message stringlengths 1 38k | message_type stringclasses 3
values | message_id int64 0 2 | conversation_id int64 477 897k | cluster float64 18 18 | __index_level_0__ int64 1.43k 2.69M |
|---|---|---|---|---|---|
what are pancreatic enzymes? | instruction | 0 | 477 | 18 | 1,431 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 477 | 18 | 1,432 |
Pancreatic Islet Transplantation (What are pancreatic islets?): Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. | input | 2 | 477 | 18 | 1,433 |
what are pancreatic enzymes? | instruction | 0 | 1,029 | 18 | 3,087 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 1,029 | 18 | 3,088 |
Pancreatic Islet Transplantation (What are pancreatic islets?): Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. | input | 2 | 1,029 | 18 | 3,089 |
what are pancreatic enzymes? | instruction | 0 | 1,581 | 18 | 4,743 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 1,581 | 18 | 4,744 |
Pancreatic Islet Transplantation What are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation areallo-transplantation auto-transplantationallo-transplantationauto-transplantationPancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?"Pancreatic islet allo-transplantation"What are the obstacles to pancreatic islet allo-transplantation?"For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal.Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia.Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin.Pancreatic islet auto-transplantation What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death.Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness.Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing.The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?""What is the role of immunosuppressive medications?"Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000.11According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation.By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again.The report identified factors linked to better outcomes for recipients, includingage—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin useage—35 years or olderlower pre-transplant triglyceride, or blood fat, levelslower pre-transplant insulin useThe report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence.1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013.1https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant.Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined.New England Journal of MedicineThe Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia).Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also haveincreased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infectionsincreased blood cholesterol, or blood fat, levelshigh blood pressureanemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygenfatiguedecreased white blood cell countsdecreased kidney functionincreased susceptibility to bacterial and viral infectionsTaking immunosuppressive medications also increases the risk of developing certain tumors and cancers.Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year.2222Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab.Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients.2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013.2https://optn.transplant.hrsa.gov/data/ Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds.Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness.Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation.The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Pancreatic Islet Transplantation The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions.What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you.What are clinical trials, and are they right for you?Find out if clinical trials are right for youWhat clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov.What clinical trials are open?www.ClinicalTrials.govWhat are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body. In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation are allo-transplantation auto-transplantation Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?" For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal. Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia. Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections. Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas. Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin. What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death. Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness. Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing. The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?" Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. 1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013. What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant. Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined. The Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia). Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also have increased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infections Taking immunosuppressive medications also increases the risk of developing certain tumors and cancers. Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year. Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients. 2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013. Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Clinical Trials The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions. What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you. What clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov. | input | 2 | 1,581 | 18 | 4,745 |
what are pancreatic enzymes? | instruction | 0 | 1,582 | 18 | 4,746 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 1,582 | 18 | 4,747 |
Pancreatic Islet Transplantation What are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation areallo-transplantation auto-transplantationallo-transplantationauto-transplantationPancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?"Pancreatic islet allo-transplantation"What are the obstacles to pancreatic islet allo-transplantation?"For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal.Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia.Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin.Pancreatic islet auto-transplantation What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death.Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness.Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing.The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?""What is the role of immunosuppressive medications?"Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000.11According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation.By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again.The report identified factors linked to better outcomes for recipients, includingage—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin useage—35 years or olderlower pre-transplant triglyceride, or blood fat, levelslower pre-transplant insulin useThe report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence.1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013.1https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant.Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined.New England Journal of MedicineThe Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia).Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also haveincreased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infectionsincreased blood cholesterol, or blood fat, levelshigh blood pressureanemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygenfatiguedecreased white blood cell countsdecreased kidney functionincreased susceptibility to bacterial and viral infectionsTaking immunosuppressive medications also increases the risk of developing certain tumors and cancers.Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year.2222Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab.Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients.2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013.2https://optn.transplant.hrsa.gov/data/ Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds.Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness.Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation.The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Pancreatic Islet Transplantation The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions.What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you.What are clinical trials, and are they right for you?Find out if clinical trials are right for youWhat clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov.What clinical trials are open?www.ClinicalTrials.govWhat are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body. In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation are allo-transplantation auto-transplantation Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?" For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal. Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia. Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections. Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas. Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin. What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death. Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness. Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing. The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?" Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. 1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013. What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant. Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined. The Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia). Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also have increased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infections Taking immunosuppressive medications also increases the risk of developing certain tumors and cancers. Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year. Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients. 2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013. Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Clinical Trials The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions. What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you. What clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov. | input | 2 | 1,582 | 18 | 4,748 |
what are pancreatic enzymes? | instruction | 0 | 2,133 | 18 | 6,399 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 2,133 | 18 | 6,400 |
Pancreatic Islet Transplantation What are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation areallo-transplantation auto-transplantationallo-transplantationauto-transplantationPancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?"Pancreatic islet allo-transplantation"What are the obstacles to pancreatic islet allo-transplantation?"For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal.Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia.Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin.Pancreatic islet auto-transplantation What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death.Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness.Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing.The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?""What is the role of immunosuppressive medications?"Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000.11According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation.By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again.The report identified factors linked to better outcomes for recipients, includingage—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin useage—35 years or olderlower pre-transplant triglyceride, or blood fat, levelslower pre-transplant insulin useThe report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence.1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013.1https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant.Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined.New England Journal of MedicineThe Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia).Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also haveincreased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infectionsincreased blood cholesterol, or blood fat, levelshigh blood pressureanemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygenfatiguedecreased white blood cell countsdecreased kidney functionincreased susceptibility to bacterial and viral infectionsTaking immunosuppressive medications also increases the risk of developing certain tumors and cancers.Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year.2222Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab.Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients.2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013.2https://optn.transplant.hrsa.gov/data/ Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds.Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness.Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation.The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Pancreatic Islet Transplantation The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions.What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you.What are clinical trials, and are they right for you?Find out if clinical trials are right for youWhat clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov.What clinical trials are open?www.ClinicalTrials.govWhat are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body. In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation are allo-transplantation auto-transplantation Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?" For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal. Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia. Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections. Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas. Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin. What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death. Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness. Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing. The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?" Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. 1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013. What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant. Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined. The Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia). Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also have increased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infections Taking immunosuppressive medications also increases the risk of developing certain tumors and cancers. Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year. Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients. 2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013. Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Clinical Trials The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions. What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you. What clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov. | input | 2 | 2,133 | 18 | 6,401 |
what are pancreatic enzymes? | instruction | 0 | 2,134 | 18 | 6,402 |
The pancreas also makes enzymes that help the body digest and use food. | output | 1 | 2,134 | 18 | 6,403 |
Pancreatic Islet Transplantation What are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin.When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body.In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation areallo-transplantation auto-transplantationallo-transplantationauto-transplantationPancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?"Pancreatic islet allo-transplantation"What are the obstacles to pancreatic islet allo-transplantation?"For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal.Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia.Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas.Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin.Pancreatic islet auto-transplantation What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death.Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness.Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing.The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?""What is the role of immunosuppressive medications?"Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000.11According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation.By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again.The report identified factors linked to better outcomes for recipients, includingage—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin useage—35 years or olderlower pre-transplant triglyceride, or blood fat, levelslower pre-transplant insulin useThe report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence.1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013.1https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant.Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined.New England Journal of MedicineThe Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia).Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also haveincreased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infectionsincreased blood cholesterol, or blood fat, levelshigh blood pressureanemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygenfatiguedecreased white blood cell countsdecreased kidney functionincreased susceptibility to bacterial and viral infectionsTaking immunosuppressive medications also increases the risk of developing certain tumors and cancers.Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year.2222Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab.Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients.2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013.2https://optn.transplant.hrsa.gov/data/ Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds.Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy.Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person.Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness.Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation.The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Pancreatic Islet Transplantation The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions.What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you.What are clinical trials, and are they right for you?Find out if clinical trials are right for youWhat clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov.What clinical trials are open?www.ClinicalTrials.govWhat are pancreatic islets? Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. The pancreas is an organ about the size of a hand located behind the lower part of the stomach. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. The pancreas also makes enzymes that help the body digest and use food. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. When the level of blood glucose, also called blood sugar, rises after a meal, the pancreas responds by releasing insulin into the bloodstream. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Diabetes develops when the pancreas does not make enough insulin, the body's cells do not use insulin effectively, or both. As a result, glucose builds up in the blood instead of being absorbed by cells in the body. In type 1 diabetes, the beta cells of the pancreas no longer make insulin because the body's immune system has attacked and destroyed them. The immune system protects people from infection by identifying and destroying bacteria, viruses, and other potentially harmful foreign substances. A person who has type 1 diabetes must take insulin daily to live. Type 2 diabetes usually begins with a condition called insulin resistance, in which the body has trouble using insulin effectively. Over time, insulin production declines as well, so many people with type 2 diabetes eventually need to take insulin. What is pancreatic islet transplantation? The two types of pancreatic islet transplantation are allo-transplantation auto-transplantation Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is currently labeled an experimental procedure until the transplantation technology is considered successful enough to be labeled therapeutic. For more information, see the section "What are the obstacles to pancreatic islet allo-transplantation?" For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from the pancreas of a single, deceased donor. The islets are purified and counted in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500,000 islets per infusion. Once implanted, the beta cells in these islets begin to make and release insulin. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness—a dangerous condition in which a person with diabetes cannot feel the symptoms of hypoglycemia, or low blood glucose. When a person feels the symptoms of hypoglycemia, steps can be taken to bring blood glucose levels back to normal. Pancreatic islet allo-transplants are only performed at hospitals that have received permission from the U.S. Food and Drug Administration (FDA) for clinical research on islet transplantation. The transplants are often performed by a radiologist—a doctor who specializes in medical imaging. The radiologist uses x rays and ultrasound to guide the placement of a thin, flexible tube called a catheter through a small incision in the upper abdomen—the area between the chest and hips—and into the portal vein of the liver. The portal vein is the major vein that supplies blood to the liver. The islets are then infused, or pushed, slowly into the liver through the catheter. Usually, the patient receives a local anesthetic and a sedative. In some cases, a surgeon performs the transplant using general anesthesia. Patients often need two or more transplants to get enough functioning islets to stop or reduce their need for insulin injections. Pancreatic islet allo-transplantation (above). In islet auto-transplantation, the islets are extracted from the patient's own pancreas. Pancreatic islet auto-transplantation is performed following total pancreatectomy—the surgical removal of the whole pancreas—in patients with severe and chronic, or long lasting, pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The procedure is performed in a hospital, and the patient receives general anesthesia. The surgeon first removes the pancreas and then extracts and purifies islets from the pancreas. Within hours, the islets are infused through a catheter into the patient's liver. The goal is to give the body enough healthy islets to make insulin. What happens after pancreatic islet transplantation? Pancreatic islets begin to release insulin soon after transplantation. However, full islet function and new blood vessel growth from the new islets take time. Transplant recipients usually take insulin injections until the islets are fully functional. They may also receive various medications before and after transplantation to promote successful implantation and long-term functioning of the islets. However, the autoimmune response that destroyed transplant recipients' own islets in the first place can happen again and attack the transplanted islets. Although the liver has been the traditional site for infusing the donor islets, researchers are investigating alternative sites, such as muscle tissue or another organ. What are the benefits and risks of pancreatic islet allo-transplantation? The benefits of pancreatic islet allo-transplantation include improved blood glucose control, reducing or eliminating the need for insulin injections to control diabetes, and preventing hypoglycemia. An alternative to islet transplantation is whole organ pancreas transplantation that is performed most often with kidney transplantation. The advantages of whole organ pancreas transplantation are less dependence on insulin and longer duration of organ function. The main disadvantage is that a whole organ transplant is a major surgery that involves a greater risk of complications and even death. Pancreatic islet allo-transplantation can also help reverse hypoglycemia unawareness. Research has shown that even partial islet function after a transplant can eliminate hypoglycemia unawareness. Improved blood glucose control from a successful allo-transplant may also slow or prevent the progression of diabetes problems, such as heart disease, kidney disease, and nerve or eye damage. Research to evaluate this possibility is ongoing. The risks of pancreatic islet allo-transplantation include the risks associated with the transplant procedure—particularly bleeding and blood clots. The transplanted islets may not function well or may stop functioning entirely. Other risks are the side effects from the immunosuppressive medications that transplant recipients must take to stop the immune system from rejecting the transplanted islets. When a patient has received a kidney transplant and is already taking immunosuppressive medications, the only additional risks are the islet infusion and the side effects from the immunosuppressive medications given at the time of allo-transplantation. Immunosuppressive medications are not needed in the case of an auto-transplant because the infused cells come from the patient's own body. Read more in the section "What is the role of immunosuppressive medications?" Collaborative Islet Transplant Registry Data In its 2010 annual report,1 the Collaborative Islet Transplant Registry presented data on 571 patients who received pancreatic islet allo-transplants between 1999 and 2009. Although most procedures were pancreatic islet allo-transplants alone, 90 procedures were done in conjunction with a kidney transplant. The majority of the islet transplant patients received one or two infusions of islets; at the end of the decade, the average number of islets received per infusion was 463,000. According to the report, about 60 percent of transplant recipients achieved insulin independence—defined as being able to stop insulin injections for at least 14 days—during the year following transplantation. By the end of the second year, 50 percent of recipients were able to stop taking insulin for at least 14 days. However, long-term insulin independence is difficult to maintain, and eventually most recipients needed to start taking insulin again. The report identified factors linked to better outcomes for recipients, including age—35 years or older lower pre-transplant triglyceride, or blood fat, levels lower pre-transplant insulin use The report noted that even partial function of the transplanted islets can improve blood glucose control and reduce the amount of insulin needed after loss of insulin independence. 1Collaborative Islet Transplant Registry seventh annual report. Collaborative Islet Transplant Registry website. https://web.emmes.com/study/isl//reports/01062012_7thAnnualReport.pdf (PDF, 8.2 MB) Updated December 30, 2011. Accessed July 23, 2013. What is the role of immunosuppressive medications? Immunosuppressive medications are needed to prevent rejection—a common problem with any transplant. Scientists have made many advances in islet transplantation in recent years. In 2000, islet transplantation researchers at the University of Alberta in Edmonton, Canada, reported their findings in the New England Journal of Medicine. Their transplant protocol, known as the Edmonton protocol, has since been adapted by transplant centers around the world and continues to be refined. The Edmonton protocol introduced the use of a new combination of immunosuppressive medications, also called anti-rejection medications, including daclizumab (Zenapax), sirolimus (Rapamune), and tacrolimus (Prograf). Researchers continue to develop and study modifications to the Edmonton protocol, including improved medication regimens that promote successful transplants. Medication regimens vary from one transplant center to another. Examples of other immunosuppressive medications used in islet transplantation include antithymocyte globulin (Thymoglobulin), alemtuzumab (Campath), basiliximab (Simulect), belatacept (Nulojix), etanercept (Enbrel), everolimus (Zortress), and mycophenolate mofetil (CellCept, Myfortic). Researchers are also evaluating nonimmunosuppresive medications, such as exenatide (Byetta) and sitagliptin (Januvia). Immunosuppressive medications have significant side effects, and their long-term effects are still not fully known. Immediate side effects may include mouth sores and gastrointestinal problems, such as upset stomach and diarrhea. Patients may also have increased blood cholesterol, or blood fat, levels high blood pressure anemia, a condition in which red blood cells are fewer or smaller than normal, which prevents the body's cells from getting enough oxygen fatigue decreased white blood cell counts decreased kidney function increased susceptibility to bacterial and viral infections Taking immunosuppressive medications also increases the risk of developing certain tumors and cancers. Scientists are seeking ways to achieve immune tolerance of the transplanted islets, in which the patient's immune system no longer recognizes the islets as foreign. Immune tolerance would allow patients to maintain transplanted islets without long-term use of immunosuppressive medications. For example, one approach is to transplant islets encapsulated with a special coating, which may help to prevent rejection. What are the obstacles to pancreatic islet allo-transplantation? The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. According to the Organ Procurement and Transplantation Network, in 2011 there were about 8,000 deceased organ donors available in the United States.2 However, only 1,562 pancreases were recovered from donors in 2011.2 Also, many donated pancreases are not suitable for extracting islets for transplants because they do not meet the selection criteria, and islets are often damaged or destroyed during processing. Therefore, only a small number of islet transplants can be performed each year. Researchers are pursuing various approaches to solve this shortage of islets, such as transplanting islets from a single, donated pancreas, using only a portion of the pancreas from a living donor, or using islets from pigs. Researchers have transplanted pig islets into other animals, including monkeys, by encapsulating the islets with a special coating or by using medications to prevent rejection. Another approach is creating islets from other types of cells, such as stem cells. New technologies could then be employed to grow islets in the lab. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Health insurance companies and Medicare generally do not cover experimental procedures. Federal law also does not allow health care providers or hospitals to charge patients or health insurance companies for research procedures. Some patient advocates and islet researchers feel that islet allo-transplantation is close to having a therapeutic label. The National Institutes of Health (NIH) currently supports studies that are working toward obtaining FDA licensure to reclassify islet allo-transplantation as therapeutic. In other countries, such as Canada and Scandinavia, islet allo-transplantation is no longer considered experimental and is an accepted therapy in certain patients. 2National data. Organ Procurement and Transplantation Network website. https://optn.transplant.hrsa.gov/data/. Accessed July 23, 2013. Eating, Diet, and Nutrition A person who receives a pancreatic islet transplant should follow a meal plan worked out with a health care provider and dietitian. Immunosuppressive medications taken after the transplant can cause changes in a person's body, such as weight gain. A healthy diet after the transplant is important to control weight gain, blood pressure, blood cholesterol, and blood glucose levels. Points to Remember Pancreatic islets, also called islets of Langerhans, are tiny clusters of cells scattered throughout the pancreas. Pancreatic islets contain several types of cells, including beta cells, that produce the hormone insulin. Insulin helps cells throughout the body absorb glucose from the bloodstream and use it for energy. Pancreatic islet allo-transplantation is a procedure in which islets from the pancreas of a deceased organ donor are purified, processed, and transferred into another person. Pancreatic islet allo-transplantation is performed in certain patients with type 1 diabetes whose blood glucose levels are difficult to control. The goals of the transplant are to help these patients achieve normal blood glucose levels with or without daily injections of insulin and to reduce or eliminate hypoglycemia unawareness. Pancreatic islet auto-transplantation is performed following total pancreatectomy in patients with severe and chronic pancreatitis that cannot be managed by other treatments. This procedure is not considered experimental. Patients with type 1 diabetes cannot receive pancreatic islet auto-transplantation. The shortage of islets from donors is a significant obstacle to widespread use of pancreatic islet allo-transplantation. Financial barriers also prevent the widespread use of islet allo-transplantation. Until the transplantation technology is considered successful enough to be labeled therapeutic rather than experimental, the costs of islet allo-transplants must be covered by research funds. Clinical Trials The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and other components of the National Institutes of Health (NIH) conduct and support research into many diseases and conditions. What are clinical trials, and are they right for you? Clinical trials are part of clinical research and at the heart of all medical advances. Clinical trials look at new ways to prevent, detect, or treat disease. Researchers also use clinical trials to look at other aspects of care, such as improving the quality of life for people with chronic illnesses. Find out if clinical trials are right for you. What clinical trials are open? Clinical trials that are currently open and are recruiting can be viewed at www.ClinicalTrials.gov. | input | 2 | 2,134 | 18 | 6,404 |
Please answer the letter of option truthfully | instruction | 0 | 2,308 | 18 | 6,924 |
B | output | 1 | 2,308 | 18 | 6,925 |
Q:Joseph Priestly discovered oxygen gas by the decomposition of solid mercury(II) oxide, HgO, to oxygen gas, O2, and liquid mercury metal, Hg. How many moles of oxygen gas will form when 4.32 g of solid mercury(II) oxide decomposes? The formula mass of mercury(II) oxide is 216 g mol^-1.?
A:0.100 mol;B:0.0100 mol;C:0.0200 mol;D:0.0150 mol | input | 2 | 2,308 | 18 | 6,926 |
Please answer the letter of option truthfully | instruction | 0 | 2,409 | 18 | 7,227 |
C | output | 1 | 2,409 | 18 | 7,228 |
Q:When the dichromate ion is reacted, one of its most common products is Cr3+. What is the oxidation state (oxidation number) of chromium in the dichromate ion? Does reduction or oxidation occur when dichromate forms Cr3+??
A:3+, reduction;B:12+, reduction;C:6+, reduction;D:6+, oxidation | input | 2 | 2,409 | 18 | 7,229 |
Please answer the letter of option truthfully | instruction | 0 | 3,154 | 18 | 9,462 |
C | output | 1 | 3,154 | 18 | 9,463 |
Q:The replication of hepatitis B includes which of the following stages??
A:Movement of intact virus to the cellular cytoplasm for replication;B:Conversion of relaxed circular viral DNA in to covalently closed circular (CCC) DNA in the nucleus;C:Virions produced in the cytoplasm by cellular DNA polymerase;D:Oncogenic activity to transform liver cells. | input | 2 | 3,154 | 18 | 9,464 |
Please answer the letter of option truthfully | instruction | 0 | 3,194 | 18 | 9,582 |
C | output | 1 | 3,194 | 18 | 9,583 |
Q:Which replication strategy is paralleled by some other viruses??
A:Cytoplasmic replication and 'snatched caps' are used as primers for RNA transcription;B:Replicates in cytoplasmic tubules;C:Extracellular replication;D:Replicates in the nucleus | input | 2 | 3,194 | 18 | 9,584 |
Please answer the letter of option truthfully | instruction | 0 | 3,294 | 18 | 9,882 |
D | output | 1 | 3,294 | 18 | 9,883 |
Q:The complete resynthesis of phosphocreatine after very high intensity exercise normally takes:?
A:about 10 seconds.;B:about 30 seconds.;C:about 1 minute.;D:about 4 minutes. | input | 2 | 3,294 | 18 | 9,884 |
Please answer the letter of option truthfully | instruction | 0 | 3,296 | 18 | 9,888 |
D | output | 1 | 3,296 | 18 | 9,889 |
Q:Fatty acids are transported into the mitochondria bound to:?
A:thiokinase.;B:coenzyme A (CoA).;C:acetyl-CoA.;D:carnitine. | input | 2 | 3,296 | 18 | 9,890 |
Please answer the letter of option truthfully | instruction | 0 | 3,298 | 18 | 9,894 |
C | output | 1 | 3,298 | 18 | 9,895 |
Q:Diisopropylfluorophosphate (DFP) binds to the active site of acetylcholinesterase (ACE) in the synapses of neurons. When DFP binds to ACE, the ACE enzyme is rendered permanently inactive. This makes DFP a potent toxin, with lethal amounts at less than 100 mg. The interaction between DFP and ACE can best be characterized as:?
A:Competitive inhibition;B:Noncompetitive inhibition;C:Irreversible inhibition;D:Partially competitive inhibition | input | 2 | 3,298 | 18 | 9,896 |
Please answer the letter of option truthfully | instruction | 0 | 3,300 | 18 | 9,900 |
A | output | 1 | 3,300 | 18 | 9,901 |
Q:Performance enhancing synthetic steroids are based on the structure of the hormone:?
A:testosterone.;B:cortisol.;C:progesterone.;D:aldosterone. | input | 2 | 3,300 | 18 | 9,902 |
Please answer the letter of option truthfully | instruction | 0 | 3,307 | 18 | 9,921 |
C | output | 1 | 3,307 | 18 | 9,922 |
Q:The transcription of DNA to a molecule of messenger RNA occurs:?
A:on the ribosomes.;B:in the cytosol.;C:in the nucleus.;D:only during cell division. | input | 2 | 3,307 | 18 | 9,923 |
Please answer the letter of option truthfully | instruction | 0 | 3,308 | 18 | 9,924 |
B | output | 1 | 3,308 | 18 | 9,925 |
Q:A new enzyme is found in a transgenic mice that participates in synthesis of an unknown product using two reactants. When using radiolabeled compounds to study the enzyme, it is found that the enzyme catalyzes a process that switches a nitrogen group on one reactant to the other reactant. Which of the following categories would this new enzyme fall under??
A:Oxidoreductase;B:Transferase;C:Hydrolase;D:Lyase | input | 2 | 3,308 | 18 | 9,926 |
Please answer the letter of option truthfully | instruction | 0 | 3,315 | 18 | 9,945 |
B | output | 1 | 3,315 | 18 | 9,946 |
Q:Embedded in the inner membrane of the mitochondrion are:?
A:the enzymes of the tricarboxylic acid cycle (Krebs' cycle).;B:the components of the electron transport chain.;C:glycogen molecules.;D:triacylglycerol molecules. | input | 2 | 3,315 | 18 | 9,947 |
Please answer the letter of option truthfully | instruction | 0 | 3,321 | 18 | 9,963 |
D | output | 1 | 3,321 | 18 | 9,964 |
Q:When preparing for the MCAT exam, a student begins studying electrochemical cells. He learns the basic information needed by actively relating it to previous information he has learned about redox reactions. He then builds from that knowledge to learn the advanced concepts needed. The student’s process is best characterized as:?
A:Chunking;B:A network model;C:Maintenance rehearsal;D:Elaborative rehearsal | input | 2 | 3,321 | 18 | 9,965 |
Please answer the letter of option truthfully | instruction | 0 | 3,324 | 18 | 9,972 |
D | output | 1 | 3,324 | 18 | 9,973 |
Q:The energy charge of the cell is:?
A:the difference between the charge on the outside and inside of a cell.;B:generated by the sodium-potassium ATPase.;C:the overall rate of energy use by the cell.;D:the extent to which the total adenine nucleotide pool is phosphorylated. | input | 2 | 3,324 | 18 | 9,974 |
Please answer the letter of option truthfully | instruction | 0 | 3,329 | 18 | 9,987 |
D | output | 1 | 3,329 | 18 | 9,988 |
Q:During muscular contraction, interactions between myosin and actin allow for shortening of each sarcomere. In addition to the power stroke, what other process of muscle contraction requires ATP??
A:Tropomyosin-troponin interaction;B:Myosin-actin interaction;C:Calcium-troponin interaction;D:Myosin-actin detachment | input | 2 | 3,329 | 18 | 9,989 |
Please answer the letter of option truthfully | instruction | 0 | 3,330 | 18 | 9,990 |
A | output | 1 | 3,330 | 18 | 9,991 |
Q:The activity of creatine kinase is:?
A:increased when intracellular ADP rises.;B:increased when muscle pH falls below 6.9.;C:always lower in Type II fibres than Type I fibres.;D:increased after a period of endurance training. | input | 2 | 3,330 | 18 | 9,992 |
Please answer the letter of option truthfully | instruction | 0 | 3,332 | 18 | 9,996 |
A | output | 1 | 3,332 | 18 | 9,997 |
Q:The net production of ATP via substrate-level phosphorylation in glycolysis is:?
A:2 from glucose and 3 from glycogen.;B:2 from glucose and 4 from glycogen.;C:3 from glucose and 4 from glycogen.;D:3 from glucose and 2 from glycogen. | input | 2 | 3,332 | 18 | 9,998 |
Please answer the letter of option truthfully | instruction | 0 | 3,335 | 18 | 10,005 |
C | output | 1 | 3,335 | 18 | 10,006 |
Q:DNA polymerase creates new DNA by adding complimentary nucleotides to a template strand from the original double-stranded DNA. If a section of the template strand had a ration of 3:2 of A:T bases, what is the ration of A:T in the newly synthesized complimentary strand of DNA??
A:3:02;B:1:01;C:2:03;D:cannot be determined | input | 2 | 3,335 | 18 | 10,007 |
Please answer the letter of option truthfully | instruction | 0 | 3,347 | 18 | 10,041 |
B | output | 1 | 3,347 | 18 | 10,042 |
Q:When branched chain amino acids are deaminated in muscle, the ammonia produced is mostly:?
A:converted into arginine and released from the muscle.;B:converted into alanine and glutamine and released from the muscle.;C:converted into urea and released from the muscle.;D:used to synthesise purines and pyrimidines in the muscle. | input | 2 | 3,347 | 18 | 10,043 |
Please answer the letter of option truthfully | instruction | 0 | 3,348 | 18 | 10,044 |
A | output | 1 | 3,348 | 18 | 10,045 |
Q:A certain molecule acts by binding to cytochrome oxidase A3, the final enzyme in the electron transport chain. Administration of a large dose of this substance to a human would likely:?
A:Lead to death due to an inability of the cell to pass electrons to oxygen, thus stopping aerobic respiration and asphyxiating the cells.;B:Lead to death due to an inadequate supply of ADP to accept a phosphate group at the ATP synthase enzyme.;C:Have no effect as cells would switch which macronutrient they metabolize to circumvent the blocked biochemical pathway.;D:Increase the cell’s ATP production as negative feedback would cause the cell to up-regulate anaerobic pathways. | input | 2 | 3,348 | 18 | 10,046 |
Please answer the letter of option truthfully | instruction | 0 | 3,359 | 18 | 10,077 |
D | output | 1 | 3,359 | 18 | 10,078 |
Q:Phophocreatine resynthesis during recovery from exercise is inhibited by:?
A:an excess of creatine.;B:hyperventilation.;C:an excess of oxygen.;D:a lack of oxygen. | input | 2 | 3,359 | 18 | 10,079 |
Please answer the letter of option truthfully | instruction | 0 | 3,361 | 18 | 10,083 |
D | output | 1 | 3,361 | 18 | 10,084 |
Q:The synthesis of glucose from lactate, glycerol, or amino acids is called:?
A:glycogenolysis.;B:glycolysis.;C:lipolysis.;D:gluconeogenesis. | input | 2 | 3,361 | 18 | 10,085 |
Please answer the letter of option truthfully | instruction | 0 | 3,367 | 18 | 10,101 |
A | output | 1 | 3,367 | 18 | 10,102 |
Q:An action potential arriving at the motor endplate causes release of:?
A:acetylcholine which traverses the neuromuscular junction.;B:sodium ions which binds to sodium receptors on the muscle membrane.;C:calcium ions which initiate an action potential along the muscle fibre.;D:noradrenaline which increases muscle metabolic activity. | input | 2 | 3,367 | 18 | 10,103 |
Please answer the letter of option truthfully | instruction | 0 | 3,371 | 18 | 10,113 |
D | output | 1 | 3,371 | 18 | 10,114 |
Q:What is the most likely outcome of this modification?
An RNA strand that normally produces a transmembrane protein that facilitates potassium entry into muscle cells is modified to produce a different strand. The original strand is as follows:
GAAUAGAUGGGAAGCGCCAGAUACAGUAACAGA…
The modified sequence is as follows:
GAAUAGAUGGGAAGCGCCAGAUACAGUACCAGA…?
A:Absence of the protein;B:Production of a similar-sized but dysfunctional protein;C:No change;D:Production of a larger, likely dysfunctional protein | input | 2 | 3,371 | 18 | 10,115 |
Please answer the letter of option truthfully | instruction | 0 | 3,372 | 18 | 10,116 |
C | output | 1 | 3,372 | 18 | 10,117 |
Q:Glycolysis is the name given to the pathway involving the conversion of:?
A:glycogen to glucose-1-phosphate.;B:glycogen or glucose to fructose.;C:glycogen or glucose to pyruvate or lactate.;D:glycogen or glucose to pyruvate or acetyl CoA. | input | 2 | 3,372 | 18 | 10,118 |
Please answer the letter of option truthfully | instruction | 0 | 3,374 | 18 | 10,122 |
A | output | 1 | 3,374 | 18 | 10,123 |
Q:Which of the following is thought to be implicated in the development of peripheral muscle fatigue during multiple sprint activities??
A:An accumulation of inorganic phosphate.;B:Development of hyperosmolality in the muscles.;C:An excess of antioxidants.;D:A lack of potassium. | input | 2 | 3,374 | 18 | 10,124 |
Please answer the letter of option truthfully | instruction | 0 | 3,376 | 18 | 10,128 |
B | output | 1 | 3,376 | 18 | 10,129 |
Q:The pyruvate dehydrogenase complex:?
A:is located in the sarcoplasm.;B:catalyses the conversion of pyruvate to acetyl CoA.;C:catalyses the conversion of pyruvate to lactate.;D:catalyses the conversion of lactate to pyruvate. | input | 2 | 3,376 | 18 | 10,130 |
Please answer the letter of option truthfully | instruction | 0 | 3,377 | 18 | 10,131 |
D | output | 1 | 3,377 | 18 | 10,132 |
Q:Hydrogen ions are formed when:?
A:glycogen becomes depleted.;B:phosphocreatine breakdown occurs.;C:pyruvate is converted to lactate.;D:glycolysis is being used as a major means of resynthesising ATP. | input | 2 | 3,377 | 18 | 10,133 |
Please answer the letter of option truthfully | instruction | 0 | 3,387 | 18 | 10,161 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.