#genome
stringclasses 121
values | asm_name
stringclasses 120
values | assembly_accession
stringclasses 120
values | bioproject
stringclasses 45
values | biosample
stringclasses 120
values | wgs_master
float64 | seq_rel_date
stringclasses 98
values | submitter
stringclasses 76
values | ftp_path
stringclasses 120
values | img_id
float64 637M
2.51B
⌀ | gtdb_id
stringclasses 120
values | scope
stringclasses 3
values | assembly_level
stringclasses 1
value | genome_rep
stringclasses 1
value | refseq_category
stringclasses 3
values | release_type
stringclasses 2
values | taxid
float64 1.15k
681k
⌀ | species_taxid
float64 7
911k
⌀ | organism_name
stringclasses 120
values | infraspecific_name
stringclasses 112
values | isolate
stringclasses 1
value | superkingdom
stringclasses 2
values | phylum
stringclasses 18
values | class
stringclasses 30
values | order
stringclasses 56
values | family
stringclasses 75
values | genus
stringclasses 89
values | species
stringclasses 117
values | classified
bool 1
class | lv1_group
stringclasses 2
values | lv2_group
stringclasses 13
values | score_faa
float64 0.93
1
⌀ | score_fna
float64 0.88
1
⌀ | score_rrna
float64 0.1
1
⌀ | score_trna
float64 0.6
1
⌀ | total_length
float64 618k
9.12M
⌀ | contigs
float64 1
22
⌀ | gc
float64 22.5
72.2
⌀ | n50
float64 616k
9.03M
⌀ | l50
float64 1
1
⌀ | proteins
float64 525
7.92k
⌀ | protein_length
float64 172k
2.68M
⌀ | coding_density
float64 74
96.9
⌀ | completeness
float64 76.3
100
⌀ | contamination
float64 0
4.4
⌀ | strain_heterogeneity
float64 0
100
⌀ | markers
float64 124
383
⌀ | 5s_rrna
stringclasses 2
values | 16s_rrna
stringclasses 1
value | 23s_rrna
stringclasses 1
value | trnas
float64 14
20
⌀ | draft_quality
stringclasses 2
values | start_position
int64 0
10M
| human_label
int64 0
1
| autotrain_text
stringlengths 150
150
| autotrain_label
class label 121
classes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
G000008165 | ASM816v1 | GCF_000008165.1 | PRJNA58091 | SAMN02598266 | null | 2004/06/24 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/165/GCF_000008165.1_ASM816v1 | 637,000,015 | RS_GCF_000008165.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 260,799 | 1,392 | Bacillus anthracis str. Sterne | strain=Sterne | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus anthracis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 5,228,663 | 1 | 35.38 | 5,228,663 | 1 | 5,471 | 1,495,624 | 84.251844 | 99.23 | 0.15 | 0 | 381 | yes | yes | yes | 20 | high | 286,650 | 0 | AACAGATAAGCAACAACTACTCCGTATAAAGGGAATCCTATAACTAAAGTAGTATATAAGTTAACTTCAGTGAATAACTGGTGGAACCAAATAGTCGGAGTTGGCTGTTTTGTTTTTATATGTATATAAGAGGCTACTACGACTAAGAAA | 6Bacillus anthracis str. Sterne ASM816v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,180,150 | 1 | GATAAAGCAGCACAAATTATGAACAAATGGGAGACTTTAAAATTAATCCACCTTCTCAAATTAATGAGAATTAAGTTTGAGAAACAGAACACTGTATTTGCTCAAGGAATTCTAAGCTAAAATTTTGCTGATAAAAATGCTTGTTACTCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 995,550 | 1 | CTGAACAAGCAGCATTTTCCTCCCAAGTCACACTGTCCTTCCTTTTTTATTTTTTTGAGACAGAGTCTCACTCTGTCACCCAGGCTGGAGTGCCGTAGCGCGATCTCGGCTCACTGCAGGCTCTGCCTCCCAGGTTCAAGCAACTCTCCT | 120homo sapiens
|
G000009905 | ASM990v1 | GCF_000009905.1 | PRJNA224116 | SAMD00061067 | null | 2004/09/02 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/905/GCF_000009905.1_ASM990v1 | 637,000,306 | RS_GCF_000009905.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 292,459 | 2,734 | Symbiobacterium thermophilum IAM 14863 | strain=IAM14863 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Symbiobacteriaceae | Symbiobacterium | Symbiobacterium thermophilum | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 3,566,135 | 1 | 68.67 | 3,566,135 | 1 | 3,297 | 1,051,001 | 86.832243 | 98.02 | 0.03 | 0 | 347 | yes | yes | yes | 20 | high | 1,894,230 | 0 | GGCACCAGGCGGAACCCATCCCCGCTGCAGGGCCGCTTTCTCCTCCGCCCGGTCCGGCACCCGGACCTCCCCGTCGGCCGTGACCTCGGTGCCCGGAATCAGCAGGGCGGCGCCGAGGGCGTGCCGGGCCGCCTGGTAGACGGCCGCCCG | 99Symbiobacterium thermophilum IAM 14863 IAM14863
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 936,000 | 0 | CGCCCGATCGGGGAAGCAGCGCAGGTCCTCTTCATTACGCTCGTAAGCTTCCTGCTGCTAGGCGTGCTCTGGGGCGTGATTCACCCGACCTCCGAACTAGTGGTGGCCACTGATGGCGGGGCAGACATGGCTCCGGGAACCGAGGATGCC | 31Corynebacterium jeikeium K411 K411 = NCTC 11915
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,721,500 | 1 | AAAAGTGCATACTTTTATGAGGCTATAAATGCATAAAGACGGATATATAAAATATATAAGTGTATATATAATTTTAGGGCTTTTTTAGTGGGGGAAAATCCACAAATGGATAATACTTTGGATATTTTCTGCAGCTCGCTTTTTTCCACC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,147,000 | 1 | GATCTACTTCACTCGATCCCTCCACAGTCAGCAGGACAACTTTATTCCAGTCTGGGGGACGCCTTACCCGCAGGAGCTGCCAATCACTGCAGACGAAGATGCTCACGTAATCTTTGCAGTCGCGCCGTTCTGCCAGCGCCATGTAGCGGC | 120homo sapiens
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 154,440 | 0 | AACGTTATCATAACGTGGTAATAAAAAATAAAATGATATAATAGGCTAAAATAGCAAAAAATCGCTAGATATTAAGATTGATGAAAAATTATGAAGATGATATAATGTAAACGTAATCAAGAATGATTGCACAAAGTAATTGTTTTAAAT | 29Clostridium acetobutylicum ATCC 824
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,427,950 | 1 | GAGGTGGTGTGTGGAAGGGATAACTTTGAAACTGTGTGTAAGTTATCATAGCCACCAGAGTTTCTTGATGGTGGCCTCCCGTTCCCGTGCAATGAGACAGCCTCCTGTCATCCCTTGTAAGATGGTGTTAATCTGACAAGAAAGGGAAGT | 120homo sapiens
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 3,197,220 | 0 | TGCCTCATATTCGTCAATGCTGTTTGCAATAAAGGATCTCTCCTTAGCAGACCACTTTGCGCTTTTTCTTCCCAACGTTTTGCCTCACTTTCCGTTAGCTGATCGCGCTCTTCATCAGTCAGCGGGTCATAGTCACGGTAGTATTTTTCG | 8Bacillus clausii KSM-K16
|
G000009965 | ASM996v1 | GCF_000009965.1 | PRJNA224116 | SAMD00061071 | null | 2005/01/05 | Kyoto University, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/965/GCF_000009965.1_ASM996v1 | 638,154,520 | RS_GCF_000009965.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 69,014 | 311,400 | Thermococcus kodakarensis KOD1 | strain=KOD1 | null | Archaea | Euryarchaeota | Thermococci | Thermococcales | Thermococcaceae | Thermococcus | Thermococcus kodakarensis | true | Archaea | Euryarchaeota | 1 | 1 | 0.9 | 0.9 | 2,088,737 | 1 | 52 | 2,088,737 | 1 | 2,314 | 650,473 | 91.73242 | 100 | 0 | 0 | 190 | no | yes | yes | 19 | medium | 580,580 | 0 | TTTCTATCTAGGACATATAATGGACAGGGAGTTTAAGGATACATTACAGAGACAATTCAAAAACGCAGTGGATAATTTTGCGATGTCTAATCTTCATACAAATAATAACGAACAATGGATATTTAGTGTCTGTAGCTTTTGTAAAGCCCA | 102Thermococcus kodakarensis KOD1
|
G000007645 | ASM764v1 | GCF_000007645.1 | PRJNA57861 | SAMN02603126 | null | 2002/12/20 | Chinese National HGC, Shanghai | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/645/GCF_000007645.1_ASM764v1 | 637,000,281 | RS_GCF_000007645.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 176,280 | 1,282 | Staphylococcus epidermidis ATCC 12228 | strain=ATCC 12228 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus epidermidis | true | Eubacteria | Firmicutes | 1 | 0.977 | 0.9 | 1 | 2,564,615 | 7 | 32.05 | 2,499,279 | 1 | 2,354 | 721,937 | 82.93198 | 99.81 | 0 | 0 | 345 | yes | yes | yes | 20 | high | 1,684,020 | 0 | TGATAACAGCTACGCCGCCAGCTAGTTTTGCCAAACGTTCCTGTAATTTTTCTTTATCAAACTCTGAATCAGTTTCTTCAATTTGTGCTTTAATTTGACCTACACGAGCATCAATATTATTTTCATCACCATTACCATCTACGACTGTTG | 88Staphylococcus epidermidis ATCC 12228 ASM764v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 79,650 | 1 | AAAAAGAGAACATCTATGTGTCCACCATACAGGATATGAAATAGAACATTTGCCGGCCATGGTGGCTCACACCTGTAATCCCAGTACTTTGGGAGGCCGAGGTGGGAGGATCACTTAAGCCCAGGACACAGGTTGCAGTGAGCCAAGATC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,795,800 | 1 | TAGTCTTGTTACTTTCTGTCATCCAGTTGTCCAGCTACTGCTACTTTCTATAGCCTGCAATTCACTTTGGTTTTGTTGTTGTTGTTGTTTGTTTTGTTTTTTGTTGTTGTTGTTGTTTTGAGACAGTCTCGCTCTGTCACCCAGGCTGGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,523,150 | 1 | CGGCTGAGGATGCAGGGCTCCCGGGCACGGTGCTAGCCCTGCCTTGAGACACCCCGAGAGCTGTGGGAAGAGCTGTGGGATCCCCTATTGCATCACAAAGCGGCCCTGGAGGGCTGGTCTTTATTTTGATGAGGCTGAGAAGGGAAGGCT | 120homo sapiens
|
G000006175 | ASM617v2 | GCF_000006175.1 | PRJNA224116 | SAMN00000040 | null | 2010/06/03 | US DOE Joint Genome Institute (JGI-PGF) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/175/GCF_000006175.1_ASM617v2 | 646,564,549 | RS_GCF_000006175.1 | Multispecies | Complete Genome | Full | representative genome | Major | 456,320 | 2,188 | Methanococcus voltae A3 | strain=A3 | null | Archaea | Euryarchaeota | Methanococci | Methanococcales | Methanococcaceae | Methanococcus | Methanococcus voltae | true | Archaea | Euryarchaeota | 0.97 | 1 | 1 | 1 | 1,936,387 | 1 | 28.59 | 1,936,387 | 1 | 1,727 | 526,927 | 80.167033 | 99.05 | 0 | 0 | 165 | no | yes | yes | 19 | medium | 1,128,010 | 0 | CTCTTGATACATATTCGTCTAAAGCTTTATCGCCCTCTTCTTCAAATTTCTTAGCCCATTTTTCATTTCCAAAGTCTTTTGCTCCACAAGCTATTAATTCTTTTACCCGGTGACTTTCAATAACGTGGGGATAACCCACCTTTAAATCAT | 59Methanococcus voltae A3
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,180,550 | 1 | AAAATGGATGGCAATCATTATCTTTTTTTATTGCAACAGAGTCCGCCCTCTGCCCTTCAGGGGAAATTCTTTTTCTTCTGTCTCCACCCCCTCAGGATCTTCAAGGGGGTGTAGGAGCCTTCAATGGGCTGATGCACAGAGCAACTGCCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,462,900 | 1 | GATTGCTTGCACCCAGGAGGTCAAGGCTGCAGTGAGCCGAGATCCTGCCACTGCACTCCAGCCTGGGCCACAGAGTGAGACTGTCTCAAAAAAAAAAAAGTTAGATCCATGATCATTTTCCTGAAGAGATTCGAGGACAGCTTAGTGCTA | 120homo sapiens
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 1,231,750 | 0 | TTGCATAACTCCATTTTCATTAAAATAATATTTATTTCCATTTACATCTTTTAAACCAGTAAGCATCATGCCGTTAGAATCAAAATAATGTTGAGAGGAAGAAGAATCCTTAAACCACCCAGTAAACATGGTACCATCAGAGTTAAAGTA | 29Clostridium acetobutylicum ATCC 824
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,242,250 | 1 | TTGTCCTATTTATTATTACTTATTGTTAATTGCTTACTGTGCCTAATATATAAATTAAACTTTATCATAGGCATGTAGTCTGTAGGAAAAAACAATATACATAGGGATGGGTACTATCTGAGGCTTCAGGCATCCGCTGGGGATCTTGGA | 120homo sapiens
|
G000008605 | ASM860v1 | GCF_000008605.1 | PRJNA224116 | SAMN02604348 | null | 1999/12/22 | US DOE Joint Genome Institute (JGI-PGF) | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/605/GCF_000008605.1_ASM860v1 | 637,000,328 | GB_GCA_000008605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,276 | 160 | Treponema pallidum subsp. pallidum str. Nichols | strain=Nichols | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema pallidum | true | Eubacteria | Spirochaetes | 0.99 | 1 | 1 | 1 | 1,138,011 | 1 | 52.78 | 1,138,011 | 1 | 1,009 | 357,124 | 92.473447 | 100 | 0 | 0 | 190 | yes | yes | yes | 20 | high | 879,060 | 0 | TAAAGCAGGTCAATTCAATGTGCCTCTCGGACGCGCTGCACCTGCGTCTCCTTTTCTAAATACCACCGCGCCTACCCCTCGCAGTACACAGCCTGCGGCGCAGGTCGGACACCTTGCAATACGCATTGATGAGGAGAATTTACGCAGCTG | 105Treponema pallidum subsp. pallidum str. Nichols ASM860v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,989,900 | 1 | TCACTGCTGTATCACCTGGCAGAGTGTCAATGCTCTACCAATATTTCCAGAATGAAAGAATGAATGAATTTCAACTAGTGAGCTAAAATCAGAACTGAATGAGAAACTTGGTAAGTAGGAAGGAATCATTCTATCTTCATGTTCACACAG | 120homo sapiens
|
G000010125 | ASM1012v1 | GCF_000010125.1 | PRJNA224116 | SAMD00061076 | null | 2005/08/12 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/125/GCF_000010125.1_ASM1012v1 | 637,000,284 | RS_GCF_000010125.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 342,451 | 29,385 | Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | strain=ATCC 15305 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Staphylococcaceae | Staphylococcus | Staphylococcus saprophyticus | true | Eubacteria | Firmicutes | 1 | 0.992 | 1 | 1 | 2,577,899 | 3 | 33.19 | 2,516,575 | 1 | 2,502 | 730,892 | 83.519176 | 99.44 | 0 | 0 | 348 | yes | yes | yes | 20 | high | 2,277,990 | 0 | TCTTGATAATGATAGTGCTCTTTGGTTAATATCAACCATTGTCACTTCGTGATGTGGGGAAACTTTTGCAATCATTAAACCGATAGGGCCATAGCCACAACCAACGTCTATAATTTTCTTCGTGGGACCAGGAGGATATGCTTTCAAAAA | 90Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 ASM1012v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 701,700 | 1 | CCTGGCTCACCTGCCTGTCACTCACGCACATCCCTGCCGAGAGTGGAACTGCTAAGGAGGTCAGCGGTGCCAGGCCGTGCAGATGACGGACTGCAAGTTCCGGGCACCCAGACCCAACCACGCCCTAGGCTCAGGTGCTAGACTAAGCGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,821,500 | 1 | TTGCACAACTCTGTGCAAATACAAAAAAAAAAAATCAACAACTTGTACACTTTATTTTTGTTTTTGAGACAGGGTCTCACTTTGTCACCCAGGCTGGAGTACAGTGATGTGATCTCAGCTCATCGCAGCCTCAACCTCCCCAGGCTCAGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,241,850 | 1 | CTGAGCTACAGGCTTATCGTCTGCCAAATTACCAGATGTTTCCAGGAAGACAGCTCTTATTTCCCTGTAGTTCCAGGAAATGTCTCATCTCTTATTGGCCCATCTTGAGTCACGTGTCTAATCTCTTGAATAAGGGGACATGGTCCTCTC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,071,050 | 1 | GCCCCCCCTCCAGGAACCCCGGGCGCTTCTGCCCTGCACGGCCAGCGCTCTCCACCATCCCCACGGGGCCTTCGGACTTCCCCATCAGCAGGGCTCTGGACGGGAGAGCACCGCGGAGGAACCTGCAGGCCCAGGGCAGGGGAGAGGGGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,909,050 | 1 | GCAAAGTTGATCAGGAAAGGAAATGTAATCATAGAACTACTTTGTGGCTCAGCTGTGAATAATAATTACATAATTATGTAAATGTTGAATATTGATCTAACCACAAATTATGATACTGGGAGGAGCGGGGCAGGGAGCTGCACGTGTGTG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,535,450 | 1 | TCAACTTCCTGTAATGGGAGGAACTCTGACACACTTCACAAAAGGGTGTCAAATTAGTTTTAAAGGGAAAAAGAACTGCAGCATGATCTGGAATTCGCTTTCTGCCCTGCGGTTCCACTGTGAAGGCAACACGCCTTCGAGGAGTTGGGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,679,500 | 1 | TCGCAACTCACGCCCAAGCTGCTCCGAGTGCCTAGCTTGGTGGGGAAAGGTGTGGAGTCACCACCTCCACTCTGCTCCTTCTCCAGGTGTCTGTCTGTCTTTGCTGCTGTCTTGGTGACTGTCCTCTGCCCCCCTGGCCTGGGCCTGACC | 120homo sapiens
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 622,180 | 0 | CACGTTTTGGGCAATGATTACATACTGGCATCAGAACGCCTTGTAAGTGCAGAGTCTCTATTGAGAGATGGCAATCTGACAGTGCGTGAATTTGTGCGTAGCGTTGCTAAATCAGAACTCTACAAAAAGAAATTTTTCTACAACAGCTTC | 70Nostoc sp. PCC 7120 ASM970v1
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 2,086,890 | 0 | TGTTGATTGTTTCAACTTCTTCTTCAGGAACTGAAGATGATCCGTGAAGTACGATAGGGAATCCCGGAAGTTTTTCCATTACAGCATCCAATACTTCGAAAGCCAATGGAGGAGGAACCATACGACCGGTAGCCGGATCGATGTGGCACT | 11Bacteroides thetaiotaomicron VPI-5482
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,703,100 | 1 | GCTCTGGATGCCGGAGCAGCAAACAAGACCCTTTCAGTTCCTGCTCCACTACATTCTAGAGATGAAAGGCAGACTGGCAAATAGCTAGATCTTGCAGGGTACAGTTACTTTAGACGAAAGGCAGAGGTATCTCTCCGTCGCTCAAAGTAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,472,100 | 1 | TGAGCACAGCCGATGTGCCAGGCATCAGAGATGCACTGCGGTGAATACACACTATCCTCGAAAGAACCCTAGAACTTGGTATGACTGCTGTTGTTACTGGGAGAACACTATGCAAATGAGGAAAGTGGGGCTGCAAGTGGAATTAGAGCG | 120homo sapiens
|
G000008345 | ASM834v1 | GCF_000008345.1 | PRJNA224116 | SAMN02603281 | null | 2004/07/30 | Goettingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/345/GCF_000008345.1_ASM834v1 | 637,000,215 | RS_GCF_000008345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 267,747 | 1,747 | Propionibacterium acnes KPA171202 | strain=KPA171202 | null | Bacteria | Actinobacteria | Actinobacteria | Propionibacteriales | Propionibacteriaceae | Cutibacterium | Cutibacterium acnes | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,560,265 | 1 | 60.01 | 2,560,265 | 1 | 2,373 | 780,330 | 89.799572 | 100 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 699,660 | 0 | TTGTTGCCTCGTTTCTCGGGAACTTCGTGGAGTGGTTCGACTATGCCACGTATTCATATTTGGCAGTGATAATCTCCAGAGTGTTCTTCCCCCAAGGAACAAGTAGGGACGCTCTTGTTCAGACATTCGCCATATTCGCCCTGTCCTTCC | 77Propionibacterium acnes KPA171202
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 1,612,260 | 0 | CAGCTCGGCGCTGAGCATCCCGCTGGATACTTTTATCTTCTTCGGCATGATCGACGCCCTGACAGCGCCTGTCGTCGTGACCGCGCTGGCCTCGAAGTTCGCCGGTGTGAGCATTGTGTGGATGATCATGGCCTGGCGTGCGCGCAACAA | 119[Pseudomonas syringae] pv. tomato str. DC3000
|
G000009825 | ASM982v1 | GCF_000009825.1 | PRJNA224116 | SAMD00061074 | null | 2004/12/30 | Kao Corporation, Biological Science Laboratories, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/825/GCF_000009825.1_ASM982v1 | 637,000,019 | RS_GCF_000009825.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 66,692 | 79,880 | Bacillus clausii KSM-K16 | strain=KSM-K16 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus clausii | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 4,303,871 | 1 | 44.75 | 4,303,871 | 1 | 4,304 | 1,270,194 | 86.940919 | 98.67 | 0.33 | 0 | 373 | yes | yes | yes | 20 | high | 340,210 | 0 | GTGTATTTTGCGCATCGTTTTCCCTCCATCATGCAACTGCCCTGCAAAGCCGTTATCTTTTAGAAAGTACCACGATCAATTAAGGAAAACAATAATAGCTACAAGGATAGCTTGTATGAAATTTTATTTCGTAATAAATTAAAATTATAT | 8Bacillus clausii KSM-K16
|
G000011065 | ASM1106v1 | GCF_000011065.1 | PRJNA62913 | SAMN02604314 | null | 2003/03/28 | Washington University Department of Molecular Biology and Pharmacology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/065/GCF_000011065.1_ASM1106v1 | 637,000,026 | RS_GCF_000011065.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 226,186 | 818 | Bacteroides thetaiotaomicron VPI-5482 | strain=VPI-5482 | null | Bacteria | Bacteroidetes | Bacteroidia | Bacteroidales | Bacteroidaceae | Bacteroides | Bacteroides thetaiotaomicron | true | Eubacteria | Bacteroidetes | 1 | 0.998 | 0.7 | 1 | 6,293,399 | 2 | 42.86 | 6,260,361 | 1 | 4,944 | 1,919,297 | 89.876027 | 99.41 | 0.4 | 0 | 348 | yes | yes | yes | 20 | high | 467,480 | 0 | AGCGTATCAAGGCAAAGGGGGCTACTATTGTGATTTTCGAGCCCACTATGCAAGATGGTGAAACTTTCTTTGGAAGTCAAGTGATCAATAATCTGGTCGAGTTTAAGGAAATAAGTCAGGCCATAATTGCCAACCGTTACGATGCTTGTC | 11Bacteroides thetaiotaomicron VPI-5482
|
G000008765 | ASM876v1 | GCF_000008765.1 | PRJNA57677 | SAMN02603243 | null | 2002/11/22 | Genome Therapeutics | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/765/GCF_000008765.1_ASM876v1 | 637,000,076 | RS_GCF_000008765.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,562 | 1,488 | Clostridium acetobutylicum ATCC 824 | strain=ATCC 824 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Clostridiaceae | Clostridium | Clostridium acetobutylicum | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.1 | 0.9 | 4,132,880 | 2 | 30.93 | 3,940,880 | 1 | 3,896 | 1,211,240 | 86.343567 | 100 | 0 | 0 | 345 | yes | yes | yes | 19 | high | 811,330 | 0 | ATTTAGCAACAATTGCAAAAAAGTATCCTGATAAAAAATTTGCGATAATAGATGATGCATATGATAAGCAGCCTAAGAATATAATGTCATTAGTATTTAAAGAACAAGAAGGTTCATTTTTAATGGGTGTTATAGCAGGAAAGATGACAA | 29Clostridium acetobutylicum ATCC 824
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,044,000 | 1 | AGAGAGATCCTTTTGCATAGAAACAACTCATTTGGGAAATGCAAGCAGGGAGAGCCCTGTGCCCAGACTGCAGGGTAAGGCCCCAAGGGGCAGAGACCTGTGGCAGGGTGCTTCTGGCCAACCAGCCAAGGGGCATGAGCAGACAGTGGG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,872,750 | 1 | TCCTCCTGCCTCAGCCTCCCGAGTAACTGGGACTACAGGCACGCACCACCATGCCCAGCTAATTTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGTCAGGCTGGTCTCAATCTCTTGACCTCATGATCCGCCCGCCTCAGCC | 120homo sapiens
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 3,594,890 | 0 | CGGCTTCAGATCGAGAAAATCGTCGCGCACGATGGAGGCGATGCCGGCATTGTTGACGAGGCAGTCGATCCGGCCGAATTCCGCGACGACCGCGTCGACGGTCGCCTGATGGCTCGAAAGGTCGGCAAGATCGGCGCGCAGGAAGATCAC | 86Sinorhizobium meliloti 1021
|
G000007385 | ASM738v1 | GCF_000007385.1 | PRJNA224116 | SAMN02603680 | null | 2005/02/02 | NIAB, Rural Development Administration | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/385/GCF_000007385.1_ASM738v1 | 637,000,346 | GB_GCA_000007385.1 | Multiisolate | Complete Genome | Full | representative genome | Major | 291,331 | 347 | Xanthomonas oryzae pv. oryzae KACC 10331 | null | null | Bacteria | Proteobacteria | Gammaproteobacteria | Xanthomonadales | Xanthomonadaceae | Xanthomonas | Xanthomonas oryzae | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,941,439 | 1 | 63.69 | 4,941,439 | 1 | 4,831 | 1,427,680 | 85.113992 | 99.82 | 0 | 0 | 355 | yes | yes | yes | 20 | high | 733,850 | 0 | CTGGGCGATGTGGCCTACCGCGAAGGCTATCTGCGCTCGCATTCGGACGTGGCGCTGATCACCGTGATCGCCTTGCTGGTGCTGGTGCAGGTGCTGCAGATGCTGGGAGACCGCCTGGTGGCGTACTACAGCCGGCGGTGAGCGGCGCTG | 113Xanthomonas oryzae pv. oryzae KACC 10331
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,604,400 | 1 | ATAGAAACTATAGACACCGGGAACTCCAAAAAAGGGAAGAGGGAAAGGGCTGAAAAACTACCTATTGGGTGGTGCTATGTTCATTATATGGGTGACAGGTTTTCAATAGAAGCCCAATGCTTAGCATCATGCAATATACCCTTGTAACAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,491,900 | 1 | GTGTGAGTCCCCGAGGTGTTCCCGCTTTTCCGTCATCTCGGAGGGACCTGCCTATGCTGACTGGTGGGTCATCAAGATTAATAAAGACAAAGGCTTTGGCGGATGCTCAGCTCAGGAAAAGCACCTGGAGCTGCTCTTTCCTGACTGATT | 120homo sapiens
|
G000007805 | ASM780v1 | GCF_000007805.1 | PRJNA57967 | SAMN02604017 | null | 2003/03/05 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/805/GCF_000007805.1_ASM780v1 | 2,508,501,074 | RS_GCF_000007805.1 | Multiisolate | Complete Genome | Full | reference genome | Major | 223,283 | 251,701 | [Pseudomonas syringae] pv. tomato str. DC3000 | strain=DC3000 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas syringae group genomosp. 3 | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.9 | 1 | 6,538,260 | 3 | 58.34 | 6,397,126 | 1 | 5,862 | 1,948,843 | 87.825109 | 100 | 0.22 | 0 | 381 | yes | yes | yes | 20 | high | 556,920 | 0 | TGCCAGGGTGCAGACGCATGATCGGCGGAGGCGGCAGGAAGCGCAGCAAACCCGGACGGTGTTTCGCCCCACGGCTGCCAGAACCCGGCGCGGTCGGTCAGGCAATACAAGCGACTCCGGGCATCAAAACGAGGTTGCTGCAGGGATTCT | 119[Pseudomonas syringae] pv. tomato str. DC3000
|
G000006865 | ASM686v1 | GCF_000006865.1 | PRJNA57671 | SAMN02603339 | null | 2001/03/21 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/865/GCF_000006865.1_ASM686v1 | 637,000,144 | RS_GCF_000006865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,623 | 1,358 | Lactococcus lactis subsp. lactis Il1403 | strain=IL1403 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Lactococcus | Lactococcus lactis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,365,589 | 1 | 35.33 | 2,365,589 | 1 | 2,383 | 693,662 | 86.378488 | 100 | 0 | 0 | 310 | yes | yes | yes | 20 | high | 198,120 | 0 | TAAAATGTCATGCACCAGGTTGTCATCAAATTGGACTTCATCGCACAGCTGACGGACTTTATGTTCTTTGTCGAAAACATCATCCAGATGTACCTAATAACCTAACGCTCAAACACATTCAAAAATCACACGTCAATGCAAAAGCGAAAA | 54Lactococcus lactis subsp. lactis Il1403 IL1403
|
G000008185 | ASM818v1 | GCF_000008185.1 | PRJNA57583 | SAMN02603967 | null | 2004/02/03 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/185/GCF_000008185.1_ASM818v1 | 637,000,327 | RS_GCF_000008185.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,275 | 158 | Treponema denticola ATCC 35405 | strain=ATCC 35405 | null | Bacteria | Spirochaetes | Spirochaetia | Spirochaetales | Spirochaetaceae | Treponema | Treponema denticola | true | Eubacteria | Spirochaetes | 1 | 1 | 1 | 1 | 2,843,201 | 1 | 37.87 | 2,843,201 | 1 | 2,578 | 885,778 | 91.799314 | 100 | 0 | 0 | 281 | yes | yes | yes | 20 | high | 2,311,400 | 0 | GGATTCAGGTGTACACGCAGCCCGCCAGGCCGTAAACTTTTTTTGCGATATAAAAAGCATGAGGGCCTCAAATTTTTTACCGGCACTTAACTCAATCCTGCCTAAGGATATAAGGGTGATGGATGCAGCTGAAGTGTCCCCCCTCCTGCA | 104Treponema denticola ATCC 35405
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 6,544,950 | 1 | GTCATGCAGCCACACCCTGCCCCATCCTAACCCCCCAAAATCACTCATCTCTGCTCTGCCACCATGGGTTGGTCTTTTTGAGAATGTCAGATGCAGGCTGGCTTCTTTCCCTCAGCCTGACACCCGTGAGAGCCGTCTGAGTTGGTGTAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,933,350 | 1 | ACCTCCAGCTGCGCAAGGCATGTGCATTATCTTCAGCACCTGTCACTTTCACAGGGACATGAGCCATTGAAGGATTGATTTGGAAACCAAAATCAGCTTGGGGAAAGGGCAATTAAACTGTGGATGACGGTTTGTTGCATGTTTTCTTGC | 120homo sapiens
|
G000007345 | ASM734v1 | GCF_000007345.1 | PRJNA224116 | SAMN03081414 | null | 2002/04/03 | Broad Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/345/GCF_000007345.1_ASM734v1 | 638,154,508 | RS_GCF_000007345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 188,937 | 2,214 | Methanosarcina acetivorans C2A | strain=C2A | null | Archaea | Euryarchaeota | Methanomicrobia | Methanosarcinales | Methanosarcinaceae | Methanosarcina | Methanosarcina acetivorans | true | Archaea | Euryarchaeota | 0.98 | 1 | 0.8 | 0.9 | 5,751,492 | 1 | 42.68 | 5,751,492 | 1 | 4,884 | 1,470,904 | 75.340086 | 99.84 | 0.03 | 0 | 229 | no | yes | yes | 18 | medium | 248,950 | 0 | CCGGGCAAAAGTCCTGGAAATAGGTTTGTTGTCCTGAGACTAATCGTCCTGTATCTATGTTATTCTGATGCCTATATCAGTCCAATGTCTACGTCAGTTTGATGTCTATGCCAGTTTGATCTTTATGTAATAATCCGTGTATTTGCTATA | 61Methanosarcina acetivorans C2A
|
G000010405 | ASM1040v1 | GCF_000010405.1 | PRJNA224116 | SAMD00060908 | null | 2007/05/08 | Japan Agency for Maine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/405/GCF_000010405.1_ASM1040v1 | 640,427,107 | RS_GCF_000010405.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 412,965 | 410,330 | Candidatus Vesicomyosocius okutanii HA | strain=HA | null | Bacteria | Proteobacteria | Gammaproteobacteria | null | null | null | Calyptogena okutanii thioautotrophic gill symbiont | true | Eubacteria | Proteobacteria | 1 | 1 | 1 | 1 | 1,022,154 | 1 | 31.59 | 1,022,154 | 1 | 976 | 297,702 | 85.803803 | 93.54 | 0 | 0 | 271 | yes | yes | yes | 20 | high | 592,670 | 0 | AATTTTTCACTTCTGTCGGTTATATAATCAGCATCAAAAATAAGAGTTTGTTTTGGTAAATATTGCAAAACTAATTCACGCAATACACAAATATCATTTTTTTTAAATGCTGACAATGGAAATAAATCTGTTGGTTGATATTTTTGAAAA | 20Candidatus Vesicomyosocius okutanii HA
|
G000009765 | ASM976v2 | GCF_000009765.2 | PRJNA224116 | SAMD00061088 | null | 2016/03/24 | NITE | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/765/GCF_000009765.2_ASM976v2 | 637,000,304 | RS_GCF_000009765.2 | Monoisolate | Complete Genome | Full | representative genome | Minor | 227,882 | 33,903 | Streptomyces avermitilis MA-4680 = NBRC 14893 | strain=MA-4680 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces avermitilis | true | Eubacteria | Actinobacteria | 1 | 0.999 | 1 | 1 | 9,119,895 | 2 | 70.7 | 9,025,608 | 1 | 7,915 | 2,675,970 | 86.456522 | 99.89 | 0.79 | 0 | 356 | yes | yes | yes | 20 | high | 1,138,280 | 0 | CGGCGCGCTCGTCTCCGTCGCCGCCACGCCGGATGAGCTCCTGCCCCGAATCGCTCCGTGGACCGAGGACAACCCGGCGCGGCTCGCCGTCGCAGCCGTCAACGGACCCCGGAGCACAGTCGTTTCCGGTGCCCGCGAGGCCGTCGCGGA | 95Streptomyces avermitilis MA-4680 = NBRC 14893 MA-4680 ASM976v2
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,646,100 | 1 | TTCTCTATCCAAGTATCCAAGGAGCATTGGCCCAGCAGTGAGGGGAAGATGCTGTTTTGAATAGGAGCAAGTTCAAGTGCCAAGTTCAGCAAGGCTGAGGATTGAGCACCAGTTTCTGCTCTATCAGTGTTCTGGCAAGTGCAGTGTCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,853,700 | 1 | CTACCTGCTCTCTGTTTATTCACAGAGTTGTTGGGAGAAGGCAGGGAGGAAATGCACGTAAAGCTACTTTGAGAAAGATAAGGGGCTCTAGCTGAATGAGTGTTTGTCTCGTCCTGTCCATCTCATGGAAGTCCATCAGCTGCAAGTCAA | 120homo sapiens
|
G000006745 | ASM674v1 | GCF_000006745.1 | PRJNA57623 | SAMN02603969 | null | 2001/01/09 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/745/GCF_000006745.1_ASM674v1 | 637,000,333 | RS_GCF_000006745.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 243,277 | 666 | Vibrio cholerae O1 biovar El Tor str. N16961 | strain=N16961 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Vibrionales | Vibrionaceae | Vibrio | Vibrio cholerae | true | Eubacteria | Proteobacteria | 1 | 0.998 | 0.9 | 1 | 4,033,464 | 2 | 47.49 | 2,961,149 | 1 | 3,594 | 1,184,587 | 86.533164 | 99.86 | 0.03 | 0 | 360 | yes | yes | yes | 20 | high | 36,010 | 0 | ACTTGAAGCTGCAGCGGTGTTTGCTACGCTCGTTCACCCCAATCACATAGTTTGCCTATGCTCATGGGGATTCACTTACTTGCCGCCTACCTGCAACTCCAAGTTGTTTGGGTATATCAGCAGAATTATTTGTCAGCAGAATTATTTGAT | 107Vibrio cholerae O1 biovar El Tor str. N16961
|
G000011025 | ASM1102v1 | GCF_000011025.1 | PRJNA224116 | SAMD00060968 | null | 2010/01/05 | Department of Bacteriology, Osaka Dental University | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/011/025/GCF_000011025.1_ASM1102v1 | 646,311,951 | RS_GCF_000011025.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 680,646 | 43,675 | Rothia mucilaginosa DY-18 | strain=DY-18 | null | Bacteria | Actinobacteria | Actinobacteria | Micrococcales | Micrococcaceae | Rothia | Rothia mucilaginosa | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,264,603 | 1 | 59.62 | 2,264,603 | 1 | 1,722 | 637,843 | 83.000906 | 99.33 | 0 | 0 | 293 | yes | yes | yes | 20 | high | 844,350 | 0 | TGGTGCGTTACGGCGGGTTCCTCTGGGTGTACCATTCCTTCTCCCACGTGGTTGCCGACGGGTTCGCCGCGTTTAACGGCCTATCCCGCGTGGCGGCGATATACCGTGCCCTGTTCGCCGGTCAGCCGGTTCCGGCAACCCGCCGCATGA | 84Rothia mucilaginosa DY-18
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,098,950 | 1 | CAACAAAATGAAATTTTAAAAATGAAATTAGATAGGAAATATCTTGTAATATTTCAAGCCTCTACCCTATTTAACATAAGACTCTAAGAATGCCCGGGCACCGTGGCGCATGCCTGGAATCCCAGCACTTTGGGAGGCAGAGGCAGGTGG | 120homo sapiens
|
G000010345 | ASM1034v1 | GCF_000010345.1 | PRJNA224116 | SAMD00060915 | null | 2007/07/11 | Japan Agency for Marine-Earth Science and Technology | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/345/GCF_000010345.1_ASM1034v1 | 640,753,056 | RS_GCF_000010345.1 | Monoisolate | Complete Genome | Full | na | Major | 387,093 | 387,093 | Sulfurovum sp. NBC37-1 | strain=NBC37-1 | null | Bacteria | Proteobacteria | Epsilonproteobacteria | null | null | Sulfurovum | Sulfurovum sp. NBC37-1 | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,562,277 | 1 | 43.87 | 2,562,277 | 1 | 2,552 | 795,482 | 91.463999 | 99.59 | 0.61 | 0 | 334 | yes | yes | yes | 20 | high | 646,100 | 0 | TGGAACCGAAACTGTACGTTCCCCAGCCTACGAAACCCGCACCTATAAATGCGATGGTTGCTACCCATATGGTCCATACGAGATATTTATTGTGTTTTTGCATCCAGCTAATCATACTTCATCTACCTTCTATCGAAAAATTTGTATAAT | 98Sulfurovum sp. NBC37-1 ASM1034v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,864,900 | 1 | GTTTCTCCATGTTGGCCAGGCTGGCCTCAAACCCCTGACCTCAGGTGATCCGCCTACCTCTGCCTTCCAAAGTGCTGGGATTATAGACGTGAGCCACTGTGCCTAGCCAGGAGTATTTTTTTTTATTGTGGCCACATGTTATACCTTTTT | 120homo sapiens
|
G000010565 | ASM1056v1 | GCA_000010565.1 | PRJDA19023 | SAMD00060921 | null | 2007/05/07 | Marine Biotechnology Institute Co., Ltd | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/010/565/GCA_000010565.1_ASM1056v1 | 640,427,128 | GB_GCA_000010565.1 | Monoisolate | Complete Genome | Full | na | Major | 370,438 | 110,500 | Pelotomaculum thermopropionicum SI | strain=SI | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptococcaceae | Pelotomaculum | Pelotomaculum thermopropionicum | true | Eubacteria | Firmicutes | 0.98 | 1 | 1 | 1 | 3,025,375 | 1 | 52.96 | 3,025,375 | 1 | 3,001 | 887,464 | 86.415667 | 100 | 0.63 | 0 | 331 | yes | yes | yes | 20 | high | 190,580 | 0 | TTTTTTATACAAGCAGAAAATAGCTACTTGATGTAGAATAAACAACTGATAATGTAGAATAATTATAGATGTTGAATAACAATAGATTGAATAATTGACCAATTTCACATCCTCCGCCTACGGCCAGGTCCGGTTACGGCGGCTCATTTT | 73Pelotomaculum thermopropionicum SI
|
G000010665 | ASM1066v1 | GCF_000010665.1 | PRJNA224116 | SAMD00060954 | null | 2009/06/11 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/665/GCF_000010665.1_ASM1066v1 | 644,736,352 | RS_GCF_000010665.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 573,370 | 184,917 | Desulfovibrio magneticus RS-1 | strain=RS-1 | null | Bacteria | Proteobacteria | Deltaproteobacteria | Desulfovibrionales | Desulfovibrionaceae | Desulfovibrio | Desulfovibrio magneticus | true | Eubacteria | Proteobacteria | 0.99 | 0.996 | 1 | 1 | 5,315,620 | 3 | 62.67 | 5,248,049 | 1 | 4,555 | 1,546,858 | 85.744052 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 4,545,450 | 0 | CACCCTGCTCACCTTTCTCAAGTTCTGGCGCGAGGAGCGGCAAAAGCGTTTCCTGCACGGGGCCTTTTCGCGCTATGTGGCCCCGGCCGTGGTGGCCCGCATCGTGGCCCGGCCCAAAGACCTGCGCCTGACCGGCGAAGAGCGCGACGT | 36Desulfovibrio magneticus RS-1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,999,500 | 1 | TCCAAATCCAGGATCCGCATTCGAACCCTTGCTTCAGGCTCTGCTTTCCAGGTGATGCAAAGACTCATGTAAATGGTTTGATGGATGTTGCAGAGACAAATGCAAGTGCTCAGCCAGGTCTCCAGCTCAAGAAACATCTCAGGAAGGAGT | 120homo sapiens
|
G000010085 | ASM1008v1 | GCF_000010085.1 | PRJNA224116 | SAMD00061079 | null | 2006/01/10 | Kitasato Institute for Life Sciences, Japan | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/085/GCF_000010085.1_ASM1008v1 | 637,000,270 | RS_GCF_000010085.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 343,509 | 63,612 | Sodalis glossinidius str. 'morsitans' | strain=morsitans | null | Bacteria | Proteobacteria | Gammaproteobacteria | Enterobacterales | Pectobacteriaceae | Sodalis | Sodalis glossinidius | true | Eubacteria | Proteobacteria | 1 | 0.993 | 1 | 1 | 4,292,502 | 4 | 54.5 | 4,171,146 | 1 | 5,742 | 1,142,020 | 78.310831 | 100 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 2,094,950 | 0 | GCTGCAAGATTTCGCGCCGAGTGAAATCCGGCGCATGCACCGCATCCAGTGCCTGTAGCGAAGGCAATAGCGCATCATCGCGGCGTTGGGAGAGTAAACAGTACAAATAGAGAGGGCCGCCGGCTTTGGGACCCGTTCCCGATAACCCTT | 87Sodalis glossinidius str. 'morsitans' morsitans
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,231,250 | 1 | TCACTTTACTAAGCAAATGAACAGTAGTGTCTGTGGCCAAAAATAATAAGACTTAAAATTTTGAGTCCTTCCAAAAGAACTTGTATTAAATCTTTGGAATAGAAAAAAAAAGTTCATATTAGGGAGTAGATCTGGGTATTGAAAGGCCTG | 120homo sapiens
|
G000010165 | ASM1016v1 | GCF_000010165.1 | PRJNA224116 | SAMD00060942 | null | 2009/04/01 | National Institute of Technology and Evaluation | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/165/GCF_000010165.1_ASM1016v1 | 643,692,011 | RS_GCF_000010165.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 358,681 | 1,393 | Brevibacillus brevis NBRC 100599 | strain=NBRC 100599 (= 47) | null | Bacteria | Firmicutes | Bacilli | Bacillales | Paenibacillaceae | Brevibacillus | Brevibacillus brevis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 6,296,436 | 1 | 47.27 | 6,296,436 | 1 | 5,917 | 1,875,522 | 87.757979 | 99.73 | 0.27 | 0 | 381 | yes | yes | yes | 20 | high | 2,377,310 | 0 | TCATCAGTTCTACCTTTGCTGCATCGGTTTTGGCTGGCTCACTTGCTTGTGGTGCGGTTTGTGTTGTCGAGCAAGCCGTTAGCATTAAGCAAAATACTGTCAATATGGCAAACCAGTGCTTCTTCATAAAAAAAGACCTCCATAATTATA | 15Brevibacillus brevis NBRC 100599
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,207,150 | 1 | AAGAAATATCCGTTTAATAGGTCAGGTTTGCATTGCCCTCCTGTCTAAATGTATGGCCAGGCTGTTGACCACCACCCACAAGGGGAGGGTGAACTGGCACCCAAAGCCCTGCACAGATACAGGGGGTTTTACCACTGTTCAAGTCTCCCA | 120homo sapiens
|
G000009205 | ASM920v1 | GCF_000009205.1 | PRJNA57679 | SAMEA1705932 | null | 2006/09/20 | Sanger Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/205/GCF_000009205.1_ASM920v1 | 640,069,308 | RS_GCF_000009205.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,563 | 1,496 | Clostridioides difficile 630 | strain=630 | null | Bacteria | Firmicutes | Clostridia | Clostridiales | Peptostreptococcaceae | Clostridioides | Clostridioides difficile | true | Eubacteria | Firmicutes | 1 | 0.998 | 0.9 | 1 | 4,298,133 | 2 | 29.06 | 4,290,252 | 1 | 3,829 | 1,209,268 | 82.891874 | 99.51 | 0.37 | 0 | 340 | yes | yes | yes | 20 | high | 2,560,870 | 0 | CAATAATTGTTTTTGACCTTGAGAAACATTACTTGCTTCTTCATTTAATTTCATCTTATATCCATCTGGTAATGTCTTAATAAATCTATGAACATGTGCAGATTTAGCAGCCTCTATAACTTCTTCATCTGTAGCATTCAACTTACCATA | 28Clostridioides difficile 630 ASM920v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,690,350 | 1 | TGCAGACAGAGAAACAGGATTAGGACCAGGTAAGGTTTCTCTTGAGGAAGCTTGAGGTTGGGTATGTAGGCTGTCACGACAGGCCAAGAGTGAGACCAGTGACACCACAGTACTTCAAGCTCTCTGCAGATATTCTGTTCCGAAGCTGGA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,762,300 | 1 | GTATCTGTGGGCCCATATCAAGACAACAAAATGGATGCTGAGACAGCAGAGTAATATTAAGTCTCAATGTTGTTTCTTCTCTCTGTTTCTCTCAGTTAGGCTGGCTAGAGATTTTTGTGTATTGATCTTGTATCTGGCAACTTTGCTGAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 2,766,900 | 1 | AATCCCACAGGACACACATGTGCTCTTTAGTGGGGGAGGCAGTTCAGTGACGATGACAGCAGTAATGACAACACACAGAAAACATGAGGGTGTGCGAGCATGGGGTCCCAGGGACGACACCTGCGGGGTGCTGCCACGATGGTGCTGGGA | 120homo sapiens
|
G000007705 | ASM770v1 | GCF_000007705.1 | PRJNA224116 | SAMN02603528 | null | 2003/08/22 | LNCC, Brazil | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/705/GCF_000007705.1_ASM770v1 | 637,000,074 | RS_GCF_000007705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 243,365 | 536 | Chromobacterium violaceum ATCC 12472 | strain=ATCC 12472 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Chromobacteriaceae | Chromobacterium | Chromobacterium violaceum | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 4,751,080 | 1 | 64.83 | 4,751,080 | 1 | 4,298 | 1,428,392 | 88.582238 | 99.04 | 0.45 | 0 | 372 | yes | yes | yes | 20 | high | 565,760 | 0 | TGGATGTCCCAGGTGCGGCGGTTGGGCAGCTGGGTCAGCTCGTCGGTGCCTGCCAGGGCTTCCAGCTTTTGCATCAGGCTGCGCATTTGCCCCAGCCATTTGTGCAGCAGCCGCACCAGCAGGATGGCCATCGCGCTGGCGATGATCCAC | 27Chromobacterium violaceum ATCC 12472
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 3,626,850 | 1 | TTCCCAGTGAGCCCCTGAGCTTCTCCATAGAAGAGGTAGGGGCACCAAAAATGGAATTGTCTTAGAGTGCCAAGGGCAGCCGTCAGAACACCTGCAACATTAAAAGTCTGCAGCCACTACCCGCCAGTCATAACCCGAGACTGAAACTGC | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,078,400 | 1 | GTAGCCATATGGTAATGATTCATAATCTTGCCAGTTAGCCAGCCCTCAAACACTGAGTATTGAGCAGAGCTGAAGAAAGGGTTTCCATAACCAGGTAAGGCCACCAGGATTGGCTCTGACTGGGTGGCACCCATTTGAAGTATTTTACAA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,284,200 | 1 | CTTTTATGGATTATGCTTCTTGAAACAAAGTCTAAGAGCTCTTTGCCTGGCCCTATATCTCAAAGCTTTTGTCCTAGGTTTTTTCCTAAGTTTCATAGTTTACATCTAGGTTCATGATCCATTTTTAGCTAATTTTTGCATAAGGTGTGA | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 279,630 | 0 | GTGCGCAAGGATGCTGCACAGCACCCAGTAGATGACCGCGACCGCCACGTACATGGTGAACACTTCGAACGTGCGCGCGGTAATCAGCTGGGCTTGGCGGAACAGCTCGGGCACCTGGATGGTCGCCGCCAGGGCGGTGTCCTTTACCAG | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,262,000 | 1 | ATCCTCAGCTTTCCTGGAAGTTCATCCATTTGTCCATTCAACACACAGACAGTGTGCGCGTCCTCTGTGCCCAGCTCTGCCAGCAGCTGGGGATGTTTCGTGAAGATGGGAGGATTCAGTCCTGTTGGGGAAACAGCAGTGAAAACCCAG | 120homo sapiens
|
G000008345 | ASM834v1 | GCF_000008345.1 | PRJNA224116 | SAMN02603281 | null | 2004/07/30 | Goettingen Genomics Laboratory | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/345/GCF_000008345.1_ASM834v1 | 637,000,215 | RS_GCF_000008345.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 267,747 | 1,747 | Propionibacterium acnes KPA171202 | strain=KPA171202 | null | Bacteria | Actinobacteria | Actinobacteria | Propionibacteriales | Propionibacteriaceae | Cutibacterium | Cutibacterium acnes | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 2,560,265 | 1 | 60.01 | 2,560,265 | 1 | 2,373 | 780,330 | 89.799572 | 100 | 0 | 0 | 319 | yes | yes | yes | 20 | high | 71,240 | 0 | CCGAGTAGGAGGCGATCGGGACGACGAAGATGCTCAACACCGGGAAAGGCACGAAGAAGAACTGGATCGCAGCCCCGATAGCGACCAAGGTCATCATGAGAAGAGGATGCTCGCGACGCATCGGCAGAGAGGCCACCATGACCATCGATG | 77Propionibacterium acnes KPA171202
|
G000008505 | ASM850v1 | GCF_000008505.1 | PRJNA58089 | SAMN02598265 | null | 2004/12/27 | DOE Joint Genome Institute | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/505/GCF_000008505.1_ASM850v1 | 637,000,023 | RS_GCF_000008505.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 281,309 | 1,428 | [Bacillus thuringiensis] serovar konkukian str. 97-27 | strain=97-27 | null | Bacteria | Firmicutes | Bacilli | Bacillales | Bacillaceae | Bacillus | Bacillus thuringiensis | true | Eubacteria | Firmicutes | 1 | 0.998 | 1 | 1 | 5,314,794 | 2 | 35.37 | 5,237,682 | 1 | 5,361 | 1,516,528 | 84.049767 | 99.07 | 0.31 | 0 | 381 | yes | yes | yes | 20 | high | 2,258,620 | 0 | TTTCAATATCGATATAATGACAAAGACTCAAAGAGAAAGGATGATGAATTTTGCCAACAACAAGAAAGGAAAACCTCCAATTTGGTATGATGATGTGCCTTGGGATGGTTATCGTAATGACGTTTTACAATTTACTAATGAATGGATCAG | 118[Bacillus thuringiensis] serovar konkukian str. 97-27
|
G000006965 | ASM696v1 | GCF_000006965.1 | PRJNA57603 | SAMEA3283068 | null | 2003/05/06 | MELILO | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/965/GCF_000006965.1_ASM696v1 | 637,000,269 | RS_GCF_000006965.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 266,834 | 382 | Sinorhizobium meliloti 1021 | strain=1021 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Rhizobiaceae | Sinorhizobium | Sinorhizobium meliloti | true | Eubacteria | Proteobacteria | 1 | 0.997 | 0.1 | 1 | 6,691,694 | 3 | 62.17 | 3,654,135 | 1 | 6,303 | 1,956,944 | 86.157242 | 99.28 | 0.31 | 0 | 373 | yes | yes | yes | 20 | high | 6,569,940 | 0 | GCCGAGCACCATGGCGAGAACCAGCGGCGCCAGCGGGTAGTCGAGCTTCTTGAACACATAGCCGAGGAGACCGAAGCCGATCACCATGAAGATGTCCGAGACGGAGTTCGCGACCTGGTAGGCCCCCGAGAAGATCACCGCGACGATGAT | 86Sinorhizobium meliloti 1021
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 5,490,810 | 0 | GACCTGGCTGCGGTACTGCAATTGCTTGACCTTGATAGCGTCATGCAAGCCCGGACTTATCGAACTGATCACTTTTTCATGGGTGAAATAATTGGCATCGAACTGCTGAGTGGCCTGGGCACTTGAAAGATTCAGCGGCTGCCACAGCCA | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,992,000 | 1 | AGGGTTTGGTTCAAAGGCCGATGGGAATTAACCATAGGAAAAATAGTCCAATTTTATTAATAGTTGGAACTTCAGGCAAATCTCACTTGAATCTACATTTTTCTTTTTTAATATTAAGGGCTAATTCTCACTATAGGTCACATTAAGAAT | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 1,284,150 | 1 | TAATGTGCCTAGGTGTTGAGGGTTTTTTGTTTATATTTATGGTGCTTGGAGTCCTCTGAACTTCACAGACCTCTGGTTTGTTGTCTTTTACTAATGAAAAAATTCTCAACCATTAGCTCTTTGAATATTTCTTCTGCCCCATTTTCTTCC | 120homo sapiens
|
G000008805 | ASM880v1 | GCF_000008805.1 | PRJNA57817 | SAMN02603997 | null | 2005/05/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/008/805/GCF_000008805.1_ASM880v1 | 637,000,189 | RS_GCF_000008805.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 122,586 | 487 | Neisseria meningitidis MC58 | strain=MC58 | null | Bacteria | Proteobacteria | Betaproteobacteria | Neisseriales | Neisseriaceae | Neisseria | Neisseria meningitidis | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 2,272,360 | 1 | 51.53 | 2,272,360 | 1 | 2,107 | 632,964 | 82.059313 | 99.75 | 1.9 | 80 | 322 | yes | yes | yes | 20 | high | 2,149,550 | 0 | CGCCATCGGCTACGTCGGCCTGGCGGCAACCGTCTGGACAGGCATCATCCCCGCCATGCTGCTCTACCGTTCGCGCAAAAAATTCGGCGCAGGCAAAACCTATAAAGTTTACGGCGGCTTGTGGCTGATGGTTTGGGTCTTCCTTTTCGG | 67Neisseria meningitidis MC58
|
G000007465 | ASM746v2 | GCF_000007465.2 | PRJNA57947 | SAMN02604090 | null | 2011/09/01 | Univ. Oklahoma | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/465/GCF_000007465.2_ASM746v2 | 637,000,288 | RS_GCF_000007465.2 | Monoisolate | Complete Genome | Full | reference genome | Major | 210,007 | 1,309 | Streptococcus mutans UA159 | strain=UA159 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Streptococcus | Streptococcus mutans | true | Eubacteria | Firmicutes | 1 | 1 | 0.9 | 1 | 2,032,925 | 1 | 36.83 | 2,032,925 | 1 | 1,897 | 591,301 | 85.692487 | 100 | 0 | 0 | 308 | yes | yes | yes | 20 | high | 988,780 | 0 | ATTTTCTTGCAACCATATCAGGCAAAATTTGACGGGTTAAATAAGTCAGACCAATGATATTAGTCGCAATCATGGTTTCCCAATCCTTGAAATTAGCCTCATAAGCCTTATCAAGACCTAAAGCCAGTCCTGCATTGTTAACAAGGAGTT | 92Streptococcus mutans UA159
|
G000006865 | ASM686v1 | GCF_000006865.1 | PRJNA57671 | SAMN02603339 | null | 2001/03/21 | INRA | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/865/GCF_000006865.1_ASM686v1 | 637,000,144 | RS_GCF_000006865.1 | Monoisolate | Complete Genome | Full | reference genome | Major | 272,623 | 1,358 | Lactococcus lactis subsp. lactis Il1403 | strain=IL1403 | null | Bacteria | Firmicutes | Bacilli | Lactobacillales | Streptococcaceae | Lactococcus | Lactococcus lactis | true | Eubacteria | Firmicutes | 1 | 1 | 1 | 1 | 2,365,589 | 1 | 35.33 | 2,365,589 | 1 | 2,383 | 693,662 | 86.378488 | 100 | 0 | 0 | 310 | yes | yes | yes | 20 | high | 201,760 | 0 | AAAATCCATAAACTTGGTGGAAAATTATTTGTCAATCCTGATGGATTGGAATGGAAAAGAACCAAGTGGGCAGCACCAATTCGTTCTTATTTGAAATTTGCTGAGAAAAAAATGGTGCGATATGCTGATTTGATTATTTCAGATAACGCA | 54Lactococcus lactis subsp. lactis Il1403 IL1403
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 5,607,000 | 1 | GGGATGTCAGTTGCTCCATCTACAAAAATAACAATTCAGTCCTCATGTGCAGGTGCTGGGAAAGATTCAATGAGGTACAACTGAATACACCGCCCTGGCTTTAAGGACATAGACTCATCCCAGCAACATCCACAGAGCCCCTGCTGGGGA | 120homo sapiens
|
G000009705 | ASM970v1 | GCF_000009705.1 | PRJNA224116 | SAMD00061094 | null | 2004/05/11 | Kazusa | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/009/705/GCF_000009705.1_ASM970v1 | 637,000,199 | RS_GCF_000009705.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 103,690 | 103,690 | Nostoc sp. PCC 7120 | null | null | Bacteria | Cyanobacteria | null | Nostocales | Nostocaceae | Nostoc | Nostoc sp. PCC 7120 | true | Eubacteria | Cyanobacteria | 1 | 0.992 | 0.9 | 1 | 7,211,789 | 7 | 41.27 | 6,413,771 | 1 | 6,159 | 2,024,679 | 82.716938 | 99.19 | 0 | 0 | 360 | yes | yes | yes | 20 | high | 3,619,590 | 0 | ATTAAAATTTCTGTCAAAAGCTTCTTCATCTTGGGCTAAATACCAAACCCCTTCAATAGCACTAGCTACCTTAGGAATAGGTGTCCAAGAAAGTAAAACATACAACAACCCCCAAAGTGGCTGTCCTAAATAAAACTTATGTAATCCAGA | 70Nostoc sp. PCC 7120 ASM970v1
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,252,650 | 1 | TATGAGAGAACCCTAGAAACGTAGCCTGGGATGGTTGGTAAAGAACAGTCCATTCTGTGTCACAACAAAGAGTTTACATTTTATTTTGTATGTTCAGGAGGAGGGATTTATTTTACCTTATTTTTATTTATTTATTTTTTTGAGACAGAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,477,500 | 1 | TGCAGGTGTGTGCCACCACACCCGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGCATTGGCCAGGATGGTCTCAAACTCCTGAACTCAGGTGATCTGCCTGCCTCGGCCTCCCAAAGTGCTGGGCTTACAGGCGTGAGTCA | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,803,700 | 1 | TACTTACACAAACCCTGGAAGGTGTAAACTGCTCCACACCTAGACTGCGTTGTATAGCCTGTTGCTCCAAGGCTATAAACTTGTGTAGCATGCTACTGTACTGAATACTACAGGCAATTATAATAGGATGGTAAGTATTTGTATATCTAA | 120homo sapiens
|
G000010605 | ASM1060v1 | GCF_000010605.1 | PRJNA224116 | SAMD00060929 | null | 2008/04/08 | The University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/605/GCF_000010605.1_ASM1060v1 | 641,522,653 | RS_GCF_000010605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 455,632 | 1,911 | Streptomyces griseus subsp. griseus NBRC 13350 | strain=NBRC 13350 | null | Bacteria | Actinobacteria | Actinobacteria | Streptomycetales | Streptomycetaceae | Streptomyces | Streptomyces griseus | true | Eubacteria | Actinobacteria | 1 | 1 | 1 | 1 | 8,545,929 | 1 | 72.23 | 8,545,929 | 1 | 7,113 | 2,547,362 | 87.837226 | 99.84 | 0 | 0 | 357 | yes | yes | yes | 20 | high | 8,027,240 | 0 | TCATCGAGGTGGTGCCCCTGCTGATCAGCTCCCTGGTCGCCGTCGCGGTCGCGGCGGTCGCCCTCGGTCTCGCGGACCTCCGGCTGGGCCTGCTGGTGATCGTGGGGACCGTCGCGATCCTGTCGGTCCTCGCCGTCATGTCCAAGCGGA | 96Streptomyces griseus subsp. griseus NBRC 13350
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 4,637,400 | 1 | TCCCATCTATCCATTCATGTATCATCCACCCATATATCCACCTATCTATCCCCCCTTTTGTCCATTTTTTATTAAATGTTATTCTGTGGACCAGAAATTGTGGTAGGCACACAGCAAGATGAGCAAGAAAGACACCATCTCTGCCCTCAG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 9,543,000 | 1 | TGGTCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGATGCTGAGGCAGGTGGATCATGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAGCCCCACCTCTACTAAAAATACAAAAAATTAGCTGGGCATGATG | 120homo sapiens
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 8,855,100 | 1 | AGCATTGTTCTAGGCAGGGGGTTGCAGCTCGACCAAGACAGACTGCAGGGCGGTCATCAGCCATTATTGCCTCTTGGGCCGGGACTGTCCTCTGTGTCTGTGTCGCCTCCTCCATCCCAGCCAGATGGCTGAAAGCTCCCGGGGACTTTG | 120homo sapiens
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 3,397,680 | 0 | AGGCGGGAAGGGCATGAACATCACCGCCCCGTTCAAGCTGCGTGCCTTCGAGCTGGCCGACCGGCGCAGCGAGCGGGCGCAATTGGCACGGGCGGCCAATGCGCTGAAGTTCGAGGATGGCCGCATCGTCGCCGAAAACTTCGATGGCAT | 78Pseudomonas putida KT2440
|
human | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | null | 7,566,600 | 1 | CGTAAGAGGAATCTCAAAGCACTCACTCATTTATTCAACCAGTACTGACAAACTGCACCTGCATGCCAGGCACTGTCCTACCACTCACTGAGTGTGCATTGGTGAACAAAATGGGTCTAACCCTTGCCTCTGTGAAACTTACAGTCTAAT | 120homo sapiens
|
G000006605 | ASM660v1 | GCF_000006605.1 | PRJNA224116 | SAMEA3283089 | null | 2005/06/27 | Bielefeld Univ | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/006/605/GCF_000006605.1_ASM660v1 | 637,000,085 | RS_GCF_000006605.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 306,537 | 38,289 | Corynebacterium jeikeium K411 | strain=K411 = NCTC 11915 | null | Bacteria | Actinobacteria | Actinobacteria | Corynebacteriales | Corynebacteriaceae | Corynebacterium | Corynebacterium jeikeium | true | Eubacteria | Actinobacteria | 1 | 0.996 | 1 | 1 | 2,476,822 | 2 | 61.35 | 2,462,499 | 1 | 2,137 | 751,284 | 89.378688 | 100 | 0.68 | 0 | 319 | yes | yes | yes | 20 | high | 293,670 | 0 | CCTCCCGCGGCGTGGACGTTTCCACCTTGGGTGCGAAGTGCCGCATGATCCTGCCGCTGATCGTCGGCATGGTGGACGATGCTGCCACCCGCGCCCGCCCGCTGCAGCGCACCGGCATCGGCGAGCCCGGCCCGCGTACCGTACTGCGCC | 31Corynebacterium jeikeium K411 K411 = NCTC 11915
|
G000007565 | ASM756v2 | GCF_000007565.2 | PRJNA57843 | SAMN02603999 | null | 2016/02/26 | TIGR | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/007/565/GCF_000007565.2_ASM756v2 | 637,000,222 | RS_GCF_000007565.2 | Multiisolate | Complete Genome | Full | reference genome | Major | 160,488 | 303 | Pseudomonas putida KT2440 | strain=KT2440 | null | Bacteria | Proteobacteria | Gammaproteobacteria | Pseudomonadales | Pseudomonadaceae | Pseudomonas | Pseudomonas putida | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 6,181,873 | 1 | 61.52 | 6,181,873 | 1 | 5,584 | 1,861,131 | 88.706707 | 99.97 | 1.2 | 0 | 381 | yes | yes | yes | 20 | high | 3,643,120 | 0 | CCCGACATGGCGCGCGGCGCCGCCGCGCAGGCCAGTGAGGATGGCGCTGGCGTTACGGATCAGCCAGCTGTTGGTGTGATTCATGTTCGTCTCCATAGCCAGTACGGCGTTTCGCATGGAAGTCAGCCCAGTTCGCTTTCGTGCCAGTGG | 78Pseudomonas putida KT2440
|
G000010525 | ASM1052v1 | GCF_000010525.1 | PRJNA224116 | SAMD00060925 | null | 2007/10/16 | University of Tokyo | ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/010/525/GCF_000010525.1_ASM1052v1 | 641,228,476 | RS_GCF_000010525.1 | Monoisolate | Complete Genome | Full | representative genome | Major | 438,753 | 7 | Azorhizobium caulinodans ORS 571 | strain=ORS 571 | null | Bacteria | Proteobacteria | Alphaproteobacteria | Rhizobiales | Xanthobacteraceae | Azorhizobium | Azorhizobium caulinodans | true | Eubacteria | Proteobacteria | 1 | 1 | 0.9 | 1 | 5,369,772 | 1 | 67.32 | 5,369,772 | 1 | 4,810 | 1,620,542 | 88.922714 | 100 | 0 | 0 | 358 | yes | yes | yes | 20 | high | 114,790 | 0 | AGCCGCTCTCGCGGGTGGTGGGCATGGGCACCACTTCGCAGCCGGCGAGTTCCGCACCGGCGCGGTAGGCGGCATAGAGCGGGTTCGGCACGAGGACGATGGGCGCGCCCTTGCGCTCCGGCCCCCGGCGGCGGGCGATGAAGGTGGCGC | 4Azorhizobium caulinodans ORS 571
|