers) experience greater pain relief than heterozygous (ct) or homozygous wild - type (cc) carriers, presumably because higher concentrations of morphine can be achieved in the cns . Clinically relevant pharmacogenomic targets for pain management the cytochrome p450 (cyp) system is responsible for metabolizing a wide range of therapeutic agents used for pain relief . Cyp2d6 is especially important for the activation or inactivation of several opioids used to treat pain, including codeine, oxycodone and tramadol . Typically, the genetic variability of cyp can be grouped into four phenotypes: ultrarapid metabolizers (um), extensive metabolizers (em), intermediate metabolizers (i m) and poor metabolizers (pm). Um - classified patients typically contain multiple copies of a gene, which results in an increase in drug metabolism . Em - classified patients are characteristic of the normal population and have a single wild - type copy of the gene, whereas im - classified patients show decreased enzymatic activity and pm - classified patients have no detectable enzymatic activity . Codeine is a prodrug that requires demethylation to its active metabolite morphine by cyp2d6 before it can exert an analgesic effect . As a result, cyp2d6 pm - classified patients experience ineffective analgesia and increased side effects from the parent drug (codeine). On the other hand, cyp2d6 um - classified patients prescribed codeine for pain management generate extensive concentrations of morphine, which can lead to adrs . Tramadol, another opioid commonly used for pain management, produces analgesia by the synergistic action of its two enantiomers and their metabolites . Tramadol undergoes metabolism by cyp2d6 to an active metabolite (o - desmethyl tramadol), which has greater affinity for the -opioid receptor than does the parent compound . Genetic variations in cyp2d6 have been shown to account for some of the variable pain response in the post - operative period because the cyp2d6 activity has a clinically relevant impact on the level of analgesia mediated by the -opioid receptor . Another important genetic target is uridine diphosphate - glucuronosyltransferase 2b7 (ugt2b7), which metabolizes morphine to morphine 3-glucuronide (m3 g) and morphine 6-glucuronide (m6 g). Morphine is commonly used to control moderate and severe pain associated with sickle cell disease . Darbari et al . Showed that the presence of the ugt2b7 -840 g> a genotypes (gg and ga) were associated with lower m3g: morphine and m6g: morphine ratios than aa genotypes . As a result, genetic polymorphisms in ugt2b7 have been shown to decrease the hepatic clearance of morphine, which translates into lower dosage requirements of morphine . In another study, the ugt2b7 * 2 polymorphism (802c> t) was also shown to be associated with the frequency of morphine - induced adrs (nausea) in cancer patients . The authors showed that the frequency of nausea was higher in patients without the ugt2b7 * 2 allele . Furthermore, the efficacy of opioid analgesia can be enhanced by the co - administration of catecholamines, which are involved in the modulation of pain . Catechol - o - methyltransferase (comt) is responsible for the inactivation of catecholamines (dopamine, adrenaline and norepinephrine). As a result, genetic variability in the comt gene can contribute to differences in pain sensitivity and response to analgesics . It has been shown that a common variant allele (1947 g> a; rs4680) results in a three- to fourfold reduction in comt enzyme activity . Homozygous wild - type (gg) cancer patients required higher doses of morphine to control pain than heterozygous or homozygous variant (aa) alleles . Finally, the -opioid receptor encoded by the opioid - receptor - like 1 (oprm1) gene is the primary site of action for most of the commonly used opioids . The 118a> g polymorphism in this gene results in less effective opioid analgesia, as reported with cancer patients with homozygous variant alleles (gg) who required higher morphine doses for pain relief than homozygous wild - type (aa) participants . In another study, chou et al . Investigated the correlation between the 118a> g polymorphism and patient - controlled morphine consumption in patients undergoing total knee arthroplasty . Patients who were homozygous variants (gg) consumed approximately 60% more morphine than patients who were heterozygous or homozygous wild - type (aa) during the first 48-hour post - operative period . Patient demographics, reported pain and other factors did not differ between the genotype groups . In a similar study, women who had homozygous variants for the 118a> g polymorphism required 30% more morphine to achieve adequate pain control than those who were wild type (aa) during the first 24 hours after a total abdominal hysterectomy . Finally, a significant relationship between the degree of pain relief and the 118a> g genotypes was shown in cancer patients being treated with morphine over the first 2 months of therapy . In the first 7 days of morphine treatment, patients homozygous for the wild - type allele (aa) had more pronounced decrease in pain from baseline than those who were homozygous variants (gg), whose response was almost undetectable . Genomic variations clearly influence pain sensitivity, the likelihood of developing chronic pain and the response to pharmacotherapy for the management of pain . Pharmacogenomic polymorphisms are definitely important in the interindividual variability in the analgesic effects and occurrence of adrs of commonly used medications prescribed for pain management, but genetic factors will provide only a partial answer to the interindividual variability observed . Other factors, including biological variations (ethnicity, age and gender), environmental factors (smoking status), co - morbidity and co - medications (potential for drug - drug interactions) must be considered along with the genetic variations because together they all affect the pharmacokinetics and pharmacodynamics of medications used for pain management . Additional studies are also needed to characterize the combined effects of multiple genes along with demographic and clinical variables in selecting the appropriate opioid and predicting the appropriate opioid dose in patients with pain . Large, randomized prospective studies are needed to develop appropriate dosing or treatment algorithms to facilitate the use of genotyping information appropriately by physicians . Furthermore, the continued development of regulator - approved genotyping assays to identify these variant alleles will allow greater access to this information to aid in day - to - day clinical decisions for acute and chronic pain management . The benefits of patient care and safety will result in the incorporation of this knowledge into the standard of care for anesthesiologists and pain management physicians . In the near future, pharmacogenomic approaches in pain management could lead to individualized therapy to best select the appropriate analgesic from the onset to provide sustained efficacy with the lowest side effect profile . Adr: adverse drug reaction; cns: central nervous system; comt: catechol - o - methyltransferase; em: extensive metabolizer; i m: intermediate metabolizer; m3 g: morphine 3-glucuronide; m6 g: morphine 6-glucuronide; pm: poor metabolizer; ugt2b7: uridine diphosphate - glucuronosyltransferase 2b7; um: ultra - rapid metabolizer . Ncb serves on the speakers bureau and advisory board of king pharmaceuticals, pfizer inc . And forest pharmaceuticals . Pjj is an associate professor in the pathology department at the medical college of wisconsin . He is the director of clinical chemistry / toxicology for froedtert hospital / dynacare laboratories . Pjj's pharmacogenomic research interests are funded by the pathology department at the medical college of wisconsin.
In many circumstances people experience external events by a number of different sensory modalities . For example, when someone is talking, there is auditory and visual information that is initially processed by specialized neural pathways . Ultimately, though, the different sensory signals are integrated into a coherent multimodal percept of the speaker . Many behavioural and neurophysiological studies have emphasized the importance of spatial co - localisation and temporal synchrony for intersensory pairing to occur (e.g., welch and warren 1980; bedford 1989; stein and meredith 1993; radeau 1994; bertelson 1999; welch 1999). However, there is accumulating evidence that some intersensory phenomena may not require spatial alignment (welch et al . 1986; scheier et al . 1999; morein - zamir et al . ; teder - salejarvi et al . 2005; vroomen and keetels 2006; keetels et al . 2007). In the present study, we explored the importance of spatial alignment for audio visual (av) temporal recalibration . Temporal recalibration refers to the phenomenon that the brain adapts itself to (small) temporal asynchronies . In a multi - modal percept this occurs, despite the fact that there are natural asynchronies between the senses caused by differences in signal transduction time through air and differences in neural transmission time . At least two options are available to handle these asynchronies: one is concerned with immediate corrections, the other is important for adaptation on a longer time scale . As concerns the immediate effect, several studies have shown that the brain corrects for small av temporal asynchronies by shifting one or both modalities on the time scale so that the temporal discordance is reduced . For example, when a sound and a light are presented at slightly different onset times (usually in the order of 100 ms), the temporal asynchrony is reduced by a capturing effect of the light by the sound; a phenomenon called temporal ventriloquism (scheier et al . 1999; fendrich and corballis 2001; morein - zamir et al . 2003; vroomen and de gelder 2004; stekelenburg and vroomen 2005; vroomen and keetels 2006). Temporal ventriloquism can, for example, be demonstrated by the use of a visual temporal order judgment (toj) task in which participants are presented two lights at various stimulus onset asynchronies (soas) and judge which light came first . By presenting a sound before the first and after the second light, the just noticeable difference (jnd) improves (i.e. Participants become more sensitive), presumably because the two sounds attract the temporal occurrence of the two lights, and thus effectively pull the lights further apart in time (scheier et al . There are also long - term effects reflecting an adaptive change to av asynchrony, a phenomenon called temporal recalibration (fujisaki et al . For example, vroomen et al . Studied temporal recalibration by exposing participants to 3 min of sound and light flashes with a constant time lag, after which an av toj or av simultaneity task was performed . Following exposure, observers were given av test stimuli and judged whether the sound or the light came first, or whether the sound and light were simultaneous or successive . The results showed that the point of subjective simultaneity (pss), the point of perceived temporal alignment between the sound and the light, was shifted in the direction of the exposure lag . So, following exposure to a train of sound - first stimulus pairs, participants perceived sound - first trials as more simultaneous than after light - first exposure . (2004) demonstrated similar findings and also provided somewhat mixed evidence that temporal recalibration may generalize to different test stimuli than the ones presented during exposure . The authors adapted participants to asynchronous tone - flash stimulus pairs and later tested them on the bounce illusion (sekuler et al . Two visual targets that move across each other can be perceived either to bounce off or to stream through each other . A brief sound presented at the moment that the visual targets coincide generally biases visual perception in favour of a bouncing motion, while without sound observers tend to report a streaming percept . Light pairs, the optimal delay for obtaining the bounce illusion was shifted in the same direction, but in other conditions, the magnitude of the after - effect was smaller for some of the cross - adaptation conditions . Tactile temporal recalibration by exposing participants to streams of brief auditory and tactile stimuli presented in synchrony, or else with the auditory stimulus leading by 75 ms . Rather than a shift in the pss, they observed that the jnd to resolve audio tactile temporal order was larger after exposure to the desynchronized streams than after exposure to the synchronous streams . The authors argued that the temporal window for integration was widened due to audio tactile asynchrony . The goal of the present study was to explore whether spatial disparity between a sound and light affects temporal recalibration . According to the common notion of intersensory pairing, intersensory effects should be bigger when the individual components of a multisensory stimulus come from the same location (e.g. Welch and warren 1980; bedford 1989; stein and meredith 1993; radeau 1994; bertelson 1999; welch 1999). However, vroomen and keetels (2006) demonstrated that, at least for temporal ventriloquism, spatial correspondence between sound and light is not important . In their study, a visual toj task was used with a sound presented before the first and after the second light . Temporal ventriloquism manifested itself as an improvement in the jnds but, crucially, the improvement was unaffected by whether the sounds came from the same or a different position as the lights, whether the sounds were static or moved, or whether the sounds and lights came from the same or opposite sides of fixation . (2007) further examined how principles of auditory grouping (bregman 1990) relate to intersensory pairing . They embedded two sounds that normally enhance sensitivity on the visual temporal order judgement task in a sequence of flanker sounds, which either had the same or different frequency, rhythm, or location . In all experiments, temporal ventriloquism only occurred when the two capture sounds differed from the flankers, thus demonstrating that intramodal grouping of the sounds in the auditory stream took priority over intersensory pairing . By combining principles of auditory grouping with intersensory pairing, they also demonstrated that the capture sounds could, counter - intuitively, be more effective when their locations differed from that of the lights rather than when they came from the same position, thus demonstrating that sound location mattered for auditory grouping, but not intersensory pairing . Here we examined whether, like in temporal ventriloquism, spatial disparity is ignored when temporal recalibration is at stake . Participants were exposed for 3 min to a train of asynchronous sounds and lights that came either from the same or a different location . Following exposure, participants performed an av toj task with sounds and lights from either the same or different location . First, we could test whether temporal recalibration is affected by spatial disparity between the sounds and lights . Recalibration is usually considered to be a low - level perceptual learning phenomenon necessary for re - alignment of the senses (bertelson and de gelder 2004). Observing an after - effect following exposure to spatially disparate sound light pairs would provide strong evidence that spatial co - occurrence is, even at this early stage, not necessary for intersensory pairing to occur . Secondly, the use of an exposure test design allowed us to introduce a change between the exposure and test stimulus so that we could test whether after - effects generalize to different test stimuli . Here we tested whether spatial similarity between the exposure and test sound affects after - effects . If spatial co - location plays no role in intersensory pairing, one would expect stimulus generalization across space to be complete . Thirty students from tilburg university received course credits for their participation . All reported normal hearing and normal or corrected - to - normal vision . The study was carried out along the principles laid down in the helsinki declaration and informed consent from the participants was obtained . Visual stimuli were presented by a green led, positioned at central location, at 70 cm from the subject s eyes (diameter of 0.5 cm, luminance of 40 cd / m). Auditory stimuli were 88 db sound bursts presented by one of two loudspeakers; one directly behind the green led and the other placed laterally at 70 cm distance on either the far left or the far right of the subject (i.e., 90 degrees of spatial separation between the sound and light). See fig . 1 for a schematic view of the experimental set - up . A small red led, placed 2 cm below the green led, was constantly lit during the experiment and served as fixation point ., the subject was exposed to a sound light pair with 100 ms temporal offset (either sound - first or light first). During exposure, sounds were either presented from central (a, c) or lateral location (b, d). In the test phase, light pairs were presented with a particular soa ranging between 240 and 240 ms, with negative values indicating that the sound was presented first . Sounds of the test - stimulus pair either came from central (a, b) or lateral location (c, d) schematic illustration of the experimental conditions . In the exposure phase, the subject was exposed to a sound light pair with 100 ms temporal offset (either sound - first or light first). During exposure, sounds were either presented from central (a, c) or lateral location (b, d). In the test phase, sound light pairs were presented with a particular soa ranging between 240 and 240 ms, with negative values indicating that the sound was presented first . Sounds of the test - stimulus pair either came from central (a, b) or lateral location (c, d) three within - subjects factors were used: exposure lag during the exposure phase (100 and + 100 ms, with negative values indicating that the sound was presented first), location of the sound during exposure (exposure - sound central or lateral) and soa between the sound and light of the test stimuli (240, 120, 90, 60, 30, 0, + 30, + 60, + 90, + 120, and + 240 ms, with negative values indicating that the sound came first). The location of the test sound (central or lateral) was a between - subjects variable . Half of the participants were tested with central test sounds, the other with lateral test sounds . These factors yielded 44 equi - probable conditions for each location of the test sound (2 2 11), each presented 12 times for a total of 528 trials . The location of the exposure sound were constant within a block, while the soa between sound and light varied randomly . The order of the blocks was counterbalanced across participants . In half of the blocks with a lateral exposure sound, each block started with an exposure phase consisting of 240 repetitions (3 min) of a sound light stimulus pair (isi = 750 ms) with a constant lag (100 or + 100 ms) between the sound and the light . After a 2,500 ms delay, the first test trial then started . To ensure that participants were fixating the light during exposure, they had to detect the occasional occurrence of the offset (150 ms) of the fixation light (i.e., a catch trial). The test phase consisted of two parts: a short av re - exposure phase followed by three av test trials of which the temporal order of the sound and light had to be judged . The re - exposure phase consisted of a train of ten sound - light pairs with the same lag, isi, and sound location as used during the immediately preceding exposure phase . After 1 s, the three av test trials were presented with a variable soa between the sounds and lights . The participant s task was to judge whether the sound or the light of the test stimulus was presented first . An unspeeded response was made by pressing one of two designated keys on a response box . The next test stimulus was presented 500 ms after a response, and the re - exposure phase of the next trial started 1,000 ms after the response on the third test stimulus . To acquaint participants with the toj task, experimental blocks were preceded by four practice blocks in which no exposure preceded the test trials . The first two practice blocks were to acquaint participants with the response buttons, and consisted of 16 trials in which only the largest soas were presented (240 and 120). During this part, participants received verbal feedback (correct or wrong) about whether they gave the correct response or not . The next two practice blocks consisted of 66 trials in which all soas were presented 6 times randomly without verbal feedback . Thirty students from tilburg university received course credits for their participation . All reported normal hearing and normal or corrected - to - normal vision . The study was carried out along the principles laid down in the helsinki declaration and informed consent from the participants was obtained . Visual stimuli were presented by a green led, positioned at central location, at 70 cm from the subject s eyes (diameter of 0.5 cm, luminance of 40 cd / m). Auditory stimuli were 88 db sound bursts presented by one of two loudspeakers; one directly behind the green led and the other placed laterally at 70 cm distance on either the far left or the far right of the subject (i.e., 90 degrees of spatial separation between the sound and light). See fig . 1 for a schematic view of the experimental set - up . A small red led, placed 2 cm below the green led, was constantly lit during the experiment and served as fixation point ., the subject was exposed to a sound light pair with 100 ms temporal offset (either sound - first or light first). During exposure, sounds were either presented from central (a, c) or lateral location (b, d). In the test phase, light pairs were presented with a particular soa ranging between 240 and 240 ms, with negative values indicating that the sound was presented first . Sounds of the test - stimulus pair either came from central (a, b) or lateral location (c, d) schematic illustration of the experimental conditions . In the exposure phase, the subject was exposed to a sound light pair with 100 ms temporal offset (either sound - first or light first). During exposure, sounds were either presented from central (a, c) or lateral location (b, d). In the test phase, light pairs were presented with a particular soa ranging between 240 and 240 ms, with negative values indicating that the sound was presented first . Sounds of the test - stimulus pair either came from central (a, b) or lateral location (c, d) three within - subjects factors were used: exposure lag during the exposure phase (100 and + 100 ms, with negative values indicating that the sound was presented first), location of the sound during exposure (exposure - sound central or lateral) and soa between the sound and light of the test stimuli (240, 120, 90, 60, 30, 0, + 30, + 60, + 90, + 120, and + 240 ms, with negative values indicating that the sound came first). The location of the test sound (central or lateral) was a between - subjects variable . Half of the participants were tested with central test sounds, the other with lateral test sounds . These factors yielded 44 equi - probable conditions for each location of the test sound (2 2 11), each presented 12 times for a total of 528 trials . The location of the exposure sound were constant within a block, while the soa between sound and light varied randomly . The order of the blocks was counterbalanced across participants . In half of the blocks with a lateral exposure sound, each block started with an exposure phase consisting of 240 repetitions (3 min) of a sound light stimulus pair (isi = 750 ms) with a constant lag (100 or + 100 ms) between the sound and the light . After a 2,500 ms delay, the first test trial then started . To ensure that participants were fixating the light during exposure, they had to detect the occasional occurrence of the offset (150 ms) of the fixation light (i.e., a catch trial). The test phase consisted of two parts: a short av re - exposure phase followed by three av test trials of which the temporal order of the sound and light had to be judged . The re - exposure phase consisted of a train of ten sound - light pairs with the same lag, isi, and sound location as used during the immediately preceding exposure phase . After 1 s, the three av test trials were presented with a variable soa between the sounds and lights . The participant s task was to judge whether the sound or the light of the test stimulus was presented first . An unspeeded response was made by pressing one of two designated keys on a response box . The next test stimulus was presented 500 ms after a response, and the re - exposure phase of the next trial started 1,000 ms after the response on the third test stimulus . To acquaint participants with the toj task, experimental blocks were preceded by four practice blocks in which no exposure preceded the test trials . The first two practice blocks were to acquaint participants with the response buttons, and consisted of 16 trials in which only the largest soas were presented (240 and 120). During this part, participants received verbal feedback (correct or wrong) about whether they gave the correct response or not . The next two practice blocks consisted of 66 trials in which all soas were presented 6 times randomly without verbal feedback . Trials of the practice session were excluded from analyses . The proportion of light - first responses was for each participant calculated for each combination of exposure lag (100, + 100 ms), location of the exposure sound (central, or lateral), location of the test sound (central, or lateral) and soa (ranging from 240 to + 240 ms). Performance on catch trials was flawless, indicating that participants were indeed looking at the fixation light during exposure . For each combination of exposure lag, location of the exposure sound and location of the test sound, an individually determined psychometric function was calculated over the soas by fitting a cumulative normal distribution using maximum likelihood estimation . The mean of the resulting distribution (the interpolated 50% crossover point) is the point of subjective simultaneity (henceforth the pss), and the slope is a measure of the sharpness with which stimuli are distinguished from one another . The slope is inversely related to the just noticeable difference (jnd) and represents the interval (absolute soa) at which 25 and 75% visual - first responses were given . The pss and the jnd data are shown in fig . 2 and table 1 . Temporal recalibration was expected to manifest itself as a shift of the pss in the direction of the exposure lag . The temporal recalibration effect (tre) was therefore computed by subtracting the pss following auditory - first exposure from visual - first exposure . 2the proportions of visual - first responses (v - first) for each exposure lag (100 ms sound - first, 100 ms light - first) for each combination of location of exposure sound (central, lateral) and location of the test sound (central, lateral)table 1mean points of subjective simultaneity (psss) in ms, and mean just noticeable differences (jnd) in parentheseslocation test sound location of the exposure soundcentral lateralav - lag (ms)pss (jnd)trepss (jnd)trecentral10012.5 (39.3)14.59.9 (37.8)6.41002.0 (40.8)3.5 (38.6)lateral1006.1 (38.2)14.214.3 (36.4)16.810020.3 (36.1)2.5 (42.0)exposure stimulus pairs were presented with an auditory visual lag (av - lag) of 100 and + 100 ms with sounds either central or lateral; the location of the test stimulus sound was either central or lateral . The temporal recalibration effect (tre) reflects the difference in psss between the 100 and + 100 ms audio visual lags the proportions of visual - first responses (v - first) for each exposure lag (100 ms sound - first, 100 ms light - first) for each combination of location of exposure sound (central, lateral) and location of the test sound (central, lateral) mean points of subjective simultaneity (psss) in ms, and mean just noticeable differences (jnd) in parentheses exposure stimulus pairs were presented with an auditory visual lag (av - lag) of 100 and + 100 ms with sounds either central or lateral; the location of the test stimulus sound was either central or lateral . The temporal recalibration effect (tre) reflects the difference in psss between the 100 and + 100 ms audio visual lags an overall 2 2 2 anova with as within - subjects factors exposure lag, location of the exposure sound and as between - subjects factor location of the test sound was run on the jnds . None of the effects was significant (all p> 0.08), except for a second - order interaction between exposure lag, exposure location and test location, f(1,28) = 4.6, p = 0.041 . Inspection of table 1 shows that the differences between the jnds (on average 38.7 ms) were rather small and unsystematic . The anova on the tres only showed a significant effect of exposure lag, f(1,28) = 23.0, p <0.001, demonstrating, as predicted, that the exposure phase shifted the pss such that there were more visual - first responses after sound - first exposure than after light - first exposure (i.e. The tre). The overall size of this effect corresponds well with previous reports (fujisaki et al . An average tre of 6.7%). There were, furthermore, no main effects of location of the exposure and test sound, and the crucial interaction between the location of the exposure and test sound was non - significant (all f <1). Temporal recalibration thus manifested itself no matter whether exposure sounds came from central or lateral location, and whether the location of the exposure and test sounds was changed or not . The goal of the present study was to address whether spatially co - located av asynchronous stimulus pairs induce temporal recalibration as much as spatially dislocated stimuli do, and whether spatial correspondence between the exposure and test sound affects the size of this effect . Results showed that in all cases, there were clear temporal recalibration effects as subjective simultaneity was shifted in the direction of the adapted audiovisual lag . The shift was equally big for spatially separated and spatially co - located exposure stimuli . Stimulus generalization across space was also complete, as the shift in temporal alignment was equally big for when the exposure and test sound came from the same or different positions . The results therefore support the notion that spatial alignment between the senses is unimportant for av pairing in the temporal domain . The results are also in line with previous reports on temporal ventriloquism (keetels et al . 2007; vroomen and keetels 2006) where it was shown that spatial separation does not affect the capturing effect of a light by a sound . Taken together, these findings provide strong evidence that spatial co - occurrence is, even at early perceptual stages, not a necessary constraint for intersensory pairing . One might object, though, that spatial ventriloquism has diminished the potential effects of spatial discordance . It is well - known that the apparent location of a sound can be shifted towards a visual stimulus that is presented at approximately the same time (howard and templeton 1966; radeau and bertelson 1978; welch 1978; bertelson and radeau 1981; bertelson 1994, 1999; radeau 1994). Could it be, then, that the av spatial discordance in our set - up was diminished, if not became unnoticeable due to spatial ventriloquism? If so, one may not observe an effect of spatial separation on temporal recalibration . This argument, though, seems highly unlikely because it is known that spatial ventriloquism dramatically declines whenever spatial separation exceeds approximately 15 degrees (slutsky and recanzone 2001; godfroy et al . Given that we maximized the spatial separation between the sound and light (i.e., at 90 degrees azimuth), and that informal testing indeed confirmed that spatial separation was clearly noticeable, it seems safe to assume that spatial ventriloquism did not diminish the effect of spatial discordance . One might also ask whether the visual task as used during the exposure phase (i.e., detection of the offset of visual fixation) resulted in an attentional shift towards the visual modality . According to the law of prior entry (titchener 1908), attending to one sensory modality speeds up the perception of stimuli in that modality, resulting in a change in the pss (see also shore et al . 2001, 2005; spence et al . 2001; schneider and bavelier 2003; zampini et al . Our visual task might thus result in a shift of the pss towards more visual - first responses . However, this shift should be uniform for all conditions, and given that temporal recalibration is expressed as a difference in the pss between exposure lags, the possible role of attention will be subtracted out . A remarkable aspect of the data is that previous studies have demonstrated that av temporal order judgements become more sensitive (i.e. Smaller jnd) when the sound and light of the test stimuli are spatially separated (see also bertelson and aschersleben 2003; spence et al ., there was a small trend in this direction (average jnd of 39.1 vs. 38.2 ms, for spatially co - located vs. separated test stimuli, respectively), but the effect was non - significant . Possibly, we might have picked up this difference if the effect were measured as a within - subjects factor . For the current purpose, though, this was considered to be unpractical because it would have doubled individual testing time . Despite that we did not observe an effect of av spatial separation on the jnds, the data speak on the interpretation on this effect . At least two explanations have been brought up for the improved temporal sensitivity when the locations of test sound and light differ . One is that there is more intersensory integration with as a consequence that the temporal discordance is fused; the other is that there are extra spatial cues that help toj performance (spence et al . 2003). Given that our results show that intersensory pairing occurs independent of a spatial mismatch (see also vroomen and keetels 2006; keetels et al . 2007), it seems more likely that the previously observed effects of spatial separation on temporal sensitivity were induced by the availability of redundant spatial cues rather than fusion per se . To conclude, our results provide strong evidence for the claim that commonality in space between a sound and light is not relevant for av pairing in the temporal domain . This may, at first sight, seem unlikely, because after all, most natural multisensory events are spatially and temporally aligned . However, a critical assumption that underlies the idea of spatial correspondence for cross - modal pairing is that space has the same function in vision and audition . This notion, though is arguable, as it has been proposed that the role of space in hearing is to steer vision (heffner and heffner 1992), while in vision it is an indispensable attribute (kubovy and van valkenburg 2001). If one accepts that auditory spatial perception evolved for steering vision, but not for deciding whether sound and light belong together, there is no reason why cross - modal interactions would require spatial co - localization . Our results therefore have also important implications for designing multimodal devices or creating virtual reality environments, as they show that the brain can ignore cross - modal discordance in space.
Transcription factors, enhancer - binding proteins and chromatin - remodeling factors all play a role in regulating gene expression . In addition, nucleosomes, the basic structural units of chromatin, are now thought to also be involved in this process [(1,2); see also (3,4)]. The dissociation or displacement of nucleosomes from dna by the action of other protein factors, such as dna- and histone - modifying enzymes (methylases, kinases, acetylases and deacetylases) likely gives the basal transcription apparatus access to the promoter regions of genes (57). A means for assessing the distribution of nucleosomes along stretches of regulatory dna would therefore be a useful addition to our understanding of gene regulation . In eukaryotic cells, nucleosomes are formed by the binding of dna to histones (8). The nucleosome consists of 147 bp of dna wound around a histone - octamer core (911). In human dna, most dna sequences are neutral or favorable to nucleosome formation, but some sequences, by virtue of their influence on the curvature and flexibility of the dna double helix (12,13), are unfavorable to nucleosome formation; we have called these nucleosome exclusion sequences (nxss). Thus, nucleosomes are not uniformly or randomly spaced along dna, allowing for variation in access to promoter and other regulatory regions by the basal transcription apparatus, transcription factors and other proteins . We have developed a program, nxsensor (available at), that locates nxss in dna and defines regions where nucleosomes are unlikely to be formed because of the presence of such sequences and their spacing at distances less than the number of base pairs in the nucleosome . We have applied nxsensor to sets of promoter sequences whose genes are known to differ in their expression patterns among different tissues, and were able to show, in agreement with recent reports, significant differences among promoter regions in the number and position of such sequences . Dna sequences chosen as nxss were the following, based on experimental observations (1416): [(g / c)3n2]3;e.g.ggcaacgcttgggta, ggccgcgcaggggct a10(=t10);e.g . Aaaaaaaaaa, tttttttttt other studies lend support to the unfavorability of these sequences for nucleosome formation because of their hindering of dna bending or flexibility (12,13,17). A nxs was defined as one of the dna sequences above, a contiguous non - overlapping dna sequence long enough to comprise one full turn of the dna double helix . The nxsensor program annotates individual dna regions by marking nxss and then examining their spacing to find sequences between nxss that are <147 bp in length, on the assumption that nucleosomes are unlikely to form in such regions . To test the general validity of the nxss chosen, and to test the ability of the nxsensor program to find and annotate such sequences, the dna sequences of positioned nucleosomes listed in the nucleosome positioning region database (nprd) were examined (18). Ideally, in these nucleosome - associated dna sequences there should be no nxss as defined here . We found that only nine (8%) of the 112 positioned nucleosomes contained any nxss . These sequences (a total of 12 nxss) comprised 199 bp in a total of 16 829 nucleosome - associated base pairs (1.18%), which represents reasonable agreement with expectation . Exceptions in which a nxs is accomodated within a nucleosome may be the result of the presence of additional protein factors associated with nucleosomal dna . As a further test of nxsensor, the sv40 viral sequence was examined because it is known to contain a nucleosome - free segment of about 400500 bp within its 5243 bp genome (1921). The results showed a close correspondence between the experimentally - determined location of the nucleosome - free region and the nucleosome - free region predicted by nxsensor's analysis of dna sequence (supplementary figure 1). In a final comprehensive test, nxsensor was used to analyze the promoter regions of two sets of human genes, housekeeping (hk) and tissue - specific (ts) genes . These two sets of genes were chosen in order to assess the potential distribution of nucleosomes in promoters of genes that are used differently in different tissues, to substantiate the conclusions of other researchers who have recently investigated this question using different approaches, and to demonstrate further the usefulness of the nxsensor tool . One hundred genes from each set, hk and ts, were selected on the basis of the tissue expression patterns given in the novartis research foundation's genomic institute symatlas () (22). The genes selected were at the two extremes of tissue expression patterns: hk genes showing significant expression in all 73 normal tissues of the symatlas, and ts genes showing, according to gene - specific non - cross - hybridizing probe sets (those with _ at suffixes), significant expression in only one or two tissues . To avoid possible bias in selecting hk genes, we included as wide a variety of basic cell functions as possible, and in selecting ts genes, as wide a variety of cell- and tissue types as possible . Genes with only one region of transcription initiation were used instead of those with widely - spaced alternative transcription start sites (tsss), as indicated in the ucsc genome browser (), and double - checked in the database of transcriptional start sites (dbtss,). The list of genes is available at . To examine the region around the tss of each gene, we used the sequence from 1000 bases upstream (which would include the complete promoter of most genes) to 1000 bases downstream from the tss (1000 to + 1000), and called this 2000 bp stretch the promoter region, centered on the tss . The tss was either the predominant site in, or a site near the middle of, the cluster of oligo - capped cdna clones shown in the dbtss (23). In cases where no oligo - capped cdna clones were available from the dbtss (21 of 100 hk genes, 36 of 100 ts genes) nucleosome segments option of nxsensor annotates the submitted sequence by highlighting in gray the segments available for nucleosome binding, leaving open the segments unlikely to be bound to nucleosomes by virtue of the number and positions of nxss (figure 1 and supplementary figure 1). Nxscore defined as the number of nxss in a window of 147 bp at a given position within the 2000 base promoter region, estimates the likelihood that nucleosomes are excluded from promoter regions at different distances from the tss . This measure is the obverse of the nucleosome formation potential based on nucleosome binding sequences used by levitsky et al . (the nxscore is averaged over all promoter regions of each class of genes, hk and ts, to generate a graph of average nxscore versus position, centered on a given window (figure 2). The second measure was the accessibility score, measuring the overall accessibility of the 2000 base promoter region to protein factors . The accessibility score is defined as the proportion of base pairs in the region likely to be free of nucleosomes, according to the number and spacing of the nxss . Accessibility scores can vary from 0.0 (all sequences potentially occupied by nucleosomes) to 1.0 (no sequences likely to be occupied by nucleosomes). In calculating the accessibility score acc(10), short exclusion sequences of 10 bp or less flanked by two segments having the potential for nucleosome binding were not considered open because of the unlikelihood that any protein would be able to bind effectively such a short sequence between two nucleosomes . A direct comparison of the average number of nxss, per window of 147 bases, in hk and ts promoter regions is shown in figure 2 . In both sets of promoter regions there were more nxss nearer the tss . There was a significant difference between hk - gene promoters and ts - gene promoters in the mean number of nxss in the specific 147 bp window centered on the tss (hk, 2.10 and ts, 0.82; p <0.01, kolmogorov supplementary figure 2 gives an illustrative example of 10 000 bases around the tss of a hk gene, in which nxsensor analysis suggests that essentially only the tss region is free of nucleosomes . Figure 2 also shows that the mean number of nxss in this window for the hk genes was significantly higher than that expected for random - sequence dna with the same base composition as the hk - gene promoter regions (2.10 for hk genes, 0.53 for the corresponding random - sequence dna, p = 0.0014). In contrast, the mean number of nxss in this window for the ts genes was hardly different from the nxss expected in random - sequence dna having the ts promoter base composition (0.82 for ts genes, 0.22 for the corresponding random - sequence dna, p = 0.06). From nxsensor output we obtained accessibility scores, as shown in figure 3a, there was a significant difference between the distributions of accessibility scores of hk genes and of ts genes, the hk genes having significantly higher accessibility scores than the ts genes (p 0.01, kolmogorov further analysis was conducted using a modified accessibility score, acc(50), which includes sequences at least 50 bp in length likely to be nucleosome - free . This is the length of sequence estimated to be occupied by the basal transcription apparatus (25,26). Acc(50) was examined for the dna region from 110 to + 60, the region in which the basal transcription apparatus would have to bind in order to initiate transcription at the majority of tsss clustered around the modal or central tss at + 1 (27). The comparison of this tss region (figure 3b) showed that 58% of the hk genes, but only 22% of the ts genes, had an acc(50) of 0.5 or higher . Of the hk genes, 45% had an acc(50) of 1.0, while only 15% of the ts genes did . The overall distributions of hk gene and ts gene acc(50) scores were significantly different by the kolmogorov work in recent years has shown that the nucleosomes are neither uniformly nor randomly positioned along the dna double helix . In a number of instances the location of nucleosomes in control regions of dna (1), and is the basis for the nucleosome positioning region database (nprd), () (18). Nucleosome formation potential scores have recently been used to demonstrate differences in the intergenic regions (28) and more specifically in the promoter regions (29) of human hk and ts genes . We have taken a different approach by utilizing a combination of published experimental and observational data to identify dna sequences unfavorable for nucleosome formation because of their influence on dna bending and flexibility . One example is tgga repeats (30), but these occurred too infrequently in our sample of 200 promoter regions to have any influence on the results . Using our nxsensor program (), we have shown that, as expected, these nxss are rare in dna sequences occupied by nucleosomes listed in the nprd . Nxsensor also accurately predicts the location of the nucleosome - free zone in viral sv40 dna . In a set of hk and ts promoter region dna sequences, nxsensor analysis has demonstrated that the promoter regions of hk genes are likely to be relatively nucleosome - free, a finding that may help to explain the wide tissue distribution of their expression . This is in contrast to those of ts genes, whose promoter regions contain sequences more favorable for nucleosome formation (28,29), and which are therefore likely to require additional ts transcription factors to modify or displace nucleosomes before the genes can be expressed . The promoter regions of the two sets of genes differed in base composition and in how many of them had cpg islands (31,32). The gc content of the promoter regions of hk genes was 56.86%, compared with 50.44% for ts genes . Cpg islands were characteristic of 92 of 100 hk genes, but only 19 of 100 ts genes, in agreement with the observations of others (32). The greater frequency of nxss of the [(g / c)3n2]3 type in hk - gene promoter regions compared with ts - gene promoter regions is partly a reflection of the higher gc content of the former (56.86% g + c in hk, 50.44% g + c in ts). However, the average number of [(g / c)3n2]3 sequences in hk - gene promoter regions, 15.4, was even higher than the 7.8 22.7 (s.d .) Expected in random sequences of the same length and base composition (p <0.05). In addition, in spite of their higher gc content, hk - gene promoter regions had almost as many nucleosome - unfriendly polya and polyt tracts as did the ts - gene promoter regions (50 in hk, as compared with 52 in ts). These two observations show that the frequency of both types of nxs in hk - gene promoters is higher than would be expected from their base composition, suggesting a functional significance, possibly related to nucleosome exclusion . It may be speculated that one component of such selection is for sequences that tend to exclude nucleosomes . Another possible component is selection for gc - rich sequences that bind certain ubiquitous transcription factors, such as sp-1 . These two components of selection might be related, in that the factors that regulate expression of hk genes may have evolved to bind to nucleosome - free regions . We were unable to find any correlation between accessibility score and expression levels of these genes as given in symatlas (22) (see supplementary figure 3). It is likely that the lower nucleosome occupancy of promoter regions of hk genes is related not to their expression levels but primarily to their ubiquity of expression in different tissues . The nxsensor web tool is flexible enough to allow for different definitions of regions likely to be free of nucleosomes and more accessible to other protein factors . Nxsensor can be set for more stringent exclusion criteria by increasing the number of tandem nxss required for nucleosome exclusion . The minimum length of nucleosome - free sequence can be increased to accommodate the space required for larger protein complexes, an approach we took to show that the region immediately surrounding tsss of hk genes is likely to be more accessible to the basal transcription apparatus than is the corresponding region of ts genes . Here we have applied nxsensor to the promoter regions of individual genes and classes of genes . Nxsensor may also be used to investigate other control regions farther from coding sequences, such as enhancer and inhibitor regions, as well as sites of methylation, imprinting, recombination, repair, pre - mrna splicing and indeed any dna sequences where nucleosome location is likely to be a factor in overall chromatin organization and function (3338). Nxsensor output for two promoter regions, 1000 to + 1000 relative to the major tss, which is highlighted in green . Left column: hk gene rbpms, rna - binding protein; right column: ts gene f12, coagulation factor xii . Top, nucleosome - segment output: shaded regions show where nucleosomes are more likely to be located, unshaded regions are more likely to be nucleosome - free; bottom row, locations of nxss . Average number of exclusion sequences per window of 147 bases in 100 hk (solid blue line) and 100 ts (dashed red line) promoter regions centered on the tss . Also shown as thinner horizontal straight lines are the expected numbers of exclusion sequences in a random - sequence of the same base composition as that of the sum of the promoter regions in each class . The average number of observed exclusion sequences in a window centered at tss is 2.10 for hk promoters, which is significantly higher (p = 0.0014) than the expected number of 0.53 in a random - sequence of the same composition . Similarly, for ts promoters, the average number of observed sequences in a window centered at tss is 0.82, which is higher than the expected number of 0.22 in a random - sequence of the same composition, at the significance level of p = 0.06 . (a) accessibility scores acc(10) for promoter regions, 1000 to + 1000 relative to the tss . Open circles, hk - gene promoter regions; dots, ts - gene promoter regions . (b) accessibility scores acc(50) in the vicinity of the tss segment, 110 to + 60 (accessibility to the basal transcription apparatus).
The term mucosa - associated lymphoid tissue (malt) lymphoma was first coined by isaacson and wright1 in 1983 . Malt lymphomas can occur in many locations, including the gastrointestinal tract, salivary glands, thyroid, lung, and breast . It is histologically characterized by lymphoepithelial lesions and lymphoplasmic epithelial invasion.1,2 lymphomas that occur in the colon account for 10% to 20% of lymphomas of the gastrointestinal tract, 2.5% of all lymphomas, and 0.2% to 0.6% of colorectal malignant tumors, and thus, are rare.2,3 most of the colonic malt lymphomas present as a nonpedunculated protruding polypoid mass and/or ulceration . Cases of primary colonic malt lymphoma reported in korea have presented as multiple submucosal tumors (one case),4 a nonpedunculated protruding polypoid mass (four cases),5,6,7,8 obstructive lesions of the colon caused by mucosal edema or a tumor (two cases),9,10 or mucosal discoloration (one case).11 here, we report the case of a colonic malt lymphoma presenting as a semipedunculated polyp that was removed by endoscopic mucosal resection (emr). A 54-year - old man visited daegu catholic university hospital after a screening colonoscopy that revealed a sigmoid colon polyp that was diagnosed pathologically as a tubular adenoma . He denied other symptoms such as abdominal pain, weight loss, fever, general weakness, loss of appetite, or hematochezia . His blood pressure was 106/64 mm hg, pulse rate 73 beats per minute, respiratory rate 20 breaths per minute, and body temperature 36.7. his consciousness was clear, and no lymphadenopathy was evident in the head and neck, axillary, or inguinal region . The laboratory findings were as follows: white blood cells, 11,400/mm (neutrophils 81.8%, eosinophils 0.4%, lymphocytes 12.4%); hemoglobin, 13.4 g / dl; and platelet count, 202,000/mm . The blood chemistry test showed the following results: aspartate aminotransferase, 16 iu / l; alanine aminotransferase, 21 iu / l; total bilirubin, 0.6 mg / dl; alkaline phosphatase, 129 iu / l; total protein, 6.5 g / dl; albumin, 4.4 g / dl; blood urea nitrogen, 12.2 mg / dl; creatinine, 0.9, mg / dl; na, 139 meq / l; k, 3.4 meq / l; and cl, 98 meq / l . The serum carcinoembryonic antigen level was 2.69 ng / ml, which was within the reference range . Colonoscopy revealed a semipedunculated polyp, approximately 2 cm in size, in the sigmoid colon . In private clinics, the tumor was diagnosed as a tubular adenoma; however, a diagnosis of submucosal tumor was not completely ruled out . We performed emr by en bloc resection of the polyp with a flex knife and a snare after injecting a glycerin solution into the submucosa (fig . Resected specimens histologically showed lymphoepithelial lesions with diffuse proliferation of atypical lymphocytes, which immunohistochemically stained positively for cd20, cd5, and bcl-6, but negatively for cd3, bcl-2, and cyclin d1 . These findings were compatible with low - grade b - cell malt lymphoma (fig . 2). There was no evidence of lymph node metastasis or involvement of any other organ, except for a gallstone, in the thoracic and abdominal computed tomography performed for staging . According to the ann arbor staging system, the resected lesion was replaced with normal mucosa on sigmoidoscopy 2 months after the emr (fig . Malt lymphoma, a subtype of non - hodgkin lymphoma, is classified as an extranodal marginal zone b - cell lymphoma and is a lymphoepithelial lesion characterized by epithelial infiltration by lymphoplasma cells.1,2 malt lymphoma of the stomach is known to be associated with helicobacter pylori infection,11 whereas nongastric malt lymphomas have been associated with borrelia burgdorferi, chlamydia psittaci, hepatitis c virus, campylobacter jejuni, and autoimmune disease.12 colonic malt lymphoma occurs at an average age of 59.8 years and shows no sex preference . Clinically, it is usually asymptomatic or present with nonspecific symptoms such as bloody diarrhea and/or abdominal pain . However, in some rare cases, intestinal obstruction or intussusception can appear.9,10,13,14 systemic symptoms such as fever and weight loss are rare because most malt lymphomas are well localized and slow growing.12 according to endoscopic findings, a malt lymphoma of the colon usually appears as a sessile protruding lesion or ulcerative lesion, and the former is approximately 10 times more common than the latter.14,15 sites of tumor growth have been reported to be the cecum (71.5%), rectum (16.9%), and ascending colon (6.2%); however, the sigmoid colon is only rarely affected.16 eight cases have been reported in korea, and these are summarized in table 1 . These cases manifested as polypoid lesions, neoplastic lesions, and protruding lesions in the form of submucosal tumors,4,5,6,7,8,10 but only rarely in the form of luminal stenosis caused by thickening of the large intestine wall or a color change of the mucosa.9,11 both neoplastic and polypoid lesions are sessile and accompanied by ulcers or nodularities in the mucosal lesion.5,6,7,8,10 in terms of regions of occurrence, five cases have been reported in the rectum,4,5,6,7,11 five cases in the appendix or ileocecal valve,5,6,8,9,11 and two cases in the ascending colon.6,9 accordingly, a malt lymphoma presenting as a semipedunculated polyp in the sigmoid colon is extremely rare . A malt lymphoma can be diagnosed during surgery or endoscopic biopsy . In the case of endoscopic biopsy, the submucosa must be collected because lymphomas can be limited to this region.4 in the present case, the tumor was diagnosed as a malt lymphoma by emr, which included the submucosal tissue, whereas it had been diagnosed as a tubular adenoma at private clinics . The specific histological findings of malt lymphoma include lymphoepithelial lesions by lymphoplasmic epithelial invasion, centrocyte - like cells, and reactive lymphoid follicles . Plasma cell differentiation is observed in one - third of all malt lymphomas.17 however, it is difficult to differentiate malt lymphoma and follicular lymphoma in the presence of multiple lymphoid follicles.14 moreover, malt lymphoma is often confused with mantle cell lymphoma because of their histologic similarities . However, malt lymphoma usually presents as a single lesion, whereas mantle cell lymphoma presents as multiple lymphomatous polyposis in the gastrointestinal tract and without lymphoepithelial lesions.18 immunohistochemically, these two types can be differentiated by the cyclin d1 status because malt lymphomas and mantle cell lymphomas are immunonegative and immunopositive for cyclin d1, respectively.14 in our case, histological findings showed that lymphoepithelial lesions were caused by the invasion of the mucosa by atypical lymphocytes, and that they were cyclin d1 negative with a ki-67 labeling index of 10% to 20%, which indicated a diagnosis of low - grade malt lymphoma . Because of the lack of an accepted etiology and the limited number of cases, no guideline has been issued for the treatment of colonic malt lymphomas . Locally extended low - grade malt lymphomas are currently treated by endoscopic or surgical excision, whereas high - grade malt lymphomas and malt lymphomas with multiple organ involvement may be treated using different modalities such as surgery, radiotherapy, chemotherapy, and, more recently, rituximab therapy.5 however, there is no standard treatment . Some have reported that antibiotic treatment against h. pylori is effective for colonic malt lymphoma, and that this treatment influences even h. pylori - negative patients,19 which suggests that some strains sensitive to antibiotics for h. pylori eradication contribute to malt lymphoma development in these patients . Grunberger et al.20 reported that the administration of antibiotics against h. pylori was ineffective in h. pylori - positive malt lymphoma patients with extragastric involvement . Some case reports published in korea have addressed the efficacy of h. pylori treatment in malt lymphoma . However, the results in these cases were inconclusive as the presence of h. pylori infection was uncertain and the patients had undergone radiotherapy.7 therefore, the efficacy of h. pylori treatment in malt lymphoma requires further study . Our patient was not tested for h. pylori, and because malt lymphoma was localized to the sigmoid colon, no measures other than endoscopic mucosal excision were performed . In the described case, malt lymphoma presented as a semipedunculated polyp during colonoscopy, and diagnosis and treatment planning were performed on the basis of the results of emr . More case reports and studies about colonic malt lymphoma presenting with variable morphology are needed to establish guidelines for the treatment of colonic malt lymphomas in the near future.
Autogenous grafting is the most commonly used surgical procedure for bone reconstruction due to its advantages in comparison with other graft materials, such as biocompatibility and bone regeneration potential . Several possibilities are reported by the literature for atrophic jaws reconstruction, and among these solutions it is possible to cite intra and extra - oral autogenous grafts, allografts, alloplastic and xenogenic grafts, with or without the use of membranes for guided bone regeneration . Autogenous bone grafts are considered the most suitable for the reconstruction of defects at oral and maxillofacial regions, mainly due to their characteristics of osteoinduction and osteoconduction . It is the only type of graft that provides live immunocompatible bone cells, essential to the stage i of osteogenesis . This makes this type of graft more advantageous, since the higher the amount of transplanted living cells, the higher the possibility of new bone formation . Graft fixation is a fundamental procedure for the normal process of bone regeneration . In the last decade, plates and screws, represented by metallic and biodegradable materials, have been used preferably for obtaining graft stability as well as for fixation of fractures of the whole craniofacial bone . This is due to the fact that these materials provide a rigid fixation with tridimensional control of the bone position . On the other hand, disadvantages such as inflammatory reactions, bone displacement and technical difficulty have guided medical and dental researchers to the search for an alternative method for graft fixation, and, in this field, tissue adhesives are a resource potentially capable of providing stability for the healing process . Tissue adhesives based on cyanoacrylate (ca) are substances that have been successfully employed for skin laceration synthesis and surgical incisions, as well as for the stabilization of thin bone fragments in orbital fractures and osteochondral fractures . The most interesting properties of the adhesives are their rapid polymerization, strong adhesion to the surfaces where they are applied, biocompatibility, bacteriostatic and hemostatic actions, besides being a quick and atraumatic fixation method . Ethyl - ca, which is a short chain ca, was one of the first adhesives to be tested for medical use, presenting excellent adhesive strength . However, its apparent toxicity to soft tissues conducted the researches for adhesives of longer chain, such as butyl and octyl - ca, which present higher biocompatibility . In spite of these findings, the adhesive capacity of ethyl - ca has still been tested for biological use in bone tissue fixation, with satisfactory results . Generally, few studies have investigated the ca behavior on mineralized tissues fixation . The purpose of this study was to perform histological and histometric analyses of the repair process of autogenous bone grafts fixed at rat calvaria with ethyl - ca adhesive this study was approved by the institutional research ethics committee (protocol #2008 - 005587). Thirty - two male adult rats were used (rattus norvegicus albinus, wistar)) with mean weight of 250 g, divided into 2 experimental groups of 16 animals each: group i - control and group ii - adhesive . During the whole experiment, the animals were kept in cages at the vivarium of the department of surgery and integrated clinics and fed solid animal chow (guabi nutrilabor, mogiana alimentos, so paulo, sp, brazil) and water ad libitum, except in the fasting period (14 - 16 hours) that preceded the surgical procedure, in which they received only water . After anesthesia with intramuscular xylazine hydrochloride (0.2 ml/250 g) (xilazin, syntec do brasil ltda, cotia, sp, brazil) and ketamine hydrochloride (cetamin, syntec do brasil ltda, cotia, sp, brazil) (0.1 ml/250 g), shaving and antisepsis were accomplished with 10% pvp - i in the frontoparietal region . The animals received an approximately 20-mm - wide mid - longitudinal incision in the scalp over the sagittal calvarial suture, followed by soft - tissue dissection, exposing the parietal bones . In each animal, a rounded osteotomy was made in the right parietal bone with a 4-mm - diameter trephine bur at low speed under constant saline irrigation to obtain a rounded bone fragment, preserving the integrity of the dura mater and brain . The defect was kept with the cavity covered by blood clot and was not examined . In the left side, at the site that would receive the graft, the parietal bone was decorticalized with a #8 spherical bur at low speed . In group i, the graft was only positioned at the recipient site, without any type of fixation material . In group ii, the graft was fixed with ethyl - ca adhesive (super bonder; loctite - henkel, itapevi, sp, brazil) applied with a microbrush . The flap was repositioned and sutured with continuous spiraled suture using mononylon 5 - 0 (mononylon, j&j ethicon, so jos dos campos, sp, brazil). The animals were euthanized by anesthetic overdose at 10 and 30 postoperative days (8 animals / period). The calvaria were removed and the left parietal bones were separated, preserving the supraperiosteal soft tissues . The pieces were fixed in 10% formaldehyde and subjected to routine laboratorial processing . Six - micrometer - thick cross sections were obtained and stained with hematoxylin and eosin for histological and histometric analyses . In the histological (qualitative) analysis, the graft / recipient site interface, the presence of the following items was assessed: adhesive fragments, inflammatory infiltrate, fibroblastic proliferation and new bone and capillary formation, in superficial and deep tissues . In the histometric (quantitative) analysis, the slides were examined in an optical microscope (aristoplan - leitz, leica, wetzlar, hesse, germany) at 2.5x magnification, through a camera (axio cam mrc5, zeiss, santo amaro, sp, brazil) connected to a computer . Using the axiovision 4.5 software, the images were converted into digital " tif " files, standardizing the height, width and number of pixels per inch . The bone graft size at 10 and 30 days was quantified in pixels, using the imagelab 2000 software (diracon bio informtica ltda, vargem grande do sul . The evaluation was performed by a single trained examiner and the measurements were done at three different moments, with an interval of 1 week between the evaluations . The mean of these three values was assigned to each slide, and the value was used for statistical analysis . Statistical analysis was accomplished with gmc 9 software (statistical software created by prof . Initially, data were submitted to normal curve adherence test, which showed a non - parametric behavior . Thus, kruskal - wallis test was used to compare the data at 10 and 30 days . All animals tolerated well the experimental procedures in such a way that, at 10 days after postoperatively, the soft tissues handled during the surgical procedures were already healed, with an aspect of normality and without signs of infection or wound dehiscence . Underneath, the graft was observed, with most of its osteocyte lacunae filled by osteocytes . At the interface between the graft and the recipient site, it was possible to observe a thin layer of compact fibrous connective tissue and areas of bone remodeling both at the graft and the parietal bone . At the peripheral regions, new bone formation, with primary bone tissue (asterisks), from the graft fragment (bone graft - bg) and parietal bone (hematoxylin - eosin original 160x) superficially, it was possible to observe a thin fibrous capsule covering the bone graft . In most specimens, a predominance of lymphocytes together with a large number of neutrophils was observed . Adjacent to the fibrous capsule it was possible to notice the bone graft with its osteocyte lacunae containing basophilic nucleus . Several bone lacunae were found into the grafts containing multinucleate cells, and, in most of the specimens, a large number of neutrophils . Deeply and adjacent to the graft, fragments of ca were observed filling the space between the graft and the recipient site . Adjacent to the bone surface of the recipient site, there were several resorption areas with a large number of osteoclastic - type multinucleate cells . A large number of lymphocytes and neutrophils were observed into the medullar spaces of the bone tissue . Few fibroblasts could be identified, with a predominance of resorption areas concerning new bone formation areas . It was still possible to observe the absence of a bone union between the bone graft and the recipient site (figure 2). Group ii 10 days: bone graft (bg) with osteocyte lacunae containing basophilic nucleus . Fragments of cyanoacrylate (ca) are observed filling the space between the bone graft and the recipient site and discrete areas of new bone formation (bn) can be observed in the recipient site (hematoxylin - eosin - original 63x) at 30 days, the periosteum layer over the graft showed no signs of hyperplasia, and presented a discrete inflammatory infiltrate . Bone graft was attached to the recipient site through newly formed bone tissue at the interface region . In several specimens, this new bone formation occurs only at the central third of the graft, and their margins remained joined to the donor area by a compact connective tissue (figure 3). The graft had an aspect of mature bone, well vascularized and with osteocyte lacunae filled by osteocytes in havers systems . Group i 30 days: bone graft (bg) incorporated to the recipient site . New bone formation at the interface observed only at the graft central region, where the extremities remained filled by fibrous connective tissue (hematoxylin - eosin original 100x) in all specimens, a fibrous capsule covered the bone graft . Underneath the fibrous capsule, graft presents some areas of bone resorption in its external surface, with some osteoclastic - type multinucleate cells . These resorptions could also be observed into the bone fragment . In the graft proximal areas, in some specimens, a bone union with the recipient site was observed; however, in most of the animals, this union could not be identified, because the region was filled with a lymphocyte - type inflammatory infiltrate, some blood vessels and several collagen fibers that maintained continuity with the capsule collagen fibers . Discrete areas of new bone formation were observed in the internal surfaces of the grafts, surfaces that were in contact with the ca . More deeply, between the graft and the recipient site, a space filled with a great amount of ca was observed . In several areas, multinucleate cells could be identified, mainly in the regions adjacent to the graft proximal surface (figure 4). Few areas of newly formed bone were observed in this space until the time period studied . Regarding the recipient site, resorption areas and new bone formation areas group ii 30 days: underneath, bone graft is linked to the recipient site only in the graft margin . Areas of new bone formation (bn) are observed in the internal surfaces of the grafts and in the recipient site . A space filled by a high amount of cyanoacrylate (ca) remains between the graft and the recipient site with a discrete inflammatory infiltrate (hematoxylin - eosin - original 63x) group ii 30 days: new bone formation observed between the bone graft and the recipient site, in contact with the cyanoacrylate (ca) (hematoxylin - eosin - original 160x) the mean bone graft sizes (in pixels) were 319,865 (21,611) and 302,268 (18,099) for group i at 10 and 30 days, respectively, and 273,149 (19,178) and 250,391 (25,127) for group ii at 10 and 30 days, respectively (figure 6). In the statistical analysis, when both results from 10 and 30 days were compared, there was no statistically significant difference between groups i and ii (p<0.05). Area of the bone graft fragment in groups i and ii at 10 and 30 days underneath, the graft was observed, with most of its osteocyte lacunae filled by osteocytes . At the interface between the graft and the recipient site, it was possible to observe a thin layer of compact fibrous connective tissue and areas of bone remodeling both at the graft and the parietal bone . At the peripheral regions, . New bone formation, with primary bone tissue (asterisks), from the graft fragment (bone graft - bg) and parietal bone (hematoxylin - eosin original 160x) superficially, it was possible to observe a thin fibrous capsule covering the bone graft . In most specimens, a predominance of lymphocytes together with a large number of neutrophils was observed . Adjacent to the fibrous capsule it was possible to notice the bone graft with its osteocyte lacunae containing basophilic nucleus . Several bone lacunae were found into the grafts containing multinucleate cells, and, in most of the specimens, a large number of neutrophils . Deeply and adjacent to the graft, fragments of ca were observed filling the space between the graft and the recipient site . Adjacent to the bone surface of the recipient site, there were several resorption areas with a large number of osteoclastic - type multinucleate cells . A large number of lymphocytes and neutrophils were observed into the medullar spaces of the bone tissue . Few fibroblasts could be identified, with a predominance of resorption areas concerning new bone formation areas . It was still possible to observe the absence of a bone union between the bone graft and the recipient site (figure 2). Group ii 10 days: bone graft (bg) with osteocyte lacunae containing basophilic nucleus . Fragments of cyanoacrylate (ca) are observed filling the space between the bone graft and the recipient site and discrete areas of new bone formation (bn) can be observed in the recipient site (hematoxylin - eosin - original 63x) at 30 days, the periosteum layer over the graft showed no signs of hyperplasia, and presented a discrete inflammatory infiltrate . Bone graft was attached to the recipient site through newly formed bone tissue at the interface region . In several specimens, this new bone formation occurs only at the central third of the graft, and their margins remained joined to the donor area by a compact connective tissue (figure 3). The graft had an aspect of mature bone, well vascularized and with osteocyte lacunae filled by osteocytes in havers systems . Group i 30 days: bone graft (bg) incorporated to the recipient site . New bone formation at the interface observed only at the graft central region, where the extremities remained filled by fibrous connective tissue (hematoxylin - eosin original 100x) in all specimens, a fibrous capsule covered the bone graft . Underneath the fibrous capsule, graft presents some areas of bone resorption in its external surface, with some osteoclastic - type multinucleate cells . Proximal areas, in some specimens, a bone union with the recipient site was observed; however, in most of the animals, this union could not be identified, because the region was filled with a lymphocyte - type inflammatory infiltrate, some blood vessels and several collagen fibers that maintained continuity with the capsule collagen fibers . Discrete areas of new bone formation were observed in the internal surfaces of the grafts, surfaces that were in contact with the ca . More deeply, between the graft and the recipient site, a space filled with a great amount of ca was observed . In several areas, multinucleate cells could be identified, mainly in the regions adjacent to the graft proximal surface (figure 4). Few areas of newly formed bone were observed in this space until the time period studied . Regarding the recipient site, resorption areas and new bone formation areas could be identified in some of the specimens (figure 5). Group ii 30 days: underneath, bone graft is linked to the recipient site only in the graft margin . Areas of new bone formation (bn) are observed in the internal surfaces of the grafts and in the recipient site . A space filled by a high amount of cyanoacrylate (ca) remains between the graft and the recipient site with a discrete inflammatory infiltrate (hematoxylin - eosin - original 63x) group ii 30 days: new bone formation observed between the bone graft and the recipient site, in contact with the cyanoacrylate (ca) (hematoxylin - eosin - original 160x) underneath, the graft was observed, with most of its osteocyte lacunae filled by osteocytes . At the interface between the graft and the recipient site, it was possible to observe a thin layer of compact fibrous connective tissue and areas of bone remodeling both at the graft and the parietal bone . At the peripheral regions, . New bone formation, with primary bone tissue (asterisks), from the graft fragment (bone graft - bg) and parietal bone (hematoxylin - eosin superficially, it was possible to observe a thin fibrous capsule covering the bone graft . In most specimens, a predominance of lymphocytes together with a large number of neutrophils was observed . Adjacent to the fibrous capsule it was possible to notice the bone graft with its osteocyte lacunae containing basophilic nucleus . Several bone lacunae were found into the grafts containing multinucleate cells, and, in most of the specimens, a large number of neutrophils . Deeply and adjacent to the graft, fragments of ca were observed filling the space between the graft and the recipient site . Adjacent to the bone surface of the recipient site, there were several resorption areas with a large number of osteoclastic - type multinucleate cells . A large number of lymphocytes and neutrophils were observed into the medullar spaces of the bone tissue . Few fibroblasts could be identified, with a predominance of resorption areas concerning new bone formation areas . It was still possible to observe the absence of a bone union between the bone graft and the recipient site (figure 2). Group ii 10 days: bone graft (bg) with osteocyte lacunae containing basophilic nucleus . Fragments of cyanoacrylate (ca) are observed filling the space between the bone graft and the recipient site and discrete areas of new bone formation (bn) can be observed in the recipient site (hematoxylin - eosin - original 63x) at 30 days, the periosteum layer over the graft showed no signs of hyperplasia, and presented a discrete inflammatory infiltrate . Bone graft was attached to the recipient site through newly formed bone tissue at the interface region . In several specimens, this new bone formation occurs only at the central third of the graft, and their margins remained joined to the donor area by a compact connective tissue (figure 3). The graft had an aspect of mature bone, well vascularized and with osteocyte lacunae filled by osteocytes in havers systems . Group i 30 days: bone graft (bg) incorporated to the recipient site . New bone formation at the interface observed only at the graft central region, where the extremities remained filled by fibrous connective tissue (hematoxylin - eosin original 100x) in all specimens, a fibrous capsule covered the bone graft . Underneath the fibrous capsule, graft presents some areas of bone resorption in its external surface, with some osteoclastic - type multinucleate cells . These resorptions could also be observed into the bone fragment . In the graft proximal areas, in some specimens, a bone union with the recipient site was observed; however, in most of the animals, this union could not be identified, because the region was filled with a lymphocyte - type inflammatory infiltrate, some blood vessels and several collagen fibers that maintained continuity with the capsule collagen fibers . Discrete areas of new bone formation were observed in the internal surfaces of the grafts, surfaces that were in contact with the ca . More deeply, between the graft and the recipient site, a space filled with a great amount of ca was observed . In several areas, multinucleate cells could be identified, mainly in the regions adjacent to the graft proximal surface (figure 4). Few areas of newly formed bone were observed in this space until the time period studied . Regarding the recipient site, resorption areas and new bone formation areas could be identified in some of the specimens (figure 5). Group ii 30 days: underneath, bone graft is linked to the recipient site only in the graft margin . Areas of new bone formation (bn) are observed in the internal surfaces of the grafts and in the recipient site . A space filled by a high amount of cyanoacrylate (ca) remains between the graft and the recipient site with a discrete inflammatory infiltrate (hematoxylin - eosin - original 63x) group ii 30 days: new bone formation observed between the bone graft and the recipient site, in contact with the cyanoacrylate (ca) (hematoxylin - eosin - original 160x) the mean bone graft sizes (in pixels) were 319,865 (21,611) and 302,268 (18,099) for group i at 10 and 30 days, respectively, and 273,149 (19,178) and 250,391 (25,127) for group ii at 10 and 30 days, respectively (figure 6). In the statistical analysis, when both results from 10 and 30 days were compared, there was no statistically significant difference between groups i and ii (p<0.05). Area of the bone graft fragment in groups i and ii at 10 and 30 days graft fixation has great importance in the graft resorption decrease, once the volume loss is variable and inconstant . (1990), the screwed internal rigid fixation enhances the life time of the onlay bone graft, decreasing its resorption when compared to the graft that is not fixed or stabilized by steel wire, mainly in great mobility areas . In the present investigation, it was not possible to use titanium screw for the graft fixation because the thin rat parietal bone makes impracticable its use . Thus, bone fragments fixed with the adhesive were compared to a group where the graft remained only juxtaposed to the recipient site . The partial graft resorption is a natural process during its remodeling stage; however, the presence of inflammatory reaction or micromovements tends to accelerate and intensify this process . It is important to emphasize that the bone graft at rat calvaria, as proposed in the experimental model of the present study, is not subjected to many movements; it is maintained in position and becomes properly incorporated to the recipient site, as observed in the control group at 10 and 30 days . Differently from the calvaria, in the mouth, the constant movements of the muscles and food, makes essential the fixation of the bone graft blocks . Graft stability is essential for the occurrence of revascularization and graft incorporation . According to clinical observations, the technique for using the adhesive was very simple, and, mechanically, the adhesive promoted a good adhesion of the graft to the recipient site . This was demonstrated by the fact that the bone fragment remained stable in both studied periods, confirming the good adhesive capacity of the ethyl - ca, which has been shown in previous studies . It has been reported that the smaller the ester chain, the higher its histotoxicity . However, regarding the inflammatory reaction provided by the adhesive, it was observed to be higher at 10 days . At 30 days, a low intensity inflammation exhibited foreign body - type multinucleate cells in areas adjacent to the ca fragments . These findings indicate that the intense inflammatory reaction, produced by the material, has a short duration . According to celik, et al . (1991), the inflammation is caused by a reaction dependent on tissue oxygen, explained by the transformation of the cellular membrane polyunsaturated fatty acids into hydroperoxide lipids, which increases the metabolism of the local arachidonic acid, unleashing the synthesis of tromboxane and prostaglandin . Clinical and experimental studies have demonstrated the adhesive efficacy to produce a stable union of bone segments, however, the histological still remain not conclusive . (2006), in a histomorphometric study utilizing rabbits as experimental models, fixed autogenous graft fragments in the calvaria with ethyl - ca adhesive . The results showed a discrete inflammatory infiltrate only at the first 15 postoperative days, which had totally receded at the posterior periods . In the present study, in fact however, the persistence of a discrete lymphocyte infiltrate associated with the presence of multinucleated cells, especially at the graft margins where the connective tissue was in direct contact with the adhesive, allow us to suggest that the material, though well tolerated, did not behave in a biocompatible way . (2006), our findings showed that the physical presence of ethyl - ca affected new bone formation . When ca fragments were suffering phagocytosis, granulation tissues containing fibroblasts, newly formed blood vessels and lymphocyte - type inflammatory infiltrate, were proliferating in the area . The formation of osseous trabeculae occurred after this migration, showing that the material did not have an osteoconductive or osteoinductive behavior, because it hampered the immediate new bone formation and graft incorporation to the recipient site . This fact, associated with the persistence of the discrete inflammatory process could explain the higher graft resorption observed at both 10 and 30 postoperative days . Polymer degradation would be necessary for a complete repair process, providing results similar to those provided by the conventional internal rigid fixation . However, as a great amount of ca was still observed in the graft / recipient site interface, further studies with longer experimental periods are suggested to determine the total bone filling of the area and the maintenance or not of the graft bone size . According to the methodology employed in this study, it was possible to conclude that, although allowing the maintenance and stability of the graft fragment at 30 days, the permanence of adhesive at the bone / graft interface did not allow graft incorporation to the recipient site, producing a low intensity but persistent local inflammatory reaction.
Aluminium (al) is ubiquitous in the environment and represents the third most common element in the earth s crust and it generally exists in a combined state with other elements . The problem of al contamination in our environment has been around for more than 25 years, despite which, it remains a neglected problem . In particular, al is found in materials used in the pharmaceutical industry, and in manufactured foodstuffs, cosmetics and tap water . By overcoming the body barriers, al can infiltrate into the blood and promote toxic effects in liver, bone and the central nervous system . When pregnant mice are exposed to al, the weights of the maternal spleen and liver increase, and their foetal top - to - heel lengths decrease, and again in pregnancy, the pro - oxidant effects of chronic al exposure disrupt normal development in baby rats . In rats exposed to al, it has been shown that al causes oxidative stress, and at high intraperitoneal doses al causes important morphologic and ultrastructural damage to the rat kidney, liver and testis [57]. One reason for this might be the increased oxidative stress due to erythrocyte al accumulation, with an induction of anaemia, potentially through the disruption of iron levels and alteration of iron homeostasis . As another systemic problem, the skeletal system is one of the targets of al toxicity, and al intake can lead to osteomalacia . However, one of the most sensitive targets of al toxicity is the nervous system . Neurotoxic effects of al have been indicated from various treatments with different salts of al that have resulted in oxidative damage to a range of cellular biomolecules, such as lipids, proteins and nucleic acids . This al toxicity has been shown to affect plants, animals and human, with its effects seen as disturbances to various second - messenger signalling systems in cells, including phosphoinositide - derived signalling and ca - signalling pathways, and in the formation of lipid peroxides . At the same time, although al absorption from the diet is low in animals and human, al can form complexes with citrate and transferrin, which can then cross the blood - brain barrier to affect the brain . After systemic intravenous al exposure in rats and rabbits, the extracellular al concentrations were seen to increase primarily in the frontal cortex and hippocampus of the brain . From further studies in rats, the neurochemical changes caused by al in the brain depend on the duration of the exposure and are region - specific, with memory and learning disorders being reported; in mice al has been shown to cause oxidative stress in the brain . When applied to cultured human brain cells, according to the time and concentration of the al exposure, reductions in cell growth rates were seen . In terms of the effects of al on the functions of the brain, in the rat, it was reported that the impaired neural function caused by al is related to its damage to intracellular ca homeostasis . This has been suggested to be linked to disturbed k and na currents, whereby al damages the rat hippocampal ca1 neurons, promoting further damage to the central nervous system . This appears to be mediated by changes in the amino - acid transmitters, with increases in glutamate and glutamine levels accompanied by a decrease in gamma - aminobutyric acid levels . This is again focused on the hippocampus, with spongiform changes to the neurons seen, which appear to be an important mechanism in al neurotoxicity . As further proposed mechanisms of al neurotoxicity in the rat, inhibition of acetylcholinesterase activity (enzyme rate; decreased vmax) has been reported in the brain, and disturbance of cellular communication through gap junctions in cultured foetal brain astrocytes . Similarly, in isolated cerebellar granule cell neurons, al neurotoxicity resulted in the formation of reactive oxygen species and elevated intracellular ca concentrations . The resulting cell death here was also not related to apoptosis, as there was no activation of caspase-3 or increase in annexin - v binding . Of particular relevance for the developmental aspects investigated in the present study, the use of the [al] radioisotope have provided a tracer to demonstrate that following its subcutaneous injection in pregnant and lactating rats, considerable amounts were then found in the brain (and particularly the cell nucleus fraction) of both the mother and foetus . Indeed, an earlier study investigating the effects of al in the ontogenetic development of cholinergic and serotonin neurotransmitter receptors in the brain demonstrated that not only is the time of exposure to al important for the effects seen, but also the timing of the exposure . Thus, this study saw reduced muscarinic and serotonin receptor sensitivities with post - natal exposure, but also a paradoxical increase in 5-ht2c receptor sensitivity in rats with prenatal exposure to high al concentrations (3000 ppm al sulphate in drinking water during pregnancy). In the present study, we therefore investigated the oxidative and histopathological damage induced by al during the development of the chick brain, as applied from the beginning of the incubation period of eggs of ross broiler chicks . Thirty - five fertilized ross broiler eggs (abalolu holding, izmir, turkey) were divided into 3 study groups: the control group (with no treatment; n=10), the sham treatment group (n=12), and the active treatment group (n=13). All of the eggs were placed in an egg incubator (vgs, veyisoullar, istanbul, turkey), and on the first day of the incubation (day 1), the sham group had 0.1 ml saline and the al - treated (active - treatment) group had 500 g al sulphate in 0.1 ml saline slowly injected into the air chambers; nothing was applied to the control group . At term (day 21), the eggs were opened and the live chicks (8/10, 8/12 and 8/13, respectively) were sacrificed under anaesthesia with 50 mg / kg ketamine and 5 mg / kg xylene (merck, germany). Their brains were then removed and divided into 2 parts, as the right and left hemispheres . The right hemispheres were used for the biochemical analyses, and the left hemispheres were used for stereological cavalieri brain volume estimations . During the study, all of the procedures were carried out in full accordance with the principles of the guide for the care and use of laboratory animals, on the protection of animals, and the study was approved by the pamukkale university experimental animals ethics committee . The malondialdehyde (mda) levels in the right hemisphere brain samples were determined using the method of okhawa et al . Each half - brain sample was homogenized in 150 mm potassium chloride solution using 10 up - and - down strokes . The assays for mda levels included: 0.4 ml brain homogenate, 1.5 ml 0.8% thiobarbituric acid, 1.5 ml 20% acetic acid (ph 3.5) and 0.2 ml 8.1% sodium dodecyl sulphate . These samples were mixed and incubated at 100c for 1 h. the absorbance was then measured at 532 nm . (1979), with some modifications . Briefly, after the homogenization of the samples as for the mda measurements, 0.5 ml homogenate was mixed with 3.0 ml deproteinization solution (5.13 m nacl, 0.2 m metaphosphoric acid, 6.8 mm edta in distilled water). Each sample was then centrifuged at 1000g for 5 min, and 0.5 ml of the supernatants were added to 2.0 ml 300 mm na2hpo4 and 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid) reagent (dtnb; ellman s reagent). After dissection and separation, the left chick - brain hemispheres were kept for 3 days in 10% formaldehyde . For brain - volume measurements, these brain hemispheres were rinsed in water and then dehydrated through a graduated ethanol series (70% to 100% ethanol). After being rinsed in xylene, systematically randomized coronal sections were taken from each brain block using a leica rm-2125 microtome (weltzlar, germany), on the basis of 15 equally spaced 5 m - thick sections . The brain volume estimations were carried out according to the cavalieri volume estimation formula: volume = (total point number) (point invasion area) (average section thickness). Points were counted on a monitor (sony trinitron kv-14lt1e tv, japan) according to uniform random placing, using a stereomicroscope (zeiss stemi 200-c, germany) and a camera (canon power shot g-2, tokyo, japan) attachment over the point catheter sections with a systematic uniform random quality . To have an acceptable coefficient of error in the volume estimations, 15 sections were used for each sample and approximately 250 points were counted for each . The data are given as means standard deviation, with box plot analyses given in the figures . The data were evaluated for significant differences among the groups using the mann - whitney u - test and kruskal - wallis tests . Thirty - five fertilized ross broiler eggs (abalolu holding, izmir, turkey) were divided into 3 study groups: the control group (with no treatment; n=10), the sham treatment group (n=12), and the active treatment group (n=13). All of the eggs were placed in an egg incubator (vgs, veyisoullar, istanbul, turkey), and on the first day of the incubation (day 1), the sham group had 0.1 ml saline and the al - treated (active - treatment) group had 500 g al sulphate in 0.1 ml saline slowly injected into the air chambers; nothing was applied to the control group . At term (day 21), the eggs were opened and the live chicks (8/10, 8/12 and 8/13, respectively) were sacrificed under anaesthesia with 50 mg / kg ketamine and 5 mg / kg xylene (merck, germany). Their brains were then removed and divided into 2 parts, as the right and left hemispheres . The right hemispheres were used for the biochemical analyses, and the left hemispheres were used for stereological cavalieri brain volume estimations . During the study, all of the procedures were carried out in full accordance with the principles of the guide for the care and use of laboratory animals, on the protection of animals, and the study was approved by the pamukkale university experimental animals ethics committee . The malondialdehyde (mda) levels in the right hemisphere brain samples were determined using the method of okhawa et al . Each half - brain sample was homogenized in 150 mm potassium chloride solution using 10 up - and - down strokes . The assays for mda levels included: 0.4 ml brain homogenate, 1.5 ml 0.8% thiobarbituric acid, 1.5 ml 20% acetic acid (ph 3.5) and 0.2 ml 8.1% sodium dodecyl sulphate . These samples were mixed and incubated at 100c for 1 h. the absorbance was then measured at 532 nm . (1979), with some modifications . Briefly, after the homogenization of the samples as for the mda measurements, 0.5 ml homogenate was mixed with 3.0 ml deproteinization solution (5.13 m nacl, 0.2 m metaphosphoric acid, 6.8 mm edta in distilled water). Each sample was then centrifuged at 1000g for 5 min, and 0.5 ml of the supernatants were added to 2.0 ml 300 mm na2hpo4 and 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid) reagent (dtnb; ellman s reagent). The malondialdehyde (mda) levels in the right hemisphere brain samples were determined using the method of okhawa et al . Each half - brain sample was homogenized in 150 mm potassium chloride solution using 10 up - and - down strokes . The assays for mda levels included: 0.4 ml brain homogenate, 1.5 ml 0.8% thiobarbituric acid, 1.5 ml 20% acetic acid (ph 3.5) and 0.2 ml 8.1% sodium dodecyl sulphate . These samples were mixed and incubated at 100c for 1 h. the absorbance was then measured at 532 nm . (1979), with some modifications . Briefly, after the homogenization of the samples as for the mda measurements, 0.5 ml homogenate was mixed with 3.0 ml deproteinization solution (5.13 m nacl, 0.2 m metaphosphoric acid, 6.8 mm edta in distilled water). Each sample was then centrifuged at 1000g for 5 min, and 0.5 ml of the supernatants were added to 2.0 ml 300 mm na2hpo4 and 0.5 ml 5,5-dithiobis-(2-nitrobenzoic acid) reagent (dtnb; ellman s reagent). After dissection and separation, the left chick - brain hemispheres were kept for 3 days in 10% formaldehyde . For brain - volume measurements, these brain hemispheres were rinsed in water and then dehydrated through a graduated ethanol series (70% to 100% ethanol). After being rinsed in xylene, systematically randomized coronal sections were taken from each brain block using a leica rm-2125 microtome (weltzlar, germany), on the basis of 15 equally spaced 5 m - thick sections . The brain volume estimations were carried out according to the cavalieri volume estimation formula: volume = (total point number) (point invasion area) (average section thickness). Points were counted on a monitor (sony trinitron kv-14lt1e tv, japan) according to uniform random placing, using a stereomicroscope (zeiss stemi 200-c, germany) and a camera (canon power shot g-2, tokyo, japan) attachment over the point catheter sections with a systematic uniform random quality . To have an acceptable coefficient of error in the volume estimations, 15 sections were used for each sample and approximately 250 points were counted for each . The data are given as means standard deviation, with box plot analyses given in the figures . The data were evaluated for significant differences among the groups using the mann - whitney u - test and kruskal - wallis tests . The al sulphate treatment of ross broiler chicks from the first day of incubation resulted in increased mda levels and decreased gsh levels, as indicators of increased biochemical oxidative damage . For mda, the mean (sd) levels for the control, sham and al treatments were 158.6 (41.2), 142.8 (107.2) and 423.7 (276.5) nmol / g tissue, respectively . As illustrated in the box plot in figure 1, this al - induced 2.7-fold increase in mda levels over the control treatment was significant when compared to both the control (p=0.001) and the sham (p=0.015) groups . The mean (sd) gsh levels seen for the control, sham and al treatments were 293.6 (51.4), 268.8 (41.1) and 184.6 (79.9) nmol / g tissue, respectively . Again, this 37% decrease in gsh levels over the control treatment was significant when compared to both the control (p=0.015) and the sham (p=0.038) groups (figure 2). In parallel, this al sulphate treatment resulted in decreased brain volume as a measure of the brain development in these ross broiler chicks . The mean (sd) total brain volume estimations according to the cavalieri volume formula (see methods) for the control, sham and al treatments were 10 354 (1158), 10 068 (900) and 8621 (1407) m . These thus demonstrated a significant 17% decrease in brain volume for the active - treatment group when compared to the control group (p=0.021), with this significance also maintained over the sham treatment (p=0.021) (figure 3). Of note, the comparisons between the control and sham treatment groups showed no significant differences for the mda and gsh levels, and for the brain volumes (figures 13). Similarly, there was no significant trend seen for the mortalities during the treatment period, indicating that the treatment with al followed in the present study did not result in significant embryo death over the non - treated and sham - treated samples . In the present study we focused in particular on the neurotoxic effects of al in terms of the growth and development of the brain, with the exposure of developing chicks to al . Indeed, in an in vitro study of the toxic effects of al on human embryonic cerebral neurocytes, increases in lipid peroxides were seen, which were indicative of the neurotoxic effects of al being caused by lipid peroxidation and the resultant damage to the membranes . Similarly, as indicated above, with the developing mouse brain, al exposure of the foetus via al treatment of the mother leads to inhibitory effects on post - partum development in general (seen as decreased weight and body length in the pups) and delayed neurobehavioral development . From a biochemical viewpoint, in the developing rat exposed to al from the treated mother through lactation, increased lipid peroxidation was seen in both the cerebrum and cerebellum of pup brains, which was accompanied by decreases in superoxide dismutase and catalase activities . In the present study, for our biochemical measures of mda and gsh, these have proven to be relevant biological measures for determination of lipid peroxidation and biochemical oxidative damage that can be caused by al not only in mouse and rabbit models, but also mainly in rat models [3,14,24,25,3241]. Furthermore, we have provided a more direct al treatment to the developing brain by use of this chick embryonic development model . Indeed, this model has been shown previously to be useful for measured dosing of various teratogenic effects of some heavy metals, or specifically in some more recent studies comparing herbicide and heavy - metal effects . Thus, although this model might not directly parallel the influence of these agents as environmental contaminants, it does provide for direct measured dosing of their absorption and monitoring of their effects on embryo development . At the same time, we also monitored neuronal degeneration as estimated stereologically using the cavalieri brain volume estimation tool . The increased lipid peroxidation and oxidative damage caused by al treatment in the chick embryonic development model in the present study support conclusions from other various animal models . In particular, along with the present study, a number of studies have investigated the whole brain, while others have investigated more specific areas of the brain . Thus these effects of al have been seen at the level of the cerebral cortex [3135,37,38,41], hippocampus, cerebellum, medulla oblongata, hypothalamus and brain stem . Thus the biochemical data for al treatment in this chick embryonic development model are in parallel with these indicators of increased lipid peroxidation and oxidative damage, although at this level it remains to be seen within which regions of the developing chick brain these neurotoxic effects might be focused . Histopathologically, al neurotoxicity appears to have been followed in fewer animal models . In the same rabbit study indicated above, the biochemical measures of mda and gsh were accompanied by morpho - pathological examination of the cerebral cortex and hippocampus by light and electron microscopy . In both brain areas, atrophy and neuron apoptosis were seen to be accompanied by neurofibrillary degeneration, argyrophilic inclusion, schwann cell degeneration, and nerve fibre demyelination . Similarly, histopathological examinations of the hippocampus in 2 rat models following al treatment showed marked changes in general brain histology, as indicated by an increased number of vacuolated spaces, and more specifically, effects on the neuronal connectivity in the hippocampus . With these al effects seen on the hippocampus, a brain - damage model for the investigation of learning and memory functions was recently reported that was established via intragastric administration of elemental al in adult rats . Similarly, adult mice and rats treated with alcl3 plus d - galactose now represent a model of alzheimer s disease due to the memory impairment and high amyloid beta - peptide levels found in the cerebral cortex and hippocampus . Thus, various studies in the literature using some specific adult animal models support these neurotoxic effects of al seen in the present study for this model of the developing chick brain.
Macula - on rhegmatogenous retinal detachment (rd) is a common cause of ophthalmic emergency that requires surgical treatment in a short period of time to prevent visual loss . The annual incidence of rd varies according to the recent references between 15.4 and 18.2 per 100 000, with a peak incidence of 52.5 per 100 000 people between 55 and 59 years of age . Myopia is a major risk factor, with a 4-fold higher risk of rd, compared with a nonmyopic eye, in eyes with mild myopia and a 10-fold higher risk in eyes with moderate and high myopia (greater than 3 diopters). The risk of rd is 4 times higher in patients who have undergone cataract surgery [5, 6]. The repair of rd has improved during the last 20 years, and today the goal is not only to reattach the retina but to achieve an adequate final vision . The development of better surgical techniques, such as scleral buckling, pneumatic retinopexy, and pars plana vitrectomy (ppv), has continued to improve the anatomical success rates, going up from 70% to 90% and achieving better functional outcomes [79]. Nevertheless, proper end vision recovery is a challenge in many cases of rd . Besides adequate anatomical reattachment, other clinical factors have been identified as determinants that prevent a good functional recovery . The status of the macula is the main factor for a successful functional result [1012]. Even in a successful rd surgery with a clinically normal macular area, poor visual acuity (va), color vision defects, and metamorphopsia have been described in successful postoperative rd macula - on surgeries, suggesting the existence of microstructural retina damage . Many series of cases have been reported with excellent anatomical results but not so for the functional outcome after rd surgery . In fact, many surgeons assume that having macula - on rd will always have a better visual function prognosis than those with macula - off . And there are few papers dealing with this topic . We performed a pubmed search for english language manuscripts reporting rd and macula - on functional outcomes published since 2003, and only 4 reports were identified [10, 11, 13, 14]. For this reason we have evaluated data collected in a prospective multicentric study including 17 centers in spain and portugal, with data from rds consecutively treated which was primarily designed to add more information on pvr development and clinical risk factors [1519]. The purpose of this report is to analyze those macula - on rd cases that were anatomical successful treated but experienced loss of vision at the third month of follow - up . Seventeen clinical ophthalmological institutions in spain and portugal participated in the study [1216]. As mentioned the project was designed to improve the sensitivity and specificity of a formula published by rodrguez de la ra et al . By using clinical factors for calculating the risk of developing proliferative vitreoretinopathy (pvr) after rd surgery . For that project, a database record was created collecting 83 variables that included all pre-, intra-, and postoperative characteristics . The study protocol was approved by the research committee of the coordinating institution (ioba, university of valladolid, spain) and by each of the participating centers . Informed consent was obtained from each patient before inclusion of his / her data in a common database . All patients consecutively admitted for surgery between october 2004 and february 2008 with rd and a minimum follow - up of three months were considered for inclusion . For this present analysis only patients with a macula - on rd at the time of the surgery and the macula - on during the entire follow - up were included . Cases of preoperative pvr grade c-1 or higher according to the retina society classification and posttraumatic rd were excluded . Patients with incomplete data regarding the status of the macula were also excluded from the final analysis . During the period of time when these patients were included, not all the centers had optical coherent tomography (oct) technology available, and it was not considered as a routine component of the rd patient examination . Therefore, the status of the macula was determined by indirect ophthalmoscopy and posterior biomicroscopy in the immediate preoperative period (less than 24 hours before surgery). From the rd patients included in the whole study, 357 had macula - on rds, and they were considered the subject sample of this study . The patients were divided into 4 groups for further analysis according to the status of the lens and the functional outcome after 3 months of follow - up . A reduction of at least one line of best corrected va (bcva) in the snellen chart at the third month of follow - up was considered as visual loss . Group 1 (g1, n = 357) included the whole sample of macula - on patients . Group 2 (g2, n = 53) included macula - on patients with reattached retina and who experienced visual loss at the third month of follow - up . Group 3 (g3, n = 39) included phakic eyes out of g2, and group 4 (g4, n = 14) involved the pseudophakic eyes out of g2 . The main preoperative characteristics recorded for g2, g3, and g4 were retinal breaks type (tear, hole, dialysis, and giant tear), size of retinal breaks in clock hours, extension of rd in quadrants, presence of preoperative pvr less than grade c, previous aphakia, previous vitreous hemorrhage, posterior vitreous detachment, myopia, and preoperative visual acuity (table 1). Only 27 out of the total 83 characteristics gathered in the whole study were used for the analysis of this report . Surgeons participating in the study were highly experienced in rd treatment and were allowed to treat their patients on their own criteria and according to their personal experience . The endotamponade with ppv was diverse, including none, air, sf6, c3f8, and silicone oil . Most of the technical details of the whole series have been already published [1520]. Anatomical success was defined as a reattached retina at the last postoperative follow - up at three months . Functional outcome was recorded as bcva with the snellen chart at the initial (preoperative) visit and at the final 3-month follow - up visit . For statistical analysis, bcva data were grouped into three ranges:> 20/40, 20/50 to 20/100, and <20/100 . Qualitative variables were described by percentages and quantitative ones by mean standard deviation (sd). In all cases, 95% confidence intervals (95%ci) were calculated . Contingency tables were constructed to evaluate the association between categorical rd characteristics and anatomical and functional outcomes . The independence was checked by chi - square test or fisher's exact test on sparse tables . Statistical analysis was conducted with spss (v.19, spss, chicago, il, usa) and r software . The average age of the g1 rd subjects was 52.9 15.6 years when the surgery was performed . The mean time between onset of rd signs or symptoms and surgery was 13.3 24.9 days, although all patients were macula - on at the time of surgery . Comparing the preoperative characteristics of the overall study patients, the g1 patients, all of whom were in the macula - on group, were statistically different for the following (table 2). (1) absence of clinical signs of pvr at the preoperative examination was more frequent in g1 . (2) rd with an extension of 1 quadrant was more frequent in g1 . (3) percentage of previous cataract surgery in g1 is slightly higher . (4) eyes without myopia were less frequent in g1 . And differences for the other pre-, intra-, and postoperative clinical characteristics were not statistically significant . The main preoperative characteristics in g1 compared to the whole study series cohort are shown in table 2 . In g1, 345 eyes (96.6%; 95%ci: 9498.2%) had reattached retinas at the end of follow - up . In 12 eyes, the central retina was not reattached; therefore, they were excluded from further analysis . Single reattachment procedures included ppv (67.2%; 95%ci: 62.172%), scleral buckle (57.7%, 95%ci: 52.4%; 62.9%), and explant (11.9%; 95%ci: 8.815.9%). The mean bcva in g1 was 0.57 0.3 in the preoperative visit and 0.59 0.29 at 3 months of follow - up . The preoperative va in g1 was <20/100 in 44 patients (12.3%; 95%ci: 8.9%, 15.7%), between 20/100 and 20/40 in 79 eyes (22.1%; 95%ci: 17.8%, 26.4%), and> 20/40 in 234 eyes (65.6%; 95%ci: 60.6%, 70.5%) (table 2). The postoperative va in this group at the end of the follow - up was <20/100 in 37 eyes (10.4%; 95%ci: 7.2%, 13.5%), between 20/100 and 20/40 in 80 eyes (22.4%; 95%ci: 18.1%, 26.7%), and> 20/40 in 240 eyes (67.2%; 95%ci: 62.4%, 72.1%). Twenty - six out of 37 eyes with a final va <20/100 (7.3%; 95%ci: 4.9%, 10.6%) had a decreased va at the end of the follow - up . In g2 (table 1), which included phakic and pseudophakic eyes with reattached retinas and visual loss, the final va, 0.23 0.14, was lower than the initial va, 0.65 0.25 (p <0.0001, paired t - test), despite reattachment of the retina . Ppv was the most commonly performed surgery (88.7%; 95%ci: 80.297.2%) followed by scleral buckle surgery (58.5%; 95%ci: 45.271.8%). In some cases, both procedures were used . In g3 (tables 1 and 3), which included 39 phakic eyes with reattached retinas but with a reduction in va at the end of follow - up, the mean time between onset of rd and surgery was 17.7 24.9 days . In the preoperative va evaluation, 82.1% of eyes (n = 32) had> 20/40 and none of them had <20/100 but at the end of the third month 30.8% (n = 12) had <20/100 . The main preoperative characteristics of this group were the following: (1) no pvr was present in 48.7%, whereas pvr grades a and b were present in 33.3% and 17.9%, respectively, (2) a visible retinal tear and a unique break were present in 97.4% and 52.6%, respectively, (3) rd extensions of 2 to 3 quadrants were found in 59% and complete posterior vitreous detachment (pvd) was present in 53,8% of eyes, and (4) ppv was performed on 87.2% (95%ci: 71.895.2%) of the patients and scleral buckle surgery on 64.1% (95%ci: 47.278.3%). Some patients received both procedures . In g4 (tables 1 and 4), which comprised 14 pseudophakic patients with macula - on and successful surgery but who had visual loss at the end of the follow - up, the average age was 63.3 14.4 years . The initial va was> 20/40 in 12 eyes (85.7%). At the end of the follow - up, the va was <20/100 in 50% and between 20/100 and 20/40 in 50% of the cases (table 4). Ppv was performed on 92.9% (95%ci: 85.9%; 99.8%) of the patients and scleral buckle surgery on 42.9% (95%ci: 29.5; 56.2%) (p <0.05). While there are published data regarding the improvement of anatomical results of rd surgery, there are few reports showing whether or not rd surgery results in functional improvement [911, 13, 14, 23, 24] and, to the best of our knowledge, there is only a report regarding visual loss in macula - on rd after successful surgery . For rd certain variables are thought to be significant predictors for functional outcome, for instance, the status of the macula (which is the most important factor), macular elevation when detached, and other factors such as age of the patient [9, 25], poor initial vision [9, 25], and interval between onset of rd and surgery [23, 2729]. It is generally assumed by most surgeons that the macula - on status before surgery guarantees good functional results, which in most cases means to preserve the patients previous va . However, we have experienced macula - on rd cases in which despite successful surgery the visual results were not favorable . This experience is common among the retinal surgeons but as mentioned there is no specific publication on this topic . Thus, although the original study was not specifically set up to investigate this event, we used its data to analyze the frequency of unfavorable outcomes and to add some clinical information . In this study, 53 out of 357 patients (14.9%; 95%ci: 11.419.1%) meeting the inclusion criteria experienced a worsening of va after rd surgery although the macula was attached . The american academy of ophthalmology has recognized that the status of the macula is the major factor related to visual prognosis . It recommends that when the rd does not affect the macula, repair should be made within the first 24 hours following the diagnosis . In our series, the mean time between the onset of the symptoms and surgery was 13.3 24.9 days . Nevertheless, the surgery was always performed within 72 hours after the admittance at the hospital, although symptoms started several days before . Because the central vision was not affected by the rd, it is likely that both the patients and the general practitioners underestimated the severity of the disease and that may explain the delayed diagnosis . In addition, photopsias could appear several days or even weeks before the development of rd . This long interval before surgery was already mentioned by our group and could be a fact related to the structure of the national health system, where most of the patients complaining floaters or flashes are referred to the general practitioner instead of ophthalmologist (gp) [16, 30]. It is acknowledged that the time interval to surgery is crucial to prevent progression of subretinal fluid into the macula and disruption of the photoreceptors, causing a possible loss of va in some cases . For our patients with macula - on rds, the evaluations were made only by indirect ophthalmoscopy or fundus biomicroscopy at 24 or 48 hours prior to the surgery . Thus, it is possible that we could not detect the presence of a small amount of subretinal fluid under the macula as a limitation of this study . It is possible that systematic analysis of the status of the macula by oct may increase the number of macula - off patients and also that structural changes in patients with visual loss could be detected . Recent studies used fourier - domain oct to evaluate postoperatively both macula - on and macula - off rds [32, 33]. Foveal anatomical abnormalities were discovered in 62% of the patients . In macula - off cases, there was disruption of the photoreceptor inner segment / outer segment (is / os) junction line (which correspond to the ellipsoid portion of the photoreceptors: ellipsoid) in 61% of the cases, and the external limiting membrane (elm) was observed only in 24% . When followed up overtime, the restoration of a normal is / os line occurred only in eyes without an initially disrupted elm as the investigators also noted . Eyes in which the is / os junction returned to normal showed better va than those in which this change did not take place . It is important to take into consideration, however, that although oct is currently a widespread tool, it could take time until patient performs it . Considering the timing for the management of this kind of rd, oct become sometimes indispensable auxiliary test . As mentioned we did not perform oct on patients preoperatively to rule out a subclinical extension of subretinal fluid under the fovea, a reason which could explain why some eyes with similar alterations have functional results significantly better than others . For phakic eyes that experienced loss of vision in spite of successful surgery, especially in those operated by vitrectomy, it is possible that the low vision could have been caused by the progression of cataracts . However, there were 14 pseudophakic eyes in the g4 group that experienced visual loss that could not be attributed to progression of lens opacity . Some factors such as intraoperative complications like rise intraocular pressure (iop) and microscope light toxicity during the surgery, as well as the use of silicon oil or gas as tamponade, could have produced retinal damage, causing a reduction in the inner retinal thickness due to neuronal cell loss in the macular area . However, no postsurgical rise in iop was detected in this series and no one received silicon oil tamponade in these groups, so these variables can be safely excluded as the cause of visual loss in our patients . Neither epiretinal membranes nor cystoid macular edema, which are also causes of visual loss after rd surgery, was identified in the follow - up . When these conditions were suspected most of the patients were evaluated by oct, when possible . As no clinical differences were found between groups, further investigations should elucidate if causes of visual loss are related to a gross anatomic factor or could be a photoreceptor damage caused by diffusible factors released by ischemic detached retina . In fact oxidative damage and tnf- are factors used experimentally for inducing damage to the rpe cells and photoreceptors . Finally, analysis of retinas after experimental retinal detachments in cats reveals that ultrastructural changes (apoptosis, gliosis) occur beyond the specific area of the detached retina . These changes could be one the reasons of the impairment of vision in our patients . First is that the study design was not intended to solve the question of vision loss in patients with macula - on rd, but, in view of the lack of reports on va loss after macula - on rd surgery, we have considered that our data could be interesting . Second limitation is that at the time of inclusion of patients oct was not available in all centers, and those having this technology had no similar equipment . So there is no way to know for sure if the data may be extrapolated to other geographical areas, although our retina 1 project reports have yielded similar results of rd surgery to those obtained by other neighboring countries [9, 12, 35, 40]. In summary, we have added information on the prevalence of the clinically significant loss of va following rd with macula - on surgery, a condition affecting a relevant percentage of patients . Neither clinical nor surgical factors were identified as responsible . This topic deserves further study, incorporating new technical devices such as swept source oct that is able to identify structural changes at the level of the inner retina . Biochemical studies could also elucidate in the future whether or not any molecule released by the detached retina may be responsible for this damage.
Reactive oxygen species (ros), normally produced during the aerobic metabolism, function as second messengers involved in many cellular functions . On the other hand, when ros level increases because of oxidant treatments and/or defective antioxidant systems, these highly reactive compounds and radicals become dangerous toxic agents . In fact, ros may cause severe damages to several cellular macromolecules, including proteins, lipids, and dna, thus contributing to the development of many pathological conditions . Indeed several evidences have been reported, indicating that the redox homeostasis is a finely regulated mechanism involved in normal cellular functions and prevention of several stress - associated pathologies . Many drugs have toxic side effects, because they provoke an imbalance of the intracellular ros level . In the past, cellular death due to a chemical injury was frequently linked to a necrotic process; now, it is clear that the main effect provoked by several drugs is the programmed cell death . Diclofenac, a nonsteroidal anti - inflammatory drug (nsaid) widely used in clinical therapeutics, has cytotoxic effects and induces apoptosis in many cultured cell lines [3, 4]., many experimental, epidemiologic and clinical studies suggest that nsaids, and in particular the highly selective cyclooxigenase-2 inhibitors, could act as anticancer agents [5, 6]. It has been reported that a combination of a specific nsaid and certain anticancer drugs has potential clinical applications . For instance, diclofenac potentiates the chemotherapeutic effects of some drugs in neuroblastoma cell lines . However, little is known about the effect of this nsaid on nervous cell lines, because most of the studies on this compound regard hepatic, gastric, or kidney cells [3, 4, 9]. In particular, ros are involved in the diclofenac - induced apoptosis of cultured gastric cells as well as in nephrotoxicity in vivo [9, 10]; furthermore, an oxidative injury causes the mitochondrial permeability transition in diclofenac - treated hepatocytes . However, the molecular mechanisms underlying the induction of apoptosis by diclofenac have not been clarified in neuronal cells . In this paper, we have investigated the involvement of mitochondrial dysfunction in the mechanism of diclofenac - induced apoptosis in the neuroblastoma cell line sh - sy5y . In particular, we have analyzed the role of the manganese superoxide dismutase (sod2) in this process . Sod2 is a key enzyme of the mitochondrial matrix involved in the protection against oxidative stress, which converts the toxic superoxide anions to hydrogen peroxide and molecular oxygen . Numerous reports have demonstrated that sod2 has an essential role in the protection against many apoptotic stimuli [1214]. In fact, in mice a partial deficiency of the sod2 gene (sod2(+/)) increases the sensitivity to apoptosis, whereas its overexpression has an antiapoptotic effect . In particular, sod2 is involved in the inhibition of the mitochondrial permeability transition after cell treatment with tumor necrosis factor- or ionizing radiations [1618], and blocks the fas - mediated apoptosis [19, 20]. Our data show that the treatment of the neuroblastoma cell line sh - sy5y with diclofenac induces a decrease in sod2 protein level and an increase of the ros concentration . This impaired redox balance predisposes the cell to apoptosis through a mechanism involving the mitochondrial pathway . Rpmi 1640 medium, fetal bovine serum (fbs), l - glutamine, penicillin g, streptomycin and trypsin were purchased from cambrex . Rhodamine 123 (r123), dichlorofluorescein diacetate (dcfh - da), and propidium iodide were purchased from sigma . Polyclonal antibody against human sod2 was purchased from upstate; polyclonal antibody against gapdh was obtained from cell signaling; polyclonal antibody against -tubulin, goat polyclonal antibody against cox-4, monoclonal antibody against cytochrome c, and each secondary antibody conjugated to horseradish peroxidase were obtained from santa cruz biotechnology . Recombinant thioredoxin a2 from the hyperthermophilic archaeon sulfolobus solfataricus (sstrx) was obtained as previously reported . The human neuroblastoma cell line sh - sy5y was obtained from american type culture collection . Sh - sy5y cells were grown in rpmi 1640 medium supplemented with 10% fbs, 2 mm l - glutamine, 100 iu / ml penicillin g, and 100 g / ml streptomycin, in humidified incubator at 37c under 5% co2 atmosphere . They were split and seeded in plates (75 cm) every three days and used for assays during exponential phase of growth . An increasing concentration of diclofenac was added to cultures, and cells were incubated for different times . Cytotoxicity was quantitatively assessed by measurements of lactate dehydrogenase (ldh) activity released in the extracellular fluid from damaged or destroyed cells . Briefly, different aliquots of cell incubation media were added to a 1-ml reaction mixture containing 0.1 m tris - hcl, ph 7.5, 125 m nadh, and incubated for 15 minutes at 30c . The reaction started with the addition of 600 m sodium pyruvate and was followed by the decrease in absorbance at 340 nm . The results were normalized to 100% death caused by cell sonication . To determine the number of apoptotic nuclei in diclofenac - treated cells, 3 10 cells / well were seeded into 96-well plates; at the end of each treatment, cell suspensions were centrifuged and pellets were resuspended in a hypotonic lysis solution containing 50 g / ml propidium iodide . After incubation at 4c for 30 minutes, cells were analysed by flow cytometry to evaluate the presence of nuclei with a dna content lower than the diploid . The intracellular ros level was detected using the oxidation - sensitive fluorescence probe dcfh - da . Briefly, cells were seeded into 6-well plate (3 10 cells / well) and treated with 150 m diclofenac for different times . Dcfh - da was added in the dark at 10 m final concentration 30 minutes before the end of each incubation; then cells were collected, washed in 10 mm sodium phosphate, ph 7.2 buffer containing 150 mm nacl (pbs), and finally resuspended in 500 l of pbs for the fluorimetric analysis . The measurement of the ros levels was realised with a cary eclipse fluorescence spectrophotometer (varian). Excitation and emission wavelengths were 485 nm and 530 nm, respectively; both excitation and emission slits were set at 10 nm . For the analysis of sod2 mrna expression, total rna was extracted from 1 10 cells using a trizol reagent (invitrogen) as described by the manufacturer . The yield and integrity of each rna sample were checked spectrophotometrically at 260 nm and by agarose gel electrophoresis, respectively . Equal amounts of rna (24 g) were subjected to a reverse transcriptase polymerase chain reaction (rt - pcr), using a specific kit (invitrogen) and random primers; three dilutions of cdna were amplified by pcr using taq dna polymerase (invitrogen). For dna amplification of both sod2 and glyceraldehyde-3-phosphate dehydrogenase (gapdh), the pcr program was 5 minutes initial denaturation at 95c, 2023 cycles of amplification (95c, 1 minute; 50c, 1 minute; 72c, 1 minute), final extension step at 72c for 10 minutes . The following primers were used: 5d - tacgtgaacaacctgaacgt-3 (sense) and 5d - caagccatgtatctttcagtta (antisense) for sod2; 5d - caccatcttccaggagcgag-3 (sense) and 5d - tcacgccacagtttcccgga-3 (antisense) for gapdh . Sod2 pcr products were normalized to the respective intensity of the house - keeping gene gapdh . Briefly, cells were seeded into 6-well plate (3 10 cells / well), incubated at 37c for 1 hour in the presence of 5 m r123, washed twice with pbs and placed in fresh complete medium containing 150 m diclofenac . After different times of drug treatment, the medium was withdrawn, and collected cells were washed twice with pbs . After detachment with trypsin, cells were harvested in pbs and centrifuged at 4c for 10 minutes . Following aspiration of supernatant, the cellular pellet was resuspended in 500 l of pbs . The fluorescence of cell - associated r123 was measured in the above - mentioned fluorescence spectrophotometer, using excitation and emission wavelengths of 490 nm and 520 nm, respectively; both excitation and emission slits were set at 10 nm . Sh - sy5y cells were plated at a density of 3 10 cells / well in 6-well plates, and 150 m diclofenac was added to the cultures . After the drug treatment, cells were harvested, washed with pbs, and then lysed in ice - cold modified ripa buffer (50 mm tris - hcl, ph 7.4, 150 mm nacl, 1% nonidet p-40, 0.25% sodium deoxycolate, 1 mm na3vo4, and 1 mm naf), supplemented with protease inhibitors and incubated for 30 minutes on ice . The supernatant obtained after centrifugation at 12,000 g for 30 minutes at 4c constituted the total protein extract . Briefly, protein samples were dissolved in sds / reducing loading buffer, run on a 14% sds - page, then transferred to immobilon p membrane (millipore). The filter was incubated with the specific primary antibody at 4c overnight and with the horseradish peroxidase - linked secondary antibody at room temperature for 1 hour . Membranes were then analyzed by an enhanced chemiluminescence reaction, using super signal west pico kit (pierce) according to the manufacturer's instructions; signals were visualized by autoradiography . Sh - sy5y cells were plated at a density of 2 10 cells / plate (75 cm). After treatment with 150 m diclofenac, cells were harvested, washed in pbs, then resuspended in buffer m (5 mm hepes, ph 7.4, 250 mm mannitol, 0.5 mm egta, 0.1% bsa), supplemented with protease inhibitors, and homogenized . The homogenate was centrifuged at 800 g for 10 minutes at 4c, and the supernatant was then centrifuged at 12,000 g for 30 minutes at 4c . The resulting pellet (mitochondrial fraction) was resuspended in buffer m and the final supernatant represented the cytosolic fraction . Aliquots of both fractions (cytosolic and mitochondrial) were used in western blotting analysis for the cytochrome c localization . Sh - sy5y cells were plated at a density of 2 10 cells / plate (75 cm) and, after one - day plating, 150 m diclofenac was added to the cultures . Cells were then collected at different times as previously indicated and then centrifuged at 300 g at 4c for 5 minutes, washed once with pbs, and finally resuspended in 50 mm potassium phoshate, ph 7.8, containing 1 mm edta . The cellular suspension was sonicated, centrifuged at 20,000 g at 4c for 30 minutes, and after protein quantitation, the supernatant was used for an activity gel assay . In particular, aliquots of cell extracts (50 g) were fractionated on a 10% polyacrylamide gel and sod activity was evaluated as previously described . This method is based on the inhibitory effect of sod on the reduction of nitro - blue tetrazolium by the superoxide anions generated by the photochemical reduction of riboflavin; sod is visualized as a colourless band over a blue background . All results are presented as histograms and data are the average sd of at least three independent measurements . In particular, data were analyzed by one - way anova, and differences were considered significant when the corresponding p - values were <.05 in the bonferroni's post - hoc test . To evaluate whether diclofenac had cytotoxic effects on neuronal cells, the human neuroblastoma cell line sh - sy5y was incubated for 24 hours with increasing concentrations of diclofenac . Propidium iodide incorporation followed by flow cytometric analysis showed a dose - dependent increase of apoptotic nuclei with sub - diploid dna content (figure 1(a)). The cytosolic enzyme lactate dehydrogenase (ldh) has been already used as a marker of cytotoxic injury . Indeed, a significant increase of ldh activity is typically found in culture media of cells undergoing a disruption of plasma membrane . To this aim, we have assayed the ldh activity in the culture media of sh - sy5y cells incubated up to 48 hours with increasing concentrations of diclofenac . No significant release of the intracellular ldh was observed up to 150 m diclofenac (not shown), which was taken as the maximal concentration of this compound not causing a significant cytotoxic effect (mntc). To analyse the time - dependent increase of apoptosis, sh - sy5y cells were exposed to 150 m diclofenac and analysed at different times . As shown in figure 1(b), the apoptotic process was already evident after 8-hour treatment and progressively increased up to 72 hours . It is known that nsaids alter the redox state of different cell types through an enhancement of intracellular ros levels [911]. Therefore, we have decided to investigate whether diclofenac affects the intracellular ros levels also in sh - sy5y cells, using the fluorescent probe dcfh - da . Indeed, when these cells were incubated with diclofenac and dcfh - da at different times, an early increase of the ros level was detected with respect to control cells; furthermore, ros production progressively continued at least up to 4 hours (figure 2). As sod2 is the primary antioxidant enzyme in mitochondria protecting cells from oxidative injuries, we have evaluated the role exerted by this enzyme in sh - sy5y cells in the course of diclofenac treatment . To this aim, the dose- and time - dependent effects of this drug on sod2 protein levels of sh - sy5y cells were analysed in the experiments reported in figure 3 . When these neuronal cells were incubated for 24 hours with increasing diclofenac concentrations, a dose - dependent decrease of the sod2 protein level was observed, as evaluated by western blotting using antibodies against human sod2 (figure 3(a)). A similar picture emerged when sh - sy5y cells were incubated with 150 m diclofenac and analysed at different times . The decrease of sod2 levels (figure 3(b)) was evident after 24-hour treatment and increased at 48 hours . To investigate the possibility that the reduction of the sod2 protein levels corresponded also to a decrease in sod activity, the protein extracts obtained from cells incubated with 150 m diclofenac were analysed at different times using a sod activity gel, which allows the detection of the activity of both mitochondrial sod2 and cytosolic sod1 . Interestingly, the sod2 activity decreased in a time - dependent manner (figure 4), thus indicating that the reduction of the enzyme level caused a lower efficiency in the defence against the superoxide anions . Vice versa, the activity of sod1 was not affected by the diclofenac treatment (not shown). We also evaluated whether the diclofenac - induced decrease of sod2 levels / activity depends on a down - regulation of the corresponding mrna . To this aim, sh - sy5y cells were incubated in the presence or in the absence of 150 m diclofenac for 4, 8, and 24 hours . In order to evaluate a possible regulation of the enzyme at transcriptional level, after rna extraction, a cdna was obtained by reverse transcriptase and used as a template in a pcr realised in the presence of specific oligonucleotides for sod2 . The data presented in figure 5 indicate that the diclofenac treatment did not significantly alter the mrna levels of sod2 at all times investigated . A similar picture with proportionally lower signals emerged when dilutions of the cdna template were used in the rt - pcr assay (not shown). These results, together with the low number of amplification cycles used, confirm that the employed pcr conditions fell in the linear dose - response range . Thioredoxin (trx), a small (12 kda) and ubiquitous protein involved in many cellular functions, is a potent disulphide oxidoreductase controlling the reduced state of intracellular proteins . The crucial antioxidant power of trx also takes advantage of its ability to cross the cellular membrane; in fact, evidences have been reported that trx can be released from cells [2628] and even enter a living cell [29, 30]. Moreover, endogenously produced or exogenously added trx increases the sod2 expression in lung carcinoma or neuronal cells . To this aim, the effect of trxa2 from the hyperthermophilic archaeon sulfolobus solfataricus (sstrx) on the reduction of sod2 levels caused by diclofenac was evaluated (figure 6). When sh - sy5y cells were treated with 150 m diclofenac, the sod2 protein level was significantly reduced . The addition of increasing concentrations of sstrx allowed a restoration of the sod2 level, thus counteracting the effect of diclofenac . In particular, in the presence of 10 m sstrx, the amount of sod2 was even higher compared to untreated cells . In a control experiment, the addition of 10 m sstrx did not cause any significant variation of the sod2 level in the absence of diclofenac (not shown). The possible protective effect of sstrx on the diclofenac - induced apoptosis was also evaluated . As shown in figure 7, the addition of sstrx partially reverted the programmed cell death provoked by the drug . In particular, in the presence of 10 m sstrx, the apoptosis of the diclofenac - treated cells was reduced at all times investigated . Loss of the membrane mitochondrial potential occurs as an early event during the apoptosis induced by specific stimuli in some cellular systems . To better evaluate the molecular mechanisms underlying the diclofenac - induced apoptosis in sh - sy5y cells, the efficiency of the mitochondrial function was evaluated through measurements of its membrane potential, using the fluorescent probe r123 . It is known that this compound crosses the mitochondrial membrane and accumulates into the matrix, only when the transmembrane potential is preserved; therefore, in case of a loss of the membrane potential, the r123 fluorescence undergoes a significant reduction . As shown in figure 8, the mitochondrial incorporation of r123 in sh - sy5y cells treated with 150 m diclofenac underwent a significant reduction compared to that measured on untreated cells . This hypopolarization of the mitochondrial membrane caused by diclofenac became evident after 2-hour treatment and significantly increased with the incubation time . A deeper insight on the involvement of mitochondria in the diclofenac - induced apoptosis was realised with a western blotting analysis aimed at the evaluation of the cytochrome c release from mitochondria . In particular, the detection of cytochrome c was carried out on both cytosolic and mitochondrial protein fractions from sh - sy5y cells incubated in the absence or in the presence of 150 m of diclofenac at different times (figure 9). Interestingly, the cytochrome c was already present after a 8-hour incubation mainly in the cytosolic fraction of diclofenac - treated cells; moreover, the amount of this mitochondrial marker in the cytosol significantly increased after a 24-hour treatment (figure 9(a)). This behaviour was confirmed by the concomitant analysis on the mitochondrial fraction, where a reduction of the cytochrome c level was observed in the diclofenac - treated cells (figure 9(b)). These data indicate that cytochrome c is released from the mitochondria, as a consequence of the diclofenac treatment of sh - sy5y cells . In this paper we describe the effects of diclofenac on cultures of the neuroblastoma cell line sh - sy5y, thus extending to this neuronal cell our knowledge on the possible toxicity of this drug, already reported for gastric, hepatic, or renal cells . Indeed, we present evidence that diclofenac induces apoptosis through a modulation of the mitochondrial function, associated to an alteration of the redox homeostasis . It is known that apoptosis is the primary cell death induced by drugs and that this process is mainly mediated by the mitochondrial pathway [36, 37]. Here we show that diclofenac induces apoptosis of sh - sy5y cells in a time- and concentration - dependent manner, thus suggesting that this compound is somehow toxic even for a neuronal - type cell . Previous pharmacokinetic studies demonstrated that the blood level of diclofenac, on the basis of the therapeutic doses used in patients (50150 mg / day), ranges between 10 and 30 m . However, in some circumstances the local concentration of the drug might increase . In particular, diclofenac concentration increases as a consequence of long - term treatments, overdosing, limited clearance, and so forth, as previously reported [3942]. For these reasons, in our in vitro studies we have used a diclofenac concentration of 150 m, because this value corresponded to the maximal concentration of this compound not causing cytotoxicity, as determined by cytotoxicity assays on sh - sy5y cells . In the light of the large therapeutic usage of diclofenac, these data are more relevant because of the known ability of this drug to cross the blood - brain barrier . Apoptosis is regulated by many signals and metabolic events, and the cellular redox state plays a critical role in this process . Indeed, several data showed that ros, mainly produced by mitochondria, are involved in the programmed cell death through an induction of the oxidative stress . In particular, an increased ros level frequently represents a triggering event upstream of the mitochondrial membrane depolarization, cytochrome c release, caspase activation, and nuclear fragmentation . An alteration of the ros levels was already demonstrated in diclofenac - induced apoptosis in gastric and renal cells [9, 10]. Also in our neuronal cell system diclofenac provokes an early and significant increase of the intracellular ros levels . These results prompted us to evaluate the downstream effects of altered ros levels in the course of diclofenac treatment of sh - sy5y cells . Under this concern, sod2 represents the major antioxidant enzyme in mitochondria, where the intense cellular respiration may produce a large amount of ros . Therefore, an efficient sod2 activity is required to counteract the mitochondrial dysfunction induced by an oxidative stress, which could lead to the programmed cell death usually observed in various disease contexts . The antiapoptotic role of sod2 is even demonstrated by the resistance to the radiation - induced damage reported for cell lines overexpressing sod2 . Our data on sh - sy5y cells show that diclofenac impairs sod2 functions, thus suggesting that this enzyme is involved in the apoptotic mechanism induced by the drug . In particular, this process is associated to a significant and concomitant reduction of both protein level and enzymatic activity of sod2, whereas rt - pcr experiments showed that the corresponding mrna levels are not affected by the diclofenac treatment . Therefore, a transcriptional regulation of the sod2 gene by diclofenac could be excluded; probably, an increased degradation of the protein levels could explain the reduced activity of the enzyme . The behaviour of sod2 in the diclofenac response was compared with the effects reported for other compounds in various experimental systems . For instance, stautosporine, a protein kinase inhibitor, did not affect the mrna levels of sod1 and sod2, but decreased protein and activity levels of both enzymes . Other authors reported that sod2 is degraded by caspases in jurkat t cells, following oligomerization of the fas receptor . On the other hand, in rat astrocytes the lipopolysaccharide induced an increase of sod2 mrna, but not of the sod2 protein . These observations confirm the regulation of sod2 functions following a drug treatment; however, the differences observed among the various experimental systems indicate that the sod2 response is a multifactorial process only poorly clarified . It is known that the induction of sod2 can be mediated by various macromolecules, such as interleukyn-1, lipopolysaccarides, and tumor necrosis factor-; furthermore, thiol - reducing agents can affect sod2 biosynthesis, as demonstrated by the enhanced sod2 expression caused by thioredoxin, a potent disulfide oxidoreductase . In this paper, the addition of a heterologous thioredoxin to diclofenac - treated cultures of sh - sy5y led to an enhancement of the sod2 levels, as well as to a reduction of the apoptosis . This result confirms the involvement of sod2 in the apoptotic processes induced by the drug and suggests that an archaeal thioredoxin is active also in human cells . Furthermore, we can speculate on a possible functional interaction between heterologous components of the thioredoxin system, because purified archaeal sstrx was added in its oxidised inactive form; its conversion to the reduced active form involves a reaction putatively catalysed by the human thioredoxin reductase . The increased ros level, the low functionality of the mitochondrial antioxidant enzyme sod2, together with a partial recovery of sod2 properties by a heterelogous thioredoxin, strongly suggest the involvement of mitochondria in the diclofenac - induced apoptosis of sh - sy5y cells . Indeed, an excessive production of ros and a decrease in sod2 levels contribute to the mitochondrial dysfunction . In particular, after a significant loss of the mithocondrial membrane potential, apoptosis - inducing factors are released from the mitochondria, thus leading to the activation of the caspase cascade, and ultimately to nuclear condensation [44, 45, 53, 54]. Also in our system, the diclofenac treatment induces an early mitochondrial hypopolarization, correlated to an increase of the intracellular ros levels, both events representing typical features of the onset of mitochondrial apoptosis . Another crucial marker of the intrinsic apoptosis is the cytocrome c release from the mitochondria, as a consequence of membrane depolarization . Our data showed that cytochrome c translocates from the mitochondria to the cytosol during the diclofenac treatment of sh - sy5y cells . This finding, together with the mitochondrial membrane depolarization, provides a more direct link between mitochondria and diclofenac - induced apoptosis, thus confirming that the programmed cell death in sh - sy5y follows the mitochondrial pathway . The results obtained in this work could be relevant for a deeper insight on the therapeutic usage of diclofenac, pointing to the oxidative damage related to its cytotoxic effect . In particular, the involvement of the main antioxidant mitochondrial enzyme in the apoptotic process may suggest the use of sod2 small interfering rna in combination with diclofenac, in order to improve the treatment of cancer, such as neuroblastoma . On the other hand, diclofenac, because of its ability to alter the cellular redox state of neuronal cells, could be considered a neurotoxic compound . Under this concern, previous studies showed that diclofenac and indomethacin, another nsaid, enhance the effects of some neurotoxins on pc12 cells and that diclofenac inhibits the proliferation and differentiation of neuronal stem cells . Our results on the protective effects of sstrx open some perspectives on the possible counteraction of the side effects caused by diclofenac.
The bacterium escherichia coli is widely used as indicator of the bacteriological condition of food and environments due to its almost exclusively fecal origin . The presence of e. coli in fresh - marketed seafood indicates recent contamination and is usually attributed to infected handlers or storage on contaminated ice . The intensification of production and the consequent increase in stocking density have made fish farming more vulnerable to disease [3, 4]. The indiscriminate use of antibiotics to treat infections and promote growth has been shown to be inefficient in the long run and to put selective pressure on bacterial populations favoring the development of resistant strains potentially hazardous to public health [57]. In fact, bacterial strains resistant to different families of antibiotics have been isolated from environmental samples by a number of researchers [810]. Foodborne strains resistant to antibiotics pose a risk to consumers' health and favor the transference of the phenotype to humans through the food chain [1113]. There are no reports of illnesses caused by e. coli in farmed fish, but resistant strains may be selected due to the presence of antibiotics in the culture environment, leading to the dissemination by mobile genetic elements of resistance to potentially pathogenic bacteria [1417]. Due to the importance of tilapia farming in northeastern brazil, the aim of the present study was to (a) investigate the presence of e. coli in fresh - marketed nile tilapia obtained from supermarkets in fortaleza, brazil, (b) establish the antibiotic susceptibility profile of e. coli strains isolated from nile tilapia samples, (c) determine whether resistance was potentially chromosomal or plasmidial, and (d) determine the multiple antibiotic resistance index of strains isolated from gills, muscle, and body surface . Thirty - six specimens of nile tilapia (oreochromis niloticus) were collected from twelve supermarkets in fortaleza (cear, brazil). The specimens were wrapped individually in plastic film and transported in ice - cooled isothermal boxes to the laboratory of seafood and environmental microbiology of the marine sciences institute (federal university of cear) for immediate bacteriological analysis . The e. coli investigation followed the guidelines of the fourth edition of the compendium of methods for the microbiological examination of foods released by the american public health association . Presumptive tests were performed separately for gills, muscle, and body surface . To sample the body surface, an area measuring 10 10 cm was stroked with a sterile cotton swab previously soaked in difco brain heart infusion (bhi) broth and subsequently immersed in 9 ml 0.85% nacl solution (vetec) diluted serially to 10 . To sample the gills, a 25 g aliquot was homogenized in 225 ml 0.85% nacl solution, shaken in a magnetic stirrer for 30 min, and diluted serially to 10 . To sample the muscle, a 25 g aliquot was ground and homogenized in 225 ml 0.85% nacl solution and diluted serially to 10 . A 1 ml aliquot was retrieved from each saline dilution and seeded with three repetitions in a test tube containing 10 ml lauryl sulfate tryptose (lst, difco). Aliquots from positive lst tubes were seeded in 4 ml tubes containing ec broth and incubated in a water bath at 45c for 48 hours . E. coli was isolated using eosin - methylene blue agar plates (difco), from which 35 colonies suspected of e. coli were selectedand submitted to imvic testing . Colonies were considered to be e. coli when positive in the indole and methyl - red test, negative in the voges - proskauer and citrate test, and gram - negative with short rods in the gram staining test . The antibiogram was done with the disk diffusion method using mueller - hinton agar (difco). Initially, an emulsion of sample in saline solution was prepared by adjustment to the 0.5 mcfarland turbidity standard, equivalent to 1 10 cfuml (clsi 2010). The susceptibility of the e. coli strains was tested in relation to several families of antibiotics, including the aminoglycoside family: amikacin (ami; 30 g) and gentamicin (gen; 10 g); the carbapenem family: imipenem (imp; 30 g); the cephalosporin family: cephalothin (cet; 30 g) and cefotaxime (ctx; 30 g); the fluoroquinolone family: ciprofloxacin (cip; 5 g); the monobactam family: aztreonam (atm; 30 g); the penicillin family: ampicillin (amp; 30 g); the quinolone family: nalidixic acid (nal; 30 g); the sulfonamide family: sulfametoxazol - trimetoprim (sut; 25 g); and the tetracycline family: tetracycline (tc; 30 g). Using sterile tweezers, commercially available antibiotic disks (laborclin) were placed individually on the surface of mueller - hinton agar . After 24 hours of incubation at 35c, the strains were scored as susceptible, intermediate, or resistant to each antibiotic based on the measurement of the inhibition halo, as recommended by clsi . The multiple antibiotic resistance (mar) index was determined for the total number of e. coli strains from each type of tissue sampled (gills, muscle, and body surface) using the formula a/(b c), where a is the total resistance score of the strains, b is the total number of families of antibiotics tested, and c is the number of strains from each type of tissue sampled . Resistant e. coli strains were submitted to plasmid curing using acridine orange dye at 100 gml (sigma). Following exposure to the mutagen, the strains were rechallenged with the antibiotics to which they were initially resistant . Forty - four of the isolates were confirmed to be e. coli, 25 (56.82%) of which were isolated from gills, 15 (34.09%) from the body surface, and 4 (9.09%) from muscle . Eleven e. coli strains isolated from gills and body surface were resistant to amp, sut, and tc, especially to last of these (gills n = 4; surface n = 3). On the other hand, strains isolated from muscle samples were susceptible to all the antibiotics tested (table 1). All strains isolated from gills, muscle, and body surface were susceptible to ami, atm, cet, ctx, cip, gen, and imp . According to some authors, the gills have a more diversified microbiota, qualitatively and quantitatively, due to their direct contact with the water, especially in plankton feeders such as the nile tilapia [2326]. Also detected e. coli in nile tilapia muscle samples, but many authors believe that the muscle is a relatively innocuous tissue [2830]. Nevertheless, the muscle may be contaminated during harvesting, a stressful process which often causes injury to the body surface, and/or during storage on contaminated ice [31, 32]. Molinari et al . Add that e. coli is commonly found in the gut of the tilapia; thus, to these authors, its presence in the muscle is an indication of poor handling practices . Four resistance profiles were observed in this study: resistance to tc (n = 5), resistance to amp (n = 4), resistance to sut+tc (n = 1), and resistance to amp+sut+tc (n = 1) (table 2). The profiles sut+tc and amp+sut+tc involved more than one family of drugs and were therefore considered profiles of multiple antibiotic resistance . The mar indexes for strains isolated from body surface and gills were 0.037 and 0.026, respectively . In a study by jiao et al . On the occurrence of e. coli in the gut of farmed nile tilapia, the isolated strains were susceptible to ami, atm, ctx, and gen, matching our own findings and supporting the notion that these antibiotics are little used in aquaculture . E. coli strains resistant to amp, sut, and tc were also reported by ryu et al . . Likewise, resistant strains of e. coli to tc were found by wang et al . . The authors suggest that improperly handled seafood is a critical reservoir for the dissemination of bacterial genes of multiple resistance . Acridine orange curing of the 11 e. coli strains resistant to amp, sut, and tc revealed resistance to be plasmid - mediated in 4 cases and potentially chromosomal in 7 . Thus, residues may be detected up to 10 days after administration, suggesting the possibility of detecting bacteria resistant to sut for a relatively long period . The presence of mobile genetic elements of resistance, especially plasmids and integrons, poses a risk to public health, as evidenced by koo and woo . Not surprisingly, tendencia and dela pea observed that the indiscriminate use of antibiotics in aquaculture has been paralleled by a significant increase in the number of reports of resistant bacteria isolated from aquaculture stock . The overall high antibiotic susceptibility of e. coli strains isolated from fresh - marketed nile tilapia was satisfactory, although the occasional finding of plasmid - mediated resistance points to the need for close microbiological surveillance of the farming, handling, and marketing conditions of aquaculture products . Nevertheless, it is necessary to note the origin of marketed fish in order to evaluate the potential risk to the consumer.
The tumor produces catecholamines, such as norepinephrine and epinephrine, and leads to well - known clinical symptoms, such as hypertension, headache, sweating, palpitation, and orthostatic hypertension . It is usually found at extra - adrenal sites and is diagnosed as a subtype of paraganglioma . The high dopamine level in this tumor is caused by a deficiency in dopamine - beta - hydroxylase, which converts dopamine to norepinephrine . For this reason, this tumor differs from classic pheochromocytomas in many respects, not only in its clinical features but also in its oncologic aspect . Only two original articles and five case reports have reported the occurrence of dopamine secreting paragangliomas in the retroperitoneum around the adrenal glands [2 - 8]. We report this interesting case and establish clinical concepts for this rare tumor by reviewing the related literature . A 26-year - old korean woman was referred after the accidental detection of an adrenal mass in her right side . She had no hypertension, palpitation, sweating, headache, flank pain, or mass upon palpation of her abdomen . On physical examination, her blood pressure was 110/90 mmhg and her heart rate was 90 beats / min . The results of laboratory tests, including a complete blood count and liver and renal function tests, were all unremarkable . Serum norepinephrine and epinephrine levels were normal but the dopamine level was high (425 ng / l). Analysis of a 24-hour urine sample revealed marked elevation of the urinary dopamine level (1,565.3 g / day) but normal levels of vanillylmandelic acid (vma), norepinephrine, epinephrine, metanephrine and normetanephrine . Computed tomography results showed a 4.3 3.2 cm hypervascular mass on the right adrenal gland with an early washout enhancement pattern . 1). Magnetic resonance imaging revealed a 2.8 cm sized tumor that was located in the right periadrenal area and that abutted against the adrenal gland laterally and ivc medially (fig . 2). Our preoperative diagnosis was a dopamine producing paraganglioma in the right retroperitoneum . Hand - assisted laparoscopic right adrenalectomy was performed because of the firm attachment of the tumor to adjacent structures . Her blood pressure was continuously normal and there were no fluctuations in vital signs during the operation . It was well encapsulated, homogenous and had a yellowish cut - surface with some internal hemorrhagic spots . Microscopic diagnosis was a neuroendocrine tumor whose clinical manifestations were consistent with those of a paraganglioma . An immunohistochemical study showed that the tumor was positive for neuroendocrine markers such as cd-56, synaptophysin and chromogranin . The tumor had a ki-67 index of less than 1 percent and was negative for s-100 (fig . Her 24-hour urine dopamine level returned to normal (388.4 g / day) after the operation . Her general condition was good and there was no recurrence during a 10-month follow - up . Among the many types of paraganglioma, an exclusively dopamine producing type is extremely rare . Only seven cases are listed in the worldwide database and no case has ever before been reported in south korea [2 - 8]. The exclusive production of dopamine can be ascribed to a deficiency in dopamine -hydroxylase which converts dopamine to norepinephrine in the catecholamine biosynthesis pathway beginning with tyrosine . Because of the abnormal catecholamine synthesis pathway, the levels of dopamine and its end product, homovanillic acid (hva), are increased, whereas the levels of norepinephrine, epinephrine and their end product, vma, are decreased . In consequence, the clinical presentation of this tumor is different from that of a classical pheochromocytoma that secretes norepinephrine and epinephrine . There is an absence of hemodynamic changes or so - called paroxysmal symptoms that are usually found in patients with catecholamine secreting pheochromocytoma . As a result, the patients with exclusively dopamine producing paraganglioma are mostly asymptomatic at initial diagnosis . Some constitutional symptoms such as fever, malaise, weight loss or diarrhea may occur as a result of the increased circulating dopamine level . Because paragangliomas tend to grow larger than adrenal pheochromocytomas, some patients experience vague abdominal pain or experience a palpable abdominal mass [4 - 8]. The asymptomatic features make it difficult for clinicians to detect the tumor at an early stage . Detection is even more challenging to physicians working in institutes without routine screening procedures for the detection of catecholamine and dopamine . Differential diagnosis can be achieved by measuring the dopamine levels in serum and 24-hour urine samples . Clinicians should not rule out the possibility of this rare tumor when evaluating adrenal masses with normal serum norepinephrine, epinephrine and urinary vma levels, even if the radiologic images strongly suggest a pheochromocytoma . Hand - assisted laparoscopic surgery has been adapted for the removal of large tumors and for the rescue of operative procedures in complicated cases of laparoscopic surgery . To minimize surgical mortality caused by hypertensive crisis during the manipulation of the tumor, preoperative administration of a -blocker is essential for norepinephrine and epinephrine producing pheochromocytomas . However, -blocker treatment is contraindicated for exclusively dopamine secreting paraganglioma because it can cause profound cardiovascular collapse after surgery, and can even result in death following a hypotensive crisis . There are two subtypes of dopamine receptors; the d1 receptor, which relaxes smooth muscles in blood vessels, and the d2 receptor, which inhibits noradrenaline release from postganglionic sympathetic neurons . These two effects could explain the pre - operative hypotension in dopamine secreting tumor patients . Blood pressure is sometimes elevated after the removal of this tumor presumably because of the same mechanism . Dopamine secreting paragangliomas are more likely to present malignant features than classic catecholamine secreting type paragangliomas or pheochromocytomas . This rare tumor tends to be diagnosed in patients who are asymptomatic, and the tumor is detected later than tumors that secrete norepinepnrine, epinephrine or both . Concerning the biochemical features, one report suggests that the decreased activity of dopamine -hydroxylase results in poor differentiation of this tumor, which may explain why the dopamine - secreting type shows advanced malignant features . Elevated dopamine or hva levels in 24-hour urine (> 120 nmol / g) is correlated with large tumor size and malignant potential . Extra - adrenal location, a tumor weight of more than 80 g, dna aneuploidy or triploidy and persistent postoperative hypertension have also been reported as risk factors for malignant pheochromocytoma . Because of the rarity of this tumor, there are no definite criteria for evaluating its malignant potential . In conclusion, lack of clinical symptoms and the rarity of this tumor can lead to the lack of, or a delay in diagnosis . In addition to radiologic imaging, dopamine assays in serum and 24-hour urine collection are useful diagnostic tests.
Venous thromboembolism (vte) is a term that encompasses deep vein thrombosis (dvt) and pulmonary embolism (pe). An evaluation of the national hospital discharge survey and census date for vte in the united states reported an annual incidence of 0.49 per 10,000, with peak rates in the neonatal period and adolescence.1)2) the majority of children with vte have multiple risk factors for thromboembolic disease at presentation, such as catheter - related thrombosis, infection, and congenital prothrombotic disorders.3) a pe is a very rare event in children, but the mortality rate is reported to be approximately 10%.4) hypereosinophilia is rarely associated with a pe in adults; however, this condition has not been reported in children . A 12-year - old boy was admitted to the hospital 10 days after the onset of cough, blood - tinged sputum, fever, right flank pain, and non - specific bilateral knee pain . Two weeks prior to admission, the patient went on a 10 hour automobile trip and ate raw fish ., he had leukocytosis with eosinophilia (peak ratio, 35%), thrombocytopenia (minimum, 33,000/mm), and an elevated c - reactive protein concentration (15.5 mg / dl). He was treated with antibiotics at a local hospital, but the symptoms did not remit . He was transferred to our institute for persistent symptoms and newly found signs of pulmonary hypertension on echocardiogram {trivial tricuspid valve regurgitation (tr) with a velocity of 3.2 m / sec}. On admission, he had a persistent cough and blood - tinged sputum . On physical examination, he had tachycardia (100 beats per minute), tachypnea (39 breaths per minute), and rales in the right lung field . The biochemical profile on admission was as follows: hemoglobin, 9.9 g / dl; white blood cell (wbc) count, 19,080/mm with 32.8% eosinophils; platelet count, 64,000/mm; erythrocyte sedimentation rate, 6 mm / hr; and c - reactive protein, 9.2 mg / dl . A coagulation assay revealed a slightly prolonged prothrombin time and activated partial thromboplastin time and elevated fibrinogen (pt inr, 1.33; aptt, 46.5 sec; and fibrinogen, 585 mg / dl). An echocardiogram showed probable mild pulmonary hypertension with trivial tr (velocity, 3 m / sec), but there were no other abnormal findings . The myocardial thickness and a chest computerized tomography (ct) scan showed pe in the right upper and lower lobar pulmonary arteries and the left lower lobar pulmonary artery . A pulmonary infarction was demonstrated in the right lower lobe on the chest ct scan (fig . A ct angiography showed a dvt in the left mid - femoral - to - popliteal and posterior tibial veins (fig . 2c). A diffuse decrease in perfusion in the right lung and a focal decrease in perfusion in the superior segment of the left lower lung the patient showed no evidence of allergic disease and parasitic infection for the elevated eosinophil count in the peripheral blood and bone marrow . These data led us to diagnose primary hypereosinophlia . However, there was no other end organ dysfunction which might be associated with hypereosinophlic syndrome . We also failed to find any other specific cause of hypercoagulation (antithrombin iii activity, 91%; protein c, 75%; protein s, 82%; and homocysteine, 6.5 mol / l). Antinuclear antibody, anticardiolipin antibody, and lupus anticoagulant levels were all either negative or within the normal range . After diagnosis of a pe, he was initially treated with heparin (50 u / kg bolus followed by 17 u / kg / hr), then low - molecular - weight heparin (1 mg / kg / dose q 12 hours) for 1 month . One week after admission, the platelet count dropped to 38,000/mm . On the 14th day after admission, the peripheral eosinophil count increased to 53.4% of the wbc (17,250/mm; total eosinophil count, 9,210/l). In 1 month, the eosinophilia and thrombocytopenia resolved spontaneously . His general condition gradually improved with the concomitant resolution of the pulmonary thromboembolism and pulmonary hypertension . The patient was discharged 1 month after admission on warfarin, which was adjusted to a pt inr of 2.0 . Based on doppler sonography, the thrombus in the lower extremity had resolved by 3 months . He took warfarin for 9 months and an anti - platelet medication (aspirin) for> 1 year without any other complications . Fifteen months after admission, the peripheral blood examination revealed the following findings: hemoglobin, 14.8 g / dl; wbc count, 5,920/mm with 4.2% eosinophils; and platelet count, 230,000/mm . While remaining on aspirin, he had no specific symptoms on evaluation in the outpatient clinic (fig . A pe occurs when a segment of a thrombus within the deep venous system detaches from the vessel, goes to the lungs, and lodges in the pulmonary arteries . The pelvic and deep veins of the lower extremities are a common source of pe.5) in 1856, rudolf virchow identified predisposing thrombotic factors, which include blood stasis, endothelial injury of the vein, and alteration in blood coagulability . Mutations in the genes for anticoagulant proteins, such as antithrombin, protein c, and protein s are important risk factors . Circumstantial factors include increasing age, immobilization, surgery, pregnancy, oral contraceptives, hormone replacement, and inflammatory conditions.1)3)6) the thrombotic events occur when one or more of the circumstantial risk factors occur together ., the patient had a high percentage of eosinophils at the onset of the thromboembolism . Hypercoagulation as a result of hypereosinophilia has previously been reported,7)8) but the mechanism remains poorly understood . Previous studies have demonstrated that eosinophils release toxic cationic proteins, which include eosinophil cationic protein, eosinophil - derived neurotoxin, major basic protein, eosinophil peroxidase, and platelet - activating factor.8) these granular proteins may promote platelet activation and coagulation, which inhibit the anticoagulation activity of thrombomodulin.7 - 9) in the patient presenting with peripheral blood eosinophilia, reactive causes should be investigated first, including parasitic infections, allergic disorders, malignancies, and collagen vascular disease . The patient in this report had a history of eating raw fish, but we did not find evidence of a parasitic infection; all the other conditions were excluded . If eosinophilia persists with an unknown etiology, the diagnosis of hypereosinophilic syndrome should be considered . Hypereosinophilic syndrome is defined as an eosinophil count> 1,500/l that is sustained for> 6 months without any other clear cause.10) this patient had transient eosinophilia and recovered spontaneously, although the actual onset of eosinophilia was not identified a pe may show non - specific signs and symptoms or no symptoms, although it can be fatal . Especially in the pediatric age group, the diagnosis of a pe may be delayed longer than in the adult age group . Pulmonary angiography has been the gold standard for diagnosing a pe, but it is more invasive and time - consuming than a ct . The treatment of a vte in hemodynamically stable patients is anticoagulation, while thrombolytic therapy is indicated in massive iliofemoral dvt and pe with hemodynamic instability . The echocardiographic evidence of right ventricular dysfunction can be helpful in determining whether or not a patient needs thrombolytic therapy.11) the duration of therapy should be decided by causes and underlying conditions . In conclusion, we have presented a case of a pulmonary thromboembolism which was accompanied by idiopathic hypereosinophila in a child.
Indeed, in 2009, half of canadian patients initiating renal replacement were over 65 years old (1). According to estimates, incidence of chronic renal failure is 242 individuals per one million worldwide (2) while over $1 trillion is spent for end - stage renal disease care, globally (3). Though, hemodialysis consists the most common treatment method for kidney failure, however, it is a stressful procedure that affects all dimensions of patients lives (1, 2, 3). Interestingly, hemodialysis patients experience various changes and limitations in their daily lives including diet and fluid constrictions, physical and cognitive impairment as well as inadequacy to accomplish prior roles, duties or activities . Additionally, patients frequently experience heavy psychological burden mainly anxiety and depression that it exerts a negative influence on the outcome of the disease . Depression is related with morbidity, mortality, impairment of quality of life, shortness of lifespan and even worse with suicidal attempts (4 - 9). Nowadays that increase in life expectancy of hemodialysis patients is not the ultimate goal in care, it has been slowly acknowledged that social support is a key element to achieve an effective treatment management (10, 11, 12). As support is defined the offer and receive of aid by a network when a crisis appears . Support is usually obtained by family, friends or significant others such as health care professionals, peer group and others (11, 12). Support has been broadly linked to improved health outcomes in chronic illnesses through various mechanisms such as decreased levels of depression, stress alleviation, improvement of patients quality of life, assistance to access health care services, better compliance to the therapeutic regimen and direct physiologic benefits on the immune system (10). The extent of association between anxiety / depression and social support to hemodialysis patients has seldom been the subject of systematic enquiry . Purpose: of this study was to explore the effect of perceived social support on the levels of anxiety and depression of hemodialysis patients . Criteria for patients inclusion in the study were: a) diagnosis of end - stage renal disease, b) current hemodialysis, c) native language - greek, and d) volunteer participation . All patients were included in the study after having been informed and given their signed consent . The study was approved by the medical research ethics committee of each dialysis center and conducted in accordance with the declaration of helsinki (1989) of the world medical association . Data were collected through the completion of a specially designed questionnaire by the method of interview . The data collected for each patient included: socio - demographic characteristics (eg gender, age, education level, marital status, etc . ), clinical therapy characteristics (eg years from first hemodialysis, frequency of hemodialysis etc . ), relations with medical - nursing staff and other patients and finally patients beliefs about the effect of illness on life (eg life style has been affected, dependency on dialysis machine, etc . ). The multidimensional scale of perceived social support (mspss) which has been translated and culturally adapted to the greek standards (11, 12) was used to evaluate the perceived social support of hemodialysis patients . This scale has good internal reliability and test - retest reliability, in various samples (13, 14). The scale is comprised of 3 groups depending on the source of support: a) significant others b) family and c) friends . More in detail, these are: family [3, 4, 8, 11], friends [6, 7, 9, 12] and a significant person [1, 2, 5, 10]. Each item is rated using a 7 range scale varying between definitely no and definitely yes. In order to calculate the final score of each dimension of social support, we add the scores of questions corresponding to each dimension and divide by the number of questions included in each dimension . Higher scores indicate higher support . For the evaluation of depression and anxiety of patients the hospital anxiety and depression scale (hads) was used . This scale was proposed in 1983 by zigmond as & snaith rp (15). The scale consists of 14 questions that assess how patients felt during the previous week . Patients are able to answer every question in a 4-point likert scale from 0 - 3 . Seven of 14 questions assess the level of depression and the other seven the level of anxiety . Scores attributed to questions are summed separately for anxiety and depression, leading to two scores with range 0 - 21 . In addition, it has been proposed and it is widely used in the literature, the following categorization: score 0 - 7 indicating no stress or depression, score 8 - 10 indicating moderate levels of anxiety or depression, and score>11 indicating high levels of anxiety or depression . The scale hads has been translated and was tested for its validity and reliability in greek population by mistakidou al ., the 2004 . Categorical variables are presented by absolute and relative frequencies (percentages), and quantitative variables are presented by median and interquartile range since they do not follow the normal distribution (tested with kolmogorov- smirnov test). To test the existence of association between levels of anxiety / depression and social support multinomial logistic regression was performed to estimate the effect of social support on the levels of anxiety / depression (dependent variable), adjusted for potential confounders . The analysis was performed with the statistical package spss, version 20 (spss inc, chicago, il, usa). The study sample was not representative of hemodialysis patients in greece, but a convenience sample . Also, the study was cross - sectional thus not allowing the causal relation between anxiety / depression and social support . Socio - demographic, clinical and other characteristics of patients are presented in table 1 . Data presented with median (iqr) from table 2 we conclude that patients felt highly supported from their significant others and their family (median 6 for both subscales) and less from their friends (median 4.5, neutral support levels). Regarding the levels of anxiety and depression, 32.9% of the patients had high levels of anxiety and 30.2% high levels of depression . On the contrary, the majority of the patients did not have any anxiety (38.4%) or depression (44.2%). Descriptive statistics for social support and levels of anxiety / depression of patients undergoing hemodialysis (n=258) table 3 presents the results of the association between social support and levels of anxiety / depression . There was a statistically significant association between anxiety / depression and social support from significant others, family and friends (p=<0,001, for all associations). In particular, patients with high levels of anxiety and depression felt less support from their significant others, family and friends . From table 3, it further appears that there was no statistically significant difference in support scores between patients with moderate levels of anxiety / depression and those with no anxiety /depression . Association between social support and levels of anxiety / depression of patients undergoing hemodialysis (n=258). Lastly, multinomial logistic regression was performed to assess the effect of social support on the levels of anxiety and depression, adjusted to various potential confounding factors affecting anxiety and depression . From table 4 we conclude that effect of confounders in the relationship between anxiety and social support we had in the case of support from significant others and family in high levels of anxiety . After adjusting for confounders, effect of social support on the levels of anxiety / depression of hemodialysis patients (n=258). * adjusted regression to the following factors: gender, marital status, educational level, years of problem, relations with nursing - medical staff and patients, and if their lifestyle has been affected . Furthermore, we conclude that after adjusting for confounding factors, statistically significant effect of social support from friends we had on anxiety levels (p=0,004) and more specifically an one point increase in the support from friends, reduces by 57% the chances that patients will have high levels of anxiety in relation to not having at all anxiety . In addition, statistically significant effect of social support from significant others, family and friends we had on depression (p = <0,001, p= 0,001 and p=0,003, respectively). In particular, an one point increase in support from significant others, family and friends reduces by 77%, 71% and 56% the chances that patients will have high levels of depression . Socio - demographic, clinical and other characteristics of patients are presented in table 1 . From table 2 we conclude that patients felt highly supported from their significant others and their family (median 6 for both subscales) and less from their friends (median 4.5, neutral support levels). Regarding the levels of anxiety and depression, 32.9% of the patients had high levels of anxiety and 30.2% high levels of depression . On the contrary, the majority of the patients did not have any anxiety (38.4%) or depression (44.2%). Descriptive statistics for social support and levels of anxiety / depression of patients undergoing hemodialysis (n=258) table 3 presents the results of the association between social support and levels of anxiety / depression . There was a statistically significant association between anxiety / depression and social support from significant others, family and friends (p=<0,001, for all associations). In particular, patients with high levels of anxiety and depression felt less support from their significant others, family and friends . From table 3, it further appears that there was no statistically significant difference in support scores between patients with moderate levels of anxiety / depression and those with no anxiety /depression . Association between social support and levels of anxiety / depression of patients undergoing hemodialysis (n=258). Lastly, multinomial logistic regression was performed to assess the effect of social support on the levels of anxiety and depression, adjusted to various potential confounding factors affecting anxiety and depression . From table 4 we conclude that effect of confounders in the relationship between anxiety and social support we had in the case of support from significant others and family in high levels of anxiety . After adjusting for confounders, effect of social support on the levels of anxiety / depression of hemodialysis patients (n=258). * adjusted regression to the following factors: gender, marital status, educational level, years of problem, relations with nursing - medical staff and patients, and if their lifestyle has been affected . Furthermore, we conclude that after adjusting for confounding factors, statistically significant effect of social support from friends we had on anxiety levels (p=0,004) and more specifically an one point increase in the support from friends, reduces by 57% the chances that patients will have high levels of anxiety in relation to not having at all anxiety . In addition, statistically significant effect of social support from significant others, family and friends we had on depression (p = <0,001, p= 0,001 and p=0,003, respectively). In particular, an one point increase in support from significant others, family and friends reduces by 77%, 71% and 56% the chances that patients will have high levels of depression . The results of the present study showed that hemodialysis participants felt highly supported from their significant others and their family and less from their friends . Nowadays, there is a growing interest in the relation between perceived social support and hemodialysis for the reason that this method of kidney replacement may become a barrier to patients social integration (17). On the other end of spectrum, a supportive environment exerts a positive impact on the clinical outcome probably due to deeper understanding of illness and better self management (18, 19, 20). Results also showed that 32.9% and 30.2% of participants experienced high levels of anxiety and depression, respectively . Similar results are coming from greece by vasilopoulou et al ., (7) who showed that 47.8% of hemodialysis patients experienced high levels of anxiety while 38.2% high level of depression . Raymond et al ., (8) claimed that up to one - third of patients with chronic kidney disease may experience depression . Taken into serious consideration, the high incidence of this psychiatric co - morbidity in hemodialysis patients, it is imperative to enhance systematic psychiatric evaluation in daily clinical practice . Failure to early diagnosis and treatment of depression in hemodialysis patients is mainly attributed to overlapping symptoms associated with uremia such as anorexia, fatigue and sleep disturbances (7, 21, 22, 23). In the present study, there are serious gaps in our knowledge why these patients either do not seek for help or there is usually no record for these psychiatric disorders during their treatment . Johnson et al ., (23) stated that untreated psychiatric illness in hemodialysis patients is associated with mortality, poor quality of life and increased risk of suicide while watnick al ., (24) demonstrated that only 16% of depressed participants received treatment when starting hemodialysis . In this line of thought, kimmel et al ., (25) highlighted the importance of using a globally accepted tool to evaluate depression and anxiety in hemodialysis patients . Hads is a valid instrument widely used to assess anxiety / depression in end - stage renal disease patients (20). According to stasiak et al ., (22) hemodialysis patients experience high levels of anxiety and depression for reasons which limit their independence such as visits to dialysis center every three days, connection to dialysis machine, diet and fluids restrictions and loss of available time . It is noteworthy that in the present study 89,2% of participants reported their life being enough and very depended on the dialysis machine while 43% believed that their life had been very affected . Moreover, participants had to spend 3 days per week (4 hours in each day) in dialysis centers . Stasiak et al ., (22) also stated that among demographic and clinical characteristics, those related with anxiety and depression are age, diabetes and antidepressants or beta - blockers . The results also revealed that patients with high levels of anxiety and depression felt less support from their significant others, family and friends . (26) illustrated that persistently high anxiety and depression are associated with reduced perceived social support . Similarly, genz et al ., (27) demonstrated that depressive symptoms were associated with lack of perceived social support . Vzquez et al ., (28) supported that trait anxiety was related to emotional disturbance and reduced social relationships . Tezel et al ., (29) showed that perceived social support from family was negatively correlated with depression . The same researchers also claimed that patients who experience lack of support usually follow maladaptive ways to express their inner world . Bisschop et al ., (30) showed that psychosocial support alleviates depressive symptoms . Health professionals should be aware that family behaviors are beneficial on patients illness management (31). In the present study, 62,8% and 30,6% of the participants reported having very good and good relations with the nursing staff . This finding is far too promising for health professionals who deeply wish to enhance patients support level . Social support from significant others, family and friends is associated with anxiety / depression . Firstly, it is essential for health professionals to develop intervention strategies to strengthen hemodialysis patients social networks and secondly, to encourage patients to express their feelings and address their psychological needs, thus confronting with the psychological burden of the disease.
Esophageal achalasia is a rare motility disorder of the esophagus involving the smooth muscle layer and the lower esophagus sphincter (les), with its incomplete relaxation and increased tone . This pathology is characterized by difficulty in swallowing, regurgitation, and sometimes chest pain . Specific tests for diagnosis of esophageal achalasia are barium swallow and esophageal manometry . Esophago - gastro - duodenoscopy with or without endoscopic ultrasound can be also performed to rule out the probability of cancer . For management, dilation or stretching of the esophagus, surgery and injection of muscle relaxing substances (botulin toxin) in the esophagus were foreseen . We present a case of esophagus achalasia diagnosed for intense rest and effort dyspnea, persistent cough, arterial hypotension, and chest discomfort . 12-leads ecg showed sinus rhythm with pulse rate at 95 beats / min . Left axial deviation and diffuse disorders of repolarization were also seen . Chest x - ray revealed massively dilated esophagus along the right cardiac border [figure 1]. Ct of the chest showed esophageal body dilatation filled with food remaining that compressed the left atrium [figure 2]. The esophageal manometry evidenced body esophageal a - peristalsis, with low amplitude of esophageal body contraction and failed relaxation of les after water swallow . Left atrial compression induced by an extrinsic structure was seen at two - dimensional - trans - thoracic echocardiography (2d - tte). This structure has an elongate form and was filled of liquid drinking to differentiate esophagus from any cardiac formation [figure 3]. Diastolic mitral inflow pattern showed an e / a waves ratio = 1.1; dt measured 210 msec . ; ivrt was 87 msec . Three dimensional echocardiography (3d - tte) pointed out the extracardiac roundish esophageal cavity compressing left atrium, clearly separated from the heart structures [figure 4]. The same evaluation performed in parasternal approach (at level of aortic root) consented to identify the pulmonary trunk and its subdivision in right and left pulmonary arteries [figure 5]. Antero - posterior chest x - ray that shows poorly defined borders at the median and lower right lobe and at the lung base ct of the chest pointed out extrinsic compression at level of the left atrium by dilated esophagus (arrow) two - dimensional echocardiography recorded in apical 4 chambers view showing an extrinsic compression on the left atrium due to a dilated and lengthened formation evidenced after drinking a liquid (arrow) (a) three - dimensional echocardiography performed in apical 2-chambers view . Evidence of a round structure (arrow) compressing left atrium; (b) three - dimensional echocardiography in the same approach . More evident dilated esophagus (arrow) located below to the cardiac plane and separated from the cardiac structures three - dimensional echocardiography performed from the parasternal approach intermediate between the long and short - axis view, at level of aortic root . Clear evidence of dilated esophagus (arrow) compressing the lower segment of the pulmonary trunk the symptoms are a consequence of the left atrial compression that reduces its volume causing an impairment of left ventricular diastolic filling . In addition, as a consequence of increased left atrial pressure, pulmonary pressure also rises causing an intense dyspnea leading to pulmonary edema . Esophageal achalasia is usually diagnosed by chest x - ray, ct, mri, and esophageal manometry . Functional magnetic resonance imaging (fmri) has been recently proposed for the evaluation of the esophagus motility . But, the test of choice for diagnosing its extrinsic compression of left atrium by esophageal achalasia is two - dimensional echocardiography (2d - tte). At 2d - tte, the achalasia moves asynchronously with the atria in contrast to intrinsic atrial structures . In our case, 2d - echocardiography performed in apical long - axis view evidenced the compression of left atrium by an extracardiac structure corresponding to the dilated esophagus evidenced by the liquid drink . Nevertheless, 2d - tte is limited to the cases with acceptable sonographic window . In the presence of a poor sonographic space, trans - esophageal echocardiography three - dimensional trans - thoracic echocardiography (3d - tte) was also performed in our patient . This was firstly carried out in an individual with esophageal achalasia . In our patient, 3d - tte records consented to better appreciate the esophagus compressing the left atrium and the lower part of the pulmonary trunk . Even though 3d - tte is not explanatory than 2d - tte, it consented to better evaluate the dilated esophagus separated from the left atrium and compressing this same and some neighboring structures without the liquid drink too
The constant shortage of donor organs led to research into xenotransplantation, which was first reported in 1906 . Pigs are currently considered the most appropriate source of organs for xenotransplantation to humans based on several advantages, including physiological / anatomical organ similarities, reproductive characteristics, the possibility of controlled breeding, and ethical considerations . Furthermore, recently, research to avoid the rejection of grafted organs has involved the production of genetically - modified pigs such as the 1,3-galactosyltransferase gene knock - out pig, expression of human complement regulatory proteins (cd46, cd55, and/or cd59), and reducing risk of endogenous porcine retrovirus infection . To resolve existing hurdles prior to the clinical application of pig organs, an appropriate method for evaluating the vascular system of micropigs must be established and immunological barriers must be addressed . To transplant micropig solid organs into humans, evaluation of the vascular system and anatomical comparisons are essential for selection of a suitable organ as well as to gather sufficient pre - clinical data . Previously, the standard method for preoperative angiographic evaluation of the donor vascular system was conventional angiography, whose disadvantages include being invasive and time - consuming, as well as the fact that it requires the use of ionizing radiation and large amounts of contrast agents . In contrast, the multidetector row computed tomographic angiography (mdcta) process using doses of nonionic contrast media and ionizing radiation exposure that are less than conventional angiography . Furthermore, venography is needed to obtain additional information regarding the venous system prior to organ transplantation . With remarkable advancements in spatial and temporal resolution, this technology has been confirmed as a valuable method that can provide a road map for surgical planning as well as to assist in donor selection . In addition, mdcta has several advantages over traditional angiography; it is less invasive and permits visualization of organ structures and possible pathology . The goal of this study was to confirm the feasibility of using mdcta to evaluate the vascular system of micropigs and establish standard reference values for the vascular diameter and anatomy, which would be useful for selection of suitable donor organs in the future . All experimental protocols were approved by the ethics committee of chonnam national university, korea (cnu iacuc - yb-2008 - 29). Physiologically and genetically intact male micropigs (n = 6) were purchased from pwg genetics korea (korea). The animals were kept in individual cages at the university's central animal facility and received a standard pig diet and water ad libitum . The mean age and weight of the animals was 360 days and 30.50 1.24 kg, respectively . Prior to undergoing mdcta, all animals were fasted for 24 h. the animals were premedicated with an intramuscular injection of azaperone (0.5 mg / kg) and xylazine (8 mg / kg) and anesthetized with an intramuscular injection of a combination of zolazepam / tiletamine (4.4 mg / kg). The examinations were performed using a 64-channel multi - detector row helical ct scanner (lightspeed vct; ge healthcare, usa) according to the following parameters: 0.5 sec per rotation, 5 mm collimation, 1.0 pitch, and a tube current of 120 kv per 140~200 milliamperes . The mdcta images were acquired with spatial resolution of 0.35 0.35 0.8 mm . The ct angiographic scan was obtained in the craniocaudal direction, and reconstruction thickness and reconstruction increment were 1 mm and 0.5 mm, respectively . For administration of intravenous contrast material, a 20-gauge peripheral line was placed in an ear vein . After a scout ct image was obtained, arterial phase volumetric image data sets were acquired following initiation of an intravenous injection of 60 ml of nonionic contrast media (ultravist 370; schering ag, germany) at the rate of 3 ml / sec using an automated injector (lf ct 9000; liebel - flarsheim, usa). An automatic bolus triggering software program was systematically applied, with a circular region of interest positioned at the level of the superior vena cava (svc) and a threshold for triggering data acquisition preset at 100 hounsfield units to obtain arterial phase images . Imaging extended from the c1 cervical vertebrae to the knee joint including both pelvis and thigh . Volumetric data sets were transferred to an advantage workstation 4.3 (ge healthcare, usa) equipped with volume viewer plus three - dimensional (3d) software for subsequent review . Transverse 0.625-mm - thick sections were reformatted into maximum intensity projection images and volume rendered images . A single radiologist reviewed all ct images at a workstation which permitted editing of ct volume data sets to create optimal 3d cta images . Volume - rendering techniques were typically employed, but maximum - intensity - projection rendering was also used as an adjunct display . The 3d images were reviewed by scrolling the acquisition displayed on a workstation monitor in conjunction with the assessment of conventional 2d axial images . The aorta was divided into four sections: ascending, arch, thoracic, and abdominal . Major aortic branches measured were right and left common carotids, celiac trunk, superior mesenteric, splenic, external iliac, and superficial femoral . The diameter of the main arteries was assessed from the most appropriate point of the segment, 1~1.5 cm from the ostium, using the workstation electronic cursor . The presence of any anatomic variations or intrinsic vascular disease such as atherosclerosis and/or calcification was also recorded . In addition, both a morphological evaluation and measurement of the diameter of the svc and inferior vena cava (ivc) were also performed . The diameter of the svc was measured at the point just proximal to the svc - right atrium junction . The diameter of the ivc was measured at three segments: hepatic, suprarenal, and infrarenal . The values presented in this study are expressed as mean sd . The data obtained from the micropigs was compared to pertinent human data published in the literature . All experimental protocols were approved by the ethics committee of chonnam national university, korea (cnu iacuc - yb-2008 - 29). Physiologically and genetically intact male micropigs (n = 6) were purchased from pwg genetics korea (korea). The animals were kept in individual cages at the university's central animal facility and received a standard pig diet and water ad libitum . The mean age and weight of the animals was 360 days and 30.50 1.24 kg, respectively . Prior to undergoing mdcta, all animals were fasted for 24 h. the animals were premedicated with an intramuscular injection of azaperone (0.5 mg / kg) and xylazine (8 mg / kg) and anesthetized with an intramuscular injection of a combination of zolazepam / tiletamine (4.4 mg / kg). The examinations were performed using a 64-channel multi - detector row helical ct scanner (lightspeed vct; ge healthcare, usa) according to the following parameters: 0.5 sec per rotation, 5 mm collimation, 1.0 pitch, and a tube current of 120 kv per 140~200 milliamperes . The mdcta images were acquired with spatial resolution of 0.35 0.35 0.8 mm . The ct angiographic scan was obtained in the craniocaudal direction, and reconstruction thickness and reconstruction increment were 1 mm and 0.5 mm, respectively . For administration of intravenous contrast material, a 20-gauge peripheral line was placed in an ear vein . After a scout ct image was obtained, arterial phase volumetric image data sets were acquired following initiation of an intravenous injection of 60 ml of nonionic contrast media (ultravist 370; schering ag, germany) at the rate of 3 ml / sec using an automated injector (lf ct 9000; liebel - flarsheim, usa). An automatic bolus triggering software program was systematically applied, with a circular region of interest positioned at the level of the superior vena cava (svc) and a threshold for triggering data acquisition preset at 100 hounsfield units to obtain arterial phase images . Imaging extended from the c1 cervical vertebrae to the knee joint including both pelvis and thigh . Volumetric data sets were transferred to an advantage workstation 4.3 (ge healthcare, usa) equipped with volume viewer plus three - dimensional (3d) software for subsequent review . Transverse 0.625-mm - thick sections were reformatted into maximum intensity projection images and volume rendered images . A single radiologist reviewed all ct images at a workstation which permitted editing of ct volume data sets to create optimal 3d cta images . Volume - rendering techniques were typically employed, but maximum - intensity - projection rendering was also used as an adjunct display . The 3d images were reviewed by scrolling the acquisition displayed on a workstation monitor in conjunction with the assessment of conventional 2d axial images . The aorta was divided into four sections: ascending, arch, thoracic, and abdominal . Major aortic branches measured were right and left common carotids, celiac trunk, superior mesenteric, splenic, external iliac, and superficial femoral . The diameter of the main arteries was assessed from the most appropriate point of the segment, 1~1.5 cm from the ostium, using the workstation electronic cursor . The presence of any anatomic variations or intrinsic vascular disease such as atherosclerosis and/or calcification was also recorded . In addition, both a morphological evaluation and measurement of the diameter of the svc and inferior vena cava (ivc) were also performed . The diameter of the svc was measured at the point just proximal to the svc - right atrium junction . The diameter of the ivc was measured at three segments: hepatic, suprarenal, and infrarenal . The values presented in this study are expressed as mean sd . The data obtained from the micropigs was compared to pertinent human data published in the literature . Ct examinations were successfully performed in all six micropigs . There was no evidence of vascular malformation, arterial stenosis, aneurysm, atherosclerosis, or calcification found in any animal . In the present study, we measured the diameters of the major systemic vessels and compared those data to previously published human data (table 1). The mean diameters of the right and left common carotid arteries measured were 0.57 0.08 cm and 0.55 0.05 cm, respectively (fig . 1). There were no significant differences between micropigs and humans with regard to anatomy or diameter of the common carotid arteries . The mean diameters of the micropig ascending and descending thoracic aorta, aortic arch, and svc were 1.69 0.12 cm, 1.23 0.11 cm, 1.50 0.07 cm, and 1.93 0.33 cm, respectively . The anatomic structure of the thoracic aorta and aortic arch of the micropigs was similar to that of humans (fig . 2), but the diameters of these vessels were considerably smaller than those in humans . In addition, the significant anatomical differences in svc of micropig compared with human were not observed . In the abdominal region, we evaluated the abdominal aorta, celiac trunk, superior mesenteric artery, splenic artery, and hepatic / suprarenal / infrarenal ivc . The mean diameters of these vessels were 0.85 0.06 cm, 0.52 0.08 cm, 0.68 0.05 cm, 0.38 0.05 cm, and 1.65 0.20/1.59 there were no anatomical variations in the micropigs in relation to humans; however, the diameter of the abdominal aorta was significantly smaller than in humans (fig ., there were no significant differences between micropigs and humans with regards to anatomy or diameter of the ivc . In the pelvic region, the diameters of the external iliac artery and superficial femoral artery were 0.52 0.05 cm, and 0.48 0.05 cm, respectively which were 42.4% and 46.3% comparable to human vessels, respectively . In all six micropigs examined, the external and internal iliac arteries arose directly from the aorta . Solid - organ transplantation is currently the definitive solution for end - stage organ failure . Accurate preoperative imaging of donor vasculature is of great importance because vascular variations, such as accessory arteries and early branching, are particularly important when determining optimal organ extraction procedures and the type of anastomosis . Furthermore, imaging evaluation of vascular systems using mdcta plays a critical role in solid - organ transplantation to facilitate the selection of suitable donors, planning the surgical procedure, and revealing any co - existing pathology . The gold standard technique for preoperative donor evaluation is conventional angiography, but this procedure has the drawback of being invasive . Angiography using mdct is fast, safe, minimally invasive, and now is routinely used in the preoperative evaluation of potential human donors for renal and liver transplantation . In this study, we performed anatomical evaluations and diameter measurements of the major systemic vessels in micropigs using 64-channel mdcta . The morphology and branching patterns of the major vessels were constant between the micropigs and there were no anatomical variations found during this study . In addition, the morphology of the major micropig vessels did not reveal significant differences when compared to those of humans, except for in the case of the iliac artery . In all micropigs evaluated, the external and internal iliac arteries arose directly from the aorta . The external artery detached one branch, the deep femoral artery, which continued as the femoral artery . There was no common iliac artery corresponding to that of humans, which arises from the aorta and branches off into the external and internal iliac arteries . Although differences in vascular diameter, morphology, and branching pattern between micropigs and human can be overcome with modern surgical techniques at the time of transplantation, there is the possibility that the function of the related micropig organs could be compromised in human systems following transplantation . Thus, further studies are needed to evaluate and compare micropig organ function with that of humans . In addition, the smaller diameter of micropig arteries compared to human vessels may be problematic in terms of perioperative complications . It has been suggested that a smaller diameter donor artery may contribute to an increased incidence of post - transplantation complications . For example, hepatic arteries with diameters less than 3 mm are considered to present a high surgical risk for liver transplantation; thus, accurate preoperative evaluation of the arterial diameter is essential for successful organ transplantation . Previous studies reported that cta can replace conventional angiography traditionally used for preoperative evaluation of potential organ donors . Along with the rapid evolution in technique, the number of detectors has gradually increased, allowing shorter scan rotation times, submillimeter slice acquisition parameters, and isotropic datasets . Mdcta appears to be an ideal method to evaluate hepatic arteries and venous anatomy, as well as detect potential hepatic transplant complications such as hepatic artery and/or portal vein stenosis or thrombosis . In addition, mdcta has been reported to be as accurate as renal angiography for evaluating the arterial anatomy and more sensitive for detecting venous and parenchymal structures . Therefore, mdcta is a suitable method to evaluate the anatomy of vascular structures of potential xenotransplantation donors as well as human recipients . In conclusion, we present cta data for the major systemic vessels in micropigs, which can be used as standard reference values for xenotransplantation studies . We have determined that 64-channel mdcta allows accurate evaluation of the major systemic vasculature in micropigs.
Add the appropriate pre - tested amount of caspase 3 to 20 l of 12 mg / ml pak2 in buffer a (50 mm tris - hcl, 150 mm nacl, and 2 mm dtt at ph 7.5) and incubate at 34 c for 30 min to fully cleave and activate pak2 . Analyze the cleavage products by sds - page (10%) and coommassie blue staining . Add the cleaved pak2 to activation buffer b (50 mm tris - hcl, 150 mm nacl, 15 mm mgcl2, 10 mm atp) at ph 7.5, in 20 l to a final concentration of 10 mg / ml pak2, and incubate at 34 c for 30 min to fully activate pak2 by autophosphorylation at 8 sites . Confirm full cleavage of pak2 by migration of the p34 and p27 fragments as determined by sds - page . Proper verification of the autophosphorylation conditions is made via autoradiography in a separate experiment using (p)atp or mass spectrometry to detect phosphopeptides . Add 1 ml of 0.1% trifluroacetic acid (tfa) at ph 2.5 to wash the agarose beads twice prior to use . Then, centrifuge the samples for 15 sec at 2,000 x g to remove the beads . Add pak2 (20 g in 2 l of 150 mm nacl, 50 mm tris - hcl and 2 mm dtt at ph 7.5) to 100 l of 0.1% tfa, and incubate the sample for 5 min with 30 l of pepsin - conjugated agarose beads . Equilibrate a reverse phase hplc c18 column with a primary solvent system of 0.1% tfa at ph 2.5 . The pepsin digest (50 l) is eluted using a linear 100-min gradient of 0 - 80% acetonitrile containing 0.1% tfa at a flow rate of 0.2 ml / min . Dry the hplc fractions with a speed - vac (3 h) and resuspend the samples in a solution of acetonitrile (5 l) and 0.1% tfa (5 l) at ph 2.5 . Initially, each fraction is screened for peptides using the maldi - tof perseptive biosystems voyager de str (pe biosystems, foster city, ca, usa). The 16 fractions containing peptides are subjected to tandem mass spectrometry using a q - tof mass spectrometer and a qstar xl omaldi ms / ms to identify the fragments . The sequence of each peptide is verified by the product ions generated by the tandem mass spectrometry with the theoretical m / z ratios based on the primary sequence of pak2 using the protein prospector website (http://prospector.ucsf.edu/). Hold all solutions and reagents needed for h / d exchange at 25 c in a water bath . Atp is dissolved in water and the ph is adjusted to 7.0 prior to use . The additional 4 mm atp in the d2o buffer is to prevent atp dissociated from pak2 after dilution . Initiate h / d exchange by addition of 18 l of buffered d2o (50 mm mops ph 6.98, 125 mm nacl) to 2 l (20 g) of pak2 in a buffer containing 150 mm nacl, 50 mm tris - hcl (ph 7.5) and 2 mm dtt, resulting in a pak2 level of 10 mg / ml and a ph of 7.0 at 0c . Incubate the samples in triplicate in the h / d exchange for 0, 0.5, 1, 3, 5, and 10 min, or 24 h. quench the h / d exchange process by adding 180 l of ice - cold 0.1% tfa at ph 2.2, which brings the ph to 2.5 in a final volume of 200 l . For the samples containing atp, 180 l of ice - cold 0.11% tfa at ph 2.2 is used to maintain the ph at 2.5 in the quenched condition . Add an aliquot (100 l) of each quenched sample to 30 l of activated pepsin - conjugated agarose beads . The pepsin digestion is allowed to proceed on ice for five min and the samples are vortexed every 30 sec . Terminate the digestion by centrifugation of the sample for 15 sec at 5,000 x g at 4 c to remove the pepsin . Rapidly freeze the samples in liquid n2 and store at -80 c for no more than 2 days prior to maldi - tof analysis . The matrix for maldi is 5 mg / ml of -cyano-4-hydroxycinnamic acid (chca) dissolved in a solution (1:1:1) of acetonitrile, ethanol and 0.1% tfa at ph 2.5 and held at 0 c . Partially thaw each sample quickly and mix 1 l of each sample with 1 l of matrix and spot on a 4 c maldi target plate . Apply a moderate vacuum to the plate to dry the spots in 30 sec prior to maldi - tof analysis . Acquire data at a 2-ghz sampling rate at 100,000 data channels, with a 20,000-v accelerating voltage, and a 65% grid voltage using delayed extraction with a 180-ns pulse delay . The maldi - tof instrument is not restricted to any brand or any particular software . Calculate the back exchange based on the ratio of the actual incorporated deuteron number at 24 hr of h / d exchange divided by all possible exchangeable sites, which are the backbone amides except the n - terminal amide (figure 1). Caspase cleavage of pak2 is complete, and produces two fragments, p27 and p34 which migrate separately . The migration of autophosphorylated p27 and p34 shows an overlap on the gel due to the retarded migration of the fully phosphorylated p27 fragment (figure 2). H / d exchange experiments are carried out multiple times between 0 and 10 min (figure 3). As an example, the time course of deuterium incorporation into the m / z peak 1697.85 of inactive pak2 is composed of multiple isotopic peaks as shown by the shift of the mass envelope over time . Caspase - cleaved pak2 (left lane), intact inactive pak2 (middle lane) and caspase - cleaved autophosphorylated pak2 (right lane) were analyzed by sds - page and coommassie blue staining . Inactive pak2 was subjected to h / d exchange for 0 - 10 min and analyzed by maldi - tof . An example of the expanded isotopic distribution of maldi - tof of peak m / z 1697.85 during the time course of h / d exchange is shown . The red dotted line indicates the average of the mass envelope and the shift of the mass envelope shows the deuteration of a peptide . Add the appropriate pre - tested amount of caspase 3 to 20 l of 12 mg / ml pak2 in buffer a (50 mm tris - hcl, 150 mm nacl, and 2 mm dtt at ph 7.5) and incubate at 34 c for 30 min to fully cleave and activate pak2 . Analyze the cleavage products by sds - page (10%) and coommassie blue staining . Add the cleaved pak2 to activation buffer b (50 mm tris - hcl, 150 mm nacl, 15 mm mgcl2, 10 mm atp) at ph 7.5, in 20 l to a final concentration of 10 mg / ml pak2, and incubate at 34 c for 30 min to fully activate pak2 by autophosphorylation at 8 sites . Confirm full cleavage of pak2 by migration of the p34 and p27 fragments as determined by sds - page . Proper verification of the autophosphorylation conditions is made via autoradiography in a separate experiment using (p)atp or mass spectrometry to detect phosphopeptides . Add 1 ml of 0.1% trifluroacetic acid (tfa) at ph 2.5 to wash the agarose beads twice prior to use . Then, centrifuge the samples for 15 sec at 2,000 x g to remove the beads . Add pak2 (20 g in 2 l of 150 mm nacl, 50 mm tris - hcl and 2 mm dtt at ph 7.5) to 100 l of 0.1% tfa, and incubate the sample for 5 min with 30 l of pepsin - conjugated agarose beads . Equilibrate a reverse phase hplc c18 column with a primary solvent system of 0.1% tfa at ph 2.5 . The pepsin digest (50 l) is eluted using a linear 100-min gradient of 0 - 80% acetonitrile containing 0.1% tfa at a flow rate of 0.2 ml / min . Dry the hplc fractions with a speed - vac (3 h) and resuspend the samples in a solution of acetonitrile (5 l) and 0.1% tfa (5 l) at ph 2.5 . Initially, each fraction is screened for peptides using the maldi - tof perseptive biosystems voyager de str (pe biosystems, foster city, ca, usa). The 16 fractions containing peptides are subjected to tandem mass spectrometry using a q - tof mass spectrometer and a qstar xl omaldi ms / ms to identify the fragments . The sequence of each peptide is verified by the product ions generated by the tandem mass spectrometry with the theoretical m / z ratios based on the primary sequence of pak2 using the protein prospector website (http://prospector.ucsf.edu/). Hold all solutions and reagents needed for h / d exchange at 25 c in a water bath . Atp is dissolved in water and the ph is adjusted to 7.0 prior to use . The additional 4 mm atp in the d2o buffer is to prevent atp dissociated from pak2 after dilution . Initiate h / d exchange by addition of 18 l of buffered d2o (50 mm mops ph 6.98, 125 mm nacl) to 2 l (20 g) of pak2 in a buffer containing 150 mm nacl, 50 mm tris - hcl (ph 7.5) and 2 mm dtt, resulting in a pak2 level of 10 mg / ml and a ph of 7.0 at 0c . Incubate the samples in triplicate in the h / d exchange for 0, 0.5, 1, 3, 5, and 10 min, or 24 h. quench the h / d exchange process by adding 180 l of ice - cold 0.1% tfa at ph 2.2, which brings the ph to 2.5 in a final volume of 200 l . For the samples containing atp, 180 l of ice - cold 0.11% tfa at ph 2.2 is used to maintain the ph at 2.5 in the quenched condition . Add an aliquot (100 l) of each quenched sample to 30 l of activated pepsin - conjugated agarose beads . The pepsin digestion is allowed to proceed on ice for five min and the samples are vortexed every 30 sec . Terminate the digestion by centrifugation of the sample for 15 sec at 5,000 x g at 4 c to remove the pepsin . Rapidly freeze the samples in liquid n2 and store at -80 c for no more than 2 days prior to maldi - tof analysis . The matrix for maldi is 5 mg / ml of -cyano-4-hydroxycinnamic acid (chca) dissolved in a solution (1:1:1) of acetonitrile, ethanol and 0.1% tfa at ph 2.5 and held at 0 c . Partially thaw each sample quickly and mix 1 l of each sample with 1 l of matrix and spot on a 4 c maldi target plate . Apply a moderate vacuum to the plate to dry the spots in 30 sec prior to maldi - tof analysis . Acquire data at a 2-ghz sampling rate at 100,000 data channels, with a 20,000-v accelerating voltage, and a 65% grid voltage using delayed extraction with a 180-ns pulse delay . The maldi - tof instrument is not restricted to any brand or any particular software . Calculate the back exchange based on the ratio of the actual incorporated deuteron number at 24 hr of h / d exchange divided by all possible exchangeable sites, which are the backbone amides except the n - terminal amide (figure 1). Caspase cleavage of pak2 is complete, and produces two fragments, p27 and p34 which migrate separately . The migration of autophosphorylated p27 and p34 shows an overlap on the gel due to the retarded migration of the fully phosphorylated p27 fragment (figure 2). H / d exchange experiments are carried out multiple times between 0 and 10 min (figure 3). As an example, the time course of deuterium incorporation into the m / z peak 1697.85 of inactive pak2 is composed of multiple isotopic peaks as shown by the shift of the mass envelope over time . Caspase - cleaved pak2 (left lane), intact inactive pak2 (middle lane) and caspase - cleaved autophosphorylated pak2 (right lane) were analyzed by sds - page and coommassie blue staining . Inactive pak2 was subjected to h / d exchange for 0 - 10 min and analyzed by maldi - tof . An example of the expanded isotopic distribution of maldi - tof of peak m / z 1697.85 during the time course of h / d exchange is shown . The red dotted line indicates the average of the mass envelope and the shift of the mass envelope shows the deuteration of a peptide . Identification of the pepsin - digested fragments is a critical step of the h / d exchange experiment . Pepsin - digested pak2 is eluted through a reverse phase hplc c18 column to obtain a clean background . In our experiments, the peptides were subjected to tandem mass spectrometry (q - tof ms / ms and omaldi ms / ms) to identify their sequences . The ms / ms spectra of a peptide should have at least three product ions to confirm the identification of the peptide . The data explorer 4.0 computer program (applied biosystems) performs the initial baseline correction and noise filtration . We calibrate our spectrum by the theoretical mass of the undeuterated m / z which are 923.45 and 1697.84 . The mass accuracy after calibration can reach 10 ppm . Upon deuteration, the mono - isotope may shift to a higher mass . Unitary step increases to these m / z ratios yielded the enhanced masses associated with deuteration . However, the peak intensities of the isotopic peaks in a particular mass envelope are critical for the calculation of the average mass . The first step of the calculation of the incorporated deuteron is subtracting the peptide mass of the non - deuterated sample from the deuterated sample . Three other factors, the d2o dilution, the residual deuterons in the side chains and the back exchange, will need to be further considered in the calculation (figure 1). The d2o dilution is the dilution factor of d2o after mixing the sample and d2o buffer to initiate the h / d exchange . The residual deuteron (4.5%) in the side chains of the pepsin - digested peptides needs to be subtracted . The back - exchange is the inevitable loss of deuteration in all deuterated and pepsin - digested peptides in the mass measurement process . The most solvent accessible peptide (m / z = 1105.60) after 24-hour of h / d exchange represents a full deuteration region . The incorporated deuteron number for each of the peptides is the difference between the centroid of the deuterated and non - deuterated pak2 peptic peptides . The most highly deuterated peptide m / z 1105 was selected to represent full deuteration when pak2 was at 24 hr of h / d exchange . The back exchange ratio was calculated by the actual incorporated deuteron number at 24 hr of h / d exchange divided by all possible exchangeable sites at peptide m / z 1105.
Patients, clinicians and other healthcare professionals assume that clinical laboratory tests performed by different laboratories at different times on the same sample and specimen can be compared and that results can be reliably and consistently interpreted (1). Unfortunately, these assumptions are not always justified because many laboratory test results are still highly variable, poorly standardized and harmonized . Harmonization represents a fundamental aspect of quality in laboratory medicine as its ultimate goal is to improve patient outcomes through the provision of an accurate and actionable laboratory information (2). Although the initial focus has to a large extent been to harmonize and standardize analytical processes and methods, the scope of harmonization goes beyond to include all other aspects of the total testing process (ttp), such as terminology and units, report formats, reference intervals and decision limits, as well as tests and test profiles request and criteria for interpretation (3, 4). Major reasons to focus on a global picture of harmonization are represented by: a) the nature of errors in laboratory medicine and the evidence of the high rates of errors in the pre - and post - analytical phases (5, 6), b) the evidence of large variations in terminology, units and reference ranges (7), c) the increasing demand for improving appropriateness in test request and result interpretation (8), and, finally, d) the risks for patient safety related to previous issues (9). As recently highlighted by tate and coll clinical laboratory testing is now a global activity, and laboratories no longer work in isolation therefore, there is an increasing awareness of the importance and urgency to achieve harmonization in all steps of the total testing process (ttp) for ensuring comparability and interchangeability of laboratory information . Several initiatives and projects are in progress for harmonizing both the pre - pre - analytical as well as the pre - analytical processes . In the initial steps of the cycle, the issue of demand management which focuses on ensuring appropriate requesting is receiving an increasing importance . A step forward in this area has been achieved through the acceptance of the definition of inappropriate test demand that appears to be a request that is made outside some form of agreed guidance (11). The type of guidance may vary from national and international guidelines to locally agreed behaviours but the basic concept is the application of scientific evidence rather than anecdote to clinical practice (8). Among the several progress, a special attention should be deserved to the national minimum retesting interval project promoted by the clinical practice section of the association for clinical biochemistry (acb) in the uk uses a state of the art approach to set consensus / evidence based recommendations on when a test should be repeated . The importance to standardize patient preparation and sample collection requirements to minimize the uncertainty from the pre - analytical phase has already activated efforts to provide better evidence and recommendations . Further work to optimize sample transportation procedures as well as the identification of indicators for their monitoring has been done, and this is a premise for future harmonization initiatives in this field (15 - 17). In addition, the harmonization of procedures for evaluating the quality of biological samples, the criteria for their acceptance and rejection even through the use of automated workstations and serum indexes has been largely reported and promoted (18 - 21). Although the terms standardization and harmonization define two distinct, albeit closely linked, concepts in laboratory medicine, the final goal is the same: the equivalence of measurement results among different routine measurement procedures over time and space according to defined analytical and clinical quality specifications (22). While standardization, which allows the establishment of metrological traceability to the system of units (si), represents the recommended approach, for a multitude of measurands the si does not yet apply, in particular when the components in the measurand comprise a heterogeneous mixture . Over the past two decades, several clinical laboratory tests have been standardized through the development of reference measurement procedures, the ifcc playing a major role in this project . In particular, the standardization of glycated haemoglobin contributed to significant improvements in diabetes (23). Other important projects are in progress in order to standardize measurands of high clinical value such as cardiac troponin (24) and carbohydrate - deficient transferrin (25). However, as a matter of fact, for a huge number of measurands neither a reference method nor reference material are available (26). For all these measurands, harmonization of available methods and diagnostic systems should be promoted . In the last few years, significant progress has been done establishing an overarching control system of the harmonization process in all its aspects through improvements in: a) defining the quality and quantity of human samples to be used for standardization and harmonization studies (27, 28), b) identifying new and more robust mathematical models and statistical treatments of the data (29, 30). A major lesson we learnt, is that standardization and harmonization should not be applied only to clinical chemistry measurands, but to the whole field of laboratory medicine, including molecular diagnostics (31). It should be highlighted that one of the most impressive and effective examples of harmonization in laboratory medicine is the expression of prothrombin results as international normalized ratio (inr). Pt results are corrected mathematically into inr by raising the pt - ratio to a power equal to the international sensitivity index (isi) thus harmonizing results stemming from different thromboplastins from patients on treatment with vitamin k antagonists (32). Therefore, the debate on harmonization should not be limited to clinical chemistry scientists but should involve all fields of laboratory medicine to provide comparability and interchangeability of all tests usually performed in clinical laboratories, including omics . Under the patient - centered viewpoint, the supposed diatribe between standardization and harmonization should concentrate on more joint efforts to provide equivalence of measurement results among different routine measurement procedures and different clinical laboratories over time and space . Several issues in the post - analytical phase are increasingly acknowledged as fundamental steps for achieving higher harmonization and effectiveness of laboratory information . Current evidence collected in the uk and in australia demonstrates a significant variation in the units used for some tests and even more widespread variation in the way they are represented on screens and paper, as well as the way they appear in electronic messages (33). This, in turn, creates a potential for misinterpretation of laboratory results and risk for patient safety (7). As test results are increasingly transferred electronically, the argument for adopting a single standardized set of units needs immediate uptake (34). Reference intervals are the most widely used decision - making tool in laboratory medicine and serve as the basis for many of the interpretations of laboratory results . Numerous studies have shown large variation of reference intervals, even when laboratories use the same assay thus contributing to different clinical interpretation, risk for patients and unnecessary test repetition (35, 36). The importance of obtaining reference intervals traceable to referent measurement systems has been reported (37) and evidence - based approaches to harmonize reference intervals have been promoted (38). The nordic reference interval project (norip) was one of the earliest reference interval harmonization initiatives and established common reference intervals in apparently healthy adult populations from five nordic countries for 25 of the most common clinical chemistry analytes (39) several more recent initiatives have already provided data for adopting common reference intervals in huge geographical areas such as asia (40), canada (41 - 43) and australasia (44). In the australasian approach, selection of a common reference interval requires a checklist assessment process be adopted to assess the evidence for their use and is based on the criteria summarized in table 1 . The final decision on the common reference interval to be used involves weighing up each piece of evidence . Importantly, the proposed reference limits should also be supported by flagging rates which provide an indication of the clinical considerations of a reference interval (46). However, the use of asterisks should require further considerations because patients and people who have no training in laboratory medicine now have direct access to their laboratory test results . Various practices, a number of different terminologies and extremely different values have been described in the literature affecting the quality of critical results management . Large variability in critical results practices have been reported not only when comparing different geographical areas but even in the same country (47). Very recently, a study on the outcomes of critical values notification, demonstrated that in more than 40.0% of cases, they were unexpected findings, and that notification led to a change of treatment in 98.0% of patients admitted to surgical and in 90.6% of those admitted to medical wards, thus confirming their importance for an effective clinical decision - making (48). Several initiatives and recommendations on the harmonization of critical result management have been released (49 - 52) and, finally, a better awareness of the importance of this issue for improving the quality of laboratory services and patient safety has been achieved . The definition, implementation and monitoring of valuable analytical quality specifications have played a fundamental role in improving the quality of laboratory services and reducing the rates of analytical errors . However, a body of evidence has been accumulated on the relevance of the extra - analytical phases, namely the pre - analytical steps, their vulnerability and impact on the overall quality of the laboratory information . The identification and establishment of valuable quality indicators (qis) represents a promising strategy for collecting data on quality in the total testing process (ttp) and, particularly, for detecting any mistakes made in the individual steps of the ttp, thus providing useful information for quality improvement projects (53). In addition, qis represent a fundamental requirement for the accreditation of clinical laboratories according to the international standard iso 15189(54). While some interesting programs on indicators in the ttp have been developed in some countries, there was no consensus for the production of joint recommendations focusing on the adoption of universal qis and common terminology in the total testing process . A preliminary agreement has been achieved in a consensus conference organized in padua in 2013, after revising the model of quality indicators (mqi) developed by the working group on laboratory errors and patient safety of the international federation of clinical chemistry and laboratory medicine (ifcc). The consensually accepted list of qis, which takes into consideration both their importance and applicability, could be actually tested by all potentially interested clinical laboratories to identify further steps in the harmonization project (55). Preliminary performance criteria based on data collected have been proposed to allow a benchmark between different laboratories and to support improvement initiatives (56). Several initiatives and projects are in progress for harmonizing both the pre - pre - analytical as well as the pre - analytical processes . In the initial steps of the cycle, the issue of demand management which focuses on ensuring appropriate requesting is receiving an increasing importance . A step forward in this area has been achieved through the acceptance of the definition of inappropriate test demand that appears to be a request that is made outside some form of agreed guidance (11). The type of guidance may vary from national and international guidelines to locally agreed behaviours but the basic concept is the application of scientific evidence rather than anecdote to clinical practice (8). Among the several progress, a special attention should be deserved to the national minimum retesting interval project promoted by the clinical practice section of the association for clinical biochemistry (acb) in the uk uses a state of the art approach to set consensus / evidence based recommendations on when a test should be repeated . (the importance to standardize patient preparation and sample collection requirements to minimize the uncertainty from the pre - analytical phase has already activated efforts to provide better evidence and recommendations . Further work to optimize sample transportation procedures as well as the identification of indicators for their monitoring has been done, and this is a premise for future harmonization initiatives in this field (15 - 17). In addition, the harmonization of procedures for evaluating the quality of biological samples, the criteria for their acceptance and rejection even through the use of automated workstations and serum indexes has been largely reported and promoted (18 - 21). Although the terms standardization and harmonization define two distinct, albeit closely linked, concepts in laboratory medicine, the final goal is the same: the equivalence of measurement results among different routine measurement procedures over time and space according to defined analytical and clinical quality specifications (22). While standardization, which allows the establishment of metrological traceability to the system of units (si), represents the recommended approach, for a multitude of measurands the si does not yet apply, in particular when the components in the measurand comprise a heterogeneous mixture . Over the past two decades, several clinical laboratory tests have been standardized through the development of reference measurement procedures, the ifcc playing a major role in this project . In particular, the standardization of glycated haemoglobin contributed to significant improvements in diabetes (23). Other important projects are in progress in order to standardize measurands of high clinical value such as cardiac troponin (24) and carbohydrate - deficient transferrin (25). However, as a matter of fact, for a huge number of measurands neither a reference method nor reference material are available (26). For all these measurands, harmonization of available methods and diagnostic systems should be promoted . In the last few years, significant progress has been done establishing an overarching control system of the harmonization process in all its aspects through improvements in: a) defining the quality and quantity of human samples to be used for standardization and harmonization studies (27, 28), b) identifying new and more robust mathematical models and statistical treatments of the data (29, 30). A major lesson we learnt, is that standardization and harmonization should not be applied only to clinical chemistry measurands, but to the whole field of laboratory medicine, including molecular diagnostics (31). It should be highlighted that one of the most impressive and effective examples of harmonization in laboratory medicine is the expression of prothrombin results as international normalized ratio (inr). Pt results are corrected mathematically into inr by raising the pt - ratio to a power equal to the international sensitivity index (isi) thus harmonizing results stemming from different thromboplastins from patients on treatment with vitamin k antagonists (32). Therefore, the debate on harmonization should not be limited to clinical chemistry scientists but should involve all fields of laboratory medicine to provide comparability and interchangeability of all tests usually performed in clinical laboratories, including omics . Under the patient - centered viewpoint, the supposed diatribe between standardization and harmonization should concentrate on more joint efforts to provide equivalence of measurement results among different routine measurement procedures and different clinical laboratories over time and space . Several issues in the post - analytical phase are increasingly acknowledged as fundamental steps for achieving higher harmonization and effectiveness of laboratory information . Current evidence collected in the uk and in australia demonstrates a significant variation in the units used for some tests and even more widespread variation in the way they are represented on screens and paper, as well as the way they appear in electronic messages (33). This, in turn, creates a potential for misinterpretation of laboratory results and risk for patient safety (7). As test results are increasingly transferred electronically, the argument for adopting a single standardized set of units needs immediate uptake (34). Reference intervals are the most widely used decision - making tool in laboratory medicine and serve as the basis for many of the interpretations of laboratory results . Numerous studies have shown large variation of reference intervals, even when laboratories use the same assay thus contributing to different clinical interpretation, risk for patients and unnecessary test repetition (35, 36). The importance of obtaining reference intervals traceable to referent measurement systems has been reported (37) and evidence - based approaches to harmonize reference intervals have been promoted (38). The nordic reference interval project (norip) was one of the earliest reference interval harmonization initiatives and established common reference intervals in apparently healthy adult populations from five nordic countries for 25 of the most common clinical chemistry analytes (39) several more recent initiatives have already provided data for adopting common reference intervals in huge geographical areas such as asia (40), canada (41 - 43) and australasia (44). In the australasian approach, selection of a common reference interval requires a checklist assessment process be adopted to assess the evidence for their use and is based on the criteria summarized in table 1 . The final decision on the common reference interval to be used importantly, the proposed reference limits should also be supported by flagging rates which provide an indication of the clinical considerations of a reference interval (46). However, the use of asterisks should require further considerations because patients and people who have no training in laboratory medicine now have direct access to their laboratory test results . Various practices, a number of different terminologies and extremely different values have been described in the literature affecting the quality of critical results management . Large variability in critical results practices have been reported not only when comparing different geographical areas but even in the same country (47). Very recently, a study on the outcomes of critical values notification, demonstrated that in more than 40.0% of cases, they were unexpected findings, and that notification led to a change of treatment in 98.0% of patients admitted to surgical and in 90.6% of those admitted to medical wards, thus confirming their importance for an effective clinical decision - making (48). Several initiatives and recommendations on the harmonization of critical result management have been released (49 - 52) and, finally, a better awareness of the importance of this issue for improving the quality of laboratory services and patient safety has been achieved . The definition, implementation and monitoring of valuable analytical quality specifications have played a fundamental role in improving the quality of laboratory services and reducing the rates of analytical errors . However, a body of evidence has been accumulated on the relevance of the extra - analytical phases, namely the pre - analytical steps, their vulnerability and impact on the overall quality of the laboratory information . The identification and establishment of valuable quality indicators (qis) represents a promising strategy for collecting data on quality in the total testing process (ttp) and, particularly, for detecting any mistakes made in the individual steps of the ttp, thus providing useful information for quality improvement projects (53). In addition, qis represent a fundamental requirement for the accreditation of clinical laboratories according to the international standard iso 15189(54). While some interesting programs on indicators in the ttp have been developed in some countries, there was no consensus for the production of joint recommendations focusing on the adoption of universal qis and common terminology in the total testing process . A preliminary agreement has been achieved in a consensus conference organized in padua in 2013, after revising the model of quality indicators (mqi) developed by the working group on laboratory errors and patient safety of the international federation of clinical chemistry and laboratory medicine (ifcc). The consensually accepted list of qis, which takes into consideration both their importance and applicability, could be actually tested by all potentially interested clinical laboratories to identify further steps in the harmonization project (55). Preliminary performance criteria based on data collected have been proposed to allow a benchmark between different laboratories and to support improvement initiatives (56). Although standardization and harmonization in laboratory medicine have been recognized as essential requirements for improving quality and value for patients for a long time, some major barriers have affected the success of such projects . In fact, the processes required to achieve harmonization are complicated, costly, and time consuming: a systematic approach, therefore, is needed . Well - defined procedures, transparent operations, effective communication with all stakeholders, and a consensus approach to cooperation (57). The increasing demand for standardization and harmonization in laboratory medicine requires incremental progress in addressing these issues through the cooperation between many stakeholders: laboratory professionals and their scientific societies and federations, clinicians, in vitro manufacturing industry, accreditation and regulatory bodies, and patients representatives (2). Several organizations, such as the ifcc, the european federation of clinical chemistry and laboratory medicine (eflm), the american association for clinical chemistry (aacc), the world health organization, the recently formed international consortium for harmonization of clinical laboratory results (ichclr) that are working in the field should cooperate and integrate their efforts to avoid duplication of initiatives and to provide joint programs . Other scientific organizations such as the clinical and laboratory standards institute (clsi) and the joint committee for traceability in laboratory medicine (jctlm), are recognized to play a major role in providing guidelines and lists of reference materials and reference procedures . But, first and foremost, laboratory professionals have to better understand the urgent need to improve harmonization in everyday clinical practice and to take a proactive role in efforts to assure comparability and interchangeability of laboratory information . According to a patient - centered viewpoint, the meaning of harmonization in the context of laboratory medicine is that the information should be comparable irrespective of the measurement procedure used and where and/or when a measurement is made: this represents the major driver for implementing harmonization initiatives . In recent years, further demanding drivers have increased the need for, and relevance of, efforts for harmonizing laboratory information, first and foremost the evidence that variations in laboratory information not only cause confusion but are potentially dangerous . There is convincing evidence that errors in laboratory medicine affect patient outcomes and affect patient safety (6). Two major progresses have been made in the area of harmonization in laboratory medicine: first, the awareness that harmonization should take into consideration not only the analytical phase but all steps of the ttp, thus dealing with the request, the sample, the measurement, and the report . Second, as the processes required to achieve harmonization are complicated, a systematic approach is needed . A further achievement is the recognition of the need to also apply the concepts of harmonization and standardization in clinical research and in projects of translational medicine (58). The cooperation between laboratory professionals, clinicians, ivd manufacturers, accreditation and regulatory bodies is essential.
Type 2 diabetes is a heterogeneous disorder characterized by peripheral insulin resistance, defects in insulin secretion, and -cell apoptosis . Pancreatic -cell dysfunction is central to the pathogenesis of type 2 diabetes, and the loss of functional -cell mass in type 2 diabetes is at least in part secondary to increased -cell apoptosis . Obesity is a well - known risk factor for diabetes and is characterized by elevated levels of circulating free fatty acids (ffas). Prolonged exposure to elevated levels of ffas has been shown to cause defective -cell proliferation and increased -cell apoptosis . Therefore, lipotoxicity plays an important role in underlying the mechanism of type 2 diabetes . Glucagon - like peptide-1 (glp-1), an incretin hormone secreted by intestinal l - cells, is a recent modality for the treatment of type 2 diabetes . Glp-1 and its receptor agonists exhibit a variety of benefits to diabetic patients . Glp-1 can be used against hyperglycemia and obesity in most t2 dm diabetic patients by stimulating insulin secretion, inhibiting glucagon secretion, slowing gastric emptying, and promoting satiety . Among all these effects, furthermore, recent data have shown that glp-1 and its receptor agonists promote the survival of -cell lines when challenged with various apoptotic stimulators, including hyperglycemia, inflammatory cytokines, oxidative stress, and endoplasmic reticulum stress [810]. However, until now whether exendin-4, a glp-1 receptor agonist, exerts cytoprotective effects in pancreatic -cells under lipotoxic condition had not been determined completely . Therefore, the aim of the present study was to investigate the potential antiapoptotic and prosurvival actions of exendin-4 in pancreatic -cells under a chronic lipotoxic condition and the underlying signaling pathways involved . Fatty - acid - free bovine serum albumin (bsa, fraction v), palmitate, hoechst33258, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromides (mtt), and pd98059 were purchased from sigma - aldrich (st . Louis, mo, usa). The anti - phospho - erk1/2 and anti - total erk1/2 antibodies were obtained from cell signaling technology (danvers, ma, usa). The anti - bax and anti - bcl-2 antibodies were obtained from santa cruz biotechnology (heidelberg, germany). An enzyme - linked immunosorbent assay- (elisa-) based bromodeoxyuridine (brdu) incorporation kit was from roche (basel, switzerland). The caspase-3 activity assay kit was from r&d systems (minneapolis, mn, usa). Mouse pancreatic -cell line min6 was a kind gift from biochemistry lab of china medical university with passage number of 10 to 20 . They were maintained in dulbecco modified eagle medium (dmem) containing 25 mm glucose, 15% fetal bovine serum (fbs), 100 u / ml penicillin, 100 mg / ml streptomycin, 100 mg / ml l - glutamine, and 5 g / l -mercaptoethanol in a 37c humidified atmosphere with 5% co2 and 95% air . Cells at 80% confluence were washed with phosphate - buffered saline (pbs) and preincubated overnight in serum - free dmem before treatment . Min6 cells were cultured in a high glucose (25 mm) serum - free dmem with 0.5% bsa or 0.4 mm palmitate added 0.5% bsa, with or without erk1/2 inhibitor, in the presence or absence of exendin-4 . Briefly, a 20 mm solution of palmitate in 0.01 m naoh was incubated at 70c for 30 min . Then 330 l 30% bsa and 400 l palmitate / naoh mixture were mixed together, filter - sterilized, and added into 20 ml dmem . We selected a 25 mm glucose concentration for all tests because an increased glucose concentration was essential for min6 proliferation, and 25 mm glucose protected min6 cells from apoptosis . Graded doses of exendin-4 (1, 10, 100, and 500 nm) were prepared freshly before tests ., cells were incubated with 1 mg / ml mtt for 1 h. the medium was removed and the formazan product was solubilized with 150 l dimethyl sulfoxide . Viability was assessed by spectrophotometry at 570 nm absorbance using a 96-well plate reader . Briefly, min6 cells were set up onto 96-well plates at 80% confluence and incubated overnight in serum - free dmem before experiments, and brdu was added to the culture medium for 1 h before cells harvest . Cells were then fixed and incubated with a peroxidase - conjugated anti - brdu antibody, and immune complexes were quantified by spectrophotometry . The hoechst positive cells represent the apoptotic cells, which were characterized with chromatin condensation or fragmented nuclear membrane . Briefly, hoechst staining was performed by exposing the cell slides to 10 g / ml hoechst33258 for 10 min at room temperature . Caspase-3 activity was measured in triplicate with a caspase-3 colorimetric assay kit, according to the manufacturer's manual . In brief, after two time washes with ice - cold pbs, cells were harvested and centrifuged at 10,000 rpm for 10 min, followed by the addition of 1 l dithiothreitol (dtt) and 100 l lysis buffer . Cell lysates were placed in a 96-well plate and incubated for 2 h at 37c with 10 l caspase-3 colorimetric substrate (devd - pna). 50 g protein samples (in 20 l buffer) were separated by sds - electrophoresis on 12% gradient polyacrylamide gels and transferred onto pvdf membranes . The membranes were incubated with the primary antibodies with appropriate concentration, including anti - phospho - erk1/2 antibody (1: 1,000), anti - total erk1/2 antibody (1: 1,000), anti - bax antibody (1: 200), and anti - bcl-2 antibody (1: 200). Immunodetection was performed with ecl advance, and resulting images were analyzed by scion image software version 4.0.3.2 (scion corporation, frederick, md). Differences between groups were determined by one - way analysis of variance (anova) followed by post hoc testing and correction by least significant difference / dunnett's t - test . If the f ratio was statistically significant, a turkey's post hoc test was considered . To determine the effects of exendin-4 on -cell survival and proliferation, min6 cells were incubated in the 0.5% bsa (bsa) and 0.4 mm palmitate added 0.5% bsa (pa), with or without increasing concentrations of exendin-4 (1500 nm) (ex) for 24 h. cell viability and proliferation were assessed by the mtt assay and an elisa - based brdu incorporation kit, respectively . Cell survival (figure 1(a)) was significantly reduced by palmitate treatment (28%, p <0.01 versus bsa). Exendin-4 treatment reversed palmitate - induced reduction of cell viability, and 100 nm exendin-4 displayed a major effect of restoring the cell viability by 27% (p <0.01 versus pa). Exendin-4 treatment alone showed a nonsignificant promotion to cell survival, and 100 nm exendin-4 provided the best potentiation (112%, p = 0.21 versus bsa). Cell proliferation (figure 1(b)) was decreased under palmitate exposure (38%, p <0.01 versus bsa). This decrease was inhibited by exendin-4 treatment, most obviously at 100 nm (29%, p <0.01 versus pa). Exendin-4 treatment alone displayed a nonsignificant increase in cell proliferation, and 100 nm exendin-4 provided the greatest tendency (120%, p = 0.11 versus bsa). In the presence of pa, 100 nm exendin-4 achieved a significant proliferative effect (91%, p = 0.03 versus pa). We next assessed cell apoptosis by hoechst33258 assay and caspase-3 activity assay . For hoechst33258 assay, min6 cells were incubated with or without 0.4 mm palmitate, in the presence or absence of 100 nm exendin-4 (figure 1(c)). Pa exposure for 24 h induced apoptosis (34.3%, p <0.01 versus bsa), which was reversed by 100 nm exendin-4 treatment by decreasing the apoptosis to 11.9% (p <0.01, pa + ex versus pa). Apoptosis was significantly increased in cells treated with pa alone (133%, p <0.01, pa versus bsa). 100 nm exendin-4 treatment with pa presence resulted in a significant decrease of apoptosis (87%, p <0.01, pa + ex versus pa). We investigated the effect of exendin-4 on erk1/2 phosphorylation under palmitate treatment, by detecting the ratio of phosphorylated erk1/2 expression to total erk1/2 expression (figure 2(a)). The erk1/2 phosphorylation was blocked by palmitate exposure (0.624 0.048 versus 0.496 0.062, p <0.05 bsa versus pa + ex at 0 min). At the end of the preincubation period, 100 nm exendin-4 was added . The maximal effect was observed at 5 min (0.721 0.135 versus 0.496 0.062, p <0.01 pa + ex at 5 min versus pa + ex at 0 min). Exendin-4 also induced the phosphorylation of erk1/2 in a concentration - dependent manner (figure 2(b)) and 100 nm exendin-4 treatment produced the most effective potentiation (0.744 0.083 versus 0.494 0.117, p <0.01 pa + ex at 100 nm versus pa). To establish the induction of phosphorylation of erk1/2 by exendin-4, we did further treatment using pd98059, a specific erk1/2 inhibitor (figure 2(c)). The exendin-4-induced phosphorylation of erk1/2 was obviously suppressed by pd98059 (0.707 0.096 versus 0.556 0.050, p <0.05 ex + pa versus ex + pd + pa), whereas the effect of pd98059 on erk1/2 phosphorylation without exendin-4 was similar to that of pa alone (0.459 0.057 versus 0.519 0.071, p = 0.217 pa + pd versus pa). We also determined the role of the erk1/2 inhibitor on the cytoprotective effect of exendin-4 by mtt assay and hoechst33258 assay (figures 2(d) and 2(e)). Consistent with the aforementioned results, exendin-4 treatment promoted cell survival (95.3 3.7% versus 68.4 6.9%, p <0.01 ex + pa versus pa) and prevented apoptosis of min6 cells (21.2 2.1% versus 33.5 3.7%, p <0.01 ex + pa versus pa) under lipotoxic condition, whereas pd98059 suppressed this promotion of cell survival (71.0 4.6% versus 95.3 3.7%, p <0.05 ex + pd + pa versus ex + pa) and attenuated the restore of apoptosis (29.2 3.2% versus 21.2 2.1%, p <0.05 ex + pd + pa versus ex + pa) under lipotoxic condition . All these results strongly suggested that exendin-4 protected min6 cells against lipotoxicity, at least in part, via activation of erk1/2 signaling pathway . Western blot analysis of bcl-2 and bax were conducted after 24 h culture under lipotoxic condition (figure 3). We found a significant decreased expression of the antiapoptotic protein bcl-2 (figure 3(a), p <0.01 versus bsa) and enhanced expression of the proapoptotic protein bax (figure 3(b), p <0.01 versus bsa) in min6 cells under palmitate treatment . While the exendin-4 treatment showed a significant increased expression of bcl-2 (figure 3(a), p <0.05 versus pa) and a nonsignificant decreased expression of bax levels (figure 3(b), p = 0.22 versus pa), compared with the parallel lipotoxic condition cultured without exendin-4 . The incretin glucagon - like peptide-1 (glp-1), the major gastrointestinal product of proglucagon processing, has been shown to exert trophic effects on -cells . Although roles of exendin-4 on cell proliferation and antiapoptosis have been demonstrated in -cells, its mechanisms are not fully understood . Moreover, whether exendin-4 protects -cells against lipotoxicity remains to be determined . In the present study, we found that exendin-4 inhibited palmitate - induced apoptosis via activating erk1/2 pathway and also through inhibiting mitochondrial apoptosis pathway in the min6 cells . Physiologic levels of lipids and glucose are not toxic but essential to -cell function, while prolonged exposure of pancreatic -cells to high levels of fatty acid impairs insulin gene expression, inhibits insulin synthesis and secretion, and induces -cell apoptosis [11, 21, 22]. In vivo, the normal plasma concentration of ffa is less than 0.6 mmol / l but could exceed 1 mmol / l in type 2 diabetic patients [23, 24]. Palmitate and oleate are the two most represented ffas in plasma (20 to 25% each), linked to albumin in the circulation [25, 26]. To mimic what is observed in vivo, we used a mixture of palmitate with 5% fatty - acid - free bsa . This high albumin concentration was used to obtain an appropriate albumin to nonesterified fatty acid ratio . In our study, the direct effects of long - term elevated palmitate on the survival of pancreatic -cells were studied . Consistent with previous observations [27, 28], theoretically, antilipotoxicity through blockade of apoptosis and enhancement of proliferation may be a novel approach to protect pancreatic -cells . Accumulating evidence supports the role of glp-1 mimetics and enhancers in regulating proliferation and protecting from cellular apoptosis . These agents constitute a novel class of antidiabetes medications, which might have a major impact on the treatment of type 2 diabetes [2931]. In this study, we demonstrated that treatment with exendin-4, a glp-1 agonist, protected pancreatic -cell from palmitate - induced toxicity by enhancing proliferation and inhibiting apoptosis, in a dose - dependent manner (figure 1). In addition, exendin-4 treatment activated the erk1/2 signaling pathway . Erk1/2, a well - known downstream target of raf-1, has been shown to participate in pathways controlling -cell survival . It has been reported in several studies that acute glucose and protein kinase a signaling may regulate -cell growth and survival through erk1/2 [3234]. On the other hand, others have shown that activation of erk1/2 is required for human islet apoptosis in response to chronic exposure to high glucose concentrations or interleukin-1 . The outcome may depend on the timing and duration of erk1/2 activation . In the present study, our findings showed that exposure of min6 cells to chronic lipotoxic conditions reduced the phosphorylation of erk1/2 . In addition, this reduction was reversed by exendin-4 treatment through a rapid activation of erk1/2 . Further treatment with the erk1/2 inhibitor pd98059 blocked this protective effect of exendin-4 (figure 2). These data indicate that exendin-4 exerted cytoprotective effect on pancreatic -cells against lipotoxicity, at least in part via the erk1/2 pathway . The mechanisms underlying apoptosis are regulated by defined biochemical pathways, involving members of the bcl-2 family . In mammalian cells, the bcl-2 family of proteins plays a central role in modulating mitochondrial - dependent apoptosis . Both prosurvival and proapoptotic bcl-2 family members are critical death regulators via mitochondrial apoptosis pathway . Among bcl-2 family proteins, prosurvival bcl-2 stabilizes the mitochondrial membrane and prevents the cytochrome c release from the mitochondria and the followed activation of caspases . In the present study, bcl-2 was found to be downregulated and the proapoptotic bax was upregulated, which was in accordance with the increased activity of caspase-3 under lipotoxic condition . After exendin-4 treatment, we observed that these alterations were partially counteracted (figure 3). So, our results indicate that exendin-4 conducts its protective effect through inhibiting mitochondrial apoptosis pathway, by promoting bcl-2 protein expression . Interestingly, some bcl-2 family proteins were found to be involved in erk1/2 signaling pathway . As reviewed by cagnol and chambard, in contrast, antiapoptotic proteins bcl-2 and bcl - xl were downregulated by erk1/2 activation . On the other hand, phosphorylation of proapoptotic protein bad was assumed to be involved in erk1/2 promoted cell survival . In human pancreatic cancer cells, inhibition of erk1/2 activities caused downregulation of antiapoptotic proteins bcl-2, mcl-1, and bcl - xl without affecting the proapoptotic proteins bax and bak . These various reports might be interpreted depending on different cell types or conditions . In our study, we found both erk1/2 activation and enhanced bcl-2 expression induced by exendin-4 treatment under lipotoxic condition . Further study on the relation between erk1/2 activation and inhibition of mitochondrial apoptosis pathway may reveal more detailed molecular mechanism of glp-1 mediated cytoprotective role on pancreatic -cells . Compared to other insulin - secreting cell lines, min6 cells express glut-2 and glucokinase and display a similar glucose stimulating insulin secretion to normal primary -cells . The insulin secretion of min6 cells reaches the maximal level approximately sevenfold above the basal level at 25 mmol / l, which is consistent with the performance of our min6 cells (data not shown). But as an immortalized cell line, some of its characters, especially the proliferative specific, are not exact same with primary -cells . This could be a confounding factor within any study on this aspect . In conclusion, it is likely that exendin-4 induced erk1/2 activation is an important pathway, by which exendin-4 exerts antiapoptotic actions against palmitate - induced lipotoxicity . Besides, the potential cytoprotective effect of exendin-4 on -cells involves the mitochondrial apoptosis pathway, by upregulating bcl-2 . Because lipotoxicity is supposed to be responsible for -cell loss in the pathological process of obesity - associated type 2 diabetes, the antilipotoxic effects on residual -cells of exendin-4 may arouse interest, considering its therapeutic utilization in type 2 diabetes treatment.
Activities in cells are partially specified by their respective ribonucleic acid (rna) content.1 with respect to mrna, at any given time, a theoretical human cell would feature the whole or some subset of all of the protein coding gene s transcripts, including all splice variants . With an estimated 21,000 coding genes and an average of 6 splice - variant forms per gene,2 the set of all messengers a given human cell can hold is at least 100,000 elements . Note, this estimate does not take into account rna editing and other post - transcriptional rna modifying events that can potentially increase the number of elements in the theoretical human set of messenger rna (mrna) molecules.3 due to their biochemical properties, mrnas can be dosed simultaneously in multiplexed assays . These array - based methods make use of the fact that single strands of nucleic acids will form a duplex with a reverse complementary strand.4 multiplexing is enabled by designing a series of probes (ie, reverse complementary strands) specific to their cognate mrna molecule within the range of hybridization parameter values . In microarray - based approaches, the probes deposited on the solid surface are in excess with regards to the soluble complementary mrna fraction . Based on the kinetics of hybridization of a homoduplex forming between 2 complementary rna molecules, the amount of mrna bound to immobilized probes at equilibrium is proportional to the concentration of mrna in the assayed sample.5 this pairing of the mrna molecule to its cognate probe on the microarray is the basic principle of mrna quantification . However, the nucleic acid molecules hybridized to the immobilized probes are not the original mrna molecules extracted from the biosample . The mrnas whose original quantities need to be dosed undergo some molecular modifications aimed at detecting their respective occurrences on the microarray once the equilibrium has been reached . One way to achieve this is to incorporate a fluorophore, so that colorimetric detection systems can be applied for subsequent quantification.6 the cartoon in figure 1 displays the set of steps performed in a generic mrna quantification assay using an array - based method . This drawing is shown to highlight the fact that an mrna assay read - out represents the outcome of a long series of steps, each of which potentially contributing to the overall variability of the quantification operation . The fact that rna abundance is so sensitive to both biological and chemical changes raises the concern that each of these steps could alter the original rna distribution, no matter which final detection method is applied . Newly introduced rna quantification technologies, collectively referred to as rna - seq, are skipping the hybridization step . Yet, they require similar complex molecular transformations, from the initial rna to the final molecular form used for the measurement.7 as a reminder, the objective of an mrna quantification assay is to assess the amount of mrna in the original biospecimen . Within the biological systems under investigation this level can change according to internal and/or external perturbations, eg, by a treatment with a pharmacologically active compound . One of the common goals of mrna quantification is to correlate a change in a subset of mrnas with a change in biological phenotype . Implicitly, the goal of the dosage is to derive the source of the biological variability, and hence to minimize the impact of other sources of change that can confound the variability typically brought on by the quantification procedures themselves . Figure 1 shows the events between the original specimen to be investigated and the rna assay readout, thus illuminating possible sources of technical variability . One of these sources is the choice of microarray used for the measurement, with each brand or source featuring its own set of probes . For example, one may use short oligonucleotides produced by in - situ photolithographic synthesis while another relies on long oligonucleotide - spotted arrays.8,9 it is acknowledged that the nature of the probe, ie, its sequence, can affect the hybridization equilibrium.10 the results of micro - array based assays are usually presented as data matrices with a molecular identifier as observations and biosamples as columns . In its most widely used form, the molecular identifier is a gene identifier, with a 1-to-1 relationship between a gene and a transcript being implicit in this kind of representation . Whether the precisions and accuracies of the measurements of a transcript by means of 2 different probes are close enough to make inter - microarray data analyses relevant is still a matter of legitimate debate.11 it is common practice in the literature to refer to observed microarray measurements as gene expression levels . Gene expression levels in this context means the steady state level of mrna, since this is the quantity that is actually measured in the assay . In other contexts, gene expression takes the meaning of de novo transcript initiation.12 mrna are not detected directly . For example, the rna is usually reverse - transcribed into a single stranded complementary dna.13 the reverse transcription is primed with either an oligo - dt primer that matches the 3poly - a tail of the mrnas or with random- hexamers which, as their name indicates, form duplexes at various expectedly random positions in the mrna template.14 the incorporation of dye into complementary dna can be achieved during the reverse transcription by providing modified nucleotides15 that can be handled by the rna - dependent dna polymerase or by means of covalently adding a fluorophore to the 5 end of the rna strand . Figure 2a shows the details of the successive steps from the soluble mrna isolated from the cells to the labeled nucleic - acids hybridized to their cognate probes on the microarray . 2 reasonable questions to ask are whether the various labeling steps alter the original distribution of the mrnas samples, and if they do, to what extent does this occur? In order to address these questions, an experiment could be designed utilizing a large quantity of rna from distinct, contrasted biological systems . The molecules would then be aliquoted and those aliquots partitioned further into groups according to the labeling protocol applied . The various labeled nucleic acids would then be assayed in replicates to the same type of microarray, such that the only source of variability is the actual rna labeling procedure, everything else remaining constant . The biological systems consisted of a set of isogenic mice of same gender and age, distributed into groups according to diet these various feeding conditions were known to determine the values of certain physiological phenotypes including body - mass index and blood chemistry . These physiological responses were also known to be specified by the activity of the liver . The scope of the experiment was to assess to what extent the liver cells activity, as measured by the level of protein coding rna, is changing with regards to the perturbation . A corollary question was whether every instance of significant change in the steady state level of a particular mrna would suggest a correlation between the activity of the cognate gene and the physiological response . Inferring a bonafide relationship between changes in the level of a given mrna molecule level with the change in the biological response under study requires providing evidence that the observed variation is explained mainly by the biological factor, and not by a confounding event . This report shows that where the assay was performed (ie, in which laboratory) and/or which method of rna labeling was used represent unexpected co - factors that actually mask the source of biological variability . Stated differently, the series of procedures starting from the extraction of rna out of the biosample up to the microarray readout is not without disturbing the original distribution of rna occurring in the biological sample . The obvious consequence is that the changes registered at the end of the assay can be attributed as much to the experimental procedure (the confounding factor) than to the biological perturbations . The quantity and purity of the rna was determined by absorbance at 260 nm and 260/280 absorbance ratio respectively . Each of the total rna preparations was individually assessed for rna quality based on the 28s/18s ratio and rna intergrity number (rin) measured on an agilent 2100 bioanalyzer system using the rna 6000 nano labchip kit . Rna was labeled according to the enzo bioarray highyield rna transcript labeling system or the affymetrix genechip 3 ivt express kit or the nugen s applause systems (fig . The image file, read out from the scanning of the microarray was converted to a numerical value per unit of measurement . The amount of light intensity / unit of measurement in the microarray were converted to a value of relative abundance of a mrna molecule through the data reduction procedure reported by izarrzi et al.17 data processing and analyses were performed with affymetrix genechip command console gcos (affymetrix, http://www.affymetrix.com/), genedata analyst (genedata ag, www.genedata.com), tibco spotfire decisionsite (tibco, http://spotfire.tibco.com/), umetrics simca - p (umetrics, http://www.umetrics.com/) and r bioconductor packages (http://www.bioconductor.org/). Physiological measurements were performed following the 2-week treatment phase . A significant variation of a series of blood analytes and of some physiological outcomes (eg, bmi) was observed . A large quantity of rna was extracted from the liver of the mice from the 3 different treatments . The 3 groups of mice, of the same strain, age, gender and growing conditions, differed only by their diet . One could conclude that, with regards to mice of the strain balb / c, the aforementioned caloric restriction induced a significant change in their respective biological statuses . To which extent the liver s failure to control the homeostasis of mouse physiological parameters can be correlated with a significant change in the level of discrete rna represented the scope of the subsequent measurement . When each laboratory data set is considered separately, do all of them return the same answer as to which mrna level correlates with the biological condition? The data for each set was processed according to the same series of transformations depicted in the figure 3: (i) extraction of numerical values from the raw image tiff file with the affymetrix genechip command console software,16 (ii) normalization according to the quantile normalization; and (iii) summarization of individual probes values into a single mrna level value as described by irizarri et al.17 this quantile normalization assumes that the overall quantity of mrna across the whole range of binned values has to be consistent across similar biological systems . The outcome of these data transformation is a data matrix with the 3 conditions, each represented by 5 replicates and ~40,000 observations, ie, the affymetrix probe sets, representative of their cognate mrna . This data processing was performed exactly in the same way for each of the 5 data sets, with the same parameters . In other words, there was no variability brought in to each laboratory set with regards to these data operations . Figure 4 shows a series of diagnostic plots commonly used to evaluate the molecular integrity of the mrna quantified in the assay . There were 3 feeding conditions with 5 each laboratory has initiated the quantification with the same source of rna . As shown in the figure 2b, the rna samples branched out to different experimental paths from the step following the rna extraction and prior to the rna labeling procedure . If we conceptually group all the finite experimental steps that span from the end of the rna extraction up to the image acquisition step into a single experimental event, the data set in hands was associated with 2 factors, the biological factor (ie, the feeding conditions) and the technical factor (ie, the rna labeling procedure). The rna degradation plot, for instance, testifies of the extent to which the rna molecules were starting to be hydrolyzed . There are some chemical and biological (eg, ribonucleases) mechanisms that potentially remain active during the rna extraction procedure, which degrade rna strand from their 5 ends . The steepness of the rna degradation plot is therefore used as a quality control metric . Assay validation studies18 concluded that whenever slopes values were greater than 3, they would disqualify the data set for downstream analysis since an advanced degradation of the rna would cause the measurement to be unreliable . The figure 4 provides a quick overview of the overall quality of the 5 laboratory data sets . It shows that all of them were of high quality and therefore valid for subsequent analyses . The affymetrix genechips, and other micro - array based assays, deliver very large data sets, with more than 40,000 variables in this case . The spread of the value of each of these 40,000 variables in the problem space evidently varies . In addition, based on prior knowledge of the regulation of gene expression, it is reasonable to state that the mrna level data matrix is not made of 40,000 independent events, and that instead there is a fair amount of redundancy . The spread of the data across these 40,000 dimensions was assessed by deriving the principal components . The score plots for the 5 laboratory data sets presented in figure 4 showed that the biological variability seems to be conserved across the 5 measurement sets . In addition, for every laboratory measurement, the biological conditions clustered within the same area in the scatter plot of the 2 major principal components . Firstly, the information content with regards to the biological input seems to have been maintained . Prior to the inception of the experiment, the mice represented the same biological object, each animal outputting physiological phenotype s values within the range of the biological noise . Secondly, when the animals were divided into 3 subgroups and fed differently, they were not the same at the end of the experiment, based on the observations of the aforementioned physiological values . The different environmental input submitted to the initially homogenous set of animals produced 3 subsets of different animals . The principle components analysis (pca) plots in figure 4 suggest that the rna content of the liver for these 3 groups of animals was also different, and the data itself, which is the output of a series of molecular transformations, has kept that difference . The environmental challenge caused a physiological change as well as a change in the composition of the rna featured in the liver . Altogether, these initial explorations allowed for the conclusion that the rna molecules quantified in this study were not degraded and were suitable for subsequent correlation studies . The density plot of the normalization outcome shown in figure 4 shows the expected adjustment brought in to the data set distributions . The data sets, regardless of the biological conditions, centered on the same value and exhibited a similar spread . The normalization s scope is to prevent artifactual shift in the mrna level matrix brought in by some inherent technical variability (eg, with the optical instrument of the affymetrix scanner). From these series of observations about the data, there was no evidence yet that would have suggested that the source of biological variability was not conserved in any of these 5 data matrices . Therefore, it looked as if one could confidently infer which mrna molecules exhibited a change correlating with the perturbation brought in by the different feeding conditions . A reasonable approach to identify these elements was to perform a parametric test, assuming a normal distribution of the mrna - level populations . This assumption might not even been required in this case, given the number of replicates, large enough to rely on the central limit theorem . An independent samples t - test was run to address the question of whether some mouse liver mrna have their respective level shifted to a different distribution whenever the mice were under high caloric food intake as opposed to low caloric . In other words, 2 conditions out of the 3 of the original design were chosen for further exploration of the data set . Given the large number of elements of the set to be compared (ie, ~40,000), the t - test was followed by a correction for multiple comparisons using a false discovery rate (fdr) analysis in this case.19 this pairwise comparison was run initially on 1 laboratory data set . Table 1 shows the top lower q - value affymetrix probe set elements returned from this test . The q - value is lower than 1.10e-7, which allows us to conclude with fairly high confidence that these 20 elements do not belong to the distribution of reference (ie, the distribution level of mrna extracted from low caloric fed - mice). Following this test on 1 laboratory data set, the exact same comparison, under the exact same data analyses procedure table 1 shows the top 20 lower q - value affymetrix probe set elements for the 3 of the 5 laboratory data sets . Unexpectedly, only 20% of affymetrix probe set elements had common values across the 5 lists . The pca discussed in the figure 4 suggested that the mrna - level data sets maintained sources of the biological variability . The result of table 1 argued that there is more information content in these data sets, in addition to the biology of liver cells . The whole data set, which included the 5 laboratory measurements, was analyzed as a single data set: the 75 cel cell intensity files (referred to as cel files) were used as input for the robust multi - array rma normalization operation and a single normalized data matrix featuring the 75 conditions was created . The pca score plot in figure 5 shows that there was 1 source of variability that was not accounted for by the mouse liver cell physiology . The data points clustered with regards to the laboratory where the rna has been processed . These differences in the rna labeling, how subtle they might seem, obviously did modify the final nucleic - acids composition mix applied to the microarray . While the plots of the figure 4 show that the 5 data sets contained biologically meaningful informational contents, the plots in figures 5 and 6 and results in table 1 indicate that any post rna extraction manipulations potentially modify the original rna composition . However, there are ample gene expression studies reported in the literature where the variability in rna content is attributed exclusively to biological variability . Physiological measurements were performed following the 2-week treatment phase . A significant variation of a series of blood analytes and of some physiological outcomes (eg, bmi) was observed . A large quantity of rna was extracted from the liver of the mice from the 3 different treatments . The 3 groups of mice, of the same strain, age, gender and growing conditions, differed only by their diet . One could conclude that, with regards to mice of the strain balb / c, the aforementioned caloric restriction induced a significant change in their respective biological statuses . To which extent the liver s failure to control the homeostasis of mouse physiological parameters can be correlated with a significant change in the level of discrete rna represented the scope of the subsequent measurement . When each laboratory data set is considered separately, do all of them return the same answer as to which mrna level correlates with the biological condition? The data for each set was processed according to the same series of transformations depicted in the figure 3: (i) extraction of numerical values from the raw image tiff file with the affymetrix genechip command console software,16 (ii) normalization according to the quantile normalization; and (iii) summarization of individual probes values into a single mrna level value as described by irizarri et al.17 this quantile normalization assumes that the overall quantity of mrna across the whole range of binned values has to be consistent across similar biological systems . The outcome of these data transformation is a data matrix with the 3 conditions, each represented by 5 replicates and ~40,000 observations, ie, the affymetrix probe sets, representative of their cognate mrna . This data processing was performed exactly in the same way for each of the 5 data sets, with the same parameters . In other words, there was no variability brought in to each laboratory set with regards to these data operations . Figure 4 shows a series of diagnostic plots commonly used to evaluate the molecular integrity of the mrna quantified in the assay . There were 3 feeding conditions with 5 each laboratory has initiated the quantification with the same source of rna . As shown in the figure 2b, the rna samples branched out to different experimental paths from the step following the rna extraction and prior to the rna labeling procedure . If we conceptually group all the finite experimental steps that span from the end of the rna extraction up to the image acquisition step into a single experimental event, the data set in hands was associated with 2 factors, the biological factor (ie, the feeding conditions) and the technical factor (ie, the rna labeling procedure). The rna degradation plot, for instance, testifies of the extent to which the rna molecules were starting to be hydrolyzed . There are some chemical and biological (eg, ribonucleases) mechanisms that potentially remain active during the rna extraction procedure, which degrade rna strand from their 5 ends . The steepness of the rna degradation plot is therefore used as a quality control metric . Assay validation studies18 concluded that whenever slopes values were greater than 3, they would disqualify the data set for downstream analysis since an advanced degradation of the rna would cause the measurement to be unreliable . The figure 4 provides a quick overview of the overall quality of the 5 laboratory data sets . It shows that all of them were of high quality and therefore valid for subsequent analyses . The affymetrix genechips, and other micro - array based assays, deliver very large data sets, with more than 40,000 variables in this case . The spread of the value of each of these 40,000 variables in the problem space evidently varies . In addition, based on prior knowledge of the regulation of gene expression, it is reasonable to state that the mrna level data matrix is not made of 40,000 independent events, and that instead there is a fair amount of redundancy . The spread of the data across these 40,000 dimensions was assessed by deriving the principal components . The score plots for the 5 laboratory data sets presented in figure 4 showed that the biological variability seems to be conserved across the 5 measurement sets . In addition, for every laboratory measurement, the biological conditions clustered within the same area in the scatter plot of the 2 major principal components . Firstly, the information content with regards to the biological input seems to have been maintained . Prior to the inception of the experiment, the mice represented the same biological object, each animal outputting physiological phenotype s values within the range of the biological noise . Secondly, when the animals were divided into 3 subgroups and fed differently, they were not the same at the end of the experiment, based on the observations of the aforementioned physiological values . The different environmental input submitted to the initially homogenous set of animals produced 3 subsets of different animals . The principle components analysis (pca) plots in figure 4 suggest that the rna content of the liver for these 3 groups of animals was also different, and the data itself, which is the output of a series of molecular transformations, has kept that difference . The environmental challenge caused a physiological change as well as a change in the composition of the rna featured in the liver . Altogether, these initial explorations allowed for the conclusion that the rna molecules quantified in this study were not degraded and were suitable for subsequent correlation studies . The density plot of the normalization outcome shown in figure 4 shows the expected adjustment brought in to the data set distributions . The data sets, regardless of the biological conditions, centered on the same value and exhibited a similar spread . The normalization s scope is to prevent artifactual shift in the mrna level matrix brought in by some inherent technical variability (eg, with the optical instrument of the affymetrix scanner). From these series of observations about the data, there was no evidence yet that would have suggested that the source of biological variability was not conserved in any of these 5 data matrices . Therefore, it looked as if one could confidently infer which mrna molecules exhibited a change correlating with the perturbation brought in by the different feeding conditions . A reasonable approach to identify these elements was to perform a parametric test, assuming a normal distribution of the mrna - level populations . This assumption might not even been required in this case, given the number of replicates, large enough to rely on the central limit theorem . An independent samples t - test was run to address the question of whether some mouse liver mrna have their respective level shifted to a different distribution whenever the mice were under high caloric food intake as opposed to low caloric . In other words, 2 conditions out of the 3 of the original design were chosen for further exploration of the data set . Given the large number of elements of the set to be compared (ie, ~40,000), the t - test was followed by a correction for multiple comparisons using a false discovery rate (fdr) analysis in this case.19 this pairwise comparison was run initially on 1 laboratory data set . Table 1 shows the top lower q - value affymetrix probe set elements returned from this test . The q - value is lower than 1.10e-7, which allows us to conclude with fairly high confidence that these 20 elements do not belong to the distribution of reference (ie, the distribution level of mrna extracted from low caloric fed - mice). Following this test on 1 laboratory data set, the exact same comparison, under the exact same data analyses procedure table 1 shows the top 20 lower q - value affymetrix probe set elements for the 3 of the 5 laboratory data sets . Table 2 shows the overlap between the 5 data sets . Unexpectedly, only 20% of affymetrix probe set elements had common values across the 5 lists . The pca discussed in the figure 4 suggested that the mrna - level data sets maintained sources of the biological variability . The result of table 1 argued that there is more information content in these data sets, in addition to the biology of liver cells . The whole data set, which included the 5 laboratory measurements, was analyzed as a single data set: the 75 cel cell intensity files (referred to as cel files) were used as input for the robust multi - array rma normalization operation and a single normalized data matrix featuring the 75 conditions was created . The pca score plot in figure 5 shows that there was 1 source of variability that was not accounted for by the mouse liver cell physiology . The data points clustered with regards to the laboratory where the rna has been processed . These differences in the rna labeling, how subtle they might seem, obviously did modify the final nucleic - acids composition mix applied to the microarray . While the plots of the figure 4 show that the 5 data sets contained biologically meaningful informational contents, the plots in figures 5 and 6 and results in table 1 indicate that any post rna extraction manipulations potentially modify the original rna composition . However, there are ample gene expression studies reported in the literature where the variability in rna content is attributed exclusively to biological variability . The ease with which rna content can be measured in a high throughput manner, has made it the biomolecule of choice for a whole range of biological studies where the objective is to correlate a change in a biological factor with respect to a change in discrete rna molecule content . The assumption of these studies is that the variability of mrna - level data captured by either micro - array - based and/or pcr - based methodology is uniquely attributable to the change in biology . In this report, we show that this is seldom the case . Therefore, we suggest that revisions to experimental designs be made prior to being confident in any biological knowledge obtained from these studies . The experimental design of this current report is an exception and is thus unlikely to become the norm . However, this data set gave us the opportunity to unravel the extent to which post- extraction rna processing impacts the final read - out . The alignment of the loading and scoring plot in the figure 6 allowed us to identify which variable (ie, which probe set measurement) actually contributed to the spread of data points on the score plot, due to the biological factor . In the score plot of the figure 6a, the relative position of each dot corresponds to a sample . The samples cluster with regards to the laboratory where the measurement was done, and also to the biological condition . In other words, the data set features two pieces of information . If the original distribution of rna had been the unique contributor of variability, the samples would have clustered into two groups only . The loading plot (fig . The clustering of the samples with regards to the biological conditions is specified by the probe sets that are co- localized in the two 3- dimensional plots . The loading plot therefore provides the means to interpret the score plot and identify which independent variable (ie, the mrna) contribute to the biological variability . These probe sets, highlighted in red in the loading plot, map to the 25% overlap of the table 1, as expected . These rna were present in a different quantity in the liver of the mouse cell prior to rna extraction . The remaining changes in the rna composition are due to the effect of the rna labeling procedure . As more than 1 high throughput method has been devised since the early days of dna microarrays almost 20 years ago, legitimate concerns were raised as to the relevance of comparing 1 data set acquired from 1 method (eg, affymetrix genechip) with another method (eg, agilent microarray). The debate also moved to the comparison between array - based methods with pcr - based methods, exemplified by quantitative real - time pcr . The latest update on that matter, released by the fda study group called the microarray quality control (maqc), advised the research community that overall, data sets collected from various platforms perform relatively in concordance to each other.10 2 comments might be added to the current recommendations of the maqc group: (i) no study was performed with respect to the other component of the high throughput rna measurement, ie, the preparation of the labeled rna; (ii) despite some overlap between the results return from the same biological sample from 2 distinct assay platforms, there remains a large fraction of observations that are due to the idiosyncrasy of the measurement . Artifacts are usually not filtered out by the research community; rather they tend to accumulate in the knowledge based derived from transcriptomic studies . In order to illustrate this latter point, we used the 100 lowest q - value elements of each of the 5 laboratory data sets as argument for 1 of the implementations of the algorithm, altogether referred to as gene set enrichment analysis (gsea).20 all 5 queries return very similar answers . The scope of the gene set enrichment query is to identify any significant contribution of 1, or more than 1, genes classes according the gene ontology classification.20 genes are grouped into categories, in this case 3, including a biological component, the cellular location and biochemical activity . This classification relies on prior knowledge and falls within the gene ontology classification.21 the gsea queried the gene ontology database with a query set of 100 elements, assign each element with their cognate attributes value and applies a nonparametric test (eg, the kolmogorov smirnov test) to infer the occurrence of gene ontology attributes values (carried by the 100-element set) which was significantly overrepresented . The scope of gsea is to provide a means to interpret the outcome of a high throughput gene expression result as described in this article: it is meant to derive some biological information from a list of genes . To some extent, the gsea result has to be interpreted in the light of the pca plots shown in figures 4 and 5 . Both analyses provided evidence that this data set, the outcome of a long series of molecular transformation, holds some valuable biological information . The overlap between the 5 data sets, shown in the table 1, are likely to be the genuinely differential mrna levels correlating with the environmental challenge submitted to the biological system . These rna species were identified by the gsea since they share some common gene ontology attributes values . The fact that no other significant gene ontology classes were retrieved suggests that the remaining subset of different mrna levels recorded in the data sets are stochastic events, caused by the various methods applied to label the rna . The biochemical and molecular methods applied to the raw rna up to the labeled nucleic acids assayed with the microarray disturbed the original distributions of rna, eventually causing a partial loss of biological information . A matter of concern lies in the inference procedure used with gsea results: in some instances authors would assign the gene ontology class returned by the gsea query to all the elements of the query list . The rationale is, given that the gsea returned an expected outcome, the whole query set is bona fide material that will reliably provide biological knowledge (the gsea in this scenario is basically used as an additional qc metric). In the case of this study, that would allow us to conclude that the 100 elements of the gsea query were all involved in carbohydrate metabolism . The literature is unfortunately populated with a growing number of reports where lists of genes are assigned to particular phenotype by virtue of the aforementioned inference procedure . In accordance with other investigators engaged in genomic research who recently reported the need to be more vigilant and transparent with regards to the documentation and recording of published data,22 this report reinforces their recommendations: high throughput genomics data sets needs to be recorded in settings that minimize the source of confounding effects . The ease with which rna content can be measured in a high throughput manner, has made it the biomolecule of choice for a whole range of biological studies where the objective is to correlate a change in a biological factor with respect to a change in discrete rna molecule content . The assumption of these studies is that the variability of mrna - level data captured by either micro - array - based and/or pcr - based methodology is uniquely attributable to the change in biology . In this report, we show that this is seldom the case . Therefore, we suggest that revisions to experimental designs be made prior to being confident in any biological knowledge obtained from these studies . The experimental design of this current report is an exception and is thus unlikely to become the norm . However, this data set gave us the opportunity to unravel the extent to which post- extraction rna processing impacts the final read - out . The alignment of the loading and scoring plot in the figure 6 allowed us to identify which variable (ie, which probe set measurement) actually contributed to the spread of data points on the score plot, due to the biological factor . In the score plot of the figure 6a, the relative position of each dot corresponds to a sample . The samples cluster with regards to the laboratory where the measurement was done, and also to the biological condition . In other words, the data set features two pieces of information . If the original distribution of rna had been the unique contributor of variability, the samples would have clustered into two groups only . The loading plot (fig . The clustering of the samples with regards to the biological conditions is specified by the probe sets that are co- localized in the two 3- dimensional plots . The loading plot therefore provides the means to interpret the score plot and identify which independent variable (ie, the mrna) contribute to the biological variability . These probe sets, highlighted in red in the loading plot, map to the 25% overlap of the table 1, as expected . These rna were present in a different quantity in the liver of the mouse cell prior to rna extraction . The remaining changes in the rna composition are due to the effect of the rna labeling procedure . As more than 1 high throughput method has been devised since the early days of dna microarrays almost 20 years ago, legitimate concerns were raised as to the relevance of comparing 1 data set acquired from 1 method (eg, affymetrix genechip) with another method (eg, agilent microarray). The debate also moved to the comparison between array - based methods with pcr - based methods, exemplified by quantitative real - time pcr . The latest update on that matter, released by the fda study group called the microarray quality control (maqc), advised the research community that overall, data sets collected from various platforms perform relatively in concordance to each other.10 2 comments might be added to the current recommendations of the maqc group: (i) no study was performed with respect to the other component of the high throughput rna measurement, ie, the preparation of the labeled rna; (ii) despite some overlap between the results return from the same biological sample from 2 distinct assay platforms, there remains a large fraction of observations that are due to the idiosyncrasy of the measurement . Artifacts are usually not filtered out by the research community; rather they tend to accumulate in the knowledge based derived from transcriptomic studies . In order to illustrate this latter point, we used the 100 lowest q - value elements of each of the 5 laboratory data sets as argument for 1 of the implementations of the algorithm, altogether referred to as gene set enrichment analysis (gsea).20 all 5 queries return very similar answers . The scope of the gene set enrichment query is to identify any significant contribution of 1, or more than 1, genes classes according the gene ontology classification.20 genes are grouped into categories, in this case 3, including a biological component, the cellular location and biochemical activity . This classification relies on prior knowledge and falls within the gene ontology classification.21 the gsea queried the gene ontology database with a query set of 100 elements, assign each element with their cognate attributes value and applies a nonparametric test (eg, the kolmogorov smirnov test) to infer the occurrence of gene ontology attributes values (carried by the 100-element set) which was significantly overrepresented . The scope of gsea is to provide a means to interpret the outcome of a high throughput gene expression result as described in this article: it is meant to derive some biological information from a list of genes . To some extent, the gsea result has to be interpreted in the light of the pca plots shown in figures 4 and 5 . Both analyses provided evidence that this data set, the outcome of a long series of molecular transformation, holds some valuable biological information . The overlap between the 5 data sets, shown in the table 1, are likely to be the genuinely differential mrna levels correlating with the environmental challenge submitted to the biological system . These rna species were identified by the gsea since they share some common gene ontology attributes values . The fact that no other significant gene ontology classes were retrieved suggests that the remaining subset of different mrna levels recorded in the data sets are stochastic events, caused by the various methods applied to label the rna . The biochemical and molecular methods applied to the raw rna up to the labeled nucleic acids assayed with the microarray disturbed the original distributions of rna, eventually causing a partial loss of biological information . A matter of concern lies in the inference procedure used with gsea results: in some instances authors would assign the gene ontology class returned by the gsea query to all the elements of the query list . The rationale is, given that the gsea returned an expected outcome, the whole query set is bona fide material that will reliably provide biological knowledge (the gsea in this scenario is basically used as an additional qc metric). In the case of this study, that would allow us to conclude that the 100 elements of the gsea query were all involved in carbohydrate metabolism . The literature is unfortunately populated with a growing number of reports where lists of genes are assigned to particular phenotype by virtue of the aforementioned inference procedure . In accordance with other investigators engaged in genomic research who recently reported the need to be more vigilant and transparent with regards to the documentation and recording of published data,22 this report reinforces their recommendations: high throughput genomics data sets needs to be recorded in settings that minimize the source of confounding effects.
Coronary heart diseases are responsible for almost half of all deaths in developed countries and 25% of deaths in developing countries . Open heart surgery with median sternotomy is most commonly performed on patients with blocked heart vessels . It can impede normal respiration, deep breathing, effective coughing, and sputum clearance, and may result in respiratory dysfunction, hypoxemia, atelectasis, and pneumonia . So, effective pain management leads to earlier recovery, reduces the postoperative complications and duration of hospitalization, and increases patient satisfaction . One of the simplest and cheapest nonpharmacologic ways to relieve pain is the use of cold . Cold therapy is an effective and safe method with few complications or no side effects . There is a paucity of scientific evidence about the use of cold therapy in patients after cardiac surgery . This study was conducted to investigate the following hypotheses and questions: (1) does cold gel pack reduce the pain associated with deep breathing and coughing (db and c) after cardiac surgery? (2) what sensations do patients have during the application of cold gel packs over sternal incision dressing? (3) do patients undergoing open heart surgery prefer cold therapy prior to db and c? This study was a randomized controlled trial (rct) with crossover design which was conducted in the cardiac surgery intensive care unit (icu) at a university - affiliated hospital in urmia, iran . The crossover design allows each subject to serve as his / her own control, so we can effectively remove subject - to - subject variation from our investigation of the relative effect of treatment and this reduces variability and directly increases power . Data were gathered between 8 a.m. and 5 p.m. in order to reduce variablity among patients, cold therapy was applied on the first post - surgical day when they were oriented to place and time and able to report pain . All patients performed four episodes of dbandc (two with cold gel pack and two without it) every 2 h. the seqence of gel pack application was randomized, so that half of the patients were given gel pack for 15 min followed by a period of no treatment (so - called washout period) and then they were not given gel pack . The other half started without gel pack first, followed by the washout period and then treatment with gel pack was given . The washout period was 2 h. random allocation to groups was performed using a random number table . Inclusion criteria for patients included: (1) male or female patients scheduled to coronary artery bypass graft (cabg) surgery with median sternotomy, (2) age 21 years, (3) able to understand and speak persian, (4) having minimum literacy of reading and writing, and (5) willing to give written informed consent . Exclusion criteria for patients included: (1) mechanically ventilated patients, (2) patients with diseases that affect pain measurement (delirium, dementia, or major depression, and severe visual, hearing, and verbal impairment), (3) contraindication to cold therapy use [e.g. Reynaud's disease, cryoglobulinemia (clumping of plasma protien), sickle cell anemia, cold allergic conditions, and in areas with impaired sensation], (4) diabetic patients, (5) postoperative complications such as infection, bleeding, uncontrolled atrial fibrillation, and wound dehiscence . Gel packs that were used as the cold source weighed 320 g and measured 25 cm by 10 cm . They were kept in the freezer on the patient service unit and were frozen until their temperature reached between 0c and 5c, then were removed from the freezer and placed in a cotton bag . The timer was activated for 15 min and gel pack was used directly over the sternal wound dressing . In the literature, controversy exists regarding the recommended length of application time which ranges from 5 to 60 min . To achieve the therapeutic effect of cold therapy so, the 15-min application time was selected in this study to achieve the desired effect . Patients were asked to rate the severity of their pain using a horizontal scale that was numbered from 0 (absence of pain) to 10 (the most intense pain possible). The numerical rating scale (nrs) is well known and has acceptable reliablity and validity, and was approved by many authors in patients with different diagnoses . The following open - ended questions were asked every 5 min during each session of using cold gel pack to assess patients perception of cold therapy: how does the gel pack feel on your chest? Can you describe the sensation to me? To assess their preferences about cold therapy, the following questions were asked at the end of the fourth session: do you prefer cold therapy prior to dbandc? Data collection instruments used in this research were as follows: a patient profile form that had been specifically designed for the study was completed by the patients . This five - part form consisted of: (1) demographic information part, stating their age, sex, level of education, marital status, religion, and employment; (2) general information part, stating their height, weight, body temperature, and the amount of hemoglobin; (3) present history information part, stating their diagnosis and type of cardiac surgery; (4) past history part, stating their underlying diseases like diabetes and hypertension and previous heart surgery; and (5) nursing history part that included history of smoking and opioid addiction, analgesics prescribed and administered (type, amount, and time at which medication was administered)nrs for measuring the intensity of painpatients description form regarding their sensations and preferences that were transcribed verbatim on the paper . A patient profile form that had been specifically designed for the study was completed by the patients . This five - part form consisted of: (1) demographic information part, stating their age, sex, level of education, marital status, religion, and employment; (2) general information part, stating their height, weight, body temperature, and the amount of hemoglobin; (3) present history information part, stating their diagnosis and type of cardiac surgery; (4) past history part, stating their underlying diseases like diabetes and hypertension and previous heart surgery; and (5) nursing history part that included history of smoking and opioid addiction, analgesics prescribed and administered (type, amount, and time at which medication was administered) nrs for measuring the intensity of pain patients description form regarding their sensations and preferences that were transcribed verbatim on the paper . A cosecutive sample of 50 patients hospitilized with confirmed diagnosis of coronary artery disease (cad) entered the study between 24 june 2012 and 20 august 2012 . The ethics committee of urmia medical sciences university (umsu) and the hospital authorities approved the research protocol . Diseases such as raynaud's syndrome and sickle cell anemia were ruled out with a cardiac surgeon; also, the patient was enquired about allergy to cold . The voluntary nature of the study, confidentiality of information, and freedom to withdraw at any time were assured . The investigator described the study aims, nsr, and techniques for db and c for each patient before the operation . Patients were randomly allocated to begin the db and c sessions either with the gel pack or without the gel pack . Prior to beginning db and c sessions, the patients rated their baseline pain from 0 to 10 by the nsr . In the gel pack sessions, the investigator brought the gel pack from the freezer and placed it over the dressing covering the patient's chest incision . The investigator remained with patients for 15 minutes when the gel pack was used . During the fifteen minutes15 min of gel pack application, the patients were asked to describe the sensation he / shethey felt during gel pack application . After 15 minutes, the gel pack was picked upremoved and the head of the bed was elevated between 45c and 90c in preparation for dbandc . In the sessions without gel pack sessions, the investigator prepared the patients for dbandc in the same manner as in gel pack sessions . A pillow or folded sheet was given to the patients for splinting purposes and dbandc was started for both groups . In each session, three cycles of three deep breaths were performed followed by an episode of coughing . The patient was asked to rate his / her pain from 0 to 10 on the nsr after completion of the third cycle . At the end of the fourth session, the patients ranged in age from 22 to 75 years, and the average age was 58.3 10.7 years in the group that began the trial with the gel pack and 60.7 11.1 years in the group that began the trial without the gel pack . There were 50 patients (35 males and 15 females) recruited for this study from post cardiac surgery icu, and no side effects or complications due to the cold therapy via gel pack were reported . All patients had one graft, and for all of them, saphenous vein was used . Also, the results showed that there were no statistically significant differences in the variables such as age, gender, he moglobin level, the time between receiving analgesic and intervention, and body mass index (bmi) in the two groups at the beginning of study (p> 0.5). Average pain scores between the group that started with the gel pack [mean (m) = 4.56, standard deviation (sd) = 1.64] and the group that started without the gel pack (m = 5.36, sd = 1.7) were not significantly different (t = 1.7, df = 48, p = 0.1). A 2 (intervention) 2 (session) 2 (time) within - subjects repeated measures analysis of variance (r m - anova) was conducted on the pain intensity scores before and after db and c in patients undergoing open heart surgery by median sternotomy . The three independent variables were: intervention with two levels (gel pack and no gel pack application), session with two levels (a.m. and p.m.), and time with two levels (befor and after). Pain scores after db and c were, on average, 6.18/10 without gel pack compared to 3.81/10 with gel pack . The interaction between intervention and time was significant (p <0.001) [table 2] and indicated that the pain scores after db and c were significantly lower when patients used the gel pack . The main effects with regard to intervention and session on pain were significant (p <0.001) and with regard to time was non - signficant (p = 0.052). Means and standard deviations of pain intensity scores pre- and post - db and c interactions between intervention, session, and time found with rm - anova at the first time of applying cold gel pack, 48 (96%) patients reported feeling coolness and 2 (4%) patients felt numbness, and at the second time of applying cold gel pack, 37 (74%) patients reported feeling coolness and 4 (8%) patients felt cold, 9 (18%) experienced numbness, and no one experienced tingling . Of 50 patients, 45 (90%) stated they would use the gel pack for pain management in the future . Pain after thoracotomy is probably the most severe pain experienced after surgeries, and patients who underwent cardiac surgeries report having most severe pain while coughing and deep breathing . Despite implementing pharmacologic interventions such as the use of nonsteroidal anti - inflammatory drugs (nsaids) and opioids, pain control has been inadequete and it might impede deep breathing and effective coughing . In this study, pain scores after dbandc were lower with gel pack compared to without gel pack in all four sessions . The results of this study showed that cold therapy is an effective method for management of sternal incision pain associated with dbandc in cardiac surgery patients . In a similar study in which participants underwent four episodes of dbandc, two with the gel pack and two without it, similar results were obtained with cold therapy in various conditions such as chest tube removal, soft tissue injuries, hernia, and orthopedic injuries . According to the nrs for pain intensity, pain scores from 1 to 3 on a 10-point scale are considered to be mild pain and scores above 3 - 6 as moderate pain . Patients in this study reported their pain as moderate (m = 3.81/10) when using the gel pack, as compared to severe pain (m = 6.18/10) reported without the gel pack . The decrease in 2.37 on the 10-point pain intensity scale was statistically significant (p <0.001) with the rm - anova . Application of cold gel packs resulted in decreased skin temperature and the feeling of coolness, cold, and numbess in patients . No one experienced negative sensations such as tingling, aching, and burning with the application of the gel pack . Feeling of coolness was the most prevalent sensation during the application of the cold gel pack . Five patients did not like the experience of cold because they did not like feeling cold . Chailler et al . Reported that 28% (n = 9) and 72% (n = 23) of the participants felt cold and coolness after the application of cold gel pack on the sternal insicion site . Most of the patients (n = 45, 90%) expressed that they would reapply the gel pack in the future . The main reasons for preferring cold gel pack were pain reduction (n = 31, 69%), feeling of coolness (n = 3, 6.7%), and both (n = 11, 24.4%). Cooling the sternum by the cold gel packs seems to be an appealing method for pain management and is perceived as being effective for pain reduction . The samples of this study consisted mainly of males, which is a limiting factor . Future studies should investigate the effects of cold application combined with different pharmacologic and nonpharmacologic therapeutic techniques . Both superficial and deep temperature changes depend on the method of cold application, so future studies could also probe for more information about the effects of different temperatures, time periods, and ways of cold application (e.g. Ice pack, ice towel, ice massage, and ice chip). Application of cold gel pack was effective for reducing incisional pain associated with db and c in cardiac surgery patients . Nurses spend more time with patients compared to other members of the treatment team in the clinical centers; so they are in the best position for pain management . They make important decisions regarding use of nonpharmacologic therapeutic interventions for pain management, and cold therapy is one of the nonpharmacologic methods that they can easily use.
Symptomatic trigeminal neuralgia (tn) is caused by a demonstrable structural lesion other than vascular compression, typically posterior fossa tumors or multiple sclerosis [1, 2]. This pain may be either persistent or intermittent, sometimes occurring in brief attacks that may reproduce tn features . Here, we report the case of a patient with wallenberg s syndrome who started having shock - like painful paroxysms in the first division of the trigeminal nerve (v1). A 41-year - old man visited our hospital reporting a 48-h lasting pain localized on the right side of his neck . Three hours before entering the emergency room, the patient felt sudden dizziness with gait instability and clumsiness of his right limbs . His past medical history was remarkable for non - controlled hypertension as well as frequent alcohol and occasional cocaine intake . The patient denied any drug intake in the past few days . On a general physical examination, the only relevant the neurologic examination revealed moderate dysarthria, a right horner syndrome, vertical nystagmus in all extreme gaze positions, an absent right gag reflex, right facial and left two limb hypoalgesia and thermoanesthesia, mild paresis of the right limbs, and severe right limb ataxia . An early brain computed tomography (ct) scan did not detect any significant abnormalities, but magnetic resonance imaging (mri) showed a recent infarction in the right lateral medulla (fig . In addition, complete occlusion of the right vertebral artery was demonstrated on magnetic resonance angiography (mra; fig . 2). There was no evidence of a vascular contact at the root entry zone of the right trigeminal nerve.fig . A axial t2-weighted flair mri shows slight hyperintensities in the right lateral medulla and right cerebellum . B diffusion - weighted mri demonstrates restricted water motion in the lesion shown in a, indicating recent infarctionfig . Coronal maximum intensity projection from mra reveals occlusion of the right vertebral artery, which is likely due to artery dissection magnetic resonance imaging (mri). A axial t2-weighted flair mri shows slight hyperintensities in the right lateral medulla and right cerebellum . B diffusion - weighted mri demonstrates restricted water motion in the lesion shown in a, indicating recent infarction magnetic resonance angiography (mra). Coronal maximum intensity projection from mra reveals occlusion of the right vertebral artery, which is likely due to artery dissection forty - eight hours after admission, the patient suffered from aspiration pneumonia with breathing compromise and required intubation at the intensive care unit (icu). After several lung complications, he was eventually extubated and returned to our hospital ward 1 month after the stroke . At this moment we found the same neurologic signs he presented at onset, though milder, including some sensory impairment on the right side of his face . Two days after leaving the icu, our patient started having brief electric shock - like pains in the whole distribution of the first division (v1) of the right trigeminal nerve . Pain attacks fulfilled diagnostic criteria for symptomatic tn, according to the international classification of headache disorders, 2nd edition (ichd - ii). They lasted for 35 s, occurred at least 10 times per hour, and were given a score of 8 out of 10 on a visual analogue pain intensity scale . Treatment with gabapentin was initiated . While being on a dose of 300 mg t.i.d ., the patient experienced a decrease in both pain frequency and intensity plus a restriction of the pain to a more circumscribed periocular area . When gabapentin was titrated up to 600 mg t.i.d, the pain was finally controlled . At discharge he maintained this dose and had no recurrences of the pain through a 2-month follow - up . It is widely accepted that the commonest cause of tn is compression of the trigeminal root entry zone by a blood vessel . The term classical tn is applied to those cases with potential vascular compression or unknown etiology . When a causative lesion other than vascular compression is demonstrated, a diagnosis of symptomatic tn is made . Overall, symptomatic tn accounts for 15% of cases of nt, and the majority of these are caused by cerebellopontine angle tumors or multiple sclerosis . Although a brainstem infarction had been previously suggested as a possible cause of tn, it was balestrino and leandri who reported the first well - documented case in 1997 . These authors discovered a small ischemic lacune at the right lateral part of the pons in a patient with a 4-year history of ipsilateral second division (v2) tn and slight sensory loss . In 1998 golby et al . Described a patient who started having lancinating pain in v1 and v2 distributions on the left side . He had experienced sudden hemifacial numbness 1 year before, and mri demonstrated an old ischemic lesion at the root entry zone of the trigeminal nerve . In 2004 peker et al . Reported a female patient who suddenly developed a neuralgic pain in her left chin and cheek . A slight hypoesthesia was found in v2 and v3 territories, and mri showed a chronic infarction transecting the central trigeminal pathways within the pons . In 2006, warren et al . Described a female patient who presented with concurrent left trigeminal and glossopharyngeal neuralgia . Katsuno and teramoto have recently reported a patient with sudden onset of facial numbness and tn in the right v2 dermatome . Mri showed an acute pontine infarction, just at the root entry zone of the right trigeminal nerve . The pathogenesis of tn secondary to a brainstem ischemic lesion is uncertain . The main hypothesis states that demyelination in the central trigeminal pathways would cause ephaptic transmission and thereby abnormal electric impulses, as it happens in multiple sclerosis . Other theories postulate that irritation of trigeminal structures in a bed made from the scar would be the base of excessive reactivity in an epileptic - like manner . Facial pain may be a feature of wallenberg s lateral medullary syndrome, along with a decrease of pain and temperature sensation of the face . Other clinical features include vertigo, eye movement disorders, an ipsilateral horner s syndrome, ipsilateral limb ataxia, and contralateral sensory deficit . In reviewing the literature, pain incidence rates following a lateral medullary infarction vary largely, with higher rates in follow - up observations . The pain may start just at the stroke onset, but most patients have a latency between 2 weeks and 6 months . Some patients feel a constant, boring, pain, while others describe short pain attacks that occur either spontaneously or related to an innocuous stimulus . Therefore, wallenberg syndrome is a typical cause of central post - stroke pain, and this pain may occasionally take the attributes of a symptomatic tn . Among 12 patients with wallenberg s syndrome, fitzek et al . Found 6 patients with facial pain . The latency between the stroke and pain onset ranged between 1 month and 2 years . Facial pain was always ipsilateral to the infarction, and was mostly localized in the periorbital region . These patients reported short pain attacks lasting seconds to minutes, and three of them also had persistent pain . Although a diagnosis of tn was not made, the shortest pain attacks i.e ., those lasting just a few seconds apparently had typical tn features . Our patient also had neuralgiform pain attacks in association with a wallenberg s syndrome . The painful paroxysms were brief and intense, fulfilling ichd - ii diagnostic criteria for symptomatic tn . They started with a latency of 1 month after the stroke onset, which was in line with fitzek s series . While the hypoesthesia extended through the territory of the three trigeminal branches, the pain occurred in a v1 distribution . This was also in accordance with fitzek s cases, whose pain was mostly centered in the periorbital region . In contrast, classical tn usually starts in v2 or v3, and only very rarely affects v1 [1, 11]. The somatotopic arrangement of trigeminal fibers may possibly account for these topographical differences between tn due to nerve root compression and tn due to a lateral medullary infarction . Lesions of the dorso - lateral medulla involve both the trigeminal descending tract and the trigeminal spinal nucleus, and this may lead to sensory impairment and pain in the ipsilateral face . In fitzek s clinical series of wallenberg s syndrome, patients with facial pain had lesions covering the trigeminal spinal tract and nucleus at the lower medulla, as demonstrated by mri . In addition, the r2 blink reflex component was abnormal only in patients with facial pain . Likewise, sensory thresholds in the ipsilateral face were specifically elevated in those patients presenting with facial pain [3, 10]. The existing studies all deal with tn associated with multiple sclerosis and are small open - label trials . Three trials including a total of 19 patients with multiple sclerosis have reported an effect of gabapentin alone or associated with carbamazepine . In fact, gabapentin, pregabalin or amitriptyline are currently recommended for first line treatment in central neuropathic pain . Indeed, he experienced significant improvement when the drug was initiated, and had complete relief with further titration . In conclusion ischemic lesions covering the trigeminal spinal tract and nucleus at the lower levels of the medulla seem to be involved in the pathogenesis of the pain . Gabapentin might be an effective drug for symptomatic tn related to a lateral medullary infarction.
Primary hyperparathyroidism (phpt) is a disease characterized by hypercalcemia due to autonomous production of parathyroid hormone (pth). Phpt is the third most common endocrine disorder in the west after diabetes mellitus and thyroid disorders . Overall, about 1% of the adults have phpt in the west, and this figure rises to 2% in people older than 55 years . With the advent of multichannel biochemical screening in the 1970s, the clinical profiles of phpt remarkably differ with regions of the world . In developing countries, such as india, phpt is still uncommonly diagnosed, overtly symptomatic disease with skeletal, muscular, and renal manifestations . In contrast, phpt has become an asymptomatic disease in the west with classic manifestations seen only in 2% cases nowadays . In this study, we describe the clinical characteristics, biochemical profile, and outcome of 78 patients with phpt seen over a period of two decades at a single center from the kashmir valley . All patients who underwent evaluation and surgery for phpt from january 1996 to december 2015 at sher - i - kashmir institute of medical sciences were included in the study . A total of 78 patients were identified during the two decades, of whom 29 patients were studied retrospectively (19962012) and remaining 49 patients were studied prospectively (20122015). The diagnosis of phpt was based on the following: (i) persistent elevation of serum calcium above the upper limit of normal range (10.5 mg / dl); (ii) increased intact pth (ipth); and (iii) histological evidence (after parathyroid surgery) of parathyroid adenoma or hyperplasia . Evaluation of the patients included the measurement of serum total calcium, inorganic phosphorus, total alkaline phosphatase (alp), ipth, 25-hydroxy vitamin d (25-ohd), serum albumin, and 24 hour urinary calcium and creatinine . Serum total calcium, inorganic phosphorus, total alp, and serum creatinine were measured by automated techniques . The normal laboratory range was 8.510.5 mg / dl for total serum calcium, 2.54.5 mg / dl for serum phosphorus, and 30140 iu / l for serum alp . Radiological survey of hands, skull, lumbar spine, pelvis, and any other suspected or known site of fracture was performed . Imaging studies for localization of parathyroid adenoma included ultrasonography (usg) neck and technetium-99 m (tc) sestamibi scan . Serum ipth was measured by chemiluminescent immunometric assay and serum 25-ohd was measured by radioimmunoassay . Vitamin d deficiency was defined as serum 25-ohd level <20 ng / ml . In patients in whom a single parathyroid adenoma was localized on tc sestamibi scan, unilateral neck exploration was performed with removal of the adenoma . Patients with doubtful lesion or nonlocalized lesions underwent bilateral neck exploration, and all parathyroid glands were examined with the removal of 3 glands . Statistical analysis was done on pc windows using statistical package for social sciences (spss), version 11.5.0, from spss inc . Pearson's chi - square method was used for comparing proportions and percentages, whereas student's t - test was used for comparing continuous variables . Anova was used wherever needed . Where the data were not uniformly distributed nonparametric test such as mann smirnov z - test, or kruskal wallis h - test was used . A p <0.05 was taken as statistically significant . In patients in whom a single parathyroid adenoma was localized on tc sestamibi scan, unilateral neck exploration was performed with removal of the adenoma . Patients with doubtful lesion or nonlocalized lesions underwent bilateral neck exploration, and all parathyroid glands were examined with the removal of 3 glands . Statistical analysis was done on pc windows using statistical package for social sciences (spss), version 11.5.0, from spss inc . Pearson's chi - square method was used for comparing proportions and percentages, whereas student's t - test was used for comparing continuous variables . Anova was used wherever needed . Where the data were not uniformly distributed nonparametric test such as mann smirnov z - test, or kruskal wallis h - test was used . A p <0.05 was taken as statistically significant . The clinical characteristics of patients are shown in table 1 . An overwhelming majority (67/78; 85.7%) of the patients were females giving a male: female ratio of 1:6 . The mean age of patients was 44.72 12.46 with a median of 45 years and a range of 1670 years . Nephrolithiasis and/or nephrocalcinosis [figure 1] was the most common presentation, seen in 50 (64.10%) patients followed by bone pain in 26 (44.1%), abdominal pain in 24 (39%), constipation in 16 (26%), and myopathy in 11 (14.10%). Skeletal involvement (osteopenia, sub - periosteal resorption, pathological fractures, salt and pepper appearance of skull, brown tumors) was present in 31 (39.74%) patients; 8 (10.25%) had fractures [figure 2]. About one - fourth (19; 24.38%) of our patients had both renal and skeletal manifestations . Clinical characteristics of 78 patients with primary hyperparathyroidism (a) radiograph of abdomen showing extensive bilateral nephrolithiasis; (b) striking improvement after successful parathyroid surgery radiograph showing advanced bone disease . (a) fracture of femur; (b) brown tumor of tibia out of fifty patients with nephrolithiasis, 15 (30%) had a past history of at least one surgery for renal stones prior to the diagnosis of phpt, and another four patients had received extracorporeal shock wave lithotripsy at least once prior to diagnosis of phpt . The mean serum calcium level was 12.5 1.7 mg / dl, (median12, range 10.719). The mean serum ipth level was 377.6 386.1 pg / ml (median 224.5, range 701900). Hypophosphatemia (serum inorganic phosphorus <2.5 mg / dl) was documented in 54 (69.23%) patients . The mean serum inorganic phosphorus level was 2.2 0.6 mg / dl (median 2.2). Hypercalciuria (24 h urinary calcium 4 mg / kg) was present in 41 (52.56%) patients . The mean serum alp was 255.1 336.8 iu / l (median 154). Biochemical variables of 78 patients with primary hyperparathyroidism serum 25-ohd was available for 54 patients . The mean 25-ohd level was 37.2 58.1 ng / ml (median 22.8, range 4.3312). We did not find any correlation between vitamin d status and biochemical parameters (serum calcium and ipth) or adenoma weight . Two females; aged 25 and 23 years had phpt and microprolactinoma, whereas a 58-year - old female patient had phpt and acromegaly . Two of our patients had associated adrenal incidentalomas causing sub - clinical cushing's syndrome in one of them . A 27-year - old female patient presented in postpartum period with nephrogenic diabetes insipidus as the sole manifestation of phpt, which settled immediately after parathyroid surgery . All our patients underwent usg neck and tc-99 m sestamibi scan for localization of parathyroid adenoma . In our series, the sensitivity of usg and tc-99 m sestamibi scan for the localization of adenoma was 89.8% and 95.3%, respectively . At the time of surgery, single adenoma was involved in 69 (88.46%) double adenomas in 6 (8.57%) and more than 2 gland involvement in 3 (4.28%) patients . Among the 69 patients with single adenoma, right inferior gland was involved most often (40; 57.97%), followed by left inferior (22; 31.88%) and right superior (7; 0.14%); none of the patients had involvement of left superior gland . On histopathology, adenoma was found in 75 (94.44%), hyperplasia in 3 (3.79%) patients . The mean parathyroid gland weight was 2.05 3.03 g (median 1.05; range 0.113.8). Using pearson's correlation coefficient, the mean postoperative serum ipth level was 61.8 43.8 pg / ml (range: 10.7154). Postoperative hungry bone syndrome (hbs) was observed in 8 (10.12%) patients . This was managed with oral calcium and calcitriol in five patients, whereas three patients needed parenteral calcium gluconate infusion . Permanent hypoparathyroidism was observed in a single patient, and postoperative pancreatitis was documented in one patient . No patient sustained permanent vocal cord paralysis, wound infection, or sepsis . The surgical success (cure) for phpt is defined by the maintenance of eucalcemia at the arbitrarily accepted interval of 6 months after surgery . Based on this definition, the overall cure rate in our series was 96.15% (75 out of our 78 patients achieved cure). One of these patients had men-1 (phpt and acromegaly); she underwent the removal of all four parathyroid glands . The second patient was a young male in whom preoperatively left inferior adenoma was localized but had a persistent disease; however, he achieved cure after second surgery . Out of 75 patients who achieved cure, long - term follow - up (more than one year, range 19 years) was available for 41 patients . During this follow - up period, none had recurrence of phpt . At the time of surgery, single adenoma was involved in 69 (88.46%) double adenomas in 6 (8.57%) and more than 2 gland involvement in 3 (4.28%) patients . Among the 69 patients with single adenoma, right inferior gland was involved most often (40; 57.97%), followed by left inferior (22; 31.88%) and right superior (7; 0.14%); none of the patients had involvement of left superior gland . On histopathology, adenoma was found in 75 (94.44%), hyperplasia in 3 (3.79%) patients . The mean parathyroid gland weight was 2.05 3.03 g (median 1.05; range 0.113.8). Using pearson's correlation coefficient, the mean postoperative serum ipth level was 61.8 43.8 pg / ml (range: 10.7154). Postoperative hungry bone syndrome (hbs) was observed in 8 (10.12%) patients . This was managed with oral calcium and calcitriol in five patients, whereas three patients needed parenteral calcium gluconate infusion . Permanent hypoparathyroidism was observed in a single patient, and postoperative pancreatitis was documented in one patient . No patient sustained permanent vocal cord paralysis, wound infection, or sepsis . The surgical success (cure) for phpt is defined by the maintenance of eucalcemia at the arbitrarily accepted interval of 6 months after surgery . Based on this definition, the overall cure rate in our series was 96.15% (75 out of our 78 patients achieved cure). One of these patients had men-1 (phpt and acromegaly); she underwent the removal of all four parathyroid glands . The second patient was a young male in whom preoperatively left inferior adenoma was localized but had a persistent disease; however, he achieved cure after second surgery . Out of 75 patients who achieved cure, long - term follow - up (more than one year, range 19 years) was available for 41 patients . During this follow - up period, the traditional age of presentation of phpt in india is in the 4 decade . In our study, our results reflect a shift in the presentation of phpt from fourth to fifth decade in india . However, our patients continue to be much younger than patients from the developed countries . Comparison of present study with other indian studies renal stone disease (50:64.10% patients) was the most common presentation in our series . The prevalence of renal stones has fallen from 57% to <5% in the west due to the detection of more and more asymptomatic cases . Thirty percent of our patients with renal stones had a past history of at least one surgery for renal stones and another four patients (8%) had received lithotripsy prior to diagnosis of phpt . Surprisingly, in none of these patients serum calcium estimation had been advised during previous evaluation . This significant delay in the diagnosis of phpt reflects the lack of awareness among urologists, nephrologists, and general practitioners regarding phpt . Mishra et al . In 2001 in a study of 29 patients reported osteitis fibrosa cystica in all of them and fractures in 57% of the patients . In a study of 52 patients reported bone disease in 67% and fractures in 48% patients . A systematic review of phpt in india has reported fractures in 40% and brown tumors in 42% patients . A recent indian study reported fractures in 25.8% of phpt patients and brown tumors in none . In our study, fractures were present only in 10.25% and brown tumors in 6.41% patients . This is the lowest prevalence of fractures in a cohort of phpt patients from india . Our results reflect a changing trend in the presentation of phpt in india wherein the overt skeletal disease in the form of fractures and brown tumors is on the decline . The remarkably low prevalence of fractures in our series probably is due to earlier diagnosis of phpt for last few years (more than half of our subjects were enrolled from 2013 onwards). The improvement in vitamin d nutrition is reflected by the mean serum 25-ohd of 37.2 ng / ml in our patients . The frequency of specific radiological manifestations of phpt in the united states declined from 23% in the 1960s to a remarkably low 2% in the 1990s . The difference in the severity of skeletal disease in phpt between western and eastern populations is determined by calcium and vitamin d nutrition, but additional factors also play a role . Previous data from india report that 1213% patients with phpt have pancreatitis . In our series, the mechanisms of phpt induced pancreatitis include hypercalcemia - induced activation of trypsinogen to trypsin, ductal obstruction due to pancreatic calculi, and finally genetic risk factors . All our patients had hypercalcemia and their mean serum calcium level was 12.5 mg / dl, which is remarkably similar to that reported by other indian studies . A previous indian study has reported hypophosphatemia in 65% patients with phpt, but another indian study has reported a normal mean serum phosphorus in phpt patients . The mean serum ipth level in our patients was 377.6 pg / ml, which is lower than that reported by previous indian studies . Elevated alp has been consistently reported by other indian series due to high prevalence of bone disease in phpt patients . The mean parathyroid weight (2.05 3.03 g) in our study is markedly lower than that reported by other indian studies [table 3]. We found a strong correlation of parathyroid gland weight with serum calcium and ipth, as has been reported previously . The mean serum 25-ohd (37.2 58.1 ng / ml) in our study was higher than that reported by previous indian studies; however, vitamin d deficiency was present in 38% of our patients . An inverse correlation between serum 25-ohd concentration and parathyroid gland weight has been reported previously . We did not find any correlation between vitamin d status and biochemical parameters (serum calcium and ipth) or adenoma weight . The likely reason is the possibility of prior vitamin d treatment and uncertainty about its timing and amount, which could have confounded the 25-ohd measurements at the time of presentation . In addition, vitamin d may not be the only significant factor in the development of bone disease in phpt patients, other factors could be playing a significant role . The preoperative localization of an abnormal parathyroid gland can reduce operative time, postoperative morbidity, and the need for repeat surgery . The imaging methods for localization include high - resolution usg, tc sestamibi scan, computerized tomography, and magnetic resonance imaging . The sensitivity of usg to localize the adenoma has been reported as 6577%, whereas the sensitivity of tc sestamibi scan has been reported as 86.9100% . In our series, the sensitivity of usg and tc sestamibi scan for localization of adenoma was 89.8% and 95.3%, respectively . With a sensitivity of 89.8%, we conclude that usg is an effective localization modality as it is inexpensive and is widely available . Mishra et al ., in a study of 29 patients reported a cure rate of 100% . Previous indian studies have reported postoperative hbs in a large proportion of patients from 24% to 82% . In our study, our results are in agreement with a recent indian study in which postoperative hbs was seen in only four patients (8%) out of fifty . Our policy to treat all patients with preoperative serum 25-ohd level <30 ng / ml with vitamin d is in all probability, responsible for much lower prevalence of postoperative hbs in our series . Consistent with the data about recurrent phpt on long - term follow - up revealing recurrence rates of zero to 41.6%, none of the 41 patients in our series on whom follow - up was available for 19 years, had recurrence of phpt . The strengths of our study include its large size and largely prospective nature with about two - thirds (62%) of the subjects evaluated prospectively . Lack of data on bone mineral density and for many patients, on vitamin d status are the limitations of the study . In conclusion, our study reflects a changing trend in the clinical profile of phpt in india . There is a shift in the age of presentation of phpt from fourth to fifth decade . Renal stone disease is emerging, the most common presentation, whereas overt skeletal disease in the form of fractures and brown tumors is on the decline.
Parkinson's disease (pd) is an age - related progressive neurodegenerative disorder which is associated with selective loss of dopaminergic neurons from the substantia nigra pars compacta region of the midbrain . Pd is broadly classified into a familial form (resulting from genetic alterations like mutations or multiplication in the snca gene encoding alpha - synuclein (-syn), early - onset form) and the idiopathic form with unknown etiology (late - onset form). The majority of idiopathic pd cases represent a late - onset sporadic form with cytoplasmic -syn aggregates which are the major component of lewy bodies and lewy neurites, the characteristic proteinacious cytoplasmic deposits that are pathological hallmark of the disease . Increasing evidence suggest that oxidative stress is a key contributor to the pathogenesis of pd, which causes damage to nucleic acids (both dna and rna), proteins, lipids and other cellular macromolecules whose functions are indispensable for cell survival . The metabolism of dopamine (da) itself contributes to oxidative stress that renders the nigral neurons particularly vulnerable in pd . The most frequent dna lesion generated by oxidative stress is 8-oxo-7,8-dihydroguanine (8-oxodg), the oxidized form of guanine, often associated with neurodegenerative diseases including pd and alzheimer's disease (ad). 8-oxodg, being a nonbulky dna lesion, has high mutagenic potential by misincorporation of an adenine instead of cytosine causing g: ct: a transversion mutation . 8-oxodg has also been implicated in an event called transcriptional mutagenesis (tm), whereby a misincorporated adenine in the transcribing mrna leads to the generation of mutated species of protein (figure 1). It is well documented that oxidative dna damage accumulates in ageing brains and this accumulation is significantly increased in brains of patients with pd and ad compared to their age - matched controls . These increased levels of dna damage are also corroborated by decrease in the dna repair capacity of specific enzymes such as 8-oxodg dna glycosylase1 (ogg1). In addition to its involvement in tumor development, tm may have a very important role in the neurodegenerative disorders, in which a nucleation - dependent protein aggregation process has a pivotal role in neuronal degeneration as seen in pd and ad . As shown in -syn a53 t mutant species that was reported in the familial form of pd, the pathologically misfolded proteins drive the template - directed misfolding of the native monomeric proteins, which contributes to the nucleation - dependent fibrillation process . Moreover, compared with replicating cells, neurons that are post - mitotic cells might be even more vulnerable to 8-oxodg - mediated tm as pathogenic effects caused by mutant species generated through tm events could be accumulated over a lifetime . In the following review, we discuss the importance of oxidative damage in pd and its scope in the pathogenesis of the disease through 8-oxodg - mediated tm events . But the greatest paradox remains in the fact that production of reactive oxygen species (ros) as a by - product of oxygen metabolism is highly toxic to cells . It can include both free radicals like superoxide, hydroxyl radical and nitric oxide (containing highly reactive unpaired electrons) and molecules like hydrogen peroxide and peroxynitrite . Post - mortem brain tissues from patients of pd, ad and amyotrophic lateral sclerosis (als) have clearly demonstrated higher amount of ros in the selective areas that undergoes neurodegeneration . Oxidative stress originates when the rate of ros production is significantly higher compared with its elimination from the system . For example, elevated levels of malondialdehyde and 4-hydroxynonenal, which are markers of oxidized lipids, have been observed in the cortex and hippocampus of patients with ad, in the substantia nigra of patients with pd and spinal fluid of patients with als . Oxidative modification of unsaturated fatty acids can result in the generation of lipid peroxides which can further cause oxidation of the unsaturated fatty acids in a chain - like event, finally leading to the disruption of plasma membranes and membranes of other cellular organelles like mitochondria . The levels of protein carbonyls, a marker of protein oxidation, have been also reported to be consistently elevated in the hippocampus and neocortex of individuals with ad, in lewy bodies in case of pd and motor neurons of als patients . Oxidation of proteins can disrupt the active site of enzymes, lead to conformational change, disrupt protein protein interactions, and alter their binding capacity to dna, eventually threatening cell survival . In addition, increased levels of oxidative damage to dna and rna bases have been consistent with the neurodegenerative conditions like pd, ad and als . Although all dna bases could be potentially oxidized, guanine is the most susceptible base to oxidative damage . It gets readily oxidized to form 8-oxodg and serves as a marker for oxidative damage . In ad, the level of nuclear dna damage in the brain regions including frontal, parietal and temporal lobes is significantly higher compared with age - matched controls . Overall, it can be concluded that oxidative stress is commonly associated with neurodegenerative conditions and has a critical role in mediating the disease processes . The origin of oxidative stress and subsequent accumulation of damage cannot only be attributed to the overproduction of ros but also to the inefficient cellular defense and repair machinery against oxidative stress . The defense machinery refers to the antioxidant enzymes like superoxide dismutase, glutathione peroxidase, glutathione reductase and catalase among many others whose primary function is to scavenge ros generated in the cells . For example, superoxide dismutase converts superoxide to hydrogen peroxide, which is subsequently converted to water by either catalase or glutathione peroxidase . Glutathione peroxidase detoxifies hydrogen peroxide using reduced glutathione . During this process, glutathione is oxidized and it can be subsequently reduced by glutathione reductase . A number of reports have shown reduced activity of the antioxidant machinery in ad . In familial als, mutations in copper- and zinc - containing superoxide dismutase lead to a toxic gain of function, rendering superoxide dismutase itself to a pro - oxidant protein involved in ros generation . Pd is also characterized by significant loss of the reducing agent glutathione in the substantia nigra, which is one of the earliest known indicators of nigral neuronal degeneration . Together, these evidences comprehensively indicate that reduced antioxidant potential might be a critical factor toward increased oxidative stress that is associated with neurodegenerative disorders . As discussed previously, accumulation of ros - induced dna damage, like oxidation of bases and single strand breaks have been implicated in the etiology of ad, pd, als and other neurological disorders . This accumulation of the dna damage may imply the defect in the dna repair machinery of the cells . It has been shown that ros - induced dna damages are primarily repaired via highly conserved base excision repair pathway . Neuronal dysfunctions have been linked to mutations or differential expression of base excision repair enzymes like ogg1, xrcc1, single - strand break repair enzymes like tdp1, aprataxin and double - strand break repair enzymes like atm and nbs1 . Furthermore, it has been shown that ogg1 knockout mice exhibit age - associated loss of nigrostriatal pathways and increased sensitivity to the dopaminergic neuronal toxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, than their wild - type littermates . Together, these evidences strongly suggest that oxidative stress - mediated damage to cellular macromolecules including dna coupled with inefficient repair leads to progressive neurodegeneration as seen in ad, pd, als and others . The high metabolic activity of neurons along with their long life span makes them highly susceptible to oxidative damage . Moreover, dopaminergic neurons in the substantia nigra, the most affected brain region by pd, are particularly vulnerable to oxidative stress . Although the exact causes for this selective vulnerability is yet to be elucidated, da metabolism itself has been considered as a major culprit for selective degeneration . Da has the capacity to auto - oxidize at normal ph into toxic quinone species, producing superoxide and hydrogen peroxide . Monoamine oxidase can also enzymatically deaminate da into nontoxic metabolite 3,4-dihydroxyphenylacetic acid and hydrogen peroxide . Hydrogen peroxide can in turn be broken down into hydroxyl radical in a reaction catalyzed by iron . The level of iron is reportedly higher in the nigral dopaminergic neurons as compared with the other regions of the brain, owning to its binding affinity to neuromelanin . Therefore, when it is synthesized or transported into cells from extracellular space, da is rapidly stored into synaptic vesicles which provides a stable environment for da without monoamine oxidase and low ph . Under conditions of pd, nigral neurons appear to be in an exaggerated oxidative stress, causing severe damage to cellular macromolecules . Damage to nucleic acids is particularly very hazardous amongst all the cellular macromolecules, because it can change genetic information present in both nuclear and mitochondrial genome . Dna damage by oxidative stress can result in the production of either nonbulky dna lesions like 8-oxodg that can be repaired by the base excision repair pathway or bulky dna lesions which are generally repaired by the nucleotide excision repair pathway . 8-oxodg, the most frequent dna lesion caused by oxidative stress is often associated with neurodegenerative diseases including pd . Immunocytochemical analysis of 8-oxodg revealed a significant increase of this dna oxidation marker in the substantia nigra of patients with pd although the extent of nuclear 8-oxodg accumulation is not as high as mitochondrial 8-oxodg . Despite the presence of 8-oxodg - specific dna repair enzyme, ogg1, a significant percentage of this dna lesion remains unrepaired and accumulated under disease conditions . Moreover, it is reported that the overall activity of ogg1 in brain decreases over ageing in a mouse model . The 8-oxodg generated by direct oxidation of dna, can be base paired with adenine as well as cytosine during replication, and consequently lead to spontaneous g: c to t: a transversion mutation . However, majority of the cells in our body, including neurons, exist in nonproliferating quiescent state . Neurons being post - mitotic cells, face a major challenge of dna repair during transcription . Failure to maintain both transcriptional and translational fidelity is expected to result in functional impairment of the cells . Studies have shown that many of these nonbulky lesions present on the sense strand of dna could be bypassed by rna polymerase during transcription, leading to misinsertion of ribonucleotides to the growing mrna strands, producing mutant transcripts . This phenomenon is referred as tm event in the cells . Since a significant increase of 8-oxodg was observed in the substantia nigra of patients with pd, it is highly possible that tm event might significantly contribute to the pathogenesis of pd . In the next few sections of this review, the perspective of tm in pd will be closely explored with the emphasis on -syn that is reckoned a major pathogenic molecule . Dna damage - mediated mutagenesis in a replication - based model has provided a wide range of information for better understanding of the origin of mutation and subsequently its contribution to the pathogenesis of human diseases such as cancers . However, as discussed briefly in the last section, majority of cells under normal physiological conditions are not frequently engaged in division and do not undergo continuous cycles of replication . Most of the multicellular organs of eukaryotes including brain or heart are mainly comprised of nondividing or terminally differentiated cells . Maintenance of complex physiological functions of these organs primarily depends on securing the high fidelity of both transcription and translation . Accumulation of tm - derived mutant transcripts and subsequently generated erroneous proteins has the potential to produce functional impairment of nonproliferating cells and organs . As the aging process may be accompanied by progressive deterioration of normal cellular functions such as dna repair machinery and antioxidation processes, tm - mediated adverse effects on cells could be exacerbated over aging . In fact, under in vitro conditions allowing tm event, it has been shown that each round of transcription keeps producing a mutant transcript as long as 8-oxodg lesion is not repaired . This event is expected to generate a fairly large population of mutant transcripts which will be translated multiple times, leading to a relatively large amount of the mutant protein . A number of studies have shown that a plethora of dna damage can lead to a tm event . The structural analysis of yeast rna polymerase ii at an 8-oxodg lesion revealed the possible mechanism of tm . In this study, it has been shown that 8-oxodg can mispair with adenine instead of cytosine through a hoogsteen base - paring with the 8-oxodg lesion at the polymerase active center, thereby escaping the proofreading of the polymerase and maintained in the nascent rna stand . The potential of 8-oxodg to cause tm event had been demonstrated in a bacterial system using escherichia coli and its role in developing antibiotic resistance . Later, using a luciferase - based reporter system, tm - derived mutation event has been also proved in mammalian cells, demonstrating that tm event is strongly affected by factors, such as promoter strength of the gene, flanking sequence around the 8-oxodg lesion and position of the lesion with reference to the promoter . In the same study, ogg1 knockout cells showed more frequent tm event compared with the cells lacking a transcription - coupled repair machinery, suggesting that a 8-oxodg lesion is not efficiently recognized by transcriptional machinery for initiating repair and rather ogg1 has a critical role in preventing tm . Replacement of a guanine with 8-oxodg at codon 61 of hras, a proto - oncogene, led to generation of a constitutively active mutant form of hras (q61k) through tm event . Moreover, under condition of ogg1 null background in mouse embryonic fibroblast, sufficient amount of the mutant protein was generated to activate the downstream mapk pathway, leading to erk phosphorylation . Together it suggests that 8-oxodg lesion is often bypassed by rna polymerase ii without efficient detection by the transcription - coupled repair or the base excision repair machinery, generating transcription mutant species and contributing to the pathogenesis of various diseases including cancer, neurodegeneration or cardiovascular disease . It can exist as random - coil state as well as -sheet conformation upon aggregation or a -helical conformation upon binding to membranes . Sequence of -syn can be divided into three regions with distinct characteristics (figure 2): (1) the amphipathic lysine - rich n - terminus (residues 160), which is mainly involved in membrane interactions; (2) the middle hydrophobic region (non - a component of amyloid plaques, residues 6195), which is prone to -sheet formation and fibrillization; and (3) the c - terminus (residues 96140), which is a highly acidic and proline - rich region and primarily controls the nuclear localization and interaction with other proteins . Multiplication as well as various single - nucleotide polymorphisms of snca have been reported in dominantly inherited early - onset pd . -syn mutant species, a30p, a53 t and e46k have been shown to alter the aggregation process and interfere with oligomerization, fibril formation and the distribution in cellular compartments . More recently, three additional mutations of -syn, h50q, g51d and a53e, have been identified in pd patients . Increasing body of evidence from various experimental models has shown that elevated levels of wild - type and various mutant species are prone to accelerate the aggregation process . In misfolded state, the mutant -syn proteins are transformed into amyloid fibrillar species consisting of -sheets, which have properties to serve as templates to drive soluble proteins to adopt similar structural changes, leading to the formation of highly ordered aggregated structure . Increased oxidative stress is a key contributor to the pathogenesis of pd and several in vitro and in vivo experiments have linked oxidative stress to -syn aggregation . Exposure of neuronal cells to various oxidative stressors including ferrous ions, hydrogen peroxide, mpp (1-methyl-4-phenylpyridinium), rotenone, nitric oxide and superoxide all promoted the aggregation process . In vivo studies also corroborated the same idea that chronic and systemic exposure of rodents to rotenone, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine or paraquat leads to selective nigrostriatal dopaminergic lesions accompanying degeneration with -syn aggregation . Thus, how the 8-oxodg - mediated tm event might have a critical role in the process of -syn fibrillogenesis depends on whether the mutant species generated by this process can acquire a misfolded state by themselves, which will eventually act as a seed in the nucleation - dependent aggregation process as seen for reported mutant -syn proteins . If the 8-oxodg - mediated tm mutant species are more stable in the -sheet form, then a limited amount of tm species could be enough to promote prion - like nucleation of -syn . Over the past few years, increasing number of studies have provided evidence that -syn aggregates can propagate from one brain region to another in a prion - like manner . This self - perpetuating cycle of -syn fibrillation and propagation could be initiated by the addition of a minute amount of pathogenic proteins that can potentially serve as aggregate seeding . 8-oxodg - derived tm species may trigger this process, leading to the pathogenesis of pd . In a paraquat - based animal model of pd, it has been shown that nuclear 8-oxodg accumulation in the substantia nigra is clearly correlated with increase in proteinase - k resistant species of -syn aggregates . A recent study has pointed that genomic distribution of 8-oxodg is not a random event, instead it is localized preferentially to specific areas of the chromosome and is negatively correlated with transcriptional activity of a gene . This fact implies that tm could affect various genes in the context of chromatin structure, and mutant species originating from tm event should be outnumbered by the normal physiological form . Therefore, for most proteins, generation of small portion of nonfunctional tm species would not be likely to cause entire functional impairment . However, -syn could become cytotoxic in the nucleation - dependent oligomerization process, in which small addition of mutant -syn species to wild - type population may initiate the seeding process and fibrillogenesis . This unique biochemical feature of -syn would strongly support the feasibility of the proposed model . All possible mutant -syn proteins which could be generated through tm - mediated replacement of cytosine with adenine in the mrna strand are listed in figure 3 . Among tm - generated -syn mutants, the following mutants, a30e, h50n and a53e, have mutations at the same amino acid position as the familial forms of mutants, a30p, h50q and both a53e and a53 t, respectively . It would strongly suggest that those tm mutants could similarly cause a nucleation - dependent -syn fibrillation . Apart from these mutant forms, there are several other residues that might disrupt the native structure of the protein when they get mutated and make them more prone to aggregation . To predict the aggregation propensity of expected tm species, we used tango, a statistical mechanics algorithm, which enables identifying -aggregating regions within a protein based on the sequence information . Tango algorithm indicated that a couple of expected tm proteins has significantly higher -aggregation scores than wild - type -syn, which include l38i, s42y, h50n and q62k in the n - terminal or the non - a component of amyloid plaques domain, predicting increases in aggregation property (figure 4). Post - translational modifications such as phosphorylation on serine 87 and 129 may also affect the -syn aggregation process . Tm event can replace the serine at 129 position with a tyrosine . Together we propose a hypothetical model by which 8-oxodg lesions in the protein coding region of snca could yield a small amount of tm protein species with higher aggregation propensity that potentially serve as a seeding for accelerating the aggregation of wild - type -syn, leading to the self - propagation of aggregates and causing degeneration of the nigrostriatal pathway in pd (figure 5). The majority of idiopathic pd cases are a late - onset sporadic form with cytoplasmic -syn aggregates, which indicates that increasing degree of aggregation does not depend only on genetic mutations in snca . However, till date, the approaches to understand the molecular mechanism of -syn aggregation have focused primarily on the biochemical properties of mutant protein species that were identified in rare familial form of pd and their behavior within the cells . The proposed model will give an insight into a novel mechanism called transcriptional mutagenesis' caused by the accumulation of oxidatively damaged dna lesions, 8-oxodg, in the snca gene . Comprehensive investigation on age - dependent changes in -syn mrna profiles as well as identification of tm species supported by functional studies on mutant proteins will definitely add a new dimension to the understanding of -syn pathology in conjunction with oxidative stress.
A stroke is a cerebrovascular event in which the supply of blood delivered to the brain is significantly altered1,2,3 . The resulting deficits or impairments following stroke vary according to the location and extent of the lesion, but often include hemiparesis, communication disorders, and cognitive deficits4 . In isolation or combined, these deficits often lead to significant difficulty completing activities of daily living . Even after extensive rehabilitation, up to 50% of stroke survivors experience lingering motor deficits4, 5 . Although the majority of stroke patients are able to walk independently, most do not reach a walking level that enables them to perform all of their daily activities . Impaired walking function, including reduced gait stability and asymmetric walking, is a common neurological deficit following stroke4 . For example, laufer et al . Reported that the nonparetic lower limb assumes 6180% of the full body weight during normal walking in patients with hemiparesis5 . Asymmetric walking caused by hemiparalysis can become a cause of instability during daily activities, and these patients have a higher rate of falls than elderly individuals in the general population4 . Thus, gait recovery is a major objective of rehabilitation programs for patients with stroke . Studies have focused especially on the musculoskeletal effects of stroke, such as strength and muscle density, which are implicated in gait and balance problems6,7,8 . Diminished muscle activity has been identified as a factor contributing to balance impairment in patients with hemiplegia, and as such, treatment to increase muscle activity has been attempted as a method to improve balance capacity9 . Trunk muscles are activated during the rhythmic movement that is part of the execution of gait . Core strengthening exercises are used to specifically strengthen the trunk muscles and have become a specialty area in the field of rehabilitation10 . Recently, in the united states and europe, pilates has become a target of interest as a useful exercise . Pilates exercises were developed by joseph h. pilates (18801967) as an exercise method to relax and strengthen the body . The exercises have a scientific, rational system for adjusting the center of the body11 . Pilates training is based on 8 principles: control, breathing, flowing movement, precision, centering, stability, range of motion, and opposition . Mat - based pilates exercises have been developed that use equipment for those who cannot exercise more vigorously due to injury or poor health . As strength - based exercises are directly connected to health, they can be an effective method to improve balance ability and can also be used to correct postural deviations for a flexible and balanced body11, 12 . A recent study on balance and pilates demonstrated that pilates can be effective for enhancing both static and dynamic equilibrium capacity in university students in a 16-week mat exercise course13 . In another study, by changgiun14, based on these findings, we hypothesized that pilates exercise training could be an effective post - stroke rehabilitation method to address impairments frequently encountered by patients with stroke, such as flexibility, somatosensory loss, muscular strength, and balance15,16,17,18 . Currently, most of the studies on pilates training programs have focused on orthopedic remedial exercise19,20,21 or balance improvement in the elderly16, 21, 22 . Reported that patients with low back pain described a lower level of functional disability after 4 weeks of pilates intervention21 . Bird et al . Reported that a 5-week pilates training course for the elderly contributed to greater benefits in static and dynamic balance compared to usual activity16 . Of these, the majority have focused on patients with multiple sclerosis22,23,24,25,26, and no studies have been conducted on the rehabilitation of patients with chronic stroke . Therefore, the purpose of this study was to investigate the effects of an 8-week mat - based pilates exercise training program on the static and dynamic balance abilities of patients with chronic stroke . Thirty participants were initially recruited from the rehabilitation center for the disabled located in uijeongbu, gyeonggi province, korea . The inclusion criteria stated that each participant must be at least 2 years post stroke, medically stable with a physician release granting approval to initiate and complete an exercise program, able to walk independently without an assistive device, and willing to participate in a pilates exercise class . Participants were excluded if they had visual impairment, hearing damage, uncontrolled high blood pressure, or were unable to understand the nature of the experiment . Participants who were receiving physical therapy separately were also excluded from this study . In total, 10 participants were excluded because they were participating in individual physical therapy sessions, and one participant dropped out of the control group due to hospital admission during the intervention period . Finally, nineteen individuals with chronic hemiparetic stroke participated in the study (age, 64.7 6.9 years; height, 161.7 7.9; and weight, 67.0 11.1). The research protocol was approved by the institutional review board of sahmyook university . Following participant selection, they were randomized into two groups, a pilates exercise training group (pg) and a control group (cg). During the intervention period, the pg was given pilates exercise training, while the cg was not given any exercises or treatment at the center for the disabled . The pilates training program was based on mat classes lasting one hour per class, three times a week for 8 weeks . In this study, two certified pilates instructors and one physical therapist were in charge of the class . One instructor demonstrated movements for patients to follow and the other instructor and the physical therapist assisted patients with the exercise . All movements included in the pilates training was based on 8 1 set of 8 repetitions per exercise . To improve core stability, breathing exercises were conducted in a sitting position before and after all training sessions . The mat based pilates training was composed of spine mobility exercises, upper limb exercises, and lower limb strengthening exercises . The exercises were composed of the following detailed movements: 1) spine mobility- chin up and down, forward spine stretch, and side spine stretch in sitting with theraband; 2) upper limb exercise- draw a sword, and deltoid lift in sitting with theraband; and 3) lower limb strengthening exercise- top leg pulse - down and bottom leg pulse - up in sidelying using the magic circle, and foot and ankle strengthening in sitting with theraband . Unlike general pilates training, lower limb strengthening exercises help to strengthen the quadriceps, gluteus medius, adductor magnus, gastrocnemius, and anterior tibialis . Additionally, for gluteal activation, a gluteal series including charlie chaplin exercises, swimming, and a heel squeeze in prone with a ball under the chest were performed, along with a prone bridge . To verify the effects of the 8-week pilates training course on the static and dynamic balance of patients with chronic stroke, two data collection protocols were conducted one week before and after the training . The variables assessed were center of pressure (cop) sway and velocity . To measure static balance, participants wore familiar shoes, and were asked to stand on an instrumented treadmill (fit, bertec corp ., usa)with their eyes open and arms at their sides comfortably for 30 seconds . Each foot was placed on a separate force plate located under the treadmill belts and foot position was measured and maintained for each evaluation . To measure dynamic balance, participants were asked to walk on the instrumented treadmill at their self - selected velocity . The over - ground self - selected velocity was determined for each participant beforehand and the treadmill belt speed was set to match that velocity during the evaluation . When it was determined that subjects were exhibiting natural walking movements (after about 35 seconds), a total of 5 static and dynamic trials were conducted for each subject, and average values from the trials were used for data analysis . And anterior - posterior (a - p) and medial - lateral (m - l) directional cop sway, as well as velocity with time series, were computed and evaluated . The 8-week pilates training effects were assessed using a paired t - test, and an independent samples t - test was conducted to compare the differences in subordinate variables between the groups . No significant differences in general characteristics were noted between the groups (p>0.05, table 1table 1.general characteristics of subjectspg (n=10)cg (n=9)gender (male / female) 10 (5/5) 9 (5/4)age (years)66.80 5.761.11 6.6height (cm)159.75 8.9163.57 10.4weight (kg) 65.01 12.6 66.43 10.9duration (years)12.80 3.013.20 6.3stroke type (hemorrhage / infarction)10 (4/6)9 (5/4)paretic side (left / right)10 (6/4)9 (5/4)pg: pilates training group; cg: control group . For static balance, cop sway significantly decreased in the pg in both the a - p and m - l directions (p<0.05, table 2table 2.changes in static balance abilityvariablespg (n=10)cg (n=9)m - l cop range (mm)pre10.85 5.011.72 5.4post7.11 2.216.10 6.1pre - post3.74 3.3 * 1.61 3.0a - p cop range (mm)pre14.75 8.016.10 6.1post10.47 3.716.82 5.0pre - post4.28 4.9 * 0.72 4.6m - l cop velocity (mm / s)pre83.94 42.184.24 45.0post66.48 26.686.69 41.9pre - post17.46 24.4 * 2.45 4.8a - p cop velocity (mm / s)pre122.00 47.6130.48 45.8post104.55 42.0135.78 43.2pre - post17.45 11.9 * 5.30 7.2a - p cop: anterior - posterior center of pressure; m - l cop: medial - lateral center of pressure . All dynamic balance parameters for both legs improved significantly in the pg after training (p<0.05, tables 3table 3.changes in dynamic balance ability on the paretic side in stance phasevariablespg (n=10)cg (n=9)m - l cop range (mm)pre15.0 2.116.0 2.4post12.0 1.416.3 2.4pre - post3.0 2.4**0.4 1.0a - p cop range (mm)pre27.0 3.226.2 3.7post22.4 2.726.5 2.9pre - post4.6 1.2***0.3 1.2m - l cop velocity (mm / s)pre88.6 33.591.8 39.8post76.5 25.692.6 38.8pre - post12.1 8.4 * 0.7 2.2a - p cop velocity (mm / s)pre114.8 31.2117.0 30.6post98.3 25.2117.1 29.1pre - post16.5 6.6**0.1 2.7a - p cop: anterior - posterior center of pressure; m - l cop: medio - lateral center of pressure . * means significant difference within group; means significant difference between groups and 4table 4 . Changes in dynamic balance ability on the non - paretic side in stance phasevariablespg (n=10)cg (n=9)m - l cop range (mm)pre12.7 1.213.7 2.2post10.4 0.814.2 1.9pre - post2.4 0.6***0.44 0.62a - p cop range (mm)pre23.2 2.422.1 3.6post18.2 1.222.9 3.3pre - post5.0 1.6***0.77 1.1m 21.287.16 26.3pre - post12.5 7.5 * 1.12 2.6a - p cop velocity (mm / s)pre89.7 28.896.9 27.5post73.2 17.997.0 25.1pre - post16.6 11.3 * 0.1 3.3a - p cop: anterior - posterior center of pressure; m - l cop: medial - lateral center of pressure . * means significant difference within group; means significant difference between groups). For all static and dynamic balance parameters, significant differences after training were found between the pg and the cg, although there were no significance differences at baseline (p<0.05, tables 3 and 4). A - p cop: anterior - posterior center of pressure; m - l cop: medial - lateral center of pressure . * means significant difference within group; means significant difference between groups a - p cop: anterior - posterior center of pressure; m - l cop: medio - lateral center of pressure . * means significant difference within group; means significant difference between groups a - p cop: anterior - posterior center of pressure; m - l cop: medial - lateral center of pressure . We examined the effects of pilates exercise training on static and dynamic balance in patients with chronic stroke . To our knowledge, this investigation is the first to show improvements in static and dynamic balance following pilates training in this population . One of the important purposes of this study was to determine whether training that had been performed for balance improvement in the elderly could be effectively applied to patients with chronic stroke16, 18, 22, 23, 27, 28 . In this study, the pg demonstrated 26% and 34% improvement in static balance in the a - p and m - l directions, respectively (table 2, p<0.05). The results of this study support the findings of studies conducted on the effects of pilates training in the elderly . In a study by newell et al ., an 8-week pilates training course contributed to a 40% improvement in a - p cop sway in the elderly28 . Further, bird et al . Reported that a 5-week pilates training course led to a 1622% improvement in m - l cop sway (p<0.001) during challenging balance tasks16 . In our study, the improvement in static balance was attributed to the 8-week pilates training course that improved muscle control of the deeper abdominal muscles (i.e., transversus abdominis, lumbar multifidus, and the respiratory and pelvic diaphragms). Conversely, bird et al . Found no significant training effects on balance performance while standing on a firm surface16 . The reason our results differ may be due to the difference in training period and frequency . In the present study, stroke survivors were trained for 3 times / week for 8 weeks, while patients in the study by bird et al . This suggests that there may be a dose response effect that should be verified in future studies . In this study, the pg demonstrated significant improvements (1522%) in dynamic stability in the a - p and m - l directions for both the paretic and nonparetic foot after training (tables 3 and 4, p<0.05). Sator et al . Reported that polyneuropathy patients demonstrated a 20% reduction in cop velocity of the midfoot during walking after a 12-week ankle strengthening program (p<0.05)29 and lim and yoon revealed that the elderly exhibited a 32% decrease in cop sway during obstacle walking as a result of a 12-week underwater training program (p<0.05)30 . It has been reported that in dynamic situations (i.e., walking), cop velocity is directly related to center of mass (com) acceleration, which represents human movement along with cop sway, and that the reduction of cop variables represents increased balance during walking31 . Unlike general pilates training, lower limb strengthening exercises this could help patients increase muscles force production and subsequently improve their dynamic balance . Given that cop variables in the m - l direction are closely related to the risk of falls32, 33, the improvement of cop variables in this direction increases the expectation that pilates training may have an influence on the reduction of fall risk in patients with chronic stroke . To our knowledge, this is the first study using pilates training as an intervention to improve static and dynamic balance in patients with chronic stroke . Despite the documented effects on balance, pilates training has not yet been applied to the rehabilitation of patients with chronic stroke . However, as a result of this study, the 8-week pilates training program has been proven fully effective for the treatment of static and dynamic balance in patients with chronic stroke . However, in using this intervention for the rehabilitation of patients with chronic stroke, careful attention will be needed on several points . First, unlike general muscular strength training or aerobic exercises, maintaining the correct posture is very important in pilates training, and it should only be carried out by qualified instructors supervising a small number of participants per session . In this study, the number of participants in a class was restricted to 811, and the same class was offered 6 times a week so that patients would not be inconvenienced by attending classes 3 days a week . Second, given the previous finding that a 5-week pilates training program for the elderly did not influence balance on firm surfaces15, a minimum of 8-weeks is suggested as a suitable training period . As pilates training for patients with chronic stroke has not been reported, this study could only be compared to studies of pilates training for the elderly . Moreover, this study did not include other variables (e.g., gait parameters or emg activity) that may be used to assess static and dynamic balance improvements after pilates training . Therefore, follow - up studies should be performed to investigate the impact of pilates training on gait parameters or lower limb emg activity related to balance measures . This study proved that an 8-week pilates training program improved the static and dynamic balance of patients with chronic stroke . If pilates training that strengthens the deeper abdominal muscles is sustained for this duration, than these results can be obtained . Therefore, if these training parameters are used in the clinic when it becomes appropriate for the patient, a pilates program can be an effective treatment for the recovery of walking ability, which is the highest objective of rehabilitation for patients with chronic stroke . Given these results, pilates training should be considered as a rehabilitation intervention for balance improvement in patients with chronic stroke.
Whereas the incidence has increased from 1 in 10,000 - 50,000 spontaneous pregnancies, with assisted reproductive technology procedures, the incidence is up to 1%, a 70-fold increased risk . There are several approaches for heterotopic cervical pregnancy management, and generally the purpose of conservative management is fertility preservation: surgical treatments including uterine artery ligation and embolization, foley catheter insertion, and cervical curettage with or without cerclage, while medical treatments include transvaginal potassium chloride (kcl) or methotrexate (mtx) injection . In 1994, frates et al . Reported the first live birth of a heterotopic cervical pregnancy, which was managed with transvaginal ultrasound - guided selective reduction with kcl . Since then, a few more live births from heterotopic cervical pregnancy have been reported . We present the case of a rare event of a heterotopic pregnancy in which it was possible to maintain the intrauterine pregnancy (iup) to term without complications and reviewed the literature to suggest the best treatment for a successful pregnancy outcome . A 36-year - old woman visited our medical center to seek treatment for primary infertility . At her first visit, dilatation and curettage was performed due to a missed abortion that was conceived by the first cycle of ivf - et . In this cycle, a total of seven oocytes were retrieved, five oocytes were fertilized by intracytoplasmic sperm injection, and two embryos were transferred . The initial serum b - hcg level was 191.44 miu / ml 11 days after embryo transfer, and follow - up levels were 1,540 miu / ml and 7,970 miu / ml at 15 days and 18 days after et, respectively . At 4 weeks and 5 days of gestation, an 8 mm gestational sac with a yolk sac was seen in the intrauterine cavity and a 3 mm gestational sac - like shadow was seen in the cervical canal in the first tvs (figure 1a). The patient was hemodynamically stable at the time of presentation (hemoglobin 11.5 g / dl). At 5 weeks+2 days of gestation, follow - up sonography confirmed a heterotopic cervical pregnancy (figure 1b - d). After explaining the treatment options to the patient, she wanted to try to conserve the iup . She decided on transvaginal pregnancy reduction of the cervical pregnancy, accepting the risk of severe bleeding and a potential need for emergency hysterectomy . Selective reduction of the cervically located gestational sac was planned, with readiness for hysterectomy . Careful intracervical gestational sac reduction without harming the endometrial area was carried out with ovum forceps under abdominal ultrasound guidance . The postoperative course was uneventful with a postoperative hemoglobin level of 11.3 g / dl . The patient was discharged on the seventh postoperative day in good health, with an intact iup (figure 2). With regular check - ups, the iup followed without any complications, and an emergency cesarean section was performed at 40 weeks+5 days of gestation due to failure to progress . An uncomplicated birth of a live newborn weighing 3,360 g occurred; the apgar scores were 8 and 9 at 1 and 5 minutes, respectively . Written informed consent was obtained from the patient for publication of this case report and the accompanying images, and this report was approved by the institutional review board of cha gangnam medical center . Heterotopic cervical pregnancy is extremely rare and most cases are associated with assisted reproductive technology . Early diagnosis of heterotopic cervical pregnancy can provide the opportunity for successful conservative management . In general, the aims of a conservative approach are the protection of a coexisting iup, the minimization of blood loss, and fertility preservation . However, there are no specific recommendations for the best treatment of heterotopic cervical pregnancy, and there is no universally accepted treatment modality . Therefore, we reviewed the literature to identify the best treatment of heterotopic cervical pregnancy for a successful pregnancy outcome . Up to the present, a total of 37 cases of heterotopic cervical pregnancy, including the one described here, have been reported in the english language literature . Only four cases of heterotopic cervical pregnancy had been conceived spontaneously and naturally [4 - 7]: the other patients had received infertility treatment . In the 30 cases in which preserving the iup was attempted, the attempt was successful in 25 cases: 24 were live births, but one case was followed up to 12 weeks of gestational age and in 5 cases, intrauterine fetal demise occurred . Among the 24 live births, the cases are classified according to the absence or presence of major obstetric complications in tables 1 and 2, respectively . In 16 cases, the iup was preserved and followed up until birth without any complications (table 1). On the other hand, the iup was preserved with major obstetric complications including placenta accreta, severe bleeding, and subsequent hysterectomy in eight cases (table 2). Different techniques were attempted to eliminate the cervical embryo . Among them, the following factors should be considered . Mtx is an agonist of folic acid that participates in dna synthesis and has the capacity to stop proliferative cell activity . Transvaginal ultrasound - guided intra - amniotic injection of mtx can be successfully used for cervical pregnancy treatment, but the risk of systemic adverse effects, such as thrombocytopenia, leukopenia, elevated serum liver enzymes, and especially the teratogenic effect, should be taken into consideration . However, this technique may result in the radiation of the viable iup, and influence on endometrial receptivity, which could decrease future fertility . Although several cases have been managed by kcl injection, there is a possibility of major bleeding because of the remaining products of conception . If chorionic tissue remains in the cervix, bleeding, cervical mass infection that could cause intrauterine infection, premature rupture of the membrane, and postpartum bleeding can sometimes occur, and placenta accreta remains a risk because of the possibility of chorionic infiltration to the cervix . In this literature review, 58.3% (7 out of 12) of the cases developed serious complications when evacuation was not performed, regardless of the initial procedure, while 91.7% (11 out of 12) whose treatment included complete evacuation of the cervical pregnancy had no major complications . In fact, the complication of the other one case was placenta abruption, which might not have been associated with remnant chorionic tissue in the cervix . We described a case of heterotopic cervical pregnancy that was successfully treated and reviewed the literature . Although a general treatment strategy cannot be suggested because of the small number of cases, complete removal of the cervical conception should be considered for a successful pregnancy outcome.
Despite the increased prevalence of weight concern and weight control practices among teenagers, obesity has been increasing steadily [1, 2]. Females attach much importance on appearance and are preoccupied with their weight from a very young age . On the other hand, males value a muscular physique, which they often associate with health [4, 5]. To achieve their ideal, teenagers engage in weight control behaviours . Teenagers who incorrectly judge their actual body size express a certain degree of body dissatisfaction [9, 10]. Healthy or overweight individuals who perceive themselves as overweight or fat are more likely to engage in weight reduction activities, whereas individuals with an excess body weight who do not perceive themselves overweight will not involve themselves in weight loss behaviours [11, 12]. Teenagers adopt both healthy balanced diet and exercise, but those who are dissatisfied with their body and want to lose weight adopt smoking, use of laxatives, purging, and fasting behaviours [13, 14]. Evidence supports that there is a decline in physical activity levels and consumption of fruits and vegetables and breakfast during adolescence among teenagers who perceive themselves as overweight . Body weight perception is influenced by a number of factors including age, gender, family, peers, media, and ethnicity [16, 17]. Studies reported that even children of eight years old were preoccupied with their body size, and this preoccupation intensified and peaked during adolescence [18, 19]. Females are more inclined to perceive themselves as overweight and engage in undue weight loss practices [12, 20]. While weight reduction is desirable in overweight and obese individual, unnecessary weight loss practices have potentially harmful consequences for adolescents including nutritional deficiencies and growth retardation [22, 23]. Teenagers adopt behaviours and attitudes that prevail among their peers, and pressure to be thin has a negative impact on body weight perception . Media constantly depicts images of slender women and muscular men, and this leads to the acceptance of these figures as social norm and may be predictive of body size overestimation or underestimation . The prevalence of obesity and chronic diseases is well documented by ministry of health and quality of life (mohql). The global school - based student health survey documented health behaviours and protective factors among mauritian teens . However, little data is available on body weight perception and weight control practices among mauritian teens . Given the implications of body weight perception on weight control behaviours, this issue needs to be examined among local teenagers . The aim of the study is to investigate body weight perception among male and female teenagers aged between 13 to 18 years of age using the conceptual framework adapted from wang et al . . The objectives of the study are to investigate the relationship of actual body weight status and body weight perception among teenagers and to document the impact of body weight perception and weight control practices among teenagers . The study is a questionnaire - based survey carried out among a sample of 180 teenagers (90 boys and 90 girls) aged between 13 to 18 years old . Participants were all mauritians and healthy (i.e., not suffering from any known diseases). The questionnaires were distributed to participants, and they were requested to complete the questionnaire before undertaking anthropometric measurements . Anthropometric measurements included weight and height and were measured as described by tiwari and sankhala . The same scale and metre rule were used to measure weight and height, respectively, for all participants . Weight was taken to the nearest 0.5 kg (standard error 0.5 kg). Height was assessed to nearest 0.01 m (standard error 0.01 m). Each respondent was assigned a weight status based on their age, gender, and calculated bmi score . Weight status was defined as per cdc growth chart (bmi <5th percentile: underweight; bmi 5th and <85th percentile: normal weight; bmi 85th and <95th percentile: overweight; and bmi 95th percentile: obese) [30, 31]. However, in this study due to the small number of overweight and obese teenagers, all those having a bmi 85th percentile were classified as overweight . Body weight perception question was adapted from brener et al ., and it was measured with the question how do you describe yourself? And the following response set was available: underweight, normal weight, overweight, and very overweight or obese . For analytical purposes, overweight and very overweight or weight control referred to any current change or changes made during the past 3 months to eating habits, physical activity, or any other behaviour in an attempt to lose or gain weight . It was assessed with the yes - no question, for example, are you trying to control your weight? And what are you trying to do about your weight? . Lose weight and gain weight were the choices provided to the latter question . Questions and methods on weight control practices were adapted from the studies of yost et al . And wardle et al . . The list for weight control practices included exercise; reducing fat consumption; reducing number of snacks eaten in between meal; increasing fruits and vegetable consumption; consuming a balanced diet; reducing the amount of food eaten at meal time; skipping meal and fasting . Whole fruits (apple / pear, orange, kiwi, banana) of different sizes (small, medium, big) and measuring cups were shown to the students to assist them in estimating the amount of fruits and vegetables they ate . The minimum recommended intake of 5 servings of fruits and vegetables as suggested by 2005 dietary guidelines for americans was taken as meeting the recommendation for fruits and vegetables . Questions from the global health school - based survey were used to measure physical activity level . The frequency and duration were multiplied to give the total number of hours of physical activity per week . A student whose total of hours of physical activity per week was 7 hours or more was classified as meeting the recommended level of physical activity per day . Equal number of boys and girls (90 boys and 90 girls) participated in the study . The average age of the participant was 16 years . Based on body mass index (bmi) (table 1), 16.6% was underweight (10.0% in boys versus 23.3% in girls); 11.7% were overweight (16.7% in boys versus 4.4% in girls; and the rest of the participants (71.7%) were of normal weight (73.3% in boys versus 70.0% in girls). Less than half (42.2%) (table 1) of the students surveyed correctly perceived their weight . Body weight overestimation was reported by 61.1% of the girls and 14.4% of boys . Among participants with a normal or underweight bmi normal weight and underweight girls had a more inaccurate self - evaluation of their current weight status with 58.3% of them finding themselves to be overweight compared to 10.7% of normal weight and underweight boys . There was substantial gender difference in body weight perception (bwp) (chi - test value = 2.8 10). Half of the surveyed population were engaged in weight control practices: 43.3% of the respondents reported trying to lose weight while 6.7% reported that they were engaged in weight gain activities . More than twice as many girls participants (61.1%) were involved in weight loss practices compared to boys (25.6%). Based on bmi (table 2), 80.8% of those who were involved in weight loss behaviours had a bmi <85th percentile (47.8% boys versus 94.5% girls). There was a considerable correlation between body weight perception and weight control activities such that 88.5% of those involved in weight loss behaviours overestimate their body weight . Body weight perception is a strong determinant of weight control practices (chi test value3.1 10). The result of the study showed that appearance and health were the two most cited weight concerns (55.6% respondents reported appearance and 43.3% reported health). No gender difference was observed in weight concern (chi - test value = 0.17). The most commonly cited methods by all the respondents were reducing fat consumption (84.7%); exercise (80.8%); increasing fruit and vegetable consumption (66.7%); reducing the amount of food eaten at meal times (59.0%); reducing the quantity of snacks consumed between meals (48.8%) and having a balanced diet (32.1%). Skipping meal (11.5%) and fasting (5.1%) however, only 4.8% of those who reported having recourse to exercise to lose weight were achieving the recommended daily one hour of physical activity; and 3.5% of those who reported increasing fruits and vegetables were actually meeting the minimum 3 servings of vegetables and 2 servings of fruits per day . No gender difference was observed in the type of weight loss and the use of healthy and unhealthy methods to lose weight . The current study reveals that media (62%) was the major source of information for this purpose followed by parents (24%) and peers (14%). Only 3.8% of the respondents (8.7% in boys versus 1.8% in girls) who reported trying to lose weight were meeting the daily one hour of physical activity . Results of the study show that in general intake of fruits and vegetables was low . A meagre 1.7% of the population sampled were consuming 5 servings of fruits and vegetables every day . The purpose of the study was to investigate body weight perception and weight control practices among teenagers, and the outcome of the study supports the general trend that exists . Many more females overestimated their body weight and were engaged in weight loss activities than males . Studies demonstrated that body weight perception tends to be inaccurate when compared to bmi [12, 13]. Consistent with other studies, the outcome of this survey indicated that body weight exaggeration was more prevalent in girls than boys . The outcome of the survey indicated a similar trend . Among the students who were involved in weight control, the prevalence of weight - loss practices was higher among girls (61.1% girls versus 25.6% boys). Studies reported that body weight perception is a strong determinant factor in weight control rather than actual bmi [3, 5, 7, 8, 36]. The findings of this study corroborate with earlier reports . A large proportion (88.5%) of teenagers engaged in weight reduction activities perceived themselves as overweight even though only 19.2% of them actually have a bmi above the 85th percentile on the growth chart . Research evidence support that female adolescents are more likely to diet and engage in unhealthy weight - loss behaviours more frequently than males . However, in the current study, both male and female teenagers were equally likely to use food manipulation and adopt healthy and unhealthy methods for weight control . Lowry et al . Documented that high school adolescents exercised and reduced intake of fat and ate fruits and vegetables to lose weight . The 3 most commonly adopted behaviours to lose weight were reduction of intake of fat (84.6%), exercise (80.8%), and consuming fruits and vegetables (66.7%). Reducing amount of food eaten at meal times was reported by more than half of the boys and girls (52.2% boys and 61.8% boys). Skipping meal and fasting as weight loss strategies were reported by 11.5% and 5.1%, respectively, and these numbers are lower than those reported by lowry et al . . . Documented that those adolescents who reported trying to lose weight did not have higher physical activity level or fruit and vegetable intake than others . Although the aim of the study was not to assess the association between individual's reported tendencies of weight loss and practices as well as physical activity level and fruits and vegetables intake, it was observed that those who reported exercising were relatively inactive and were not meeting the international recommendations for fruits and vegetables, respectively . This is, agreement with nowak who reported that there is no difference in exercise frequency between australian adolescents who were trying to lose weight and those who were not . Results herein indicate a similar pattern with an overall response rate of 6.1% meeting the international recommendations for physical activity . There was no difference in physical activity level between weight - loss and nonweight - loss students . In fact, 14.5% of weight loss girls did not exercise at all, and this is possible due to body dissatisfaction that hinders participation in physical activity [39, 40]. The majority of weight loss teens (95.8%) expressed some body dissatisfaction in that they perceived themselves overweight, and this could partly explain their poor engagement in physical activity . Similar to other adolescents' population [5, 41], the students in the current study had low fruit and vegetable intake . There was no difference in consumption pattern of fruits and vegetables between those who reported trying to lose weight and others . Only 2.6% of the weight - loss students met the minimum recommended 5 servings of fruit and vegetable per day . Statistics in the us showed that 1137% of school children and adolescents did not have breakfast regularly . The current study demonstrated a similar scenario as no difference was observed in breakfast consumption between weight - loss and nonweight - loss adolescents . The findings of the study demonstrated that body weight perception was poorly associated with bmi among mauritian teenagers . Gender difference was observed in body weight perception with many more female adolescents overestimating their body size . Teenagers who perceived themselves as overweight engaged in weight reducing activities and exercise and reducing fat intake which were the two most commonly reported methods for weightloss in both genders . In light of the high prevalence of body weight misperception existing among the teenagers and the fact that body weight perception motivated weight control behaviours, promotion of healthy body image perception and healthy eating by schools and health organisations is important . Since media holds an important place in influencing body weight perception, media can be used to vehicle healthful messages . One major limitation in this study is sample size which may not be representative of all teenagers . Future studies should consider the latter as it influences body image and weight control practices.
Obesity is a major cause of morbidity in canada and in many parts of the world and it is increasing worldwide . As indicated by a body mass index (bmi) greater than or equal to 30 kg / m, obesity is a risk factor for cardiovascular disease, type 2 diabetes, several types of cancer, asthma, gallbladder disease, osteoarthritis, and chronic back pain [1, 2]. Class ii+ obesity (bmi 35 kg / m) is also associated with an increased risk of all - cause mortality . Obesity and its associated comorbidities exact a heavy toll on health care systems and expenditures . In canada, the 2006 direct medical cost of overweight and obesity was $6.0 billion . Against a global background comprising of 500 million obese adults, obesity has reached a historic high in canada with one - quarter of adults and 9% of children meeting the definition . Federal government statistical agencies, such as statistics canada and the national center for health statistics, use large population - based studies to track nationwide obesity trends . Researchers usually use the bmi as a proxy to gauge obesity in these large national studies . According to health canada, although the bmi is not a direct measure of an individual's body fat, it is the most useful indicator of the health risks associated with under and overweight at a population level . In addition to using the bmi despite its limitations, large - scale research must rely heavily on self - reported obesity estimates, due to economic and logistical constraints, even though these estimates are distorted by reporting bias and error [7, 8]. As a result of the bias and error, self - reported values underestimate the prevalence of obesity and, consequently, overestimate associations between excess body fat and chronic diseases [79]. Accurate obesity prevalence data are not only needed by public health planners and policy makers, but also by those who conduct obesity research . As direct bmi measurements, which are the gold standard for bmi data, are an expensive method of data collection, researchers have recently developed and recommended the use of correction equations based on measured data to correct self - reported values [7, 1015]. It has been established that correction equations can vary with time and they are survey- and population specific . For example, bias and error between self - reported bmi and physical measurements rise with increasing body weight . Therefore, although connor gorber and colleagues [7, 15] generated correction equations in 2008 for canadians in general and reassessed them in 2011, given that they are population - specific, they may not hold in atypical regions of canada such as atlantic canada, which has unique sociodemographic characteristics and the highest obesity rates in the country . The purpose of this study was to determine whether correction equations developed for the canadian population were appropriate for use in atlantic canada and to compare the accuracy of the national equations to equations that were developed specifically for the atlantic canadian population . This study involved a secondary data analysis of a large national representative survey, specifically the canadian community health survey (cchs) 2007 - 2008, to answer the following main research question: how well do the national correction equations correct self - reported estimates of obesity in atlantic canada and is there a significant difference between atlantic canadian and national correction equations in yielding corrected obesity estimates that are closer to measured data, as compared to self - reported values? The study was approved by the interdisciplinary committee on ethics in human research at memorial university . Furthermore, study approval was obtained from statistics canada and the social sciences and humanities research council of canada (sshrc). The cchs collects data on health status, health care utilization, and health determinants for the canadian population . Details of the 2007 - 2008 cchs are published elsewhere [17, 18]. The target population of the 2007 - 2008 cchs was persons aged 12 years and over living in private dwellings in all provinces and territories . The survey excludes persons living on aboriginal reserves and settlements or in institutions, full - time members of the canadian forces, and residents of certain remote regions . The 2007 - 2008 cchs had three sampling frames to select the sample of households: 49% of the sample of households came from an area frame, 50% were from a list frame of telephone numbers, and 1% came from a random digit dialing sampling frame . The national response rate for the cchs 2007 - 2008 cycle was 78% in 2007 and 75% in 2008, with a total of 131,959 canadian respondents and 17,126 atlantic respondents . Weight (mhw) data were collected in 2008 by trained interviewers with calibrated equipment for a subsample of about 5,000 canadians . In the atlantic canadian region, the provincial response rates for the mhw subsample ranged from 84% to 90% at the household level and from 51% to 67% for the direct measurement component, yielding overall response rates between 45% and 60% . The mhw subsample size for the current study was 318 atlantic canadian adults . To minimize nonresponse bias, statistics canada created a sampling weight by redistributing the sampling weights of nonrespondents to respondents using response propensity classes . The data analyses included all 2007 - 2008 cchs atlantic canadian respondents, with the exception of pregnant and breastfeeding women and children under the age of 18 because the bmi is not intended for use with these groups . Outliers, with differences between their self - reported and measured bmis that were more than three standard deviations from the mean, were also excluded from the analyses . Descriptive analyses were conducted to describe the sociodemographic characteristics of the atlantic canadian population, as compared to the rest of canada . Using the correction method employed by connor gorber et al ., atlantic correction equations were developed in the mhw subsample . Multiple regression models were used to predict bmi using the self - reported counterpart as the independent variable . No other independent variables (e.g., age) were utilized, as it was previously shown that gains in predictive value were minimal for the canadian population . Self - reported bmi was corrected by multiplying the self - reported estimate by its corresponding model coefficient and adding the model intercept . The correction model, namely, bmimeasured = b0 + b1(bmiself - reported) + error, employed in this study was equivalent to that of connor gorber and colleagues' model 4 . Bmi estimates were derived with 95% confidence intervals (ci) and exact variance estimates were computed using bootstrap methods . Since bias in bmi is known to differ by sex, all data analyses were run for males and females separately . We used the following health canada bmi categories: underweight, bmi <18.5; normal weight, bmi = 18.524.9; overweight, bmi = 25.029.9; obese, bmi 30 . However, due to limited sample sizes, the underweight and normal weight categories were combined . Statistics canada's guidelines for tabulation, analysis, and release were followed [17, 18]. For instance, statistics canada mandates that cells computed from fewer than 10 respondents are suppressed and estimates computed from 10 or more respondents with a coefficient of variation (cv) between 16.6% and 33.3% are released with caution, while cvs greater than 33.3% are suppressed [17, 18]. All data analyses were conducted at the atlantic research data centre (ardc) at dalhousie university using sas 9.2 statistical software (sas institute inc ., cary, nc, usa). Table 1 shows the sociodemographic characteristics of the 2007 - 2008 cchs respondents from atlantic canada as compared to those from other regions of canada . In atlantic canada, there were more females and full - time workers (p <.01). Also, atlantic respondents were significantly less educated and had lower household incomes than other canadians (p <.0001). Among the 2007 - 2008 cchs respondents, residents of atlantic canada were more than twice as likely to live in a rural area . Besides being slightly older (mean age = 44.6 years, 95% ci 44.544.7 versus 43.2 years, 95% ci 43.243.3), atlantic canadians also differed significantly from their canadian counterparts in terms of ethnicity and immigrant status . Most of those from the atlantic region were white (92.2%) and canadian - born (95.3%), compared to about three - quarters of canadians (p <.0001). The correction equations for the atlantic region were males: bmi (corrected) = 1.36 + 1.09bmi (reported) females: bmi (corrected) = 1.71 + .98bmi (reported). Males: bmi (corrected) = 1.36 + 1.09bmi (reported) females: bmi (corrected) = 1.71 + .98bmi (reported). Table 2 displays information on the direction and magnitude of bias and error in self - reported bmi for both sexes in atlantic canada . A negative difference between self - reported and measured bmi indicates underreporting, whereas a positive difference indicates overreporting . Mean bmi values based on self - reported height and weight data were significantly lower (p <.0001) than those based on measurements for both sexes . However, male and female corrected bmi means obtained from both the national and atlantic - specific correction methods were not significantly different from their equivalent measured means . Men and women equally underreported their bmi by 1.4 kg / m on average . The corrected bmi means were only 0.1 - 0.2 kg / m and 0.3 as presented in table 3, the degree of misreporting varied by bmi category . With each categorical increase in bmi, therefore, underestimation of bmi was the highest among obese individuals, with obese men under - reporting their bmi by 2.6 kg / m on average and obese women under - reporting their bmi by an average of 3.1 kg / m . Table 3 also provides information on the performance of the national and the atlantic correction equations across the different bmi categories . For both equations, among men who were underweight or normal weight, both self - reported and corrected bmi means were not significantly different than their measured counterpart . Among women who were underweight or normal weight, the self - reported bmi mean was not significantly different from the measured mean, but this was not the case for either corrected mean . With respect to overweight or obese men and women, the corrected bmi means were more accurate (i.e., closer to the corresponding measured mean) than the comparable means calculated from self - reported data . Indeed, for overweight men and women, the corrected bmi means were significantly better than the equivalent self - reported means and they were identical or nearly identical to the bmi means based on measurements . While recognizing their deficiencies, researchers use self - reported bmi data out of necessity in large surveys, such as the cchs in canada and the national health interview survey in the united states . Initial attempts to correct bmi values based on self - report led plankey et al . To publicize in 1997 that prediction equations do not eliminate systematic error in self - reported bmi data . Although corrected estimates are not usually identical to direct measurements, in recent years, bmi correction equations have been more successful at bridging the gap between self - reported numbers and measurements [7, 915]. The recent success of correction equations may be partly due to the changing nature of the reporting bias / error itself . Since the dawn of correction equations, reporting bias and error have doubled in canada, which improves the odds of having corrected bmi values that are significantly closer to physical measurements than their corresponding self - reported figures [7, 16]. The latest correction equations show great promise, notwithstanding some caveats for their use . As reporting bias and error can vary from one population to the next and they may not be stable over time, correction equations need to be developed specifically for a particular population and monitored periodically . In addition, as observed in this and another canadian study, while the equations bring self - reported overweight and obesity estimates closer to measured values, which is important in this line of research [7, 8, 23], it should be noted that this process skews the underweight and normal weight data . Atlantic canada holds the unfavourable distinction of having the highest obesity rates in the country . Moreover, the results of our present analysis comparing atlantic canada with the rest of the nation on a number of sociodemographic characteristics demonstrate that atlantic canadians are distinct from other canadians in several respects . Given that correction equations are population specific, we compared the national equations with the ones we developed specifically for this unique region of canada . Both correction equations significantly improved the accuracy of self - reported atlantic canadian obesity data . The results of the current study suggest that the national equations, which are starting to be used elsewhere in the country, are generalizable even to atypical regions of canada . The success of the correction equations used herein also corroborates current assertions by international researchers [7, 1015] that these equations provide better obesity estimates than those based on self - report . In keeping with other studies [716, 2224], mean bmi based on self - reported height and weight data was significantly lower than mean bmi based on measurements . In the current study, most of the research in this area demonstrated that the trend of under - reporting was slightly more pronounced among women [7, 8, 10, 11, 1316, 2224]. In sharp contrast, jain found that under - reporting of obesity prevalence in the united states was 0.7% lower in females than in males . Perhaps the context of the survey used by jain (i.e., the national health and nutrition examination survey (nhanes)) played a role in the anomalous finding . As pointed out in a recent publication, bias in self - reported bmi depends on survey context, such as whether or not respondents know they will be measured when they report their weight and height . In the nhanes, at the time of self - reported weight and height, respondents are aware that they will later be measured, which is not the case for the cchs . In the current study, other researchers [7, 9, 10, 1214, 2224] documented similar results . In a canadian national study, this relationship was only observed outside of the underweight category for men and women alike . Among those who were underweight, bmi was overestimated by males, but there was no significant difference between self - reported and measured bmi for females . Corresponding results were found among american college students . In the current study, we merged the underweight and normal weight bmi categories due to small sample sizes notwithstanding this difference, we observed no significant difference between self - reported and measured bmi for males and females in the underweight and normal weight category . Canadian regional statistics on levels of obesity are normally derived from self - report questionnaires on account of sample size limitations for measured data . Our measured bmi results suggest that obesity may be at a record level in this region of the country . The data analysis revealed a measured mean bmi of 29.1 kg / m (95% ci 28.030.1) for men and 27.7 kg / m (95% ci 26.628.9) for women in the atlantic region in 2008 . According to an analysis of canadian health measures survey data, the measured mean bmi for canadian men was 27.5 kg / m (95% ci 27.127.9) and it was 26.6 kg / m (95% ci 25.927.4) for canadian women from 2007 to 2009 . Second, this study is innovative in that it equips researchers with data supporting the utilization of the national correction equations throughout the atlantic region in the absence of measured data . The national equations could be used in future analyses of self - reported bmi data from the cchs in any or all of the four atlantic provinces . Bearing in mind the considerable attention drawn to the issue of obesity by health authorities and researchers in the region, future research using obesity estimates lies ahead . As it currently stands, a cursory search of pubmed, using the search terms obesity and since obesity prevalence data are the foundation of some other obesity - related research analyses, the accuracy of prevalence data is essential . The application of the national correction equations should strengthen research conducted with self - reported atlantic canadian obesity data ., we could not maintain separate bmi categories for those who were underweight and those who were of normal weight, which precluded a more refined analysis for these groups . Ideally, we would have had a larger subsample size to compute the correction equations for the atlantic region . However, we used the best data and the largest subsample size available . Furthermore, the regression models used to compute the correction equations for both sexes were highly significant (f(1, 188) = 1185.8, p <.0001 and f(1, 108) = 593.0, p <.0001 for females and males, respectively) and the cv for the estimate from either model was less than 7.0, indicating that the level of precision was well within acceptable limits . In atlantic canada, the provincial overall response rates for the mhw subsample were between 45% and 60%, but this was similar to the response rate for the mhw subsample for the rest of the country . Although a sampling weight created by statistics canada was used to adjust for differential participation rates, if the characteristics of non - respondents, such as mean bmi, were significantly different than respondents, then non - response bias may have tainted the study . An additional study limitation involved the measurement of height and weight . Trained interviewers and calibrated equipment were used to collect the data, but we cannot exclude significant measurement error as intra- and interrater reliability were not evaluated . Also, although the bmi is frequently used to measure adiposity at the population level, there are well - documented limitations of the bmi as a tool to quantify body fat . Furthermore, shields and colleagues [7, 9, 15] caution against the indiscriminate use of correction equations because they can change over time and they are dependent upon the population and survey context . For the particular correction method used in this study, sensitivity values are reduced for the normal weight population . In other words, while postcorrection percentages provide a more accurate estimation of overweight and obesity, the precorrection percentages are a better estimation of normal weight because the reporting bias and error are lower in this bmi category . This study provides some evidence of the generalizability of the national correction equations to atypical regions of canada . Also, the results of this study add to a small, but accumulating body of research supporting the efficacy of bmi correction equations . In light of reports that self - reported bmi statistics underestimate the prevalence of obesity and overestimate associations between obesity and chronic diseases [7, 8, 23], we strongly recommend the use of correction equations to other researchers analysing obesity data collected by self - report . In particular, given the nature of bmi correction equations, we recommend that canadian researchers use the national correction equations in the absence of measured data or compute their own correction equations if they have measured and self - reported obesity data.
The main structures related to human memory are the papez circuit, the basolateral limbic circuit, and the basal forebrain, which communicate with each other through white - matter tracts . Damage to these structures (including the communication tracts) from hemorrhages, infarctions, and tumors can result in memory disturbances.1,2 in addition to these structures, valenstein et al . Suggested that the retrosplenium could be a supplementary pathway of the limbic system connecting the anterior thalamus and medial temporal lobe structures.3 the retrosplenium is located in the posterior cingulate cortex surrounding the splenium, and is a cytoarchitecturally distinct structure forming brodmann areas 29 and 304 (fig . We report on a patient who developed both verbal and visual memory deficits after an acute infarction of the retrosplenial cortex . A 57-year - old right - handed man who had suffered from diabetes mellitus for 10 years was admitted to an emergency room due to acute memory loss . One month prior to admission he was diagnosed with syphilis and began treatment with penicillin g. on the day of his symptom onset, his daughter noted that he asked repeatedly over the phone about an appointment time for a clinic visit . After the conversation, he asked his daughter what day of the week it was . Two days later, accompanied by his daughter, he went to the hospital in order to receive treatment for syphilis, but he did not know why he was there or where he was . Therefore, he was transferred to the emergency room for further evaluation . On initial evaluation at the emergency room, his blood pressure was 103/63 mmhg and his heart rate was 75 beats / min and regular . His score on the initial mini - mental state examination (mmse) was 22/30 (memory registration, 3/3; memory recall, 0/3; orientation to time, 4/5; orientation to place, 3/5; calculation and concentration, 4/5; and reading, 0/1). The visual fields of both eyes were constricted due to a previous panretinal photocoagulation procedure for diabetic retinopathy, but all the other cranial nerve examinations were normal . A cerebrospinal fluid (csf) analysis showed a normal wbc count (2 /ml) and mild elevated protein (81.5 mg / ml). In addition, the csf / serum glucose ratio was 0.474 and the csf vdrl test was negative . The memory of the patient began to improve on the second day of hospitalization, but he could not remember his home address and phone number . He underwent a formal neuropsychological test four days after the onset of symptoms (table 1), at which time the score on the mmse was 27/30 (memory registration, 3/3; memory recall, 1/3; and calculation and concentration, 4/5). On the rey auditory verbal learning test (avlt), the score for free recall was 13 (3.75%ile of age - matched control subjects) and that for 20 min delayed recalls was 0 (0.04%ile). The scores for immediate and delayed recalls were 2/36 (3.07%ile) and 3/36 (1.07%ile), respectively . On recognition of the rey copying test, there were four true positives and one false positive . Five days later, his memory appeared to have recovered considerably, but he still could not remember his home address . Brain mri (3.0-tesla device, philips) was performed two days after the onset of symptoms . Diffusion - weighted and sagittal t2-weighted mri images (fig . 2-a and 2-b) revealed a high - signal - intensity lesion in the left splenium and retrosplenium that appeared as a low - intensity signal on the apparent diffusion coefficient (adc) map of b 1000 values . In addition, there was a point lesion in the center of the thalamus and small scattered lesions in the area supplied by the left posterior cerebral artery (pca) (fig . 3). On magnetic resonance angiography (mra) images, there was an occlusion in the p2 portion of the left pca (fig . The blood flow to the pca region was delayed slightly based on the images of the time - to - peak (ttp) maps (fig . After discharge, the patient demonstrated a marked improvement in both his visual and verbal memory impairments and did not complain of any cognitive dysfunctions . Repeated neuropsychological tests - which demonstrated impairment at the time of admission - at two months after symptom onset demonstrated improvement on the rey avlt and a near - normal recall score on the rey - osterrieth complex figure test (table 1). Figure 2-a shows that the cerebral infarction was restricted to the left splenium with a little area of the retrosplenium . We considered that the amnesia of our patient was due to the retrosplenial lesion, because memory - related structures other than the retrosplenium were intact . Although the mild perfusion delay to the left pca territory might have contributed to his amnesia, there were no significant changes in the relative cerebral blood volume and cerebral blood flow compared with the corresponding contralateral regions (fig . However, we could not exclude the possibility of other small infarctions being present in the areas related to the memory function because we did observe point lesions in the left central thalamus and left pca territory . In contrast, there are reported cases of a single right retrosplenial lesion causing both visual and verbal memory deficits.5 there is strong evidence that the right medial temporal lobe is involved in navigation, and it now appears that input of the hippocampus and related structures receive from and convey to the right retrosplenial cortex has a similar spatial preference, while the left medial temporal and left retrosplenial cortices appear primarily concerned with more - general aspects of episodic memory.3,4,6 however, there are recent studies that can explain the presence of both visual and verbal amnesias in our case . Most functional neuroimaging studies have shown that navigation or orientation in a large - scale space activate the retrosplenial cortex, usually bilaterally.4 in addition, some functional mri studies have shown that during episodic memory, bilateral retrosplenial areas were activated.7 although there is a tendency for predominance, each retrosplenium must be involved in both visual and verbal memories . Although bilateral retrosplenial lesions tend to have a poor prognosis, retrosplenial amnesia generally recovers rapidly.4,8 each retrosplenium receives major inputs from the contralateral retrosplenium, the orbital and dorsolateral prefrontal cortex, the anterior cingulate cortex, parahippocampal cortex, superior temporal sulcus, precuneus, claustrum, and the anterior and lateral thalamic nuclei.9 therefore, a good prognosis may be partly due to functional substitution of the counterpart retrosplenium or other parts of the cerebrum . In addition, the prognosis may be influenced by the location of the retrosplenial lesion . Saito, et al.1 reported a case of transient global amnesia (tga) resulting from a retrosplenial infarction at a similar location to that in our case . However, in the case of yasuda, et al.,5 which showed a poor prognosis, the lesion encroached the retrosplenium more posteriorly, although the size and location of the cerebral infarction were similar to those in our case . In contrast, takahashi, et al.6 reported three cases of retrosplenial lesions that extended even to the inferior precuneus, all of which showed a good prognosis . Therefore, specific areas in the retrosplenium may critically affect the prognosis, and these could be elucidated by further functional neuroimaging, which would improve our understanding of the function of the retrosplenium.
Asthma is a chronic inflammatory disease of the lower airways and is among the most common chronic conditions, affecting children and adults . It is characterized by increased airway responsiveness to a variety of stimuli, resulting in airflow obstruction that is typically recurrent and reversible . Asthma treatment and its duration play a role in the severity of the aforementioned clinical manifestations (i.e., the severity of asthma). The more severe the clinical manifestations of asthma, the greater the difficulty in managing the disease . A history of wheezing has been reported in 46.6% of the children living in the city of salvador, brazil, as has a trend toward an increase in the rate of physician - diagnosed asthma among children and adolescents in brazil . In 2003, the programa de controle da asma e da rinite alrgica na bahia (proar, bahia state program for the control of asthma and allergic rhinitis) was created . The proar is a multidisciplinary education, research, and treatment program integrating the sistema nico de sade (sus, brazilian unified health care system) and the federal university of bahia, located in the city of salvador . The proar focuses on preventing and treating asthma and allergic rhinitis; providing free medication regularly; reducing hospitalizations, emergency room visits, and mortality; and improving quality of life (qol). The information obtained by assessing the qol of patients treated at a given health care facility can inform decisions regarding the choice of procedures and treatments for achieving optimal patient health ., qol assessment is relevant to clinical practice because treatment planning and progression are focused on the patient rather than on the disease . They also state that a holistic approach is required in order to assess qol, which should not be seen purely in terms of treatment outcome . The asthma quality of life questionnaire (aqlq) is a disease - specific instrument that was developed in 1992 specifically for use in clinical studies . The aqlq comprises domains assessing multiple aspects of the daily life of asthma patients and assesses their physical and emotional status, thus allowing assessment of the subjective experience of asthma . The use of inhaler devices in the pharmacotherapy of asthma requires patient education on inhaler technique and handling . Optimal inhaler use increases lung drug deposition and, consequently, treatment efficacy, resulting in asthma control, which is important for a better qol . The level of patient satisfaction with their inhaler device has been found to have a positive influence on patient - reported outcomes in asthma, resulting in fewer emergency room visits, fewer nocturnal exacerbations, and improved qol . Questionnaires have been developed in order to assess the level of asthma control, and studies have assessed the correlation between asthma control and qol . The asthma control questionnaire (acq) is an instrument that can be used in clinical practice, clinical trials, and cross - sectional studies, acq scores correlating well with aqlq scores . Severe asthma has been associated with numerous comorbidities that are related to poor asthma control, increased use of the health care system, and reduced qol, the management of which has been reported to have a positive impact on asthma outcomes . Comorbidities are common and include allergic rhinitis, obesity, osteoporosis, gastroesophageal reflux disease, tuberculosis, hypertension, and diabetes . The risk of drug interactions and adverse drug reactions increases exponentially with the number of drugs used . Iatrogenic complications can lead to the addition of other medications, polypharmacy therefore being a public health problem that has a negative impact on patient qol . In bahia, patients with severe asthma have access to a program that provides treatment with inhaled corticosteroids (ics) and bronchodilators, as well as asthma education and guidance on the use of inhalers . However, given the complexity of the pharmacological treatment of severe asthma and the clinical manifestations of the underlying disease, asthma management involves more than disease control and access to drugs . In the context of pharmaceutical care, few studies have examined the impact of pharmacotherapy on the qol of patients with severe asthma . Given the importance of this issue, the objective of the present study was to identify and characterize factors associated with qol in patients with severe asthma treated at a referral center in the city of salvador, as well as to determine the association of qol - related factors with aqlq scores (overall and individual domain scores). This was a cross - sectional study to assess the qol of patients with severe asthma . The data were collected from the database of a randomized controlled clinical trial conducted at an sus asthma outpatient clinic, where the proar is headquartered . The study population consisted of patients 18 years of age or older treated at the proar outpatient clinic and presenting with severe asthma, refractory asthma, or uncontrolled asthma (or meeting clinical criteria for severe asthma); receiving drugs regularly from the proar pharmacy; using polypharmacy, high - dose ics, or both; presenting with comorbidities; and having an fev1 60% of predicted . At a single time point, qol was assessed with the aqlq, which was administered by three previously trained pharmacists . The aqlq is a disease - specific questionnaire consisting of 32 items grouped into four domains: activity limitation (11 items); symptoms (12 items); emotional function (5 items); and environmental stimuli (4 items) the overall aqlq score is the arithmetic mean of all items, the minimum score being 1 (extremely low qol) and the maximum score being 7 (excellent qol). The level of asthma control was assessed with the acq, which was administered at the same time point as was the aqlq . The acq consists of seven questions: five questions regarding symptoms; one question regarding the use of short - acting 2 agonists; and one question regarding fev1 . All items have the same weight, and the level of asthma control is given by the arithmetic mean of all items, ranging from zero (well - controlled asthma) to six (severely uncontrolled asthma). The following data were collected from the aforementioned database: sociodemographic data (gender, age, level of education, race, and occupation); clinical data (history of smoking, history of pulmonary tuberculosis, presence of other respiratory diseases, diagnosis of refractory asthma, bmi, presence of comorbidities, percent predicted fev1, and acq scores); clinical data on pharmacotherapy (starting dose of ics, types of inhalers, number of inhalers, and number of drugs used); and qol data (aqlq scores). Given that the aqlq was administered at a single time point, a cut - off score of 4 (moderate qol) was used as reference . Scores> 4 were considered to indicate moderate - to - excellent qol, whereas scores 4 were considered to indicate moderate - to - poor qol . For the acq scores 1.5 were considered to indicate controlled asthma, whereas scores> 1.5 were considered to indicate uncontrolled asthma . High - dose ic use was defined as the use of more than 800 g of budesonide or equivalent . Descriptive statistics were calculated for sociodemographic, clinical, qol, and pharmacotherapy variables . The kolmogorov - smirnov test was used in order to determine whether quantitative variables were normally distributed . Variables with normal distribution were summarized as means, whereas those with non - normal distribution were summarized as medians . For variables with normal distribution, the student's t - test was used in order to assess significant differences between comparison groups . For variables with non - normal distribution, the value of p was derived from those two tests, in accordance with the characteristics of the study variables . The variables of interest were dichotomized as follows: gender (male / female); age (<60 years/ 60 years); number of inhalers used in combination (2 inhalers/> 2 inhalers); ic dose (800 g/> 800 g); polytherapy (yes / no); level of asthma control (acq 1.5/acq> 1.5); number of comorbidities (5 comorbidities/> 5 comorbidities); overall aqlq score and individual aqlq domain scores (4 /> 4). The odds ratios (ors) for the associations of the study variables with the overall aqlq score and those of its domains were thus estimated . Finally, the factors associated with qol in the study sample were identified and characterized, and their association with the overall aqlq score and individual aqlq domain scores was determined . Independent variables were associated with better qol when 0 <or <1, being associated with worse qol when or> an or of 1 indicated that there was no association between a given independent variable and qol . The present study was approved by the research ethics committee of the federal university of bahia professor edgard santos university hospital (caae 128/2008), in the city of salvador . Statistical analysis was performed with the statistical package for the social sciences, version 14.0 (spss inc ., of the 50 patients whose data were available in our database, 49 (98%) were evaluated in the present study, 1 (2%) being excluded from the analysis because of missing data . Table 1sociodemographic and clinical characteristics of 49 patients with severe or refractory asthma treated at a brazilian unified health care system asthma outpatient clinic in the city salvador, brazil . Characteristicresultage, years53.6 13.4genderfemale41 (84)male8 (16)raceblack22 (45)mulatto7 (14)white7 (14)other6 (13)no data7 (14)occupationhomemaker18 (37)workers in the commercial sector3 (6)legal assistant7 (14)retired10 (20)seamstress2 (4)housekeeper2 (4)unemployed1 (2)other6 (14)level of educationilliterate2 (4)9 years of schooling28 (57)high school12 (25)college7 (14)history of smokingyes19 (38)no30 (62)history of pulmonary tuberculosisyes12 (25)no37 (76)refractory asthmayes10 (20)no39 (80)obesityyes14 (29)no35 (71)fev1,% of predicted47.6 15.8avalues expressed as n (%). Or as mean sd . Table 2descriptive statistics for the independent variables associated with pharmacotherapy in patients with severe asthma treated at an asthma referral center in the city of salvador, brazil . Variableresultacq score 2.73 1.37number of comorbidities 4 (2 - 8)inhaled corticosteroid dose, g 1,600 (800 - 1,800)combined use of inhaler devices (dpi + mdi)19 (39)aerolizer used as the primary treatment for asthma28 (57)mdi used as an add - on device30 (61)concomitant use of at least 5 drugs31 (62)acq: asthma control questionnaire; dpi: dry powder inhaler; and mdi: metered dose inhaler . Acq: asthma control questionnaire; dpi: dry powder inhaler; and mdi: metered dose inhaler . The aqlq scores reveal a moderate qol in our sample (approximately 4), both regarding the overall aqlq scores and the aqlq domain scores (table 3). Neither the overall aqlq score nor individual aqlq domain scores showed significant differences regarding gender, age, or number of inhalers used in combination . Although the overall aqlq score did not show statistically significant differences regarding ic dose, polytherapy, or number of comorbidities, some of the individual aqlq domain scores did . There was a statistically significant difference between the level of asthma control (mean acq scores) and the overall aqlq score (p <0.01). Regarding the aqlq domain scores, there were statistically significant differences of polytherapy and ic dose with aqlq " activity limitation " domain scores . There was a statistically significant difference between the number of comorbidities and aqlq " environmental stimuli " domain scores . Asthma control (acq scores) was found to show statistically significant differences with aqlq " emotional function " and " symptoms " domain scores (table 4). Table 4association of independent variables with the overall asthma quality of life questionnaire score and those of its individual domains . Variableoverall scoresymptoms domain scoreactivity limitation domain scoreemotional function domain scoreenvironmental stimuli domain scoreor (95% ci)por (95% ci)por (95% ci)por (95% ci)por (95% ci)pgender2.215 (0.382 - 11.828)0.3820.962 (0.201 - 4.604)0.9614.480 (0.503 - 39.919)0.1491.920 (0.344 - 10.711)0.4520.864 (0.190 - 3.932)0.851age1.064 (0.467 - 5.512)0.4511.830 (0.528 - 6.342)0.3382.100 (0.599 - 7.361)0.2420.808 (0.225 - 2.896)0.7433.231 (0.901 - 11.586)0.069number of inhalers0.900 (0.285 - 2.843)0.8580.750 (0.234 - 2.408)0.6280.889 (0.274 - 2.885)0.8451.067 (0.334 - 3.40)0.9132.489 (0.787 - 7.870)0.121polytherapy1.800 (0.554 - 5.845)0.3262.100 (0.638 - 6.916)0.2193.651 (1.061 - 12.561)0.0361.008 (0.306 - 3.318)0.9901.029 (0.325 - 3.253)0.962acq score0.380 (0.004 - 0.341)0.0000.086 (0.016 - 0.476)0.0010.262 (0.062 - 1.111)0.0600.086 (0.016 - 0.476)0.0010.298 (0.067 - 1.330)0.105number of comorbidities0.461 (0.122 - 1.741)0.2530.317 (0.075 - 1.330)0.1100.587 (0.154 - 2.237)0.4380.808 (0.225 - 2.896)0.7455.042 (1.316 - 19.317)0.015ic dose0.500 (0.148 - 1.691)0.2660.435 (0.127 - 1.487)0.1840.249 (0.070 - 0.885)0.0290.643 (0.189 - 2.187)0.4831.771 (0.522 - 6.003)0.362acq: asthma control questionnaire; and ic: inhaled corticosteroid . The ors for the associations of the study variables with the overall aqlq score and those of its domains are shown in table 4 . In the present study, neither the overall aqlq score nor individual aqlq domain scores were significantly associated with gender, age, or number of inhalers used in combination . In contrast, the overall aqlq score and those of its domains (symptoms, activity limitation, emotional function, and environmental stimuli) were significantly associated with the following variables: polytherapy; ic dose; acq score; and number of comorbidities . Of the study variables, polytherapy and ic dose are directly related to the pharmacological treatment of asthma . In contrast, the acq score and the number of comorbidities are indirectly related to the pharmacological treatment of asthma . The acq score is indirectly related to the pharmacological treatment of asthma because the latter is aimed at controlling the disease, reducing airway remodeling, and reducing mortality . The number of comorbidities is also related to the pharmacological treatment of asthma, in the form of polytherapy use or untreated conditions . Therefore, the association of those variables with qol was assessed (with the aqlq). Many studies have assessed the qol of asthma patients, showing that severe asthma has a strong impact on qol . Given that the present study was a cross - sectional study in which the aqlq was administered at a single time point, an aqlq score of 4 (i.e., moderate qol) was used as a cut - off point for the association of independent variables with qol . In another cross - sectional study, the same cut - off point was used in order to assess the qol of asthma patients at a single time point . The aqlq is an instrument that is cross - sectionally and longitudinally correlated with clinical measures . Studies have shown that polytherapy does not improve the qol of patients, as well as showing drug interaction rates as high as 50% and the possibility of iatrogenic complications from the concomitant use of at least five drugs . In the present study, it can be assumed that the use of polytherapy increased the likelihood of worse qol outcomes in the " activity limitation " domain . Although mean overall scores were more likely to be negatively influenced by the " activity limitation " domain score (<4, i.e., moderate - to - poor qol), there was no significant association between polypharmacy and the overall aqlq score to confirm this assumption . The level of asthma control (as measured by the acq) was found to be a " protective factor " for the overall aqlq score and for aqlq " symptoms " and " emotional function " domain scores . An acq score 1.5 (controlled asthma) increased the likelihood of better overall aqlq scores (> 4) and better aqlq " symptoms " and " emotional function " domain scores . Other studies have shown an association between well - controlled asthma and better qol, patients with well - controlled asthma having higher overall aqlq scores . In the present study, an association was found between the number of comorbidities and aqlq " environmental stimuli " domain scores . It is of note that patients with fewer than five comorbidities were more likely to have worse " environmental stimuli " domain scores . Consequently, their overall aqlq scores were more likely to be negatively influenced by their " environmental stimuli " domain scores, although the association was not statistically significant . Although the study design does not allow causal interpretations, it is possible that, in our sample, there were patients with other respiratory diseases or with medical conditions influenced by factors associated with environmental stimuli, and that those factors played a role in the lack of asthma control (atopy, difficult - to - control allergic rhinitis, etc . ). Therefore, it is possible that patient perception of qol was negatively influenced by the presence of such comorbidities, regardless of the number of comorbidities . The results of the present study differ from those of other studies . According to heyworth et al ., a higher number of chronic conditions translates to a greater negative impact on qol . The use of 800 g of budesonide or equivalent was found to be associated with better qol outcomes in the " activity limitation " domain (a score> 4, i.e., moderate - to - excellent qol) in the present study . Patients using 800 g of budesonide or equivalent were more likely to have better aqlq " activity limitation " domain scores . Therefore, it is possible that the use of 800 g of budesonide or equivalent contributed positively to the overall aqlq score . However, no statistically significant association was found between the use of 800 g of budesonide or equivalent and the overall aqlq score to confirm this assumption . The results of the present study differ from those of a study of patients with moderate to severe asthma before and after treatment with high - dose fluticasone (equivalent to 1,600 g of budesonide). The overall aqlq score was correlated with better qol, as were individual aqlq domain scores . Therefore, it is possible that the degree of association in that study was different from that in the present study . In addition, the aforementioned study was not conducted in brazil, meaning that various patient - related factors might have influenced qol outcomes . In the present study, it was impossible to assess other aspects of pharmacotherapy, such as adherence to treatment, adverse reactions to ics or other drugs, use of medicinal plants / herbal medicines, and stratification by drug class, because the available data were insufficient to do so . Studies that have a cross - sectional design preclude the establishment of causal relationships between qol and independent variables . However, the importance of this issue, the results presented herein, and the lack of qol studies taking pharmacotherapy into consideration warrant longitudinal studies to establish such relationships . The importance of this issue and the results of the present study indicate the need for studies investigating pharmacotherapy - related factors influencing the qol of patients with severe asthma treated at an sus referral outpatient clinic . With regard to the goals established by the clinical protocols and treatment guidelines for asthma control, improving the qol of patients with severe asthma is as important as choosing the appropriate pharmaceutical interventions and drug therapies, given that qol reflects how patients perceive asthma management outcomes and how they live with the disease . Pharmacists play an extremely important role in the management of severe asthma, recognizing pharmacotherapy - related factors associated with qol measures and aiding in choosing the appropriate drug therapy for controlling asthma, reducing morbidity, reducing mortality, and enhancing patient well - being . Identificar, caracterizar e medir a associao de fatores relacionados qualidade de vida (qv) de pacientes asmticos sob a perspectiva da farmacoterapia . Estudo de corte transversal com 49 pacientes (18 anos) portadores de asma grave no controlada ou asma refratria, atendidos em um ambulatrio especializado do sistema nico de sade, em uso regular de altas doses de corticoides inalatrios (cis) e / ou de diversos medicamentos e com comorbidades . Obtiveram - se as medidas de qv atravs da aplicao do questionrio asthma quality of life questionnaire (aqlq) num nico momento . O escore global e dos domnios do aqlq foram relacionados com variveis demogrficas (gnero e idade), escore do asthma control questionnaire, terapia medicamentosa (dose inicial de ci, dispositivos inalatrios e politerapia) e comorbidades . Melhores escores do aqlq associaram - se com asma controlada - escore global (or = 0,38; ic95%: 0,004 - 0,341; p <0,001) e domnios " sintomas " (or = 0,086; ic95%: 0,016 - 0,476; p = 0,001) e " funo emocional " (or = 0,086; ic95%: 0,016 - 0,476; p = 0,001) - e com dose de ci 800 g - domnio " limitao de atividades " (or = 0,249; ic95%: 0,070 - 0,885; p = 0,029). Piores escores do aqlq correlacionaram - se com politerapia - domnio " limitao de atividades " (or = 3,651; ic95%: 1,061 - 12,561; p = 0,036) - e com nmero de comorbidades 5 - domnio " estmulo ambiental " (or = 5,042; ic95%: 1,316 - 19,317; p = 0,015). Nossos resultados, a importncia do tema, e a escassez de estudos sob a perspectiva da farmacoterapia apontam a necessidade da realizao de estudos longitudinais para se estabelecer uma relao de causalidade entre os fatores identificados e a qv em pacientes com asma . A asma uma doena inflamatria crnica das vias areas inferiores e est entre as condies crnicas mais comuns, afetando tanto crianas quanto adultos . Apresenta um caracterstico aumento da responsividade das vias areas a estmulos diversos, resultando, consequentemente, em obstruo ao fluxo areo, com tpica reversibilidade e recorrncia . O grau em que essas manifestaes clnicas se apresentam depende do tratamento que necessrio ao controle da doena, modificando - se com o tempo de tratamento e podendo denominar - se tambm como gravidade da doena . Quanto mais graves e mais intensas as manifestaes clnicas da asma, maior ser a complexidade envolvida no cuidado ao paciente . No brasil, estima - se uma prevalncia de asma em torno de 10% . As prevalncias mdias de sintomas indicativos de asma em grandes cidades brasileiras para crianas e adolescentes so, respectivamente, 24,3% e 19,0% . H registros de histria de sibilncia em 46,6% das crianas na cidade de salvador (ba), assim como uma tendncia de aumento no diagnstico de asma em crianas e adolescentes no brasil . Em 2003, criou - se o programa de controle da asma e da rinite alrgica na bahia (proar). Trata - se de um projeto multiprofissional de ensino, pesquisa e assistncia, que integra o sistema nico de sade (sus) e a universidade pblica . O proar objetiva principalmente a coordenao das aes preventivas e de assistncia a pacientes portadores de asma e de rinite alrgica, com o intuito de fornecer medicamentos gratuitos regularmente e promover redues tanto nas internaes como nos atendimentos de emergncia e na mortalidade, assim como a melhoria na qualidade de vida (qv). Informaes obtidas pela avaliao da qv em um determinado servio de sade podem direcionar a tomada de deciso por um procedimento ou tratamento, entre diversos disponveis, que deve ser institudo ao paciente, de modo a serem obtidos os melhores resultados para a sua sade . Segundo la scala et al.,"talvez a maior razo para se falar em qv, na prtica clnica, o fato de que o planejamento do tratamento e sua evoluo se focam no indivduo e no na doena . A qv no significa apenas o resultado final do tratamento, mas sim ter qualidade em todos os aspectos que compem o indivduo [...] " . O instrumento doena - especfico mais utilizado e citado nos estudos de asma o asthma quality of life questionnaire (aqlq), criado em 1992 especificamente para ser aplicado em estudos clnicos . Contm domnios relacionados s situaes comumente presentes no cotidiano do paciente asmtico, mas tambm avalia suas condies fsicas e emocionais, o que torna mensurvel a subjetividade do indivduo . Foi validado para uso no brasil em 2007, sendo, portanto, aplicvel realidade brasileira . O surgimento dos dispositivos inalatrios na farmacoterapia da asma trouxe a necessidade de cuidados ao paciente acerca da educao da tcnica inalatria e do manuseio desses dispositivos . O melhor uso do dispositivo possibilita o alcance do medicamento ao local de ao e, como consequncia, a efetividade do tratamento, obtendo - se o controle da asma, o que importante para uma melhor qv . O nvel de satisfao com o dispositivo em uso relatado como um fator que influencia o alcance de um melhor desfecho na asma, com reduo de idas a servios de emergncia e de exacerbaes noturnas, assim como a melhoria da qv . Estudos demonstram uma correlao entre o nvel de controle de sintomas da asma e qv . Questionrios foram desenvolvidos para a avaliao do controle da asma, e a correlao desse controle com a qv j foi mensurada . O asthma control questionnaire (acq), por exemplo, um instrumento que pode ser utilizado na prtica clnica, em ensaios clnicos ou em estudos transversais e tem boa correlao com o aqlq . A asma grave tem sido associada a inmeras comorbidades que se relacionam a um pior controle da asma, aumento da utilizao do sistema de sade e reduo da qv, cujos manejos tm incrementado positivamente os desfechos em asma . Comum a ocorrncia concomitante de outras morbidades: rinite alrgica, obesidade, osteoporose, doena do refluxo gastresofgico, tuberculose, hipertenso e diabetes . Em paralelo s diversas patologias diagnosticadas, quase sempre o paciente asmtico tem no estabelecimento do seu tratamento uma polifarmcia . O risco de interaes medicamentosas e de reaes adversas aumenta exponencialmente com o aumento do nmero de medicamentos em uso . A iatrogenia tambm favorece a adio de outros medicamentos, tornando a polifarmcia um problema de sade pblica que impacta negativamente na qv do paciente . Na bahia, apesar do acesso a um programa que possibilita o tratamento com corticoides inalatrios, broncodilatadores, educao em asma e orientaes sobre o uso dos dispositivos inalatrios a pacientes portadores de asma grave, a complexidade da terapia medicamentosa, aliada manifestao clnica da doena de base, impelem expanso do cuidado para alm do controle da asma ou do acesso ao(s) medicamento(s). No contexto da assistncia farmacutica, no entanto, so escassos estudos focados especificamente na qv do paciente asmtico grave sob a perspectiva da farmacoterapia . Tendo em vista a importncia do tema frente populao de pacientes com asma grave atendidos em um centro de referncia, objetivou - se, com o presente estudo, identificar e caracterizar os fatores relacionados qv nessa populao, assim como verificar a associao desses achados com o questionrio doena - especfico (aqlq e seus domnios). Trata - se de um estudo de corte transversal para avaliar a qv de pacientes com asma grave . O estudo foi realizado no perodo entre setembro e novembro de 2013 . Os dados so provenientes de um banco de dados de um ensaio clnico randomizado controlado, realizado no ambulatrio especializado em asma da rede sus, onde funciona o proar . A populao estudada foi composta por pacientes com idade 18 anos com asma grave, asma refratria ou asma no controlada e / ou com critrios clnicos de gravidade, admitidos no ambulatrio do proar, que recebiam medicamentos regularmente na farmcia, em uso de diversos medicamentos e / ou em uso de doses elevadas de corticosteroides inalatrios, que apresentavam comorbidades e tinham vef1 60% do valor predito . Os dados de medidas de qv foram obtidos atravs da aplicao, em um nico momento, do aqlq por trs farmacuticas treinadas previamente . O aqlq um questionrio doena - especfico que apresenta 32 perguntas agrupadas em quatro domnios: limitao de atividades (11 itens), sintomas (12 itens), funo emocional (5 itens) e estmulo ambiental (4 itens). Foi desenvolvido para ser aplicado por um entrevistador ou ser autoaplicado . O escore global do questionrio a mdia aritmtica de todos os itens, sendo o escore mnimo de 1 (qv extremamente baixa) e o mximo de 7 (qv excelente). O controle da asma foi mensurado pelo acq no mesmo momento da aplicao do aqlq . Um questionrio com cinco questes referentes a sintomas, uma questo sobre o uso de 2-agonistas de curta durao e uma questo sobre o vef1 . Os itens possuem o mesmo peso, e o nvel de controle da asma resultante da mdia das sete questes, variando entre zero (asma bem controlada) a seis (asma extremamente no controlada). Extraram - se desse banco os dados sociodemogrficos (gnero, idade, escolaridade, raa e ocupao), dados clnicos (histria de tabagismo, histria de tuberculose pulmonar, presena de outras patologias respiratrias, diagnstico de asma refratria, imc, presena de comorbidades, vef1% predito e escore do acq), dados clnicos referentes farmacoterapia (dose inicial de corticoide inalatrio, tipos e nmero de dispositivos inalatrios e quantidade de medicamentos em uso) e dados de qv (escores do aqlq). Por conta de o aqlq ter sido aplicado em um nico momento, utilizou - se como referncia o ponto de corte igual a 4 (qv mediana). Valores maiores que 4 foram interpretados como qv de mediana a excelente, enquanto valores menores ou iguais a 4 como qv de mediana a ruim . Como asma controlada, enquanto valores acima do ponto de corte foram considerados como asma no controlada . Adotou - se como definio de politerapia o uso de pelo menos cinco medicamentos pelo paciente . Foi considerada como dose alta de corticoide inalatrio como o uso acima de 800 g de budesonida ou equivalente . Fizeram - se as anlises descritivas das variveis sociodemogrficas, clnicas, das medidas de qv e daquelas referentes terapia medicamentosa . A fim de comprovar a distribuio normal das variveis quantitativas, utilizou - se o teste de kolmogorov - smirnov . Quando as variveis tiveram distribuio normal, foram utilizadas suas mdias para os clculos estatsticos; quando a distribuio no era normal, as medianas foram consideradas . O teste t de student serviu verificao entre variveis com distribuio normal na avaliao de diferenas significativas entre os grupos comparados . Para as variveis cuja distribuio no foi normal, utilizou - se o teste de mann - whitney . Desses dois testes estatsticos foi extrado o valor de p, obedecendo - se s caractersticas das variveis estudadas . As variveis de interesse foram dicotomizadas da seguinte forma: gnero (feminino / masculino), idade (<60 anos/ 60 anos), nmero de dispositivos inalatrios associados (2 dispositivos associados/> 2 dispositivos inalatrios associados), dose de corticoide inalatrio (800 g/> 800 g), politerapia (sim / no), controle da asma (acq 1,5/acq> 1,5), nmero de comorbidades (5 comorbidades/> 5 comorbidades), escore global e dos domnios de aqlq (4/> 4). Calculou - se, deste modo, a medida estimada da associao de odds ratio (or) de cada uma das variveis com o escore global e de cada domnio do aqlq . Ao final, foram identificados e caracterizados os fatores associados qv para nossa amostra, assim como foi avaliada a associao desses fatores com o escore global e com cada um dos quatro domnios do aqlq . As variveis independentes foram consideradas fatores de proteo para a qv quando 0 <or <1 . Considerou - se que houve associao entre as variveis independentes e pior qv quando or> 1 . No caso de or = 1, considerou - se no haver associao entre a varivel independente e qv . O presente estudo foi submetido e aprovado pelo comit de tica em pesquisa do complexo hospitalar universitrio professor edgard santos da universidade federal da bahia (caae 128/2008). A anlise estatstica foi realizada por meio do programa estatstico statistical package for the social sciences, verso 14.0, (spss inc ., no presente estudo foram avaliados os dados de 49 pacientes (98%) dos 50 pacientes registrados em nosso banco de dados . Um paciente (2%) foi excludo da anlise pela indisponibilidade os dados sociodemogrficos e clnicos dos pacientes estudados encontram - se dispostos na tabela 1 . Tabela 1caractersticas sociodemogrficas e clnicas de 49 pacientes com diagnstico de asma grave ou asma refratria atendidos em um ambulatrio especializado da rede do sistema nico de sade em salvador (ba). Caractersticasresultadosidade, anos53,6 13,4gnerofeminino41 (84)masculino8 (16)raa / cornegra22 (45)mulata7 (14)branca7 (14)outras6 (13)no declaradas7 (14)ocupaodona de casa18 (37)comercirio3 (6)assistente jurdico7 (14)aposentado10 (20)costureira2 (4)diarista2 (4)desempregado1 (2)outros6 (14)escolaridadeanalfabetos2 (4)ensino fundamental28 (57)ensino mdio12 (25)ensino superior7 (14)histria de tabagismo sim19 (38)no30 (62)histria de tuberculose pulmonarsim12 (25)no37 (76)asma refratriasim10 (20)no39 (80)obesidadesim14 (29)no35 (71)vef1,% do predito47,6 15,8 tabela 2estatstica descritiva das variveis independentes relativas terapia medicamentosa dos pacientes com asma grave de um centro de referncia em asma em salvador (ba). Variveisresultadosescore acq, pontos 2,73 1,37nmero de comorbidades 4 (2 - 8)dose de corticoide inalatrio, g 1.600 (800 - 1.800)combinao de dispositivos inalatrios (ipo + ip)19 (39)aerolizer como dispositivo principal28 (57)ip como dispositivo associado30 (61)quantidade de medicamentos em uso 5 31 (62)acq: asthma control questionnaire; ipo: inalador de p; e ip: inalador pressurizado . Valores expressos como mediana (variao).avalores expressos em n (%) ou em mdia dp . Acq: asthma control questionnaire; ipo: inalador de p; e ip: inalador pressurizado . Os valores do aqlq revelam uma qv mediana nessa amostra (em torno de 4), tanto em relao ao escore global como aos escores dos domnios do questionrio (tabela 3). Tabela 3escore global e dos domnios do asthma quality of life questionnair e. aqlq, pontosresultadosescore global3,66 1,41sintomas3,69 1,52limitao das atividades3,59 1,45funo emocional3,60 1,87estmulo ambiental4 (1 - 7)aqlq: asthma quality of life questionnaire . No houve diferenas significativas quanto ao escore global do aqlq ou aos de seus domnios quando os pacientes foram comparados em relao a gnero, idade e nmero de dispositivos inalatrios associados . Quando comparados quanto dose de corticoide, politerapia e nmero de comorbidades, no houve diferenas estatisticamente significativas entre eles quanto ao escore global do aqlq, mas essa ocorreu particularmente em relao a alguns dos seus domnios . Houve uma diferena estatisticamente significativa apenas quando se avaliaram os pacientes quanto ao controle da asma (mdia do valor do acq) em relao ao escore global do aqlq (p <0,01). Referentes aos domnios do aqlq, observaram - se diferenas estatisticamente significativas quando os pacientes foram avaliados quanto politerapia e dose de corticoide inalatrio em relao ao domnio " limitao de atividades " . Em relao ao domnio " estmulo ambiental ", houve uma diferena estatisticamente significativa quando os pacientes foram avaliados quanto ao nmero de comorbidades . Quanto aos domnios " funo emocional " e " sintomas ", houve diferenas estatisticamente significativas quando se avaliaram os pacientes quanto ao controle da asma (acq; tabela 4). Tabela 4associao entre variveis independentes e escore global e dos domnios do asthma quality of life questionnaire .variveisescore globalsintomaslimitao de atividadesfuno emocionalestmulo ambientalor (ic95%)por (ic95%)por (ic95%)por (ic95%)por (ic95%)pgnero2,215 (0,382 - 11,828)0,3820,962 (0,201 - 4,604)0,9614,480 (0,503 - 39,919)0,1491,920 (0,344 - 10,711)0,4520,864 (0,190 - 3,932)0,851idade 1,064 (0,467 - 5,512)0,4511,830 (0,528 - 6,342)0,3382,100 (0,599 - 7,361)0,2420,808 (0,225 - 2,896)0,7433,231 (0,901 - 11,586)0,069nmero de dispositivos inalatrios 0,900 (0,285 - 2,843)0,8580,750 (0,234 - 2,408)0,6280,889 (0,274 - 2,885)0,8451,067 (0,334 - 3,40)0,9132,489 (0,787 - 7,870)0,121politerapia1,800 (0,554 - 5,845)0,3262,100 (0,638 - 6,916)0,2193,651 (1,061 - 12,561)0,0361,008 (0,306 - 3,318)0,9901,029 (0,325 - 3,253)0,962acq0,380 (0,004 - 0,341)0,0000,086 (0,016 - 0,476)0,0010,262 (0,062 - 1,111)0,0600,086 (0,016 - 0,476)0,0010,298 (0,067 - 1,330)0,105nmero de comorbidades0,461 (0,122 - 1,741)0,2530,317 (0,075 - 1,330)0,1100,587 (0,154 - 2,237)0,4380,808 (0,225 - 2,896)0,7455,042 (1,316 - 19,317)0,015dose de ci0,500 (0,148 - 1,691)0,2660,435 (0,127 - 1,487)0,1840,249 (0,070 - 0,885)0,0290,643 (0,189 - 2,187)0,4831,771 (0,522 - 6,003)0,362acq: asthma control questionnaire; e ci: corticoide inalatrio . Associao (or) de cada uma das variveis com o escore global e os dos domnios de aqlq est apresentada na tabela 4 . Os resultados obtidos no presente estudo revelaram que no houve associaes estatisticamente significativas entre o escore global do aqlq ou de seus domnios com as variveis gnero, idade e nmero de dispositivos inalatrios associados . Por outro lado, constataram - se associaes significativas do aqlq e de seus domnios (sintomas, limitao de atividades, funo emocional e estmulo ambiental) com as seguintes variveis: politerapia, dose de corticoide inalatrio, escore do acq e nmero de comorbidades associadas . Dentre as variveis analisadas, politerapia e dose de corticoide inalatrio esto diretamente vinculadas ao tratamento medicamentoso . O acq e o nmero de comorbidades, contudo, esto indiretamente ligados ao tratamento medicamentoso . O acq vincula - se indiretamente ao tratamento medicamentoso, uma vez que, com a instituio desse tratamento, objetiva - se o controle da asma, a reduo do remodelamento das vias areas e da mortalidade . O nmero de comorbidades vincula - se ao campo do tratamento medicamentoso, como a possvel instituio de politerapia ou mesmo como condies no tratadas . Por conta disso, houve a incluso dessas variveis na avaliao de associaes com a qv (aqlq). Muitos estudos tm avaliado a qv em asma, demonstrando o quo impactante essa patologia para o paciente asmtico grave . Por se tratar de um estudo de corte transversal, com uma nica medida de aqlq, adotou - se como ponto de corte o valor 4 (qv mediana) para a verificao da associao das variveis independentes qv . Num estudo de corte transversal, o mesmo ponto de corte foi utilizado para as avaliaes da qv em pacientes asmticos em um nico momento . O aqlq um instrumento que apresenta correlao transversal e longitudinal com medidas clnicas . Estudos revelam que, na presena de politerapia, no h um aumento da qv dos pacientes, assim como se estima uma alta proporo (50%) de interao medicamentosa e a possibilidade de iatrogenia a partir da quantidade de cinco medicamentos usados concomitantemente . A politerapia esteve associada significativamente ao aqlq quanto ao domnio " limitao das atividades " . Supe - se que, para esses pacientes, a instituio da politerapia aumentou a chance de se ter uma pior qv no quesito " limitaes das atividades " . Houve uma maior chance tambm de o escore global ter o valor mdio final influenciado negativamente pelo valor obtido para esse domnio (<4, ou seja, qv de mediana a ruim), embora no tenha havido uma associao significativa entre a varivel polifarmcia e o escore global do aqlq para comprovar essa suposio . O controle da asma (medido pelo acq) revelou - se como um " fator protetor ", em relao ao escore global do aqlq e de seus domnios " sintomas " e " funo emocional " . Para esses pacientes, o escore acq 1,5 (asma controlada) resultou em uma maior chance de haver um melhor escore global do aqlq (> 4), assim como para os domnios " sintomas " e " funo emocional " . A associao entre um bom ndice de controle da asma e uma melhor qv foi constatada em outros estudos, que demonstraram que pacientes com asma bem controlada tambm tiveram escores globais de aqlq maiores . Constatou - se uma associao do nmero de comorbidades com o domnio " estmulo ambiental " . Os pacientes que apresentavam menos que cinco comorbidades, curiosamente, tiveram uma maior chance de ter resultados piores no escore " estmulo ambiental " . Por consequncia, esses pacientes tiveram uma maior chance de ter o escore global da qv influenciado negativamente pelo valor desse domnio, mas isso no foi estatisticamente significativo . Embora no seja possvel estabelecer causalidade atravs desse desenho de estudo, existe a possibilidade de que, no grupo estudado, houvesse pacientes com outras patologias respiratrias ou com condies clnicas que sofressem influncia de questes relacionadas ao estmulo ambiental e que essas questes estivessem implicando no no controle da asma (atopia, rinite alrgica de difcil controle, etc . ). Dessa maneira, a influncia de comorbidades como essas, ainda que houvesse um nmero menor de patologias associadas, poderia gerar uma pior percepo da qv por parte dos pacientes ., quanto maior o nmero de condies crnicas, maior seria a influncia negativa na qv . A dose de budesonida ou a equivalente de corticoide 800 g revelou - se um fator de proteo para uma melhor qv em relao " limitao de atividades " (> 4, ou seja, qv de mediana a excelente). Houve uma maior chance de que houvesse pacientes com uma melhor qv referente a esse domnio quando utilizada essa faixa de dose . Por conseguinte, houve a possibilidade de essa medida contribuir positivamente no escore global de qv . Por outro lado, tambm no houve associao estatisticamente significativa entre essa varivel e o escore global de aqlq para comprovar tal suposio . H um resultado diverso na literatura para o uso de altas doses de corticoide inalatrio (fluticasona), equivalentes a 1.600 g de budesonida, comparando - se o mesmo grupo de pacientes com asma moderada e grave em dois perodos, antes e aps o tratamento . O escore global do aqlq, assim como de seus domnios, foram correlacionados com uma melhor qv . Tratava - se, contudo, de um estudo longitudinal, com uma amostra de 60 pacientes, e, por conta disso, o nvel de associao pode ter sido diferente do encontrado no presente estudo . Alm disso, o estudo foi realizado em um pas diferente, podendo - se considerar aspectos variados relativos ao paciente, influenciando os resultados de qv . No foi possvel avaliar outros aspectos relativos terapia medicamentosa, como adeso ao tratamento, reaes adversas a corticoides inalatrios ou a outros medicamentos, uso de plantas medicinais e / ou fitoterpicos e estratificao da terapia medicamentosa por classe de medicamentos, por no haver dados disponveis suficientes para tais anlises . Atravs de um estudo de corte transversal, no se pode estabelecer causalidade entre variveis independentes estudadas e qv . Porm, diante da importncia do tema e pelos resultados apresentados, necessria a realizao de um estudo longitudinal para estabelec - la, tendo em vista a escassez de investigao acerca da qv sob a perspectiva da terapia medicamentosa . A importncia do tema frente populao de pacientes com asma grave, atendidos em um ambulatrio da rede sus, referncia para asma, e os resultados encontrados no presente estudo indicam a necessidade de fomentar novos estudos acerca dos fatores da farmacoterapia que influenciam a qv dessa populao . O direcionamento das intervenes farmacuticas e a instituio da terapia medicamentosa, portanto, no que concerne o alcance das metas estabelecidas com o protocolo e diretrizes teraputicas para o controle da asma, so to importantes quanto o alcance de uma melhor qv desses pacientes, pois se trata do ponto de vista do paciente quanto aos resultados dos manejos da asma e da sua convivncia com a patologia . Para essa populao, de extrema importncia a colaborao do profissional farmacutico para o reconhecimento dos aspectos da terapia medicamentosa nas medidas de qv, auxiliando no direcionamento da farmacoterapia para o alcance do controle da asma, a reduo de morbidade e da mortalidade, alm do bem - estar do paciente.
Antibiotic resistance has become one of the most important public health problems worldwide due to morbidity and mortality and healthcare costs . Although the spanish national health system (snhs) has a population coverage of almost 100%, 30% of all antibiotic use occurs outside the snhs and is largely due to the dispensing of antibiotics without a medical prescription (dawmp). Although this practice is unlawful, it is common in spain, favoured by the fact that it is not a punishable offence . This, in turn, means that dispensing depends on the attitude of the individual pharmacist . This study sought: (i) to estimate the percentage of pharmacists who employ dawmp; and (ii) to identify such pharmacists' personal and professional traits, as well as their knowledge and attitudes, in view of the potential link between these and the practice of dawmp . Although we were undertaking an observational study, the ethics committee for clinical research of galicia was informed and approval was granted (n 2007/107). We carried out exhaustive sampling of the study population, which comprised all community pharmacists from a region in north - western spain in september 2012 (183 pharmacies and 393 pharmacists). A self - administered questionnaire was used (available as supplementary data at jac online). The statements were classified into three blocks: (i) personal and professional information; (ii) knowledge of and attitudes to antibiotics and antibiotic resistance; and (iii) dawmp in four situations (urinary, dental and upper respiratory tract infections, and cases where the patient promised to bring the prescription at some later point in time). In this last block, respondents were given three options for each of the situations: no / yes / only if the patient is someone known to the pharmacist . Agreement with the statements was measured using an unnumbered, horizontal visual analogue scale 7 cm long, with replies being scored from 0 (total disagreement) to 10 (total agreement). The questionnaire was based on a previous qualitative focus group study conducted by our research group . (ii) data were analysed and grouped into categories (complacency, insufficient knowledge, indifference and external responsibility). (iii) these categories were transformed into statements, based on expressions used by the participants in the focus groups . (iv) the content and face validity was reviewed with the aid of pharmacology, psychology and public health experts . (v) the structure of the questionnaire was revised, and both the wording and the content of these items were improved . (vi) to assess the reproducibility (the degree of agreement among answers), a pilot test was conducted on 30 pharmacists . The questionnaire was delivered twice to each pharmacist, with an interval of 4 weeks . A research team member (m. z .- c .) Personally delivered and retrieved the questionnaires . Pharmacists who were not at the pharmacy at the time of the visit were not included in the study . Participants who replied yes or only if the patient is someone known to the pharmacist in at least one of the four scenarios were classified as dawmp . The reproducibility of the questionnaire was assessed using the intraclass correlation coefficient (icc), based on the results obtained for the first and second answers from each pharmacist . To take into account the distribution of the independent variables, we calculated the interquartile odds ratio (or), which is the effect of the exposure change from the 25th to the 75th percentile . When the or was <1, we calculated the inverse interquartile or (1/interquartile or), which is the effect when the exposure changes from the 75th to the 25th percentile . Although we were undertaking an observational study, the ethics committee for clinical research of galicia was informed and approval was granted (n 2007/107). We carried out exhaustive sampling of the study population, which comprised all community pharmacists from a region in north - western spain in september 2012 (183 pharmacies and 393 pharmacists). A self - administered questionnaire was used (available as supplementary data at jac online). The statements were classified into three blocks: (i) personal and professional information; (ii) knowledge of and attitudes to antibiotics and antibiotic resistance; and (iii) dawmp in four situations (urinary, dental and upper respiratory tract infections, and cases where the patient promised to bring the prescription at some later point in time). In this last block, respondents were given three options for each of the situations: no / yes / only if the patient is someone known to the pharmacist . Agreement with the statements was measured using an unnumbered, horizontal visual analogue scale 7 cm long, with replies being scored from 0 (total disagreement) to 10 (total agreement). The questionnaire was based on a previous qualitative focus group study conducted by our research group . (ii) data were analysed and grouped into categories (complacency, insufficient knowledge, indifference and external responsibility). (iii) these categories were transformed into statements, based on expressions used by the participants in the focus groups . (iv) the content and face validity was reviewed with the aid of pharmacology, psychology and public health experts . (v) the structure of the questionnaire was revised, and both the wording and the content of these items were improved . (vi) to assess the reproducibility (the degree of agreement among answers), a pilot test was conducted on 30 pharmacists . The questionnaire was delivered twice to each pharmacist, with an interval of 4 weeks . A research team member (m. z .- c .) Personally delivered and retrieved the questionnaires . Pharmacists who were not at the pharmacy at the time of the visit were not included in the study . Participants who replied yes or only if the patient is someone known to the pharmacist in at least one of the four scenarios were classified as dawmp . The reproducibility of the questionnaire was assessed using the intraclass correlation coefficient (icc), based on the results obtained for the first and second answers from each pharmacist . Associations between the independent variables and dawmp were modelled by multiple logistic regression . To take into account the distribution of the independent variables, we calculated the interquartile odds ratio (or), which is the effect of the exposure change from the 25th to the 75th percentile . When the or was <1, we calculated the inverse interquartile or (1/interquartile or), which is the effect when the exposure changes from the 75th to the 25th percentile . In the pilot study, all scale items had an icc> 0.4 . Of the pharmacies visited, 22 (12.0%) refused to participate in the study . Of the 286 pharmacists (72.8%) who completed the questionnaire, 185 stated that they carried out dawmp (64.7%). None of their personal and professional traits showed any relationship with dawmp (table 1). Table 2 shows the degree of agreement with the attitudes and their influence on dawmp . The changes in exposure from the 25th to the 75th percentile increased the probability of dawmp by 14% (95% ci 1%30%) for insufficient knowledge, 119% (95% ci 42%236%) for external responsibility (health system), 46% (95% ci 11%92%) for indifference and 484% (95% ci 235%915%) for complacency . In the case of external responsibility (investigation), a change from the 75th to the 25th percentile in the assessment of this opinion would mean an 80% increase (95% ci 19%170%) in the probability of dawmp . Table 1.influence of personal and professional traits on dawmptraitsdawmp, n (%) analysisnoyesor (95% ci)pgender female79 (78.2)145 (78.4)1.00 male20 (19.8)35 (18.9)1.01 (0.482.14)0.974 md2 (2.0)5 (2.7)age (years) <3927 (26.7)58 (31.4)1.00 394834 (33.7)55 (29.7)0.70 (0.222.25)0.546> 4827 (26.7)60 (32.4)0.81 (0.312.16)0.680 md13 (12.9)12 (6.5)work status owner56 (55.4)86 (46.5)1.00 staff43 (42.6)98 (53.0)0.85 (0.421.71)0.639 md2 (2.0)1 (0.5)population rural47 (46.5)89 (48.1)1.00 semi - rural20 (19.8)29 (15.7)0.67 (0.311.43)0.298 urban32 (31.7)65 (35.1)0.69 (0.271.78)0.444 md2 (2.0)2 (1.1)years of experience as community pharmacist <1128 (27.7)58 (31.4)1.00 112038 (37.6)67 (36.2)0.99 (0.293.42)0.989> 2026 (25.7)49 (26.5)0.83 (0.312.21)0.705 md9 (8.9)11 (5.9)medication dispensed per day <8021 (20.8)56 (30.3)1.00 8015039 (38.6)74 (40.0)1.11 (0.413.06)0.837> 15015 (14.9)33 (17.8)0.82 (0.351.94)0.658 md26 (25.7)22 (11.9)antibiotics dispensed per day <524 (23.8)54 (29.2)1.00 51035 (34.7)88 (47.6)1.40 (0.464.28)0.554> 1014 (13.9)23 (12.4)1.74 (0.724.20)0.220 md28 (27.7)20 (10.8)md, missing data.adjusted for the effects of the other variables included in the table.categorized by tertiles of the total sample . Table 2.influence of attitudes to and opinions about dawmpattitudespercentilesor (95% ci)interquartile or (95% ci)inverse interquartile or (95% ci)p255075(1) antibiotic resistance is an important public health issue.9.010.010.01.14 (1.011.30)1.14 (1.011.30)0.041(2) the fact that an antibiotic is prescribed to a patient will not influence the appearance of resistance.1.03.87.50.96 (0.891.02)1.35 (0.862.13)0.193(3) the prescription of antibiotics is less strict under private insurance than under the galician health service (servizo galego de sade sergas).0.52.05.51.17 (1.071.27)2.19 (1.423.36)<0.001(4) when dispensing antibiotics, i warn the patient about the importance of correct therapeutic compliance.10.010.010.00.94 (0.711.27)1.00 (1.001.00)0.711(5) when dispensing, possible interactions between the antibiotic and other drugs that the patient is taking should be evaluated.9.510.010.01.00 (0.831.21)0.988(6) antibiotics are sometimes dispensed without medical prescription because the patient is known to have difficulty in gaining access to a doctor.0.94.57.01.33 (1.221.46)5.84 (3.3510.15)<0.001(7) the main cause of the appearance of antibiotic resistance is inappropriate use by patients.8.09.510.00.98 (0.891.08)1.04 (0.851.27)0.693(8) the wrong antibiotic is sometimes knowingly dispensed by pharmacists because there is no time to explain why it is not the correct one.0.51.03.31.15 (1.041.27)1.46 (1.111.92)0.007(9) i am convinced that new antibiotics will be developed to solve the resistance issue.4.95.59.50.88 (0.810.96)1.80 (1.192.70)0.005(10) the use of antibiotics on animals is an important cause of the appearance of new resistance.5.07.510.01.04 (0.951.13)1.20 (0.791.83)0.381(11) if patients feel that they need an antibiotic and it is not dispensed, they will try to obtain it at another pharmacy.2.55.59.51.17 (1.091.26)3.04 (1.825.10)<0.001(12) the phenomenon of resistance to antibiotics is mainly a problem in hospital settings.1.02.55.81.06 (0.981.15)1.32 (0.921.92)0.132insufficient knowledge.external responsibility.complacency.indifference . Influence of personal and professional traits on dawmp adjusted for the effects of the other variables included in the table the results of this study indicate that pharmacists' knowledge and attitudes are strongly associated with dawmp . Indifference, complacency, external responsibility and insufficient knowledge have all been identified as attitudes that increase the risk of dawmp . Since attitudes are potentially modifiable, these results would indicate that educational strategies specifically aimed at changing certain attitudes could substantially improve antibiotic dispensing . Our data confirm that the sale by pharmacies of antibiotics without a medical prescription continues to be widespread in spain, since over 60% of the pharmacists in our study acknowledged the practice . One possibility is that pharmacists feel competent to undertake dawmp, particularly in the case of minor infections . Our results indicate a much greater propensity to dispense in the case of urinary and dental infections than in the case of respiratory infections . Some authors have shown their agreement with the dispensing of antibiotics over the counter in cases such as minor urinary infections, although this is controversial . When we performed a second analysis excluding dispensing for minor urinary infections, the influence of attitudes on dispensing habits was unchanged (data not shown). When the pharmacist knew the patient (complacency), this increased the probability of dawmp, which is consistent with another study conducted in the same setting . Some pharmacists explain this practice by saying that they have regular customers and are familiar with their clinical history . Since income depends on sales, this behaviour could nevertheless be motivated by the fear of losing a regular customer . Moreover, pharmacists who believe that patient would find the antibiotic at some other pharmacy increase the probability of dawmp, probably to foster customer loyalty or for fear of losing the sale . Another factor that might influence dawmp is the pressure exerted by patients to obtain an antibiotic . Medical prescribing is influenced by patients' expectations, and a similar pattern of behaviour could well arise in the dispensing process, particularly in countries like spain where patients are more prone to use antibiotics even for treating minor complaints and/or viral illnesses . This paradoxical effect can be explained because they give more importance to immediate efficacy or patient satisfaction (an individual point of view) over potential long - term antibiotic resistance in the population (a collective point of view). Responsibility to other professionals (other pharmacists / medical staff, patients, the healthcare system or the use of antibiotics in animals) is another attitude associated with dawmp and is common among health professionals . A possible limitation of this study is bias caused by those who did not respond . However, the level of participation was very high, to the extent of being one of the highest for this type of study (72.8%). Another possible limitation is that the percentage of pharmacists who acknowledged dawmp might be underestimated . Such an acknowledgement could indicate that professionals placed trust in the anonymity of the questionnaire, presumably because it had been issued by an academic institution . Another possible study limitation was the difficulty of assessing the validity criterion, since there is no reference method for measuring attitudes . However, the fact that knowledge and attitudes can discriminate between dispensing antibiotics with and without a prescription, supports the construct validity of these statements . The results of this study may not be applicable in environments where the legislative framework regarding dawmp is stricter, as in the case of northern europe and north america . The results of this study could be used to design interventions to improve antibiotic dispensing . These interventions could emphasize: (i) the high level of dawmp (responsibility); (ii) the importance of resistance and its association with antibiotic use in outpatients (insufficient knowledge and indifference); and (iii) pharmacist - patient communication through health education (complacency). The results of this study could be used to design interventions to improve antibiotic dispensing . These interventions could emphasize: (i) the high level of dawmp (responsibility); (ii) the importance of resistance and its association with antibiotic use in outpatients (insufficient knowledge and indifference); and (iii) pharmacist - patient communication through health education (complacency). This work was supported by health research fund (fondo de investigacin sanitaria) grants (pi 081239, pi09/90609) from the spanish ministry of health . A. f. and p. l .- v . Designed the study, and a. f., p. l .- v . Data collection was carried out by m. z .- c ., who also undertook database management and statistical analysis . The text was drafted by m. z .- c . And a. f., and discussed in depth by m. z .- c ., a. f., c. g .- a. f. and p. l .- v . Designed the study, and a. f., p. l .- v . Data collection was carried out by m. z .- c ., who also undertook database management and statistical analysis . The text was drafted by m. z .- c . And a. f., and discussed in depth by m. z .- c ., a. f., c. g .-
Morphea, also known as localized scleroderma (ls), is an inflammatory skin disorder characterized by excessive collagen deposition . It primarily affects the dermis and sometimes extends into the subcutaneous fat and fascia producing thickening and hardening of the skin due to fibrosis . It is estimated that approximately half of the patients undergo spontaneous remission or skin softening ~2.7 years after the onset of the disease.1 however, at the most severe end of the spectrum, morphea may progress for years, resulting in significant atrophy; joint contractures; and functional, cosmetic, and psychologic disabilities . Epidemiologic data suggest that morphea progresses to systemic sclerosis in 0.9%5.7% of patients.2 morphea shows a great variety in its clinical presentation and has been classified into circumscribed, linear (including scleroderma en coup de sabre), generalized, pansclerotic, and mixed - variant morphea.3 the therapeutic options include the use of topical or oral corticosteroids, vitamin d analogs (calcitriol), tacrolimus, psoralen and ultraviolet a (puva) photochemotherapy, uva1, cyclosporin, penicillamine, antimalarial drugs, and methotrexate (mtx).48 although treatment algorithms for morphea subtypes have been suggested by fett and werth, there are still no consistent recommendations for the treatment of morphea based on the disease characteristics.9,10 this study attempts to assess the clinical efficacy and safety of mtx in refractory generalized morphea . This was a retrospective study conducted between april 2010 and may 2015 at the clinic for autoimmune dermatoses of andreas sygros hospital, first department of skin and venereal diseases of national and kapodistrian university of athens medical school, greece . Inclusion criteria were the following: 1) age 18 years; 2) clinical diagnosis of generalized plaque scleroderma defined as> 4 indurated plaques> 3 cm affecting at least 2 anatomic areas; 3) confirmation of clinical diagnosis by histologic and serologic examination; and 4) generalized morphea refractory to topical treatment (corticosteroids, calcineurin inhibitors, vitamin d analogs), puva, and oral corticosteroids . Patients who had additionally failed to other systemic treatments or combination treatment were not excluded from the study . A total of 52 patients with generalized plaque scleroderma attended our clinic for autoimmune dermatoses during this time period . Thirty - two patients demonstrated significant clinical improvement after being treated with any of the following treatments: topical corticosteroids, calcineurin inhibitors, vitamin d analogs, puva, and oral corticosteroids . The frequencies of concomitant diseases from patients medical history were the following: coronary artery disease in 7 patients (35%), diabetes in 4 patients (20%), and elevated cholesterol in 5 patients (25%). Furthermore, all of them had failed puva (although high - dose uva1 light is likely the most effective ultraviolet light therapy for morphea, it was not available in our hospital). A total of 2, 3, and 2 patients had no response when later being treated with penicillamine, hydroxychloroquine, and combination of oral corticosteroids and topical calcineurin inhibitors, respectively . Clinical characteristics of patients were recorded comprising the disease duration, past treatments for morphea, and extracutaneous manifestations of the disease, while family history of autoimmune diseases was also indicated . Laboratory examinations included antinuclear antibodies (anas); anti - topoisomerase i antibodies (anti - scl-70); complement fractions (c3 and c4); and anti - pm / scl, anti - sm, anti - u1-rnp, anti - ro / ssa, and anti - la / ssb antibodies . Standard screening prior to treatment initiation with mtx consisted of a full blood count, liver biochemistry, serum urea, and creatinine . These tests were performed twice weekly for the first 3 months of treatment, four times weekly during the second 3 months of treatment, and thereafter thrice monthly in the case of stable dose and no toxicity.11 serology tests for hepatitis b (hbv) and hepatitis c (hcv) and tuberculosis testing were considered for high - risk patients . A chest x - ray was appropriate for patients with lung disease such as asthma, bronchitis, or smoker s cough . Treatment was ceased in cases of very good improvement, lack of improvement, progressive disease, or not manageable adverse events based on the judgment of our clinical team . Fourteen out of 20 patients (70%) received mtx as a sole systemic treatment, whereas the other ones were administered a combination of oral mtx and/or topical emollients . Clinical assessment of skin lesions was performed based on 3 criteria: erythema, skin thickness / induration, and size of the lesion . This evaluation of the outcomes was represented on a mannequin and documented in patients medical files . A physician s global assessment (pga) scale was also used to evaluate the efficacy of the treatment with mtx after 6, 9, and 12 months of therapy based on the improvement of the above mentioned 3 criteria . Treatment failure was defined as no improvement in any of the 3 criteria and/or appearance of the disease activity / function, that is, worsening of the sclerosis, presence of lilac ring, increase of lesion size, and presence of new lesions within previous visit . Very good response was defined as improvement in all 3 criteria, good as improvement in 2 out of 3 criteria, while fair response as improvement in 1 out of 3 criteria . Moreover, all patients were asked to complete a dermatology life quality index (dlqi) questionnaire to evaluate the impact of the disease on the patient s quality of life.12 this study was conducted in the dermatology department of andreas sygros hospital of cutaneous and venereal diseases in athens . The study protocol was approved by the ethics committee of the hospital, and written informed consent was obtained from all patients . This was a retrospective study conducted between april 2010 and may 2015 at the clinic for autoimmune dermatoses of andreas sygros hospital, first department of skin and venereal diseases of national and kapodistrian university of athens medical school, greece . Inclusion criteria were the following: 1) age 18 years; 2) clinical diagnosis of generalized plaque scleroderma defined as> 4 indurated plaques> 3 cm affecting at least 2 anatomic areas; 3) confirmation of clinical diagnosis by histologic and serologic examination; and 4) generalized morphea refractory to topical treatment (corticosteroids, calcineurin inhibitors, vitamin d analogs), puva, and oral corticosteroids . Patients who had additionally failed to other systemic treatments or combination treatment were not excluded from the study . A total of 52 patients with generalized plaque scleroderma attended our clinic for autoimmune dermatoses during this time period . Thirty - two patients demonstrated significant clinical improvement after being treated with any of the following treatments: topical corticosteroids, calcineurin inhibitors, vitamin d analogs, puva, and oral corticosteroids . The frequencies of concomitant diseases from patients medical history were the following: coronary artery disease in 7 patients (35%), diabetes in 4 patients (20%), and elevated cholesterol in 5 patients (25%). Furthermore, all of them had failed puva (although high - dose uva1 light is likely the most effective ultraviolet light therapy for morphea, it was not available in our hospital). A total of 2, 3, and 2 patients had no response when later being treated with penicillamine, hydroxychloroquine, and combination of oral corticosteroids and topical calcineurin inhibitors, respectively . Clinical characteristics of patients were recorded comprising the disease duration, past treatments for morphea, and extracutaneous manifestations of the disease, while family history of autoimmune diseases was also indicated . Laboratory examinations included antinuclear antibodies (anas); anti - topoisomerase i antibodies (anti - scl-70); complement fractions (c3 and c4); and anti - pm / scl, anti - sm, anti - u1-rnp, anti - ro / ssa, and anti - la / ssb antibodies . Standard screening prior to treatment initiation with mtx consisted of a full blood count, liver biochemistry, serum urea, and creatinine . These tests were performed twice weekly for the first 3 months of treatment, four times weekly during the second 3 months of treatment, and thereafter thrice monthly in the case of stable dose and no toxicity.11 serology tests for hepatitis b (hbv) and hepatitis c (hcv) and tuberculosis testing were considered for high - risk patients . A chest x - ray was appropriate for patients with lung disease such as asthma, bronchitis, or smoker s cough . Treatment was ceased in cases of very good improvement, lack of improvement, progressive disease, or not manageable adverse events based on the judgment of our clinical team . Fourteen out of 20 patients (70%) received mtx as a sole systemic treatment, whereas the other ones were administered a combination of oral mtx and/or topical emollients . Clinical assessment of skin lesions was performed based on 3 criteria: erythema, skin thickness / induration, and size of the lesion . This evaluation of the outcomes was represented on a mannequin and documented in patients medical files . A physician s global assessment (pga) scale was also used to evaluate the efficacy of the treatment with mtx after 6, 9, and 12 months of therapy based on the improvement of the above mentioned 3 criteria . Treatment failure was defined as no improvement in any of the 3 criteria and/or appearance of the disease activity / function, that is, worsening of the sclerosis, presence of lilac ring, increase of lesion size, and presence of new lesions within previous visit . Very good response was defined as improvement in all 3 criteria, good as improvement in 2 out of 3 criteria, while fair response as improvement in 1 out of 3 criteria . Moreover, all patients were asked to complete a dermatology life quality index (dlqi) questionnaire to evaluate the impact of the disease on the patient s quality of life.12 this study was conducted in the dermatology department of andreas sygros hospital of cutaneous and venereal diseases in athens . The study protocol was approved by the ethics committee of the hospital, and written informed consent was obtained from all patients . The patients in this study had a mean disease duration of 27 months before the initiation of mtx treatment . Clinically, most of the patients in general started to show signs of experienced marked or moderate improvement within the first 3 months of therapy and continued to improve throughout the next months . A significant improvement in clinical manifestation was reflected in scoring systems including dlqi score (table 1). According to pga, 3 months on treatment, patients had very good, good, and fair response, while only 2 failed treatment; thus, treatment was discontinued in both cases (table 2). After 12 months of therapy, very good response was achieved in 6 patients (30%) and good response in 10 patients (50%). These patients were followed up for a mean time interval of 21 months . During the follow - up period, no new skin lesions of generalized morphea appeared, and no exacerbation of the disease was observed . Nausea and abdominal pain were observed in 4 patients (20%). Only 1 patient developed acute elevation of liver biochemistry, which was normalized after reducing dosage of mtx to 10 mg once weekly for 2 consecutive weeks . Seven patients (35%) were ana positive, 1 patient (5%) was anti - scl-70 positive, while c3 and c4 were within normal range in all patients . Anti - pm / scl, anti - sm, anti - u1-rnp, anti - ro / ssa, and anti - la / ssb antibodies were not detected in any of the patients . Morphea with> 4 lesions affecting at least 2 anatomic areas is usually limited to the skin and subcutaneous tissue and attends a self - limited course.3,13 however, the prognosis may be unpredictable.14 topical treatments are available and usually effective for the inflammatory phase . It is a well - accepted practice to use systemic medications to treat severe and disabling forms of morphea, including lesions resistant to topical therapy either in a cosmetically significant site (face, scalp, and transverse a joint) or with deep subcutaneous involvement.15 mtx has been studied as a treatment option for both morphea and systemic sclerosis . This enzyme is involved in pyrimidine (dna) synthesis.16 inhibition of this enzyme leads to depletion of tetrahydrofolates, which are essential for the synthesis of dna, rna, and protein.14 advantages of treatment with mtx include a weekly dosage schedule, low cost, and a relatively safe profile.17 whereas adverse events like nausea, vomiting, fatigue, and mucositis are common, they are rarely life - threatening . While pulmonary toxicity is very rare, hepatic and toxicities toxicity are common with mtx but not usually severe, particularly when the dose is low and can be managed with dose reduction as needed.17 consequently, frequent blood monitoring is required . Although this is an uncontrolled study, there do appear to be encouraging results, since the majority of the patient group (80%) of this study showed good and very good response after 12 months of mtx treatment . Only 2 patients had to discontinue treatment due to no response to therapy or worsening of their clinical condition . According to literature, mtx has been proved to be an effective and well - tolerated treatment for achieving disease remission in pediatric patients with ls.15,1820 however, few studies have been conducted in adult population . In a cohort study, kroft et al have demonstrated the efficacy of mtx for various sclerotic skin diseases (ls, eosinophilic fasciitis, and pseudoscleroderma) in adult patients.21 in another study, improvement was observed in adult patients with severe morphea treated with pulsed intravenous corticosteroids plus mtx.22 van den hoogen et al have shown that mtx therapy in systemic sclerosis resulted in reduction of skin thickness and improvement in general well - being.23 similar findings have been reported by pope et al.24 in addition, a recent retrospective chart review of adult patients with morphea treated with mtx showed that younger age at treatment initiation was associated with higher rates of disease remission, suggesting that early treatment should be preferred in morphea.25 the mechanism of action of mtx is not fully understood . This may be attributed to its anti - inflammatory effect or to a possible direct effect on the skin fibroblasts . Both seyger et al in an adult ls series and van den hoogen et al in an adult systemic sclerosis trial suggested that mtx may have an anti - fibrotic action.23,26 a possible mechanism of mtx in modifying morphea is by interfering with cytokine expression . Decreased levels of circulating soluble interleukin-2 receptors and decreased serum levels of interleukin-6 and interleukin-8 after mtx treatment have been reported both in juvenile and in adult rheumatoid arthritis, while increased levels of the above mentioned cytokines have been related to an active phase in morphea.2730 in addition, a recent study showed that suppression of the jak / stat pathway is likely to be the principal anti - inflammatory and immunosuppressive mechanism - of - action of low - dose mtx.31 mtx was considered a safe strategy for the management of this specific clinical subset of morphea . The overall tolerability of the treatment was high, and the adverse events observed were mild and reversible . Nevertheless, this is an uncontrolled study of a disease with a tendency to spontaneous improvement so it is difficult to be certain that improvement is due to mtx.
This was an observational cohort study of healthy subjects, glaucoma suspects, and open - angle glaucoma (oag) patients enrolled from the diagnostic innovations in glaucoma study (digs) who completed oct - a imaging (angiovue; optovue, inc ., fremont, ca, usa) and optic nerve head imaging using sd - oct (avanti; optovue, inc . )., all participants underwent an ophthalmologic examination, including assessment of best - corrected visual acuity, slit - lamp biomicroscopy, intraocular pressure (iop) measurement with goldmann applanation tonometry, gonioscopy, ultrasound pachymetry, dilated fundus examination, simultaneous stereophotography of the optic disc, and visual field testing . Inclusion criteria were (1) greater than 18 years of age, (2) open - angles on gonioscopy, and (3) best - corrected visual acuity (bcva) of 20/40 or better . Healthy subjects had (1) iop <21 mm hg with no history of elevated iop; (2) normal appearing optic disc, intact neuroretinal rim, and rnfl; and (3) a minimum of two reliable normal visual fields, defined as a pattern standard deviation (psd) within 95% confidence limits and a glaucoma hemifield test (ght) result within normal limits . Eyes were classified as glaucomatous if they had repeatable glaucomatous visual field damage defined as a ght outside normal limits and psd outside 95% normal limits . Glaucoma suspects were defined as having glaucomatous optic neuropathy or suspicious appearing optic discs based on stereophotograph reviewed by two experienced graders and/or ocular hypertension (iop> 21 mm hg) without evidence of repeatable glaucomatous visual field damage . The diagnostic category for each participant was determined based on the diagnosis of his or her worse eye . Participants with a history of intraocular surgery (except for uncomplicated cataract surgery or glaucoma surgery), coexisting retinal pathologies, nonglaucomatous optic neuropathy, uveitis, or ocular trauma were excluded from the study . Participants were also excluded if there was a diagnosis of parkinson's disease, alzheimer's disease, dementia, or a history of stroke . Participants with systemic hypertension and diabetes mellitus were included unless they were diagnosed with diabetic or hypertensive retinopathy . Participants having unreliable visual field, poor quality oct - a, or optic nerve head sd - oct scans were also excluded from our study . Systemic measurements included two blood pressure (bp) measurements obtained using an omron automatic (model bp791it; omron healthcare, inc . Mean arterial pressure was calculated as one - third systolic bp + two - thirds diastolic bp . Mean ocular perfusion pressure (mopp) was defined as the difference between two - thirds of mean arterial pressure and iop . Optical coherence tomography angiography and sd - oct images were obtained by the same operator and at the same visit using the angiovue, which is a dual modality oct system . The angiovue is an angiographic platform implemented on an existing commercially available sd - oct platform . Informed consent was obtained from all participants, and all methods adhered to the tenets of the declaration of helsinki and the health insurance portability and accountability act and were approved by the institutional review boards at the university of california san diego . Standard automated perimetry visual field tests were completed using swedish interactive threshold algorithm standard 24 - 2 (humphrey field analyzer; carl zeiss meditec, dublin, ca, usa) strategies . The quality of the visual fields was reviewed by the visual field assessment center (visfact) staff . Only reliable tests (33% fixation losses and false - negative errors and 15% false - positive errors) and visual fields without rim and eyelid artifacts, evidence of inattention or fatigue effects, and no evidence that the abnormal results of the visual field were caused by a disease other than glaucoma, were included . Visual field result was considered to be abnormal if a ght was outside of normal limits or a psd fell outside of the 95% normal confidence limits . The angiovue provides a noninvasive oct - based method for visualizing the vascular structures of the retina . It uses an 840-nm light source and has an a - scan rate of 70,000 scans / s and a bandwidth of 50 nm . Each volume contains 304 304 a - scans with two consecutive b - scans captured at each fixed position . Each volume scan is acquired in 3 seconds and consists of two orthogonal volumes that are used to minimize motion artifacts arising from microsaccades and fixation changes . The split - spectrum amplitude - decorrelation angiography (ssada) method was used to capture the dynamic motion of the red blood cells and provide a high - resolution 3d visualization of perfused retinal vasculature . The angiovue characterizes vascular information at various user - defined retinal layers as a vessel density map and quantitatively as vessel density (%) (fig . Vessel density was automatically calculated as the proportion of measured area occupied by flowing blood vessels defined as pixels having decorrelation values acquired by the ssada algorithm above the threshold level . Retinal nerve fiber layer vessel density map in healthy, glaucoma suspect, and open - angle glaucoma eyes . Bottom row: area vessel density color - coded map . For this report, we analyzed vessel density in the peripapillary rnfl in images with a 4.5 4.5-mm field of view centered on the optic disc . Vessel density within the rnfl was measured from internal limiting membrane (ilm) to rnfl posterior boundary using standard angiovue software (version 2015.1.0.90). Whole enface image vessel density (wivd) was measured in the entire 4.5 4.5-mm image, and circumpapillary vessel density (cpvd) was calculated in the region defined as a 750-m - wide elliptical annulus extending from the optic disc boundary (fig . Image quality review was completed on all scans according to a standard protocol established by the university of california, san diego imaging data evaluation and analysis (idea) reading center . Trained graders reviewed scans and excluded poor quality images, defined as images with (1) a signal strength index of less than 48, (2) poor clarity, (3) residual motion artifacts visible as irregular vessel pattern or disc boundary on the enface angiogram, (4) local weak signal, or (5) rnfl segmentation errors . The location of the disc margin was reviewed for accuracy and adjusted manually if required . All subjects also underwent optic nerve head imaging with a commercially available sd - oct system (avanti) with a70-khz axial line rate, 840-nm central wavelength, a 22-m focal spot diameter, and an axial resolution of 5 m in tissue . The optic nerve head (onh) map protocol was used to obtain rnfl thickness measurements; rnfl measurements were calculated in a 10-pixel - wide band along a circle of 3.45 mm in diameter centered on the onh . Only good - quality images, as defined by scans with a signal strength index 37, and without segmentation failure and artifacts were included . The overall average rnfl thickness was used in this analysis . The distribution of numerical data was tested for normality using the shapiro - wilk test . Descriptive statistics were calculated as the mean and standard deviation for normally distributed variables and median, first quartile, and third quartile for nonnormally distributed variables . Age - adjusted anova was used for the comparison between groups, and the tukey - kramer honest significant difference (hsd) post hoc test was performed to adjust for multiple comparisons between groups within each analysis . Diagnostic accuracy for differentiating between (1) healthy and glaucoma eyes and (2) healthy and glaucoma suspect eyes was evaluated by calculating the area under the receiver operating characteristic (auroc) curves . For the analysis of vessel density, each participant contributed eyes to either the glaucoma patient group or the glaucoma suspect group, but not both . If both eyes of a glaucoma patient did not show evidence of repeatable visual field damage, then the eye without visual field damage was excluded from the analyses of both the glaucoma eyes and glaucoma suspect eyes . For completeness, diagnostic accuracy also was calculated for differentiating between (1) healthy subjects and glaucoma patients and (2) healthy subjects and glaucoma suspect participants using the mean vessel density of both eyes as the unit of analysis for each subject . The auroc curves were adjusted for age differences between groups, using a covariate adjustment regression method . For the analysis by eye, a between - cluster variance estimator was used to adjust for including both eyes of the same subject in the model . Pairwise comparisons of the aurocs were performed using the method suggested by pepe al . To evaluate whether there were statistically significant differences between the roc curves . All statistical analyses were performed with commercially available software a stata version 14 (statacorp, college station, tx, usa) and jmp version 11.2.0 (sas, inc ., this was an observational cohort study of healthy subjects, glaucoma suspects, and open - angle glaucoma (oag) patients enrolled from the diagnostic innovations in glaucoma study (digs) who completed oct - a imaging (angiovue; optovue, inc ., fremont, ca, usa) and optic nerve head imaging using sd - oct (avanti; optovue, inc . )., all participants underwent an ophthalmologic examination, including assessment of best - corrected visual acuity, slit - lamp biomicroscopy, intraocular pressure (iop) measurement with goldmann applanation tonometry, gonioscopy, ultrasound pachymetry, dilated fundus examination, simultaneous stereophotography of the optic disc, and visual field testing . Inclusion criteria were (1) greater than 18 years of age, (2) open - angles on gonioscopy, and (3) best - corrected visual acuity (bcva) of 20/40 or better . Healthy subjects had (1) iop <21 mm hg with no history of elevated iop; (2) normal appearing optic disc, intact neuroretinal rim, and rnfl; and (3) a minimum of two reliable normal visual fields, defined as a pattern standard deviation (psd) within 95% confidence limits and a glaucoma hemifield test (ght) result within normal limits . Eyes were classified as glaucomatous if they had repeatable glaucomatous visual field damage defined as a ght outside normal limits and psd outside 95% normal limits . Glaucoma suspects were defined as having glaucomatous optic neuropathy or suspicious appearing optic discs based on stereophotograph reviewed by two experienced graders and/or ocular hypertension (iop> 21 mm hg) without evidence of repeatable glaucomatous visual field damage . The diagnostic category for each participant was determined based on the diagnosis of his or her worse eye . Participants with a history of intraocular surgery (except for uncomplicated cataract surgery or glaucoma surgery), coexisting retinal pathologies, nonglaucomatous optic neuropathy, uveitis, or ocular trauma were excluded from the study . Participants were also excluded if there was a diagnosis of parkinson's disease, alzheimer's disease, dementia, or a history of stroke . Participants with systemic hypertension and diabetes mellitus were included unless they were diagnosed with diabetic or hypertensive retinopathy . Participants having unreliable visual field, poor quality oct - a, or optic nerve head sd - oct scans were also excluded from our study . Systemic measurements included two blood pressure (bp) measurements obtained using an omron automatic (model bp791it; omron healthcare, inc . Mean arterial pressure was calculated as one - third systolic bp + two - thirds diastolic bp . Mean ocular perfusion pressure (mopp) was defined as the difference between two - thirds of mean arterial pressure and iop . Optical coherence tomography angiography and sd - oct images were obtained by the same operator and at the same visit using the angiovue, which is a dual modality oct system . The angiovue is an angiographic platform implemented on an existing commercially available sd - oct platform . Informed consent was obtained from all participants, and all methods adhered to the tenets of the declaration of helsinki and the health insurance portability and accountability act and were approved by the institutional review boards at the university of california san diego . Standard automated perimetry visual field tests were completed using swedish interactive threshold algorithm standard 24 - 2 (humphrey field analyzer; carl zeiss meditec, dublin, ca, usa) strategies . The quality of the visual fields was reviewed by the visual field assessment center (visfact) staff . Only reliable tests (33% fixation losses and false - negative errors and 15% false - positive errors) and visual fields without rim and eyelid artifacts, evidence of inattention or fatigue effects, and no evidence that the abnormal results of the visual field were caused by a disease other than glaucoma, were included . Visual field result was considered to be abnormal if a ght was outside of normal limits or a psd fell outside of the 95% normal confidence limits . The angiovue provides a noninvasive oct - based method for visualizing the vascular structures of the retina . It uses an 840-nm light source and has an a - scan rate of 70,000 scans / s and a bandwidth of 50 nm . Each volume contains 304 304 a - scans with two consecutive b - scans captured at each fixed position . Each volume scan is acquired in 3 seconds and consists of two orthogonal volumes that are used to minimize motion artifacts arising from microsaccades and fixation changes . The split - spectrum amplitude - decorrelation angiography (ssada) method was used to capture the dynamic motion of the red blood cells and provide a high - resolution 3d visualization of perfused retinal vasculature . The angiovue characterizes vascular information at various user - defined retinal layers as a vessel density map and quantitatively as vessel density (%) (fig . Vessel density was automatically calculated as the proportion of measured area occupied by flowing blood vessels defined as pixels having decorrelation values acquired by the ssada algorithm above the threshold level . Retinal nerve fiber layer vessel density map in healthy, glaucoma suspect, and open - angle glaucoma eyes . Bottom row: area vessel density color - coded map . For this report, we analyzed vessel density in the peripapillary rnfl in images with a 4.5 4.5-mm field of view centered on the optic disc . Vessel density within the rnfl was measured from internal limiting membrane (ilm) to rnfl posterior boundary using standard angiovue software (version 2015.1.0.90). Whole enface image vessel density (wivd) was measured in the entire 4.5 4.5-mm image, and circumpapillary vessel density (cpvd) was calculated in the region defined as a 750-m - wide elliptical annulus extending from the optic disc boundary (fig . Image quality review was completed on all scans according to a standard protocol established by the university of california, san diego imaging data evaluation and analysis (idea) reading center . Trained graders reviewed scans and excluded poor quality images, defined as images with (1) a signal strength index of less than 48, (2) poor clarity, (3) residual motion artifacts visible as irregular vessel pattern or disc boundary on the enface angiogram, (4) local weak signal, or (5) rnfl segmentation errors . The location of the disc margin was reviewed for accuracy and adjusted manually if required . All subjects also underwent optic nerve head imaging with a commercially available sd - oct system (avanti) with a70-khz axial line rate, 840-nm central wavelength, a 22-m focal spot diameter, and an axial resolution of 5 m in tissue . The optic nerve head (onh) map protocol was used to obtain rnfl thickness measurements; rnfl measurements were calculated in a 10-pixel - wide band along a circle of 3.45 mm in diameter centered on the onh . Only good - quality images, as defined by scans with a signal strength index 37, and without segmentation failure and artifacts were included . The overall average rnfl thickness was used in this analysis . The distribution of numerical data was tested for normality using the shapiro - wilk test . Descriptive statistics were calculated as the mean and standard deviation for normally distributed variables and median, first quartile, and third quartile for nonnormally distributed variables . Age - adjusted anova was used for the comparison between groups, and the tukey - kramer honest significant difference (hsd) post hoc test was performed to adjust for multiple comparisons between groups within each analysis . Diagnostic accuracy for differentiating between (1) healthy and glaucoma eyes and (2) healthy and glaucoma suspect eyes was evaluated by calculating the area under the receiver operating characteristic (auroc) curves . For the analysis of vessel density, each participant contributed eyes to either the glaucoma patient group or the glaucoma suspect group, but not both . If both eyes of a glaucoma patient did not show evidence of repeatable visual field damage, then the eye without visual field damage was excluded from the analyses of both the glaucoma eyes and glaucoma suspect eyes . For completeness, diagnostic accuracy also was calculated for differentiating between (1) healthy subjects and glaucoma patients and (2) healthy subjects and glaucoma suspect participants using the mean vessel density of both eyes as the unit of analysis for each subject . The auroc curves were adjusted for age differences between groups, using a covariate adjustment regression method . For the analysis by eye, a between - cluster variance estimator was used to adjust for including both eyes of the same subject in the model . Pairwise comparisons of the aurocs were performed using the method suggested by pepe al . To evaluate whether there were statistically significant differences between the roc curves . All statistical analyses were performed with commercially available software a stata version 14 (statacorp, college station, tx, usa) and jmp version 11.2.0 (sas, inc ., two hundred sixty - one eyes of 164 healthy subjects, glaucoma suspects, and oag patients with good - quality scans were included in the analysis . Mean age in the healthy group was significantly lower than both glaucoma and glaucoma suspect group (p <0.001; table 1). Therefore, all comparisons and roc curves were adjusted for age differences between groups . Compared with glaucoma suspect and healthy subjects, glaucoma patients had significantly lower iops (p <0.001 and p = 0.042, respectively), and they had also thinner central corneas compared with the glaucoma suspect group (p = 0.040). Demographic and ocular characteristics of healthy subjects, glaucoma suspects, and glaucoma patients there were no statistically significant differences between systolic, diastolic, mean bp and mean ocular perfusion pressure measurements among groups . However, self - reported history of hypertension was more frequent in glaucoma patients and glaucoma suspects compared with healthy controls (p = 0.006). Statistically significant differences were found between glaucoma patients and healthy subjects for all ocular parameters except for disc area . Visual field mean deviation and psd were not significantly different between glaucoma suspects and healthy controls (p = 0.819 and p = 0.870, respectively). However, glaucoma suspects had on average thinner rnfl and smaller rim areas compared with healthy subjects (p <0.05 for both). Age - adjusted 1-way anovas showed that the vessel density values were significantly different among the three groups (p <0.001 for both wivd and cpvd). The wivd values were significantly lower in glaucoma eyes (46.2%), followed by glaucoma suspect eyes (51.3%) and healthy eyes (56.6%); all three pairwise comparisons were statistically significant (tukey - kramer hsd, p <0.05 for all comparisons). For cpvd, the pairwise comparisons showed that glaucoma eyes (55.1%) had significantly lower cpvd values compared with both glaucoma suspects eyes (60.3%) and healthy eyes (64.2%) (tukey - kramer hsd, p <0.001 for both). However, there was no significant difference in cpvd between glaucoma suspect and healthy eyes (p = 0.426; table 2; fig . Age - adjusted mean values and diagnostic accuracy (auroc) for oct - a vessel density and spectral - domain oct rnfl thickness measurements in healthy participants, glaucoma suspects, and glaucoma patients boxplots illustrating the distribution of whole image vessel density (top), circumpapillary vessel density (middle), and average retinal nerve fiber layer thickness (bottom) measurements in healthy, glaucoma suspect, and glaucoma eyes . Overall, the auroc se for discriminating between healthy and glaucomatous eyes was highest for wivd (0.94 0.03), followed by rnfl (0.92 0.03) and cpvd (0.83 0.06). Pairwise comparisons showed that the age - adjusted auroc of wivd (0.94) was higher than cpvd (0.83) (p <0.05), and their diagnostic accuracies were similar to rnfl thickness (0.92) (p> 0.05 for both) for differentiating between glaucoma and healthy eyes (table 2; fig . The auroc for differentiating between glaucoma suspect eyes from healthy eyes was highest for wivd (0.70 0.10), followed by rnfl thickness (0.65 0.09) and cpvd (0.65 0.10). Area under the receiver operator characteristic curves for whole image vessel density (0.94), circumpapillary vessel density (0.83), and average rnfl (0.92), for differentiating between glaucoma eyes and healthy eyes . Area under the receiver operator characteristic curves for whole image vessel density (0.70), circumpapillary vessel density (0.65), and average rnfl (0.65) for differentiating between glaucoma suspect eyes and healthy eyes . Similar analyses were completed comparing healthy subjects and glaucoma patients and healthy subjects and glaucoma suspect patients using the mean of both eyes in the analysis . Overall, the auroc se for discriminating between healthy and glaucomatous participants was highest for wivd (0.87 0.05), followed by rnfl thickness (0.87 0.04) and cpvd (0.71 0.08). The auroc for differentiating between healthy and glaucoma suspects was highest for wivd (0.70 0.11), followed by cpvd (0.62 0.10) and rnfl thickness (0.62 0.09). In the current study, we demonstrated that oct - a vessel density measured in the rnfl, the most superficial layer of the retina, distinguishes among groups of glaucoma, glaucoma suspect, and healthy participants . Specifically, wivd performs as well as rnfl thickness for discriminating between healthy and glaucoma patients and for differentiating between the healthy and glaucoma suspect groups . The wivd also had significantly better diagnostic accuracy than cpvd for differentiating between glaucoma patients and healthy groups . In the present study, the diagnostic accuracy of vessel density measurements were evaluated for differentiating glaucoma eyes from healthy eyes, as well as glaucoma patients from healthy subjects . Regardless of whether the analysis was completed with the participant as the unit of analysis or whether the eye was the unit of analysis, the same conclusion was drawn; vessel density measures have similar diagnostic accuracy as rnfl thickness for glaucoma and glaucoma suspect detection . However, compared with the analysis with participant as the unit of analysis, the auroc with eyes as the unit of analysis had larger auroc values (0.87 and 0.94, respectively) because the analysis by participant included the mean of both eyes in the analysis, regardless of whether the fellow eye had visual field damage . These results are consistent with previous reports that showed differences in oct - a microvasculature between glaucoma and healthy groups in the optic disc and peripapillary region . However, these reports assessed both the superficial and deep capillary beds and calculated the vascular parameters in a thicker retinal slab from the ilm to the rpe . To our knowledge, this is the first study using oct - a to evaluate the microvascular bed in the rnfl layer, which largely reflects the rpcs . These findings that oct - a vessel density measurements and oct - based rnfl thickness measurements have a similar auroc for glaucoma detection are also consistent with other studies reporting high auroc for both peripapillary vessel density measures in a thicker slab from ilm to rpe and sd - oct rnfl thickness measurements (aurocs, 0.94 and 0.97, respectively). Although structural measurements, such as rnfl and optic nerve head parameters (rim, cup, etc . ), have been shown to be associated with disc size, to the best of our knowledge, no studies evaluated the effect of disc size on vessel density measurements . In the current study, there was no significant correlation between disc area and wivd and cpvd measurements in healthy eyes (r = 0.04, p = 0.815 and r = 0.01, p = 0.474, respectively). For this reason,, it also was found that wivd performs as well as rnfl thickness for discriminating between glaucoma suspect eyes and healthy controls, with aurocs se of 0.70 0.10 and 0.65 0.09, respectively (p = 0.497). There is evidence that rnfl thinning is detectable in ocular hypertensive eyes and preperimetric glaucomatous eyes even before morphologic changes of the optic disc become visible and visual field defects occur . There is also evidence that changes in the blood flow are detectable in glaucoma suspects with no visual field defect . However, the ability of oct - a to discriminate between glaucoma suspects and healthy subjects has not been reported previously . An unexpected finding in the current study was the significantly better diagnostic accuracy of wivd compared with cpvd for differentiating between healthy and glaucoma groups . First, the larger measurement area has the advantage of detecting changes in the rpcs, the rnfl capillary plexus, which is an additional superficial vascular bed accompanying axons that extend eccentrically along the temporal vessels . In contrast to rnfl thickness assessment that measures virtually all ganglion cell axons as they exit the eye at the optic nerve, measuring cpvd may not fully capture the presence of most of the rpcs . In this regard some studies suggest that rpcs originate from retinal vessels in the ganglion cell layer and arch up abruptly to supply the rnfl, whereas others report that they originate from the optic disc . There is, however, consensus regarding the anatomy of the rpcs; these distinct elongated microvascular networks run parallel to the rgc axons and are more prominent in the peripheral arcuate rnfl region . Therefore, the larger measurement area of the wivd may, at least in part, explain the better performance of these measurements compared to cpvd . As suggested in figure 1, vessel dropout is visible qualitatively in all areas of the image, including the periphery outside the measurement area of cpvd . Thus, the limited measurement size of cpvd may not include regions of sparse vasculature that are of diagnostic value . Finally, because the study population comprises a high proportion of early glaucoma patients, the larger measurement area may be detecting early vessel dropout associated with focal rnfl damage in early glaucoma that is more apparent in the peripapillary retina farther from the circumpapillary region included in cpvd . Impairment of blood flow in the optic nerve and peripapillary retina in glaucoma patients is well documented . However, not all studies found significant differences in the blood flow of the neuroretinal rim and peripapillary area between glaucoma patients and healthy controls . Results of studies relating ocular blood flow to glaucoma are difficult to compare due to the variety of techniques applied, different parameters of ocular hemodynamics investigated, and differences in glaucoma populations studied . Measurement of ocular blood flow has been challenging, and it should be noted that oct - a does not directly measure blood flow . A number of methods have been used to document differences in blood flow between glaucoma and normal eyes, but none have been appropriate for routine clinical use . The high variability of doppler flowmetry and laser speckle flowgraphy measurements, the limited resolution with mri, and invasive nature and time intensiveness of fluorescein angiography limit their ability to provide information on vascular components that contribute to the pathophysiology of glaucoma . Doppler oct has been used for measuring total retinal blood flow, with a better level of precision than other doppler methods . However, this technique is only able to assess flow in larger retinal vessels and does not provide information on the microvascular networks, which is of primary interest in glaucoma . The rnfl is largely comprised of the axons of rgcs, one of the most metabolically active cells in human . These cells have tremendous metabolic requirements and depend on regional capillary networks to meet them . Despite the critical role of rnfl capillary plexus relative to glaucomatous damage suggested by several investigators, our previous inability to quantify microvascular network features has prevented evaluation of the clinical characteristics of the rnfl capillary beds and obtaining a more comprehensive understanding of the rgc axonal damage in glaucoma . Based on the results of the current study, we hypothesize that oct - a provides a new imaging target for early diagnosis and management of glaucoma . First, the healthy participants were significantly younger than the glaucoma suspects and glaucoma patients . Moreover, it is unlikely that the main finding that vessel density measures performed as well as rnfl thickness for differentiating between healthy and glaucoma participants would be affected by the age of the healthy controls, as the same subjects are used in all analyses . In addition, due to the cross - sectional, noninterventional design of the study, it was not possible to evaluate the potentially confounding impact of ocular hypotensive eye drops and bp - lowering medications on vascular measurements . Most participants in the glaucoma (83.7%) and glaucoma suspect (73.0%) groups were treated using ocular antihypertensive medications at the time of oct - a imaging . Further, 41.3% of glaucoma patients and 35.2% glaucoma suspects were taking multiple ocular antihypertensive medications . It also should be noted that in the present study patients were not excluded based on systemic conditions or systemic medication in order to better reflect the general population . As outlined in table 1, 45.2% of glaucoma patients, 32.4% of glaucoma suspects, and 17.4% of healthy participants with self - reported history of hypertension were taking antihypertensive medications . Therefore, we could not rule out the impact of systemic conditions and systemic medications on vessel density measurements . Further studies are needed to address the influence on oct - a measurements of ocular hypotensive treatment and systemic medications more specifically . Finally, it was not possible to characterize the causal relationship between altered vessel density and glaucomatous damage . Therefore, longitudinal studies are needed to elucidate the temporal relationship between retinal vascular change and glaucomatous optic neuropathy . The current study demonstrated that oct - a vessel density is lower in glaucoma patients compared with healthy controls and glaucoma suspects and has a similar diagnostic accuracy to rnfl thickness for discriminating healthy subjects from glaucoma suspects and glaucoma patients . This study is unique in that it compared the diagnostic accuracy of oct - a measures and standard sd - oct rnfl thickness for discriminating between healthy, glaucoma suspect, and glaucoma patients . The ability of oct - a to noninvasively evaluate the capillary networks shows promise for characterizing glaucomatous retinal vascular changes and may have a role in glaucoma management . Longitudinal studies are needed to determine whether a lower vessel density found in glaucoma patients precedes or follows optic nerve damage and whether this information can be used to improve glaucoma management.
Wegener s granulomatosis (wg) is an uncommon necrotizing vasculitis that most commonly affects the upper airways, lungs and kidneys, but can involve any other organ . The disease presents with varying symptoms and signs and early recognition and initiation of adequate immunomodulatory therapy are essential in limiting the potentially life - threatening aspects of the disorder . We report a case illustrating that wg may present with localized, cutaneous manifestations preceding systemic disease . An 18-year old caucasian man presented with a painful rash on the truncus that had developed over the course of a few weeks . The patient was known to have type-1 diabetes mellitus since the age of 8, but was otherwise healthy and reported no recent travel activity or antecedent trauma to the affected area . Objective examination of the skin revealed inflamed cystic and nodular lesions confined to the chest and left shoulder, but there was no significant suppuration or other apparent signs of infection . The condition resembled a case of severe acne, and initial histopathological examination of a skin biopsy supported this preliminary clinical diagnosis . A few weeks later the patient developed a sore throat and signs of upper respiratory tract infection including cough, dyspnoea and mild chest pain . The skin changes remained limited to the chest and shoulder but had clearly progressed and now appeared as deep vasculitic ulcerations, including multiple elements more than 0.5 cm deep (figure 1). These findings and symptoms were accompanied by several weeks of fever (up to 39.6c), malaise and substantial unilateral facial pain, and the patient was admitted to a department of nephrology for further investigation and treatment . Figure 1cystic and nodular lesions on the chest, notice necrotic wounds with element size ranging from a few millimeters up to 2 cm . In consistence with vasculitis the elements are inflamed and do not blanch on pressure . Cystic and nodular lesions on the chest, notice necrotic wounds with element size ranging from a few millimeters up to 2 cm . The blood leukocyte and thrombocyte counts were normal as were liver and renal function tests, but c - reactive protein (crp) was 300 mg / l (normal range, less than 10 mg / l) and anti - neutrophil cytoplasmic antibodies including specific identification of proteinase 3 (c - anca / pr3-anca) was 223 ku / l (normal range, less than 7 the patient s kidney function was continually assessed and monitored, but levels of creatinine and urea remained within normal ranges and examination of urine including microbiological analysis revealed no abnormalities . Chest x - ray examination was performed and several lung infiltrates with caverns were noted . A subsequent ct guided lung biopsy demonstrated no sign of infection, but significant inflammation of the tissue was observed, and a diagnosis of wg with concomitant mononeuritis multiplex involving the trigeminal nerve was established . The patient received systemic methylprednisolone and cyclofosfamide pulse therapy, which resulted in prompt improvement of the clinical condition and skin lesions as well as a decrease in the crp and anca titers . Shortly after, however, the patient developed fever and renewed elevation of the c - anca / pr3-anca, and treatment was supplemented with rituximab leading to immediate resolution of symptoms and no residual pulmonary or cutaneous sequelae on recent follow - up . Our patient initially presented with a localized rash on the truncus, but his condition was insidiously complicated by malaise, fever and progression of the cutaneous lesions, and ultimately a diagnosis of systemic wg was established . The etiology of the disease remains unknown, however, several studies suggest that infectious antigens and especially s. aureus may contribute to the pathogenesis of vasculitis in susceptible hosts . The clinical presentation of wg is complex and found to be dependent on the number of organs affected and the duration of the disease . As in our case, the clinical course of wg is characterized by an initial or localized phase which may affect any organ followed by a generalized or systemic phase in approximately 80% of cases . However, in most patients specific cutaneous findings develop concurrently or after the onset of systemic involvement and affect the head or extremities, but in our case they were confined to the truncus and preceded systemic symptoms and signs, which has only seldomly been described . In wg specific cutaneous lesions are seen in approximately 15% of cases, and are usually associated with renal disease and musculoskeletal affection, but this was not noted in our patient . Patients may develop more than one type of cutaneous lesion and these may change over time or with treatment, but several studies have identified palpable purpura as the most characteristic cutaneous lesion, and nodules, papules, ulcerations and deep erythema nodusum - like subcutaneous nodules complete the clinical spectrum . Oral involvement is not uncommon in wg, but this was not observed in our patient during the course of the disease . In this present case the level of c - a nca / pr3-anca was markedly elevated, and anca positivity has been found to occur in 9095% of cases with active wg . However, as levels correlate with disease activity and relapses in the absence of anca are rare, repeat testing and evaluation of blood biochemistry in order to follow the course of the disease is highly recommended . As illustrated by our case the diagnosis of wg represents a challenge and is based on anamnestic information closely correlated with clinical features, pathologic findings and anca testing . Relevant differential diagnoses are numerous and include leukocytoclastic vasculitis, henoch - schnlein purpura, pyoderma gangrenosum, lymphoma, erythema nodosum, rheumatoid arthritis, drug reactions, and a variety of infectious conditions . However, like wg, these conditions often present with varying and uncharacteristic symptoms and signs and, as in our case, dermatological evaluation may provide valuable diagnostic information . If untreated, systemic wg leads to more than 90% mortality in the first two years, hence early recognition and initiation of adequate immunomodulatory treatment are essential and associated with significantly decreased morbidity and mortality . High dose corticosteoroids and pulsed intravenous cyclofosfamide remain the mainstay of initial therapy, but relapse and refractory wg still represent therapeutic challenges . However, data from recent studies evaluating biological therapies, including tnf- blockers (infliximab) and monoclonal antibodies (rituximab) are promising and future treatment regimes will hopefully further improve the outcome of this patient group . We report a case illustrating that patients with wg may initially present with localized cutaneous symptoms and signs preceding serious systemic disease . Prompt recognition of the condition and initiation of early and adequate immunomodulatory therapy is crucial in order to reduce mortality and morbidity . Dermatologists therefore need to be aware of wg as a possible differential diagnosis, especially in patients presenting with characteristic skin manifestations and accompanying systemic symptoms and signs.
Primary spontaneous pneumothorax (psp) is a benign disease, usually occurring in young patients without known underlying lung disorder . The occurrence rate is reported to be about 9 individuals per 100 000 each year . Depending on the individual severity, the therapeutic options include simple observation, needle aspiration, tube thoracostomy and definite operation . If surgery is indicated, video - assisted thoracoscopic surgery (vats) using an endoscopic linear cutter to resect the involved blebs is currently the most popular treatment . Nevertheless, we try to avoid using the endoscopic staple device at our hospital because payment for the device is excluded by the national health insurance system in taiwan . Thanks to the increased experience with therapeutic thoracoscopy that we have gained in recent years, we used the technique of thoracoscopic suturing to imbricate the blebs, without resection, to treat the air leakage in psp patients, and report here our early results . From january 2001 to april 2002, we had 50 episodes of primary spontaneous pneumothorax in 49 patients referred for the operation . Among them, 26 patients with 26 episodes received transaxillary thoracotomy with or without assisted - thoracoscopy inspection . Twenty - one patients with 22 episodes of psp received vats wedge closure by suturing . In this study, we dealt solely with the vats group . Study patients included 2 female and 19 male patients, with a mean age of 25 years, ranging from 16 to 52 years . These 2 female patients were much older than the other patients, being 52 and 45 years of age, respectively . Because of no abnormal pulmonary disease except for the attack of pneumothorax the surgical indications included recurrences in 11 episodes (10 patients), prolonged air leakage for more than 5 days in 4 episodes (4 patients), and apical blebs seen on radiography in 2 episodes (2 patients). Five patients in 5 episodes underwent the operation owing to fear of recurrence, thus not fitting the above indications . The patients were kept in the lateral decubitus position after anesthesia was administered with single - lung ventilation . The first 10-mm port was created in the 7th intercostal space (ics), mid - axillary line . The second 5-mm and third 10-mm ports were created in the 5th ics, anterior - axillary, and posterior - axillary line, respectively . After the full exploration of the lung surface, the involved blebs were sutured with an absorbable (3 - 0) vicryl polyglactin suture (ethicon endo - surgery, inc, cincinatti, oh). The curved needle had to be straightened before it could be put into the trocar port . If no bleb was found, the apical scar area was sutured in the same way . Coagulation of parietal pleura by the endo - instrument was routinely performed in all patients to achieve pleurodesis . The mean disease duration from attack to operation was 5 days, ranging from 1 to 30 days . The mean operation time was 133 minutes, ranging from 80 minutes to 270 minutes . The mean hospital stay after the operation was 4 days, ranging from 3 to 8 days . Three patients complained of prolonged intermittent intercostal neuralgia during the follow - up period, and 1 patient suffered dehiscence at the chest tube port . During the mean 6-month follow - up, ranging from 1 to 16 months, most patients recovered well, except 2 patients who experienced recurrences . Vats endo - suturing of the leaking area was performed again, with apical pleurectomy for this patient . The suture - puncture of the leaking blebs, instead of the normal tissue, in the prior operation was condemned . No bleb was found in her prior vats . A relationship between the attack and her menstruation no matter what surgical approach is executed, the goal of treatment is to find the offending bleb, remove it, and perform some manipulations to encourage adhesion formation . Recently, video - assisted thoracoscopic surgery (vats) has been shown to produce results comparable to those obtained following open thoracotomy, yet with a reduction of postoperative pain, respiratory dysfunction and catabolic response to trauma, and decrease in wound - related complications . We believe that for psp vats is the best treatment, as abdala et al recommend, because it allows us to treat the ruptured bleb radically avoiding any recurrence . However, it is not the treatment of choice for all physicians due to the high cost of the equipment and the stapling devices needed for the wedge resection of the involved blebs . In taiwan due to the financial policy of the national health system, the charge of the high price of the endo - stapling instruments to the patient always concerns us, which is just the same as that in yim's report . Finding a way to replace the endo - stapling method endo - suturing is not a new skill, and it is widely applied in laparoscopic surgery . Nevertheless, using the endosuturing method to treat spontaneous pneumothorax was only reported by yim in 1995 in the english literature . Because the incurred blebs are always idiopathic in patients with primary spontaneous pneumothorax, we think that it is not necessary to remove them . Furthermore, the preserved bleb tissues are of help in wound healing and prevent air leakage from the wound, which can shorten the duration of the chest tube insertion . Therefore, the length of suturing is not a problem, and in 1 case a 10-cm suturing - line was performed without prolonged air - leakage . Without adequate treatment, the recurrence rate after the first pneumothorax on the same side is about 25%, and after the second episode, more than 50% . Although no general agreement exists about the best time for surgical intervention (ie, after the first or second episode), vats therapy is now accepted as a definite treatment even in the first episode . In this study they were all well informed about the conventional indication of the surgery before being included in this study . Ventilation of 1 lung is mandatory in this procedure because complete lung collapse promotes the effect of suturing . The suture tension becomes tight enough to stop any air leaks after the lung fully expands . In addition, the tissue of the bleb itself can be used as a buttress to enforce the suturing area . The recurrence rate after the vats operation is reported to be high, between 13.7% and 20%, due to newly formed blebs or bullae unidentified during operation . Recently, a favorable 2.1% recurrence rate by vats has been reported by maier et al who use a rotating brush as a supplement ., the cause of recurrence is thought to be improper suturing with direct puncture of the blebs during the operation and thus the leakage area is not repaired well . During reoperation by vats, the air leak was found near the previous sutured area, which adhered intensively to the parietal pleura . Step - by - step dissection has to be carefully executed to prevent tissue damage during the second - look operation . Therefore, we have an 9.1% (2/22) recurrence rate, which is acceptable compared with that of the other vats reports . The coagulation pleurodesis seems ineffective if the definite treatment of the ruptured blebs is not accurately executed . It is thought that the limited pleura being applied via the 3 small ports during vats renders coagulation pleurodesis ineffective . The incidence of chronic postoperative complaints after minimally invasive procedures for spontaneous pneumothorax is relatively high . In the majority of the patients, two of our patients complained of intermittent anterior chest pain in the ipsilateral side, which may have been due to concurrent injury to the intercostal nerve at the trocar site . The vats wedge closure of the blebs by suturing, without resection of the involved blebs, is a feasible and effective alternative treatment for primary spontaneous pneumothorax if cost of the endo - stapler is regarded as a major problem.
The adenoma is solitary in 8590% of patients, while others have multiple adenomas or parathyroid hyperplasia . Accurate preoperative localization is essential for good surgical outcome, and inability to locate the adenoma in an ectopic gland may delay the diagnosis . Nuclear imaging accurately localizes the tumor in more than 90% of cases, obviating the need for advanced imaging modalities . Rarely, patients present with localization failure posing a great challenge to the treating endocrinologist and operating surgeon . We report the use of a novel imaging method leading to successful outcome in a patient of primary hyperparathyroidism with failed first surgery . A 54-year - old lady presented with body pains and muscle aches for 1-year duration to a peripheral hospital . Investigations revealed high serum calcium (11.6 mg / dl), low phosphorus (2.6 mg / dl), elevated alkaline phosphatase (677 u / l) and intact parathyroid hormone (ipth) of 116 pg / ml (normal 10 - 65 pg / ml). Sestamibi scan revealed right inferior parathyroid adenoma, and she was diagnosed as a case of primary hyperparathyroidism . She underwent adenomectomy along with thyroidectomy and showed no features of hungry bone syndrome postoperatively . There was no confirmation of parathyroid adenomectomy by using intraoperative pth levels or by frozen section of the removed tissue . Her clinical symptoms persisted after surgery and histopathological examination of the specimen removed showed thyroid tissue with no evidence of parathyroid adenoma . She reported to us after 6 months of initial surgery with persisting complaints of body aches and myalgia . Her clinical examination was unremarkable, with a normotensive blood pressure, and well - healed scar in the neck . Serum biochemistry revealed elevated calcium (10.8 mg / dl), low phosphorus (2.8 mg / dl) and elevated alkaline phosphatase (280 bone mineral density estimation revealed a t - score of -2.2 at hip joint and z - score of -2.3 . Serum 25 hydroxy vitamin d level was 22 ng / l and parathyroid hormone was elevated (ipth-140 pg / ml). Localization with sestamibi scan revealed right inferior parathyroid adenoma with no tracer uptake in thyroid bed [figure 1]. Abdominal sonography showed normal renal parenchyma and ultrasonography neck and plain ct neck did not show parathyroid adenoma . Tc 99 m sestamibi scan showing right inferior parathyroid adenoma in view of past history of failed surgery, tc 99 m sestamibi single photon emission computed tomography ct (spect) was done for precise localization of the adenoma prior to re - exploration . It revealed an ectopic parathyroid adenoma, located suprasternally in the pretracheal region on right side [figure 2]. Histopathological examination of the specimen confirmed the parathyroid adenoma . During last follow - up, 1 year after second surgery the patient is free of all symptoms and had normal serum calcium, phosphorus and alkaline phosphatase values . Sestamibi emission computed tomography ct showing parathyroid adenoma pretracheal in location (coronal and sagittal views) the disease is detected during asymptomatic stage in developed countries, while we encounter the advanced spectrum of the disease with severe metabolic bone disease . Precise localization is important to prevent further delay in definitive therapy after biochemical confirmation of the diagnosis . Parathyroid glands are derived from pharyngeal pouches (superior parathyroid glands from 4 and inferior from 3 pouch) with subsequent caudal migration . The modalities available for precise localization of a parathyroid adenoma are palpation, ultrasonography (usg), ct, mri, nuclear scintigraphy, and combination of these tests . Ultrasonography is useful for its wide availability, convenience, cost and a guiding tool for the surgeon before surgery . However, the sensitivity and specificity of usg reported was 73% and 100%, respectively . Ct and mri scans provide excellent spatial resolution but often miss a small parathyroid adenoma . This is recommended mostly in cases of failed surgery, recurrent disease and when planned for a limited surgical exploration . Immediate imaging reveals the tracer uptake in both thyroid and parathyroid gland along with adenoma but the adenomatous tissue shows retention of the tracer in delayed images . Spect scan is an advance in radionuclide studies with a three - dimensional (3-d) reconstruction, further increasing the sensitivity for adenoma localization . Spect scan, with its 3-d capability, combined with ct images, is very helpful in directing the surgeon particularly in recurrent or residual hyperparathyroidism . Recent reports suggest that spect / ct is superior to spect scan alone for localization of parathyroid adenoma with nodular goiter, distorted neck anatomy and those with ectopic parathyroid glands . To conclude, our patient had an ectopic parathyroid adenoma resulting in failed initial surgery . Use of a novel imaging modality like spect helped in accurate localization of the adenoma prior to repeat surgical exploration.
Symptomatic disc herniation located in the thoracic spine is a relatively uncommon disease with an estimated annual incidence of 1:1000 to 1:10000003,9,10). On the other hand, it is thought to represent 0.25 to 0.75% of all symptomatic disc herniations, making it common enough so that any spine surgeon will occasionally face this problem2,3). These patients may present with subtle complaints of localized or radiated pain as well as severe myelopathy with motor and sensory deficits, usually requiring prompt surgical treatment1,6,23). Since the first description of a herniated thoracic disc by c. a. key in 1838, surgical management of thoracic disc herniation (tdh) has proven to be a challenge . In mixter and barr's famous 1934 report on surgery for disc herniation, four patients had tdhs - of those, three underwent surgery with disastrous results: two of them developed paraplegia postoperatively while the third died of unknown causes10,21). Poor results such as these were replicated throughout the early and mid - twentieth century and soon recognized to be secondary to cord manipulation during a laminectomy - only posterior approach17,18). Consequently, several posterolateral and anterior approaches were developed to avoid cord manipulation, such as lateral extracavitary12) and its variant, costotransversectomy15), transthoracic - transpleural16), transpedicular23), video - assisted thoracoscopic19) and transthoracic - retropleural, either open20) or minimally - invasive28). Today, cord manipulation is recognized as extremely deleterious and kept to a minimum; accordingly, neurologic morbidity rates have decreased steeply after these new techniques were introduced . Other complications are more commonly encountered today, such as those resulting from a transthoracic exposure (pleural effusion, post - thoracotomy pain, etc .) Or incomplete cord decompression1,3,9,29). Given the limited visualization of the anterior dura afforded by posterolateral approaches and the frequently calcified nature of tdhs, the preferred approach for midline tdhs is anteriorly through the thoracic cavity, either transpleural or, as recently described, retropleural3,10,29). We present a case in which the application of intraoperative ultrasound (us) enabled us to successfully perform a transpedicular approach for a midline, calcified tdh and discuss its potential applications and deficiencies . A 41-year - old woman with a prior medical history of coccidioides meningitis requiring a ventriculoperitoneal shunt (vps) in 2010, presented with a complaint of inability to walk, involuntary movements of her lower extremities and nocturia for 4 months . On exam, she could only stand with assistance and was unable to walk more than 2 - 3 steps (nurick 4). Spastic paraparesis (mrc 4/5, nurick 4) with patellar and ankle clonus and up - going toes to plantar stimulation were noted . A diagnosis of thoracic myelopathy was made and computed tomography (ct) and magnetic resonance imaging (mri) were obtained . A large, calcified, midline tdh was found at t7 - 8 causing cord deformation and signal change (fig . Brain imaging was also obtained and remained unchanged compared to after her vps three years before . Following endotracheal intubation and continuous blood pressure monitoring, the patient was positioned prone on the open jackson frame . Care was taken at all times to maintain a mean blood pressure of at least 80 mm hg and intraoperative somatosensory evoked potential (ssep) and motor evoked potential (mep) monitoring were set up . The spinous, transverse and articular processes of t6 through t8 were exposed with the bovie cautery and vertebral levels were confirmed once again with anteroposterior fluoroscopy . Laminectomies from t6 to t8 were performed with a high - speed bur and epidural bleeding controlled with a combination of hemostatic agents . At this point, the ultrasound probe (ust-9120 3.75 - 10 mhz multi - frequency convex probe, hitachi aloka, tokyo, japan) was brought into the field and utilized to localize the anterior tdh, thus confirming the t7 - 8 level again (fig . This probe was brought intermittently into the operative field for use by the surgeon himself, when the cavity would be filled with warm saline . Care was maintained at all times to provide a minimum working distance of 3 cm to the exposed dura . . The left t7 inferior articular process, t8 superior articular process and pedicle were removed with a high - speed bur thus completely exposing the left t8 nerve root and t7 - 8 disc (fig . Ligation of the t8 nerve root was not necessary as it was found in its typical location, on the rostral part of the foramen . The t7 - 8 disc was incised with a #11 blade and, as expected, little material could be obtained . The calcified, midline tdh could be palpated and delimited with a variety of angled curettes and instruments . We thus proceeded to create a cavity in the t8 vertebral body as described by jefferson and utilized a combination of angled instruments to dissect the calcified mass from the anterior dura; as this plane was delimited, the calcified mass was pushed anterior into the crevice and then removed piecemeal13). Alternatively, an angled instrument was also inserted from the opposite side and used to push the mass towards the left, where it could be manipulated; this did not require any additional removal of the right articular processes beyond a standard laminectomy (fig . 2c). The us probe was frequently brought into the field to assess cord decompression progress until the calcified tdh had been completely resected (fig . No objective instability was observed; as the right t7 - 8 zygapophysial joint was rendered almost intact and the vertebral body cavity was estimated at less than 10% of the vertebral body, an instrumented fusion was not considered necessary . Estimated blood loss (ebl) was 150 ml and the procedure lasted 2 hours . Ssep and mep monitoring remained unchanged and the patient woke up from surgery at her neurological baseline . She was discharged home on postoperative day 3 and gait improved steadily over the first few days . Three months after surgery, she is able to walk unassisted, though her gait has not returned to normal (nurick 2). A 41-year - old woman with a prior medical history of coccidioides meningitis requiring a ventriculoperitoneal shunt (vps) in 2010, presented with a complaint of inability to walk, involuntary movements of her lower extremities and nocturia for 4 months . On exam, she could only stand with assistance and was unable to walk more than 2 - 3 steps (nurick 4). Spastic paraparesis (mrc 4/5, nurick 4) with patellar and ankle clonus and up - going toes to plantar stimulation were noted . A diagnosis of thoracic myelopathy was made and computed tomography (ct) and magnetic resonance imaging (mri) were obtained . A large, calcified, midline tdh was found at t7 - 8 causing cord deformation and signal change (fig . Brain imaging was also obtained and remained unchanged compared to after her vps three years before . Following endotracheal intubation and continuous blood pressure monitoring, the patient was positioned prone on the open jackson frame . Care was taken at all times to maintain a mean blood pressure of at least 80 mm hg and intraoperative somatosensory evoked potential (ssep) and motor evoked potential (mep) monitoring were set up . The spinous, transverse and articular processes of t6 through t8 were exposed with the bovie cautery and vertebral levels were confirmed once again with anteroposterior fluoroscopy . Laminectomies from t6 to t8 were performed with a high - speed bur and epidural bleeding controlled with a combination of hemostatic agents . At this point, the ultrasound probe (ust-9120 3.75 - 10 mhz multi - frequency convex probe, hitachi aloka, tokyo, japan) was brought into the field and utilized to localize the anterior tdh, thus confirming the t7 - 8 level again (fig . This probe was brought intermittently into the operative field for use by the surgeon himself, when the cavity would be filled with warm saline . Care was maintained at all times to provide a minimum working distance of 3 cm to the exposed dura . . The left t7 inferior articular process, t8 superior articular process and pedicle were removed with a high - speed bur thus completely exposing the left t8 nerve root and t7 - 8 disc (fig . Ligation of the t8 nerve root was not necessary as it was found in its typical location, on the rostral part of the foramen . The t7 - 8 disc was incised with a #11 blade and, as expected, little material could be obtained . The calcified, midline tdh could be palpated and delimited with a variety of angled curettes and instruments . We thus proceeded to create a cavity in the t8 vertebral body as described by jefferson and utilized a combination of angled instruments to dissect the calcified mass from the anterior dura; as this plane was delimited, the calcified mass was pushed anterior into the crevice and then removed piecemeal13). Alternatively, an angled instrument was also inserted from the opposite side and used to push the mass towards the left, where it could be manipulated; this did not require any additional removal of the right articular processes beyond a standard laminectomy (fig . The us probe was frequently brought into the field to assess cord decompression progress until the calcified tdh had been completely resected (fig . No objective instability was observed; as the right t7 - 8 zygapophysial joint was rendered almost intact and the vertebral body cavity was estimated at less than 10% of the vertebral body, an instrumented fusion was not considered necessary . Estimated blood loss (ebl) was 150 ml and the procedure lasted 2 hours . Ssep and mep monitoring remained unchanged and the patient woke up from surgery at her neurological baseline . She was discharged home on postoperative day 3 and gait improved steadily over the first few days . Three months after surgery, she is able to walk unassisted, though her gait has not returned to normal (nurick 2). Surgical approaches for tdh have evolved dramatically since the first surgical report by adson in 19224,13). While laminectomy alone has been abandoned due to dismal neurological outcomes, the time - honored open transthoracic, transpleural approach still poses considerable challenges - an access surgeon, double - lumen endotracheal intubation, ipsilateral lung deflation and a chest tube are typically required . In a recent series of open transthoracic cases, ayhan et al . Report good neurological outcomes (90% improved or stabilized myelopathy) but some of the reported figures are concerning that this approach may not be applicable to the sickest patients: 605 ml mean ebl, four days of chest drainage and seven days in - hospital stay on average3). Vats was described by mack et al . For tdhs and though less invasive than the open alternative, still requires an access surgeon, lung deflation and a chest tube while some additional training in utilizing 2d optics is required3,19). The latest development in anterior approaches for tdh has been the minimally - invasive (mis) lateral approach through a tubular channel . These may be performed retro- or transpleural but have been described without the assistance of the access surgeon, double lumen intubation or lung deflation7,28,29). A chest tube may or may not be required depending on the surgeon's preference; neurological outcomes have been very good and ebl better or equivalent to vats3,28,29). Long working distances also pose less of a challenge today since special retractors have been made available, though they may still be a concern for surgeons unfamiliar with tubular techniques - in the reported patient, working distances would be in the order of 140 mm . Regardless of the type of anterior approach, the risk of injury to chest wall vessels exists and instances of such episodes are inferred from major report quoted above - maximum ebl in each series ranged from 1500 to 3000 ml1,3,29). Posterolateral approaches to tdhs were developed in the 1960s and their applications have been greatly expanded . They are preferable, when feasible, to any of the anterior approaches and have been reported in a minimally - invasive variation as well5,8,10,14). However, visualization of the anterior dura is limited and posterolateral approaches have created a set of complications of their own, especially inadequate anterior decompression of the spinal cord9). Posterolateral approaches are therefore typically reserved for those " soft " tdhs located off the midline8,9,10). In order to circumvent this visualization problem, we applied ultrasound guidance to the transpedicular approach previously described by patterson and arbit23). Intraoperative us guidance in spine surgery was first reported in 1978 by reid for intrinsic cord lesions but has been since applied to both anterior and posterior approaches for degenerative disease across all vertebral segments11,22,24,25). It is an inexpensive and accurate method to supply the surgical team with real - time imaging without the use of ionizing radiation . When compared to intraoperative ct, minimal training and equipment is required and probe utilization is intuitive to any surgeon familiar with spine anatomy27). Us guidance has been applied once to tdh by stone et al . To localize an intradural disc herniation during a different posterolateral approach26). This is, however, the first time it is applied to a transpedicular approach to assess cord decompression in a midline calcified tdh; as such, it is applicable to any open posterolateral approach and should be considered an important surgical adjunct . Surgical management of a midline, calcified tdh can be a daunting task for even the most experienced surgeons . Posterolateral approaches, especially the transpedicular approaches, have become the procedure of choice for off - midline tdhs . The utilization of intraoperative us further expands its application to encompass midline, calcified tdhs while enabling the surgeon to avoid cord manipulation . It is still unclear to us if this technique could be applied to every midline tdh, particularly those suspected of having an intradural component; only continued utilization will answer this question . This is a viable alternative of midline tdhs especially for surgeons unfamiliar with tubular techniques or patients who cannot risk the potential complications of an anterior approach . Intraoperative ultrasound is a simple yet valuable tool that can provide real - time visualization of the dura - disc interface, objective assessment of spinal cord decompression and disc removal during transpedicular thoracic discectomy when direct visualization is limited . Spine surgeons should take this valuable tool into consideration when choosing surgical approaches for thoracic disc herniations . The real - time visualization provided by intraoperative us increases the safety profile of posterior approaches and may make thoracotomy unnecessary in a selected group of patients, especially when a patient has existing pulmonary disease or is otherwise not medically fit for the transthoracic approach.
Acute hemorrhagic leukoencephalitis (ahle) is a rare fatal disease presenting with an acute onset of neurological abnormalities . It is categorized in a group of diseases called acute disseminated encephalomyelitis (adem). In this disease, an acute rapidly progressive hemorrhage in the white matter leads to a fulminant clinical course . The first presentations are fever and a rapid deterioration of consciousness, but it may finally lead to death within a few days . The acute onset of a rapidly progressive neurological disorder with asymmetric involvement of the brain, polymorphonuclear predominant peripheral leukocytosis, cerebrospinal fluid (csf) pleocytosis, and specific findings in the serial computed tomography scans or magnetic resonance imaging (mri) are the main criteria for the diagnosis . The areas involved in the majority of the cases are the parietal lobes, but the lesions can be seen in the subcortical white matter, mid brain, pons, corpus callosum, basal ganglia, medulla, cerebellum, and even spinal cord . The imaging techniques may also complicate the diagnosis as computed tomography and mri might show nonspecific findings such as hematoma in the basal ganglia and ventricles . In addition, symmetrical low density areas in the bilateral white matter might result in a false preliminary diagnosis of hemorrhagic cerebrovascular disease . In this case report, we present a case of ahle in children . A 13-year - old girl with loss of consciousness and right - sided parotiditis was referred to our center, imam reza hospital, mashhad university of medical sciences, from a hospital in herat (northern afghanistan). She had been admitted to that center 4 days previously because of fever and loss of consciousness . According to the girl s mother, the right side of her face was swollen on the evening of the first admission . The loss of consciousness had begun with drowsiness, which had progressed to unresponsiveness to the verbal stimuli and poor response to painful stimuli by midnight . Eventually, the patient had become completely unresponsive to any stimuli in the hospital in herat . After the initiation of supportive measures and performance of lumbar puncture, intravenous ceftriaxone, vancomycin, and acyclovir (30 mg / kg / d) was commenced for the patient . After she was admitted to our center, an informed consent was obtained from her parents . Her consciousness deteriorated even more, and she became completely unresponsive to verbal stimuli . Within 2 days, she developed respiratory failure and a decerebrated posture and subsequently spasticity of the four limbs and rigidity of the left leg . Her initial mri revealed multifocal hemorrhages without edema in the right temporal white matter (figure 1). In complete blood count lumbar puncture performed in the hospital in afghanistan, the csf showed an elevated white blood cell count (3 - 4 cells / mm) and an increased protein level (69 mg / dl). The culture of the csf regarding bacterial and viral infections was negative, although there were some limitations to serological tests, including deficit of technical instrumentations in our hospital . The result of immunological and microbiological studies, comprising hepatitis b surface antigen, anti - hepatitis a virus and hepatitis b virus, and polymerase chain reaction for herpes simplex virus, were all negative . The laboratory tests for mycoplasma and tuberculosis as well as the csf culture were also negative . Coagulation tests such as bleeding time, prothrombin time, partial thromboplastin time, and platelet count were normal . No abnormality was found in electrolyte analysis and biochemical studies such as blood sugar and liver function tests . A second mri (20 days later) showed multiple hemorrhagic lesions in the pons and thalamus of both sides (figure 2). Our diagnosis was according to clinical, radiological, and laboratory findings, and there were no pathological examinations to confirm it . There are multiple hemorrhagic lesions in the pons and thalamus of both sides . With a diagnosis of ahle, our patient was treated with methylprednisolone (20 mg / kg pulse therapy), intravenous immunoglobulin (ivig), acyclovir (30 mg / kg / d), and plasmapheresis (3-hour sessions for 3 times). After 29 days stay in the pediatric intensive care unit and under supervision of pediatric toxicologists and neurologists, she was extubated and attained a remarkable healing . Her mri demonstrated improvement (figure 3). At one year s follow - up, the treatment was completely successful and neurological examinations, comprised of mental status, motor skills, sensory skills, balance and coordination, reflexes, and functioning of the nerves, were all normal . Ahle is a rare demyelinating disease characterized by an acute rapidly progressive fulminant inflammation of the white matter . It is a more severe form of adem and is characterized by a fulminant clinical course . It is usually preceded by an infectious illness such as measles, mumps, rubella, and respiratory infections . Nevertheless, no virus or other infectious agent has been isolated from the csf or brain in case of adem . Considering clinical and imaging findings, the differential diagnosis of this disease are hemorrhagic cerebrovascular disease, infectious encephalitis, meningitis, vasculitis, fulminant multiple sclerosis, other causes of adem, and venous sinus thrombosis . Most of the patients experience a viral, bacterial, or parasitical infection and usually have fever at the time of admission . However, infectious encephalitis and meningitis are similar to ahle as they are both usually preceded by an infectious disease such as measles, mumps, and respiratory tract infections . Our patient had parotiditis on admission, which is in favor of a viral infection . In two different reports, befort and francisci presented cases of ahle after epstein - barr virus infection in adults . Nonetheless, as can be observed in our patient, besides differences in the clinical presentations and course of the disease, vasculitis usually manifests on mri as smaller multiple lesions that are both in the cortex and in the white matter . Moreover, serological tests for collagen diseases, which are used for the diagnosis of vasculitides, were negative in our patient . Fever, leukocytosis, and csf features, which were seen in our patient, are not compatible with the diagnosis of acute fulminant multiple sclerosis . The absence of oligoclonal bands is another characteristic for the exclusion of acute fulminant multiple sclerosis . It is very difficult to distinguish other causes of adem from ahle based on clinical and mri findings, and diagnosis is basically made via biopsy . However, there are certain epidemiological, clinical, laboratory, and pathological distinctions between them . For instance, adem is mainly a disease of children, whereas ahle is more common in young adults . In addition, ahle presents more acutely and has larger and more edematous lesions with features of hemorrhage . In our patient, several findings, including acute fulminant course of the disease, a history of parotiditis, csf profiles, indicative immunological and bacteriological tests, and mri results, strongly supported the diagnosis of ahle . Previous studies have shown that treatment with iv methylprednisolone, ivig, acyclovir, and plasmapheresis are helpful and can be life - saving . Following the same protocol, our patient recovered and was extubated . Still, as there is evidence that ahle might have a biphasic presentation, our patient should be followed up for a longer time period with several mris . Ahle is a rare and severe demyelinating disease, the mortality and morbidity of which can be lessened by early detection and treatment with steroid therapy, ivig, acyclovir, and plasmapheresis.
The prostate cancer is the most common malignant disease of men in western countries (1). Its incidence is continuously increasing korea and its age - standardized incidence rates per 100,000 men was 4.6 cases, which was the 8th - highest cause among the organ - specific malignant tumors in 2007 (2). Many pre - treatment prognostic factors have been proposed to be used to determine one of the treatment modalities and the gleason system was proved to be one of the most important prognostic factors . Histological variation within each tumor brought two grades, the predominant, or primary grade and the less extensive, or secondary grade (3). Biopsy - derived gleason score (bgs) is used as one of the most important pretreatment prognostic factors (4, 5). Though the overall accuracy of gleason grade on needle biopsies was found to be good in predicting prostatectomy specimen grade, upgrading and downgrading, large difference (2 points) between biopsy - derived and post - prostatectomy gleason scores (pgs) may confuse the clinicians in consulting the patients . At 14 medical centers in korea, the medical records of 1,582 men who underwent radical prostatectomy for prostate cancer between 1995 and 2007 were reviewed retrospectively . Prostate biopsy was recommended to the patients who had abnormal finding in digital rectal examination or whose serum prostate specific antigen (psa) level was above 3.0 or 4.0 ng / ml according to the policy for prostate biopsy of each medical center . All the pathologic slides of 18-gauge needle biopsy and the surgical prostate specimen from the involved medical centers were reevaluated by single expert uropathologist . According to the 2005 international society of urological pathology (isup) consensus on gleason grading of prostatic carcinoma (8), bgs was defined as summation of primary gs and highest grade gs of all biopsy cores; and pgs was defined as summation of primary and secondary gs in the prostate specimen . Tumor volume was measured in the whole mount section of the resected prostate by the pathologist . The patients who took neoadjuvant therapy including androgen deprivation or radiation therapy and the patients whose pathological slides showed too poor quality to reevaluate were excluded . Biochemical failure was defined as serum psa elevation above 0.2 ng / ml from nadir after radical prostatectomy . Time to biochemical failure was measured by the time interval from radical prostatectomy to biochemical failure . Needle biopsy specimen was taken from 6 (10.9%), 8 (8.4%), 10 (14.8%) and 12 cores (65.8%) and additional cores of suspicious nodules . Clinical stage was classified into ct1, ct2, and ct3 based on digital rectal examination and mri findings . Operation procedure was included 1,036 radical retropubic prostatectomies (71.6%), 220 radical perineal prostatectomies (15.2%), 125 laparoscopic radical prostatectomies (8.6%) and 65 robot - assisted radical prostatectomies (4.5%). Mean age was 64.9 (38 - 85) yr old and preoperative spsa was 11.8 ng / ml . The distribution of bgs was 46.7%, 39.5% and 13.8% in gs 6, 7, and 8, respectively (table 1). According to the difference between bgs and pgs, the patients were divided into three groups: group a (decreased in pgs by 2 or more), group b as a control group (changed in pgs within 1 point), and group c (increased in pgs by 2 or more). We evaluated various clinicopathological factors of prostate cancer, including age, preoperative spsa, the number of biopsy cores, the highest cancer% in biopsy cores, clinical and pathological stage, volume% and distribution of cancer cells in surgical specimen, and surgical margin status, univariately and multivariately . Anova and chi - square test was used for analysis of the variables in three groups . Scheffe's method and dunnett's c method were used for post - hoc test for identifying the groups which made difference . Kaplan - meier method and log rank test and cox - regression hazard model this study was reviewed and approved by the institutional review board of the samsung medical center (no . This study was reviewed and approved by the institutional review board of the samsung medical center (no . Each group included 30 (2.1%), 1,361 (94.1%) and 55 (3.8%) patients . Group a included bgs 7, 9 and 10 by 26.7%, 70.0%, and 3.3%, respectively, and group c, bgs 4, 5, 6, 7, and 8 by 5.5%, 7.3%, 21.8%, 63.6%, and 1.8% (table 1). In the comparison of the clinicopathological factors of the three groups, the number of biopsy cores, maximal cancer% in positive cores, clinical and pathological stage, cancer volume%, and surgical margin status were significantly different (table 2). In group a and c, maximal% of tumor in biopsy cores (p <0.001 and p = 0.032, respectively) and margin positivity (p = 0.025 and p = 0.002, respectively) were higher than the control group b and pathological t stage was also worse in the group a and c than the control group b (p = 0.006 and p <0.001, respectively). In group c, the number of biopsy core was significantly lower but tumor volume% in the pathology specimen was significantly higher and tumor was more widely distributed in the prostate specimen than the control group b (p = 0.001), which were different aspects from group a (table 3). Of the patients in group a, 73.3% diagnosed as prostate cancer of bgs 9 or 10 and their pgs fell into pgs 7 or 8 . Though pgs of 8 patients (26.7%) who was diagnosed as bgs 7 was decreased to 5, the pathological stage of 7 of them were pt2c or higher . Hazard ratio (hr) for biochemical failure was significantly higher in both groups (group a, hr 2.385, 95% ci [1.222 - 4.656] p = 0.011; group c, hr 1.750, 95% ci [1.147 - 2.672], p = 0.009) (fig . The median time to biochemical failure in group a and c were 46.0 and 62.6 months respectively but that of the control group did not reach median value within follow - up period . In multivariate analysis, however, this difference of bgs and pgs was not an independent prognostic factor of biochemical recurrence . Well - known prognostic factors of prostate cancer such as pgs (p = 0.045), pt stage (p <0.001), surgical margin (p = 0.004) were significant in multivariate analysis (table 4). It has been noted that there is 20%-40% of discrepancy between bgs and pgs in the pathology of prostate cancer (6, 7, 9). Interestingly, in the univariate analysis, the result of current study demonstrated that the patients with this large difference between gs of pre- and post - prostatectomy showed worse clinicopathological findings and worse prognosis in biochemical failure than the control group irrespective of increase or decrease of the pgs compared with bgs . A similar study to this, in which the patients were classified into three groups, namely, upgraded, downgraded, and unchanged, proposed that gs upgrading was associated with adverse pathological outcome compared with downgraded and unchanged groups, which included higher rates of extraprostatic extension, lymph node metastasis, positive surgical margins, and seminal vesicle invasion (7). Of the patients who showed two or more points some of them were diagnosed as pgs 5, however, pathological stage of most of them was pt2c or higher . One of the reasons of this discrepancy between bgs and pgs may be sampling error in biopsy of heterogenic and multicentric prostate cancer (10). Prostate cancer which showed uniform pattern histology was reported only 12%-33% in several studies (11). Needle biopsy specimen could be obtained mainly in high grade of tertiary component, which would be ignored in prostatectomy specimen . If the biopsy specimen contained small amount of high grade prostate cancer, the pathologists would be tend to diagnose needle biopsy specimen as more aggressive cancer . In a study, analyzing 101 completely sectioned whole - mounted radical prostatectomy samples, the average number of different grades was 2.7 (range 1 - 5) (12). In an extended study with 155 tumors from 61 whole - mounted radical prostatectomy samples, 15% of tumors included three or more histological grades (13). A recent meta - analysis revealed that the presence of tertiary grade correlated with pathological stage, psa recurrence and clinical progression (14). In several studies, samples characterized with pathological variables of poor outcome, such as extraprostatic extension and positive surgical margins contained a high grade tertiary component with consistently higher frequency (15, 16). Therefore bgs of the patients in group a rather than pgs may reflect prognosis and should be considered as one of the important prognostic factors together with pathological stage . The patients who showed two or more points increase in pgs from bgs also demonstrated aggressive tumor burden and poor prognosis in biochemical failure . In these patients, a recent study of 301 patients with low - risk prostate cancer (clinical stage t1c - t2a, psa 10 ng / ml, and bgs 6) who underwent an extended (10-core) prostate needle biopsy, in men assessed with 10 - 12 cores, the rate of gs upgrading was 47.9%, which was significantly higher than 23.5% in 18 cores (17). In another study, the authors proposed that prostate size and number of sampling was associated with gleason upgrading (18). The mean prostate volume of the patients in group c was smaller than that of control group . On the other hand, tumor volume in whole - mount prostate was bigger . Thus insufficient number of prostate sampling, especially in small prostate containing aggressive cancer might cause gleason upgrading . However, multivariate analysis showed clinical significance not in the difference of bgs and pgs but in well - known prognostic factors of prostate cancer such as spsa, bgs or pgs itself, pt stage and surgical margin . In the clinical settings, even if both of the clinicians and the patients would be confused with the somewhat large discrepancy in bgs and pgs, it can be ignored compared with other well - known prognostic clinicopathological factors . However, the clinicians had better kept in mind that many of these patients who showed large discrepancy in bgs and pgs might have other unfavorable clinicopathological factors of prostate cancer . Bias related with interobserver variation in the pathologic result of gleason score or gleason sum would be one of major limitation of this kind of study . A considerable interobserver variation in the gleason scores of prostate cancer referred to several studies has been reported (19, 20). In addition, we did not review the tertiary component of prostate cancer specimen in group a, and survival analysis was not included due to the short follow - up period . Practically, the large gleason score gap of 2 or more points in bgs and pgs rarely occurs . In the current study, the total number of reviewed patients was 1,582, however, the number of focused patients was very small, which can be addressed as another limit point . In summary, clinical significance of a large difference (2 points) between biopsy and post - prostatectomy pathological gleason scores in patients with prostate cancer changhee yoo, cheol young oh, jin seon cho, cheryn song, seong il seo, hanjong ahn, tae - kon hwang, jun cheon, kang hyun lee, tae gyun kwon, tae young jung, moon kee chung, sang eun lee, hyun moo lee, eun sik lee, young deuk choi, byung ha chung, hyung jin kim, wun - jae kim, seok - soo byun, and han yong choi large difference (2 points) between biopsy - derived (bgs) and post - prostatectomy gleason scores (pgs) may confuse the clinicians in consulting the patients with prostate cancer . In the present study, we compared the prognosis of patients with the difference between pgs and bgs . When the pgs was changed from bgs by 2 points or above, such patients showed poor prognosis . Strikingly, even in the decreased group (pgs <bgs) showed poor prognosis . However the large difference between bgs and pgs was not an independent prognostic factor, and one should be cautious in the interpretation of the scoring values.
Microbiological confirmation of bacterial infection is rarely achieved in children with acute lower - respiratory - tract infections (alrtis) because of the inability to obtain material from the infection site (ie, the lung). Treatment is, therefore, mostly empirical, which irrevocably leads to overtreatment and sometimes undertreatment . Sputum induction with nebulized hypertonic saline can help adequately produce sputum in children who are otherwise unable to do so . Sputum induction is routinely used to obtain samples for microbial cultures in pediatric illnesses such as cystic fibrosis and tuberculosis . It may also be useful in establishing a causative diagnosis of alrti in otherwise healthy children . The purpose of this study was to determine the effectiveness of sputum induction in obtaining good quality sputum in children with clinically suspected alrti in the everyday, busy general hospital setting . A prospective study in 2 large regional hospitals (jeroen bosch hospital and mxima medical centre) in the netherlands was conducted between october 2009 and october 2011 . Children aged 6 months to 18 years presenting with suspected alrti were eligible for inclusion . Suspected alrti was a clinical diagnosis of the attending physician, with tachypnea and 1 of the following symptoms: dyspnea, fever, cough, and/or abdominal pain . Exclusion criteria for participation were a recent severe asthma exacerbation, oxygen saturation 92%, anatomical airway abnormalities, and the use of -blockers or diuretics blood inflammation parameters (ie, leukocyte count and c - reactive protein [crp] level), blood culture, and chest x - ray were performed before initiation of the study procedure as part of routine diagnostics . Sputum induction was performed with hypertonic saline (nacl 5.8%) inhalation using a nebulizing device with oxygen flow . When a patient was unable to expectorate sputum after induction, a sterile suction catheter was used to obtain secretions from the oropharynx . Specimens were considered of good quality if <25 squamous epithelial cells and> 25 leukocytes were present per low - power field (10x lens objective). Sputum samples were cultured for 48 hours using routine microbiological procedures . A concomitant nasopharyngeal lavage sample was also obtained and used for routine bacterial culture . Also, infection with influenza a, influenza b, respiratory syncytial virus (rsv), and human metapneumovirus (hmpv) was routinely investigated by polymerase chain reaction on nasopharyngeal specimens, if considered necessary by the treating physician, taking into account anticipated seasonal circulation . Continuous data were first analyzed for normality using stem - and - leaf plots and quantile - quantile plots, after which either a t - test or mann - whitney u test for nonparametric data was performed . To assess the agreement between sputum and nasopharyngeal bacterial cultures, a simple coefficient was calculated . Spss (version 22.0; ibm corp, armonk, ny) was used for all statistical analyses . A prospective study in 2 large regional hospitals (jeroen bosch hospital and mxima medical centre) in the netherlands was conducted between october 2009 and october 2011 . Children aged 6 months to 18 years presenting with suspected alrti were eligible for inclusion . Suspected alrti was a clinical diagnosis of the attending physician, with tachypnea and 1 of the following symptoms: dyspnea, fever, cough, and/or abdominal pain . Exclusion criteria for participation were a recent severe asthma exacerbation, oxygen saturation 92%, anatomical airway abnormalities, and the use of -blockers or diuretics blood inflammation parameters (ie, leukocyte count and c - reactive protein [crp] level), blood culture, and chest x - ray were performed before initiation of the study procedure as part of routine diagnostics . Sputum induction was performed with hypertonic saline (nacl 5.8%) inhalation using a nebulizing device with oxygen flow . When a patient was unable to expectorate sputum after induction, a sterile suction catheter was used to obtain secretions from the oropharynx . Specimens were considered of good quality if <25 squamous epithelial cells and> 25 leukocytes were present per low - power field (10x lens objective). Sputum samples were cultured for 48 hours using routine microbiological procedures . A concomitant nasopharyngeal lavage sample was also obtained and used for routine bacterial culture . Also, infection with influenza a, influenza b, respiratory syncytial virus (rsv), and human metapneumovirus (hmpv) was routinely investigated by polymerase chain reaction on nasopharyngeal specimens, if considered necessary by the treating physician, taking into account anticipated seasonal circulation . Continuous data were first analyzed for normality using stem - and - leaf plots and quantile - quantile plots, after which either a t - test or mann - whitney u test for nonparametric data was performed . To assess the agreement between sputum and nasopharyngeal bacterial cultures, a simple coefficient was calculated . Spss (version 22.0; ibm corp, armonk, ny) was used for all statistical analyses . Informed consent was obtained for 126 patients with suspected alrti, but 28 patients (22%) did not complete the study procedure and were excluded in the analysis of the microbiological sputum data (figure 1). In 3 patients, the final study group consisted of 98 patients, with a median age of 2.6 years (range = 0.5 - 16.8 years). The study and drop - out groups were not significantly different in terms of age (p = .694), sex (p = .365), leukocyte count (p = .725), crp level (p = .444), or radiological diagnosis (p = .289). Flow diagram of the study group and sputum samples . In 89/98 (91%) patients, only 4 patients were unable to produce sputum after completing the induction procedure; 5 samples were of poor quality and were, therefore, not processed (figure 1). Mild adverse reactions were reported in 6 patients: cough (n = 3), vomiting (n = 1), wheezing (n = 1), transiently decreased oxygen saturation (n = 1), and mild epistaxis (n = 1). No treatment was needed for the adverse reactions; no serious adverse events were reported . Bacterial pathogens were isolated in 22/89 sputum cultures (25%); 13 samples grew only 1 pathogen: haemophillus influenzae (n = 8), streptococcus pneumoniae (n = 1), staphylococcus aureus (n = 2), moraxella catarrhalis (n = 1), sphingomonas paucimobilis (n = 1). In 9 samples, 2 bacterial pathogens were isolated: h influenzae + m catarrhalis (n = 3), h influenzae + streptococcus pneumoniae (n = 5), and streptococcus pyogenes + pseudomonas aeruginosa (n = 1). The detection of bacteria in sputum samples was similar in patients with and without radiologically confirmed pneumonia (24% vs 27%, p = .483). When comparing the detection of bacteria in sputum cultures with their concomitant nasopharyngeal bacterial cultures (n = 76), different pathogens were frequently found . In 15 sputum samples, a bacterial pathogen was also found in the concomitant nasopharyngeal culture; 19 nasopharyngeal cultures yielded bacterial pathogens that were not found in concomitant sputum cultures . In 6 sputum samples, the bacterial pathogen was only detected in sputum and not in the concomitant nasopharyngeal aspirate: moraxella catarrhalis (n = 3), haemophilus influenzae (n = 4), and sphingomonas paucimobilis (n = 1). No significant associations between the sputum and nasopharyngeal bacterial yield were found, with the exception of haemophilus influenzae (= 0.538). Viral (co)infections (rsv, hmpv, influenza a, and influenza b) were found in 35/75 (47%) nasopharyngeal specimens . The viral presence did not differ between the bacterial sputum culture positive and negative groups (p = .484) or between the children with and without radiologically confirmed pneumonia (p = .87). This study shows that good quality sputum samples could be obtained by an induced sputum collection procedure in our everyday, busy general hospital setting in 91% of children with clinically suspected alrti . Our success rate is significantly higher than previously reported, using similar definitions of sputum quality . Bacterial pathogens were found in 25% of induced sputum samples . Not unexpectedly, haemophilus influenzae, streptococcus pneumoniae, and moraxella catarrhalis were found most frequently . In 29% of positive sputum cultures, the bacterial pathogen was found only in sputum and not in the concomitant nasopharyngeal aspirate culture, suggesting its origin from the lower respiratory tract . These findings support our hypothesis that sputum induction is useful to support etiological diagnoses in every day practice because its yield is significantly higher when compared with blood culture or acute phase serology . The relatively low percentage of bacterial pathogens detected from induced sputum samples is probably a result of the fact that many alrtis were in fact viral infections, as is common in young children . Induced sputum not only identifies bacterial pathogens but can also help exclude bacterial infections and, thus, reduce overtreatment with antibiotics when comparing our results with those of a similar study performed by mermond et al, there is a difference in bacterial sputum yield (25% vs 50%). However, their good quality sputum yield was significantly lower than ours (91% vs 25%), which was attributed by the authors to methodological problems . Another study by lahti et al found evidence for a bacterial infection from induced sputum in 79% of cases but only included patients with radiologically confirmed pneumonia . In our cohort, we found no difference between the presence of common viral and/or bacterial pathogens and radiological diagnosis . Because the use of radiology for the diagnosis of alrtis has been a major point of discussion, study inclusion based on clinical suspicion of alrti probably gives a more realistic reflection of everyday practice . Even though we found no significant difference in baseline characteristics between the groups, the drop - out percentage after inclusion (22%) is a limitation of our study, but is similar to that in the study by lahti et al, a study that is currently seen as a justification of sputum induction in alrtis . Another limitation of our study is that we cannot rule out the possibility that, occasionally, the induced sputum did not reflect the etiology of the alrti because we did not compare the induced sputum cultures with material retrieved directly from the lungs by bronchoalveolar lavage or thoracocentesis, which would obviously have been unethical to perform in these non critically ill children . The majority of bacteria found in sputum cultures were also present in the concomitant nasopharyngeal cultures . This could either mean that the sputum sample was contaminated while passing the upper - respiratory tract during expectoration or that an invasive infection by a colonizing bacterial pathogen had taken place, which is a known phenomenon in respiratory tract infections . It is likely that many bacteria cultured from induced sputum during an acute respiratory tract infection play a causative role . In conclusion, we found that sputum induction in children with suspected alrtis in a general hospital setting provides good quality sputum in most cases, with infrequent and only mild adverse events . It can be a useful tool for the general pediatrician to promote pathogen - based treatment of alrtis in everyday clinical practice . Iyb contributed to the conception and design; contributed to acquisition, analysis, and interpretation of data; drafted the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Mm contributed to the acquisition and interpretation of data; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Rvg contributed to acquisition of data; critically revised the analysis and first drafts of the manuscript; could not give final approval (deceased). Mhvl contributed to acquisition and interpretation of data; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Mh contributed to analysis of data; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Aw contributed to the conception and design; contributed to interpretation; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Pcw contributed to the conception and design; contributed to interpretation; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy . Edv contributed to the conception and design; contributed to acquisition, analysis, and interpretation of data; codrafted the manuscript; critically revised the manuscript; gave final approval; and agrees to be accountable for all aspects of work ensuring integrity and accuracy.
Blood pressure levels in the very elderly are more scattered than in younger elderly or middle - aged persons . After initial blood pressure increase, which occurred up to the seventh decade in both sexes, furthermore, levels of blood pressure in the very elderly have paradoxical inverse relationship to morbidity and mortality . The most described covariates and consequences of blood pressure decline have been shorter survival [46], cognitive decline [7, 8], and dementia [912]. Heart studies showed that demented patients had lower blood pressure and thinner left ventricle posterior wall . Cognitive impairment was also common in subjects with heart failure combined with hypotension [14, 15]. Studies describing ambulatory blood pressure (abpm) are mainly focused on younger elderly or middle - aged persons, mainly with essential hypertension, and seldom comprising population - based samples [1620]. Frequency of sustained, white - coat, and reverse hypertension in the very elderly is also unknown . In most study centers, a profile of abpm in younger elderly or middle - aged persons was used as a predictor of vascular events later in their life . In the very elderly, level of abpm should be regarded not only as a predictor of target organ damage, but also as a mirror of general vascular status . The aim of our study was to assess a profile of abpm in a cohort of octogenarian men who were longitudinally followed since random inclusion from a population of city of malm, sweden . Contrary to previous studies, we assessed an impact of vascular and life - style risk factors observed at age 68, and a time progress of atherosclerotic disease, on the abpm profile when subjects reached the age of 82 years . It includes all men born in the even months of 1914 in the city of malm, sweden . A total of 809 men were invited to participate in the study, and 703 men took part in the first health examination . When they were 68 years old, 465 men in the cohort and additional 95 new residents were invited to attend a new examination . The most recent followup of the cohort started when the subjects reached 81 - 82 years of age, and 281 men were found to be still alive . Of these, 185 agreed to take part (66%) in a new investigation, including both physical and psychological examinations . Blood pressure data and psychological data were available from 171 of them at the ages of 68 and 81 . In the following year study subjects and their spouses answered to a questionnaire focusing on life - style factors, prescribed medicines, and previous diseases . All underwent medical examination including hachinski ischemic score . To evaluate the role of established vascular risk factors, we measured levels of blood glucose, cholesterol, and triglycerides during fasting conditions and body mass index (bmi) at age 68 . At the recent followup at age 81, the medical examination was repeated, and 185 men answered a questionnaire focusing on lifestyle and health markers . Possible dementia was classified according to the dsm - iv criteria, and one subject was diagnosed as being demented . Two established markers of vascular disease were examined: carotid stenosis, determined using carotid ultrasound at age 81, and low peripheral circulation in the lower extremities, estimated using the ankle - brachial pressure index (abi) at ages 68 and 81 . The clinic blood pressure (cbp) was measured sphygmomanometrically in the upper right arm, in the supine position after 15 min of rest at age 68 and at age 81, using a calibrated mercury manometer and rubber cuffs (12 35 cm for normal, and 15 cm for obese subjects). Hypertension was defined as systolic and diastolic brachial bp 160 mmhg or 90 mmhg, respectively, or medication for hypertension . These hypertension criteria have been used previously and were valid until the world health organization drew up new ones in 1999 . All the subjects had been monitored and treated during their lifetime according to these hypertension criteria, and they were thus used for the statistical analysis in this study . Ambulatory blood pressure monitoring was performed using micro am recorder, model ki5600 (kontron instruments). Readings at 20-minute intervals during a day (from 06.20 am to 09.40 pm) and at 60 min intervals at night (from 10.00 pm to 06.00 am) were performed . The ambulatory bp - measurement was performed with auscultatory method, but in case of measurement failure the examination was immediately repeated using an oscillometric method . The accuracy of ki5600 was confirmed by a simultaneous measurement with a standard mercury sphygmomanometer and accepted if they were within 10 mmhg of standard method . The exclusion of patients was made according to the quality criteria: deficit in measurement time intervals at least 6 h accumulated during a daytime or more than 3 h accumulated at nighttime, or more than 3 h consecutively during a daytime or at least 2 h consecutively during a nighttime . For the individual data, the relative nocturnal bp fall was calculated using a formula: (daytime bp - nighttime bp) 100/daytime bp, and expressed in% . Preawakening sbp was defined as a mean of measurements at 04.00, 05.00, and 06.00 am . Postawakening sbp was a mean of measurements: 06.20, 06.40, 07.00, 07.20, 07.40, and 08.00 . Morning sbp surge is defined as a difference between postawakening sbp and mean sbp nighttime . Ankle blood pressure was estimated, both at ages 68 and 81 years, by placing a cuff at the ankle level and using doppler signal on tibial posterior artery or dorsal foot artery to detect peripheral blood flow in the supine position . Arithmetic average of duplicate recordings was used . For each leg, an ankle - brachial pressure index (abi) was calculated by dividing the ankle systolic pressure with the highest upper arm systolic pressure value . The examination of carotid arteries was made at age 81, using computed sonography system (acuson xp 10, acuson, mountain view, calif, usa) with a 7 mhz b - mode real - time linear scanner, including a 5 mhz - pulsed and color - coded doppler . The color - coded doppler was used to localize areas with high - flow velocities in the internal carotid artery, and the maximum - flow velocity (m / s) was measured with the pulsed doppler . Differences in vascular risk factors / markers were calculated with mann - whitney rank sum test . Local ethical committee at lund university accepted the study, and informed consent was obtained from all participants . Values of abpm, that is, daytime and nighttime sbp, dbp, systolic and diastolic variability (mean sd - sbp and sd - dbp), nocturnal sbp fall, morning sbp surge, preawakening sbp, and postawakening sbp are presented in table 1 . Levels of clinic blood pressure, p - cholesterol, triglycerides, and b - glucose as well as markers of vascular disease, that is, carotid stenosis, ankle - brachial index, and its time - change during follow - up, are also presented . Compared to a sample of 70-year - old population of uppsala, sweden, subjects of this study had lower mean daytime sbp with 9 mmhg, mean dbp, and pp with 5 mmhg but the same variability / standard deviation . At nighttime, data of this cohort and uppsala cohort were similar concerning sbp, dbp, and pp . Compared to a sample (age 73 6) from a population of madrid, spain at daytime, mean values of sbp, dbp, pp, and sd were very similar with only 1 - 2 mmhg differences . The same was observed if compared to nighttime values, except for nighttime pp which was lower with 5 mmhg in this study . Compared to 15-year younger japanese population - based sample of ohasama study (mean age 66.7 y), subjects of this study had similar daytime sbp and dbp but higher nighttime sbp with mean 5 mmhg . Compared to italian pamela population study (mean age 69.0 y 2.3), subjects of this study had similar daytime values, higher nighttime sbp with 6 mmhg but not dbp [25, 26]. Compared to the oldest sample of population - based study from dublin, ireland (age 5079 y), subjects of this study had lower daytime sbp with 2 mmhg, daytime dbp with 4 mmhg, higher nighttime sbp with 7 mmhg, and equal mean nighttime dbp . Daytime values of the irish study were similar to this study in the sample at age 4049 y. compared to uruguayan population sample of men untreated for hypertension at age> 70 y, subjects of this study had lower mean daytime sbp with 3 mmhg, dbp with 5 mmhg, and mean nighttime sbp with 3 mmhg but similar nighttime dbp . Compared to younger elderly (5059 and 6069 y), subjects of this study had similar daytime and nighttime sbp but lower daytime dbp with 7 mmhg and nighttime dbp with 3 mmhg . In a population study from denmark, compared to the subgroup at age 7079 y, subjects of this study had lower daytime sbp with mean 7 mmhg, daytime dbp with 3 mmhg, higher nighttime sbp with 3 mmhg, and lower dbp with 2 mmhg . Compared to the subgroup at age 6069 y, subjects of this study had lower daytime sbp with mean 12 mmhg, daytime dbp with 10 mmhg, the same nighttime sbp, and lower dbp with 3 mmhg . Compared to the subgroup at age 5059 y, subjects of this study had lower daytime sbp with mean 3 mmhg, daytime dbp with 5 mmhg, higher nighttime sbp with 6 mmhg, and lower dbp with 2 mmhg . Small samples of the danish study were presented by high standard deviation of each bp value . Hypertension, diagnosed or treated during the first followup at age 68, has been tested as possible predictor of abpm 14 years later (table 2, right columns). The values of abpm did not differ between subjects who were hyper- and normotensive at age 68 . When hypertension was defined with the same criteria at age 81 (table 2, left columns), the values of abpm examined the same year differed between the groups and presented, in hypertensive subjects, higher daytime sbp and pp, and higher nocturnal sbp and pp, and higher pre- and postawakening sbp, but we have previously shown that blood pressure dynamics differed in these study subjects during the followup . Those, who presented higher clinic bp levels at age 68, were prone to have declining sbp until age 81 . In this study, time course of sbp correlated positively with mean sbp and daytime, nighttime, and with pre- and postawakening sbp levels (figure 2). Highest daytime sbp variability was observed in subjects with increasing office sbp . To estimate the impact of vascular risk factors at age 68 on future abpm levels, we calculated if there was a correlation between office bp, levels of p - cholesterol, triglycerides, glucose at age 68, and abpm levels 14 years later (table 3), without recording any significant values . However, bmi levels at age 68 correlated negatively with daytime dbp and its variability, that is, sd - dbp . In addition, abi levels at age 68 correlated negatively with future sbp variability and with pulse pressure at daytime, presenting the lowest abi levels in subjects with highest daytime sbp variability and pulse pressure . Abpm values have been splitted according to their smoking profile at age 68 (table 4). Those subjects who were still current smokers at age 68 had higher systolic and diastolic pressure variability (sd - sbp, sd - dbp) both daytime and nighttime . The absolute values of sbp or dbp did not differ between these groups, neither daytime nor nighttime . At age 82, the cbp correlated positively with daytime: sbp, sd - sbp, dbp, and pp, and with nighttime: sbp, dbp, and pp as well as with pre- and postawakening sbp (table 5). Clinic dbp was expressed better by daytime sbp and dbp levels, than clinic sbp . Carotid stenosis correlated positively with nocturnal and preawakening sbp and daytime pp, but not with daytime sbp or dbp values . Ankle - brachial index was lowest in subjects with higher nocturnal: sbp, pp, sbp variability, and preawakening sbp . The time course of abi between age 68 and 82 showed that the largest abi decline was reflected by higher daytime and nighttime systolic variability, that is, sd - sbp, and by higher pp, as well as by higher pre- and postawakening sbp levels, but not by daytime or nighttime sbp / dbp levels at age 82 . This study provides a longitudinal observation data on a population - based sample of elderly men between ages of 68 and 82 years . The baseline data of abpm performed in the study subjects at age 82 should be discussed in the light of other population - based samples . The majority of previously published studies on abpm included either preselected hypertensive elderly patients or examined younger elderly populations . Compared to latter studies performed in cohorts aged 7079 y, octogenarians from our study had generally lower daytime levels of sbp / dbp and in some cases even lower nighttime sbp / dbp levels . In the danish study, a similar profile of increasing abpm values in the younger samples until age of 70 y was observed, but a decreasing abpm in a subgroup at age 80 + . This age - related threshold of abpm values could be supported by our observation that the higher level of office - bp or suffering from hypertension at age 68 did not predict higher abpm neither daytime nor nighttime at age 82 . Instead, longitudinal change in clinic bp during 13 years correlated with abpm values . By analyzing abpm values in hypertensive and normotensive subjects at age 82, we could conclude that low values of abpm in the whole cohort were partly due to low abpm values in those men who were hypertensive at age 68, and at the same time developed decline of clinic bp until their 80-ties . On the other side, higher values of abpm were observed not in those subjects who were highly hypertensive at 68 but those who developed hypertension in the last decade and had largest increase in vascular burden during that time . These observations could be confirmed by the data showing that established laboratory risk factors at age 68 did not predict future levels of ambulatory blood pressure . However, lower ankle - brachial index and particularly current smoking at age 68 predicted larger bp variability both daytime and nighttime . Yet, when measured at age 81, clinic bp and being diagnosed as hypertensive at age 81 could be strongly reflected by higher values of abpm and especially diurnal pulse pressure (pp). Abpm could also adequately express the grade of atherosclerotic process at age 82 by higher nighttime and preawakening bp - levels, higher nighttime bp variability, and pp values, in those men who had higher grade of carotid stenosis, lower abi, and extended abi - decline during the 14-year followup . Possible explanation of the lower abpm values in the very elderly, compared to the younger population samples, could be a selective mortality of those subjects from our cohort, who died before age 68, that is, before the first followup, due to early hypertension, metabolic syndrome, intensive smoking, and advanced atherosclerosis . Another explanation could be the fact that survivors, who were included in this sample, had been less exposed to vascular risk factors than those who declined to take part in the last followup or died prior to it . However, in the whole examined sample, sbp decreased with mean 7 mmhg and dbp with 9 mmhg, which points to the fact that not only selective mortality is an explanatory factor, but also a part of the cohort expresses a bp decline during the last 14 observation years, which results in lower abpm levels compared to the younger population . Cigarette smoking, as the strongest risk factor at age 68, did not predict absolute values of bp in octogenarians, but increasing sbp and dbp variability (sd) by ca 20%, both daytime and nighttime . Similarly, lower abi level at age 68 predicted higher daytime sbp variability and pp, and not the absolute abpm values . At age 81, subjects defined as hypertensive expressed higher nighttime and daytime sbp, post- and preawakening sbp, and above all, higher pp . The values of clinic bp at age 81 correlated with values of abpm, mainly clinic dbp, high values which were reflected by higher daytime and nighttime sbp, dbp, sd - sbp, and pre- and postawakening sbp as well as daytime pp . It suggests that in very elderly men clinic dbp seems to express overall 24-h bp profile in a more adequate way that clinic sbp, and that diurnal pp should be used as an important complement to both clinic and diurnal bp measurements . Nocturnal values of abpm could be used as a risk factor or marker of vascular burden in the octogenarian men . Nighttime and preawakening sbp and daytime pp correlated best with a grade of carotid stenosis . Similar result were observed concerning abi, where high nighttime sbp, sd - sbp, pp, and high preawakening sbp were observed in subjects with a diminished peripheral leg circulation . The largest progress in peripheral arterial disease, expressed as a decreasing abi over 14 years, was observed not in these subjects who had high absolute abpm values, but in those who expressed high pp and high sbp - variability both night- and daytime, and had larger pre- and postawakening sbp . In conclusion, in a population sample cohort of 82-year - old men, high daytime and nighttime abpm measurements reflected increasing office - bp and aggravating atherosclerosis only in the last decade . Subjects with early developed hypertension, peripheral atherosclerosis and active smokers already in their 60 ties reached an inflection point in their blood pressure development and did not express increasing abpm values in their eighties any longer.
Regenerative medicine is an emerging field of biotechnology that combines various aspects of medicine, cell and molecular biology, materials science and bioengineering in order to regenerate, repair or replace tissues . The oral surgery and maxillofacial surgery have a role in the treatment of traumatic or degenerative diseases that lead to a tissue loss: frequently, to rehabilitate these minuses, you should use techniques that have been improved over time . Since 1990, tissue engineering has developed protocols in which it has been proposed the use of platelet concentrates, which showed enormous benefits for the patient: they favored and accelerated the post - surgical and provided a support for tissue regeneration due to growth factors contained in them . Several authors 1 - 4 have described the importance of growth factors in tissue repair processes, in fact, they are important elements for new tissue production, moreover, they perform feedback controls on inflammatory processes within the tissue graft, in cases of regenerative surgery . Whitman5 and marx6 published the first studies on the use of growth factors contained in platelet gel, called platelet - rich plasma (prp). Thanks to marx's studies, it was possible to verify that the platelet concentrate is a very effective tool for the modulation of wound healing and tissue regeneration . However, the prp showed a number of disadvantages, such as the need of having to run a complex and expensive protocol for its production . To overcome some of these problems, the prgf (plasma rich in growth factors) the prgf is considered an evolution of the prp 7,8 and it allows a higher concentration of growth factors in platelet preparation . Among the advantages of the prgf, we can cite the lesser amount of blood taken for the preparation and a procedure relatively faster, while, among the disadvantages we can mention the rapid clot formation, which require speed in its surgical use . In 2001, choukroun et coll . Prf is derived from a simple preparation protocol that does not require alteration of the blood; it is a platelet concentrate rich in gfs that contains a three - dimensional matrix of autologous, elastic and flexible fibrin . Have shown that platelet cytokines (pdgf, tgfbeta1 and igf-1) are present in three - dimensional fibrin matrix derived from these platelet concentrates; moreover, prf matrix traps glycosaminoglycans such as heparin and hyaluronic acid, which have considerable affinity with some peptides present in the bloodstream and therefore show strong ability of chemotaxis and diapedesis, useful for the healing of tissue damaged, for example, by trauma 9 . Moreover, it was shown that this matrix can be a valuable support for the transplantation of bone morphogenetic proteins (bmp) issued in a progressive manner to induce osteogenic differentiation, as demonstrated by recent studies on muscle preparations10,11; about this, the results of wiltfang et al . Are encouraging, in fact, they show an improvement of osteoblast proliferation in cases in which it was used the prf compared to prp 12 . Described a case in which is documented the filling with prf of a large osteolytic cavity and complete bone reformation 13 . Have suggested that the osteoinductive potential of prf is related to its neoangiogenic ability and concentration of gfs, in relation to the fibrin content and platelet cytokines present, all suitable for the totipotent cell migration and activation of pre - osteoblastic cells present in the surgical site, fundamental aspects for bone regeneration 14 . Platelets concentrates are, thus, versatile products in surgery, with regard to their biological properties and their easy manipulation in the form of gel or membranes; these features allow the use of prf as well as other platelet concentrates in cases, for example, of maxillary surgical sites or in the surgery of maxillary sinus 15 . The frontier of regenerative medicine nowadays is represented by the mesenchymal stem cells (mscs): overcoming the ethical problems thanks to the use of mesenchymal stem cells from adult patient, and with the increasingly sophisticated technology to support their manipulation, mscs are undoubtedly the future of medicine regenerative and they are showing perspectives unimaginable just a few years ago . Most recent studies are aimed to tissues regeneration using mscs taken from sites that are even more accessible and rich in stem cells: the oral cavity turned out to be an important source of mscs with the advantage to be easily accessible to the surgeon, thus avoiding to increase the morbidity of the patient . The aim of the regenerative medicine and tissue engineering is to regenerate and repair the damaged cells and tissues in order to establish the normal functions 16 . The regenerative medicine involves the use of biomaterials, growth factors and stem cells 17 . Regeneration of the tissues exists naturally due to the presence of stem cells with the potential to self - regenerate and differentiate into one of more specialized cell types . This regenerative potential decreases with age and regeneration is not sufficient to repair the damages produced by degenerative, inflammatory or tumor based diseases18 . Stem cells are immature and unspecialized cells with the ability to renew and divide themselves indefinitely through self - renewal and able to differentiate into multiple cell lineages 19 . The stem cells use for regenerative medicine should fit the following criteria: they can be: a) found in abundant numbers and can be differentiated in multiple cell lineages in a reproducible and controllable manner; b) isolated by minimally invasive procedure with minimal morbidity for patients, c) produced in accordance with gmp (good manufacture practice) and d) transplanted safely 20,21 . In the last decade, several improvements have been produced in the comprehension of stem cells properties in view of the fact that these cells have an important role in the repair of every organ and tissue . In general, the stem cells are divided into three main types that can be utilized for tissue repair and regeneration: i) the embryonic stem cells derived from embryos (es) 22,23; ii) the adult stem cells that are derived from adult tissue24; and iii) the induced pluripotent stem (ips) cells that have been produced artificially via genetic manipulation of the somatic cells 25 . Es and ips cells are considered pluripotent stem cells because they can develop into all types of cells from all three germinal layers . Both stem cells have technical and moral obstacles, in addition these cells are not easy to control and they can form tumors after injection22 . On the contrary, adult stem cells are multipotent because they can only differentiate into a restricted number of cell types . Adult stem cells, also termed postnatal stem cells or somatic stem cells, are discovered in a particular area of each tissue named stem cell niche . Different type of postnatal stem cells resides in numerous mesenchymal tissues and these cells are at the same time referred to as mesenchymal stem cells (mscs)24,26 . Mscs were first isolated and characterized from bone marrow (bmscs) by friedenstein et al . In 1974 27 . Subsequently, different studies have showed that mscs can be isolated from other tissues, such as peripheral blood, umbilical cord blood, amniotic membrane, adult connective, adipose and dental tissues28 - 32 . Recently, orofacial and dental tissues have acquired interest as a further accessible source of mesenchymal stem cells 33 due to the fact that the oral area is rich in mscs (table 1). Today, every cell population which has the following characteristics independently of its tissue source, is usually referred as mscs: i) they adhere to plastic and have a fibroblast - like morphology; ii) they have the capacity of self - renewal and could differentiate into cells of the mesenchymal lineage such as osteocytes, chondrocytes and adipocytes . In addition, mscs also can also differentiate, under appropriate conditions, into cells of the endoderm and ectoderm lineages such as hepatocytes and neurons, respectively 34,35 . Phenotypically, mscs express the cd13, cd29, cd44, cd59, cd73, cd90, cd105, cd146 and stro-1 surface antigens, and they do not express cd45 (leukocyte marker), cd34 (the primitive hematopoietic progenitor and endothelial cell marker), cd14 and cd11 (the monocyte and macrophage markers), cd79 and cd19 (the b cell markers), or hla class ii 36 . Research related to msc from oral origin began in 2000 37 and every year numerous investigations have demonstrated that oral tissues, which are simply available for dentists, are a rich source for mesenchymal stem cells 33,38 . Today numerous types of mscs have been isolated from teeth: in 2000 mscs were first isolated by gronthos et al . From dental pulp (dpscs)37,38 . These cells possess phenotypic characteristics similar to those of bmscs 39, and they have definitive stem cell properties such as self - renewal and multi- differentiation capacity, and can form the dentin - pulp structure when transplanted into immunocompromised mice 40 . Moreover, dpscs participate in the regeneration of non - orofacial tissues, in fact, these cells have been differentiated into hair follicle-, hepatocyte-, neuron-, islet-, myocyte- and cardiomyocyte - like cells 41 - 46 . Subsequently, mscs have been also isolated from dental pulp of human exfoliated deciduous teeth (sheds). These cells, like dpscs, have the ability to differentiate in vitro in odontoblasts, osteoblasts, adipocytes and neuron - like cells . Also sheds were able to form dentin and bone when transplanted with ha / tcp in vivo47 . The periodontal ligament is another adult mscs source in dental tissue, and periodontal ligament stem cells (pdlscs) were isolated from extracted teeth 48 . Pdlscs have the ability to regenerate periodontal tissues such as the cementum, periodontal ligament and alveolar bone 49 . Moreover, mscs have been also isolated from developing dental tissues such as the dental follicle (dfpcs)50 and apical papilla (scaps) 51 . Dfpcs have the ability to regenerate periodontal tissues whereas scaps demonstrate better proliferation and better regeneration of the dentin matrix when transplanted in immunocompromised mice with compared to dpscs 50,52,53 . Zhang et al . Have isolated mesenchymal stem cells from the gingiva, these mscs exhibited higher clonogenicity, self - renewal and multipotent differentiation capacity similar to that of bmscs 54 . Moreover, the salivary glands derived mscs could differentiate into the salivary gland duct cells as well as mucin and amylase producing acinar cells in vitro 55 . In addition, de bari et al . Demonstrated that single - cell - derived clonal populations of adult human periosteal cells possess mesenchymal multipotency, as they differentiate to osteoblast, chondrocyte, adipocyte and skeletal myocyte lineages in vitro and in vivo . Therefore, expanded mscs isolated from periosteum could be useful for functional tissue engineering, especially for bone regeneration 56 . The mscs contained within the bone marrow aspiration from the iliac crest, and liposuction from extra - oral tissue are not easily - accessible stem cells . On the contrary, the orofacial bone marrow, periosteum, salivary glands and dental tissues are the most accessible stem cell sources . Moreover, the isolation of mscs from these sources may still not be convenient because it requires surgical methods or tooth or pulp extraction . In addition, even if impacted wisdom teeth could be a mesenchymal stem cell source, these mscs are present in a low percentage and can, therefore, be difficult to isolate, purify and expand . Furthermore, not all adults need the extraction of the wisdom teeth . To overcome these limitations, recently, marrelli et al . Demonstrated that mscs derived from periapical cysts (hpcy - mscs) have a mesenchymal stem cell immunophenotype and the ability to differentiate into osteogenic and adipogenic lineages 57 . The periapical cyst, which is a tissue that is easily obtainable and whose cells can be simply expanded from patients with minimal discomfort, seems to be a promising source of adult stem cells in dentistry for regenerative medicine . In fact, a recent study of marrelli et al . Showed that hpcy - mscs similarly to dpscs have neural progenitor - like properties by expressing spontaneously neuron and astrocyte specific proteins and neural related genes before any differentiation . Furthermore, hpcy - mscs, under appropriate neural stimulation, acquire neural morphology and significantly over - express several neural markers at both protein and transcriptional level (in press, not yet published research by marrelli et al . ). It was reported that mscs isolated from whole bone marrow aspirates in combination with scaffolds and growth factors are able to repair cranial defects in several animal models 58 - 60 . These studies demonstrated that mscs can alleviate the complications of craniofacial surgical procedures that required allogenic tissue grafts or extraction of autologous bone from secondary sites . This approach may alleviate donor site morbidity and allow a virtual unlimited source of cellular material derived from allogenic mscs 61 . The identification of msc residing in the oral cavity tissues increases clinical interest in mscs as a cell source for regeneration of other connective tissues such as cementum, dentin and periodontal ligament (pdl). Many research studies research have been performed to assess the capacity of dental derived mscs to enhance periodontal regeneration . Seo et al . Have demonstrated that human pdlscs were able to generate a cementum / pdl - like structures when transplanted into immunocompromised mice, and consequently transplantation of pdlscs could be considered as a therapeutic approach for regeneration of tissues damaged by periodontal diseases 48 . Moreover, kim et al . Compared the alveolar bone regeneration achieved from implantation of pdlscs and bmscs and identified no significant difference in regenerative potential in vivo between these mscs 62 . The three key elements in the field of tissue engineering are stem cells, scaffolds and growth factors 63 . Recently, researchers are trying to identify the ideal scaffold that facilitate growth, cell spreading, adhesion, integration and differentiation of mscs . This scaffold should be biocompatible and biodegradable, should have optimal physical features and mechanical properties 64 . Different material have been designed and constructed for tissue engineering approaches, using natural or synthetic polymers or inorganic materials, which have been fabricated into porous scaffolds, nanofibrous material, hydrogels and microparticles . Natural materials include collagen, elastin, fibrin, silk, chitosan and glycosaminoglycans 65 . Recently, hydrogels have been investigated for tissue engineering applications because they offer numerous properties including biocompatibility and mechanical characteristics similar to those of native tissue synthetic poly lactic - co - glycolic acid (plga) and titanium provide excellent chemical and mechanical properties for bone tissue regeneration in vivo using dpscs 68 . Furthermore, recent studies demonstrated that dpscs loaded onto scaffolds of chitosan formed a dentine - pulp complex in vivo 69 whereas dpscs cultured on hydroxyapatite (ha) and placed subcutaneously in nude mice formed bone 70 . A great number of investigations for evaluating the in vivo application of mscs isolated from the oral cavity were carried out on animal models . A clinical study conducted by papaccio's group gave evidence of the possibility to utilise dpscs to repair bone defect in humans . In fact, they showed that dpscs / collagen biocomplex completely restored human mandible bone defects subsequent to dpscs transplantation 71 . The future is the regeneration of whole organs and complex biological systems consisting of many different tissues, starting from an initial stem cell line, probably using innovative scaffolds together with the nano - engineering of biological tissues: this approach is already a research topic in several international research institutes, and the best way to merge the numerous skills needed to get a so ambitious result is the multicenter collaboration . The authors are closely collaborating together with high - level international universities, to develop protocols aimed to control and lead the tissues regeneration . This goal could make born a new generation of stem - cells based therapies, so to open the door to a new highly - performing regenerative medicine . Starting from 2000, in only fifteen years, researchers have changed the face of the tissues engineering and the expectation of quality of life in more than 2 billions of patients undergone to a regenerative surgery: the challenge is to continue to make the patient's life better, to make the surgery more predictable and to simply replace damaged or degenerated tissues with mscs from dental and oral sources.
Dyslipidemia is a disorder of lipid and lipoprotein metabolism, including overproductivity, deficiencies, or other changes in lipid metabolism, which results in abnormal amounts of lipids and lipoproteins in the blood . Dyslipidemia can manifest as an elevation of the total cholesterol (tc), low - density lipoprotein (ldl)cholesterol, or triglyceride (tg) concentration, or a reduction in the high - density lipoprotein (hdl)cholesterol concentration in the blood (goldberg, 2013). Abnormal lipid levels are one of the essential causes of atherosclerosis and coronary artery disease (cad) (vance and vance, 2008, world health organization, h.g.p ., 1999). When lipoproteins in the plasma, and hence in the arterial wall, fall below a certain threshold level, atherogenesis does not occur . However, the absolute value of this threshold varies among individuals and may be very low in subjects with genetic and/or environmental factors that render their arteries highly susceptible to atherogenic processes (vance and vance, 2008, world health organization, h.g.p ., 1999). Polygenic hypercholesterolemia is characterized by moderate elevations in ldl cholesterol (3.637.77 mmol / l), with serum tg concentrations within the reference range . Like more extreme monogenic diseases, although the main causes of dyslipidemia are high fat intake (particularly saturated fats) and obesity, genetic factors are also considered important, because many individuals vary in their responses to dietary cholesterol . However, there is no clear pattern of inheritance, and a combination of several genetic variants is generally required for this type of hypercholesterolemia (durrington, 2003). Epidemiological studies have established that a reduction in plasma tc reduces the risk of coronary heart disease (chd) (bhagavan, 2002), indicating the importance of characterizing the most strongly associated snps with the main risk factors for elevated blood lipid levels . This characterization should facilitate the early diagnosis of these risk factors, before the development of cad symptoms, and the administration of appropriate treatment . Recent genome - wide association studies (gwas) and other human genetic studies have localized many common snps and many loci that influence the levels of different blood lipids, including previously known loci that are potentially involved in lipid metabolism (aulchenko et al ., 2009, braun et al, burkhardt et al ., 2008, chasman et al ., 2008, edmondson et al, heid et al ., 2008, hiura et al ., 2009, igl et al, johansen et al, kathiresan et al, 2009, suchindran et al, wallace et al ., 2008, waterworth et al, willer et al ., 2008) more than 40 loci have been associated with the levels of one or more blood lipid parameters, and contain many snps, but not all of these associations have been confirmed in other populations (aulchenko et al ., 2009, burkhardt et al ., 2008, chasman et al ., 2008, heid et al ., 2008, hiura et al ., 2009, igl et al, kathiresan et al, 2009, suchindran et al, wallace et al ., 2008, waterworth et al, willer et al ., 2008, ma et al, pollin et al ., 2008, ridker et al ., 2009, kooner et al ., 2008, sabatti et al ., 2009, sandhu et al ., 2008, saxena et al ., 2007, frequent polymorphisms in abca1, angptl3, apoa1, apoa5, apob, apoe, celsr2, cetp, cilp2, dock7, fads2, galnt2, gckr, gpr109a / b, gpr81, hmgcr, kntc1, lcat, ldlr, lipc, lipg, lpl, mlxipl, ncan, niacr1, niacr2, pcsk9, pltp, tomm40, trib1, ttc39b, and other loci have been shown to be significantly associated with the blood levels of one or more lipid parameters in many populations (aulchenko et al ., 2009, chasman et al, 2008, ma et al, ridker et al ., 2009, khovidhunkit et al). It has been demonstrated that a number of missense mutations at some of these loci can cause different types of monogenic hypercholesterolemia . For example, mutations in the abca1 gene cause familial hdl deficiency, or tanger disease (bhagavan, 2002). Similarly, mutations in the apoa5, apob, and apoe genes cause different types of hyperlipoproteinemias or even familial hypercholesterolemia type b (bhagavan, 2002, marcais et al ., 2005, soria et al ., 1989), but these are rare and usually more severe in their phenotypes . Confirmation of previously identified associations in different ethnic groups can give additional support to the underlying genetic architecture of the associated loci, especially when data from related populations are compared (baba et al ., 2009). Genetic structure studies of europeans have shown that populations from baltic countries (estonia, latvia, and lithuania), together with poland and the western part of russia, form rather a homogeneous group, distinct from the rest of the europe (nelis et al ., 2009). However, there is little information available on the snps associated with blood lipid levels in any of these countries . Here, we report the associations between common snps and the plasma levels of different plasma lipids in a relatively large sample of the latvian population . The main aims of this study were to investigate the associations between the most - informative snps from previous gwas and four blood lipid parameters: tc, hdl cholesterol, ldl cholesterol, and tg in the latvian population and to provide additional information to characterize the genetic factors that influence blood lipid levels . We conducted this research using dna samples from the genome database of the latvian population (lgdb), which included 18,888 participants in september 2011 when the study sample was selected (ignatovica et al ., 2011). We selected all individuals from this dataset for whom there was information on all four blood lipid parameters (tc, hdl, ldl, and tg), body mass index (bmi), glucose levels, sex, and age, resulting in 1581 samples . We then filtered out subjects with cardiovascular disease and those undergoing lipid - lowering therapies, resulting finally in 1345 samples . One sample was excluded as an outlier because of an extremely high tg level . A proportion (56.5%) of the samples matched those used in a previous study based on the same genotyping panel (radovica et al . The genotypes of those samples were obtained from the database, and the remaining 585 samples were genotyped in this study . Written informed consent was acquired from all lgdb participants . The study protocol was approved by the central medical ethics committee of latvia (protocol no 2007 a-7 and 01 - 29.1/25). We previously created a genotyping panel from gwas, which contained 144 snps that were associated with one or more lipid traits (aulchenko et al ., 2009, burkhardt et al ., 2008, chasman et al ., 2008, edmondson et al, heid et al ., 2008, hiura et al ., 2009,, 2009, wallace et al ., 2008, waterworth et al, willer et al ., 2008, ma et al, pollin et al ., 2008,, 2009, kooner et al ., 2008, sabatti et al ., 2009, sandhu et al ., 2008, saxena et al ., 2007, khovidhunkit et al). These snps occurred in more than 30 loci, including abca1, angptl3, apoa1, apoa5, apob, apoe, celsr2, cetp, cilp2, dock7, fads2, galnt2, gckr, gpr109a / b, hmgcr, lcat, ldlr, lipc, lipg, lpl, mlxipl, ncan, niacr1, niacr1/kntc1, niacr2, niacr2/gpr81, pcsk9, pltp, tomm40, trib1, and ttc39b . The snp selection procedure is described in detail in our previous publication (radovica et al ., 2013). All 144 snps were genotyped with the illumina beadxpress system (illumina goldengate genotyping assay), according to the manufacturer's instructions . The quality control procedure applied to the raw data can be found in our previous article (radovica et al ., 2013). After quality control, the remaining sample consisted of 1273 individuals with 139 genotyped snps, with a successful genotyping rate of 99.76% . The normal distributions of all quantitative variables were tested with the two most important parameters, the mean value and its standard deviation (sd) (altman, 1991), and with the shapiro wilk test . Therefore, to assess the influence of the covariates, we used linear regression, applying less - stringent normality criteria: the 689599.7 rule or the three - sigma rule, according to which about 68% of values should fit within an interval of one sd, 95% in two sds, and 99.7% in three sds . Among all the variables tested, the tg levels were not normally distributed, so they were log transformed for further statistical analysis . We applied a linear regression analysis with and without the covariates (age, sex, bmi, and glucose levels), and tested epistasis and hardy weinberg equilibrium with the plink v2.050 software (http://pngu.mgh.harvard.edu/purcell/plink/) (purcell et al . The bonferroni correction was used to calculate the significance level (0.05/139 = 3.5 10). To calculate the joint effects, all snps in genes with more than one nominally associated snp were divided into haploblocks using hapmap data and haploview software v4.2 (barrett, 2009, barrett et al ., 2005), and the joint effect analyses were performed with the spss v13.0 software, using a one - sample t test . A gene - by - gene interaction analysis was performed with the plink v2.050 software and gmdr software beta 0.9 (http://sourceforge.net/projects/gmdr/) (lou et al ., 2007). Imputation was performed with the impute2 v2.2.2 software (https://mathgen.stats.ox.ac.uk/impute/impute_v2.html#home) (howie et al ., 2009, marchini et al ., 2007) for loci containing more than five snps . As reference haplotypes the imputation region was set based on the coordinates of the first- and last - tested snp at each locus . The snptest v2.4.1 software was used to calculate the association between the imputed snps and the four lipid parameters (https://mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html#download_and_compilation) (marchini et al ., 2007). To accommodate uncertain genotypes, we used the method threshold option, with a threshold value of 0.9 . The bonferroni threshold was calculated as follows: 0.05/number of our genotyped snps (n = 139) at all loci . Statistical power was calculated with the quanto v1.2.4 software (gauderman and morrison, 2006). The minor allele frequencies (mafs) of our genotyped snps ranged from 0.020 to 0.474 . Taking into account this range of mafs, our study had sufficient power (80%) to detect beta coefficients in the following range for each of the parameters: increased tc, 0.500.15; increased ldl cholesterol, 0.450.15; reduced hdl cholesterol, 0.200; and increased tg, 0.300.10 . We conducted this research using dna samples from the genome database of the latvian population (lgdb), which included 18,888 participants in september 2011 when the study sample was selected (ignatovica et al ., 2011). We selected all individuals from this dataset for whom there was information on all four blood lipid parameters (tc, hdl, ldl, and tg), body mass index (bmi), glucose levels, sex, and age, resulting in 1581 samples . We then filtered out subjects with cardiovascular disease and those undergoing lipid - lowering therapies, resulting finally in 1345 samples . One sample was excluded as an outlier because of an extremely high tg level . A proportion (56.5%) of the samples matched those used in a previous study based on the same genotyping panel (radovica et al . The genotypes of those samples were obtained from the database, and the remaining 585 samples were genotyped in this study . Written informed consent was acquired from all lgdb participants . The study protocol was approved by the central medical ethics committee of latvia (protocol no 2007 a-7 and 01 - 29.1/25). We previously created a genotyping panel from gwas, which contained 144 snps that were associated with one or more lipid traits (aulchenko et al ., 2009, burkhardt et al ., 2008, chasman et al ., 2008, edmondson et al, heid et al ., 2008, hiura et al ., 2009,, 2009, wallace et al ., 2008, waterworth et al, willer et al ., 2008, ma et al, pollin et al ., 2008, ridker et al ., 2009, kooner et al ., 2008, sabatti et al ., 2009, sandhu et al ., 2008, saxena et al ., 2007, khovidhunkit et al). These snps occurred in more than 30 loci, including abca1, angptl3, apoa1, apoa5, apob, apoe, celsr2, cetp, cilp2, dock7, fads2, galnt2, gckr, gpr109a / b, hmgcr, lcat, ldlr, lipc, lipg, lpl, mlxipl, ncan, niacr1, niacr1/kntc1, niacr2, niacr2/gpr81, pcsk9, pltp, tomm40, trib1, and ttc39b . The snp selection procedure is described in detail in our previous publication (radovica et al ., 2013). All 144 snps were genotyped with the illumina beadxpress system (illumina goldengate genotyping assay), according to the manufacturer's instructions . The quality control procedure applied to the raw data can be found in our previous article (radovica et al ., 2013). After quality control, the remaining sample consisted of 1273 individuals with 139 genotyped snps, with a successful genotyping rate of 99.76% . The normal distributions of all quantitative variables were tested with the two most important parameters, the mean value and its standard deviation (sd) (altman, 1991), and with the shapiro therefore, to assess the influence of the covariates, we used linear regression, applying less - stringent normality criteria: the 689599.7 rule or the three - sigma rule, according to which about 68% of values should fit within an interval of one sd, 95% in two sds, and 99.7% in three sds . Among all the variables tested, the tg levels were not normally distributed, so they were log transformed for further statistical analysis . We applied a linear regression analysis with and without the covariates (age, sex, bmi, and glucose levels), and tested epistasis and hardy weinberg equilibrium with the plink v2.050 software (http://pngu.mgh.harvard.edu/purcell/plink/) (purcell et al ., 2007). The bonferroni correction was used to calculate the significance level (0.05/139 = 3.5 10). To calculate the joint effects, all snps in genes with more than one nominally associated snp were divided into haploblocks using hapmap data and haploview software v4.2 (barrett, 2009, barrett et al ., 2005), and one snp was chosen from each haploblock . The joint effect analyses were performed with the spss v13.0 software, using a one - sample t test . A gene - by - gene interaction analysis was performed with the plink v2.050 software and gmdr software beta 0.9 (http://sourceforge.net/projects/gmdr/) (lou et al ., 2007). Imputation was performed with the impute2 v2.2.2 software (https://mathgen.stats.ox.ac.uk/impute/impute_v2.html#home) (howie et al ., 2009, marchini et al ., 2007) for loci containing more than five snps . As reference haplotypes the imputation region was set based on the coordinates of the first- and last - tested snp at each locus . The snptest v2.4.1 software was used to calculate the association between the imputed snps and the four lipid parameters (https://mathgen.stats.ox.ac.uk/genetics_software/snptest/snptest.html#download_and_compilation) (marchini et al ., 2007). To accommodate uncertain genotypes, we used the method threshold option, with a threshold value of 0.9 . The bonferroni threshold was calculated as follows: 0.05/number of our genotyped snps (n = 139) at all loci . Statistical power was calculated with the quanto v1.2.4 software (gauderman and morrison, 2006). The minor allele frequencies (mafs) of our genotyped snps ranged from 0.020 to 0.474 . Taking into account this range of mafs, our study had sufficient power (80%) to detect beta coefficients in the following range for each of the parameters: increased tc, 0.500.15; increased ldl cholesterol, 0.450.15; reduced hdl cholesterol, 0.200; and increased tg, 0.300.10 . We performed linear regression analyses for all 139 snps with the four blood lipid parameters (tc, hdl, ldl, and logtg). In unadjusted analyses, 26 snps from nine loci were associated with tc, 22 snps from 10 loci with ldl, 58 snps from 13 loci with hdl, and 40 snps from 14 loci with logtg at the nominally significant level (p <0.05). After age, sex, bmi, and glucose levels were added as covariates to the linear regression analysis, 24 snps at 11 loci were associated with tc, 23 snps at nine loci with ldl, 56 snps at 13 loci with hdl, and 40 snps at 14 loci with logtg, with the same significance level . Data for the associations of all snps are shown in supplementary table 1 . In total, 16 snps remained significantly associated after the bonferroni correction was applied (table 2): 10 snps at the cetp (cholesteryl ester transfer protein) locus and two snps at the mlxipl (mlx - integrating protein like) locus were associated with reduced hdl cholesterol levels; one snp at the tomm40 (translocase of outer mitochondrial membrane 40) locus was associated with increased ldl cholesterol; and four snps located at the mlxipl locus were associated with increased logtg levels . In order to explore the ld in association with changes in blood lipids detailed haplotype analysis was performed for both genes with more than one significantly associated snp (mlxipl and cetp). We thus selected all snps from our panel that were located within or in near proximity of cetp and mlxipl gene and assigned them in haploblocks that were generated from the hapmap1/3 data . In total one haploblock was identified in the mlxipl locus but four were found in cetp locus . Acquired haplotype data was further used for haplotype association test . Reconstructed haplotypes that exceeded the frequency of 0.01 and the results of association test are shown in table 3 . More detailed description of cetp haplotypes and their genomic localization can be found in our previous paper (radovica et al ., 2013). Pair wise snp snp interactions for all 139 snps were analyzed with the epistasis option implemented in the plink software package to determine whether interactions between two snps were associated with lipid levels . One interacting snp pair was associated with reduced hdl cholesterol levels (rs1551894 in hmgcr, encoding 3-hydroxy-3-methylglutaryl - coa reductase, interacting with rs6586891 in lpl, encoding lipoprotein lipase); two snp pairs were associated with increased ldl cholesterol levels (rs4803750 in tomm40 interacting with rs157580 in apoe, encoding apolipoprotein e; and rs157580 in apoe interacting with rs405509 in tomm40); and one pair of snps was associated with increased logtg (rs10889353 in angptl3, encoding angioprotein - like 3, interacting with rs166358 in lipc, encoding hepatic lipase). Gene epistasis test with the gmdr software, but this analysis revealed no significant gene we performed imputation and subsequent association analyses for 11 loci that contained five or more snps (celsr2, apob, hmgcr, mlxipl, lpl, apoa1/5, kntc1/niacr1, lipc, cetp, and tomm40/apoe), using the 1000 genomes phase i integrated variant set of haplotypes as the reference and the coordinates of the outer snps from our 11 loci as the interval boundaries . At four loci, apob (apolipoprotein b), cetp, lpl, and tomm40, a number of snps displayed p values lower than the bonferroni threshold for one or more lipid traits . To illustrate these results, we created manhattan plots for these four loci (shown in fig . 1). The p values and beta coefficients for the 71 corrected snps that were associated with one of the lipid traits after imputation and snptest are shown in supplementary table 2 . Thus, for apob and lpl, only the imputed snps reached the appropriate significance level for association with ldl, tc, and hdl . One nucleotide deletion at chr2:21428937 (apob locus) showed the strongest association with ldl cholesterol levels . Rs289, located in the sixth intron of the lpl gene, displayed the strongest association with hdl cholesterol . We found a number of imputed snps at the tomm40 locus that reached the appropriate significance level for their associations with ldl cholesterol levels, and had lower p values than our genotyped snps . The most strongly associated snp was rs62117206, located in the intron of the bcl3 gene (b - cell leukemia / lymphoma 3). We found many snps with the appropriate significance level at the cetp locus for association with hdl cholesterol; however none of these snps had a p value lower than that for rs3764261, which was genotyped with our panel . Most of the associated snps were found within introns, although some were located in 5 or 3 untranslated regions, but none occurred in a coding region . Because the effects of individual snps are rather small, we decided to investigate the summary effects of associated snps on blood lipid parameters, using the risk allele dosage test and those snps that were nominally associated with different blood lipid levels before the bonferroni correction, each of which represented one haploblock . Sixteen snps representing the abca1, angptl3, apob, apoe, dock7, hmgcr, lcat, lipc, and tomm40 loci were included in case of tc; 24 snps representing the abca1, apoa1, cetp, hmgcr, niacr1, lcat, lipc, lpl, mlxipl, pltp, and trib1 loci were included in cases of hdl cholesterol; 15 snps representing abca1, angptl3, apoa1, apob, apoe, dock7, hmgcr, lcat, and tomm40 loci were included in case of ldl cholesterol; and 27 snps representing abca1, angptl3, apoa1, apoa5, apob, cetp, cilp2, dock7, gckr, lipc, lpl, mlxipl, ncan, and tomm40 loci were included in case of logtg . The distribution of risk allele number within each group of lipid parameters analyzed was almost normally distributed and therefore we divided the sample into three equivalent groups based on the range of the risk allele distribution separately for each lipid parameter . We then performed a one - sample t test with the spss software to calculate the differences between these three groups . We found that the number of risk alleles correlated strongly with the blood lipid levels for all four parameters . The results of this analysis are shown in fig . 2 . In case of tc the group of individuals with 410 risk alleles had a mean tc level 0.53 mmol / l lower than that of the median group, represented by individuals with 1118 risk alleles (p = 1.59e 44). In the group with 1926 risk alleles, the mean tc level was 0.40 mmol / l higher (p = 4.18e 97) than that in the median group . The mean hdl cholesterol level was 0.24 mmol / l higher (p = 1.59e 44) in the group with 1321 risk alleles and 0.18 mmol / l lower (p = 7.51e 241) in the group with 31 40 risk alleles compared to the value for the median group (2230 risk alleles). The mean ldl cholesterol level was 0.56 mmol / l lower (p = 1.36e 22) in the group with two to nine risk alleles and 0.51 mmol / l higher (p = 7.91e 140) in the group with 1017 risk alleles compared to the value in the median group (1017 risk alleles). The mean logtg value was 0.07 log mmol / l lower (p = 1.06e 31) in the group with 1321 risk alleles and 0.09 log mmol / l higher (p = 1.76e 34) in the group with 3039 risk alleles compared to the median group (2229 risk alleles). We performed linear regression analyses for all 139 snps with the four blood lipid parameters (tc, hdl, ldl, and logtg). In unadjusted analyses, 26 snps from nine loci were associated with tc, 22 snps from 10 loci with ldl, 58 snps from 13 loci with hdl, and 40 snps from 14 loci with logtg at the nominally significant level (p <0.05). After age, sex, bmi, and glucose levels were added as covariates to the linear regression analysis, 24 snps at 11 loci were associated with tc, 23 snps at nine loci with ldl, 56 snps at 13 loci with hdl, and 40 snps at 14 loci with logtg, with the same significance level . Data for the associations of all snps are shown in supplementary table 1 . In total, 16 snps remained significantly associated after the bonferroni correction was applied (table 2): 10 snps at the cetp (cholesteryl ester transfer protein) locus and two snps at the mlxipl (mlx - integrating protein like) locus were associated with reduced hdl cholesterol levels; one snp at the tomm40 (translocase of outer mitochondrial membrane 40) locus was associated with increased ldl cholesterol; and four snps located at the mlxipl locus were associated with increased logtg levels . In order to explore the ld in association with changes in blood lipids detailed haplotype analysis was performed for both genes with more than one significantly associated snp (mlxipl and cetp). We thus selected all snps from our panel that were located within or in near proximity of cetp and mlxipl gene and assigned them in haploblocks that were generated from the hapmap1/3 data . In total one haploblock was identified in the mlxipl locus but four were found in cetp locus . Acquired haplotype data was further used for haplotype association test . Reconstructed haplotypes that exceeded the frequency of 0.01 and the results of association test are shown in table 3 . More detailed description of cetp haplotypes and their genomic localization can be found in our previous paper (radovica et al ., 2013). Pair wise snp snp interactions for all 139 snps were analyzed with the epistasis option implemented in the plink software package to determine whether interactions between two snps were associated with lipid levels . One interacting snp pair was associated with reduced hdl cholesterol levels (rs1551894 in hmgcr, encoding 3-hydroxy-3-methylglutaryl - coa reductase, interacting with rs6586891 in lpl, encoding lipoprotein lipase); two snp pairs were associated with increased ldl cholesterol levels (rs4803750 in tomm40 interacting with rs157580 in apoe, encoding apolipoprotein e; and rs157580 in apoe interacting with rs405509 in tomm40); and one pair of snps was associated with increased logtg (rs10889353 in angptl3, encoding angioprotein - like 3, interacting with rs166358 in lipc, encoding hepatic lipase). Gene epistasis test with the gmdr software, but this analysis revealed no significant gene gene interactions . We performed imputation and subsequent association analyses for 11 loci that contained five or more snps (celsr2, apob, hmgcr, mlxipl, lpl, apoa1/5, kntc1/niacr1, lipc, cetp, and tomm40/apoe), using the 1000 genomes phase i integrated variant set of haplotypes as the reference and the coordinates of the outer snps from our 11 loci as the interval boundaries . At four loci, apob (apolipoprotein b), cetp, lpl, and tomm40, a number of snps displayed p values lower than the bonferroni threshold for one or more lipid traits . To illustrate these results, we created manhattan plots for these four loci (shown in fig . 1). The p values and beta coefficients for the 71 corrected snps that were associated with one of the lipid traits after imputation and snptest are shown in supplementary table 2 . Thus, for apob and lpl, only the imputed snps reached the appropriate significance level for association with ldl, tc, and hdl . One nucleotide deletion at chr2:21428937 (apob locus) showed the strongest association with ldl cholesterol levels . Rs289, located in the sixth intron of the lpl gene, displayed the strongest association with hdl cholesterol . We found a number of imputed snps at the tomm40 locus that reached the appropriate significance level for their associations with ldl cholesterol levels, and had lower p values than our genotyped snps . The most strongly associated snp was rs62117206, located in the intron of the bcl3 gene (b - cell leukemia / lymphoma 3). We found many snps with the appropriate significance level at the cetp locus for association with hdl cholesterol; however none of these snps had a p value lower than that for rs3764261, which was genotyped with our panel . Most of the associated snps were found within introns, although some were located in 5 or 3 untranslated regions, but none occurred in a coding region . Because the effects of individual snps are rather small, we decided to investigate the summary effects of associated snps on blood lipid parameters, using the risk allele dosage test and those snps that were nominally associated with different blood lipid levels before the bonferroni correction, each of which represented one haploblock . Sixteen snps representing the abca1, angptl3, apob, apoe, dock7, hmgcr, lcat, lipc, and tomm40 loci were included in case of tc; 24 snps representing the abca1, apoa1, cetp, hmgcr, niacr1, lcat, lipc, lpl, mlxipl, pltp, and trib1 loci were included in cases of hdl cholesterol; 15 snps representing abca1, angptl3, apoa1, apob, apoe, dock7, hmgcr, lcat, and tomm40 loci were included in case of ldl cholesterol; and 27 snps representing abca1, angptl3, apoa1, apoa5, apob, cetp, cilp2, dock7, gckr, lipc, lpl, mlxipl, ncan, and tomm40 loci were included in case of logtg . The distribution of risk allele number within each group of lipid parameters analyzed was almost normally distributed and therefore we divided the sample into three equivalent groups based on the range of the risk allele distribution separately for each lipid parameter . We then performed a one - sample t test with the spss software to calculate the differences between these three groups . We found that the number of risk alleles correlated strongly with the blood lipid levels for all four parameters . In case of tc the group of individuals with 410 risk alleles had a mean tc level 0.53 mmol / l lower than that of the median group, represented by individuals with 1118 risk alleles (p = 1.59e 44). In the group with 1926 risk alleles, the mean tc level was 0.40 mmol / l higher (p = 4.18e 97) than that in the median group . The mean hdl cholesterol level was 0.24 mmol / l higher (p = 1.59e 44) in the group with 1321 risk alleles and 0.18 mmol / l lower (p = 7.51e 241) in the group with 31 40 risk alleles compared to the value for the median group (2230 risk alleles). The mean ldl cholesterol level was 0.56 mmol / l lower (p = 1.36e 22) in the group with two to nine risk alleles and 0.51 mmol / l higher (p = 7.91e 140) in the group with 1017 risk alleles compared to the value in the median group (1017 risk alleles). The mean logtg value was 0.07 log mmol / l lower (p = 1.06e 31) in the group with 1321 risk alleles and 0.09 log mmol / l higher (p = 1.76e 34) in the group with 3039 risk alleles compared to the median group (2229 risk alleles). The aim of this study was to identify associations between 144 snps selected from published gwas and blood lipid levels in the latvian population . This is the first report in which many genetic loci, involved in a number of lipid - related metabolic pathways, were simultaneously studied in a relatively large group representing the latvian population (420 males, 853 females; for detailed data, see table 1). Our study has convincingly identified associations between 16 of the 139 most strongly associated snps and one or more blood lipid parameters . In our previous case control study, we reported strong associations between 10 snps in cetp and reduced hdl cholesterol (radovica et al ., 2013). In this study, we confirmed this strong evidence for this association between the cetp gene and hdl cholesterol levels and discovered the new association of two snps at the mlxipl locus (table 2), using quantitative analyses . Moreover, haplotype analyses also confirmed the associations demonstrated in our previous study (radovica et al ., 2013). These results also agree well with those of other studies around the world (chasman et al ., 2008, heid et al ., 2008, hiura et al ., 2009,, 2008, kathiresan et al ., 2009, willer et al ., 2008, ma et al, ridker et al ., 2009, khovidhunkit et al, thompson et al ., 2005, thompson et al ., 2007) and are supported by the well - known function of cetp in lipid metabolism . Cetp promotes the transfer of cholesteryl esters from hdl particles to apolipoprotein - b - containing particles in exchange for tg, allowing the receptor - mediated uptake of cholesterol esters by the liver and reducing hdl cholesterol levels (vance and vance, 2008). In contrast, cetp deficiency increases hdl cholesterol levels . Supporting the association between snps in the mlxipl locus and hdl cholesterol, their relationship within the lipid metabolic pathways is not as direct as that of the snp cetp association . The protein encoded by the mlxipl gene is a helix loop helix leucine zipper transcription factor, which forms a heterodimer with mlx to bind dna (cairo et al ., 2001). This transcription factor complex is activated by high glucose and inhibited by cyclic adenosine monophosphate (camp) (kawaguchi et al ., 2001), and can repress e - box - dependent transcription (cairo et al ., 2001) or the carbohydrate response element motifs in the promoters of lipogenic enzymes . In adipose tissues, mlxipl is a major determinant of adipose tissue fatty - acid synthesis and systemic insulin sensitivity (herman et al . ). Therefore, it is plausible that changes in mlxipl expression indirectly influence hdl cholesterol levels through various metabolic pathways . We also found strong associations between four snps at the mlxipl locus and increased logtg (table 2). Because mlxipl is a transcription factor that influences fatty - acid synthesis in adipose tissue, it is plausible that snps in this gene indirectly affect tg levels . We also found that a snp in the tomm40 locus is associated with increased ldl cholesterol levels (table 2). More precisely, this snp is located in the first intron of the bcl3 gene (fig the protein encoded by the bcl3 gene is an inhibitor of subunit two of nuclear factor kappa - b (nf-b) (franzoso et al ., 1992, wulczyn et al ., 1992). Because interactions between bcl3 and nf-b have not yet been linked to lipid metabolism, we think that this snp might be in linkage disequilibrium (ld) with functional snps in one of the genes encoding various apolipoproteins located downstream from the tomm40 gene . For example, mutations in the apoe gene (located immediately downstream from tomm40) can cause hyperlipoproteinemia type iii (utermann et al ., 1979). Alternatively, the associated snps may be located within upstream regulatory elements of these apolipoprotein genes because the distance between the tomm40 gene and, for example, the apoe gene is rather large (2.1 mbp), arguing against a simple ld - based explanation . Since the number of associated snps was found in cetp and mlxipl gene, we estimated the association of individual haplotypes with all lipid levels . First it should be noted that in case of cetp the results of hdl associations corresponded exactly to our previous findings (radovica et al ., most of the associated snps fall in second and third haploblock (table 3). These haploblocks cover the region starting from ~ 2 kb upstream cetp gene, promoter region and include first ~ 10 kb of cetp gene . Interestingly, the strongest association was observed for two protective haplotypes with increased hdl levels: haplotype 2.1 from second haploblock and 3.1 from the third haploblock . For second haploblock it is clear that effect is explained by the presence of risk alleles from two snps rs173539 and rs3764261 that are both in strong ld with each other (r = 0.94). In case of third haploblock t allele of rs9939224 from the second intron of cetp gene is present only in two risk haplotypes and may be linked to the increased expression or functionality of cetp, thus decreasing the hdl - c levels as suggested by our previous observations (radovica et al ., 2013). The effect of protective haplotype may be explained by the presence of rs1800775 a allele that has been linked to changes in binding site sp1/sp3 in functional studies (dachet et al ., 2000, thompson et al ., 2004). In case of mlxipl one protective haplotype was identified that was associated with increased hdl and decreased logtg levels and one risk haplotype associated with decreased hdl . Due to strong ld it is however less clear which of the tested snps may be responsible for these effects . We found four pairs of snps that showed probable interactions in their associations with blood lipid parameters . Two pairs of snps, located again in the tomm40 and apoe genes, showed functional or ld - based interactions that affected ldl cholesterol levels . Another two interactions were associated with hdl cholesterol (hmgcr and lpl) or logtg levels (angptl3 and lipc). The hmgcr gene encodes 3-hydroxy-3-methylglutaryl - coa reductase, which catalyzes the crucial step in cholesterol biosynthesis (vance and vance, 2008). In contrast, the lpl gene encodes lipoprotein lipase, which hydrolyzes tgs derived from blood lipid particles . These are taken up into cells as fatty acids and are stored or delivered to the cholesterol or tg synthetic pathways (vance and vance, 2008). Encodes angiopoietin - like 3 protein, which belongs to the specific vascular endothelium growth factor protein family (camenisch et al ., 2002), and homozygous or compound heterozygous mutations in angptl3 cause familial hypobetalipoproteinemia type ii (musunuru et al . The lipc gene encodes hepatic lipase, which is synthesized in the liver and acts in the uptake of lipoproteins and cholesteryl esters by hepatocytes, thus directly influencing plasma lipid levels (cai et al ., it is not known how these two proteins interact to influence lipid metabolism, but such interactions cannot be excluded . However, it should be noted that the majority of genes selected for this study have well - established functions in lipid metabolism . Therefore, all attempts to explain these interactions statistically, based on the relationships of these protein functions, are highly biased, and in all cases, further investigation is required in large well - characterized cohorts . Unfortunately, these findings were not supported by the gmdr software, perhaps because more - specific algorithms are used in ghmdr, taking into account, for example, covariates, course of dimensionality, and other criteria that are not included in the plink toolset and which therefore better exclude false positive results (chen et al . ). For a more detailed analysis and to find other strongly associated snps at our test loci, we performed imputation for 11 loci that contained five or more snps (celsr2, apob, hmgcr, mlxipl, lpl, apoa1/5, kntc1/niacr1, lipc, cetp, and tomm40/apoe). We found many imputed snps in the cetp gene that were associated with changes in hdl cholesterol levels; although none of these associations was stronger than those of the originally genotyped snps (fig these results again agree well with those of our previous study, in that cetp is the strongest and most common genetic factor to influence hdl cholesterol levels in the latvian population . Imputed snps at another three loci, apob, lpl, and tomm40, were significantly associated with one or more lipid trait (fig . 1). All these snps were located in noncoding regions and many of them have already been associated with disease phenotypes, including cad, myocardial infarction, and atherosclerosis . The apob and lpl genes are known to be directly involved in lipid metabolism, and a number of functional mutations in these genes have already been reported to cause different types of monogenic familial hypercholesterolemia (http://www.hgmd.org/). Therefore, it is likely that common variants with smaller effects may play roles in milder forms of dyslipidemia . It is also possible that our cohort contained a number of patients with undiagnosed monogenic hypercholesterolemia . This may have influenced the association results either because of the ld between these mutations and the markers used in our study or simply by adding a stronger genetic modifier . A number of imputed snps at the tomm40 locus reached the appropriate significance level in their associations with ldl cholesterol levels . Again, the role of tomm40 in the regulation of ldl metabolism is unclear (see discussion above). To achieve our aim, we performed an allele dosage association test with nominally associated snps, each representing one haploblock, for all four blood lipid parameters to calculate the influence of the number of risk alleles on lipid levels . We divided our sample in three equivalent groups based on the number of risk alleles . There was a strong correlation between the number of risk alleles and the plasma lipid levels for all four lipid parameters (fig . 2). Therefore, it is possible that the discovery and inclusion of additional lipid - influencing snps in similar analyses will lead to the development of prognostic tests for dyslipidemia and the prescription of appropriate drugs . The results of this study confirm that of all the genes included in the analysis, cetp, mlxipl, and tomm40 are the genetic factors that most strongly influence the plasma lipid levels in our study population . We have also shown that these risk alleles have strong cumulative effects on all lipid parameters . It should be noted that this is the first replication study of a relatively large sample population from the baltic states and eastern europe . Cadcoronary artery diseasetctotal cholesterolsnpsingle - nucleotide polymorphismldllow - density lipoproteinhdlhigh - density lipoproteintgtriglyceridebmibody mass indexmafminor allele frequencychrchromosomemaminor allelegwasgenome - wide association studiescampcyclic adenosine monophosphateldlinkage disequilibriumsdstandard deviation coronary artery disease single - nucleotide polymorphism low - density lipoprotein high - density lipoprotein minor allele frequency genome - wide association studies cyclic adenosine monophosphate linkage disequilibrium the following are the supplementary data related to this article.supplementary table 1association data for all 139 snps used in present study.supplementary table 2imputed snps associated with one or more lipid traits.
A 27-year - old hispanic man was admitted to the queens hospital center because of cough, weakness, night sweats, and weight loss . The patient was well until 1 month before admission when he started having weakness, coughing, and sweats . On return to the united states he saw a physician for the above symptoms and was prescribed azithromycin for 5 days . However, the symptoms progressively worsened over weeks and at presentation also included drenching night sweats and dizziness . His coworkers noted him to be paler . On interview, he was noted to have lost 25 pounds over 4 to 6 weeks . He had fatigue, and felt early satiety due to pressure in the left upper quadrant of abdomen . He denied any travel to the countryside, significant outdoor activities, hiking or spelunking . He also denied any bright red blood per rectum, melena, myalgia, arthralgia, hematuria or dark colored urine . He was a non - smoker, drank socially, and did not take any illicit or recreational drugs . His father was recently diagnosed with multiple myeloma and his mother had diabetes mellitus . On physical examination, the patient was alert and oriented . The blood pressure was 119/76 mmhg, the temperature 100.0f, the pulse 119/min with regular rhythm, the respiratory rate 16/min with oxygen saturation 100% on ambient air . The patient had pale conjunctiva, icteric sclera, non - tender left supraclavicular and cervical lymphadenopathy, hepatomegaly with palpable liver edge 23 cm below right costal margin and splenomegaly . On hospital day (hd) 1, his complete blood count showed white blood cell count 3,100/mcl, hemoglobin 6.6 g / dl, hematocrit 20% and platelets 76,000/mcl . Liver function tests (lfts) were abnormal with alkaline phosphatase of 611 u / l, aspartate aminotransferase (ast) of 42 u / l, gamma glutamyl transpeptidase (ggt) of 68 u / l, lactate dehydrogenase (ldh) of 581 u / l, total bilirubin of 2.67 mg / dl and conjugated bilirubin of 1.25 mg / dl . Anemia workup revealed a reticulocyte count of 1,231/l with reticulocytes 5.53% (0.5%1.5%), iron 60 g / dl (60160 g / dl), total iron binding capacity (tibc) of 213 g / dl (250460 g / dl), ferritin of 3,128 ng / ml (15200 ng / ml), vitamin b12 level of 1,387 pg / ml (200900 pg / ml) and serum folate 11.25 ng / ml (2.520 ng / ml). Initial review of a peripheral blood smear showed thrombocytopenia with occasional large platelets, poikilocytosis, polychromasia, decreased white blood cells without toxic granulation and no schistocytes . Tests for hemolysis, including direct anti - globulin test and haptoglobin level, were negative on hd 2 . A computed tomography (ct) scan of chest, abdomen, and pelvis done on hd 1 revealed enlarged lymph nodes in the mediastinum, retroperitoneum and splenomegaly and hepatomegaly . A lymph node biopsy was requested, given pancytopenia and concurrent lymphadenopathy and performed on hd 6 . The bone marrow biopsy showed a markedly hypercellular marrow (90%100%) with erythroid hyperplasia, left shifted granulocytic series, and increased megakaryocytes with atypical and dysplastic forms, suggesting a myelodysplastic or myeloproliferative disorder . The bone marrow aspirate smears showed occasional abnormal mononuclear cells, likely vacuolated lymphoid precursors and mature myeloid and erythroid lines with no evidence of blasts . The findings were later interpreted as an unusual reaction to hodgkin s lymphoma (hl). Cytogenetic analysis of a bone marrow specimen revealed tetraploidy, aneuploidy, and multiple abnormalities including xxy, add(2)(p25), add(5)(p15)2, add(6)(q27), add(10)(q23), add(13)(p11), add(14), del(10)(q22,q23), + 5, + 8 and + 9 . The liver enzymes including total and direct bilirubin worsened while awaiting results from the biopsies . A magnetic resonance cholangiopancreatography did not show any intra or extra hepatic biliary obstruction or any clear involvement of the liver by lymphoma, but it identified multiple hypodensities in the spleen . A hepatobiliary iminodiacetic acid scan showed marked hepatomegaly with smooth contour, but no evidence of focal defects . Drug - induced hepatitis was considered as the patient had been on fluconazole and acetaminophen during the course of his hospital stay . Lfts showed a predominantly obstructive pattern initially and the serum acetaminophen level at presentation was less than 10 g / ml . Prednisone was started on hd 14 in an attempt to stop further decline in lfts . Despite steroids, his total bilirubin on hd 20 had increased up to 9.22 mg / dl with conjugated bilirubin of 5.76 mg / dl . A left cervical lymph node biopsy revealed mixed cellularity classical hl with multiple reed sternberg and hodgkin cells with immunohistochemical expression of pax5, cd30 and cd15, background cd3 positive t cells and cd 20-positive residual follicles . Due to elevated lfts, major dose reductions or omission of most chemotherapeutic agents would be needed . Gemcitabine was considered because of its ability to be used even with hepatic impairment and its effectiveness as a salvage regimen . After first dose of gemcitabine with methylprednisone, total bilirubin, conjugated bilirubin and alkaline phosphatase levels decreased . Thirteen days after the administration of gemcitabine, lfts were still abnormal but improved sufficiently that dose reduced adriamycin, bleomycin, vinblastine, and dac - arbazine (abvd) could be administered . A follow - up bone marrow biopsy was done after completing six cycles of abvd, which showed 70% cellularity with trilineage hematopoiesis, all three cell lines proceeding to maturity and no cytogenetic evidence of an abnormal clone . A repeat ct scan of the chest, abdomen, and pelvis showed decrease in the size of mediastinal, left supraclavicular, abdominal, and pelvic lymph nodes . A follow - up whole body positron emission tomography / ct scan showed no evidence of fluorodeoxy (fdg) avid tumor and decreased splenomegaly . Hl originates from clonotypic b cells.1 the standard regimens used in the usa at the time the patient presented were abvd, stanford v regimen and, less commonly, dose escalated beacopp (bleomycin, etoposide, adriamycin, cyclophosphamide, vincristine, procarbazine, prednisone). Older regimens such as mopp (mechlorethamine, vincristine, procarbazine, prednisone) are less effective than abvd.2,3 there is a paucity of data and published case reports for treatment of patients with hl and severely impaired liver function as this patient presented . Case reports have been published using chemotherapy agents for patients with hl presenting with high bilirubin levels.46 many of the active agents used in treatment for hl require extensive dose reduction for severe liver impairment (table 3). Liver involvement is uncommon at presentation in patients with hl, and is exceptionally rare in the absence of splenic involvement.7,8 the hepatic involvement could range from hepatic infiltration by lymphoma to biliary obstruction by lymph node masses or infiltration of the common bile duct.911 the lfts in our case revealed a cholestatic picture with high alkaline phosphatase and conjugated hyperbilirubinemia . Vanishing bile duct syndrome as a cause of jaundice has also been reported to be associated with hl.4,12,13 in one case report, bilirubin level normalized after two cycles of mopp, one cycle of reduced dose p(v)ag (prednisone, vinblastine was excluded due to potential neurotoxicity, doxorubicin and gemcitabine) followed by six cycles of full dose p(v) ag from 5.4 to 0.15 mg / dl.4 however, the treatment course in that case was complicated with prolonged fever, pancytopenia, severe peripheral polyneuropathy and toxic interstitial pneumonitis, requiring intensive care after receiving two cycles of mopp . A case report of successful use of dhap (full - dose dexamethasone, high - dose cytarabine, and cisplatin) in a patient with stage iv nodular sclerosis classical hl with severe hepatic dysfunction resulted in significant improvement in the hepatic function after the administration of dhap regimen as evidenced by the normalization of serum bilirubin from 6.5 mg / dl to 1.2 mg / dl.5 gemcitabine has been shown to be effective as a salvage regimen in patients with refractory hl with a response rate of 39% with mild drug related toxicities.14 currently, three gemcitabine based regimens, gvd (gemcitabine, vinorelbine and pegylated liposomal doxorubicin),15 gdp (gemcitabine, dexamethasone and cisplatin),16 and gcd(r) (gemcitabine, carboplatin, dexamethasone, rituximab)17 have been evaluated for use in relapsed and/or refractory hl . A retrospective study has shown that gemcitabine combined with vinorelbine or cisplatinum and steroid is an effective treatment option with a manageable toxicity profile in patients with post - transplant progression of hl and in patients eligible for allogeneic or second autologous stem cell transplantation as a pre - transplant option.18 manufacturer drug package insert and phase i pharmacokinetic trials of gemcitabine in patients with hepatic or renal dysfunction have demonstrated that dose adjustments are not necessary for elevated transaminases nor elevated bilirubin and creatinine levels.19,20 finally, chromosomal abnormalities in hl have not been well studied to characterize a coherent cytogenetic picture.21 recent studies have designated some common chromosomal aberrations including gains of short arm of chromosome 2 involving rel oncogene locus1,22 and chromosomal breakpoints involving immunoglobulin loci.23 frequent occurrence of abnormalities involving 1p, 1q and 6q chromosomal arms was shown in a case series.21 the cytogenetic studies in our case were not typical for hl except 6q involvement and the clinical significance of these chromosomal findings and its disappearance in complete remission still remains to be elucidated . In summary, we present an unusual case of hl with severe hepatic impairment, splenomegaly and multiple chromosomal abnormalities, which was treated successfully with gemcitabine and steroids to initially improve lfts, such that six cycles of abvd could be given.
Cancer - related inflammation affects many aspects of malignancy, including proliferation and survival of malignant cells, angiogenesis, and therapeutic response . In a previous study that utilizes a mouse model, we showed that an inflammatory response is elicited in the early stages of the postsurgical wound healing process, leading to an increase in the number of inflammatory cells in the peritoneum . This further increases pro - matrix metalloproteinase-9 (pro - mmp-9), which plays a key role in the growth and progression of peritoneal metastases . Based on these experimental results, we hypothesize that the local metastatic microenvironment will be changed during the early inflammatory phase in the process of wound healing . Clinically, there have been efforts to demonstrate a correlation between operative systemic inflammation and cancer . Some biomarkers representing the degree of systemic inflammation, such as the glasgow prognostic score, neutrophil lymphocyte ratio (nlr), and platelet lymphocyte ratio (plr), have been shown to have prognostic value in many kinds of cancer patients [5 - 8]. However, these results only focus on the effects of preoperative cancer or inflammation, regardless of etiology of the inflammation . Until now, there is only a few research regarding postoperative systemic inflammation on cancer prognosis . In this study, we examine not only the effect of the preoperative inflammatory state on cancer, but also the effects of early postoperative systemic inflammation on cancer prognosis, based on the previous animal study results . Six hundred thirty - nine consecutive patients underwent surgery for colorectal cancer at yeouido st . Mary's hospital, the catholic university of korea from january 2006 to december 2009 . Patients were excluded if they had colorectal cancer other than adenocarcinoma and carcinoma in situ . However, patients who had preoperative radiation therapy and those who were not able to undergo curative resection were included . Routine laboratory measurements, including white blood cell (wbc) count, neutrophil count, lymphocyte count, monocyte count, and platelet count, were performed preoperatively, daily until day four postoperatively, and subsequently every two days . We did not consider preoperative infection and inflammatory condition and postoperative infection and inflammatory condition . Patients were divided into three groups based on the days spent on the leukocyte count to drop below 10,000/mm after surgery (dsnlc; group i, 0 - 1 days; group ii, 2 - 3 days; group iii, 4 days). For a comparative analysis with the results of the other study, grouping of the variables, such as the wbc count, neutrophil count, lymphocyte count, monocyte count, and platelet count, " right side colon " was defined as both the right colon and the transverse colon . " Left side colon " was defined as both the left colon and the recto - sigmoid colon above the peritoneal reflection . Staging evaluation was carried out according to the guidelines of american joint committee on cancer, sixth edition . This study was approved by the institutional review board of the college of medicine (sc11tisi0080). The relationship between the number of days required for the leukocyte count to drop below 10,000/mm after surgery (group i, 0 - 1 day; group ii, 2 - 3 days; group iii, 4 days) and clinicopathologic factors was assessed using the chi - squared and fisher's exact tests . The overall duration of survival was calculated from the date of surgery until the date of death . The duration of cancer - free survival was calculated from the date of surgery until the date of detection of disease recurrence, defined using clinical, radiographic or pathological findings . Overall and cancer - free survival rates were calculated using the kaplan - meier method, and differences among curves were tested using the log - rank test . Variables that were significantly related to the survival rate in a univariate analysis were subsequently included in a multivariate analysis employing the cox multiple regression model . This method finds the' best' variables (p<0.05) for which the effects on prognosis are not only significant, but also independent when correlated with the other factors included in the model . All statistical tests were two - tailed and the significance level was set at 0.05 . Six hundred thirty - nine consecutive patients underwent surgery for colorectal cancer at yeouido st . Mary's hospital, the catholic university of korea from january 2006 to december 2009 . Patients were excluded if they had colorectal cancer other than adenocarcinoma and carcinoma in situ . However, patients who had preoperative radiation therapy and those who were not able to undergo curative resection were included . Routine laboratory measurements, including white blood cell (wbc) count, neutrophil count, lymphocyte count, monocyte count, and platelet count, were performed preoperatively, daily until day four postoperatively, and subsequently every two days . We did not consider preoperative infection and inflammatory condition and postoperative infection and inflammatory condition . Patients were divided into three groups based on the days spent on the leukocyte count to drop below 10,000/mm after surgery (dsnlc; group i, 0 - 1 days; group ii, 2 - 3 days; group iii, 4 days). For a comparative analysis with the results of the other study, grouping of the variables, such as the wbc count, neutrophil count, lymphocyte count, monocyte count, and platelet count, " right side colon " was defined as both the right colon and the transverse colon . " Left side colon " was defined as both the left colon and the recto - sigmoid colon above the peritoneal reflection . Staging evaluation was carried out according to the guidelines of american joint committee on cancer, sixth edition . This study was approved by the institutional review board of the college of medicine (sc11tisi0080). The relationship between the number of days required for the leukocyte count to drop below 10,000/mm after surgery (group i, 0 - 1 day; group ii, 2 - 3 days; group iii, 4 days) and clinicopathologic factors was assessed using the chi - squared and fisher's exact tests . The overall duration of survival was calculated from the date of surgery until the date of death . The duration of cancer - free survival was calculated from the date of surgery until the date of detection of disease recurrence, defined using clinical, radiographic or pathological findings . Overall and cancer - free survival rates were calculated using the kaplan - meier method, and differences among curves were tested using the log - rank test . Variables that were significantly related to the survival rate in a univariate analysis were subsequently included in a multivariate analysis employing the cox multiple regression model . This method finds the' best' variables (p<0.05) for which the effects on prognosis are not only significant, but also independent when correlated with the other factors included in the model . All statistical tests were two - tailed and the significance level was set at 0.05 . The male - to - female ratio of patients was 1.48:1, and the mean age was 62.311.5 years . Three hundred fifty patients (58.2%) were under 65 years old, and 250 patients (41.7%) were over 65 years old . The follow - up period ranged from 1 to 72 months (mean, 27.418.2 months). Tumors were localized to the right side colon in 156 patients (26.0%), the left side colon in 250 patients (41.7%), the rectum in 184 patients (30.7%) and multiple areas in 10 patients (1.7%). There were no differences between the groups with regards to complication of cancer, which was defined by perforating or obstructing colorectal lesions . Among the rectal cancer patients laparoscopic treatment was performed in 69 patients (11.5%), and conventional treatment was performed in 531 patients (88.5%). Five hundred thirty - one patients (88.5%) underwent r0 resection and 69 patients (11.5%) underwent r1 resection . We observed stage i disease in 140 patients (23.3%), stage ii disease in 178 patients (29.7%), stage iii0 disease in 208 patients (34.7%), and stage iv disease in 52 patients (8.7%). There were no differences in the characteristics of patients between the three groups, other than neoadjuvant rt and surgical approach methods (p=0.003 and p=0.005, respectively) (table 1). In total, 548 patients (91.3%) had preoperative wbc counts under 10,000/mm and 52 patients (8.7%) had increased preoperative wbc counts (over 10,000/mm). Postoperative wbc counts exceeded 10,000/mm in 417 patients (69.5%), including 74 cases (45.8%) in group i, 198 cases (33.0%) in group ii, and 127 cases (21.2%) in group iii . Preoperative wbc counts correlated significantly with disease stage (p=0.047). In particular, increased preoperative wbc counts were noted in patients at stages ii and iii (data not shown). However, neither postoperative wbc counts nor the number of days required for the leukocyte count to fall below 10,000/mm correlated with disease stage (p=0.394 and p=0.402, respectively). Patients who received preoperative radiotherapy and patients who had laparoscopic surgery had statistically significant shorter wbc normalization periods compared to patients without preoperative radiotherapy and with conventional surgery . The results did not show a significant difference in the postoperative wbc normalization period for the combined resection of other organs (p=0.329). The duration of postoperative hospital stay, according to the wbc normalization period, was as follows: group i, 127.1 days (median, 11.0 days); group ii, 12.37.3 days (median, 10.0 days); group iii, 14.87.9 days (median, 12.0 days). However, there were no significant differences, between groups i and ii . There are significant correlations between the groups with regards to preoperative neutrophil count (p<0.001), lymphocyte count (p=0.001), monocyte count (p<0.001), and platelet count (p=0.001), but no correlation between preoperative nlr (p=0.47) (table 1). In univariate survival analyses, tumor, node, metastasis (tnm) stage and monocyte count were significantly associated with cancer - free survival (p<0.01 for both parameters). In addition, cancer - free survival outcomes were significantly worse in patients who required more than four days for the normalization of wbc count (hazard ratio [hr], 1.652; 95% confidence interval [ci], 1.105 to 2.468; p=0.014). A tnm stage greater than ii and nlr is significantly associated with the duration of overall survival (p<0.050 and p=0.045, respectively), but no correlation was observed between dsnlc and duration of overall survival (table 2). Cancer - free and overall survival curves are shown according to the stage, time for leukocyte count to decline below 10,000/mm and monocyte count in figs . 1, 2, and 3, respectively . No correlation was revealed between the elevated preoperative and postoperative wbc counts (1010) and cancer - free or overall survival . In a multivariate analysis of these significant variables (except curative resection), tnm stage (stage ii: hr, 3.545; 95% ci, 1.571 to 7.997; p=0.002; stage iii: hr, 6.115; 95% ci, 2.818 to 13.447; p<0.001; stage iv: hr, 15.928; 95% ci, 6.974 to 36.378; p<0.001), an interval longer than four days for normalization of wbc counts (hr, 1.509; 95% ci, 0.999 to 2.278; p=0.050), and monocyte count (hr, 2.133; 95% ci, 1.262 to 3.605; p=0.005) were independently associated with cancer - free survival (table 3). The male - to - female ratio of patients was 1.48:1, and the mean age was 62.311.5 years . Three hundred fifty patients (58.2%) were under 65 years old, and 250 patients (41.7%) were over 65 years old . The follow - up period ranged from 1 to 72 months (mean, 27.418.2 months). Tumors were localized to the right side colon in 156 patients (26.0%), the left side colon in 250 patients (41.7%), the rectum in 184 patients (30.7%) and multiple areas in 10 patients (1.7%). There were no differences between the groups with regards to complication of cancer, which was defined by perforating or obstructing colorectal lesions . Among the rectal cancer patients laparoscopic treatment was performed in 69 patients (11.5%), and conventional treatment was performed in 531 patients (88.5%). Five hundred thirty - one patients (88.5%) underwent r0 resection and 69 patients (11.5%) underwent r1 resection . We observed stage i disease in 140 patients (23.3%), stage ii disease in 178 patients (29.7%), stage iii0 disease in 208 patients (34.7%), and stage iv disease in 52 patients (8.7%). There were no differences in the characteristics of patients between the three groups, other than neoadjuvant rt and surgical approach methods (p=0.003 and p=0.005, respectively) (table 1). In total, 548 patients (91.3%) had preoperative wbc counts under 10,000/mm and 52 patients (8.7%) had increased preoperative wbc counts (over 10,000/mm). Postoperative wbc counts exceeded 10,000/mm in 417 patients (69.5%), including 74 cases (45.8%) in group i, 198 cases (33.0%) in group ii, and 127 cases (21.2%) in group iii . Preoperative wbc counts correlated significantly with disease stage (p=0.047). In particular, increased preoperative wbc counts were noted in patients at stages ii and iii (data not shown). However, neither postoperative wbc counts nor the number of days required for the leukocyte count to fall below 10,000/mm correlated with disease stage (p=0.394 and p=0.402, respectively). Patients who received preoperative radiotherapy and patients who had laparoscopic surgery had statistically significant shorter wbc normalization periods compared to patients without preoperative radiotherapy and with conventional surgery . The results did not show a significant difference in the postoperative wbc normalization period for the combined resection of other organs (p=0.329). The duration of postoperative hospital stay, according to the wbc normalization period, was as follows: group i, 127.1 days (median, 11.0 days); group ii, 12.37.3 days (median, 10.0 days); group iii, 14.87.9 days (median, 12.0 days). However, there were no significant differences, between groups i and ii . There are significant correlations between the groups with regards to preoperative neutrophil count (p<0.001), lymphocyte count (p=0.001), monocyte count (p<0.001), and platelet count (p=0.001), but no correlation between preoperative nlr (p=0.47) (table 1). In univariate survival analyses, tumor, node, metastasis (tnm) stage and monocyte count in addition, cancer - free survival outcomes were significantly worse in patients who required more than four days for the normalization of wbc count (hazard ratio [hr], 1.652; 95% confidence interval [ci], 1.105 to 2.468; p=0.014). A tnm stage greater than ii and nlr is significantly associated with the duration of overall survival (p<0.050 and p=0.045, respectively), but no correlation was observed between dsnlc and duration of overall survival (table 2). Cancer - free and overall survival curves are shown according to the stage, time for leukocyte count to decline below 10,000/mm and monocyte count in figs . 1, 2, and 3, respectively . No correlation was revealed between the elevated preoperative and postoperative wbc counts (1010) and cancer - free or overall survival . In a multivariate analysis of these significant variables (except curative resection), tnm stage (stage ii: hr, 3.545; 95% ci, 1.571 to 7.997; p=0.002; stage iii: hr, 6.115; 95% ci, 2.818 to 13.447; p<0.001; stage iv: hr, 15.928; 95% ci, 6.974 to 36.378; p<0.001), an interval longer than four days for normalization of wbc counts (hr, 1.509; 95% ci, 0.999 to 2.278; p=0.050), and monocyte count (hr, 2.133; 95% ci, 1.262 to 3.605; p=0.005) were independently associated with cancer - free survival (table 3). In univariate survival analyses, tumor, node, metastasis (tnm) stage and monocyte count were significantly associated with cancer - free survival (p<0.01 for both parameters). In addition, cancer - free survival outcomes were significantly worse in patients who required more than four days for the normalization of wbc count (hazard ratio [hr], 1.652; 95% confidence interval [ci], 1.105 to 2.468; p=0.014). A tnm stage greater than ii and nlr is significantly associated with the duration of overall survival (p<0.050 and p=0.045, respectively), but no correlation was observed between dsnlc and duration of overall survival (table 2). Cancer - free and overall survival curves are shown according to the stage, time for leukocyte count to decline below 10,000/mm and monocyte count in figs . 1, 2, and 3, respectively . No correlation was revealed between the elevated preoperative and postoperative wbc counts (1010) and cancer - free or overall survival . In a multivariate analysis of these significant variables (except curative resection), tnm stage (stage ii: hr, 3.545; 95% ci, 1.571 to 7.997; p=0.002; stage iii: hr, 6.115; 95% ci, 2.818 to 13.447; p<0.001; stage iv: hr, 15.928; 95% ci, 6.974 to 36.378; p<0.001), an interval longer than four days for normalization of wbc counts (hr, 1.509; 95% ci, 0.999 to 2.278; p=0.050), and monocyte count (hr, 2.133; 95% ci, 1.262 to 3.605; p=0.005) were independently associated with cancer - free survival (table 3). First, inflammatory diseases increase the risk of developing many types of cancer and inflammatory cells . Second, chemokines and cytokines are present in the microenvironment of all tumors in experimental animal models and in humans from the earliest stages of development . As mentioned above, our experimental mouse model creates an inflammatory reaction in the peritoneum and confers an increased metastatic burden at the wound site compared with the undamaged normal peritoneal tissues . Furthermore, this model demonstrates an abundance of pro - inflammatory cells at the wound site, which likely induces mesothelial cells in the peritoneum . Consequently, an increase in the mesothelial cells and other inflammatory cells constitute a pro - metastatic microenvironment in the normal peritoneum . In addition, in the early stages of wound healing, wound metastasis occurs . For wounds with continued inflammation, we confirmed that wound metastasis occurs even after seven days of wound healing . The glasgow prognostic score (gps), which includes only serum c - reactive protein and serum albumin, has a prognostic value independent of stage in patients with advanced or primary operable cancer . In addition, the nlr and plr have been shown to have an independent prognostic value in a variety of cancers [5 - 8]. These studies demonstrate that the prognostic values of nlr or plr are independent of tumor stage, conventional scoring systems and treatment modalities . Furthermore, studies conducted by leitch et al . Show that monocyte count and gps are independently associated with cancer - specific survival . In this study, monocyte count was significantly associated with cancer - free survival in a univariate survival analysis . Postoperative wbc count (1010) did not reveal any correlation with cancer - free survival or overall survival . Most studies mentioned above examined the effects of the preoperative inflammatory condition . However, the research presented in this report does not focus on one point of time, but rather on a certain period of an inflammatory condition that will have a great effect on the metastatic microenvironment . This idea was brought on by the fact that mmp-9 increases in the first three days postoperatively during wound healing and that the early postoperative changes affect peritoneal metastasis, as observed in the author's prior animal model experiment study [4 - 12]. Thus, in the current study, regardless of the preoperative and postoperative inflammatory status, the groups were classified by the normalization of wbc count . The period in which the metastatic microenvironment is exposed to inflammation was defined as the period until the wbc count is normalized . The results did not show significant differences between the groups, the cancer location, the extent of curative resection, or stage . These results demonstrate that the differences in surgical methods according to stage did not affect the postoperative wbc count or dsnlc . In a univariate analysis, the presence of increased wbcs in the preoperative stages did not affect the duration of disease - free survival or overall survival . On the other hand, sustained inflammation over four days did affect disease - free survival and overall survival . We can analyze that this sustained inflammation can also have a systematic effect, like the result of three day inflammatory cell increase of wound healing process having an effect on peritoneal metastasis . Moreover, dsnlc was independently associated with cancer - free survival in a multivariate survival analysis . Other studies have shown that an elevated gps may reflect an altered innate immune response, as gps was also associated with increased numbers of neutrophils and monocytes . This may suggest that activation of innate immunity, rather than down - regulation of acquired immunity, is the most important factor in determining a poor outcome in patients with colorectal cancer . One study also revealed that an early increase in wbcs during surgery correlates with an increased innate immune response . In addition, an increase in wbcs is a better prognostic parameter than an increase in monocytes or nlr . In this study, an early operative increase in wbc correlates with increased innate immunity, and this increase is predictive of a poorer outcome for colorectal cancer more so than monocyte or nlr increase, which only shows an increase in innate immunity at one point of time . Preoperative wbc count shows a correlation with an increase of cancer stage, with the exception of stage iv . Iv, since neoadjuvant chemotherapy can be performed, an increase in wbcs may be lower than in stages ii and iii . In addition, patients receiving preoperative radiation show statistically significant shorter periods for normalization of wbc counts compared to patients not receiving radiation therapy . Generally, in radiation therapy, numerous inflammatory cells are recruited into the irradiation field . Gross inflammatory scores and microscopic inflammatory scores are significantly higher at the colonic anastomotic line after preoperative irradiation . However, in colorectal cancer, the systemic effect of radiotherapy may not be substantial, and instead, the accompanying chemotherapy may be the reason for a shorter period of normalization of wbc count . In addition, there is a shorter wbc count normalization period following laparoscopic surgery; this is an advantage of minimally invasive surgery . En bloc resection with radical lymphadenectomy is performed by laparoscopic surgery in our center in the same manner of open surgery . Since there is no difference in operative extent between surgical methods, the shorter wbc count normalization period and decreased persistence of inflammation is attributable to laparoscopic surgery . However, there is no difference in the duration of disease - free survival between laparoscopic and open surgery . Postoperative increase in wbc count has many contributory factors, such as cancer cell itself, surgical complications, radiation therapy, chemotherapy and surgical methods . Whatever the causative factor, the increase in postoperative wbcs affects the metastatic microenvironment and eventually contributes to cancer recurrences . Wbc count decrease was observed in cases that had preoperative radiation or chemotherapy . For laparoscopic surgery, more research is necessary as there are relatively few cases; thus other factors, such as selection bias, can influence the results . Complicated cancer was defined by perforating or obstructing colorectal lesions shows a correlation with an increase of preoperative wbc count (p=0.004), but there were no differences between the groups (p=0.694, data not shown). This fact shows that complicated colorectal cancer was not correlative with the normalization of wbc count unless the lesion persists . In addition, the wbc count normalization period after surgery did not correlate with the presence of combined resection, but rather correlated with the duration of postoperative hospital stay . In this study, three factors (surgical approach method, preoperative radiation therapy and postoperative hospital stay) were found to be associated with the difference in time of the period of normalization of wbc count . Postoperative complications, factors in the preoperative period or factors that can affect the cancer itself may also be considered . Among these additional factors, unfortunately, postoperative complications were not recorded prospectively . Postoperative complications were omitted as a factor, leading to inaccuracy in the retrospective study, and this represents a shortcoming of this study . Taking into account the postoperative hospital stay, it can be inferred that postoperative complications are likely to have a correlation . In summary, postoperative early inflammatory phase and preoperative monocyte count correlate with the poor prognosis of colon cancer even after the calibration of stage . Thus, we can conclude that preoperativeand postoperative inflammatory response and period unfavorably affect the metastatic microenvironment.
Tailgut cysts, also known as retrotrectal cystic hamartomas, are rare congenital developmental lesions arising from postnatal primitive gut remnants, that generally occur in the retrorectal space, but have also been described in prerectal and perirenal locations . The retrorectal space is a potential space bound anteriorly by the mesorectum and posteriorly by the sacrum . The superior border is formed by the peritoneal reflection while the inferior border is formed by the rectosacral fascia . The lateral borders of the retrorectal space are formed by the ureters, the iliac vessels, the sacral nerve roots, and the lateral stalks of the rectum . The retrorectal space contains loose connective tissue, the middle sacral, iliolumbar and middle hemorrhoidal vessels, branches of the sympathetic and parasympathetic nervous systems, and lymphatics . The anatomical position and rarity of the lesion lead to difficulty first in diagnosis (the lesion is often misdiagnosed) and second in surgical management (the condition is often suboptimally managed). These tailgut cysts predominantly occur in women, with average age of presentation at 35 years . Rertrorectal tumors are frequently asymptomatic and are found incidentally during evaluation for unrelated physical complaints . Half of the patients present with symptoms such as low back or rectal pain, pain during defecation, rectal bleeding, urinary frequency, etc . Furthermore, retrorectal lesions in women can mimic gynecological pathology, and the risk of malignant transformation of a tailgut cyst always exists . Despite that, the role of preoperative biopsy for retrorectal tumors is very controversial, but most authors agree that it can be a more harmful than a useful option . This is why preoperative high - resolution modern imaging techniques (pelvic computed tomography [ct] or magnetic resonance imaging [mri]) play such a crucial role in differential diagnostics between retrorectal tumors and planning the surgical management of retrorectal lesions, including tailgut cysts . Complete surgical resection with negative margins still remains the cornerstone of surgical treatment, as this eliminates the potential of recurrence, hemorrhage, infection, compression, and malignant changes . A 40-year - old female was referred to our institution with the history of lower back swelling since 2 years . She consulted a surgeon, at some regional hospital, about 1 year back, who misdiagnosed it to be an abscess . The swelling was subjected to incision and drainage, at that regional hospital, but without any success . Later on, the patient was referred to us, ultrasonography for pelvic organs demonstrated ill - defined large cystic lesion 8 cm 7 cm, posterior to the uterus . The margins could not be well defined due to distal acoustic shadowing of adjacent gut loops . A lumbosacral contrast - enhanced ct (cect) [figures 1 and 2], demonstrated a well - defined fluid density mass / collection with enhancing walls in the retrorectal, presacral, precoccygeal area, measuring (7.9 cm 11.2 cm 11.5 cm), with anterolateral displacement of rectum to left side, extending posterior to sacrum and coccyx through the infracoccygeal region forming a fluid collection with enhancing walls (4.5 cm 4.8 cm 13.5 cm). Cect report suggested the lesion most likely to represent tailgut duplication cyst / retrorectal cystic hamartoma . Bilobed retrorectal cyst axial view of retro - rectal / tailgut cyst following discussion, it was decided that surgical excision of this lesion was the most appropriate course of action given its symptomatology and uncertain malignant potential . A vertical incision was given over the swelling on the sacrococcygeal area, facilitated en bloc removal of the sacrococcygeal cystic mass [figures 3 and 4]. The peritoneum overlying the pelvic brim was incised posterolaterally, and the mesorectal plane was entered . The rectum was fully mobilized, allowing the cyst, which was adherent to it, to also be mobilized and removed intact . Previous scar of incision and drainage, and mucoid color fluid on aspiration of cyst surgical excision of cyst from the posterior approach histopathology revealed a multiloculated tailgut cyst containing abundant mucoid material lined by glandular mucinous epithelium with fibrous tissue and showing intestinal glands [figure 5], with no evidence of malignancy . She remains well at 1-year follow - up with no evidence of recurrence on serial pelvic imaging . Histopathology showing intestinal glands within cyst wall confirming tailgut cyst (h and e, 100) embryologically, tailgut cysts are believed to arise from vestigial remnants of the embryonic hindgut . The largest reported case series of 53 tailgut cysts over a 35-year period from 1950 to 1985 was described by hjermstad and helwig . They found that these cysts predominantly occurred in women (female to male ratio, 3:1). The ages ranged from 4 days to 73 years with an average age of presentation at 35 years . Symptoms only occur due to the local mass effect on surrounding organs (rectal fullness, constipation, painful defecation, lower abdominal and/or back pain or genitourinary obstruction (dysuria)), infection (cysts with secondary infection have typical symptoms of anorectal or pelvic abscess and fistula, or perianal sinus), bleeding or malignant transformation / degeneration (pain in the anorectal region). Retrorectal cystic hamartomas in the presacral space are usually well - defined, thin - walled and multicystic or unilocular . Despite the fact that the majority of tailgut cysts are benign, and can very rarely undergo malignant transformation and then most common histopathologic diagnoses are adenocarcinoma or carcinoid . They were lined by a variety of epithelia which varied not only among multiple cysts of multicystic lesions but also within the same cyst . The contents varied from clear fluid to dense mucous . Due to the location of tailgut cysts, almost all of them are palpable on rectal examination as extrinsic, contained; fluctuant masses . The differential diagnoses can be classified as congenital, neurogenic, osseous, miscellaneous, and inflammatory . Excluding inflammatory processes, congenital lesions account for approximately two - thirds of retrorectal lesions . These include developmental cysts, chordomas (remnants of notochord), and anterior sacral meningoceles . Developmental cysts can be further divided according to their origin and histopathological features into tailgut cysts, enteric duplication cysts, dermoid cysts, epidermoid cysts, and teratomas . Plain films, for investigation of presacral masses, are of limited use but may show evidence of bony destruction suggesting malignancy or an osseous lesion . Rarely, they may identify a sacrococcygeal anomaly associated with tailgut cysts . Transrectal ultrasound may be useful in demonstrating the integrity of the layers of the rectum as well as revealing a cystic lesion and clarifying whether it is unilocular or multilocular . The appearance of a tailgut cyst on ct imaging is usually of a well - defined, thin - walled, uni- or multi - locular, nonenhancing lesion in the retrorectal space . Calcification does not tend to be a feature of tailgut cysts but has been reported and if present may suggest the possibility of malignancy . In our case, we did not get mri scan done as it was quite obvious on ct scan . Mri has become the modality of choice to image tailgut cysts because of its multiplanar imaging capability (allowing imaging of surgically relevant planes) as well as its good soft tissue contrast . Mri typically demonstrates a retrorectal lesion with low signal intensity on t1-weighted images and high signal intensity on - t2 weighted images although this may vary depending on cyst content . Malignancy is suspected if there is focal irregular wall thickening and intermediate signal intensity before contrast on both t1- and t2-weighted images with enhancement after contrast . Historically, the classical treatment in this area consists of different approaches: the anterior (transabdominal), the posterior approaches (inter - sphincteric, trans - sphincteric parasacrococcygeal, trans - sacral, trans - sacrococcygeal, trans - anorectal, and transvaginal). In the current case, combined approach (posterior and then trans - abdominal) was undertaken as the lesion could not be removed solely from posterior approach due to large retrorectal component and adhesions with the rectum . On follow - up, the patient was relieved of discomfort, constipation, and swelling . Patient has been advised to visit hospital 36 monthly for the 1 year and yearly after that or if any fresh complaints appear . There is no standard recommendation for the follow - up of tailgut cysts in the literature . Follow - up of this rare condition should, therefore, be clinical and case specific . If the patient develops symptomatology, targeted cross - sectional imaging should be instituted . In the presence of abnormal histology, serial perineal examination, and cross - sectional imaging are advised . The anatomical position and rarity of the tailgut cyst lead to difficulty firstly in diagnosis (the lesion is often misdiagnosed) and secondly in surgical management (the condition is often suboptimally managed). Surgical excision is the treatment of choice for tailgut cysts as this provides a definitive diagnosis, relieves symptoms, and prevents possible complications such as infection, fistula formation, and malignant degeneration . Preoperative imaging with ct or mri is essential to plan the most appropriate surgical approach . One should be very alert while separating cyst from the rectal wall so as to prevent inadvertent injury to the rectum.
Ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi, known as ibn al - nafis (1210 - 1288 ad), was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood . The most voluminous of his books is alshamel fi sanaat tebbiat, which is a comprehensive medical encyclopedia . The aim of this review article, as a tribute to ibn al - nafis, was to introduce his valuable but neglected encyclopedia of materia medica . Ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article . Alshamel fi sanaat tebbiat covers three branches of knowledge . The first category is devoted to theoretical traditional medicine . The third category is on materia medica covering the aspect of unani medicine, from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far . The latter, introduces mono - ingredient medications in alphabetical order . Each chapter, in several parts, is dedicated to the botanical characteristics and nature of each mono - ingredient medication . In addition, this book explains traditional pharmacokinetic of every single medication for each human body organs . Based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat, it could be considered as the main reference book on traditional medicine and pharmacy, worthy of revival.
Fondaparinux sodium is a new synthetic, sulfated pentasaccharide, selective coagulation factor xa inhibitor, a safe and effective antithrombotic agent, which is indicated for preventing thrombus formation in patients with acute coronary syndromes, including those with st - segment elevation myocardial infarction (stemi), non - stemi (nstemi), or unstable angina . It is a pure, unique chemical entity consisting of five saccharide units (pentasaccharide) obtained entirely by chemical synthesis . However, inhibition of factor xa results in effective and linear dose dependent inhibition of thrombin generation, whether triggered by intrinsic or extrinsic pathways . Unlike conventional antithrombotics such as lmwhs (enoxaparin), which act on multiple targets within a coagulation cascade thereby, increasing the propensity of causing more bleeding complications . Thus fondaparinux has a favorable tolerability profile, particularly with regard to the risk of major bleeding . In the oasis-5 trial, fondaparinux has been shown to reduce major bleeding with similar short - term efficacy as enoxaparin and lowers death and stroke during long - term follow - up in patients with acute coronary syndromes undergoing percutaneous coronary intervention . Similarly, it has been shown superior to enoxaparin in reducing death or ischemic events at 9 days maintaining the efficacy up to 6 months in patients with unstable angina or nstemi with major bleeding occurring in fewer fondaparinux than enoxaparin recipients . On comparison with a heparin - based therapy, fondaparinux reduce mortality, ischemic events and major bleeding across the full spectrum of acute coronary syndromes . Thus, it is assumed and projected from the existing knowledge that fondaparinux being more selective in its action may prove safe and efficacious . There are few reports of heparin - induced thrombocytopenia (hit) related to fondaparinux in a patient previously exposed to unfractionated heparin (ufh) and delayed - onset hit caused during its prophylaxis . In contrast, it is used sometimes off label in the management of hit with thrombosis . Major bleeding is known to exist with the use of fondaparinux in previously exposed heparin user but to best of our knowledge there exist no isolated case report presenting with fondaparinux - induced major bleeding in elderly postmenopausal women prescribed for recently diagnosed nstemi . We hereby report a rare case of fondaparinux - induced major bleeding in a 58-year - old postmenopausal woman, a known hypertensive and type 2 diabetes mellitus (t2 dm) patient prescribed for nstemi reported in our adrm centre . The patient presented in the emergency with complaints of chest pain not relieved by sublingual nitrate . On examination pulse rate was 94/min, regular, normal volume, no radio - femoral delay, and vessel wall not palpable . Blood pressure (bp) measured in both limbs was 160/90 mmhg . Laboratory investigations revealed hb 11g%, tlc 8400/cmm, platelet count 2.4 lacs / cmm, rbs 194 mg%, blood urea 29 mg, serum creatinine 0.9 mg, hba1c 7.8%, serum cholesterol 245 mg%, serum triglyceride 185 mg%, hdl 35 mg% . Ecg was done immediately, which showed nstemi and a positive 10 hour troponin - t assay . Patient was treated with oxygen, morphine, beta blocker, ace inhibitor, statins, aspirin, and clopidogrel, fondaparinux 2.5 mg once daily by subcutaneous route . Third day patient developed purpura and extensive ecchymosis in right arm and forearm [figures 1 and 2]. The patient also developed epistaxis lasting> 10 min, which required ent intervention as well as macroscopic hematuria lasting for 3 days . There were no signs of deep venous thrombosis, pulmonary embolism, gangrene, retroperitoneal, intracranial, or intraocular hemorrhage in the patients as suggested by usg abdomen and mri brain . Based on clinical and laboratory findings, a diagnosis of fondaparinux - induced major bleeding was established . After which platelet count and hb rapidly reestablished to 1.5 l / cmm and 8.9 g% . She was discharged in a satisfactory condition after 15 days of hospitalization and is now regular follow up and prophylaxis treatment of mi . Since the adr was serious and most likely thought to be associated with fondaparinux because of its previous known few reports . Extensive ecchymoses in right arm and forearm of a patient extensive ecchymoses in right arm and forearm of a patient (closer view) de - challenge of drug and blood / platelet transfusion caused adr to ameliorate . Further re - challenge was not done with the fear of reappearance of adr and due to ethical constrains . Thus, the appearance of major bleeding could not be explained by a concurrent disease as such, drug or chemicals and de - challenge improved the condition . Probable / likely as per causality assessment with the score 6 . Since this adr was not studied for dose dependent response and was unpredictable / unusual as per mechanism of action is known, hence it could not be clearly labeled as type - a or b class of adr . Anticoagulation, traditionally with ufh is a cornerstone of therapy for patients of unstable coronary artery disease (cad). However ufh exhibits unpredictable anticoagulant effect, which requires frequent monitoring and has low bioavailability due to high protein binding and induced thrombocytopenia . An effort to avoid this inherent limitation of ufh has led to introduction of low molecular weight heparin (lmwh). Enoxaparin, dalteparin, nadoparin, reviparin, and latest addition in the armamentarium in countering the thrombotic events in unstable cad is fondaparinux . It is a synthetic pentasaccharide that acts as a selective inhibitor of activated factor x. the mechanism of action of fondaparinux involves high affinity (but reversible) binding to antithrombin iii and a resultant conformational change in the serpin's reactive loop that greatly enhances antithrombin iii's basal rate of factor xa inactivation . Fondaparinux acts as an antithrombin iii catalyst, with one molecule of fondaparinux leading to inhibition of many factors xa molecules . Because of its selectively, it is proposed to be devoid of major bleedings, unlike current report . As longevity is constantly increasing, the numbers of elderly patients who require anticoagulation are also rising steadily . Managing elderly patients receiving anticoagulants is challenging because those patients are at high risk of both thrombosis and bleeding . Moreover, older patients are commonly frail; they have substantial chronic comorbid conditions including renal impairment and frequent acute illnesses and are often on many medicines . There remains a clear need to optimize the use of anticoagulant drugs in these patients as suggested by current case report . The current case report highlights, a need for clinicians to have a sound understanding of anticoagulant pharmacology, dosing, toxicity, individualized approach, and predicting the risk of bleeding before they are prescribed to advancing age persons.
Orotracheal intubation is not suitable for assessing the dental relationship and occlusion, and nasotracheal intubation is contraindicated in patients with nasoorbitoethmoidal fractures or fractures of the base of the skull owing to potential complications such as cerebrospinal fluid leakage and meningitis . Tracheostomy provides an alternative, surgical intervention, but can be associated with increased post - operative care, complication rates, and morbidity . We present two cases of submental intubation using a reinforced endotracheal tube with non - detachable universal connector in patients with complex maxillofacial trauma . An 18-year - old male patient (60 kg, 170 cm) was scheduled for open reduction and internal fixation of a nasoorbitoethmoidal fracture (fig . Preliminary investigations indicated that he was otherwise healthy, with preanesthetic evaluation being unremarkable except for signs of sinus bradycardia (41 bpm). As intra - operative assessment of dental occlusion was required, orotracheal intubation was not indicated, with nasotracheal intubation also being inappropriate due to his nasoorbitoethmoidal fracture . In order to avoid tracheostomy, the patient was monitored with pulse oximetry, electrocardiography, and noninvasive blood pressure measurements . Before anesthetic induction, after preoxygenation with 100% oxygen for 3 minutes, anesthesia was induced with propofol (100 mg) and fentanyl (100 g). After successful ventilation with a facial mask, rocuronium (50 mg) was administered intravenously . Prior to intubation, the universal connector of a reinforced endotracheal tube (ett) was detached gently from the tube and reattached so that it could be easily disconnected during the procedure (fig . Orotracheal intubation was performed using a 7.5-mm - internal diameter reinforced ett (lo - contour oral / nasal tracheal tube cuffed, mallinckrodt, ireland). Anesthesia was maintained with sevoflurane and 100% oxygen to increase the apneic reservoir during the procedure . Approximately 3 cm lateral to the mandibular midline, a submental horizontal incision (of 1.5 cm) was placed a fingerbreadth below the mandibular inferior border . Blunt dissection toward the mouth floor was performed using a thin mosquito hemostat, forming an orocutaneous tunnel . A kelly forceps was then introduced through the tunnel from the outside to widen it . At that moment, the ett was disconnected from the ventilator circuit, and its connector was removed . The ett was then grasped by the tip of the kelly forceps and pulled out through the tunnel of the sub - mental incision, followed by the pilot balloon . After the ett was shifted, then, the ett was repositioned using magill forceps, and a stay suture was applied with silk in order to fix the tube to the skin to prevent accidental extubation (fig ., the stay suture was removed, and the ett with a pilot balloon was retracted from the oral cavity, removed via the mouth, and brought back to the orotracheal position . The submental incision was layer - sutured, and wet gauze dressing was applied at the site of the wound at the mouth floor to facilitate secondary healing . Following the procedure, extubation was performed, and the patient was transferred to the post - anesthetic care unit . The post - operative period was unremarkable, and there was negligible submental scarring at two months post - operation . A 48-year - old male patient (65 kg, 175 cm) sustained bilateral orbital wall and maxillary fractures with a skull - base fracture after a motor vehicle accident . He had undergone brain surgery for epidural hematoma removal 11 days prior . As his level of consciousness was alert, intubation following the operation was unnecessary . The patient was monitored with pulse oximetry, electrocardiography, and noninvasive blood pressure measurements . After preoxygenation with 100% oxygen for 3 minutes, anesthesia was induced with propofol (80 mg) and rocuronium (50 mg). Following orotracheal intubation with a reinforced ett (internal diameter, 7.5 mm), the tube was removed through the submental area using the aforementioned method . After the operation, the patient was transferred to the intensive care unit and was extubated at post - operative day 1 . An 18-year - old male patient (60 kg, 170 cm) was scheduled for open reduction and internal fixation of a nasoorbitoethmoidal fracture (fig . Preliminary investigations indicated that he was otherwise healthy, with preanesthetic evaluation being unremarkable except for signs of sinus bradycardia (41 bpm). As intra - operative assessment of dental occlusion was required, orotracheal intubation was not indicated, with nasotracheal intubation also being inappropriate due to his nasoorbitoethmoidal fracture . In order to avoid tracheostomy, the patient was monitored with pulse oximetry, electrocardiography, and noninvasive blood pressure measurements . Before anesthetic induction, after preoxygenation with 100% oxygen for 3 minutes, anesthesia was induced with propofol (100 mg) and fentanyl (100 g). After successful ventilation with a facial mask, rocuronium (50 mg) was administered intravenously . Prior to intubation, the universal connector of a reinforced endotracheal tube (ett) was detached gently from the tube and reattached so that it could be easily disconnected during the procedure (fig . Orotracheal intubation was performed using a 7.5-mm - internal diameter reinforced ett (lo - contour oral / nasal tracheal tube cuffed, mallinckrodt, ireland). Anesthesia was maintained with sevoflurane and 100% oxygen to increase the apneic reservoir during the procedure . Approximately 3 cm lateral to the mandibular midline, a submental horizontal incision (of 1.5 cm) was placed a fingerbreadth below the mandibular inferior border . Blunt dissection toward the mouth floor was performed using a thin mosquito hemostat, forming an orocutaneous tunnel . A kelly forceps was then introduced through the tunnel from the outside to widen it . At that moment, the ett was disconnected from the ventilator circuit, and its connector was removed . The ett was then grasped by the tip of the kelly forceps and pulled out through the tunnel of the sub - mental incision, followed by the pilot balloon . After the ett was shifted, then, the ett was repositioned using magill forceps, and a stay suture was applied with silk in order to fix the tube to the skin to prevent accidental extubation (fig ., the stay suture was removed, and the ett with a pilot balloon was retracted from the oral cavity, removed via the mouth, and brought back to the orotracheal position . The submental incision was layer - sutured, and wet gauze dressing was applied at the site of the wound at the mouth floor to facilitate secondary healing . Following the procedure, extubation was performed, and the patient was transferred to the post - anesthetic care unit . The post - operative period was unremarkable, and there was negligible submental scarring at two months post - operation . A 48-year - old male patient (65 kg, 175 cm) sustained bilateral orbital wall and maxillary fractures with a skull - base fracture after a motor vehicle accident . He had undergone brain surgery for epidural hematoma removal 11 days prior . As his level of consciousness was alert, intubation following the operation was unnecessary . The patient was monitored with pulse oximetry, electrocardiography, and noninvasive blood pressure measurements . After preoxygenation with 100% oxygen for 3 minutes, anesthesia was induced with propofol (80 mg) and rocuronium (50 mg). Following orotracheal intubation with a reinforced ett (internal diameter, 7.5 mm), the tube was removed through the submental area using the aforementioned method . After the operation, the patient was transferred to the intensive care unit and was extubated at post - operative day 1 . Although orotracheal intubation is the most frequently used route in securing the airway, it interferes with the surgical field and disturbs intra - operative assessment of dental occlusion . As an alternative to orotracheal intubation, nasotracheal intubation nasotracheal intubation is contraindicated in cases of skull - base trauma due to the incidence of accidental intracranial placement, possible cerebral spinal fluid leakage, and/or meningitis . Tracheostomy is a good route to secure the airway in patients with complex maxillofacial injuries, particularly for those who need prolonged intubation . However, the procedure is associated with the risk of hemorrhage, pneumothorax, infection, and tracheal stenosis ., it has been used as an attractive option for intra - operative airway control in specific, complex maxillofacial injuries . Submental intubation is also applied to bimaxillary orthognathic surgeries with simultaneous rhinoplasty or orthognathic surgeries in patients with large pharyngeal flaps or other anatomic anomalies precluding nasotracheal intubation . Other possible indications for this technique are certain base of skull procedures or cancrum oris . Submental intubation is contraindicated in patients who have severe neurological defects or those who require long - term airway support and maintenance . In these cases, tracheostomy should be considered . In patients with a history of severe keloid formation, this technique can be contraindicated . In the first case, endotracheal intubation was not indicated because of circumstances that prevented the intra - operative assessment of dental occlusion, with nasotracheal intubation also being inappropriate due to his nasoorbitoethmoidal fracture . As he was healthy, with the exception of his nasoorbitoethmoidal fracture, and did not require prolonged ventilatory support, the decision to choose submental intubation over tracheostomy had greater significance . In the second case, nevertheless, submental intubation was chosen because of his alert mental status in addition to his unrequired use of long - term airway support . Flexible and kink - resistant ett is required to maintain airway patency despite the acute angle of the airway, particularly in the submental route . Ball et al . Reported submental intubation using the flexible tracheal tube supplied with the intubating laryngeal mask (ilm, intavent, uk). However, it is rare in the market and expensive compared to our reinforced tube (lo - contour oral / nasal tracheal tube cuffed, mallinkrodt, ireland). The universal connector of a standard reinforced ett, which we used, is bounded firmly to the tube to prevent accidental detachment . Prior to intubation, it is important to detach and reattach the connector gently from ett using mosquito forceps so that it can be easily disconnected during the procedure . As discussed, tracheostomy is associated with increased postoperative care, complication rate, and morbidity . In comparison, the complications associated with submental intubation are less severe and lower in frequency . With respect to surgery, as maxillofacial trauma can often result in dental disarrangement, dental occlusion becomes clinically important . Submental intubation removes the ett from the surgical field, thereby providing a clear surgical field that also assists in preventing injuries of the ett . Additional advantages of submental intubation include its minimally invasive nature and the more esthetically acceptable nature of the resulting scar . The most serious complication is accidental extubation; however, this can be prevented via a stay suture, as used in our cases . Other complications are superficial skin infections, damage to the ett, tube dislodgement or obstruction, transient lingual nerve paresthesia, venous bleeding, and submental scarring . The submental intubation technique is a reliable alternative to tracheostomy in patients undergoing complex maxillofacial surgeries who do not require prolonged ventilatory support . It has minimal morbidity, a low complication rate, and avoids the potential complications associated with tracheostomy.
Fixed drug eruption (fde) is a distinctive variant of drug induced dermatoses characterized by sharply demarcated, erythematous patches with / without blistering that develop within hours of administration of the causative drug and heals with postinflammatory residual hyperpigmentation . It usually recurs at the same site of the skin or mucous membrane upon subsequent exposure to the same / similar group of drugs . Fluoroquinolones are widely used antimicrobials, which cause cutaneous adverse drug reactions in about 1 - 2% of patients . However, bullous fde is rarely reported . Herein we report a rare case of fde induced by ciprofloxacin followed by ofloxacin administration . A 37-year - old male presented to the outpatient dermatology department of our hospital, puducherry with a history of multiple fluid filled blisters over both hands and feet [figures 1 and 2]. He stated that the lesions appeared within 5 h of taking a single dose of oral ofloxacin, which was obtained as over the counter drug for fever from a local private medical shop . History of itching over both hands and feet followed by a burning sensation and the subsequent development of multiple fluid filled lesions were present . There was no previous history of any medical conditions such as allergy or atopic dermatitis . On further inquiry, he recalled a history of a similar episode about 1 year back for ciprofloxacin, which has been prescribed for fever . At that time physical examination revealed multiple flaccid bullous lesions with intact roof of the blister in an erythematous base were seen over proximal metacarpophalangeal joint of left thumb, left instep of sole, right dorsal big toe and little toe of left foot . Diagnosis of fde caused by ofloxacin was made taking into account of previous history of fde induced by ciprofloxacin and clinical signs . Patch test was not done as the patient did not give consent for the same . The causative drug ofloxacin was discontinued and the patient was treated with antihistaminics and topical emollients . The lesions and symptoms improved gradually within a week leaving behind residual hyperpigmentation and the patient was advised not to take fluoroquinolones in future . Well - defined bullous lesion in the instep of left foot bullous lesions in the right dorsal toe fluoroquinolones are commonly used antimicrobials (effective for both gram negative and gram positive bacteria) in the treatment of various bacterial infections and are generally well tolerated . Common side - effects include gastrointestinal effects (nausea, vomiting and diarrhea) and neuropsychiatric symptoms (headache and insomnia). Photosensitivity and morbilliform rash have been reported with fluoroquinolones, but fde is quite uncommon . A large number of drugs have been reported to elicit fdes such as trimethoprim - sulfamethoxazole, tetracyclines, penicillin, erythromycin, nonsteroidal antiinflammatory drugs, barbiturates, valproate, phenytoin, phenolphthalein, and nitroimidazoles . Even though, the pathogenesis of fde is not known, certain serum factors, antibodies, and cell mediated immunity have been attributed as causative factors . Localized tissue damage results when intra - epidermal cd t - cells are activated to kill surrounding keratinocytes and release cytokines such as interferon - gamma into the microenvironment . Quinolones can cause both delayed type and ige - mediated hypersensitivity reactions . In this case, the following criteria were considered: there were previous conclusion reports on this reaction (+ 1); the adverse event appeared after ofloxacin was administered (+ 2); adverse event improved when ofloxacin was discontinued (+ 1); adverse event reappeared when ofloxacin was re - administered (0); alternate causes that could solely have caused the reaction (+ 2); the reaction reappeared when a placebo was given (0); drug detected in the blood (or other fluids) in a concentration known to be toxic (0); the reaction was more severe when the dose was increased or less severe when the dose was decreased (0); the patient had a similar reaction to ciprofloxacin in the previous exposure (+ 1); the adverse event confirmed by objective evidence (+ 1). Probable reaction to ofloxacin administration . According to who - uppsala monitoring centre causality assessment system patient had fde to ciprofloxacin 1 year back followed by similar reaction to ofloxacin in the current admission . Cross - reaction between quinolone families, clinically manifested as fde, has been rarely reported in the literature . To the best of our knowledge, only one case of cross reactivity between ciprofloxacin and ofloxacin has been reported so far which proposed the probable mechanism would be a complex of quinolone and piperazine residue as the antigenic determinant for both ciprofloxacin and ofloxacin . Bullous fde due to fluoroquinolones should be included in the differential diagnosis when fde is suspected . Our case described the cross sensitivity between two fluoroquinolones ciprofloxacin and ofloxacin used within 1 year interval time . Hence, health care providers should be aware of the diagnosis and proper management of fde . Patients should be warned against the use of anti - microbials without the physician's advice.
Fierce competition for better mating partners has been a driving force for evolution of diverse forms and behaviors in sex - related traits . During fertilization, sperms from multiple males this natural experimentation in every single fertilization has selected sperms that work best in their fertilization environment, leading to diversification of sperm morphology as a result of sperm competition . Although tadpole - like sperm morphology in mammals represents a remarkable perfection as swimming cell machinery, extensive diversification of sperm morphology and physiology has been observed across other species, serving as a resource for resolving species phylogenies . Evolution of sperm tail in insects and other arthropods is particularly rapid and diverse, ranging from aflagellate to multi - flagellate, and in some cases develops extraordinary long tails . During sperm competition, any advantageous traits of sperm to outdo its competitors (better swimmer, longer survival, blocking competitors, dimorphism, etc .) Will directly contribute to fertilization and reproductive success in his descendant . Females are also under a strong evolutionary pressure to gain control over the fertilization process to pick sperms from a particular male of their choice . Among taxa as wide as birds, reptiles and insects, females have sperm storage organs specially adapted for sperm selection . Thus, co - evolution of sperm and the female sperm storage organ has been reported in many species, sometimes leading them to develop bizarre morphology of these organs . The co - evolution of male and female reproductive traits in drosophila makes it a unique and powerful model for exploring the evolutionary consequences of post - copulatory sexual selection (fig . The drosophilidae has great variation in sperm length, ranging from 300 m to 6 cm . The female has two storage organs, seminal receptacle and spermathecae, in which sperms stay in a fertile state waiting for ovulation . It has been shown that the length of the primary storage organ, seminal receptacle, positively correlates with sperm length across 46 drosophilidae species . The length of seminal receptacle range from 400 m to 8 cm, and in most of the cases is slightly longer than the sperm length . It was suggested that inside the thin tubular seminal receptacle, sperm from different males are mixed and compete with each other for a chance to reach the ovulated egg, and that a longer tail is helpful to position the sperm head closer to the exit from the seminal receptacle . Indeed, it is empirically demonstrated that a longer sperm tail is advantageous for reproduction . It was hypothesized that the length of seminal receptacle and sperm tail have co - evolved, and the length incompatibility suppresses fertilization efficiency, thereby promoting reproductive isolation . In order to understand the genetic basis for sperm competition in drosophila, knowledge of the cellular basis for sperm tail elongation is necessary . We have undertaken a cell biological approach to identify the mechanism of sperm tail elongation in drosophila . Two giant mitochondria elongate together with microtubules and push cell membrane of elongating sperm tail . Study of sperm morphogenesis has been slow due to lack of both genetic tool and in vitro culture system for detailed observation of spermatogenesis . Noguchi and miller have previously shown that carefully dissected spermatids (64 cell cyst) from model animal drosophila melanogaster testes can be cultured in vitro and elongated spermatids separated into single sperms through individualization . Axoneme, a major structure of sperm tail which propels the swimming motion, is dispensable for tail elongation because spermatids of axoneme - less mutants (dsas-4) elongated reasonably well in vitro, consistent with the previous observation of immobile but well - elongated sperms in testes of the mutants . However, microtubule inhibitor experiments demonstrated that yet another microtubule - based structure is essential for sperm tail elongation . Fluorescent microscopy and electron microscopic analyses revealed that cytoplasmic microtubules are located in the vicinity of mitochondria, arranged in parallel to the longitudinal axis of the sperm tail . Based on live imaging and local drug treatment data, we found that microtubules at the tail tip region with particularly fast turn - over rate and active sliding motion are essential for sperm tail elongation . Through genetic perturbation of mitochondrial functions, we discovered that mitochondria play an essential role in sperm tail elongation . In postmeiotic spermatids, a testis - specific mitofusin, fuzzy onions, promotes massive fusion of mitochondria to form two large pieces of mitochondrial derivatives called nebenkern . During spermatid elongation, giant mitochondrial lobes elongate in parallel to the axoneme to fill the entire length of sperm tail (fig . When final mitochondrial length was reduced by mutations of fuzzy onions or no mitochondrial derivative, sperm tails failed to elongate to the maximum length . Similar defect in elongation was observed in mutants of milton - dmiro complex, an adaptor linking mitochondria to microtubule motor protein kinesin . In addition, we found that the surface of spermatid mitochondria serves as a microtubule - organizing center (mtoc), promoting assembly of microtubule array around themselves . We propose that double membrane architecture of mitochondria combined with cytoplasmic microtubules can serve as structural support for sustainable elongation of the sperm tail . Elongation and sliding of microtubules in the growth zone would stretch folded mitochondria to expose open surface for new microtubule assembly . By repetition of this stretch cycle, giant mitochondria can be a self - promoted structural scaffold, in addition to its original role as energy sources needed for flagellar motion . First, it demonstrated that mitochondria play a novel role in cell morphogenesis acting as an inner skeleton of sperm tail . In other words, mitochondria, a double membrane organelle with mtoc activity, can actually determine the extracellular morphology of sperm . Another double membrane organelle nucleus showing similar morphological diversification in sperm across species is also likely serving as an alternative shaping tool for sperm morphogenesis . Second, this is a detailed cell biological study on tissue specific mitochondrial morphogenesis, which is poorly understood in the field of mitochondria biogenesis . Typical mitochondria in somatic cells are 34 m in length and 1 m in diameter moving along microtubules and undergo fusion and fission process . However, in cells of many specialized tissues, great variations of mitochondrial number, size, and morphology have been reported . Many of which are suggested to be related to their tissue specific functions . In the case of drosophila sperm morphogenesis, motor complex (milton / dmiro / kinesin) used for mitochondrial trafficking in neuronal cells are converted into an elongation machinery of much larger mitochondria . Intriguing questions are whether the conversion of microtubule motor complex from mitochondrial trafficking and mitochondria dependent microtubule nucleation are general mechanisms required for morphogenesis of mitochondria in other type of cells, such as the ordered arrays within muscle fibers of muscle cells and the elongated forms in photoreceptor cells of human retina . Having outlined the process of sperm tail elongation, we are in the position of starting a comparative analysis of spermatid elongation in drosophila melanogaster strains with long and short sperm . Since sperm length variation appears to occur rapidly during regional separation, it should be possible to search for rapidly evolving genes among genes involved in key steps of spermatid elongation . In addition, gigantic sperms in drosophilidae appear to have multiple evolutional origins; it will be of interest to search for the crucial process that may have permitted the appearance of long sperm by asking which step of sperm elongation differs most between closely related species of long and short sperm . Measurement of the size of spermatocyte and nebenkern, speed of elongation, time required to reach full length and requirement of microtubules and mitochondria should clarify whether the mitochondria - driven elongation mechanism is used in other drosophilidae species with extremely long sperms . One of the main questions in speciation is the identification of mechanism for reproductive isolation, reducing gene exchange between two populations and enhancing the chance of speciation genes to fix among them giant sperm are reported from a range of taxa including the coleopterans divales bipustulatus, ptinella patella, hemipteran notonecta glauca and the lepidopteran xenosoma geometrina . Also, large mitochondria are the most frequent feature of sperms among insects and arthropods . Thus, the sperm - elongation mechanism described in this report might be a general system for facilitating sperm - size variation among insects with giant mitochondria, thereby enhancing sexual selection and reproductive isolation . Moreover, recent advance in transgenesis and gene knockout technologies has made genetic analysis in non - model insects more feasible . Therefore, cell biological analyses we performed on drosophila melanogaster may be applied to other species . Taken together, our study revealed a novel mechanism of cell elongation and set a road map for future study to address the genetic basis for sperm competition and reproductive isolation.
Ceramic and composite resin, esthetic dental materials are continuously developing to meet functional and esthetic demand . Indirect restorations require appropriate cement for long - term use in changeable oral conditions and also to meet patients esthetic expectations . In success of indirect restorations, it is important that indirect restorations are firmly attached to the tooth structure with resin - based cement . Several different types of light curing unit (lcu), from conventional quartz - tungsten - halogen (qth) lamps to argon laser, have been employed . Qth lamps emit light when electrical energy heats a small tungsten filament to high temperatures . Qth - curing lights work at wavelengths of 400 to 500 nm with output ranging from 400 to 800 mw / cm . Light - emitting diode (led) or solid - state led, instead of the hot filaments used in halogen bulbs, leds use junctions of doped semiconductors for generating light . Recently, polywave led units (with two or more spectral peaks) have been introduced using two or more different led colors, meaning that their spectral output ranges from blue (460 nm) to violet wavelengths (410 nm) of light . These lights can polymerize composite resins containing both conventional and alternative photoinitiators . Since most manufacturers of direct resin - based restorative materials do not provide details about the photoinitiators contained in their products, narrow blue led light spectra emission is ideal for photopolymerization of camphorquinone containing materials, but this may not be such efficient when other photoinitiators, such as 1-phenyl-1,2-propanedione, are present in very light composite shades (high color value) used for repair of bleached teeth . This situation was addressed by manufacturing dual - wave (or polywave) led lcus, emitting in the violet (410 nm) and blue (470 nm) component of the light spectrum . The third generation, polywave leds are used in these led lcus . While many publications have discussed the physical properties of led light - cured materials, few have investigated the color stability of resin - based restorative materials when cured with qth and led lights . Monowave and polywave led lcus and qth lcus have not previously been compared in terms of efficiency in curing resin cement under indirect restorative materials . Shade matching, whether by visual or instrumental methods, requires an understanding of color harmony and tolerance . In other words, the e value of 2.5 exhibited a borderline value recognizable to all people in a color test . Color changes are considered visually perceptible when e> 1 and clinically acceptable when e <3.3 . The cie l*a*b * - based color difference formula is most widely used . Cie l*a*b * color appearance attributes are frequently used to calculate cie l*a*b * color difference (e) as equations . Color differences (e) were calculated using the cielab35 color notation system namely, l * (lightness, ranging from 0 to 100 with higher numbers being brighter), a * (green - red direction), and b * (blue is the yellow direction). Cielab parameters (l *, a *, and b *) of each specimen were recorded at initial (i) and at final (f). The purpose of this study was, therefore, to evaluate the effect of color changes in a resin cement material polymerized under different restorations using different light polymerizing units . The hypothesis of this study would be different curing systems and different interface materials effects the resin cement color stability at different time interval . Conventional halogen (qth), polywave and monowave led lcus, and interface materials (polystyrene strip, ceramic, and composite resin) were used . A list of the curing lights, including specifications and manufacturers, is given in table 1 (kuraray, japan, lot: 0015 aa) resin cement was used for all test groups . Curing regimes and curing conditions the protocol involved 18 groups (n = 5); three interface materials and three different curing systems at two - time intervals . Resin cement was firmly pressed under a 5 kgf load for 3 min in a teflon cylindrical mold under a glass slide covered by a polystyrene strip (kerrhawe stopstrip, kerrhawe sa, bioggio, switzerland, lot: 70501264) to produce a uniform thickness . Resin cements were polymerized on interfaces prefabricated from ceramic (a2 vita porcelain, sckingen, germany) and composite resin (a2 esthet x hd, dentsply, caulk, milford, de, lot no: 090119) for simulated ceramic or composite restoration . The resin cement was exposed to light through the upper glass slide in contact with a curing 9-mm light tip for 20 or 40 s in the case of qth units, 20 or 40 s for monowave led units, and 3 or 6 s for polywave led units [table 1]. The output of the curing light was checked with a radiometer (curing radiometer, model 100, kerr corp ., no polishing techniques were used in order to avoid modification of the surfaces that might have influenced the results . The color of each specimen was measured three times; before polymerization and twice after polymerization (20/40 s for qth and monowave led and 3/6 s for polywave led) using a colorimeter (shade eye nnc, shofu, japan). The measurements were performed, according to the cie l*a*b * system, and mean l *, a *, and b * values for each material were calculated . The total color change (e) obtained was calculated for each specimen using the equation: where l *, a *, and b * are differences in the respective values before and after polymerization . Data obtained were analyzed using three - way analysis of variance (anova) followed by duncan test significant difference tests for comparisons among groups at a 0.05 level of significance . Conventional halogen (qth), polywave and monowave led lcus, and interface materials (polystyrene strip, ceramic, and composite resin) were used . A list of the curing lights, including specifications and manufacturers, is given in table 1 (kuraray, japan, lot: 0015 aa) resin cement was used for all test groups . Curing regimes and curing conditions the protocol involved 18 groups (n = 5); three interface materials and three different curing systems at two - time intervals . Resin cement was firmly pressed under a 5 kgf load for 3 min in a teflon cylindrical mold under a glass slide covered by a polystyrene strip (kerrhawe stopstrip, kerrhawe sa, bioggio, switzerland, lot: 70501264) to produce a uniform thickness . Resin cements were polymerized on interfaces prefabricated from ceramic (a2 vita porcelain, sckingen, germany) and composite resin (a2 esthet x hd, dentsply, caulk, milford, de, lot no: 090119) for simulated ceramic or composite restoration . The resin cement was exposed to light through the upper glass slide in contact with a curing 9-mm light tip for 20 or 40 s in the case of qth units, 20 or 40 s for monowave led units, and 3 or 6 s for polywave led units [table 1]. The output of the curing light was checked with a radiometer (curing radiometer, model 100, kerr corp ., no polishing techniques were used in order to avoid modification of the surfaces that might have influenced the results . The color of each specimen was measured three times; before polymerization and twice after polymerization (20/40 s for qth and monowave led and 3/6 s for polywave led) using a colorimeter (shade eye nnc, shofu, japan). The measurements were performed, according to the cie l*a*b * system, and mean l *, a *, and b * values for each material were calculated . The total color change (e) obtained was calculated for each specimen using the equation: where l *, a *, and b * are differences in the respective values before and after polymerization . Data obtained were analyzed using three - way analysis of variance (anova) followed by duncan test significant difference tests for comparisons among groups at a 0.05 level of significance . Resin cement colorimetric values (l*a*b *) of the resin cement polymerized under ceramic and composite discs with three light polymerizing units before and after polymerization are given in table 2 . Color changes (e) of all test groups are presented table 3 and figure 1 . L *, a *, b values (mean sd) of the test groups (n=5) e values and sd of the test groups (n = 5) color changes (e) of all test groups are presented three - way anova revealed significance for interface materials and curing units in relation to e (p <0.05). The interaction between polymerizing units, material and time was not significant (p> 0.05) [table 4]. Results of three - way anova both interface materials, ceramic and composite resin are induced less color change than the control group (p <0.05). Monowave led exhibited significantly higher color changes than the other materials (p <0.05) (e 2.94). Composite specimens with qth induced significantly less color changes ([p <0.05] [e 0.87 0.41]) [figure 1]. This study investigated the color of indirect composite or ceramic restoration, after cementation with resin cement using differently lcus . The color stability of both indirect restorations and luting materials is important for the esthetics of laminate veneers, all - ceramic crowns, and indirect composite restorations . One of the most important benefits of ceramic crowns is the semi - translucency of the material that allows light transmission . This optical property improves the esthetics of ceramic crowns as compared to metal - ceramic crowns that do not allow light transmission through the metal . However, the translucency of esthetic indirect restorations is very important in terms of the complex color matching process . The color of the tooth and the luting cement can affect the appearance of indirect restorations . Several studies have reported the importance of color to the clinical appearance of an esthetic crown . Led lcus have become the gold standard for photopolymerization of resin - based dental materials . Since contemporary led lights provide superior irradiance, expanded lifetime, little light output degradation over time to qth light, led lights are expected to optimally polymerize resin materials as or even more effectively than qth . In the current study, color changes in specimens polymerized with monowave led were statistically greater than those in halogen - based polymerizing units and polywave led lcus (p <0.05). Polywave led devices portrayed as having maximum theoretical polymerization efficacy also have characteristics that need to be developed . In some of these polywave led units, the spectral emission is not uniformly distributed across the light tip, further compounding the effects of beam inhomogeneity . This may explain the color changes in the specimens polymerized with polywave led lcus used in this study being greater than the color change values in specimens polymerized with monowave led lcus . In the present study, significant difference was showed between interface materials prepared for the purpose of representing indirect restorations . The greatest color change was obtained in the control group since polymerization was more effective (p <0.05). Ceramic and composite interface materials were seen to be able to cause a decrease in polymerization efficacy . Inadequate polymerization or cement type factors that may cause the color changes followed by polymerization . Clearfil sa cement is a dual cure cement and polymerized in two stages with physically and chemically . Such reaction may occur a higher monomer conversion which allows the polymerization of the deeper layers of the resin . However, the thickness and light transmittance of the indirect restoration, which applied on the resin cement, should be able to allow sufficient polymerization of the resin cement . In our study, similarly, the ceramic disc used in our study is more translucent than composite, and it was caused a higher polymerization by passing more light from composite block . Watanabe et al . Has shown that high - intensity led unit is more effective than qth units during polymerization of dual cure cement trough ceramic material . Has reported that led units emit more homogenous light and thus yield more uniform distribution of surface hardness (knoop hardness number) of a resin composite than halogen units . In our study, monowave led exhibited significantly higher color changes . The color appearance of a layered ceramic disk specimen is strongly influenced by the core and veneer thicknesses and also by their interaction between them . In contrast, a 1.0-mm thick ips empress 1 ceramic material was not affected by the shades of substrate and luting composite cement tested . The effects of two different cement shades (vita a1 and a3) and water storage on the leucite - reinforced ceramic color over time showed no changes in the experimental design may explain the different results from different studies, such as the contents of materials, color of the test specimens, and the color - measuring instruments . It is also important to realize the impossibility of establishing exact comparability between in vitro and in vivo tests . Considering the methodology applied and the limitations of this in vitro study, it can be concluded that different curing units and interface materials have a significant effect on the final color of resin cement . More studies are now needed to evaluate the efficiency of polymerization of mono / polywave led lcus and to evaluate the effect of different interface materials on color stability of resin cement.
The advantages of phacoemulsification surgery include excellent potential visual outcome, small corneal incision, and the possibility to employ premium intraocular lenses.23 however, it is not easy to master the technique due to its steep learning curve . Some rely on self - learning methods such as videos of expert surgeons or request training from the vendor of phacoemulsification units who are more than willing to offer tips to beginners.4 some get trained by practicing on animal eyes in a wet lab . Although this is a good opportunity to know the functioning of the machine, human eyes differ considerably from animal eyes . Due to the difference in the thickness of lens capsule and lack of a nucleus in the animal lens, phacoemulsification in animal eyes is not the same as human eyes . In the most teaching centers, formal training provided to a beginner who learns the procedure under the supervision of an expert who intervenes only at if complications occur or the duration of surgery is too long.456 in a stepwise training program, phacoemulsification surgery is divided into various steps and proficiency in one step leads to next step under the guidance and supervision of an expert trainer.7 some centers in the developed world use simulators.89 the road to sics aided by phacoemulsification is said to be slippery with vitreous . Numerous studies of resident training focus on preserving the posterior capsule and limiting vitreous loss.710111213 a novel technique of reverse method of training, in which the final steps of the surgical technique are taught first, and the initial steps are taught last was attempted in brazil.14 however, it has never been compared to the traditional start to finish supervised method of teaching phacoemulsification surgery . The aim of the study was to compare start to finish or conventional method to the reverse method of training with regards to posterior capsular rupture (pcr) in phacoemulsification surgery at a teaching institute . This study was conducted at the lions national association for the blind (nab) eye hospital, a tertiary referral and teaching center in western maharashtra, india . The incidence of pcr depends on the level of skill of a surgeon; hence, surgeons learning phacoemulsification surgery in the institution were divided into two groups . It also has some doctors enrolling for short - term phacoemulsification training (30 days course). These were ophthalmologists who had done their residency a few years ago and had now joined to enhance their skills . Beginners were thus not novice surgeons who were performing cataract surgery for the 1 time but had some experience with manual sics and were now upgrading their skills for phacoemulsification . Chronology of steps in which the beginner learned surgery by start to finish or reverse method is demonstrated serially . From march 2008 to february 2009, beginners learned the start to finish method of teaching were considered group a (" start to finish " or conventional), whereas from march 2009 to february 2010, beginners who learned using the reverse method were considered as group b (reverse). The beginners in both groups were well versed with tunnel construction, continuous curvilinear capsulorhexis, and hydro dissection as they were performing manual sics independently and with good results . The hospital authorities considered this criterion for beginning phacoemulsification training as the safest approach to transition to phacoemulsification, similar to other centers in india.515 therefore, the first three steps for both the groups were same . Each beginner from their respective group was given 3 - 5 cases to learn a particular step from step number four . On acquiring adequate skill of the particular step they were allowed to move to the next step . The fourth step was removing (washing) viscoelastic material from the anterior chamber in a case that was being completed by the trainer . The fifth step was the aspiration of the cortex in a case where the trainer had already emulsified the nucleus . The seventh step involved the beginner being taught to crack the nucleus that was already trenched by the trainer . The eighth step involved teaching the beginner to trenching the nucleus and in ninth step nucleus rotation was taught . The final tenth step was in the bag implantation of poly - methyl - methacrylate lens with 5 mm optics . In the reverse method, steps 4 - 9 were exact reversals of the conventional method . After the 30 case, the surgeons were asked to perform surgery by the conventional method and were graduated to the trainee group . In both groups, nucleus emulsification was taught with the divide and conquer method and irrigation - aspiration was taught as a bimanual method . Order of steps of phacoemulsification taught there are a variety of techniques for teaching phacoemulsification, the three supervising surgeons used the divide and conquered technique as they were most familiar with this method and considered it the easiest for the transition . Most trainees had some experience with manual sics, and were proficient in tunnel construction and capsulorhexis and were familiar with the nuclear and advanced cortical cataracts that formed the bulk of the training cases . Suturing of the tunnel was performed if there was any uncertainty about the integrity of wound closure . The outcome measure was the incidence of pcr in each group, and for beginners and trainees . Statistical analysis was performed with a two - by - two chi - square test . Thirty - two ophthalmologists learning phacoemulsification (the first 100 surgeries) participated in the study . They were supervised by 3 trainers (2 female), each of whom had an experience of at least 8000 cataract surgeries, of at least 1000 were phacoemulsification cases . Comparison of posterior capsular rupture by both methods of training fifteen beginners (first 30 cases) performed 287 surgeries by with the conventional method and had pcr occurred in 18 (6.2%) cases . Eleven of these beginners later performed 679 surgeries (" trainee " group next 31 - 100 cases), and pcr occurred in 32 (4.7%) cases . Seventeen beginners performed 322 surgeries using the reverse method and pcr occurred in 15 (4.6%) cases (p = 0.38, chi - square test for comparison between beginners of the two groups). Twelve surgeons taught with the reverse method later performed 722 phacoemulsification surgeries (trainee group, next 31 - 100 cases) and pcr occurred in 31 (4.3%) cases (p = 0.705, chi - square test for comparison between trainees of the two groups). Table 3 presents that 18 cases had pcr with the conventional training method and pcr occurred while aspirating cortex in 8 (2.8%) cases followed by rupture during emulsification of nuclear fragments in 5 (1.7%) cases . Of 15 cases of pcr with the reverse training method, pcr occurred during nucleus fragmentation, emulsification, and cortical aspiration in 4 (1.2%) cases each . Steps during surgery where posterior capsular rupture occurred the transition from sics or conventional extracapsular cataract extraction (ecce) to phacoemulsification is a steep learning curve.1112 this is akin to new driver who initially has poor hand - foot - eye - brain coordination while learning to drive a car . The use of a foot switch is new to these individuals and requires some experience . Judicious use of ultrasound energy, vacuum, and flow rate is learned with experience . Those who were trained on simulators had less intraoperative complications and shorter learning curves.9 hand and foot activated surgical tools in simulated ophthalmic surgery are also used to assess dexterity.8 in reverse training method, the transition to the new technique was gradual . A study assessing the difficulty of the various steps of phacoemulsification surgery reported an incidence of pcr of 9%.16 the most difficult steps were phacoemulsification of the nucleus and capsulorhexis.16 the steps considered most challenging that carried the greatest risks were emulsification of the nucleus and cortex aspiration . In the current study, these steps were taught towards the end of the training once the other steps were adequately performed . While washing viscoelastic as the first step of conversion, the trainee surgeon was familiarized with the use of the foot switch and gained experience in the nuances of foot pedal control . Cortex aspiration without use of ultrasound energy, emulsification of already divided nucleus, cracking of already divided nucleus helped build the confidence of the surgeons . The reverse training method resulted in almost a third lower incidence of pcr in beginner group compared to conventional groups (31 - 100 learning cases), the incidence of pcr was similar . In the cortical aspiration step, the incidence of pcr decreased more than 50% in the reverse method compared to conventional method . In nucleus cracking step, the incidence of pcr was> 0.89% in reverse method compared to the conventional method . However, these differences were not statistically significant (two proportion z - test). The decreased incidence of pcr could be due to the trainer surgeons performing the initial steps (e.g., continuous curvilinear capsulorhexis, hydro - dissection, and rotation of the nucleus) more diligently . The trainer surgeons were experienced and left a clean and clear field for the trainees to operate on, thus decreasing the chance of the capsular damage . However, they experienced difficulty in cortical aspiration and nucleus fragment emulsification likely due unfamiliarity with using a foot switch . Thomas observed two residents in early stage of learning phacoemulsification and noted an incidence of pcr of 10% although they were familiar with sics.13 hennig stated that in unsupervised learning, formal training, and stepwise formal training the incidence of pcr was 15%, 10%, and 4.8%, respectively; thus advocating stepwise formal training for beginner.4 studies of complications during surgical residency training from germany and usa reported an incidence of pcr of 3.8% and 3.1%, respectively during phacoemulsification training.710 reports from taiwan and usa evaluating the learning curve of phacoemulsification in resident surgeons reported an incidence of pcr of 4.9% and 5.1% respectively.1112 the us study noticed that the incidence of pcr decreased from 5.1% to 1.9% after 80 surgeries indicating safety and efficiency improved with experience . Our study had comparable results although the reverse technique made the training safer in terms of pcr . The brazilian council of ophthalmology, in partnership with alcon brazil, used the reverse method to teach phacoemulsification surgery . Was slightly different where the progress of three 2 -year resident surgeons was monitored at five checkpoints . The incidence of pcr in this study was 13.1%.14 india has a large pool of young ophthalmologists who need phacoemulsification training.17 the feedback from residency training programs showed that surgical training for residents was considered inadequate by many of the respondents.18 one reason is that the residency chief believed surgical teaching may compromise on the quality of patient care.1920 many young ophthalmologists, therefore, seek special phacoemulsification training after the completion of their residency and fellowship programs . The limitations of this study include that nonrandomized design and that data from a single center are reported . A larger comparison with multiple centers would help refute or validate the relatively greater safety of the reverse method in preserving the posterior capsule . In addition, our beginners were surgeons with some experience in manual sics and not residents performing cataract surgery for the 1 time or those who were only familiar with ecce . This study revealed that both stepwise, supervised start to finish conventional and reverse methods of training phacoemulsification were safe and effective.
Deficits in working memory (wm), a limited capacity system that supports the online manipulation and temporary storage of information, are considered to be a hallmark of alzheimer's disease (ad), even in its earliest stages . Deficits in span tasks [3, 4] and dual task procedures [5, 6] emerge in the early stages of ad, and have been attributed to central executive dysfunction . Of particular interest is the finding that individuals at genetic risk of developing ad show poor wm performance relative to those not at genetic risk [8, 9], highlighting the potential of such tasks to detect early ad . This study considered the usefulness of the subject - performed task (spt) manipulation in improving wm in early ad and healthy older adult controls, in a task measuring the ability to verbally repeat short sequences of instructions . The subject - performed task involves verbally presenting participants with words or instructions consisting of sets of simple actions (e.g., open the book), which they are required to enact during this encoding phase . Recall of the actions is then subsequently tested, typically via verbal recall or recognition . In general, research shows that enacted encoding facilitates later memory performance, relative to control conditions in which no enactment occurs during encoding . Cohen originally hypothesised that spt effects are nonstrategic in nature, such that encoding during spt does not rely on active verbal or organisational strategies that are necessary during basic verbal encoding . The enactment effect may also be attributable to the development of a richer set of representations supporting performance including visual, spatial, and motoric information, or specifically the impact of increased motor coding . Alternatively kormi - nouri proposes that enacted encoding is strategic in nature and that it is the involvement of the self during spt that leads to enhanced remembering . Spt has been found to enhance recall in several clinical groups, including parkinson's disease and autism spectrum disorder (asd), yet research with ad participants has generated mixed findings . Several studies have explored this effect, all using episodic long - term memory (ltm) tasks [1720]. The first study to investigate spt in individuals with ad failed to find an enactment effect on ltm, and of those studies that have observed an effect, the majority have found it in instances of cued recall but not free recall . In contrast, the most recent study to investigate the enactment effect in mild ad patients demonstrated superior recall for spt relative to verbal - only encoding tasks in free recall, as well as in semantic - cued recall and object - cued recall . In fact, this study demonstrated that the benefit of object - cued recall was greater for ad patients than neurologically intact older adults, thus highlighting encoding specificity as a principle that might enhance recall in ad . To summarize, the present study examines the advantage of spt over verbal - only encoding tasks in individuals with early ad using a recently developed wm task . To our knowledge, this is the first study of its type to adopt a wm approach to enactment with ad patients . The present study uses a modified version of the following instruction task, which was designed to explore links between wm decrements and difficulty in retaining, repeating, and implementing complex instructions . In the original version of this task, children heard verbal instructions (e.g., touch the red pencil and put it in the black box) and were required to either perform the sequence or repeat it immediately after presentation . As a wm task, it features a minimal delay between presentation and test, and instruction sequences that are comparatively shorter than those most frequently used in the spt literature . As the instruction task has been shown to rely heavily on wm abilities, and because patients with early ad have wm deficits, we predicted that this group would perform poorer relative to an older adult control group . It was expected that healthy older adult control participants would show a substantial benefit of encoding - based enactment . As the benefit of spt has been suggested to rely on the involvement of the self, and because research suggests that ad might be accompanied by a disrupted sense of self (but see for evidence of an intact self - reference effect in ad), we might predict that individuals with ad will fail to benefit from enacted encoding . In contrast, if instead the benefit of enacted encoding relies more on automatic, nonstrategic and multimodal encoding, we predict that spt will enhance remembering in ad patients, as well as older adult controls . In other words, the potential nonstrategic nature of spt might allow patients to overcome the executive demands involved in constructing memory representations and thus facilitate their recall performance . Twelve individuals diagnosed with mild ad (5 males) and two diagnosed with mild cognitive impairment (mci; both female) were recruited for participation from a memory clinic in leeds (uk), and all received formal diagnosis by a psychiatrist . A number of participants were being medicated with acetylcholinesterase inhibitors at the time of testing, but medication was stabilised for at least 8 weeks prior to testing . Regarding ad severity, all patients scored above 19 on the mini mental state examination (mmse) (mean = 23.42, sd = 3.18), both patients with mci scored 25 . Fifteen older adult controls (5 males) were recruited from a volunteer panel held by the university of leeds (uk). Older adult controls reported themselves to be in good physical and mental health; none were taking any medication that is known to affect the central nervous system, and all were living independently at the time of testing . Participants were screened for symptoms of ad using the mmse, all scored above the cut - off of 26 points (mean = 29.07, sd = 0.70). There were no significant group differences in age (t(27) = 1.79, p = 0.09, d = 0.66) or predicted full scale iq (fsiq; t(27) = 1.44, p = 0.16, d = 0.54) (national adult reading test (nart)). Mean fsiq scores were 116.36 (sd = 10.26) (range 92128) in the ad group and 121.2 (7.77) (range 103129) in the older adult control group . Mean age of ad participants was 82.43 (6.14) (range 7192) and 78.60 (5.41) (range 6890) in the older adult group . The method used was a modified version of that used by wojcik et al . . Action - object pairings were generated by combining 8 actions (thumb, spin, push, drag, flip, tap, lift, and shake) with 15 objects (erasers, rulers, pens, boxes, and folders with red, yellow, and blue versions of each). Each action was combined with an object to create action - object pairs (e.g., tap the yellow ruler). Instruction sequences were then generated; they contained between three and seven action - object pairs; for instance, flip the red ruler (1), then spin the blue pen (2), then shake the yellow box (3) is an example of a three action - object sequence . Importantly, in order to minimize ltm contributions and focus on wm, there were no meaningful preexisting relationships between any of the actions or objects . As instruction sequences included up to seven action - object pairs, some colours (e.g., red) and objects (e.g., box) appeared more than once within a single instruction sequence, but no sequence used the same particular object (e.g., red box) twice . Participants attempted 5 sequences at each length, beginning with sequences containing 3 pairs before progressing to the next sequence length . This continued until all sequence lengths had been completed or until the participant was unable to correctly recall any action - object pairs from the instruction sequence . Instructions were read out loud by the experimenter (verbal - only task, vt) or read by the experimenter and performed by the participant themselves (subject - performed task, spt) (see figure 1 for a schematic representation of each encoding task). In the spt condition, each action - object pair was performed by the participant immediately after verbal presentation; for instance, tap the yellow ruler enactment>. In the vt condition, participants listened only and were restricted from touching any of the objects . The performance of actions was self - paced in the spt condition, and a two - second delay separated verbal presentation of each action - object pair in the vt condition to control for this . In both conditions a test phase immediately followed verbal presentation of each instruction sequence, in which participants were asked to verbally recall the entire multiaction sequence . A practice phase, consisting of two practice trials (each involving two action - object pairs), was given prior to each condition, and all actions were demonstrated to participants prior to testing . Conditions were separated by a ten - minute break in which the nart and mmse were administered to assess cognitive impairment and estimate fsiq in both groups . Written informed consent was obtained from all participants and full ethical approval was granted by the university of leeds' ethics committee prior to the start of any testing . Ethical approval for this research was also granted by the nhs ethics committee prior to testing . Performance was scored as the mean proportion of elements correctly recalled from each sequence; that is, participants received credit for each individual action, object, or colour correctly recalled . Analysis of serial order recall (elements recalled in the order that they were presented in) yielded evidence of floor effects, with several participants failing to recall any elements in their correct serial positions . Therefore, as serial ordering mechanisms were not of primary interest in this experiment, free order performance (elements recalled regardless of original order) is reported here . Analysis was carried out on three action - object pair sequences and four action - object pair sequences, as all participants in both groups completed these sequence lengths . A 2 (group) 2 (encoding condition) 2 (sequence length) mixed anova was performed . This revealed a main effect of group, f(1,27) = 14.16, p = 0.001, and p = 0.34, such that older adult control participants recalled significantly more elements from the action - object instruction sequences than did ad patients . A main effect of encoding condition was also found, f(1, 27) = 46.71, p <0.001, and p = 0.63, and this was in the direction predicted, as recall was significantly higher in the spt condition compared with the vt condition, across group and sequence length . Analysis also revealed a main effect of sequence length, f(1,27) = 47.5, p <0.001, and p = 0.64, with the proportion of correctly recalled information being higher for 3 action - object pair sequences than for 4 pair sequences . There was no significant interaction between encoding condition and group, f(1,27) = 2.67, p = 0.11, and p = 0.09, though the effects of spt were slightly larger in the older adult group . There was also no interaction between condition and sequence length, f(1,27) = 1.09, p = 0.31, and p = 0.04 . Overall, spt led to improved performance across participant groups and number of action - object pairs . A significant interaction between sequence length and group was found, f(1,27) = 10.12, p = 0.004, and p = 0.27 . Inspection of figure 2 suggests that older adults show a greater proportional decline when sequence length is increased from 3 action - object pair sequences to 4 pair sequences . This is regardless of encoding condition, as there was no significant 3-way interaction, f(1,27) = 0.87, p = 0.36, and p = 0.04 . In order to explore the group length interaction, data was collapsed across encoding condition, and paired samples t - tests indicated that increasing sequence length had a greater effect on the recall performance of older adult controls than it did on ad participants, t(29) = 7.08, p <0.001, and d = 1.38, and t(27) = 2.95, p = 0.006, and d = 0.56, respectively . This is likely due to the already relatively poor performance of ad participants at the shorter sequence length . All analyses were repeated without mci participants to determine whether this had any effect on findings; this was not the case; all basic patterns of findings were replicated . This study examined the memory performance of individuals with early ad and older adult controls on an instruction task that required the temporary storage in wm and subsequent recall of action - object sequences, following self - enactment (spt) or a baseline control condition (vt). Participants with ad tended to show a deficit in remembering relative to older adult controls, supporting extensive existing literature indicating wm deficits in early ad . The primary focus of the present study was to establish whether the wm performance of ad patients would benefit from self - enactment at encoding . The findings reveal that verbal recall in both older adults and individuals with ad was significantly facilitated by the performance of actions on objects at encoding . To our knowledge, this is the first study to indicate a beneficial enactment effect on wm in older adults and ad patients, and it suggests that this manipulation might have useful applications for the amelioration of cognitive deficits in early ad . More generally, the basic task of following and recalling instructions might be useful in detecting early stage ad . The ability to follow instructions has been observed to be particularly deficient in children identified as having poor wm; an analogous deficit may also emerge as a result of ad . What implications might these findings have both for the enactment effect in wm and for the nature of the cognitive deficit in ad? Wojcik et al . Observed substantial benefits of encoding - based enactment in a similar wm task in typical children and children with autism spectrum disorder, though accuracy was measured by physical enactment rather than verbal recall . Taken together, these findings indicate a positive encoding - based enactment effect in wm across populations and response measures . This benefit might reflect a development of a richer set of representations supporting performance including visual, spatial, and motoric information or specifically the impact of increased motor coding . Linked to this, spt - based enactment has also been attributed to a boost in item - based encoding, possibly at the expense of relational information, which may be relevant to the improvements observed in the present study on a task that did not emphasize serial order . If enactment does indeed lead to capture of information from multiple sources, one storage capacity for integrating and retaining such information may be the episodic buffer component of wm recently developed by baddeley . An important aspect of many theoretical approaches to enactment / spt is that any gains from this manipulation are automatic and nonstrategic in nature . Alzheimer's disease is characterised by a relative preservation of automatic cognitive processes and a progressive loss of controlled cognitive processes . This may help explain why the ad group were able to also benefit from this manipulation despite their possible deficits in wm control and executive ability . This observation of significant enactments in wm on free recall tasks differs from some findings in the ltm literature [17, 19], though it fits with work by lekeu and colleagues . A common factor between that work and the present study is the availability of cues at both encoding and retrieval . Whilst previous research by herlitz et al . Found no memory improvement from spt on free recall tasks, they showed that ad patients experience an enactment effect in semantic - cued recall . In fact, herlitz and colleagues demonstrated that enacted encoding is sufficient to improve the ltm performance of patients with severe dementia when semantic cues are present at recall . This suggests that patients require support at both encoding and retrieval in order for enhanced recall via self - performance . In our study, objects remained on view in the response phase, though recall was verbal in nature . It may be that the enactment effect is indeed nonstrategic in nature, but in ad it relies on cue availability in order to enable significant performance facilitation . In contrast, kormi - nouri has argued that enactment emphasizes involvement of the self, a form of processing that has been suggested to be impaired in ad . The present observation that significant effects of this manipulation were observed in ad might suggest that enactment does not particularly engage the self when used in wm tasks . However, conclusions on this issue are necessarily tentative, and the fact that enactment had a slightly larger benefit for older adults than ad patients (though the interaction was not significant) means further research will be necessary . Our results demonstrate a positive encoding - based enactment effect in wm across older adults and patients with early ad . Findings also support previous research which shows that recall is facilitated in ad by the availability of cues at both encoding and retrieval . Due to the nature of the cognitive deficits in ad, replication using this group and extension to similar paradigms might prove useful in elucidating the mechanisms responsible for the enactment effect . Of particular importance is the role that this manipulation might play in ameliorating the cognitive deficits that present in early ad.
Though both minor and major spontaneous or post - operative bleeding is the most common presentation of this rare disorder, there are several case reports of thrombotic complications also . There are few reports of myocardial infarction (mi) in the literature in patients of afibrinogenemia . A 33-year - old man, who was a confirmed case of congenital afibrinogenemia and was diagnosed six years back when he had excessive bleeding following trauma over face and persisted even after suturing that area, presenting to us with severe retro sternal chest pain of 10 h duration . He had a past history of myocardial infarction (mi) two years back and was advised dual antiplatelet therapy . He was born of second degree consanguineous marriage with history of sibling death after birth . On admission, electrocardiogram showed 2 mm st segment elevation in leads ii, iii, avf and st depression in leads i and avl [figure 1]. Troponin t obtained at admission was strongly positive with 1.24 ng / ml (normal- <0.1 ng / ml). Coagulation profile was sent after admission and tests revealed absent fibrinogen using the clauss method, markedly reduced fibrinogen antigen level, normal platelet count and bleeding time, infinitely prolonged activated partial thromboplastin time (aptt), prothrombin time (pt) and thrombin time . Prominent q wave, st segment elevation and t wave inversion in lead ii, iii and avf with st segment depression seen in lead i and avl . Right sided chest leads (v4r - v6r) showed <1 mm st segment elevation as this patient had high risk for bleeding, thrombolysis or primary percutaneous transluminal coronary angioplasty (ptca) was not advised though he had ongoing chest pain . He was treated with dual antiplatelet therapy (aspirin plus clopidogrel), statins, betablocker, angiotensin converting enzyme inhibitors and injection nitroglycerin (ntg). After few hours of treatment, the chest pain subsided and st segment showed evolving changes . His admission lipid profile was normal (low density lipoprotein 112 mg / dl, triglyceride 128 mg / dl, high density lipoprotein 40 mg / dl). The patient did not experience a recurrence of angina and was discharged three days after admission with dual antiplatelet therapy . Fibrinogen is the major coagulation protein in blood by mass: normal fibrinogen levels vary between 1.5 and 3.5 bleeding, which usually manifests already in the neonatal period (85% of cases presenting umbilical cord bleeding), is the main complication of afibrinogenemia . Paradoxically, both arterial and venous thromboembolic complications have also been reported in afibrinogenemic patients . These complications can occur in the presence of concomitant risk factors such as a co - inherited thrombophilic risk factor or after replacement therapy . First, even in the absence of fibrinogen, platelet aggregation is possible due to the action of von willebrand factor and, in contrast to patients with hemophilia, afibrinogenemic patients are able to generate thrombin, both in the initial phase of limited production and also in the secondary burst of thrombin generation . Second, the increase of prothrombin activation fragments or thrombin - antithrombin complexes have been observed, reflecting enhanced thrombin generation . So, antithrombin role has also been attributed to fibrinogen because in its absence, clearance of thrombin is impaired . Though there are several reports of both arterial and venous thrombosis in afibrinogenemia, only a few cases have been reported where these patients developed mi . With recurrent mi, treatment of mi in the presence of a bleeding disorder like afibrinogenemia is difficult as administration of thrombolysis and anticoagulant will increase bleeding . So, we treated with both aspirin and clopidogrel in our case . As patient stopped taking dual antiplatelet therapy he had recurrence of mi . Chest pain subsided after starting injection of ntg and the area of myocardial involvement was also small, we managed the patient conservatively, and discharged him on dual antiplatelet therapy . Further study is needed on this aspect to determine the best treatment that we can provide to them . Until then dual antiplatelet therapyshould be recommended to all these patient with hereditary bleeding disorder with close supervision of bleeding diathesis since without this treatment they may have recurrences.